#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A4GALT	53947	genome.wustl.edu	37	22	43089316	43089316	+	Nonsense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr22:43089316G>C	ENST00000401850.1	-	2	1131	c.642C>G	c.(640-642)taC>taG	p.Y214*	A4GALT_ENST00000465765.2_5'Flank|A4GALT_ENST00000249005.2_Nonsense_Mutation_p.Y214*|A4GALT_ENST00000381278.3_Nonsense_Mutation_p.Y214*			Q9NPC4	A4GAT_HUMAN	alpha 1,4-galactosyltransferase	214					globoside biosynthetic process (GO:0001576)|glycosphingolipid biosynthetic process (GO:0006688)|plasma membrane organization (GO:0007009)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	galactosyltransferase activity (GO:0008378)|lactosylceramide 4-alpha-galactosyltransferase activity (GO:0050512)|toxic substance binding (GO:0015643)			NS(1)|central_nervous_system(2)|large_intestine(6)|skin(1)|urinary_tract(1)	11						CGTTGAGGACGTAGCGGGACT	0.612																																						dbGAP											0													47.0	38.0	41.0					22																	43089316		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0				CCDS14041.1	22q13.2	2014-07-18	2008-07-31		ENSG00000128274	ENSG00000128274	2.4.1.228		18149	protein-coding gene	gene with protein product	"""Gb3 synthase"", ""CD77 synthase"", ""globotriaosylceramide synthase"", ""lactosylceramide 4-alpha-galactosyltransferase"""	607922	"""alpha 1,4-galactosyltransferase (globotriaosylceramide synthase, P blood group)"""			10854428	Standard	XM_005261643		Approved	A14GALT, Gb3S, P(k)	uc003bdb.3	Q9NPC4	OTTHUMG00000150744	ENST00000401850.1:c.642C>G	22.37:g.43089316G>C	ENSP00000384794:p.Tyr214*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7C4|Q9P1X5	Nonsense_Mutation	SNP	pfam_A1-4-GlycosylTfrase_dom,pfam_GlycoTrfase_DXD_sugar-bd_CS	p.Y214*	ENST00000401850.1	37	c.642	CCDS14041.1	22	.	.	.	.	.	.	.	.	.	.	G	18.95	3.731381	0.69189	.	.	ENSG00000128274	ENST00000401850;ENST00000249005;ENST00000381278;ENST00000535654	.	.	.	5.29	-5.75	0.02384	.	0.000000	0.52532	D	0.000073	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-12.2403	14.5248	0.67881	0.5812:0.0:0.4188:0.0	.	.	.	.	X	214	.	ENSP00000249005:Y214X	Y	-	3	2	A4GALT	41419260	0.847000	0.29606	0.917000	0.36280	0.672000	0.39443	-0.147000	0.10234	-0.914000	0.03827	-1.036000	0.02392	TAC	A4GALT	-	pfam_GlycoTrfase_DXD_sugar-bd_CS	ENSG00000128274		0.612	A4GALT-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	A4GALT	HGNC	protein_coding	OTTHUMT00000319917.1	16	0.00	0	G	NM_017436		43089316	43089316	-1	no_errors	ENST00000249005	ensembl	human	known	69_37n	nonsense	4	76.47	13	SNP	0.573	C
AIM1	202	genome.wustl.edu	37	6	106967547	106967547	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr6:106967547G>A	ENST00000369066.3	+	2	1727	c.1240G>A	c.(1240-1242)Gac>Aac	p.D414N		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AGAGGCTGCAGACAGCAAAAG	0.483																																						dbGAP											0													87.0	88.0	88.0					6																	106967547		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1240G>A	6.37:g.106967547G>A	ENSP00000358062:p.Asp414Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.D414N	ENST00000369066.3	37	c.1240	CCDS34506.1	6	.	.	.	.	.	.	.	.	.	.	G	9.541	1.113276	0.20795	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.70631	-0.5	5.93	2.86	0.33363	.	0.626367	0.14334	N	0.326125	T	0.24084	0.0583	N	0.11201	0.11	0.20196	N	0.99992	B	0.06786	0.001	B	0.09377	0.004	T	0.16247	-1.0409	10	0.22109	T	0.4	.	5.488	0.16761	0.4085:0.0:0.5915:0.0	.	414	Q9Y4K1	AIM1_HUMAN	N	822;414	ENSP00000358062:D414N	ENSP00000285105:D822N	D	+	1	0	AIM1	107074240	0.003000	0.15002	0.020000	0.16555	0.020000	0.10135	0.330000	0.19715	0.865000	0.35603	0.655000	0.94253	GAC	AIM1	-	NULL	ENSG00000112297		0.483	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	73	0.00	0	G			106967547	106967547	+1	no_errors	ENST00000369066	ensembl	human	known	69_37n	missense	89	21.93	25	SNP	0.005	A
ALG13	79868	genome.wustl.edu	37	X	111003141	111003141	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chrX:111003141C>G	ENST00000394780.3	+	27	3340	c.3328C>G	c.(3328-3330)Caa>Gaa	p.Q1110E	ALG13_ENST00000251943.4_Missense_Mutation_p.Q927E|ALG13_ENST00000470971.1_3'UTR	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	1110					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)			endometrium(2)|lung(10)|skin(1)	13						TGGTTCTTCTCAAATTCATGG	0.493																																						dbGAP											0													99.0	77.0	83.0					X																	111003141		1568	3582	5150	-	-	-	SO:0001583	missense	0			AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.3328C>G	X.37:g.111003141C>G	ENSP00000378260:p.Gln1110Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU,pfscan_Tudor	p.Q927E	ENST00000394780.3	37	c.2779	CCDS55477.1	X	.	.	.	.	.	.	.	.	.	.	C	13.53	2.263324	0.39995	.	.	ENSG00000101901	ENST00000251943;ENST00000394780;ENST00000436609	T;T	0.56103	1.47;0.48	5.81	4.95	0.65309	.	0.859611	0.10486	N	0.669029	T	0.49813	0.1579	L	0.47716	1.5	0.09310	N	1	P;B;P	0.37548	0.571;0.255;0.599	B;B;B	0.37888	0.121;0.026;0.26	T	0.35251	-0.9796	10	0.34782	T	0.22	-0.0444	13.8065	0.63236	0.0:0.9239:0.0:0.0761	.	1032;1110;927	Q9NP73-3;Q9NP73;Q9NP73-4	.;ALG13_HUMAN;.	E	927;1110;664	ENSP00000251943:Q927E;ENSP00000378260:Q1110E	ENSP00000251943:Q927E	Q	+	1	0	ALG13	110889797	0.457000	0.25752	0.012000	0.15200	0.989000	0.77384	3.732000	0.55021	1.219000	0.43474	0.600000	0.82982	CAA	ALG13	-	NULL	ENSG00000101901		0.493	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ALG13	HGNC	protein_coding	OTTHUMT00000272895.1	226	0.00	0	C	NM_018466		111003141	111003141	+1	no_errors	ENST00000251943	ensembl	human	known	69_37n	missense	149	12.87	22	SNP	0.136	G
ANKRD26	22852	genome.wustl.edu	37	10	27324552	27324552	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr10:27324552A>C	ENST00000376087.4	-	24	2992	c.2827T>G	c.(2827-2829)Ttt>Gtt	p.F943V	ANKRD26_ENST00000376070.3_Missense_Mutation_p.F500V|ANKRD26_ENST00000436985.2_Missense_Mutation_p.F959V	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	942					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						AGGTCCTCAAAACATTTCTTT	0.308																																						dbGAP											0													96.0	78.0	84.0					10																	27324552		1811	4074	5885	-	-	-	SO:0001583	missense	0			AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.2827T>G	10.37:g.27324552A>C	ENSP00000365255:p.Phe943Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Polyketide_synth_docking,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.F959V	ENST00000376087.4	37	c.2875	CCDS41499.1	10	.	.	.	.	.	.	.	.	.	.	A	1.638	-0.517206	0.04171	.	.	ENSG00000107890	ENST00000376070;ENST00000376087;ENST00000436985	T;T;T	0.14144	2.53;2.53;2.53	5.64	-0.389	0.12455	.	0.938028	0.08785	N	0.894172	T	0.10680	0.0261	L	0.55103	1.725	0.09310	N	1	B;B;B	0.17667	0.023;0.013;0.011	B;B;B	0.13407	0.002;0.001;0.009	T	0.41556	-0.9502	10	0.30854	T	0.27	.	0.3946	0.00416	0.3057:0.285:0.1363:0.273	.	943;942;959	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	V	500;943;959	ENSP00000365238:F500V;ENSP00000365255:F943V;ENSP00000405112:F959V	ENSP00000365238:F500V	F	-	1	0	ANKRD26	27364558	0.242000	0.23868	0.521000	0.27850	0.981000	0.71138	0.340000	0.19892	0.288000	0.22398	0.482000	0.46254	TTT	ANKRD26	-	NULL	ENSG00000107890		0.308	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD26	HGNC	protein_coding	OTTHUMT00000047296.1	235	0.00	0	A			27324552	27324552	-1	no_errors	ENST00000436985	ensembl	human	known	69_37n	missense	128	27.68	49	SNP	0.012	C
