#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACE	1636	genome.wustl.edu	37	17	61558968	61558968	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr17:61558968C>A	ENST00000290866.4	+	7	1011	c.987C>A	c.(985-987)ttC>ttA	p.F329L	ACE_ENST00000538928.1_Missense_Mutation_p.F329L|ACE_ENST00000584529.1_3'UTR|ACE_ENST00000428043.1_Missense_Mutation_p.F329L	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	329	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	CAGAGGAGTTCTTCACCTCCC	0.682																																						dbGAP											0													46.0	43.0	44.0					17																	61558968		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.987C>A	17.37:g.61558968C>A	ENSP00000290866:p.Phe329Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	pfam_Peptidase_M2,prints_Peptidase_M2	p.F329L	ENST00000290866.4	37	c.987	CCDS11637.1	17	.	.	.	.	.	.	.	.	.	.	c	22.1	4.250660	0.80135	.	.	ENSG00000159640	ENST00000538928;ENST00000290866;ENST00000428043	T;T;T	0.42131	0.98;0.98;0.98	4.48	2.41	0.29592	.	0.000000	0.85682	D	0.000000	T	0.67135	0.2861	M	0.91663	3.23	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.976	D;D;D	0.85130	0.997;0.995;0.972	T	0.71583	-0.4549	10	0.62326	D	0.03	-24.975	9.5453	0.39277	0.14:0.7835:0.0:0.0765	.	329;329;329	F5H1K1;P12821-2;P12821	.;.;ACE_HUMAN	L	329	ENSP00000439591:F329L;ENSP00000290866:F329L;ENSP00000397593:F329L	ENSP00000290866:F329L	F	+	3	2	ACE	58912700	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	3.867000	0.56047	1.095000	0.41419	0.561000	0.74099	TTC	ACE	-	pfam_Peptidase_M2	ENSG00000159640		0.682	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACE	HGNC	protein_coding	OTTHUMT00000337675.2	37	0.00	0	C			61558968	61558968	+1	no_errors	ENST00000290866	ensembl	human	known	69_37n	missense	39	49.37	39	SNP	1.000	A
ALPP	250	genome.wustl.edu	37	2	233244601	233244601	+	Silent	SNP	G	G	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr2:233244601G>T	ENST00000392027.2	+	5	881	c.612G>T	c.(610-612)ggG>ggT	p.G204G	AC068134.8_ENST00000441266.1_RNA|AC068134.8_ENST00000439072.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	204					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		GCCAGGAGGGGTGCCAGGACA	0.682																																						dbGAP											0													65.0	67.0	66.0					2																	233244601		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.612G>T	2.37:g.233244601G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P05188|P06861|Q53S78|Q96DB7	Silent	SNP	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.G204	ENST00000392027.2	37	c.612	CCDS2490.1	2																																																																																			ALPP	-	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase	ENSG00000163283		0.682	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPP	HGNC	protein_coding	OTTHUMT00000257032.3	29	0.00	0	G	NM_001632		233244601	233244601	+1	no_errors	ENST00000392027	ensembl	human	known	69_37n	silent	50	19.35	12	SNP	0.999	T
AMBP	259	genome.wustl.edu	37	9	116840414	116840414	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr9:116840414G>C	ENST00000265132.3	-	1	338	c.76C>G	c.(76-78)Ccc>Gcc	p.P26A		NM_001633.3	NP_001624.1	P02760	AMBP_HUMAN	alpha-1-microglobulin/bikunin precursor	26					cell adhesion (GO:0007155)|female pregnancy (GO:0007565)|heme catabolic process (GO:0042167)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of JNK cascade (GO:0046329)|protein catabolic process (GO:0030163)|protein-chromophore linkage (GO:0018298)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|calcium oxalate binding (GO:0046904)|heme binding (GO:0020037)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)|small molecule binding (GO:0036094)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	11					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	ATGTTGTCGGGCGGCGTTGGC	0.622																																						dbGAP											0													112.0	122.0	119.0					9																	116840414		2203	4300	6503	-	-	-	SO:0001583	missense	0			X04494	CCDS6800.1	9q32-q33	2014-01-22			ENSG00000106927	ENSG00000106927		"""Lipocalins"""	453	protein-coding gene	gene with protein product	"""growth-inhibiting protein 19"", ""uristatin"", ""complex-forming glycoprotein heterogeneous in charge"", ""bikunin"", ""inter-alpha-trypsin inhibitor light chain"", ""protein HC"", ""uronic-acid-rich protein"", ""trypstatin"""	176870		ITI, ITIL		1708673, 1385302	Standard	NM_001633		Approved	UTI, HCP, EDC1, HI30, IATIL, ITILC	uc004bie.4	P02760	OTTHUMG00000020534	ENST00000265132.3:c.76C>G	9.37:g.116840414G>C	ENSP00000265132:p.Pro26Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	P00977|P02759|P78491|Q2TU33|Q5TBD7|Q9UC58|Q9UDI8	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_A1-microglobln,prints_PstgldnD_synth,prints_Prot_inh_Kunz-m,prints_Lipocalin,pfscan_Prot_inh_Kunz-m	p.P26A	ENST00000265132.3	37	c.76	CCDS6800.1	9	.	.	.	.	.	.	.	.	.	.	G	10.33	1.320920	0.23994	.	.	ENSG00000106927	ENST00000265132	D	0.82526	-1.62	3.83	1.91	0.25777	Calycin-like (1);Calycin (1);	0.130441	0.51477	D	0.000087	T	0.80994	0.4731	M	0.80183	2.485	0.18873	N	0.999986	B	0.23937	0.094	B	0.19148	0.024	T	0.71741	-0.4501	10	0.45353	T	0.12	.	10.4029	0.44239	0.0:0.3046:0.6954:0.0	.	26	P02760	AMBP_HUMAN	A	26	ENSP00000265132:P26A	ENSP00000265132:P26A	P	-	1	0	AMBP	115880235	0.024000	0.19004	0.001000	0.08648	0.079000	0.17450	1.082000	0.30803	0.554000	0.29061	0.563000	0.77884	CCC	AMBP	-	superfamily_Calycin-like	ENSG00000106927		0.622	AMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBP	HGNC	protein_coding	OTTHUMT00000053758.2	117	0.00	0	G	NM_001633		116840414	116840414	-1	no_errors	ENST00000265132	ensembl	human	known	69_37n	missense	83	37.59	50	SNP	0.001	C
APOLD1	81575	genome.wustl.edu	37	12	12940449	12940449	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr12:12940449G>A	ENST00000326765.6	+	2	773	c.703G>A	c.(703-705)Gag>Aag	p.E235K	APOLD1_ENST00000356591.4_Missense_Mutation_p.E204K	NM_001130415.1	NP_001123887.1	Q96LR9	APLD1_HUMAN	apolipoprotein L domain containing 1	235					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|endothelial cell activation (GO:0042118)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|regulation of endothelial cell differentiation (GO:0045601)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	5		Prostate(47;0.0632)		BRCA - Breast invasive adenocarcinoma(232;0.0338)|GBM - Glioblastoma multiforme(207;0.149)		GAAACTGGCCGAGAGCCTGGA	0.627																																						dbGAP											0													42.0	51.0	48.0					12																	12940449		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136783	CCDS8654.1, CCDS44833.1	12p13.2	2006-02-03	2006-01-23		ENSG00000178878	ENSG00000178878			25268	protein-coding gene	gene with protein product		612456				11230166	Standard	NM_030817		Approved	FLJ25138, DKFZP434F0318	uc001rau.4	Q96LR9	OTTHUMG00000153561	ENST00000326765.6:c.703G>A	12.37:g.12940449G>A	ENSP00000324277:p.Glu235Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVR2|Q9H0I5	Missense_Mutation	SNP	pfam_ApoL	p.E235K	ENST00000326765.6	37	c.703	CCDS44833.1	12	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852085	0.91355	.	.	ENSG00000178878	ENST00000326765;ENST00000356591	T;T	0.01304	5.03;5.03	5.44	5.44	0.79542	.	0.220496	0.35903	U	0.002920	T	0.01287	0.0042	L	0.29908	0.895	0.43555	D	0.995862	P;P	0.40107	0.539;0.703	B;B	0.27380	0.044;0.079	T	0.72453	-0.4289	10	0.38643	T	0.18	-18.5108	13.6089	0.62063	0.0742:0.0:0.9258:0.0	.	204;235	A0AVN6;Q96LR9	.;APLD1_HUMAN	K	235;204	ENSP00000324277:E235K;ENSP00000348998:E204K	ENSP00000324277:E235K	E	+	1	0	APOLD1	12831716	0.998000	0.40836	0.996000	0.52242	0.998000	0.95712	2.863000	0.48396	2.567000	0.86603	0.579000	0.79373	GAG	APOLD1	-	NULL	ENSG00000178878		0.627	APOLD1-001	KNOWN	basic|CCDS	protein_coding	APOLD1	HGNC	protein_coding	OTTHUMT00000331627.1	37	0.00	0	G	NM_030817		12940449	12940449	+1	no_errors	ENST00000326765	ensembl	human	known	69_37n	missense	37	44.78	30	SNP	0.997	A
ASH1L	55870	genome.wustl.edu	37	1	155451186	155451186	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr1:155451186T>G	ENST00000368346.3	-	3	2114	c.1475A>C	c.(1474-1476)aAa>aCa	p.K492T	ASH1L_ENST00000392403.3_Missense_Mutation_p.K492T			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	492					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AAACATTTCTTTCTCCAAATT	0.363																																						dbGAP											0													75.0	71.0	72.0					1																	155451186		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.1475A>C	1.37:g.155451186T>G	ENSP00000357330:p.Lys492Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.K492T	ENST00000368346.3	37	c.1475		1	.	.	.	.	.	.	.	.	.	.	T	17.41	3.382893	0.61845	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.91180	-2.8;-2.8	5.08	5.08	0.68730	.	0.126318	0.52532	D	0.000066	D	0.88288	0.6396	N	0.14661	0.345	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.78314	0.981;0.991	D	0.91422	0.5159	10	0.87932	D	0	.	13.5244	0.61586	0.0:0.0:0.0:1.0	.	492;492	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	T	492	ENSP00000357330:K492T;ENSP00000376204:K492T	ENSP00000357330:K492T	K	-	2	0	ASH1L	153717810	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.391000	0.44424	2.261000	0.74972	0.533000	0.62120	AAA	ASH1L	-	NULL	ENSG00000116539		0.363	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	168	0.00	0	T	NM_018489		155451186	155451186	-1	no_errors	ENST00000368346	ensembl	human	known	69_37n	missense	127	20.00	32	SNP	1.000	G
ATP10B	23120	genome.wustl.edu	37	5	160047807	160047807	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr5:160047807C>T	ENST00000327245.5	-	15	2809	c.1963G>A	c.(1963-1965)Gtg>Atg	p.V655M	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	655					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTGGTGGCCACGTTGGCCCCT	0.567																																						dbGAP											0													79.0	84.0	82.0					5																	160047807		2149	4246	6395	-	-	-	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.1963G>A	5.37:g.160047807C>T	ENSP00000313600:p.Val655Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.V655M	ENST00000327245.5	37	c.1963	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	C	0.706	-0.788793	0.02884	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	T;T	0.42900	0.96;2.01	5.36	-10.7	0.00240	HAD-like domain (1);	3.007070	0.00604	N	0.000384	T	0.16896	0.0406	N	0.11255	0.115	0.09310	N	1	B;B	0.21147	0.036;0.052	B;B	0.17098	0.01;0.017	T	0.08597	-1.0714	9	.	.	.	.	3.4713	0.07569	0.1456:0.3869:0.0863:0.3813	.	263;655	Q2YDW8;O94823	.;AT10B_HUMAN	M	655;263	ENSP00000313600:V655M;ENSP00000431081:V263M	.	V	-	1	0	ATP10B	159980385	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.853000	0.01666	-2.085000	0.00864	-0.742000	0.03525	GTG	ATP10B	-	superfamily_HAD-like_dom	ENSG00000118322		0.567	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	42	0.00	0	C	NM_025153		160047807	160047807	-1	no_errors	ENST00000327245	ensembl	human	known	69_37n	missense	47	44.71	38	SNP	0.000	T
C17orf107	100130311	genome.wustl.edu	37	17	4803317	4803317	+	Silent	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr17:4803317G>A	ENST00000381365.3	+	2	380	c.153G>A	c.(151-153)ctG>ctA	p.L51L	CHRNE_ENST00000575637.1_5'Flank|CHRNE_ENST00000293780.4_Intron|C17orf107_ENST00000521575.1_Silent_p.L51L	NM_001145536.1	NP_001139008.1	Q6ZR85	CQ107_HUMAN	chromosome 17 open reading frame 107	51										endometrium(2)	2						TCAGAGAGCTGAAGTCCCTGG	0.632																																						dbGAP											0													29.0	33.0	32.0					17																	4803317		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK128415	CCDS45591.1	17p13.2	2009-09-30			ENSG00000205710	ENSG00000205710			37238	protein-coding gene	gene with protein product							Standard	NM_001145536		Approved		uc002fzl.3	Q6ZR85	OTTHUMG00000164838	ENST00000381365.3:c.153G>A	17.37:g.4803317G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.L51	ENST00000381365.3	37	c.153	CCDS45591.1	17																																																																																			C17orf107	-	NULL	ENSG00000205710		0.632	C17orf107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf107	HGNC	protein_coding	OTTHUMT00000380556.1	41	0.00	0	G	NM_001145536		4803317	4803317	+1	no_errors	ENST00000381365	ensembl	human	known	69_37n	silent	2	93.33	28	SNP	0.006	A
C1orf43	25912	genome.wustl.edu	37	1	154185071	154185071	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr1:154185071G>A	ENST00000368521.5	-	5	568	c.370C>T	c.(370-372)Ccc>Tcc	p.P124S	C1orf43_ENST00000350592.3_Missense_Mutation_p.P90S|C1orf43_ENST00000368518.1_Missense_Mutation_p.P124S|C1orf43_ENST00000368519.1_Missense_Mutation_p.P106S|C1orf43_ENST00000362076.4_Missense_Mutation_p.P72S|C1orf43_ENST00000368516.1_Missense_Mutation_p.P90S	NM_001098616.1	NP_001092086.1	Q9BWL3	CA043_HUMAN	chromosome 1 open reading frame 43	124						integral component of membrane (GO:0016021)	coenzyme binding (GO:0050662)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	10	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)					AAGGAACGGGGATGCCGGCCT	0.458																																						dbGAP											0													58.0	57.0	57.0					1																	154185071		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF077036	CCDS1061.1, CCDS1062.1, CCDS41404.1, CCDS72924.1	1q21.2	2012-06-25			ENSG00000143612	ENSG00000143612			29876	protein-coding gene	gene with protein product						11042152, 11230159	Standard	XM_005245077		Approved	NICE-3, DKFZp586G1722	uc001fei.2	Q9BWL3	OTTHUMG00000035981	ENST00000368521.5:c.370C>T	1.37:g.154185071G>A	ENSP00000357507:p.Pro124Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3G8|D3DV72|D3DV74|Q5M801|Q5VU73|Q5VU83|Q96HP7|Q9UFU2|Q9UGL7|Q9UGL8|Q9Y2R6	Missense_Mutation	SNP	pfam_NICE-3_prd	p.P124S	ENST00000368521.5	37	c.370	CCDS41404.1	1	.	.	.	.	.	.	.	.	.	.	g	10.47	1.358699	0.24598	.	.	ENSG00000143612	ENST00000350592;ENST00000368521;ENST00000362076;ENST00000368519;ENST00000368518;ENST00000368516	.	.	.	5.39	3.53	0.40419	.	0.155147	0.64402	N	0.000015	T	0.34483	0.0899	L	0.51422	1.61	0.53005	D	0.999962	B;B;B;B;B	0.21147	0.013;0.01;0.052;0.011;0.013	B;B;B;B;B	0.21151	0.011;0.017;0.033;0.011;0.028	T	0.17410	-1.0370	9	0.18710	T	0.47	-6.5768	10.446	0.44495	0.0729:0.1419:0.7852:0.0	.	106;90;124;72;90	Q9BWL3-5;Q9BWL3-2;Q9BWL3;Q9BWL3-4;Q09GN0	.;.;CA043_HUMAN;.;.	S	90;124;72;106;124;90	.	ENSP00000271925:P90S	P	-	1	0	C1orf43	152451695	1.000000	0.71417	0.985000	0.45067	0.254000	0.26022	2.558000	0.45879	0.852000	0.35287	-0.196000	0.12772	CCC	C1orf43	-	pfam_NICE-3_prd	ENSG00000143612		0.458	C1orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf43	HGNC	protein_coding	OTTHUMT00000087664.2	77	0.00	0	G	NM_015449		154185071	154185071	-1	no_errors	ENST00000368521	ensembl	human	known	69_37n	missense	45	43.75	35	SNP	1.000	A