ASB1	51665	genome.wustl.edu	37	2	239353225	239353225	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr2:239353225A>C	ENST00000264607.4	+	4	984	c.737A>C	c.(736-738)cAc>cCc	p.H246P	ASB1_ENST00000409297.1_Missense_Mutation_p.H145P	NM_001040445.1	NP_001035535.1	Q9Y576	ASB1_HUMAN	ankyrin repeat and SOCS box containing 1	246					intracellular signal transduction (GO:0035556)|male genitalia development (GO:0030539)|negative regulation of cytokine biosynthetic process (GO:0042036)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				breast(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		all_epithelial(40;2.65e-14)|Breast(86;7.61e-05)|Renal(207;0.00183)|all_lung(227;0.0283)|Ovarian(221;0.0365)|Lung NSC(271;0.0941)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)		GTTCTGCGCCACGGCTGTGAG	0.577																																						dbGAP											0													72.0	73.0	73.0					2																	239353225		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156777	CCDS33416.1	2q37	2013-01-10	2011-01-25		ENSG00000065802	ENSG00000065802		"""Ankyrin repeat domain containing"""	16011	protein-coding gene	gene with protein product		605758	"""ankyrin repeat and SOCS box-containing 1"""				Standard	XR_241235		Approved	ASB-1	uc002vyg.3	Q9Y576	OTTHUMG00000152866	ENST00000264607.4:c.737A>C	2.37:g.239353225A>C	ENSP00000264607:p.His246Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL50|Q4ZG29|Q9ULS4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.H246P	ENST00000264607.4	37	c.737	CCDS33416.1	2	.	.	.	.	.	.	.	.	.	.	A	20.1	3.933914	0.73442	.	.	ENSG00000065802	ENST00000264607;ENST00000409297	T;T	0.65178	0.67;-0.14	5.91	5.91	0.95273	Ankyrin repeat-containing domain (2);	0.210963	0.49916	D	0.000126	T	0.74419	0.3714	M	0.69358	2.11	0.58432	D	0.999997	D	0.67145	0.996	P	0.59115	0.852	T	0.74833	-0.3530	9	.	.	.	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	246	Q9Y576	ASB1_HUMAN	P	246;145	ENSP00000264607:H246P;ENSP00000387025:H145P	.	H	+	2	0	ASB1	239017964	1.000000	0.71417	0.193000	0.23327	0.966000	0.64601	6.632000	0.74281	2.254000	0.74563	0.533000	0.62120	CAC	ASB1	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000065802		0.577	ASB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB1	HGNC	protein_coding	OTTHUMT00000328294.1	71	0.00	0	A	NM_001040445		239353225	239353225	+1	no_errors	ENST00000264607	ensembl	human	known	69_37n	missense	95	21.31	26	SNP	0.971	C
BLOC1S5	63915	genome.wustl.edu	37	6	8016001	8016001	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr6:8016001T>G	ENST00000397457.2	-	5	482	c.445A>C	c.(445-447)Atg>Ctg	p.M149L	BLOC1S5_ENST00000543936.1_Missense_Mutation_p.M85L|BLOC1S5-TXNDC5_ENST00000439343.2_Intron|EEF1E1-BLOC1S5_ENST00000397456.2_3'UTR|TXNDC5_ENST00000539054.1_Intron|BLOC1S5_ENST00000475998.1_5'UTR	NM_001199323.1|NM_201280.2	NP_001186252.1|NP_958437.1	Q8TDH9	BL1S5_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 5, muted	149					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to melanosome transport (GO:0035646)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|neuron projection development (GO:0031175)|otolith morphogenesis (GO:0032474)|positive regulation of pigment cell differentiation (GO:0050942)	BLOC-1 complex (GO:0031083)|transport vesicle (GO:0030133)											TGCTCCTTCATGAAGTTGTCC	0.428																																						dbGAP											0													183.0	156.0	165.0					6																	8016001		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF426434	CCDS4506.1, CCDS75394.1	6p25.1-p24.3	2012-08-01	2012-08-01	2012-08-01		ENSG00000188428		"""Biogenesis of lysosomal organelles complex-1 subunits"""	18561	protein-coding gene	gene with protein product		607289	"""muted homolog (mouse)"""	MUTED		11912185	Standard	NM_001199322		Approved	MU, dJ303A1.3		Q8TDH9	OTTHUMG00000014220	ENST00000397457.2:c.445A>C	6.37:g.8016001T>G	ENSP00000380598:p.Met149Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVM2|Q0VDJ6|Q0VDJ7|Q5THS1|Q68D56|Q8N5F9|Q9NU16	Missense_Mutation	SNP	pirsf_BLOC-1_complex_muted_subunit	p.M149L	ENST00000397457.2	37	c.445	CCDS4506.1	6	.	.	.	.	.	.	.	.	.	.	T	3.185	-0.167098	0.06461	.	.	ENSG00000188428	ENST00000397457;ENST00000543936	.	.	.	5.6	0.417	0.16421	.	.	.	.	.	T	0.07908	0.0198	N	0.20328	0.56	0.23665	N	0.997169	B;B	0.09022	0.001;0.002	B;B	0.08055	0.003;0.003	T	0.41142	-0.9525	8	0.12430	T	0.62	.	6.9905	0.24753	0.0:0.1291:0.3525:0.5184	.	85;149	Q0VDJ6;Q8TDH9	.;MUTED_HUMAN	L	149;85	.	ENSP00000380598:M149L	M	-	1	0	MUTED	7961000	0.999000	0.42202	0.919000	0.36401	0.406000	0.30931	0.315000	0.19451	0.121000	0.18284	0.528000	0.53228	ATG	BLOC1S5	-	pirsf_BLOC-1_complex_muted_subunit	ENSG00000188428		0.428	BLOC1S5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLOC1S5	HGNC	protein_coding	OTTHUMT00000039797.2	303	0.00	0	T	NM_201280		8016001	8016001	-1	no_errors	ENST00000397457	ensembl	human	known	69_37n	missense	203	21.01	54	SNP	0.999	G
BPIFB3	359710	genome.wustl.edu	37	20	31652642	31652642	+	Silent	SNP	C	C	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr20:31652642C>T	ENST00000375494.3	+	8	915	c.915C>T	c.(913-915)acC>acT	p.T305T		NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	305					innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										TGGACATCACCCCTGAGCTGG	0.597																																						dbGAP											0													45.0	38.0	41.0					20																	31652642		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.915C>T	20.37:g.31652642C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDX7	Silent	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.T305	ENST00000375494.3	37	c.915	CCDS13212.1	20																																																																																			BPIFB3	-	pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_C	ENSG00000186190		0.597	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB3	HGNC	protein_coding	OTTHUMT00000078654.2	32	0.00	0	C	NM_182658		31652642	31652642	+1	no_errors	ENST00000375494	ensembl	human	known	69_37n	silent	46	16.36	9	SNP	0.098	T
BTBD7	55727	genome.wustl.edu	37	14	93709023	93709023	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr14:93709023G>A	ENST00000334746.5	-	11	3302	c.2995C>T	c.(2995-2997)Cct>Tct	p.P999S	BTBD7_ENST00000554565.1_Missense_Mutation_p.P648S|BTBD7_ENST00000393170.2_Missense_Mutation_p.P573S	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	999					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		TGTTTTTTAGGAGACGTCTGA	0.483																																						dbGAP											0													156.0	145.0	148.0					14																	93709023		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.2995C>T	14.37:g.93709023G>A	ENSP00000335615:p.Pro999Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.P999S	ENST00000334746.5	37	c.2995	CCDS32146.1	14	.	.	.	.	.	.	.	.	.	.	G	18.71	3.683159	0.68157	.	.	ENSG00000011114	ENST00000334746;ENST00000554565;ENST00000553975;ENST00000393170	T;T	0.49432	1.12;0.78	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.39200	0.1069	N	0.19112	0.55	0.58432	D	0.999997	B;B;B	0.32324	0.165;0.364;0.038	B;B;B	0.30855	0.121;0.121;0.033	T	0.32214	-0.9915	10	0.87932	D	0	.	20.6086	0.99469	0.0:0.0:1.0:0.0	.	573;648;999	E7ERI4;Q9P203-5;Q9P203	.;.;BTBD7_HUMAN	S	999;648;614;573	ENSP00000335615:P999S;ENSP00000451010:P648S	ENSP00000335615:P999S	P	-	1	0	BTBD7	92778776	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.972000	0.76110	2.880000	0.98712	0.655000	0.94253	CCT	BTBD7	-	NULL	ENSG00000011114		0.483	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD7	HGNC	protein_coding	OTTHUMT00000412701.1	214	0.00	0	G	NM_001002860		93709023	93709023	-1	no_errors	ENST00000334746	ensembl	human	known	69_37n	missense	57	62.50	95	SNP	1.000	A
CACNA2D1	781	genome.wustl.edu	37	7	81589141	81589141	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr7:81589141A>T	ENST00000356253.5	-	37	3262	c.3007T>A	c.(3007-3009)Ttt>Att	p.F1003I	CACNA2D1_ENST00000356860.3_Missense_Mutation_p.F991I|CACNA2D1_ENST00000535308.1_Missense_Mutation_p.F203I			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	1003					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TCTCCATGAAAGATTCTGCAA	0.323																																						dbGAP											0													65.0	60.0	61.0					7																	81589141		2203	4300	6503	-	-	-	SO:0001583	missense	0			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.3007T>A	7.37:g.81589141A>T	ENSP00000348589:p.Phe1003Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	pfam_VDCC_a2/dsu,pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.F1003I	ENST00000356253.5	37	c.3007		7	.	.	.	.	.	.	.	.	.	.	A	13.89	2.371387	0.42003	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000535308	T;T;T	0.73575	-0.76;-0.76;-0.76	5.46	5.46	0.80206	.	0.061430	0.64402	D	0.000002	T	0.76695	0.4023	L	0.42686	1.345	0.36785	D	0.88455	P;B	0.44429	0.835;0.364	P;B	0.50791	0.65;0.192	T	0.82458	-0.0447	10	0.62326	D	0.03	-19.1787	15.5262	0.75910	1.0:0.0:0.0:0.0	.	203;991	B7Z658;P54289-2	.;.	I	991;1010;1003;203	ENSP00000349320:F991I;ENSP00000348589:F1003I;ENSP00000443124:F203I	ENSP00000284088:F1010I	F	-	1	0	CACNA2D1	81427077	1.000000	0.71417	1.000000	0.80357	0.158000	0.22134	8.730000	0.91510	2.067000	0.61834	0.528000	0.53228	TTT	CACNA2D1	-	NULL	ENSG00000153956		0.323	CACNA2D1-201	KNOWN	basic	protein_coding	CACNA2D1	HGNC	protein_coding		98	0.00	0	A			81589141	81589141	-1	no_errors	ENST00000356253	ensembl	human	known	69_37n	missense	72	10.00	8	SNP	1.000	T
CAMSAP2	23271	genome.wustl.edu	37	1	200818901	200818901	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:200818901C>G	ENST00000236925.4	+	12	3086	c.3037C>G	c.(3037-3039)Cct>Gct	p.P1013A	CAMSAP2_ENST00000358823.2_Missense_Mutation_p.P1002A|CAMSAP2_ENST00000413307.2_Missense_Mutation_p.P986A			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	1013					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										GGATAGCCTTCCTCGGTTAAG	0.408																																						dbGAP											0													112.0	116.0	115.0					1																	200818901		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.3037C>G	1.37:g.200818901C>G	ENSP00000236925:p.Pro1013Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrell-like,superfamily_CH-domain	p.P1013A	ENST00000236925.4	37	c.3037		1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.607935	0.66558	.	.	ENSG00000118200	ENST00000358823;ENST00000413307;ENST00000236925	T;T;T	0.36157	1.31;1.27;1.32	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.62768	0.2455	M	0.73217	2.22	0.80722	D	1	D;D;D	0.89917	0.999;0.973;1.0	D;P;D	0.97110	0.991;0.845;1.0	T	0.60505	-0.7250	10	0.52906	T	0.07	-23.5126	20.3214	0.98679	0.0:1.0:0.0:0.0	.	986;1013;1002	Q08AD1-2;Q08AD1;Q08AD1-3	.;CAMP2_HUMAN;.	A	1002;986;1013	ENSP00000351684:P1002A;ENSP00000416800:P986A;ENSP00000236925:P1013A	ENSP00000236925:P1013A	P	+	1	0	CAMSAP1L1	199085524	1.000000	0.71417	0.986000	0.45419	0.975000	0.68041	5.896000	0.69822	2.804000	0.96469	0.655000	0.94253	CCT	CAMSAP2	-	NULL	ENSG00000118200		0.408	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CAMSAP2	HGNC	protein_coding	OTTHUMT00000086956.2	170	0.00	0	C	NM_203459		200818901	200818901	+1	no_errors	ENST00000236925	ensembl	human	known	69_37n	missense	85	51.43	90	SNP	1.000	G
CAPS2	84698	genome.wustl.edu	37	12	75716789	75716789	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr12:75716789G>C	ENST00000409445.3	-	5	509	c.313C>G	c.(313-315)Caa>Gaa	p.Q105E	CAPS2_ENST00000442339.2_Intron|CAPS2_ENST00000393284.3_5'UTR|CAPS2_ENST00000409799.1_Intron	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	105							calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						TATGGAGTTTGACATGGTGTG	0.279																																						dbGAP											0													35.0	32.0	33.0					12																	75716789		692	1588	2280	-	-	-	SO:0001583	missense	0			AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.313C>G	12.37:g.75716789G>C	ENSP00000386959:p.Gln105Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PH84|Q8N242|Q8NAY5	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.Q105E	ENST00000409445.3	37	c.313	CCDS9008.2	12	.	.	.	.	.	.	.	.	.	.	G	1.833	-0.469321	0.04445	.	.	ENSG00000180881	ENST00000409445	T	0.52295	0.67	4.75	3.84	0.44239	.	0.547761	0.16749	N	0.201098	T	0.30355	0.0762	N	0.17082	0.46	0.30013	N	0.814961	B	0.11235	0.004	B	0.06405	0.002	T	0.16988	-1.0384	10	0.20046	T	0.44	-6.2122	12.1025	0.53792	0.0:0.0:0.8267:0.1733	.	105	Q9BXY5	CAYP2_HUMAN	E	105	ENSP00000386959:Q105E	ENSP00000386959:Q105E	Q	-	1	0	CAPS2	74003056	0.931000	0.31567	0.009000	0.14445	0.008000	0.06430	1.264000	0.33015	1.315000	0.45114	0.561000	0.74099	CAA	CAPS2	-	NULL	ENSG00000180881		0.279	CAPS2-001	KNOWN	basic|CCDS	protein_coding	CAPS2	HGNC	protein_coding	OTTHUMT00000327880.2	43	0.00	0	G			75716789	75716789	-1	no_errors	ENST00000409445	ensembl	human	known	69_37n	missense	12	42.86	9	SNP	0.039	C