CLK3	1198	genome.wustl.edu	37	15	74914837	74914837	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr15:74914837G>A	ENST00000395066.3	+	5	1374	c.913G>A	c.(913-915)Gag>Aag	p.E305K	CLK3_ENST00000348245.3_Missense_Mutation_p.M124I|CLK3_ENST00000345005.4_Missense_Mutation_p.E157K|CLK3_ENST00000352989.5_Intron	NM_001130028.1	NP_001123500.1	P49761	CLK3_HUMAN	CDC-like kinase 3	305	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	cytoplasmic vesicle (GO:0031410)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)|stomach(2)|urinary_tract(1)	15						TCTCCTAGATGAGATTGTGGG	0.527																																					Ovarian(133;694 1754 28950 29027 31859)	dbGAP											0													93.0	89.0	90.0					15																	74914837		2197	4296	6493	-	-	-	SO:0001583	missense	0			L29220	CCDS10265.1, CCDS45304.1	15q24	2008-05-02			ENSG00000179335	ENSG00000179335		"""CDC-like kinases"""	2071	protein-coding gene	gene with protein product		602990				7990150, 9856501	Standard	NM_003992		Approved	clk3	uc010uln.2	P49761	OTTHUMG00000141320	ENST00000395066.3:c.913G>A	15.37:g.74914837G>A	ENSP00000378505:p.Glu305Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW59|Q53Y48|Q9BRS3|Q9BUJ7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E305K	ENST00000395066.3	37	c.913	CCDS45304.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.3|24.3	4.518411|4.518411	0.85495|0.85495	.|.	.|.	ENSG00000179335|ENSG00000179335	ENST00000345005;ENST00000395066;ENST00000454830|ENST00000348245	T|.	0.65916|.	-0.18|.	5.46|5.46	5.46|5.46	0.80206|0.80206	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.45276|0.45276	0.1334|0.1334	N|N	0.05330|0.05330	-0.07|-0.07	0.36257|0.36257	D|D	0.854327|0.854327	B;B|.	0.28419|.	0.211;0.161|.	B;B|.	0.31686|.	0.134;0.113|.	T|T	0.57093|0.57093	-0.7870|-0.7870	10|6	0.22706|0.44086	T|T	0.39|0.13	.|.	18.9104|18.9104	0.92481|0.92481	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	305;84|.	P49761;B3KUU7|.	CLK3_HUMAN;.|.	K|I	157;157;305|124	ENSP00000344112:E157K|.	ENSP00000344112:E157K|ENSP00000321136:M124I	E|M	+|+	1|3	0|0	CLK3|CLK3	72701890|72701890	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.902000|7.902000	0.87389|0.87389	2.559000|2.559000	0.86315|0.86315	0.655000|0.655000	0.94253|0.94253	GAG|ATG	CLK3	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000179335		0.527	CLK3-003	KNOWN	basic|CCDS	protein_coding	CLK3	HGNC	protein_coding	OTTHUMT00000390442.3	103	0.00	0	G			74914837	74914837	+1	no_errors	ENST00000395066	ensembl	human	known	69_37n	missense	74	44.36	59	SNP	1.000	A
COL16A1	1307	genome.wustl.edu	37	1	32122636	32122636	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr1:32122636C>T	ENST00000373672.3	-	65	4570	c.4054G>A	c.(4054-4056)Gag>Aag	p.E1352K	RP11-73M7.6_ENST00000609033.1_RNA|RP11-73M7.6_ENST00000591592.1_RNA|RP11-73M7.6_ENST00000585413.1_RNA|RP11-73M7.6_ENST00000585660.1_RNA|RP11-73M7.6_ENST00000445166.1_RNA|RP11-73M7.6_ENST00000608332.1_RNA|RP11-73M7.6_ENST00000587445.1_RNA|RP11-73M7.6_ENST00000593188.1_RNA|RP11-73M7.6_ENST00000608888.1_RNA|RP11-73M7.6_ENST00000589462.1_RNA|RP11-73M7.6_ENST00000609625.1_RNA|RP11-73M7.6_ENST00000610216.1_RNA|RP11-73M7.6_ENST00000610043.1_RNA|RP11-73M7.6_ENST00000607926.1_RNA|RP11-73M7.6_ENST00000609373.1_RNA|RP11-73M7.6_ENST00000609338.1_RNA|COL16A1_ENST00000271069.6_Missense_Mutation_p.E1352K|COL16A1_ENST00000461217.1_5'Flank|RP11-73M7.6_ENST00000608246.1_RNA|RP11-73M7.6_ENST00000591929.1_RNA|RP11-73M7.6_ENST00000609549.1_RNA|RP11-73M7.6_ENST00000588288.1_RNA	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1352	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		AACTGTACCTCTTTGCCAGCT	0.512																																					Colon(143;498 1786 21362 25193 36625)	dbGAP											0													149.0	188.0	175.0					1																	32122636		2056	4193	6249	-	-	-	SO:0001583	missense	0			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.4054G>A	1.37:g.32122636C>T	ENSP00000362776:p.Glu1352Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.E1352K	ENST00000373672.3	37	c.4054	CCDS41297.1	1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.517242	0.44763	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000440437	D;D;D	0.94092	-3.23;-3.23;-3.35	5.24	5.24	0.73138	.	0.117691	0.56097	D	0.000030	D	0.90854	0.7127	N	0.05510	-0.035	0.45330	D	0.998321	D;D	0.64830	0.99;0.994	P;D	0.63488	0.824;0.915	D	0.87364	0.2346	10	0.11182	T	0.66	.	16.5974	0.84800	0.0:1.0:0.0:0.0	.	1352;1350	Q07092;Q07092-2	COGA1_HUMAN;.	K	1352;1352;209	ENSP00000362776:E1352K;ENSP00000271069:E1352K;ENSP00000390281:E209K	ENSP00000271069:E1352K	E	-	1	0	COL16A1	31895223	1.000000	0.71417	1.000000	0.80357	0.542000	0.35054	5.901000	0.69861	2.837000	0.97791	0.655000	0.94253	GAG	COL16A1	-	NULL	ENSG00000084636		0.512	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL16A1	HGNC	protein_coding	OTTHUMT00000011057.2	150	0.00	0	C	NM_001856		32122636	32122636	-1	no_errors	ENST00000271069	ensembl	human	known	69_37n	missense	93	42.94	70	SNP	1.000	T
CUBN	8029	genome.wustl.edu	37	10	17126407	17126407	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr10:17126407G>A	ENST00000377833.4	-	17	2229	c.2164C>T	c.(2164-2166)Cct>Tct	p.P722S		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	722	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GACAACTCAGGCAAGAAGAGT	0.517																																						dbGAP											0													100.0	83.0	89.0					10																	17126407		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.2164C>T	10.37:g.17126407G>A	ENSP00000367064:p.Pro722Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.P722S	ENST00000377833.4	37	c.2164	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	G	12.49	1.954669	0.34471	.	.	ENSG00000107611	ENST00000377833	T	0.46063	0.88	5.69	-0.66	0.11421	CUB (5);	1.224140	0.06062	N	0.658528	T	0.45736	0.1357	M	0.82193	2.58	0.80722	D	1	P	0.38148	0.62	B	0.39617	0.305	T	0.47355	-0.9124	10	0.72032	D	0.01	.	3.3018	0.06985	0.1921:0.1936:0.5082:0.1061	.	722	O60494	CUBN_HUMAN	S	722	ENSP00000367064:P722S	ENSP00000367064:P722S	P	-	1	0	CUBN	17166413	1.000000	0.71417	0.000000	0.03702	0.129000	0.20672	0.687000	0.25407	-0.415000	0.07484	-0.140000	0.14226	CCT	CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000107611		0.517	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	116	0.00	0	G	NM_001081		17126407	17126407	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	missense	66	45.90	56	SNP	0.998	A
DCC	1630	genome.wustl.edu	37	18	50278518	50278518	+	Silent	SNP	C	C	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr18:50278518C>T	ENST00000442544.2	+	2	802	c.186C>T	c.(184-186)tcC>tcT	p.S62S	DCC_ENST00000412726.1_5'Flank	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	62	Ig-like C2-type 1.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TCGACTGCTCCGCGGAGTCCG	0.502																																						dbGAP											0													70.0	69.0	70.0					18																	50278518		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.186C>T	18.37:g.50278518C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P30L	ENST00000442544.2	37	c.89	CCDS11952.1	18																																																																																			DCC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000187323		0.502	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	82	0.00	0	C	NM_005215		50278518	50278518	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000578080	ensembl	human	putative	69_37n	missense	61	40.20	41	SNP	0.874	T
CYB5A	1528	genome.wustl.edu	37	18	71959066	71959066	+	Silent	SNP	C	C	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr18:71959066C>T	ENST00000340533.4	-	1	185	c.45G>A	c.(43-45)gaG>gaA	p.E15E	CYB5A_ENST00000494131.2_Silent_p.E15E|CYB5A_ENST00000397914.4_Silent_p.E15E|CYB5A_ENST00000299438.9_5'Flank	NM_148923.3	NP_683725.1	P00167	CYB5_HUMAN	cytochrome b5 type A (microsomal)	15	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.			EEIQ -> QEIE (in Ref. 10; AA sequence, 11; AA sequence and 12; AA sequence). {ECO:0000305}.	hydrogen ion transmembrane transport (GO:1902600)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	aldo-keto reductase (NADP) activity (GO:0004033)|cytochrome-c oxidase activity (GO:0004129)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(1)|lung(1)|skin(1)	4		Esophageal squamous(42;0.0749)|Prostate(75;0.157)|Melanoma(33;0.211)				TCTGAATCTCCTCTAGGGTGT	0.582											OREG0025052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(176;1530 2076 2606 27426 50572)|Ovarian(151;328 1870 2837 37860 52175)	dbGAP											0													249.0	209.0	223.0					18																	71959066		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M22865	CCDS12004.1, CCDS12005.1, CCDS54188.1	18q23	2006-01-30	2006-01-30	2006-01-30	ENSG00000166347	ENSG00000166347		"""Cytochrome b genes"""	2570	protein-coding gene	gene with protein product		613218	"""cytochrome b-5"", ""cytochrome b5 (microsomal)"""	CYB5		1840560	Standard	NM_148923		Approved		uc002lli.3	P00167	OTTHUMG00000132843	ENST00000340533.4:c.45G>A	18.37:g.71959066C>T		Somatic	1134	WXS	Illumina GAIIx	Phase_IV	A8MV91|F8WEU4|Q6IB14	Silent	SNP	pfam_Cyt_B5,superfamily_Cyt_B5,prints_Cyt_B5,pfscan_Cyt_B5	p.E15	ENST00000340533.4	37	c.45	CCDS12004.1	18																																																																																			CYB5A	-	pfam_Cyt_B5,superfamily_Cyt_B5,pfscan_Cyt_B5	ENSG00000166347		0.582	CYB5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5A	HGNC	protein_coding	OTTHUMT00000256316.1	197	0.50	1	C	NM_001914, NM_148923		71959066	71959066	-1	no_errors	ENST00000340533	ensembl	human	known	69_37n	silent	175	41.67	125	SNP	0.955	T
DSE	29940	genome.wustl.edu	37	6	116757537	116757537	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr6:116757537C>T	ENST00000331677.3	+	7	2350	c.1906C>T	c.(1906-1908)Cct>Tct	p.P636S	DSE_ENST00000452085.3_Missense_Mutation_p.P636S|DSE_ENST00000359564.2_Missense_Mutation_p.P636S|DSE_ENST00000537543.1_Missense_Mutation_p.P655S			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	636					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)	p.P636S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		AGTGACATATCCTCGGGGCTA	0.498																																						dbGAP											1	Substitution - Missense(1)	NS(1)											148.0	128.0	135.0					6																	116757537		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.1906C>T	6.37:g.116757537C>T	ENSP00000332151:p.Pro636Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R3K6	Missense_Mutation	SNP	superfamily_Chondroitin_lyas	p.P655S	ENST00000331677.3	37	c.1963	CCDS5107.1	6	.	.	.	.	.	.	.	.	.	.	C	16.90	3.251317	0.59212	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	T	0.74427	0.3715	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.72956	-0.4134	10	0.56958	D	0.05	-13.9452	20.5211	0.99222	0.0:1.0:0.0:0.0	.	655;636	B7Z765;Q9UL01	.;DSE_HUMAN	S	636;655;636;636	ENSP00000404049:P636S;ENSP00000441152:P655S;ENSP00000332151:P636S;ENSP00000352567:P636S	ENSP00000332151:P636S	P	+	1	0	DSE	116864230	1.000000	0.71417	0.991000	0.47740	0.586000	0.36452	7.487000	0.81328	2.861000	0.98227	0.650000	0.86243	CCT	DSE	-	NULL	ENSG00000111817		0.498	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DSE	HGNC	protein_coding	OTTHUMT00000041940.2	139	0.00	0	C	NM_013352		116757537	116757537	+1	no_errors	ENST00000537543	ensembl	human	known	69_37n	missense	26	75.47	80	SNP	1.000	T
OTULIN	90268	genome.wustl.edu	37	5	14687728	14687728	+	Silent	SNP	A	A	G			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr5:14687728A>G	ENST00000284274.4	+	5	645	c.567A>G	c.(565-567)aaA>aaG	p.K189K		NM_138348.4	NP_612357.4	Q96BN8	OTUL_HUMAN		189	OTU.				canonical Wnt signaling pathway (GO:0060070)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|protein linear deubiquitination (GO:1990108)|sprouting angiogenesis (GO:0002040)	cytoplasm (GO:0005737)|LUBAC complex (GO:0071797)	cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	14	Lung NSC(4;0.00696)					ATAAAATTAAAGAGTCCCTTA	0.418																																						dbGAP											0													135.0	140.0	138.0					5																	14687728		1842	4085	5927	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000284274.4:c.567A>G	5.37:g.14687728A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTD3|Q8NAS0|Q96IA3	Silent	SNP	prints_FAM105,prints_FAM105B,prints_FAM105A	p.K189	ENST00000284274.4	37	c.567	CCDS43302.1	5																																																																																			FAM105B	-	prints_FAM105A	ENSG00000154124		0.418	FAM105B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM105B	HGNC	protein_coding	OTTHUMT00000366012.1	126	0.00	0	A			14687728	14687728	+1	no_errors	ENST00000284274	ensembl	human	known	69_37n	silent	121	32.97	60	SNP	0.998	G
ELL2	22936	genome.wustl.edu	37	5	95226942	95226942	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr5:95226942C>G	ENST00000237853.4	-	10	1975	c.1626G>C	c.(1624-1626)caG>caC	p.Q542H	ELL2_ENST00000431061.2_Missense_Mutation_p.Q292H	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	542					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		CCTTATAATTCTGGCGTTGCT	0.373																																						dbGAP											0													144.0	136.0	139.0					5																	95226942		2203	4300	6503	-	-	-	SO:0001583	missense	0			U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.1626G>C	5.37:g.95226942C>G	ENSP00000237853:p.Gln542His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNK7	Missense_Mutation	SNP	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.Q542H	ENST00000237853.4	37	c.1626	CCDS4080.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.54|18.54	3.646976|3.646976	0.67358|0.67358	.|.	.|.	ENSG00000118985|ENSG00000118985	ENST00000237853;ENST00000431061|ENST00000508757	T;T|.	0.24350|.	1.86;1.86|.	5.85|5.85	4.99|4.99	0.66335|0.66335	Occludin/RNA polymerase II elongation factor, ELL domain (1);|.	0.049487|.	0.85682|.	D|.	0.000000|.	T|T	0.64193|0.64193	0.2576|0.2576	M|M	0.65975|0.65975	2.015|2.015	0.58432|0.58432	D|D	0.999997|0.999997	D|.	0.76494|.	0.999|.	D|.	0.83275|.	0.996|.	T|T	0.63594|0.63594	-0.6602|-0.6602	10|5	0.54805|.	T|.	0.06|.	-0.0277|-0.0277	9.2096|9.2096	0.37311|0.37311	0.0:0.7808:0.0:0.2192|0.0:0.7808:0.0:0.2192	.|.	542|.	O00472|.	ELL2_HUMAN|.	H|T	542;292|60	ENSP00000237853:Q542H;ENSP00000399704:Q292H|.	ENSP00000237853:Q542H|.	Q|R	-|-	3|2	2|0	ELL2|ELL2	95252698|95252698	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	1.615000|1.615000	0.36922|0.36922	1.472000|1.472000	0.48140|0.48140	0.650000|0.650000	0.86243|0.86243	CAG|AGA	ELL2	-	pfam_Occludin_RNApol2_elong_fac_ELL	ENSG00000118985		0.373	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL2	HGNC	protein_coding	OTTHUMT00000242846.1	206	0.00	0	C	NM_012081		95226942	95226942	-1	no_errors	ENST00000237853	ensembl	human	known	69_37n	missense	189	10.85	23	SNP	1.000	G
FNBP4	23360	genome.wustl.edu	37	11	47753007	47753007	+	Missense_Mutation	SNP	C	C	T	rs560546491		TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr11:47753007C>T	ENST00000263773.5	-	12	1939	c.1927G>A	c.(1927-1929)Gat>Aat	p.D643N	FNBP4_ENST00000534003.1_5'Flank	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	643						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						AGAGTCTCATCTCTATTTTCT	0.423																																						dbGAP											0													192.0	184.0	186.0					11																	47753007		1871	4106	5977	-	-	-	SO:0001583	missense	0			BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.1927G>A	11.37:g.47753007C>T	ENSP00000263773:p.Asp643Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.D643N	ENST00000263773.5	37	c.1927	CCDS41644.1	11	.	.	.	.	.	.	.	.	.	.	C	10.48	1.362682	0.24684	.	.	ENSG00000109920	ENST00000263773	T	0.12147	2.71	6.03	5.11	0.69529	.	0.675708	0.15781	N	0.244917	T	0.10937	0.0267	L	0.36672	1.1	0.33356	D	0.571661	B	0.28128	0.201	B	0.27608	0.081	T	0.06338	-1.0832	10	0.37606	T	0.19	-11.017	7.1195	0.25435	0.1199:0.6809:0.1296:0.0696	.	643	Q8N3X1	FNBP4_HUMAN	N	643	ENSP00000263773:D643N	ENSP00000263773:D643N	D	-	1	0	FNBP4	47709583	0.998000	0.40836	0.998000	0.56505	0.720000	0.41350	0.890000	0.28295	2.861000	0.98227	0.655000	0.94253	GAT	FNBP4	-	NULL	ENSG00000109920		0.423	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNBP4	HGNC	protein_coding	OTTHUMT00000390237.3	245	0.00	0	C			47753007	47753007	-1	no_errors	ENST00000263773	ensembl	human	known	69_37n	missense	115	41.03	80	SNP	0.997	T
GPR12	2835	genome.wustl.edu	37	13	27333003	27333003	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr13:27333003G>A	ENST00000381436.2	-	1	1424	c.962C>T	c.(961-963)cCg>cTg	p.P321L	GPR12_ENST00000405846.3_Missense_Mutation_p.P321L			P47775	GPR12_HUMAN	G protein-coupled receptor 12	321					cellular calcium ion homeostasis (GO:0006874)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			endometrium(7)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		GAGACTGGACGGGATGCAGCC	0.557																																						dbGAP											0													79.0	79.0	79.0					13																	27333003		2203	4300	6503	-	-	-	SO:0001583	missense	0			U18548	CCDS9319.1	13q12	2014-06-12			ENSG00000132975	ENSG00000132975		"""GPCR / Class A : Orphans"""	4466	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 84"""	600752				8262253, 8530049	Standard	NM_005288		Approved	GPCR21, PPP1R84	uc010aal.3	P47775	OTTHUMG00000016620	ENST00000381436.2:c.962C>T	13.37:g.27333003G>A	ENSP00000370844:p.Pro321Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T8P3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_GPR_orph_rcpt,prints_GPR12_rcpt,prints_7TM_GPCR_Rhodpsn	p.P321L	ENST00000381436.2	37	c.962	CCDS9319.1	13	.	.	.	.	.	.	.	.	.	.	G	19.81	3.896130	0.72639	.	.	ENSG00000132975	ENST00000405846;ENST00000381436	T;T	0.36157	1.27;1.27	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.41971	0.1182	L	0.58101	1.795	0.80722	D	1	D	0.53885	0.963	B	0.43082	0.407	T	0.44787	-0.9305	10	0.62326	D	0.03	.	19.3487	0.94376	0.0:0.0:1.0:0.0	.	321	P47775	GPR12_HUMAN	L	321	ENSP00000384932:P321L;ENSP00000370844:P321L	ENSP00000370844:P321L	P	-	2	0	GPR12	26231003	1.000000	0.71417	0.819000	0.32651	0.982000	0.71751	9.739000	0.98837	2.594000	0.87642	0.511000	0.50034	CCG	GPR12	-	NULL	ENSG00000132975		0.557	GPR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR12	HGNC	protein_coding	OTTHUMT00000044257.2	148	0.00	0	G			27333003	27333003	-1	no_errors	ENST00000381436	ensembl	human	known	69_37n	missense	29	76.61	95	SNP	1.000	A
HGD	3081	genome.wustl.edu	37	3	120394696	120394696	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr3:120394696A>C	ENST00000283871.5	-	2	489	c.30T>G	c.(28-30)ttT>ttG	p.F10L	HGD_ENST00000488183.1_5'UTR	NM_000187.3	NP_000178.2	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	10					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	homogentisate 1,2-dioxygenase activity (GO:0004411)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)	25				GBM - Glioblastoma multiforme(114;0.158)		ACTCATTCCCAAATCCAGAAA	0.418																																						dbGAP											0													111.0	105.0	107.0					3																	120394696		2203	4296	6499	-	-	-	SO:0001583	missense	0				CCDS3000.1	3q	2010-04-27	2010-04-27		ENSG00000113924	ENSG00000113924	1.13.11.5		4892	protein-coding gene	gene with protein product	"""homogentisate oxidase"""	607474	"""homogentisate 1,2-dioxygenase (homogentisate oxidase)"""	AKU		8188241	Standard	NM_000187		Approved	HGO	uc003edw.3	Q93099	OTTHUMG00000159441	ENST00000283871.5:c.30T>G	3.37:g.120394696A>C	ENSP00000283871:p.Phe10Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K417|B2R8Z0	Missense_Mutation	SNP	pfam_Homogentis_dOase,superfamily_RmlC_Cupin,tigrfam_Homogentis_dOase	p.F10L	ENST00000283871.5	37	c.30	CCDS3000.1	3	.	.	.	.	.	.	.	.	.	.	A	22.2	4.259497	0.80246	.	.	ENSG00000113924	ENST00000283871	D	0.99507	-6.04	5.82	0.572	0.17357	Cupin, RmlC-type (1);	0.048594	0.85682	N	0.000000	D	0.98836	0.9607	M	0.79805	2.47	0.58432	D	0.999998	P	0.44006	0.824	P	0.48334	0.574	D	0.97496	1.0057	10	0.62326	D	0.03	0.2241	8.6589	0.34079	0.5648:0.0:0.4352:0.0	.	10	Q93099	HGD_HUMAN	L	10	ENSP00000283871:F10L	ENSP00000283871:F10L	F	-	3	2	HGD	121877386	0.978000	0.34361	1.000000	0.80357	0.991000	0.79684	0.234000	0.17930	0.076000	0.16826	0.533000	0.62120	TTT	HGD	-	pfam_Homogentis_dOase,superfamily_RmlC_Cupin,tigrfam_Homogentis_dOase	ENSG00000113924		0.418	HGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGD	HGNC	protein_coding	OTTHUMT00000355410.1	88	0.00	0	A			120394696	120394696	-1	no_errors	ENST00000283871	ensembl	human	known	69_37n	missense	48	49.47	47	SNP	0.998	C
HMBS	3145	genome.wustl.edu	37	11	118963868	118963868	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr11:118963868C>T	ENST00000278715.3	+	14	1112	c.961C>T	c.(961-963)Cgt>Tgt	p.R321C	HMBS_ENST00000537841.1_Missense_Mutation_p.R304C|HMBS_ENST00000442944.2_Missense_Mutation_p.R304C|HMBS_ENST00000542729.1_Missense_Mutation_p.R264C|HMBS_ENST00000544387.1_Missense_Mutation_p.R281C|HMBS_ENST00000543090.1_Missense_Mutation_p.R290C|HMBS_ENST00000392841.1_Missense_Mutation_p.R304C	NM_000190.3	NP_000181.2	P08397	HEM3_HUMAN	hydroxymethylbilane synthase	321					heme biosynthetic process (GO:0006783)|peptidyl-pyrromethane cofactor linkage (GO:0018160)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	hydroxymethylbilane synthase activity (GO:0004418)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		CATCACTGCTCGTAACATTCC	0.522																																						dbGAP											0													121.0	100.0	107.0					11																	118963868		2200	4295	6495	-	-	-	SO:0001583	missense	0			X04808	CCDS8409.1, CCDS41726.1, CCDS58186.1, CCDS58187.1	11q23.3	2013-07-10			ENSG00000256269	ENSG00000256269	2.5.1.61		4982	protein-coding gene	gene with protein product		609806	"""uroporphyrinogen I synthase"", ""porphobilinogen deaminase"", ""porphyria, acute; Chester type"""	PBGD, UPS, PORC		8432552, 17298217	Standard	NM_001258208		Approved		uc001puz.1	P08397	OTTHUMG00000168295	ENST00000278715.3:c.961C>T	11.37:g.118963868C>T	ENSP00000278715:p.Arg321Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2L0|G3V1P4|G5EA58|P08396|Q16012	Missense_Mutation	SNP	pfam_Porphobilin_deaminase_N,pfam_Porphobilinogen_deaminase_C,superfamily_Porphobilinogen_deaminase_C,pirsf_4pyrrol_synth_OHMeBilane_synth,prints_4pyrrol_synth_OHMeBilane_synth,tigrfam_4pyrrol_synth_OHMeBilane_synth	p.R321C	ENST00000278715.3	37	c.961	CCDS8409.1	11	.	.	.	.	.	.	.	.	.	.	c	11.19	1.564325	0.27915	.	.	ENSG00000256269;ENSG00000256269;ENSG00000256269;ENSG00000256269;ENSG00000256269;ENSG00000256269;ENSG00000149397	ENST00000278715;ENST00000537841;ENST00000542729;ENST00000544387;ENST00000543090;ENST00000392841;ENST00000442944	D;D;D;D;D;D;D	0.99830	-7.01;-7.0;-6.71;-6.71;-6.93;-7.0;-7.0	5.35	3.38	0.38709	Porphobilinogen deaminase, C-terminal (2);	1.059230	0.07244	N	0.864740	D	0.98748	0.9579	N	0.12182	0.205	0.18873	N	0.999984	B;B;B;B	0.17852	0.001;0.019;0.003;0.024	B;B;B;B	0.12156	0.002;0.002;0.002;0.007	D	0.99959	1.1697	10	0.41790	T	0.15	-6.478	12.9197	0.58224	0.442:0.558:0.0:0.0	.	264;290;281;321	G3V1P4;F5H345;G5EA58;P08397	.;.;.;HEM3_HUMAN	C	321;304;264;281;290;304;304	ENSP00000278715:R321C;ENSP00000444730:R304C;ENSP00000443058:R264C;ENSP00000438424:R281C;ENSP00000445429:R290C;ENSP00000376584:R304C;ENSP00000392041:R304C	ENSP00000392041:R304C	R	+	1	0	CTD-2589C9.4;HMBS	118469078	0.065000	0.20965	0.771000	0.31576	0.798000	0.45092	0.959000	0.29240	0.739000	0.32628	0.651000	0.88453	CGT	HMBS	-	superfamily_Porphobilinogen_deaminase_C,pirsf_4pyrrol_synth_OHMeBilane_synth	ENSG00000256269		0.522	HMBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMBS	HGNC	protein_coding	OTTHUMT00000399188.1	88	0.00	0	C	NM_000190		118963868	118963868	+1	no_errors	ENST00000278715	ensembl	human	known	69_37n	missense	10	88.10	74	SNP	0.029	T
HTATSF1	27336	genome.wustl.edu	37	X	135593486	135593486	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chrX:135593486G>A	ENST00000218364.4	+	9	1756	c.1582G>A	c.(1582-1584)Gag>Aag	p.E528K	HTATSF1_ENST00000535601.1_Missense_Mutation_p.E528K	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	528	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					CCTCAACAAGGAGTCTGAAGA	0.423																																						dbGAP											0													45.0	44.0	45.0					X																	135593486		2190	4285	6475	-	-	-	SO:0001583	missense	0			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1582G>A	X.37:g.135593486G>A	ENSP00000218364:p.Glu528Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E528K	ENST00000218364.4	37	c.1582	CCDS14657.1	X	.	.	.	.	.	.	.	.	.	.	G	7.233	0.599794	0.13939	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	T;T	0.04275	3.66;3.66	4.53	3.67	0.42095	.	0.937658	0.08881	N	0.880053	T	0.02929	0.0087	N	0.08118	0	0.09310	N	1	B	0.24258	0.1	B	0.15484	0.013	T	0.40887	-0.9539	10	0.46703	T	0.11	-0.0052	6.2538	0.20861	0.2217:0.0:0.7783:0.0	.	528	O43719	HTSF1_HUMAN	K	528	ENSP00000442699:E528K;ENSP00000218364:E528K	ENSP00000218364:E528K	E	+	1	0	HTATSF1	135421152	0.016000	0.18221	0.002000	0.10522	0.154000	0.21943	1.734000	0.38166	1.259000	0.44117	0.523000	0.50628	GAG	HTATSF1	-	NULL	ENSG00000102241		0.423	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTATSF1	HGNC	protein_coding	OTTHUMT00000058497.1	22	0.00	0	G	NM_014500		135593486	135593486	+1	no_errors	ENST00000218364	ensembl	human	known	69_37n	missense	0	100.00	12	SNP	0.003	A
IREB2	3658	genome.wustl.edu	37	15	78786397	78786397	+	Splice_Site	SNP	C	C	T	rs200306100		TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr15:78786397C>T	ENST00000258886.8	+	19	2620	c.2471C>T	c.(2470-2472)aCg>aTg	p.T824M		NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	824					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		TCAGGACAGACGGTGAGAATG	0.299													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17310	0.0		0.0	False		,,,				2504	0.0				NSCLC(200;764 2208 35157 49871 50830)	dbGAP											0													63.0	67.0	66.0					15																	78786397		2196	4291	6487	-	-	-	SO:0001630	splice_region_variant	0			M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.2472+1C>T	15.37:g.78786397C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2	p.T824M	ENST00000258886.8	37	c.2471	CCDS10302.1	15	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	14.44	2.534669	0.45073	.	.	ENSG00000136381	ENST00000258886	T	0.18174	2.23	5.84	2.9	0.33743	Aconitase/3-isopropylmalate dehydratase, swivel (2);Aconitase A/isopropylmalate dehydratase small subunit, swivel (1);	0.138168	0.64402	N	0.000003	T	0.24084	0.0583	L	0.48362	1.52	0.80722	D	1	D	0.89917	1.0	P	0.58013	0.831	T	0.01334	-1.1382	10	0.54805	T	0.06	.	5.8527	0.18701	0.1357:0.6582:0.0:0.2061	.	824	P48200	IREB2_HUMAN	M	824	ENSP00000258886:T824M	ENSP00000258886:T824M	T	+	2	0	IREB2	76573452	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	1.223000	0.32527	0.365000	0.24400	-0.218000	0.12543	ACG	IREB2	-	pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Aconitase/3IPM_dehydase_swvl,tigrfam_Aconitase/Fe_reg_prot_2	ENSG00000136381		0.299	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IREB2	HGNC	protein_coding	OTTHUMT00000290109.3	99	0.00	0	C	NM_004136	Missense_Mutation	78786397	78786397	+1	no_errors	ENST00000258886	ensembl	human	known	69_37n	missense	41	47.44	37	SNP	1.000	T
KCNQ3	3786	genome.wustl.edu	37	8	133186503	133186503	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr8:133186503A>T	ENST00000388996.4	-	6	1447	c.1027T>A	c.(1027-1029)Ttt>Att	p.F343I	KCNQ3_ENST00000521134.1_Missense_Mutation_p.F223I|KCNQ3_ENST00000519445.1_Missense_Mutation_p.F343I	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	343					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	AGGGCAAAAAAGGAGACGCCA	0.517																																						dbGAP											0													108.0	71.0	84.0					8																	133186503		2159	4142	6301	-	-	-	SO:0001583	missense	0			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1027T>A	8.37:g.133186503A>T	ENSP00000373648:p.Phe343Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ3,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.F343I	ENST00000388996.4	37	c.1027	CCDS34943.1	8	.	.	.	.	.	.	.	.	.	.	A	29.0	4.965806	0.92855	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.98264	-4.83;-4.83;-4.83	4.96	4.96	0.65561	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97854	0.9295	L	0.31804	0.96	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.99316	1.0905	10	0.87932	D	0	-14.4591	14.103	0.65070	1.0:0.0:0.0:0.0	.	343;343	E7ET42;O43525	.;KCNQ3_HUMAN	I	343;223;343;332;222	ENSP00000373648:F343I;ENSP00000429799:F223I;ENSP00000428790:F343I	ENSP00000373648:F343I	F	-	1	0	KCNQ3	133255685	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.335000	0.96500	1.980000	0.57719	0.460000	0.39030	TTT	KCNQ3	-	pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl	ENSG00000184156		0.517	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	HGNC	protein_coding	OTTHUMT00000268621.2	88	0.00	0	A	NM_004519		133186503	133186503	-1	no_errors	ENST00000388996	ensembl	human	known	69_37n	missense	119	30.41	52	SNP	1.000	T
KIAA0100	9703	genome.wustl.edu	37	17	26971123	26971123	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr17:26971123delA	ENST00000528896.2	-	2	225	c.151delT	c.(151-153)tggfs	p.W51fs	KIAA0100_ENST00000389003.3_5'UTR|KIAA0100_ENST00000544884.1_5'UTR	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	51						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TTCTGGATCCAAAAAAAGCGG	0.478											OREG0024280	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													84.0	95.0	91.0					17																	26971123		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.151delT	17.37:g.26971123delA	ENSP00000436773:p.Trp51fs	Somatic	790	WXS	Illumina GAIIx	Phase_IV	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Frame_Shift_Del	DEL	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.W51fs	ENST00000528896.2	37	c.151	CCDS32595.1	17																																																																																			KIAA0100	-	pfam_FMP27_N	ENSG00000007202		0.478	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	76	0.00	0	A	NM_014680		26971123	26971123	-1	no_errors	ENST00000005905	ensembl	human	known	69_37n	frame_shift_del	33	10.81	4	DEL	1.000	-