CCDC150	284992	genome.wustl.edu	37	2	197541323	197541323	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr2:197541323G>C	ENST00000389175.4	+	12	1443	c.1308G>C	c.(1306-1308)caG>caC	p.Q436H	CCDC150_ENST00000472405.2_3'UTR|CCDC150_ENST00000423093.2_Missense_Mutation_p.Q104H|CCDC150_ENST00000272831.7_Missense_Mutation_p.Q104H	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	436										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						AGAAAGCACAGGATGCTGAAA	0.393																																						dbGAP											0													75.0	71.0	72.0					2																	197541323		1860	4109	5969	-	-	-	SO:0001583	missense	0				CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.1308G>C	2.37:g.197541323G>C	ENSP00000373827:p.Gln436His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P5U6|Q6P663|Q8N8V5	Missense_Mutation	SNP	NULL	p.Q436H	ENST00000389175.4	37	c.1308	CCDS46478.1	2	.	.	.	.	.	.	.	.	.	.	G	10.36	1.329276	0.24167	.	.	ENSG00000144395	ENST00000272831;ENST00000389175;ENST00000423093	T	0.47528	0.84	5.22	4.34	0.51931	.	0.507607	0.18036	N	0.153773	T	0.50990	0.1648	L	0.54323	1.7	0.33624	D	0.605227	P;P	0.36249	0.545;0.545	P;P	0.45138	0.471;0.471	T	0.64706	-0.6344	10	0.51188	T	0.08	-0.6143	11.1181	0.48273	0.0864:0.0:0.9136:0.0	.	104;436	B4DZ03;Q8NCX0	.;CC150_HUMAN	H	104;436;104	ENSP00000373827:Q436H	ENSP00000272831:Q104H	Q	+	3	2	CCDC150	197249568	0.006000	0.16342	0.949000	0.38748	0.287000	0.27160	0.320000	0.19540	1.442000	0.47568	0.563000	0.77884	CAG	CCDC150	-	NULL	ENSG00000144395		0.393	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC150	HGNC	protein_coding	OTTHUMT00000335377.2	115	0.00	0	G	NM_001080539		197541323	197541323	+1	no_errors	ENST00000389175	ensembl	human	known	69_37n	missense	108	11.48	14	SNP	0.989	C
CD163L1	283316	genome.wustl.edu	37	12	7527924	7527924	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr12:7527924C>G	ENST00000313599.3	-	11	3011	c.2954G>C	c.(2953-2955)gGa>gCa	p.G985A	CD163L1_ENST00000396630.1_Missense_Mutation_p.G985A|CD163L1_ENST00000544331.1_5'Flank|CD163L1_ENST00000416109.2_Missense_Mutation_p.G995A			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	985	SRCR 9. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						GGGAGGTGCTCCAAGAACTGT	0.423																																						dbGAP											0													91.0	79.0	83.0					12																	7527924		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2954G>C	12.37:g.7527924C>G	ENSP00000315945:p.Gly985Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Srcr_rcpt	p.G985A	ENST00000313599.3	37	c.2954	CCDS8577.1	12	.	.	.	.	.	.	.	.	.	.	C	16.95	3.263351	0.59431	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.35973	1.28;1.28;1.28	2.29	2.29	0.28610	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.000000	0.49916	U	0.000138	T	0.60856	0.2301	M	0.89601	3.045	0.22835	N	0.998676	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.52756	-0.8533	10	0.26408	T	0.33	.	10.6356	0.45563	0.0:1.0:0.0:0.0	.	995;985	E7EVK4;Q9NR16	.;C163B_HUMAN	A	985;995;985	ENSP00000315945:G985A;ENSP00000393474:G995A;ENSP00000379871:G985A	ENSP00000315945:G985A	G	-	2	0	CD163L1	7419191	0.936000	0.31750	0.012000	0.15200	0.821000	0.46438	3.478000	0.53158	1.577000	0.49804	0.455000	0.32223	GGA	CD163L1	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000177675		0.423	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	HGNC	protein_coding	OTTHUMT00000399329.1	53	0.00	0	C	NM_174941		7527924	7527924	-1	no_errors	ENST00000313599	ensembl	human	known	69_37n	missense	70	20.45	18	SNP	0.591	G
CIC	23152	genome.wustl.edu	37	19	42794664	42794664	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr19:42794664G>C	ENST00000575354.2	+	10	1784	c.1744G>C	c.(1744-1746)Gcg>Ccg	p.A582P	CIC_ENST00000572681.2_Missense_Mutation_p.A1491P|CIC_ENST00000160740.3_Missense_Mutation_p.A582P	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	582	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				TGGGGGTCCAGCGACACCTTC	0.677			"""Mis, F, S"""		oligodendroglioma																																	dbGAP		Rec	yes		19	19q13.2	23152	capicua homolog		O	0													35.0	42.0	40.0					19																	42794664		2202	4297	6499	-	-	-	SO:0001583	missense	0			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.1744G>C	19.37:g.42794664G>C	ENSP00000458663:p.Ala582Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.A582P	ENST00000575354.2	37	c.1744	CCDS12601.1	19	.	.	.	.	.	.	.	.	.	.	G	10.61	1.398373	0.25205	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.98	-1.93	0.07594	.	.	.	.	.	T	0.10852	0.0265	N	0.08118	0	0.09310	N	1	B	0.32693	0.38	B	0.23018	0.043	T	0.19451	-1.0305	8	0.87932	D	0	0.1603	1.6744	0.02818	0.171:0.1344:0.4203:0.2744	.	582	Q96RK0	CIC_HUMAN	P	582	.	ENSP00000160740:A582P	A	+	1	0	CIC	47486504	0.009000	0.17119	0.039000	0.18376	0.569000	0.35902	0.072000	0.14617	-0.044000	0.13491	0.491000	0.48974	GCG	CIC	-	NULL	ENSG00000079432		0.677	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIC	HGNC	protein_coding	OTTHUMT00000438532.2	44	0.00	0	G			42794664	42794664	+1	no_errors	ENST00000160740	ensembl	human	known	69_37n	missense	78	21.21	21	SNP	0.029	C