KIAA1755	85449	genome.wustl.edu	37	20	36841609	36841609	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr20:36841609delA	ENST00000279024.4	-	14	3709	c.3438delT	c.(3436-3438)cctfs	p.P1146fs		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	1146										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GGGCAGGGTCAGGCAGCTTGT	0.647																																						dbGAP											0													44.0	46.0	46.0					20																	36841609		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.3438delT	20.37:g.36841609delA	ENSP00000279024:p.Pro1146fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9C0A8	Frame_Shift_Del	DEL	superfamily_CRAL-TRIO_dom	p.D1147fs	ENST00000279024.4	37	c.3438	CCDS33467.1	20																																																																																			KIAA1755	-	NULL	ENSG00000149633		0.647	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1755	HGNC	protein_coding	OTTHUMT00000079144.3	39	0.00	0	A	NM_001029864		36841609	36841609	-1	no_errors	ENST00000279024	ensembl	human	known	69_37n	frame_shift_del	33	33.96	18	DEL	0.000	-
KIF1B	23095	genome.wustl.edu	37	1	10397180	10397180	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr1:10397180G>A	ENST00000377086.1	+	30	3380	c.3178G>A	c.(3178-3180)Gag>Aag	p.E1060K	KIF1B_ENST00000377081.1_Missense_Mutation_p.E1060K|KIF1B_ENST00000263934.6_Missense_Mutation_p.E1014K			O60333	KIF1B_HUMAN	kinesin family member 1B	1060					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GTCCTTGGAGGAGTTGAGGAT	0.423																																						dbGAP											0													192.0	187.0	188.0					1																	10397180		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.3178G>A	1.37:g.10397180G>A	ENSP00000366290:p.Glu1060Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E1014K	ENST00000377086.1	37	c.3040		1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.033087	0.93575	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.78481	-1.18;-1.18;-1.18	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.85336	0.5673	L	0.45352	1.415	0.80722	D	1	P;D;D;D;B;D	0.69078	0.946;0.988;0.992;0.997;0.158;0.974	P;P;P;D;B;D	0.79784	0.718;0.76;0.872;0.993;0.018;0.969	D	0.85475	0.1175	10	0.72032	D	0.01	.	20.0036	0.97427	0.0:0.0:1.0:0.0	.	1046;1020;1060;1034;1060;1014	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	K	1060;1014;1060;1060	ENSP00000263934:E1014K;ENSP00000366290:E1060K;ENSP00000366284:E1060K	ENSP00000263934:E1014K	E	+	1	0	KIF1B	10319767	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.763000	0.74955	2.824000	0.97209	0.655000	0.94253	GAG	KIF1B	-	NULL	ENSG00000054523		0.423	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	177	0.00	0	G			10397180	10397180	+1	no_errors	ENST00000263934	ensembl	human	known	69_37n	missense	26	82.07	119	SNP	1.000	A
MAP3K11	4296	genome.wustl.edu	37	11	65374961	65374961	+	Silent	SNP	C	C	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr11:65374961C>T	ENST00000530153.1	-	5	1019	c.498G>A	c.(496-498)gaG>gaA	p.E166E	MAP3K11_ENST00000309100.3_Silent_p.E423E|MAP3K11_ENST00000534432.1_5'Flank|MAP3K11_ENST00000532507.1_5'Flank					mitogen-activated protein kinase kinase kinase 11											breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(14)|skin(1)	24						CTCGCGTCAGCTCCTCCTCGC	0.721																																						dbGAP											0													12.0	15.0	14.0					11																	65374961		2108	4191	6299	-	-	-	SO:0001819	synonymous_variant	0				CCDS8107.1	11q13.1-q13.3	2011-06-09			ENSG00000173327	ENSG00000173327	2.7.10.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6850	protein-coding gene	gene with protein product		600050		MLK3, PTK1		9267807, 8183572	Standard	NM_002419		Approved	SPRK, MEKK11	uc001oew.3	Q16584	OTTHUMG00000166529	ENST00000530153.1:c.498G>A	11.37:g.65374961C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A129T	ENST00000530153.1	37	c.385		11																																																																																			MAP3K11	-	NULL	ENSG00000173327		0.721	MAP3K11-004	PUTATIVE	basic|exp_conf	protein_coding	MAP3K11	HGNC	protein_coding	OTTHUMT00000390233.2	10	0.00	0	C			65374961	65374961	-1	no_start_codon	ENST00000524848	ensembl	human	known	69_37n	missense	15	46.43	13	SNP	1.000	T
MED8	112950	genome.wustl.edu	37	1	43852271	43852271	+	Nonsense_Mutation	SNP	G	G	C			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr1:43852271G>C	ENST00000372457.4	-	5	525	c.482C>G	c.(481-483)tCa>tGa	p.S161*	RP1-92O14.6_ENST00000436713.1_RNA|MED8_ENST00000372455.4_Nonsense_Mutation_p.S72*|MED8_ENST00000290663.6_Nonsense_Mutation_p.S161*	NM_001001653.2|NM_201542.3	NP_001001653.1|NP_963836.2	Q96G25	MED8_HUMAN	mediator complex subunit 8	161					gene expression (GO:0010467)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	9	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TCCACTCTCTGATTCTCGCTC	0.418																																						dbGAP											0													177.0	156.0	163.0					1																	43852271		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF521562, BC010543	CCDS486.2, CCDS487.2, CCDS60108.1	1p34.1	2008-02-05	2007-07-30		ENSG00000159479	ENSG00000159479			19971	protein-coding gene	gene with protein product		607956	"""mediator of RNA polymerase II transcription, subunit 8 homolog (S. cerevisiae)"""			12149480, 9671713	Standard	NM_052877		Approved	MGC17544, MGC19641, ARC32	uc001cje.2	Q96G25	OTTHUMG00000007421	ENST00000372457.4:c.482C>G	1.37:g.43852271G>C	ENSP00000361535:p.Ser161*	Somatic		WXS	Illumina GAIIx	Phase_IV	A9IZ91|A9IZ92|Q5JUY8|Q96FQ4	Nonsense_Mutation	SNP	pfam_Mediatior_Med8_fun/met	p.S161*	ENST00000372457.4	37	c.482	CCDS487.2	1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970176	0.92855	.	.	ENSG00000159479	ENST00000290663;ENST00000372457;ENST00000372455	.	.	.	6.02	6.02	0.97574	.	0.171039	0.52532	D	0.000065	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-3.5284	20.6011	0.99457	0.0:0.0:1.0:0.0	.	.	.	.	X	161;161;72	.	ENSP00000290663:S161X	S	-	2	0	MED8	43624858	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.268000	0.78473	2.878000	0.98634	0.650000	0.86243	TCA	MED8	-	pfam_Mediatior_Med8_fun/met	ENSG00000159479		0.418	MED8-007	KNOWN	basic|appris_principal|CCDS	protein_coding	MED8	HGNC	protein_coding	OTTHUMT00000318959.1	598	0.00	0	G	NM_052877		43852271	43852271	-1	no_errors	ENST00000290663	ensembl	human	known	69_37n	nonsense	323	38.12	199	SNP	1.000	C
MMP16	4325	genome.wustl.edu	37	8	89130939	89130939	+	Silent	SNP	C	C	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr8:89130939C>T	ENST00000286614.6	-	5	1142	c.861G>A	c.(859-861)caG>caA	p.Q287Q	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	287					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	CATATATCTTCTGGATGCCCT	0.393																																						dbGAP											0													171.0	150.0	157.0					8																	89130939		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.861G>A	8.37:g.89130939C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAN7|Q14824|Q52H48	Silent	SNP	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.Q287	ENST00000286614.6	37	c.861	CCDS6246.1	8																																																																																			MMP16	-	pirsf_Pept_M10A_matrix_strom,pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,prints_Pept_M10A_matrixin	ENSG00000156103		0.393	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	125	0.00	0	C	NM_005941		89130939	89130939	-1	no_errors	ENST00000286614	ensembl	human	known	69_37n	silent	93	43.64	72	SNP	1.000	T
MMRN1	22915	genome.wustl.edu	37	4	90856574	90856574	+	Silent	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr4:90856574G>A	ENST00000394980.1	+	7	2062	c.1743G>A	c.(1741-1743)ttG>ttA	p.L581L	MMRN1_ENST00000508372.1_Silent_p.L323L|MMRN1_ENST00000394981.1_Intron|MMRN1_ENST00000264790.2_Silent_p.L581L			Q13201	MMRN1_HUMAN	multimerin 1	581					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		CCGTCTCTTTGGAGATGGAGA	0.343																																						dbGAP											0													55.0	57.0	56.0					4																	90856574		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.1743G>A	4.37:g.90856574G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5L1|Q6P3T8|Q6ZUL9	Silent	SNP	pfam_C1q,pfam_EMI_domain,pfam_EGF-like_dom,superfamily_Tumour_necrosis_fac-like,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C1q,pfscan_C1q,pfscan_EG-like_dom,pfscan_EMI_domain,prints_C1q	p.L581	ENST00000394980.1	37	c.1743	CCDS3635.1	4																																																																																			MMRN1	-	NULL	ENSG00000138722		0.343	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN1	HGNC	protein_coding	OTTHUMT00000253546.2	56	0.00	0	G	NM_007351		90856574	90856574	+1	no_errors	ENST00000264790	ensembl	human	known	69_37n	silent	6	73.91	17	SNP	0.663	A
MON1B	22879	genome.wustl.edu	37	16	77227443	77227443	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr16:77227443G>C	ENST00000248248.3	+	3	594	c.244G>C	c.(244-246)Gag>Cag	p.E82Q	MON1B_ENST00000439557.2_Intron|MON1B_ENST00000545553.1_Intron|MON1B_ENST00000320859.6_Missense_Mutation_p.E82Q	NM_014940.2	NP_055755.1	Q7L1V2	MON1B_HUMAN	MON1 secretory trafficking family member B	82										breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	17						TGCAGCCCCTGAGAATAGTCC	0.622																																						dbGAP											0													53.0	54.0	54.0					16																	77227443		2198	4300	6498	-	-	-	SO:0001583	missense	0			BC024277	CCDS10925.1, CCDS67082.1, CCDS67083.1	16q23.1	2013-08-21	2013-08-21		ENSG00000103111	ENSG00000103111			25020	protein-coding gene	gene with protein product		608954	"""MON1 homolog B (yeast)"""			10048485	Standard	NM_014940		Approved	SAND2, HSRG1, KIAA0872	uc002fez.3	Q7L1V2	OTTHUMG00000137618	ENST00000248248.3:c.244G>C	16.37:g.77227443G>C	ENSP00000248248:p.Glu82Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDZ0|O94949	Missense_Mutation	SNP	pfam_Vacuolar_fusion_protein_MON1,prints_Vacuolar_fusion_protein_MON1	p.E82Q	ENST00000248248.3	37	c.244	CCDS10925.1	16	.	.	.	.	.	.	.	.	.	.	G	16.89	3.246104	0.59103	.	.	ENSG00000103111	ENST00000248248;ENST00000320859	.	.	.	4.11	3.14	0.36123	.	0.903856	0.08995	N	0.863871	T	0.23965	0.0580	N	0.14661	0.345	0.09310	N	1	B	0.19583	0.037	B	0.14578	0.011	T	0.23940	-1.0174	9	0.16896	T	0.51	.	7.2815	0.26314	0.215:0.0:0.785:0.0	.	82	Q7L1V2	MON1B_HUMAN	Q	82	.	ENSP00000248248:E82Q	E	+	1	0	MON1B	75784944	0.998000	0.40836	0.006000	0.13384	0.048000	0.14542	4.520000	0.60524	1.000000	0.39049	0.563000	0.77884	GAG	MON1B	-	NULL	ENSG00000103111		0.622	MON1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON1B	HGNC	protein_coding	OTTHUMT00000269036.2	83	0.00	0	G	NM_014940		77227443	77227443	+1	no_errors	ENST00000248248	ensembl	human	known	69_37n	missense	8	86.67	52	SNP	0.203	C
MUC15	143662	genome.wustl.edu	37	11	26587427	26587427	+	5'UTR	DEL	T	T	-			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr11:26587427delT	ENST00000455601.2	-	0	97				MUC15_ENST00000527569.1_Frame_Shift_Del_p.K20fs|MUC15_ENST00000529533.1_Frame_Shift_Del_p.K20fs|MUC15_ENST00000281268.8_Frame_Shift_Del_p.K20fs|ANO3_ENST00000256737.3_Intron|ANO3_ENST00000525139.1_Intron|ANO3_ENST00000537978.1_Intron|ANO3_ENST00000531568.1_Intron|MUC15_ENST00000436318.2_Frame_Shift_Del_p.K20fs	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						TTGGTATTGGTTTTTTTTTAA	0.289																																						dbGAP											0													30.0	31.0	30.0					11																	26587427		2174	4267	6441	-	-	-	SO:0001623	5_prime_UTR_variant	0			AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.-22A>-	11.37:g.26587427delT		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Frame_Shift_Del	DEL	NULL	p.K20fs	ENST00000455601.2	37	c.60	CCDS7859.1	11																																																																																			MUC15	-	NULL	ENSG00000169550		0.289	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC15	HGNC	protein_coding	OTTHUMT00000387866.1	44	0.00	0	T	NM_145650		26587427	26587427	-1	no_errors	ENST00000436318	ensembl	human	known	69_37n	frame_shift_del	17	10.53	2	DEL	0.000	-
MYH1	4619	genome.wustl.edu	37	17	10399833	10399833	+	Missense_Mutation	SNP	G	G	A	rs555367957	byFrequency	TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr17:10399833G>A	ENST00000226207.5	-	34	4784	c.4690C>T	c.(4690-4692)Cgc>Tgc	p.R1564C	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1564					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						AGCTGGATGCGCAGGATCTTT	0.393													G|||	3	0.000599042	0.0	0.0	5008	,	,		22230	0.0		0.0	False		,,,				2504	0.0031					dbGAP											0													94.0	94.0	94.0					17																	10399833		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.4690C>T	17.37:g.10399833G>A	ENSP00000226207:p.Arg1564Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CA4|Q9Y622	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1564C	ENST00000226207.5	37	c.4690	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	G	16.96	3.265365	0.59431	.	.	ENSG00000109061	ENST00000226207	D	0.84800	-1.9	5.52	5.52	0.82312	Myosin tail (1);	0.000000	0.44097	U	0.000487	D	0.94460	0.8217	M	0.93283	3.4	0.58432	D	0.999991	D	0.69078	0.997	D	0.67548	0.952	D	0.95317	0.8417	10	0.87932	D	0	.	19.7889	0.96450	0.0:0.0:1.0:0.0	.	1564	P12882	MYH1_HUMAN	C	1564	ENSP00000226207:R1564C	ENSP00000226207:R1564C	R	-	1	0	MYH1	10340558	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.124000	0.50461	2.734000	0.93682	0.655000	0.94253	CGC	MYH1	-	pfam_Myosin_tail	ENSG00000109061		0.393	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	186	0.53	1	G	NM_005963		10399833	10399833	-1	no_errors	ENST00000226207	ensembl	human	known	69_37n	missense	25	84.38	135	SNP	1.000	A
NOBOX	135935	genome.wustl.edu	37	7	144097327	144097327	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr7:144097327G>A	ENST00000467773.1	-	5	922	c.923C>T	c.(922-924)aCg>aTg	p.T308M	NOBOX_ENST00000223140.5_Missense_Mutation_p.T223M|NOBOX_ENST00000483238.1_Missense_Mutation_p.T308M	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	308					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					CACCCCCACCGTCTGGGCAAT	0.552																																						dbGAP											0													76.0	72.0	73.0					7																	144097327		1892	4110	6002	-	-	-	SO:0001583	missense	0					7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.923C>T	7.37:g.144097327G>A	ENSP00000419457:p.Thr308Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCD3|A8MZN5	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.T308M	ENST00000467773.1	37	c.923		7	.	.	.	.	.	.	.	.	.	.	G	3.653	-0.071046	0.07228	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140;ENST00000555556	D;D;D	0.96168	-3.93;-3.93;-3.93	5.79	0.922	0.19408	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.854934	0.10629	N	0.652396	D	0.88276	0.6393	N	0.17901	0.54	0.09310	N	1	B	0.26708	0.157	B	0.21546	0.035	T	0.77487	-0.2569	10	0.33141	T	0.24	-7.562	4.4501	0.11616	0.3937:0.0:0.4614:0.1449	.	308	O60393	NOBOX_HUMAN	M	308;308;223;97	ENSP00000419565:T308M;ENSP00000419457:T308M;ENSP00000223140:T223M	ENSP00000223140:T223M	T	-	2	0	NOBOX	143728260	0.335000	0.24748	0.045000	0.18777	0.169000	0.22640	1.129000	0.31381	-0.106000	0.12110	-0.840000	0.03056	ACG	NOBOX	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000106410		0.552	NOBOX-002	KNOWN	basic	protein_coding	NOBOX	HGNC	protein_coding	OTTHUMT00000350095.1	124	0.00	0	G	XM_001134420		144097327	144097327	-1	no_errors	ENST00000467773	ensembl	human	known	69_37n	missense	79	45.52	66	SNP	0.016	A