CKLF	51192	genome.wustl.edu	37	16	66592170	66592170	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr16:66592170A>T	ENST00000264001.4	+	2	305	c.156A>T	c.(154-156)gaA>gaT	p.E52D	CKLF_ENST00000345436.4_Missense_Mutation_p.E52D|CKLF_ENST00000417030.2_Missense_Mutation_p.E52D|CKLF-CMTM1_ENST00000532838.1_Intron|CKLF_ENST00000563092.1_Intron|CKLF_ENST00000351137.4_Intron|CKLF_ENST00000362093.4_Intron|CKLF-CMTM1_ENST00000527729.1_Intron	NM_016951.3	NP_058647.1	Q9UBR5	CKLF_HUMAN	chemokine-like factor	52	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell proliferation (GO:0008283)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|neutrophil chemotaxis (GO:0030593)|secretion by cell (GO:0032940)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chemokine activity (GO:0008009)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|upper_aerodigestive_tract(1)	5		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0689)|Epithelial(162;0.217)		CTGGATTTGAAGTCACCGTTA	0.353																																						dbGAP											0													216.0	219.0	218.0					16																	66592170		2201	4300	6501	-	-	-	SO:0001583	missense	0			AF096895	CCDS10806.1, CCDS10807.1, CCDS10808.1, CCDS10809.1, CCDS45502.1	16q22.1-q22.3	2008-02-05	2003-02-28	2003-03-07	ENSG00000217555	ENSG00000217555			13253	protein-coding gene	gene with protein product			"""chemokine-like factor 1"""	CKLF1		11042152, 11415443	Standard	NM_016326		Approved	UCK-1, CKLF3, CKLF4, HSPC224, C32		Q9UBR5	OTTHUMG00000137504	ENST00000264001.4:c.156A>T	16.37:g.66592170A>T	ENSP00000264001:p.Glu52Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JE38|Q9UHM7|Q9UHN8|Q9UI41	Missense_Mutation	SNP	NULL	p.E52D	ENST00000264001.4	37	c.156	CCDS10807.1	16	.	.	.	.	.	.	.	.	.	.	A	21.7	4.182087	0.78677	.	.	ENSG00000217555	ENST00000264001;ENST00000345436;ENST00000361141;ENST00000417030	T;T	0.58652	0.32;0.35	5.05	3.93	0.45458	Marvel (1);	.	.	.	.	T	0.69070	0.3070	M	0.73217	2.22	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.994;0.994	T	0.68872	-0.5294	9	0.45353	T	0.12	0.6988	6.026	0.19656	0.8833:0.0:0.1167:0.0	.	52;52;52	Q9UBR5-5;Q9UBR5;Q9UBR5-4	.;CKLF_HUMAN;.	D	52	ENSP00000264001:E52D;ENSP00000416678:E52D	ENSP00000264001:E52D	E	+	3	2	CKLF	65149671	1.000000	0.71417	0.998000	0.56505	0.792000	0.44763	2.598000	0.46223	2.114000	0.64651	0.528000	0.53228	GAA	CKLF	-	NULL	ENSG00000217555		0.353	CKLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKLF	HGNC	protein_coding	OTTHUMT00000268816.2	312	0.00	0	A	NM_016326		66592170	66592170	+1	no_errors	ENST00000264001	ensembl	human	known	69_37n	missense	124	50.20	125	SNP	0.997	T
CNTNAP2	26047	genome.wustl.edu	37	7	147675016	147675016	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr7:147675016G>C	ENST00000361727.3	+	15	2834	c.2318G>C	c.(2317-2319)gGa>gCa	p.G773A		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	773	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GTGGTGGTTGGAGATACTGAC	0.493										HNSCC(39;0.1)																												dbGAP											0													141.0	124.0	130.0					7																	147675016		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.2318G>C	7.37:g.147675016G>C	ENSP00000354778:p.Gly773Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EGF-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.G773A	ENST00000361727.3	37	c.2318	CCDS5889.1	7	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346039	0.61073	.	.	ENSG00000174469	ENST00000361727;ENST00000455301	T;T	0.35048	1.33;1.33	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.57917	0.2086	M	0.94063	3.49	0.80722	D	1	P	0.48294	0.908	P	0.50490	0.642	T	0.65853	-0.6067	10	0.08381	T	0.77	.	17.7394	0.88403	0.0:0.0:1.0:0.0	.	773	Q9UHC6	CNTP2_HUMAN	A	773;164	ENSP00000354778:G773A;ENSP00000392208:G164A	ENSP00000354778:G773A	G	+	2	0	CNTNAP2	147305949	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.299000	0.78831	2.530000	0.85305	0.655000	0.94253	GGA	CNTNAP2	-	NULL	ENSG00000174469		0.493	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	184	0.00	0	G			147675016	147675016	+1	no_errors	ENST00000361727	ensembl	human	known	69_37n	missense	155	22.00	44	SNP	1.000	C
COPS2	9318	genome.wustl.edu	37	15	49420938	49420938	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr15:49420938G>A	ENST00000388901.5	-	12	1221	c.1148C>T	c.(1147-1149)gCt>gTt	p.A383V	COPS2_ENST00000542928.1_Missense_Mutation_p.A319V|COPS2_ENST00000299259.6_Missense_Mutation_p.A390V	NM_001143887.1|NM_004236.3	NP_001137359.1|NP_004227.1	P61201	CSN2_HUMAN	COP9 signalosome subunit 2	383	PCI.				cell proliferation (GO:0008283)|cullin deneddylation (GO:0010388)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(2)	18		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)		CTCCACATCAGCTACATCTAT	0.284																																					NSCLC(36;322 1063 10349 30082 48062)|Esophageal Squamous(122;685 1633 15569 21293 52803)	dbGAP											0													110.0	117.0	115.0					15																	49420938		2196	4291	6487	-	-	-	SO:0001583	missense	0			AF212227	CCDS32235.1, CCDS45257.1	15q21.2	2013-03-14	2013-03-14						30747	protein-coding gene	gene with protein product		604508	"""COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)"""			7776974, 9535219	Standard	NM_004236		Approved	TRIP15, ALIEN, CSN2	uc001zxh.3	P61201		ENST00000388901.5:c.1148C>T	15.37:g.49420938G>A	ENSP00000373553:p.Ala383Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O88950|Q15647|Q6FGP4|Q9BY54|Q9R249|Q9UNI2|Q9UNQ5	Missense_Mutation	SNP	pfam_PCI_dom,pfam_COP9_signalosome_subunit_CSN8,smart_PAM,smart_PCI_dom	p.A390V	ENST00000388901.5	37	c.1169	CCDS32235.1	15	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378754	0.42207	.	.	ENSG00000166200	ENST00000299259;ENST00000388901;ENST00000542928	T;T;T	0.30981	1.51;1.51;1.51	5.17	5.17	0.71159	Winged helix-turn-helix transcription repressor DNA-binding (1);Proteasome component (PCI) domain (2);	0.099830	0.64402	D	0.000003	T	0.30355	0.0762	L	0.44542	1.39	0.54753	D	0.999989	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.12837	0.008;0.008;0.008	T	0.04053	-1.0981	10	0.31617	T	0.26	-21.7388	18.6726	0.91517	0.0:0.0:1.0:0.0	.	319;391;383	B4DIH5;Q59EL2;P61201	.;.;CSN2_HUMAN	V	390;383;319	ENSP00000299259:A390V;ENSP00000373553:A383V;ENSP00000443664:A319V	ENSP00000299259:A390V	A	-	2	0	COPS2	47208230	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.116000	0.57871	2.420000	0.82092	0.563000	0.77884	GCT	COPS2	-	pfam_PCI_dom,pfam_COP9_signalosome_subunit_CSN8,smart_PCI_dom	ENSG00000166200		0.284	COPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS2	HGNC	protein_coding	OTTHUMT00000417840.1	112	0.00	0	G	NM_004236		49420938	49420938	-1	no_errors	ENST00000299259	ensembl	human	known	69_37n	missense	50	28.57	20	SNP	1.000	A
CPT1B	1375	genome.wustl.edu	37	22	51007768	51007768	+	Silent	SNP	C	C	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr22:51007768C>T	ENST00000360719.2	-	19	2455	c.2318G>A	c.(2317-2319)tGa>tAa	p.*773*	CPT1B_ENST00000440709.1_Silent_p.*692*|CPT1B_ENST00000312108.7_Silent_p.*773*|CPT1B_ENST00000457250.1_Silent_p.*739*|CPT1B_ENST00000405237.3_Silent_p.*773*|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000434492.2_Silent_p.*568*|CPT1B_ENST00000395650.2_Silent_p.*773*	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	0					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		CTCCAACCTTCAGCTGTAGGC	0.582																																					Esophageal Squamous(170;988 1933 25577 30295 48163)	dbGAP											0													126.0	120.0	122.0					22																	51007768		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.2318G>A	22.37:g.51007768C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Silent	SNP	pfam_Carn_acyl_trans	p.*773	ENST00000360719.2	37	c.2318	CCDS14098.1	22																																																																																			CPT1B	-	NULL	ENSG00000205560		0.582	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT1B	HGNC	protein_coding	OTTHUMT00000317264.5	109	0.00	0	C	NM_152246		51007768	51007768	-1	no_errors	ENST00000312108	ensembl	human	known	69_37n	silent	86	19.63	21	SNP	0.996	T