OR4F17	81099	genome.wustl.edu	37	19	111016	111016	+	Missense_Mutation	SNP	T	T	G	rs200336441		TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr19:111016T>G	ENST00000585993.1	+	2	477	c.338T>G	c.(337-339)tTt>tGt	p.F113C	OR4F17_ENST00000318050.3_Missense_Mutation_p.F113C			Q8NGA8	O4F17_HUMAN	olfactory receptor, family 4, subfamily F, member 17	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(2)	2		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCATGGGCTTTGACAGATAT	0.463																																						dbGAP											0													1.0	1.0	1.0					19																	111016		76	150	226	-	-	-	SO:0001583	missense	0			AC005605	CCDS32854.1	19p13.3	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15381	protein-coding gene	gene with protein product				OR4F19, OR4F11P, OR4F18			Standard	NM_001005240		Approved		uc002loc.1	Q8NGA8		ENST00000585993.1:c.338T>G	19.37:g.111016T>G	ENSP00000467301:p.Phe113Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNE8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F113C	ENST00000585993.1	37	c.338	CCDS32854.1	19	.	.	.	.	.	.	.	.	.	.	.	9.777	1.174271	0.21704	.	.	ENSG00000176695	ENST00000442916;ENST00000318050	T	0.00520	6.85	2.55	2.55	0.30701	GPCR, rhodopsin-like superfamily (1);	0.156294	0.30193	N	0.010181	T	0.01189	0.0039	M	0.75884	2.315	0.31291	N	0.689393	D	0.76494	0.999	D	0.74674	0.984	T	0.24154	-1.0168	10	0.72032	D	0.01	.	4.9478	0.13999	0.2703:0.0:0.0:0.7297	.	113	Q8NGA8	O4F17_HUMAN	C	161;113	ENSP00000315047:F113C	ENSP00000315047:F113C	F	+	2	0	OR4F17	62016	0.698000	0.27777	1.000000	0.80357	0.325000	0.28411	0.344000	0.19962	1.410000	0.46936	0.346000	0.21813	TTT	OR4F17	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000176695		0.463	OR4F17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F17	HGNC	protein_coding	OTTHUMT00000451410.1	15	0.00	0	T			111016	111016	+1	no_errors	ENST00000318050	ensembl	human	known	69_37n	missense	28	26.32	10	SNP	0.999	G
OR52H1	390067	genome.wustl.edu	37	11	5566050	5566050	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr11:5566050delC	ENST00000322653.4	-	1	729	c.704delG	c.(703-705)ggcfs	p.G235fs	HBG2_ENST00000380259.2_Intron	NM_001005289.1	NP_001005289.1	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H, member 1	235			G -> C (in dbSNP:rs1995157).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGAGGGAAGGCCAAAGACAGC	0.483																																						dbGAP											0													115.0	102.0	106.0					11																	5566050		2201	4297	6498	-	-	-	SO:0001589	frameshift_variant	0			AB065802	CCDS31386.1	11p15.4	2012-08-09			ENSG00000181616	ENSG00000181616		"""GPCR / Class A : Olfactory receptors"""	15218	protein-coding gene	gene with protein product							Standard	NM_001005289		Approved		uc010qzh.2	Q8NGJ2	OTTHUMG00000066909	ENST00000322653.4:c.704delG	11.37:g.5566050delC	ENSP00000326259:p.Gly235fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH26|Q6IF79	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.G235fs	ENST00000322653.4	37	c.704	CCDS31386.1	11																																																																																			OR52H1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181616		0.483	OR52H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52H1	HGNC	protein_coding	OTTHUMT00000143400.1	134	0.00	0	C	NM_001005289		5566050	5566050	-1	no_errors	ENST00000322653	ensembl	human	known	69_37n	frame_shift_del	20	77.08	74	DEL	0.137	-
OR5I1	10798	genome.wustl.edu	37	11	55703513	55703513	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr11:55703513A>T	ENST00000301532.3	-	1	363	c.364T>A	c.(364-366)Tat>Aat	p.Y122N		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	122					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TAGCGATCATAGGCCATGGCG	0.443																																						dbGAP											0													61.0	63.0	62.0					11																	55703513		2201	4292	6493	-	-	-	SO:0001583	missense	0			BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.364T>A	11.37:g.55703513A>T	ENSP00000301532:p.Tyr122Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEU4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Y122N	ENST00000301532.3	37	c.364	CCDS7949.1	11	.	.	.	.	.	.	.	.	.	.	A	13.43	2.234872	0.39498	.	.	ENSG00000167825	ENST00000301532	T	0.00490	7.03	4.94	4.94	0.65067	GPCR, rhodopsin-like superfamily (1);	0.165039	0.28989	N	0.013490	T	0.01287	0.0042	H	0.94698	3.57	0.29494	N	0.855446	D	0.53885	0.963	P	0.48425	0.577	T	0.03641	-1.1017	10	0.87932	D	0	.	12.8531	0.57869	1.0:0.0:0.0:0.0	.	122	Q13606	OR5I1_HUMAN	N	122	ENSP00000301532:Y122N	ENSP00000301532:Y122N	Y	-	1	0	OR5I1	55460089	0.250000	0.23951	0.029000	0.17559	0.066000	0.16364	4.565000	0.60836	1.970000	0.57323	0.519000	0.50382	TAT	OR5I1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000167825		0.443	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5I1	HGNC	protein_coding	OTTHUMT00000391528.1	52	0.00	0	A	NM_006637		55703513	55703513	-1	no_errors	ENST00000301532	ensembl	human	known	69_37n	missense	66	12.00	9	SNP	0.638	T
PAK7	57144	genome.wustl.edu	37	20	9546864	9546864	+	Silent	SNP	G	G	C			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr20:9546864G>C	ENST00000378429.3	-	6	1704	c.1158C>G	c.(1156-1158)ccC>ccG	p.P386P	PAK7_ENST00000353224.5_Silent_p.P386P|PAK7_ENST00000378423.1_Silent_p.P386P	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	386	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			TCTGCAGGGAGGGGTGATGGT	0.587																																						dbGAP											0													156.0	149.0	151.0					20																	9546864		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1158C>G	20.37:g.9546864G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAK_box_Rho-bd,superfamily_Kinase-like_dom,smart_PAK_box_Rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAK_box_Rho-bd,pfscan_Prot_kinase_cat_dom	p.P386	ENST00000378429.3	37	c.1158	CCDS13107.1	20																																																																																			PAK7	-	NULL	ENSG00000101349		0.587	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAK7	HGNC	protein_coding	OTTHUMT00000077962.1	130	0.00	0	G			9546864	9546864	-1	no_errors	ENST00000353224	ensembl	human	known	69_37n	silent	124	42.40	92	SNP	0.000	C
PAN2	9924	genome.wustl.edu	37	12	56713711	56713711	+	Silent	SNP	C	C	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr12:56713711C>T	ENST00000425394.2	-	21	3271	c.2895G>A	c.(2893-2895)ctG>ctA	p.L965L	PAN2_ENST00000257931.5_Silent_p.L964L|PAN2_ENST00000440411.3_Silent_p.L961L|PAN2_ENST00000549090.1_5'Flank|PAN2_ENST00000548043.1_Silent_p.L965L	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	GCATCTCATTCAGCATCAGTG	0.498																																						dbGAP											0													153.0	124.0	134.0					12																	56713711		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.2895G>A	12.37:g.56713711C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,pfam_Peptidase_C19,superfamily_RNaseH-like_dom,superfamily_WD40_repeat_dom,smart_Exonuclease,pfscan_Peptidase_C19	p.L965	ENST00000425394.2	37	c.2895	CCDS44922.1	12																																																																																			PAN2	-	superfamily_RNaseH-like_dom	ENSG00000135473		0.498	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN2	HGNC	protein_coding	OTTHUMT00000409024.1	228	0.00	0	C	NM_014871		56713711	56713711	-1	no_errors	ENST00000425394	ensembl	human	known	69_37n	silent	271	23.66	84	SNP	1.000	T
PCDH11X	27328	genome.wustl.edu	37	X	91873742	91873742	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chrX:91873742G>A	ENST00000373094.1	+	7	4692	c.3847G>A	c.(3847-3849)Gtg>Atg	p.V1283M	PCDH11X_ENST00000373097.1_Missense_Mutation_p.V1273M|PCDH11X_ENST00000298274.8_Missense_Mutation_p.V1246M|PCDH11X_ENST00000406881.1_Missense_Mutation_p.V1275M|PCDH11X_ENST00000504220.2_3'UTR|PCDH11X_ENST00000373088.1_Missense_Mutation_p.V1246M|PCDH11X_ENST00000361655.2_Missense_Mutation_p.V1265M	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1283					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GCAAGGTTGGGTGCAAGGTGC	0.512																																					NSCLC(38;925 1092 2571 38200 45895)	dbGAP											0													291.0	255.0	267.0					X																	91873742		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3847G>A	X.37:g.91873742G>A	ENSP00000362186:p.Val1283Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V1283M	ENST00000373094.1	37	c.3847	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	G	13.65	2.301558	0.40694	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.54866	0.59;0.6;0.55;0.57;0.59;0.55	4.28	1.44	0.22558	.	.	.	.	.	T	0.30947	0.0781	N	0.08118	0	0.26785	N	0.969512	B;B;B;B;B	0.13145	0.007;0.007;0.007;0.007;0.004	B;B;B;B;B	0.14023	0.01;0.01;0.01;0.01;0.005	T	0.22941	-1.0202	9	0.52906	T	0.07	.	8.8159	0.34996	0.2827:0.0:0.7173:0.0	.	1246;1265;1275;1273;1283	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	M	1283;1273;1246;1265;1275;1283;1246	ENSP00000362186:V1283M;ENSP00000362189:V1273M;ENSP00000362180:V1246M;ENSP00000355105:V1265M;ENSP00000384758:V1275M;ENSP00000298274:V1246M	ENSP00000298274:V1246M	V	+	1	0	PCDH11X	91760398	1.000000	0.71417	0.981000	0.43875	0.601000	0.36947	2.268000	0.43338	0.239000	0.21243	-0.412000	0.06146	GTG	PCDH11X	-	NULL	ENSG00000102290		0.512	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	243	0.00	0	G	NM_032969		91873742	91873742	+1	no_errors	ENST00000373094	ensembl	human	known	69_37n	missense	39	81.13	172	SNP	0.972	A
PCDHA2	56146	genome.wustl.edu	37	5	140176671	140176672	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	T|C	T|C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr5:140176671_140176672TC>AA	ENST00000526136.1	+	1	2122_2123	c.2122_2123TC>AA	c.(2122-2124)TCc>AAc	p.S708N	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.S708N|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Missense_Mutation_p.S708N	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	708					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCGCGGTATCCAGCCTGTTG	0.688																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		Exception_encountered	5.37:g.140176671_140176672delinsAA	ENSP00000431748:p.Ser708Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O75287|Q9BTV3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S708T|p.S708Y	ENST00000526136.1	37	c.2122|c.2123	CCDS54914.1	5																																																																																			PCDHA2	-	NULL	ENSG00000204969		0.688	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	HGNC	protein_coding	OTTHUMT00000372877.3	32	0.00	0	T|C	NM_018905		140176671|140176672	140176671|140176672	+1	no_errors	ENST00000526136	ensembl	human	known	69_37n	missense	61	41.35	43	SNP	1.000	A
PCDHA5	56143	genome.wustl.edu	37	5	140203381	140203381	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr5:140203381C>T	ENST00000529859.1	+	1	2021	c.2021C>T	c.(2020-2022)gCg>gTg	p.A674V	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.A674V|PCDHA5_ENST00000378126.3_Missense_Mutation_p.A674V|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	674	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTGGCCAGGCGCCGAAGGCC	0.677																																						dbGAP											0													40.0	48.0	46.0					5																	140203381		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.2021C>T	5.37:g.140203381C>T	ENSP00000436557:p.Ala674Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O75284|Q8N4R3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A674V	ENST00000529859.1	37	c.2021	CCDS54917.1	5	.	.	.	.	.	.	.	.	.	.	C	14.12	2.439850	0.43326	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.51325	0.75;0.71;0.73	4.01	0.393	0.16294	Cadherin (2);	.	.	.	.	T	0.40347	0.1113	M	0.64170	1.965	0.09310	N	1	B;B;B	0.19706	0.007;0.021;0.038	B;B;B	0.15870	0.002;0.014;0.008	T	0.32107	-0.9919	9	0.35671	T	0.21	.	6.63	0.22851	0.1858:0.6581:0.0:0.1561	.	674;674;674	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	V	674	ENSP00000433416:A674V;ENSP00000436557:A674V;ENSP00000367366:A674V	ENSP00000367366:A674V	A	+	2	0	PCDHA5	140183565	0.000000	0.05858	0.112000	0.21494	0.679000	0.39708	-0.063000	0.11655	0.308000	0.22923	0.306000	0.20318	GCG	PCDHA5	-	smart_Cadherin,pfscan_Cadherin	ENSG00000204965		0.677	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA5	HGNC	protein_coding	OTTHUMT00000372883.2	30	0.00	0	C	NM_018908		140203381	140203381	+1	no_errors	ENST00000529859	ensembl	human	known	69_37n	missense	55	40.86	38	SNP	0.008	T
PHF14	9678	genome.wustl.edu	37	7	11022484	11022484	+	Silent	SNP	C	C	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr7:11022484C>T	ENST00000403050.3	+	3	1050	c.598C>T	c.(598-600)Ctg>Ttg	p.L200L	PHF14_ENST00000445996.2_Intron	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	200					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		CATGGAAGAGCTGAATGACAT	0.468																																						dbGAP											0													94.0	90.0	91.0					7																	11022484		2060	4220	6280	-	-	-	SO:0001819	synonymous_variant	0			AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.598C>T	7.37:g.11022484C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MCZ3|B4DI82	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.L200	ENST00000403050.3	37	c.598	CCDS47542.1	7																																																																																			PHF14	-	NULL	ENSG00000106443		0.468	PHF14-001	KNOWN	basic|CCDS	protein_coding	PHF14	HGNC	protein_coding	OTTHUMT00000318212.1	147	0.68	1	C	NM_014660		11022484	11022484	+1	no_errors	ENST00000403050	ensembl	human	known	69_37n	silent	113	41.45	80	SNP	1.000	T
PLEC	5339	genome.wustl.edu	37	8	144997236	144997236	+	Silent	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr8:144997236G>A	ENST00000322810.4	-	31	7441	c.7272C>T	c.(7270-7272)gcC>gcT	p.A2424A	PLEC_ENST00000354958.2_Silent_p.A2265A|PLEC_ENST00000436759.2_Silent_p.A2314A|PLEC_ENST00000398774.2_Silent_p.A2255A|PLEC_ENST00000357649.2_Silent_p.A2291A|PLEC_ENST00000527096.1_Silent_p.A2310A|PLEC_ENST00000354589.3_Silent_p.A2287A|PLEC_ENST00000356346.3_Silent_p.A2273A|PLEC_ENST00000345136.3_Silent_p.A2287A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2424	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CAGCCTCTTGGGCCGCCACAC	0.642																																						dbGAP											0													13.0	15.0	14.0					8																	144997236		2186	4268	6454	-	-	-	SO:0001819	synonymous_variant	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.7272C>T	8.37:g.144997236G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.A2424	ENST00000322810.4	37	c.7272	CCDS43772.1	8																																																																																			PLEC	-	superfamily_Chorismate_mutase_type_II	ENSG00000178209		0.642	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	14	0.00	0	G	NM_000445		144997236	144997236	-1	no_errors	ENST00000322810	ensembl	human	known	69_37n	silent	25	28.57	10	SNP	0.959	A
ZNHIT1	10467	genome.wustl.edu	37	7	100861229	100861229	+	5'UTR	SNP	C	C	G			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr7:100861229C>G	ENST00000305105.2	+	0	281				PLOD3_ENST00000223127.3_5'Flank	NM_006349.2	NP_006340.1	O43257	ZNHI1_HUMAN	zinc finger, HIT-type containing 1						negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of histone deacetylation (GO:0031063)|regulation of T cell proliferation (GO:0042129)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)	11	Lung NSC(181;0.168)|all_lung(186;0.215)					AACACCGTGACCACATCTTTA	0.478																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF093571	CCDS5716.1	7q22.1	2010-09-15	2010-09-15	2003-08-08	ENSG00000106400	ENSG00000106400		"""Zinc fingers, HIT-type"""	21688	protein-coding gene	gene with protein product	"""putative cyclin G1 interacting protein"""		"""zinc finger protein, subfamily 4A (HIT domain containing), member 1"", ""zinc finger, HIT domain containing 1"""	ZNFN4A1			Standard	NM_006349		Approved	CG1I, H_DJ0747G18.14	uc003uye.3	O43257	OTTHUMG00000157113	ENST00000305105.2:c.-248C>G	7.37:g.100861229C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IB12	Missense_Mutation	SNP	NULL	p.V8L	ENST00000305105.2	37	c.22	CCDS5716.1	7	.	.	.	.	.	.	.	.	.	.	C	9.630	1.136036	0.21123	.	.	ENSG00000106397	ENST00000414785	T	0.15017	2.46	2.8	-1.54	0.08584	.	.	.	.	.	T	0.08088	0.0202	.	.	.	0.20489	N	0.999894	.	.	.	.	.	.	T	0.36212	-0.9757	6	0.22706	T	0.39	.	1.5974	0.02667	0.1567:0.4421:0.158:0.2432	.	.	.	.	L	8	ENSP00000407551:V8L	ENSP00000407551:V8L	V	-	1	0	PLOD3	100647949	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.026000	0.03596	-0.799000	0.04439	-1.943000	0.00494	GTC	PLOD3	-	NULL	ENSG00000106397		0.478	ZNHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLOD3	HGNC	protein_coding	OTTHUMT00000347488.1	16	0.00	0	C	NM_006349		100861229	100861229	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000414785	ensembl	human	putative	69_37n	missense	16	61.90	26	SNP	0.000	G
POLG	5428	genome.wustl.edu	37	15	89876861	89876861	+	Missense_Mutation	SNP	C	C	T	rs74382477		TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr15:89876861C>T	ENST00000268124.5	-	2	458	c.125G>A	c.(124-126)cGg>cAg	p.R42Q	POLG_ENST00000442287.2_Missense_Mutation_p.R42Q|POLG_ENST00000525806.1_5'Flank|RP11-217B1.2_ENST00000562356.1_RNA|RP11-217B1.2_ENST00000569473.1_RNA	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	42					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			ctgctgctgccgccgccgctg	0.736								DNA polymerases (catalytic subunits)																													Colon(73;648 1203 11348 18386 27782)	dbGAP											0																																										-	-	-	SO:0001583	missense	0			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.125G>A	15.37:g.89876861C>T	ENSP00000268124:p.Arg42Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NFM2|Q92515	Missense_Mutation	SNP	pirsf_DNA-dir_DNA_pol_A_mt_sub,pfam_DNA-dir_DNA_pol_A_palm_dom,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_A_palm_dom,prints_DNA-dir_DNA_pol_A_mt	p.R42Q	ENST00000268124.5	37	c.125	CCDS10350.1	15	.	.	.	.	.	.	.	.	.	.	C	4.741	0.137797	0.09032	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.96200	-3.94;-3.94	2.53	-0.795	0.10915	.	0.227039	0.13631	U	0.373696	D	0.84511	0.5488	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.72805	-0.4182	10	0.10636	T	0.68	.	5.1171	0.14840	0.0:0.2444:0.3969:0.3588	.	42	P54098	DPOG1_HUMAN	Q	42	ENSP00000268124:R42Q;ENSP00000399851:R42Q	ENSP00000268124:R42Q	R	-	2	0	POLG	87677865	0.017000	0.18338	0.003000	0.11579	0.012000	0.07955	-0.201000	0.09464	-0.338000	0.08413	-1.937000	0.00501	CGG	POLG	-	pirsf_DNA-dir_DNA_pol_A_mt_sub	ENSG00000140521		0.736	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLG	HGNC	protein_coding	OTTHUMT00000312854.2	10	0.00	0	C	NM_002693		89876861	89876861	-1	no_errors	ENST00000268124	ensembl	human	known	69_37n	missense	28	21.62	8	SNP	0.003	T
PREPL	9581	genome.wustl.edu	37	2	44565657	44565657	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr2:44565657C>G	ENST00000409936.1	-	8	1425	c.988G>C	c.(988-990)Gat>Cat	p.D330H	PREPL_ENST00000409411.1_Missense_Mutation_p.D241H|PREPL_ENST00000378520.3_Missense_Mutation_p.D330H|PREPL_ENST00000409272.1_Missense_Mutation_p.D330H|PREPL_ENST00000260648.6_Missense_Mutation_p.D330H|PREPL_ENST00000541738.1_Missense_Mutation_p.D241H|PREPL_ENST00000410081.1_Missense_Mutation_p.D330H|PREPL_ENST00000378511.3_Intron|PREPL_ENST00000409957.1_Missense_Mutation_p.D241H	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	330						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GCAGGGGTATCAGCCGCTGTT	0.378																																						dbGAP											0													70.0	69.0	69.0					2																	44565657		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.988G>C	2.37:g.44565657C>G	ENSP00000386543:p.Asp330His	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Missense_Mutation	SNP	pfam_Peptidase_S9,pfam_Peptidase_S9A_B_C_N,superfamily_Peptidase_S9A_B_C_N,prints_Peptidase_S9A	p.D330H	ENST00000409936.1	37	c.988	CCDS33190.1	2	.	.	.	.	.	.	.	.	.	.	C	17.54	3.415623	0.62511	.	.	ENSG00000138078	ENST00000541738;ENST00000409411;ENST00000409957;ENST00000409936;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378520	T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.35	4.28	0.50868	Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (2);	0.220809	0.46145	D	0.000310	T	0.50205	0.1602	N	0.19112	0.55	0.23657	N	0.997186	D;D	0.63046	0.981;0.992	P;P	0.62740	0.756;0.906	T	0.43475	-0.9389	10	0.44086	T	0.13	-23.5174	14.9082	0.70735	0.0:0.9193:0.0:0.0807	.	330;330	Q4J6C6-2;Q4J6C6	.;PPCEL_HUMAN	H	241;241;241;330;330;330;330;330	ENSP00000439626:D241H;ENSP00000387095:D241H;ENSP00000387241:D241H;ENSP00000386543:D330H;ENSP00000260648:D330H;ENSP00000386909:D330H;ENSP00000386509:D330H;ENSP00000367781:D330H	ENSP00000260648:D330H	D	-	1	0	PREPL	44419161	0.947000	0.32204	1.000000	0.80357	0.952000	0.60782	1.599000	0.36751	2.496000	0.84212	0.655000	0.94253	GAT	PREPL	-	pfam_Peptidase_S9A_B_C_N,superfamily_Peptidase_S9A_B_C_N	ENSG00000138078		0.378	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PREPL	HGNC	protein_coding	OTTHUMT00000327900.1	111	0.00	0	C	NM_006036		44565657	44565657	-1	no_errors	ENST00000260648	ensembl	human	known	69_37n	missense	66	46.34	57	SNP	0.672	G
RELN	5649	genome.wustl.edu	37	7	103214731	103214731	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr7:103214731C>A	ENST00000428762.1	-	30	4478	c.4319G>T	c.(4318-4320)tGt>tTt	p.C1440F	RELN_ENST00000424685.2_Missense_Mutation_p.C1440F|RELN_ENST00000343529.5_Missense_Mutation_p.C1440F	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1440	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ATTTGACACACAGGTTCCTTG	0.453																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											0													84.0	71.0	75.0					7																	103214731		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4319G>T	7.37:g.103214731C>A	ENSP00000392423:p.Cys1440Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.C1440F	ENST00000428762.1	37	c.4319	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240218	0.79912	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.26518	1.73;1.73;1.73	5.51	5.51	0.81932	Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.49270	0.1547	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	0.977;1.0	P;D	0.79784	0.622;0.993	T	0.22173	-1.0224	10	0.36615	T	0.2	.	19.7654	0.96337	0.0:1.0:0.0:0.0	.	1440;1440	P78509-2;P78509	.;RELN_HUMAN	F	1440	ENSP00000392423:C1440F;ENSP00000345694:C1440F;ENSP00000388446:C1440F	ENSP00000345694:C1440F	C	-	2	0	RELN	103001967	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.445000	0.80570	2.750000	0.94351	0.655000	0.94253	TGT	RELN	-	superfamily_Growth_fac_rcpt,smart_EGF-like	ENSG00000189056		0.453	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	89	0.00	0	C	NM_005045		103214731	103214731	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	52	48.51	49	SNP	1.000	A
RFX3	5991	genome.wustl.edu	37	9	3293227	3293227	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr9:3293227G>C	ENST00000382004.3	-	7	892	c.581C>G	c.(580-582)gCa>gGa	p.A194G	RFX3_ENST00000302303.1_Missense_Mutation_p.A194G|RFX3_ENST00000358730.2_Missense_Mutation_p.A194G	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	194					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		CACTCCTTCTGCTGTCTCATA	0.438																																						dbGAP											0													96.0	84.0	88.0					9																	3293227		2203	4300	6503	-	-	-	SO:0001583	missense	0			AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.581C>G	9.37:g.3293227G>C	ENSP00000371434:p.Ala194Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.A194G	ENST00000382004.3	37	c.581	CCDS6449.1	9	.	.	.	.	.	.	.	.	.	.	G	32	5.176814	0.94846	.	.	ENSG00000080298	ENST00000382004;ENST00000381992;ENST00000358730;ENST00000302303;ENST00000457373	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	5.72	5.72	0.89469	Winged helix-turn-helix transcription repressor DNA-binding (1);DNA-binding RFX (1);	0.000000	0.85682	D	0.000000	D	0.90222	0.6943	M	0.77103	2.36	0.80722	D	1	P;D;B;P	0.52996	0.927;0.957;0.308;0.927	P;P;B;P	0.58620	0.759;0.795;0.333;0.842	D	0.89496	0.3760	10	0.46703	T	0.11	-6.2765	19.8752	0.96867	0.0:0.0:1.0:0.0	.	169;194;194;194	B1ANP5;P48380-3;P48380-2;P48380	.;.;.;RFX3_HUMAN	G	194;169;194;194;169	ENSP00000371434:A194G;ENSP00000351574:A194G;ENSP00000303847:A194G;ENSP00000405664:A169G	ENSP00000303847:A194G	A	-	2	0	RFX3	3283227	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.771000	0.98977	2.699000	0.92147	0.591000	0.81541	GCA	RFX3	-	pfam_DNA-bd_RFX	ENSG00000080298		0.438	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX3	HGNC	protein_coding	OTTHUMT00000051545.1	145	0.00	0	G	NM_002919		3293227	3293227	-1	no_errors	ENST00000382004	ensembl	human	known	69_37n	missense	13	88.60	101	SNP	1.000	C
RYR1	6261	genome.wustl.edu	37	19	38954480	38954480	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr19:38954480G>A	ENST00000359596.3	+	22	2776	c.2776G>A	c.(2776-2778)Gag>Aag	p.E926K	RYR1_ENST00000360985.3_Missense_Mutation_p.E926K|RYR1_ENST00000355481.4_Missense_Mutation_p.E926K			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	926	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GATGTCTGGGGAGACGCTCAA	0.627																																						dbGAP											0													55.0	55.0	55.0					19																	38954480		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2776G>A	19.37:g.38954480G>A	ENSP00000352608:p.Glu926Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.E926K	ENST00000359596.3	37	c.2776	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	g	20.7	4.034212	0.75617	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.93247	-3.19;-3.19;-3.19	4.0	4.0	0.46444	Ryanodine receptor Ryr (1);	0.000000	0.64402	U	0.000002	D	0.97120	0.9059	M	0.89715	3.055	0.52501	D	0.999959	D;D	0.89917	0.997;1.0	D;D	0.85130	0.995;0.997	D	0.98081	1.0404	10	0.72032	D	0.01	.	15.9968	0.80256	0.0:0.0:1.0:0.0	.	926;926	P21817-2;P21817	.;RYR1_HUMAN	K	926	ENSP00000352608:E926K;ENSP00000347667:E926K;ENSP00000354254:E926K	ENSP00000347667:E926K	E	+	1	0	RYR1	43646320	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.411000	0.97342	2.093000	0.63338	0.444000	0.29173	GAG	RYR1	-	pfam_Ryanodine_rcpt	ENSG00000196218		0.627	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	36	0.00	0	G			38954480	38954480	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	missense	5	80.00	20	SNP	1.000	A
SF3B4	10262	genome.wustl.edu	37	1	149895759	149895760	+	Frame_Shift_Ins	INS	-	-	G			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr1:149895759_149895760insG	ENST00000271628.8	-	5	1644_1645	c.1060_1061insC	c.(1060-1062)cgafs	p.R354fs		NM_005850.4	NP_005841.1	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4, 49kDa	354					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R354fs*>72(1)		endometrium(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)	17	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			TGGAGGCCCTCGGGGGGGCATG	0.624																																						dbGAP											1	Insertion - Frameshift(1)	ovary(1)								15,4235		0,15,2110						5.0	1.0			16	15,8229		0,15,4107	no	frameshift	SF3B4	NM_005850.4		0,30,6217	A1A1,A1R,RR		0.182,0.3529,0.2401				30,12464				-	-	-	SO:0001589	frameshift_variant	0			L35013	CCDS72900.1	1q21.2	2013-02-12	2002-08-29		ENSG00000143368	ENSG00000143368		"""RNA binding motif (RRM) containing"""	10771	protein-coding gene	gene with protein product		605593	"""splicing factor 3b, subunit 4, 49kD"""			7958871	Standard	NM_005850		Approved	SAP49, SF3b49, Hsh49	uc001etk.2	Q15427	OTTHUMG00000012208	ENST00000271628.8:c.1061dupC	1.37:g.149895766_149895766dupG	ENSP00000271628:p.Arg354fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZ63	Frame_Shift_Ins	INS	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R354fs	ENST00000271628.8	37	c.1061_1060	CCDS941.1	1																																																																																			SF3B4	-	NULL	ENSG00000143368		0.624	SF3B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B4	HGNC	protein_coding	OTTHUMT00000033753.1	32	0.00	0	-	NM_005850		149895759	149895760	-1	no_errors	ENST00000271628	ensembl	human	known	69_37n	frame_shift_ins	23	36.11	13	INS	1.000:0.998	G
SLC12A7	10723	genome.wustl.edu	37	5	1075597	1075597	+	Missense_Mutation	SNP	G	G	C	rs143947354		TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr5:1075597G>C	ENST00000264930.5	-	15	1899	c.1856C>G	c.(1855-1857)tCc>tGc	p.S619C		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	619					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.S619F(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	ACCCAGAAAGGACAGGGTCCT	0.637																																						dbGAP											1	Substitution - Missense(1)	skin(1)											55.0	50.0	51.0					5																	1075597		2201	4300	6501	-	-	-	SO:0001583	missense	0			AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1856C>G	5.37:g.1075597G>C	ENSP00000264930:p.Ser619Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	pfam_AA-permease_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.S619C	ENST00000264930.5	37	c.1856	CCDS34129.1	5	.	.	.	.	.	.	.	.	.	.	g	18.61	3.660148	0.67586	.	.	ENSG00000113504	ENST00000264930	D	0.98835	-5.17	4.27	4.27	0.50696	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.99020	0.9665	M	0.84082	2.675	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	D	0.99449	1.0940	10	0.87932	D	0	.	14.5317	0.67931	0.0:0.0:1.0:0.0	.	619	Q9Y666	S12A7_HUMAN	C	619	ENSP00000264930:S619C	ENSP00000264930:S619C	S	-	2	0	SLC12A7	1128597	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	8.731000	0.91529	2.084000	0.62774	0.491000	0.48974	TCC	SLC12A7	-	pfam_AA-permease_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000113504		0.637	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SLC12A7	HGNC	protein_coding	OTTHUMT00000366446.2	39	0.00	0	G	NM_006598		1075597	1075597	-1	no_errors	ENST00000264930	ensembl	human	known	69_37n	missense	67	27.17	25	SNP	1.000	C