CRLS1	54675	genome.wustl.edu	37	20	6011956	6011956	+	Silent	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr20:6011956G>A	ENST00000378863.4	+	4	757	c.600G>A	c.(598-600)tcG>tcA	p.S200S	CRLS1_ENST00000452938.1_Intron|CRLS1_ENST00000378868.4_Silent_p.S101S|CRLS1_ENST00000464921.1_3'UTR	NM_019095.4	NP_061968.1	Q9UJA2	CRLS1_HUMAN	cardiolipin synthase 1	200					cardiolipin biosynthetic process (GO:0032049)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			lung(3)|ovary(1)	4						TGATCATTTCGAGAGATGTAA	0.303																																						dbGAP											0													165.0	144.0	151.0					20																	6011956		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF241784	CCDS13096.1, CCDS46578.1	20p13-p12.3	2006-04-04	2006-04-04	2006-04-04	ENSG00000088766	ENSG00000088766			16148	protein-coding gene	gene with protein product	"""GCD10 homolog (S. cerevisiae)"""	608188	"""chromosome 20 open reading frame 155"""	C20orf155		16547353	Standard	NM_019095		Approved	dJ967N21.6, CLS1, GCD10	uc002wmn.4	Q9UJA2	OTTHUMG00000031823	ENST00000378863.4:c.600G>A	20.37:g.6011956G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW09|E9PAT4|Q27RP0|Q69YQ5	Silent	SNP	pfam_CDP-OH_P_trans	p.S200	ENST00000378863.4	37	c.600	CCDS13096.1	20																																																																																			CRLS1	-	NULL	ENSG00000088766		0.303	CRLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRLS1	HGNC	protein_coding	OTTHUMT00000077902.2	377	0.00	0	G	NM_019095		6011956	6011956	+1	no_errors	ENST00000378863	ensembl	human	known	69_37n	silent	300	17.76	65	SNP	1.000	A
CSMD2	114784	genome.wustl.edu	37	1	34076840	34076840	+	Silent	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:34076840G>A	ENST00000373380.1	-	20	2983	c.2763C>T	c.(2761-2763)atC>atT	p.I921I	CSMD2_ENST00000373381.4_Silent_p.I2048I|CSMD2_ENST00000373388.2_Silent_p.I147I|CSMD2_ENST00000373377.1_Silent_p.I147I			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2008	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TCAGGAACTGGATGTGAGCTC	0.557																																						dbGAP											0													79.0	83.0	82.0					1																	34076840		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.2763C>T	1.37:g.34076840G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.I2048	ENST00000373380.1	37	c.6144		1																																																																																			CSMD2	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000121904		0.557	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000030635.4	138	0.00	0	G	NM_052896		34076840	34076840	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	silent	105	22.22	30	SNP	0.997	A
CSMD3	114788	genome.wustl.edu	37	8	113960102	113960103	+	In_Frame_Ins	INS	-	-	TTT			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr8:113960102_113960103insTTT	ENST00000297405.5	-	9	1668_1669	c.1424_1425insAAA	c.(1423-1425)aat>aaAAAt	p.474_475insK	CSMD3_ENST00000455883.2_In_Frame_Ins_p.370_371insK|CSMD3_ENST00000343508.3_In_Frame_Ins_p.434_435insK|CSMD3_ENST00000352409.3_In_Frame_Ins_p.474_475insK	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	474						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TACCTCCCTCATTTACTGCAAC	0.282										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.1422_1424dupAAA	8.37:g.113960103_113960105dupTTT	ENSP00000297405:p.Leu474_Asn475insLys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	In_Frame_Ins	INS	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.475in_frame_insK	ENST00000297405.5	37	c.1425_1424	CCDS6315.1	8																																																																																			CSMD3	-	NULL	ENSG00000164796		0.282	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	258	0.00	0	-	NM_052900		113960102	113960103	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	in_frame_ins	143	11.73	19	INS	1.000:1.000	TTT
DDR2	4921	genome.wustl.edu	37	1	162745606	162745606	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:162745606C>A	ENST00000367922.3	+	16	2459	c.2021C>A	c.(2020-2022)tCt>tAt	p.S674Y	RN7SL861P_ENST00000473793.2_RNA|DDR2_ENST00000367921.3_Missense_Mutation_p.S674Y	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	674	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	CCCCCTAATTCTTCCTCCAGC	0.483																																					NSCLC(161;314 2006 8283 19651 23192)	dbGAP											0													122.0	122.0	122.0					1																	162745606		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.2021C>A	1.37:g.162745606C>A	ENSP00000356899:p.Ser674Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z730	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S674Y	ENST00000367922.3	37	c.2021	CCDS1241.1	1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042650	0.55003	.	.	ENSG00000162733	ENST00000367922;ENST00000367921	D;D	0.89196	-2.48;-2.48	5.5	3.63	0.41609	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.663946	0.16021	N	0.233305	T	0.77948	0.4207	L	0.45581	1.43	0.34181	D	0.670880	B	0.20671	0.047	B	0.29440	0.102	T	0.74688	-0.3581	9	0.62326	D	0.03	.	8.6013	0.33747	0.0:0.8241:0.0:0.1759	.	674	Q16832	DDR2_HUMAN	Y	674	ENSP00000356899:S674Y;ENSP00000356898:S674Y	ENSP00000356898:S674Y	S	+	2	0	DDR2	161012230	0.002000	0.14202	0.004000	0.12327	0.389000	0.30415	1.801000	0.38843	1.301000	0.44836	0.655000	0.94253	TCT	DDR2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000162733		0.483	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDR2	HGNC	protein_coding	OTTHUMT00000083213.2	117	0.00	0	C	NM_006182		162745606	162745606	+1	no_errors	ENST00000367921	ensembl	human	known	69_37n	missense	125	29.78	53	SNP	0.285	A