SLC25A32	81034	genome.wustl.edu	37	8	104412655	104412655	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr8:104412655C>T	ENST00000297578.4	-	7	1098	c.932G>A	c.(931-933)aGa>aAa	p.R311K	SLC25A32_ENST00000523701.1_5'Flank|SLC25A32_ENST00000543107.1_Missense_Mutation_p.R179K	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32	311					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	TCTCTTTTCTCTAAGGTCAAG	0.373																																						dbGAP											0													107.0	105.0	106.0					8																	104412655		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790	ENST00000297578.4:c.932G>A	8.37:g.104412655C>T	ENSP00000297578:p.Arg311Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96JZ6|Q96SU7	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.R311K	ENST00000297578.4	37	c.932	CCDS6300.1	8	.	.	.	.	.	.	.	.	.	.	C	13.85	2.360407	0.41801	.	.	ENSG00000164933	ENST00000297578;ENST00000424899;ENST00000543107	T;T	0.77877	-0.73;-1.13	5.66	3.7	0.42460	.	0.194185	0.56097	N	0.000039	T	0.47911	0.1471	N	0.02011	-0.69	0.42385	D	0.9925	B	0.02656	0.0	B	0.08055	0.003	T	0.35450	-0.9788	10	0.08179	T	0.78	-19.2705	10.2086	0.43128	0.0:0.7727:0.0:0.2273	.	311	Q9H2D1	MFTC_HUMAN	K	311;295;179	ENSP00000297578:R311K;ENSP00000443497:R179K	ENSP00000297578:R311K	R	-	2	0	SLC25A32	104481831	0.991000	0.36638	0.995000	0.50966	0.996000	0.88848	0.563000	0.23547	0.628000	0.30357	0.655000	0.94253	AGA	SLC25A32	-	prints_Mit_uncoupling	ENSG00000164933		0.373	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A32	HGNC	protein_coding	OTTHUMT00000380290.2	112	0.00	0	C	NM_030780		104412655	104412655	-1	no_errors	ENST00000297578	ensembl	human	known	69_37n	missense	59	44.86	48	SNP	0.998	T
SLCO4C1	353189	genome.wustl.edu	37	5	101631639	101631639	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr5:101631639G>A	ENST00000310954.6	-	1	614	c.328C>T	c.(328-330)Cac>Tac	p.H110Y		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		AGGCAGTAGTGAAGCAGAAAG	0.622																																						dbGAP											0													57.0	56.0	56.0					5																	101631639		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.328C>T	5.37:g.101631639G>A	ENSP00000309741:p.His110Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.H110Y	ENST00000310954.6	37	c.328	CCDS34205.1	5	.	.	.	.	.	.	.	.	.	.	G	9.122	1.009324	0.19277	.	.	ENSG00000173930	ENST00000310954	T	0.38077	1.16	4.42	2.64	0.31445	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.437819	0.18993	N	0.125542	T	0.18002	0.0432	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32428	-0.9907	10	0.02654	T	1	.	3.9332	0.09294	0.2939:0.1788:0.5273:0.0	.	110	Q6ZQN7	SO4C1_HUMAN	Y	110	ENSP00000309741:H110Y	ENSP00000309741:H110Y	H	-	1	0	SLCO4C1	101659538	0.156000	0.22821	0.247000	0.24249	0.689000	0.40095	0.702000	0.25631	0.488000	0.27723	0.591000	0.81541	CAC	SLCO4C1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000173930		0.622	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4C1	HGNC	protein_coding	OTTHUMT00000370332.1	81	0.00	0	G	NM_180991		101631639	101631639	-1	no_errors	ENST00000310954	ensembl	human	known	69_37n	missense	48	46.07	41	SNP	0.063	A
SOX5	6660	genome.wustl.edu	37	12	23887621	23887621	+	Silent	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr12:23887621G>A	ENST00000451604.2	-	6	908	c.807C>T	c.(805-807)atC>atT	p.I269I	SOX5_ENST00000537393.1_Silent_p.I234I|SOX5_ENST00000309359.1_Silent_p.I256I|SOX5_ENST00000541536.1_Silent_p.I256I|SOX5_ENST00000381381.2_Silent_p.I256I|SOX5_ENST00000545921.1_Silent_p.I259I|SOX5_ENST00000546136.1_Silent_p.I256I			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	269					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						TTCTGACCTGGATCTGTTGCT	0.313																																						dbGAP											0													135.0	127.0	129.0					12																	23887621		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.807C>T	12.37:g.23887621G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Silent	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.I269	ENST00000451604.2	37	c.807	CCDS8699.1	12																																																																																			SOX5	-	NULL	ENSG00000134532		0.313	SOX5-002	KNOWN	basic|CCDS	protein_coding	SOX5	HGNC	protein_coding	OTTHUMT00000402006.2	275	0.00	0	G	NM_006940		23887621	23887621	-1	no_errors	ENST00000451604	ensembl	human	known	69_37n	silent	106	47.78	97	SNP	1.000	A
SSX2IP	117178	genome.wustl.edu	37	1	85136470	85136470	+	Silent	SNP	T	T	C			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr1:85136470T>C	ENST00000342203.3	-	3	335	c.72A>G	c.(70-72)tcA>tcG	p.S24S	SSX2IP_ENST00000370612.4_Silent_p.S24S|SSX2IP_ENST00000605755.1_5'UTR|SSX2IP_ENST00000603677.1_Intron|SSX2IP_ENST00000437941.2_5'UTR	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	24					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TCTTTGTTTCTGAGGTATATT	0.323																																						dbGAP											0													109.0	123.0	118.0					1																	85136470		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.72A>G	1.37:g.85136470T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Silent	SNP	pfam_Afadin/alpha-actinin-bd	p.S24	ENST00000342203.3	37	c.72	CCDS699.1	1																																																																																			SSX2IP	-	NULL	ENSG00000117155		0.323	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSX2IP	HGNC	protein_coding	OTTHUMT00000027469.1	61	0.00	0	T	NM_014021		85136470	85136470	-1	no_errors	ENST00000342203	ensembl	human	known	69_37n	silent	28	61.64	45	SNP	1.000	C
STX5	6811	genome.wustl.edu	37	11	62595056	62595056	+	Silent	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr11:62595056G>A	ENST00000294179.3	-	3	426	c.273C>T	c.(271-273)cgC>cgT	p.R91R	STX5_ENST00000541317.1_5'UTR|STX5_ENST00000377897.4_Silent_p.R91R|STX5_ENST00000394690.1_Silent_p.R37R	NM_001244666.1|NM_003164.4	NP_001231595.1|NP_003155.2	Q13190	STX5_HUMAN	syntaxin 5	91					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion with Golgi apparatus (GO:0048280)|vesicle targeting (GO:0006903)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|SNARE complex (GO:0031201)	protein N-terminus binding (GO:0047485)|SNAP receptor activity (GO:0005484)			breast(2)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	18						TGAATTCACTGCGTTGTCGGA	0.488																																						dbGAP											0													134.0	120.0	125.0					11																	62595056		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			U26648	CCDS8038.2, CCDS58140.1	11q12.3	2008-02-05	2006-04-25	2006-04-25	ENSG00000162236	ENSG00000162236			11440	protein-coding gene	gene with protein product		603189	"""syntaxin 5A"""	STX5A		9188044, 11959998	Standard	NM_003164		Approved	SED5	uc001nvh.3	Q13190	OTTHUMG00000143864	ENST00000294179.3:c.273C>T	11.37:g.62595056G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8T2|F8W8Q9|Q5U0D4|Q7Z3T6|Q9BUG1	Silent	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.R91	ENST00000294179.3	37	c.273	CCDS8038.2	11																																																																																			STX5	-	pfam_Syntaxin_N,superfamily_t-SNARE	ENSG00000162236		0.488	STX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX5	HGNC	protein_coding	OTTHUMT00000290113.1	116	0.00	0	G	NM_003164		62595056	62595056	-1	no_errors	ENST00000294179	ensembl	human	known	69_37n	silent	107	41.21	75	SNP	1.000	A
TBKBP1	9755	genome.wustl.edu	37	17	45785815	45785815	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr17:45785815G>T	ENST00000361722.3	+	7	1777	c.928G>T	c.(928-930)Gag>Tag	p.E310*		NM_014726.2	NP_055541.1			TBK1 binding protein 1											endometrium(5)|kidney(1)|lung(1)	7						CCGGCTTCGGGAGTTGAGTTC	0.637																																						dbGAP											0													60.0	67.0	65.0					17																	45785815		2004	4158	6162	-	-	-	SO:0001587	stop_gained	0			AB018318	CCDS45722.1	17q21.32	2012-05-17				ENSG00000198933			30140	protein-coding gene	gene with protein product		608476				14743216, 19481056	Standard	NM_014726		Approved	ProSAPiP2, KIAA0775	uc002ilu.3	A7MCY6		ENST00000361722.3:c.928G>T	17.37:g.45785815G>T	ENSP00000354777:p.Glu310*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.E310*	ENST00000361722.3	37	c.928	CCDS45722.1	17	.	.	.	.	.	.	.	.	.	.	G	45	11.389267	0.99555	.	.	ENSG00000198933	ENST00000361722	.	.	.	4.31	4.31	0.51392	.	0.352162	0.25543	N	0.029944	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-6.4004	10.4548	0.44544	0.0977:0.0:0.9023:0.0	.	.	.	.	X	310	.	ENSP00000354777:E310X	E	+	1	0	TBKBP1	43140814	0.999000	0.42202	1.000000	0.80357	0.976000	0.68499	4.372000	0.59530	2.125000	0.65367	0.462000	0.41574	GAG	TBKBP1	-	NULL	ENSG00000198933		0.637	TBKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBKBP1	HGNC	protein_coding	OTTHUMT00000441363.1	158	0.00	0	G	NM_014726		45785815	45785815	+1	no_errors	ENST00000361722	ensembl	human	known	69_37n	nonsense	12	86.32	82	SNP	1.000	T
TBX22	50945	genome.wustl.edu	37	X	79277953	79277953	+	Intron	SNP	G	G	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chrX:79277953G>T	ENST00000373294.5	+	1	203				TBX22_ENST00000476373.1_3'UTR|TBX22_ENST00000373291.1_5'Flank|TBX22_ENST00000442340.1_Intron|TBX22_ENST00000373296.3_Intron	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22						multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						GGTAAGTACTGCCATTGCCCT	0.637																																						dbGAP											0													48.0	36.0	40.0					X																	79277953		2161	4236	6397	-	-	-	SO:0001627	intron_variant	0			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.175+10G>T	X.37:g.79277953G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JZ06|Q96LC0|Q9HBF1	RNA	SNP	-	NULL	ENST00000373294.5	37	NULL	CCDS14445.1	X																																																																																			TBX22	-	-	ENSG00000122145		0.637	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX22	HGNC	protein_coding	OTTHUMT00000057334.1	88	0.00	0	G	NM_016954		79277953	79277953	+1	no_errors	ENST00000476373	ensembl	human	known	69_37n	rna	10	84.85	56	SNP	0.000	T
TRIM48	79097	genome.wustl.edu	37	11	55032759	55032759	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr11:55032759G>A	ENST00000417545.2	+	2	514	c.428G>A	c.(427-429)tGt>tAt	p.C143Y		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	127						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CACAGACACTGTCCCGCTGAG	0.502																																						dbGAP											0													46.0	43.0	44.0					11																	55032759		2188	4251	6439	-	-	-	SO:0001583	missense	0			AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.428G>A	11.37:g.55032759G>A	ENSP00000402414:p.Cys143Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUW4	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.C143Y	ENST00000417545.2	37	c.428	CCDS7947.2	11	.	.	.	.	.	.	.	.	.	.	g	1.632	-0.518665	0.04171	.	.	ENSG00000150244	ENST00000417545	T	0.42900	0.96	0.596	-0.574	0.11738	Zinc finger, B-box (3);	.	.	.	.	T	0.27629	0.0679	L	0.49571	1.57	0.23598	N	0.997321	B	0.10296	0.003	B	0.20184	0.028	T	0.37957	-0.9683	9	0.02654	T	1	.	4.7328	0.12974	0.284:0.0:0.716:0.0	.	127	Q8IWZ4	TRI48_HUMAN	Y	143	ENSP00000402414:C143Y	ENSP00000402414:C143Y	C	+	2	0	TRIM48	54789335	0.001000	0.12720	0.053000	0.19242	0.099000	0.18886	-0.093000	0.11111	-0.213000	0.10094	0.413000	0.27773	TGT	TRIM48	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	ENSG00000150244		0.502	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM48	HGNC	protein_coding	OTTHUMT00000347088.1	95	0.00	0	G			55032759	55032759	+1	no_errors	ENST00000417545	ensembl	human	known	69_37n	missense	87	44.94	71	SNP	0.981	A
TRMT11	60487	genome.wustl.edu	37	6	126333930	126333930	+	Silent	SNP	C	C	T			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr6:126333930C>T	ENST00000334379.5	+	10	1060	c.939C>T	c.(937-939)atC>atT	p.I313I	TRMT11_ENST00000368332.3_Silent_p.I313I	NM_001031712.2	NP_001026882.2	Q7Z4G4	TRM11_HUMAN	tRNA methyltransferase 11 homolog (S. cerevisiae)	313					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)|tRNA binding (GO:0000049)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				GBM - Glioblastoma multiforme(226;0.0356)		CATATGGTATCAGAGAATCTA	0.378																																						dbGAP											0													114.0	113.0	113.0					6																	126333930		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF182423	CCDS35496.1	6q11.1-q22.33	2009-06-15	2006-11-28	2006-11-28	ENSG00000066651	ENSG00000066651			21080	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 75"""	C6orf75			Standard	XM_006715546		Approved	MDS024, dJ187J11.2, TRM11, TRMT11-1	uc003qam.3	Q7Z4G4	OTTHUMG00000015515	ENST00000334379.5:c.939C>T	6.37:g.126333930C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P570|Q5JY11|Q6PGQ5|Q9HC13	Nonsense_Mutation	SNP	pfam_RNA_methylase_dom,pfam_DNA_methylase_A-5,prints_N12N6_MeTrfase	p.Q112*	ENST00000334379.5	37	c.334	CCDS35496.1	6	.	.	.	.	.	.	.	.	.	.	C	9.252	1.041093	0.19669	.	.	ENSG00000066651	ENST00000453993	.	.	.	5.61	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-11.3499	8.2008	0.31424	0.0:0.7552:0.0:0.2448	.	.	.	.	X	112	.	.	Q	+	1	0	TRMT11	126375623	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.266000	0.33039	1.327000	0.45338	0.655000	0.94253	CAG	TRMT11	-	pfam_RNA_methylase_dom,pfam_DNA_methylase_A-5,prints_N12N6_MeTrfase	ENSG00000066651		0.378	TRMT11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRMT11	HGNC	protein_coding		188	0.00	0	C	NM_021820		126333930	126333930	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000453993	ensembl	human	known	69_37n	nonsense	275	22.97	82	SNP	1.000	T