DEFB1	1672	genome.wustl.edu	37	8	6735372	6735372	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr8:6735372G>T	ENST00000297439.3	-	1	172	c.8C>A	c.(7-9)aCt>aAt	p.T3N		NM_005218.3	NP_005209.1	P60022	DEFB1_HUMAN	defensin, beta 1	3					acute inflammatory response (GO:0002526)|antibacterial humoral response (GO:0019731)|chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|response to bacterium (GO:0009617)|response to testosterone (GO:0033574)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(1)	1			STAD - Stomach adenocarcinoma(24;0.0984)	COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.128)		AAGGTAGGAAGTTCTCATGGC	0.562																																					Pancreas(35;916 948 9612 33610 36642)	dbGAP											0													103.0	89.0	94.0					8																	6735372		2203	4300	6503	-	-	-	SO:0001583	missense	0			X92744	CCDS5959.1	8p23.1	2012-03-27			ENSG00000164825	ENSG00000164825		"""Defensins, beta"""	2766	protein-coding gene	gene with protein product		602056				7628632	Standard	NM_005218		Approved	HBD-1, DEFB-1, DEFB101, HBD1, BD1, MGC51822	uc003wqs.2	P60022	OTTHUMG00000090367	ENST00000297439.3:c.8C>A	8.37:g.6735372G>T	ENSP00000297439:p.Thr3Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q09753	Missense_Mutation	SNP	pfam_Defensin_beta-typ	p.T3N	ENST00000297439.3	37	c.8	CCDS5959.1	8	.	.	.	.	.	.	.	.	.	.	G	14.65	2.597888	0.46318	.	.	ENSG00000164825	ENST00000297439	T	0.27256	1.68	4.02	-3.09	0.05331	.	3.711220	0.01244	N	0.008705	T	0.18341	0.0440	.	.	.	0.09310	N	1	P	0.50617	0.937	B	0.35413	0.202	T	0.48969	-0.8987	9	0.87932	D	0	-1.2831	10.3142	0.43727	0.2336:0.0:0.7664:0.0	.	3	P60022	DEFB1_HUMAN	N	3	ENSP00000297439:T3N	ENSP00000297439:T3N	T	-	2	0	DEFB1	6722782	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.148000	0.03185	-0.458000	0.07023	0.655000	0.94253	ACT	DEFB1	-	NULL	ENSG00000164825		0.562	DEFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB1	HGNC	protein_coding	OTTHUMT00000251292.1	105	0.00	0	G	NM_005218		6735372	6735372	-1	no_errors	ENST00000297439	ensembl	human	known	69_37n	missense	119	13.14	18	SNP	0.000	T
DMGDH	29958	genome.wustl.edu	37	5	78328517	78328517	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr5:78328517G>A	ENST00000255189.3	-	9	1538	c.1510C>T	c.(1510-1512)Cag>Tag	p.Q504*	DMGDH_ENST00000380311.4_Nonsense_Mutation_p.Q303*|DMGDH_ENST00000540686.1_Nonsense_Mutation_p.Q124*	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	504					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		CACCTGTACTGAGTGTCCTGG	0.542																																						dbGAP											0													136.0	136.0	136.0					5																	78328517		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.1510C>T	5.37:g.78328517G>A	ENSP00000255189:p.Gln504*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBN0|B4E1J9	Nonsense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_SoxG	p.Q504*	ENST00000255189.3	37	c.1510	CCDS4044.1	5	.	.	.	.	.	.	.	.	.	.	G	15.79	2.936541	0.52972	.	.	ENSG00000132837	ENST00000255189;ENST00000523732;ENST00000380311;ENST00000540686;ENST00000539598	.	.	.	5.59	0.197	0.15164	.	0.448197	0.27117	N	0.020844	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	22.0116	0.99965	0.0:0.8233:0.1766:0.0	.	.	.	.	X	504;343;303;124;354	.	ENSP00000255189:Q504X	Q	-	1	0	DMGDH	78364273	1.000000	0.71417	0.515000	0.27774	0.033000	0.12548	2.471000	0.45127	0.013000	0.14918	0.655000	0.94253	CAG	DMGDH	-	NULL	ENSG00000132837		0.542	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMGDH	HGNC	protein_coding	OTTHUMT00000226963.3	35	0.00	0	G	NM_013391		78328517	78328517	-1	no_errors	ENST00000255189	ensembl	human	known	69_37n	nonsense	22	15.38	4	SNP	1.000	A
DNAH7	56171	genome.wustl.edu	37	2	196912145	196912145	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr2:196912145G>C	ENST00000312428.6	-	5	429	c.329C>G	c.(328-330)tCc>tGc	p.S110C	DNAH7_ENST00000410072.1_Missense_Mutation_p.S110C	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	110	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CTTTGATTTGGAAGTAGATGG	0.328																																						dbGAP											0													185.0	183.0	184.0					2																	196912145		1842	4080	5922	-	-	-	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.329C>G	2.37:g.196912145G>C	ENSP00000311273:p.Ser110Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.S110C	ENST00000312428.6	37	c.329	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	G	4.646	0.120045	0.08881	.	.	ENSG00000118997	ENST00000312428;ENST00000410072;ENST00000312446;ENST00000427816	T;T	0.24151	1.87;2.78	5.2	1.34	0.21922	.	0.536026	0.17964	N	0.156089	T	0.15825	0.0381	L	0.36672	1.1	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.21930	-1.0231	10	0.56958	D	0.05	.	2.0375	0.03543	0.1726:0.1562:0.5097:0.1615	.	110	Q8WXX0	DYH7_HUMAN	C	110;110;110;85	ENSP00000311273:S110C;ENSP00000386260:S110C	ENSP00000311273:S110C	S	-	2	0	DNAH7	196620390	0.997000	0.39634	0.142000	0.22268	0.092000	0.18411	1.506000	0.35747	0.062000	0.16340	-0.229000	0.12294	TCC	DNAH7	-	NULL	ENSG00000118997		0.328	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	244	0.00	0	G	NM_018897		196912145	196912145	-1	no_errors	ENST00000312428	ensembl	human	known	69_37n	missense	125	59.94	187	SNP	0.180	C
DOC2A	8448	genome.wustl.edu	37	16	30018135	30018135	+	Silent	SNP	G	G	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr16:30018135G>T	ENST00000350119.4	-	8	1039	c.849C>A	c.(847-849)gtC>gtA	p.V283V	DOC2A_ENST00000564979.1_Silent_p.V283V|DOC2A_ENST00000564944.1_Silent_p.V283V	NM_001282062.1|NM_001282063.1|NM_001282068.1|NM_003586.2	NP_001268991.1|NP_001268992.1|NP_001268997.1|NP_003577.2	Q14183	DOC2A_HUMAN	double C2-like domains, alpha	283	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Interaction with UNC13D.				nervous system development (GO:0007399)|regulation of calcium ion-dependent exocytosis (GO:0017158)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|lysosome (GO:0005764)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)	9						AGTAACCGTTGACGTCCATGG	0.662																																						dbGAP											0													56.0	61.0	59.0					16																	30018135		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			D31897	CCDS10666.1	16p11.2	2014-07-02			ENSG00000149927	ENSG00000149927		"""Synaptotagmins"""	2985	protein-coding gene	gene with protein product		604567				7826360, 9736751	Standard	NM_003586		Approved		uc002dvn.3	Q14183	OTTHUMG00000132109	ENST00000350119.4:c.849C>A	16.37:g.30018135G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEJ2|H3BNH6|Q6P4G4|Q7Z5G0|Q8IVX0	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin,prints_C2_dom	p.Q120K	ENST00000350119.4	37	c.358	CCDS10666.1	16																																																																																			DOC2A	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin,prints_C2_dom	ENSG00000149927		0.662	DOC2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOC2A	HGNC	protein_coding	OTTHUMT00000255148.2	72	0.00	0	G	NM_003586		30018135	30018135	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000564357	ensembl	human	novel	69_37n	missense	94	16.81	19	SNP	1.000	T