TRPC4	7223	genome.wustl.edu	37	13	38229311	38229311	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr13:38229311T>A	ENST00000379705.3	-	7	2655	c.1798A>T	c.(1798-1800)Atg>Ttg	p.M600L	TRPC4_ENST00000379673.2_Missense_Mutation_p.M600L|TRPC4_ENST00000338947.5_Missense_Mutation_p.M427L|TRPC4_ENST00000447043.1_Missense_Mutation_p.M600L|TRPC4_ENST00000358477.2_Missense_Mutation_p.M600L|TRPC4_ENST00000426868.2_3'UTR|TRPC4_ENST00000379679.1_Missense_Mutation_p.M427L|TRPC4_ENST00000379681.3_Missense_Mutation_p.M600L|TRPC4_ENST00000355779.2_Missense_Mutation_p.M600L			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	600					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		GTCCCAAACATGGTGGCACCA	0.393																																						dbGAP											0													117.0	102.0	107.0					13																	38229311		2203	4299	6502	-	-	-	SO:0001583	missense	0			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1798A>T	13.37:g.38229311T>A	ENSP00000369027:p.Met600Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC4_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.M600L	ENST00000379705.3	37	c.1798	CCDS9365.1	13	.	.	.	.	.	.	.	.	.	.	T	15.46	2.841650	0.51057	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	D;D;D;D;D;D;D;D	0.98164	-4.76;-4.76;-4.76;-4.76;-4.76;-4.76;-4.76;-4.76	5.5	5.5	0.81552	Ion transport (1);	0.067620	0.85682	D	0.000000	D	0.97377	0.9142	N	0.17379	0.485	0.80722	D	1	P;P;P;D;P;D	0.67145	0.664;0.729;0.65;0.996;0.925;0.995	P;B;P;D;P;D	0.81914	0.653;0.444;0.743;0.995;0.897;0.984	D	0.96984	0.9717	10	0.25106	T	0.35	-25.1604	15.6557	0.77133	0.0:0.0:0.0:1.0	.	600;600;600;427;600;600	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	L	600;600;427;427;600;600;600;600	ENSP00000369027:M600L;ENSP00000369003:M600L;ENSP00000342580:M427L;ENSP00000369001:M427L;ENSP00000348025:M600L;ENSP00000351264:M600L;ENSP00000368995:M600L;ENSP00000414316:M600L	ENSP00000342580:M427L	M	-	1	0	TRPC4	37127311	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.694000	0.84235	2.095000	0.63458	0.477000	0.44152	ATG	TRPC4	-	pfam_Ion_trans_dom,tigrfam_TRP_channel	ENSG00000133107		0.393	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4	HGNC	protein_coding	OTTHUMT00000044574.2	107	0.00	0	T	NM_003306		38229311	38229311	-1	no_errors	ENST00000379681	ensembl	human	known	69_37n	missense	9	84.48	49	SNP	1.000	A
TSEN2	80746	genome.wustl.edu	37	3	12558155	12558155	+	Missense_Mutation	SNP	G	G	C	rs531497302		TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr3:12558155G>C	ENST00000284995.6	+	7	1342	c.955G>C	c.(955-957)Gag>Cag	p.E319Q	C3orf83_ENST00000567514.1_Intron|RNU6-377P_ENST00000515965.1_RNA|TSEN2_ENST00000402228.3_Missense_Mutation_p.E319Q|TSEN2_ENST00000314571.7_Missense_Mutation_p.E293Q|TSEN2_ENST00000454502.2_Missense_Mutation_p.E260Q|TSEN2_ENST00000415684.1_Missense_Mutation_p.E293Q|TSEN2_ENST00000444864.1_Missense_Mutation_p.E293Q|TSEN2_ENST00000383797.5_Intron	NM_025265.3	NP_079541.1	Q8NCE0	SEN2_HUMAN	TSEN2 tRNA splicing endonuclease subunit	319					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)	19						TATTTACTATGAGAAGGTAAG	0.323																																						dbGAP											0													145.0	126.0	133.0					3																	12558155		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC019582	CCDS2611.1, CCDS46757.1, CCDS46758.1, CCDS46759.1	3p25.2	2013-08-06	2013-08-06		ENSG00000154743	ENSG00000154743		"""tRNA splicing endonuclease subunits"""	28422	protein-coding gene	gene with protein product		608753	"""tRNA splicing endonuclease 2 homolog (SEN2, S. cerevisiae)"", ""tRNA splicing endonuclease 2 homolog (S. cerevisiae)"""			15109492	Standard	NM_025265		Approved	SEN2, SEN2L, MGC2776	uc003bxb.3	Q8NCE0	OTTHUMG00000129765	ENST00000284995.6:c.955G>C	3.37:g.12558155G>C	ENSP00000284995:p.Glu319Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6K1|C9IZI7|G5E9Q3|Q8WTW7|Q9BPU7	Missense_Mutation	SNP	pfam_tRNA_intron_Endonuc_cat-like,pfam_tRNA_intron_Endonuc_N,superfamily_tRNA_intron_Endonuc_cat-like,pirsf_tRNA_splic_SEN2	p.E319Q	ENST00000284995.6	37	c.955	CCDS2611.1	3	.	.	.	.	.	.	.	.	.	.	G	13.20	2.165352	0.38217	.	.	ENSG00000154743	ENST00000446004;ENST00000314571;ENST00000454502;ENST00000402228;ENST00000284995;ENST00000444864;ENST00000537959;ENST00000415684	T;T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.63	3.84	0.44239	tRNA intron endonuclease, N-terminal (1);	0.653791	0.16931	N	0.193700	T	0.67590	0.2909	L	0.46614	1.455	0.80722	D	1	B;B;B;B	0.30634	0.288;0.031;0.168;0.04	B;B;B;B	0.31016	0.107;0.086;0.075;0.123	T	0.60414	-0.7268	10	0.21540	T	0.41	-15.7309	7.7167	0.28708	0.3049:0.0:0.6951:0.0	.	293;319;293;260	G5E9Q3;Q8NCE0;Q8NCE0-3;C9IZI7	.;SEN2_HUMAN;.;.	Q	319;293;260;319;319;293;292;293	ENSP00000406238:E319Q;ENSP00000323188:E293Q;ENSP00000392029:E260Q;ENSP00000385976:E319Q;ENSP00000284995:E319Q;ENSP00000407974:E293Q;ENSP00000416510:E293Q	ENSP00000284995:E319Q	E	+	1	0	TSEN2	12533155	1.000000	0.71417	0.962000	0.40283	0.960000	0.62799	1.586000	0.36611	1.376000	0.46267	0.563000	0.77884	GAG	TSEN2	-	pfam_tRNA_intron_Endonuc_N,pirsf_tRNA_splic_SEN2	ENSG00000154743		0.323	TSEN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSEN2	HGNC	protein_coding	OTTHUMT00000251981.1	247	0.00	0	G	NM_025265		12558155	12558155	+1	no_errors	ENST00000284995	ensembl	human	known	69_37n	missense	216	32.08	102	SNP	0.997	C
TTK	7272	genome.wustl.edu	37	6	80746293	80746293	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr6:80746293A>G	ENST00000369798.2	+	17	2137	c.2026A>G	c.(2026-2028)Aca>Gca	p.T676A	TTK_ENST00000509894.1_Missense_Mutation_p.T675A|TTK_ENST00000230510.3_Missense_Mutation_p.T675A	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	676	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		ACCAGATACAACAAGTGTTGT	0.338																																						dbGAP											0													126.0	120.0	122.0					6																	80746293		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2026A>G	6.37:g.80746293A>G	ENSP00000358813:p.Thr676Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T676A	ENST00000369798.2	37	c.2026	CCDS4993.1	6	.	.	.	.	.	.	.	.	.	.	A	26.0	4.693688	0.88735	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.64991	-0.13;-0.13;-0.13	6.08	6.08	0.98989	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.086423	0.85682	D	0.000000	T	0.60444	0.2269	N	0.20357	0.565	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.91635	0.999;0.992	T	0.68070	-0.5506	10	0.59425	D	0.04	-22.7234	15.8323	0.78764	1.0:0.0:0.0:0.0	.	676;675	P33981;A8K8U5	TTK_HUMAN;.	A	675;675;676	ENSP00000422936:T675A;ENSP00000230510:T675A;ENSP00000358813:T676A	ENSP00000230510:T675A	T	+	1	0	TTK	80803012	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.962000	0.93254	2.333000	0.79357	0.482000	0.46254	ACA	TTK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000112742		0.338	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTK	HGNC	protein_coding	OTTHUMT00000041316.2	199	0.50	1	A			80746293	80746293	+1	no_errors	ENST00000369798	ensembl	human	known	69_37n	missense	100	41.86	72	SNP	1.000	G
VPS13A	23230	genome.wustl.edu	37	9	79827929	79827929	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr9:79827929G>C	ENST00000360280.3	+	8	860	c.600G>C	c.(598-600)gaG>gaC	p.E200D	VPS13A_ENST00000376634.4_Missense_Mutation_p.E200D|VPS13A_ENST00000376636.3_Missense_Mutation_p.E200D|VPS13A_ENST00000357409.5_Missense_Mutation_p.E200D	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	200					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ATGAAACTGAGAAACTGGTTC	0.333																																						dbGAP											0													173.0	162.0	166.0					9																	79827929		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.600G>C	9.37:g.79827929G>C	ENSP00000353422:p.Glu200Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.E200D	ENST00000360280.3	37	c.600	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	G	11.37	1.619515	0.28801	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.47869	1.0;0.83;0.92;1.0	5.93	2.9	0.33743	.	0.198334	0.42548	D	0.000688	T	0.31670	0.0804	L	0.39397	1.21	0.80722	D	1	P;P;B;B	0.41080	0.726;0.737;0.065;0.065	B;B;B;B	0.39119	0.291;0.22;0.046;0.046	T	0.04991	-1.0913	10	0.19590	T	0.45	.	4.7372	0.12993	0.0856:0.3243:0.4731:0.117	.	200;200;200;200	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	D	200	ENSP00000365821:E200D;ENSP00000365823:E200D;ENSP00000353422:E200D;ENSP00000349985:E200D	ENSP00000349985:E200D	E	+	3	2	VPS13A	79017749	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	1.920000	0.40025	0.810000	0.34279	0.551000	0.68910	GAG	VPS13A	-	NULL	ENSG00000197969		0.333	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	363	0.00	0	G	NM_015186		79827929	79827929	+1	no_errors	ENST00000360280	ensembl	human	known	69_37n	missense	218	41.71	156	SNP	1.000	C
ZNF41	7592	genome.wustl.edu	37	X	47308385	47308385	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chrX:47308385G>C	ENST00000377065.4	-	5	1423	c.784C>G	c.(784-786)Cag>Gag	p.Q262E	ZNF41_ENST00000313116.7_Missense_Mutation_p.Q262E|ZNF41_ENST00000465311.1_5'Flank|ZNF41_ENST00000397050.2_Missense_Mutation_p.Q272E	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	304					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				TGAATTTTCTGATGGTGGGTG	0.418																																						dbGAP											0													195.0	174.0	181.0					X																	47308385		2203	4300	6503	-	-	-	SO:0001583	missense	0			X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.784C>G	X.37:g.47308385G>C	ENSP00000366265:p.Gln262Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q272E	ENST00000377065.4	37	c.814	CCDS14279.1	X	.	.	.	.	.	.	.	.	.	.	G	9.373	1.070991	0.20147	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	T;T;T	0.28895	1.59;1.59;1.59	3.57	3.57	0.40892	.	0.527164	0.14263	N	0.330697	T	0.17280	0.0415	N	0.08118	0	0.19575	N	0.999964	B;B;B;B;B	0.20887	0.007;0.012;0.049;0.012;0.007	B;B;B;B;B	0.17433	0.01;0.01;0.018;0.01;0.004	T	0.14504	-1.0470	10	0.45353	T	0.12	.	12.3357	0.55065	0.0:0.0:1.0:0.0	.	262;264;272;296;304	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	E	262;262;272	ENSP00000315173:Q262E;ENSP00000366265:Q262E;ENSP00000380243:Q272E	ENSP00000315173:Q262E	Q	-	1	0	ZNF41	47193329	.	.	0.036000	0.18154	0.810000	0.45777	.	.	2.059000	0.61396	0.594000	0.82650	CAG	ZNF41	-	NULL	ENSG00000147124		0.418	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF41	HGNC	protein_coding	OTTHUMT00000056429.1	307	0.00	0	G	NM_153380		47308385	47308385	-1	no_errors	ENST00000397050	ensembl	human	known	69_37n	missense	21	86.27	132	SNP	0.772	C
ZNF488	118738	genome.wustl.edu	37	10	48371106	48371106	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr10:48371106C>A	ENST00000395702.2	+	2	801	c.574C>A	c.(574-576)Ctg>Atg	p.L192M	ZNF488_ENST00000586537.1_Missense_Mutation_p.L85M|ZNF488_ENST00000494156.1_3'UTR			Q96MN9	ZN488_HUMAN	zinc finger protein 488	192					negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte development (GO:0014003)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L192M(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|ovary(2)	14						CCTGGGGGAGCTGTCTGGACT	0.537																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											102.0	98.0	99.0					10																	48371106		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056666	CCDS73120.1	10q11.22	2014-04-10			ENSG00000165388	ENSG00000265763		"""Zinc fingers, C2H2-type"""	23535	protein-coding gene	gene with protein product							Standard	NM_153034		Approved	FLJ32104	uc001jex.3	Q96MN9	OTTHUMG00000188322	ENST00000395702.2:c.574C>A	10.37:g.48371106C>A	ENSP00000379054:p.Leu192Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05CE0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L192M	ENST00000395702.2	37	c.574	CCDS7217.1	10	.	.	.	.	.	.	.	.	.	.	C	14.22	2.469075	0.43839	.	.	ENSG00000165388	ENST00000395702	T	0.26518	1.73	5.55	4.51	0.55191	.	0.096997	0.44902	D	0.000401	T	0.41119	0.1145	M	0.63843	1.955	0.23043	N	0.998385	D	0.67145	0.996	P	0.62435	0.902	T	0.24297	-1.0164	10	0.56958	D	0.05	.	8.2082	0.31467	0.0:0.7941:0.0:0.2059	.	192	Q96MN9	ZN488_HUMAN	M	192	ENSP00000379054:L192M	ENSP00000379054:L192M	L	+	1	2	ZNF488	47991112	0.737000	0.28175	0.015000	0.15790	0.588000	0.36517	0.592000	0.23984	1.093000	0.41377	0.561000	0.74099	CTG	ZNF488	-	NULL	ENSG00000165388		0.537	ZNF488-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF488	HGNC	protein_coding	OTTHUMT00000314632.1	97	0.00	0	C	NM_153034		48371106	48371106	+1	no_errors	ENST00000395702	ensembl	human	known	69_37n	missense	52	55.17	64	SNP	0.824	A
ZNF512B	57473	genome.wustl.edu	37	20	62592679	62592679	+	Silent	SNP	G	G	A	rs112150897		TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr20:62592679G>A	ENST00000450537.1	-	16	2470	c.2410C>T	c.(2410-2412)Ctg>Ttg	p.L804L	ZNF512B_ENST00000369888.1_Silent_p.L804L|ZNF512B_ENST00000217130.3_Silent_p.L804L			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	804					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TGGGTCTTCAGGATGTGGTAT	0.642																																						dbGAP											0													93.0	80.0	85.0					20																	62592679		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.2410C>T	20.37:g.62592679G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AK9|Q9ULM4	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L804	ENST00000450537.1	37	c.2410	CCDS13548.1	20																																																																																			ZNF512B	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196700		0.642	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF512B	HGNC	protein_coding	OTTHUMT00000080246.1	78	0.00	0	G	NM_020713		62592679	62592679	-1	no_errors	ENST00000217130	ensembl	human	known	69_37n	silent	9	91.74	111	SNP	1.000	A
ZNF560	147741	genome.wustl.edu	37	19	9577519	9577519	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A13Y-01A-11D-A10Y-09	TCGA-D8-A13Y-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8bb90325-028e-491a-bbaf-2cf4b3b87cd6	527b325c-63e5-4f66-9caf-6081829fbc2a	g.chr19:9577519G>A	ENST00000301480.4	-	10	2317	c.2104C>T	c.(2104-2106)Cgc>Tgc	p.R702C		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	702					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						GTTTTTAAGCGATCATGAAAG	0.378																																						dbGAP											0													131.0	130.0	130.0					19																	9577519		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.2104C>T	19.37:g.9577519G>A	ENSP00000301480:p.Arg702Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495S9|Q495T1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R702C	ENST00000301480.4	37	c.2104	CCDS12214.1	19	.	.	.	.	.	.	.	.	.	.	G	8.502	0.864502	0.17250	.	.	ENSG00000198028	ENST00000301480	T	0.15256	2.44	1.5	0.421	0.16451	.	.	.	.	.	T	0.15565	0.0375	L	0.55213	1.73	0.20307	N	0.999919	B	0.06786	0.001	B	0.04013	0.001	T	0.26815	-1.0092	9	0.72032	D	0.01	.	6.0848	0.19960	0.1867:0.0:0.8133:0.0	.	702	Q96MR9	ZN560_HUMAN	C	702	ENSP00000301480:R702C	ENSP00000301480:R702C	R	-	1	0	ZNF560	9438519	0.004000	0.15560	0.000000	0.03702	0.005000	0.04900	0.453000	0.21811	0.190000	0.20209	-0.448000	0.05591	CGC	ZNF560	-	NULL	ENSG00000198028		0.378	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF560	HGNC	protein_coding	OTTHUMT00000449901.1	87	0.00	0	G	NM_152476		9577519	9577519	-1	no_errors	ENST00000301480	ensembl	human	known	69_37n	missense	14	77.42	48	SNP	0.227	A