DYNC2H1	79659	genome.wustl.edu	37	11	103178535	103178535	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr11:103178535A>T	ENST00000375735.2	+	78	11612	c.11468A>T	c.(11467-11469)cAg>cTg	p.Q3823L	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.Q3830L|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3823	AAA 6. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		ATTTTACTACAGTCAAGTCTG	0.343																																						dbGAP											0													51.0	48.0	49.0					11																	103178535		1851	4092	5943	-	-	-	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.11468A>T	11.37:g.103178535A>T	ENSP00000364887:p.Gln3823Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Q3830L	ENST00000375735.2	37	c.11489	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	A	25.3	4.619539	0.87460	.	.	ENSG00000187240	ENST00000375735;ENST00000398093;ENST00000540621	T;T	0.10099	2.91;2.91	5.53	5.53	0.82687	Dynein heavy chain (1);	0.059198	0.64402	D	0.000002	T	0.32133	0.0819	M	0.73217	2.22	0.80722	D	1	D;D	0.65815	0.987;0.995	D;D	0.66979	0.926;0.948	T	0.03315	-1.1049	10	0.87932	D	0	.	15.6549	0.77126	1.0:0.0:0.0:0.0	.	3823;3830	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	L	3823;3830;69	ENSP00000364887:Q3823L;ENSP00000381167:Q3830L	ENSP00000364887:Q3823L	Q	+	2	0	DYNC2H1	102683745	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.481000	0.90437	2.118000	0.64928	0.459000	0.35465	CAG	DYNC2H1	-	pfam_Dynein_heavy	ENSG00000187240		0.343	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	119	0.00	0	A	XM_370652		103178535	103178535	+1	no_errors	ENST00000398093	ensembl	human	known	69_37n	missense	31	76.52	101	SNP	1.000	T
EFR3B	22979	genome.wustl.edu	37	2	25358467	25358467	+	Silent	SNP	C	C	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr2:25358467C>T	ENST00000403714.3	+	13	1626	c.1443C>T	c.(1441-1443)ttC>ttT	p.F481F	EFR3B_ENST00000402191.1_Silent_p.F446F|EFR3B_ENST00000401432.3_Silent_p.F481F|EFR3B_ENST00000405108.1_Silent_p.F333F	NM_014971.1	NP_055786.1	Q9Y2G0	EFR3B_HUMAN	EFR3 homolog B (S. cerevisiae)	481										endometrium(1)	1						TCATCAGTTTCATTGATCGTC	0.517																																						dbGAP											0													88.0	74.0	78.0					2																	25358467		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AB023170	CCDS46231.1	2p24.1	2008-02-05	2007-11-14	2007-11-14	ENSG00000084710	ENSG00000084710			29155	protein-coding gene	gene with protein product			"""KIAA0953"""	KIAA0953		10231032	Standard	NM_014971		Approved	FLJ37871	uc010eyh.3	Q9Y2G0	OTTHUMG00000151988	ENST00000403714.3:c.1443C>T	2.37:g.25358467C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPL8|Q86XU6	Silent	SNP	superfamily_ARM-type_fold	p.F481	ENST00000403714.3	37	c.1443	CCDS46231.1	2																																																																																			EFR3B	-	superfamily_ARM-type_fold	ENSG00000084710		0.517	EFR3B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFR3B	HGNC	protein_coding	OTTHUMT00000324808.1	111	0.00	0	C	NM_014971		25358467	25358467	+1	no_errors	ENST00000403714	ensembl	human	known	69_37n	silent	87	39.58	57	SNP	1.000	T
EHMT1	79813	genome.wustl.edu	37	9	140729276	140729276	+	Silent	SNP	C	C	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr9:140729276C>T	ENST00000460843.1	+	27	3795	c.3768C>T	c.(3766-3768)tgC>tgT	p.C1256C		NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1256					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		TCTTCAGCTGCCGCTGCGGCT	0.667																																						dbGAP											0													35.0	32.0	33.0					9																	140729276		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.3768C>T	9.37:g.140729276C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Silent	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.C1256	ENST00000460843.1	37	c.3768	CCDS7050.2	9																																																																																			EHMT1	-	NULL	ENSG00000181090		0.667	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHMT1	HGNC	protein_coding	OTTHUMT00000055371.2	25	0.00	0	C	NM_024757		140729276	140729276	+1	no_errors	ENST00000460843	ensembl	human	known	69_37n	silent	26	18.75	6	SNP	1.000	T
ESAM	90952	genome.wustl.edu	37	11	124623780	124623780	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr11:124623780G>A	ENST00000278927.5	-	7	1064	c.935C>T	c.(934-936)tCt>tTt	p.S312F	VSIG2_ENST00000326621.5_5'Flank|ESAM_ENST00000442070.2_Intron|VSIG2_ENST00000403470.1_5'Flank	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	312					blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		GGAGGTGACAGAGGAAAGGGT	0.622																																						dbGAP											0													72.0	84.0	80.0					11																	124623780		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.935C>T	11.37:g.124623780G>A	ENSP00000278927:p.Ser312Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVN8|Q96T50	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S312F	ENST00000278927.5	37	c.935	CCDS8453.1	11	.	.	.	.	.	.	.	.	.	.	G	22.1	4.247049	0.80024	.	.	ENSG00000149564	ENST00000278927	T	0.35789	1.29	5.28	5.28	0.74379	.	0.060240	0.64402	D	0.000003	T	0.61274	0.2334	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.64753	-0.6333	10	0.87932	D	0	.	16.1819	0.81915	0.0:0.0:1.0:0.0	.	312	Q96AP7	ESAM_HUMAN	F	312	ENSP00000278927:S312F	ENSP00000278927:S312F	S	-	2	0	ESAM	124128990	1.000000	0.71417	0.907000	0.35723	0.826000	0.46750	6.362000	0.73077	2.612000	0.88384	0.655000	0.94253	TCT	ESAM	-	NULL	ENSG00000149564		0.622	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESAM	HGNC	protein_coding	OTTHUMT00000324686.1	125	0.00	0	G	NM_138961		124623780	124623780	-1	no_errors	ENST00000278927	ensembl	human	known	69_37n	missense	84	18.45	19	SNP	0.997	A
EXOC6	54536	genome.wustl.edu	37	10	94653185	94653185	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr10:94653185G>A	ENST00000260762.6	+	2	195	c.181G>A	c.(181-183)Gaa>Aaa	p.E61K	EXOC6_ENST00000371547.4_Missense_Mutation_p.E77K|EXOC6_ENST00000371552.4_Missense_Mutation_p.E56K|EXOC6_ENST00000443748.2_Missense_Mutation_p.E61K|EXOC6_ENST00000371543.1_Missense_Mutation_p.E61K	NM_019053.4	NP_061926.3	Q8TAG9	EXOC6_HUMAN	exocyst complex component 6	61					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	26		Colorectal(252;0.123)				TCATGACAAGGAAATTGAAAA	0.348																																						dbGAP											0													106.0	108.0	107.0					10																	94653185		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC028395	CCDS7424.2, CCDS31247.1	10q23.33	2013-01-22	2006-11-07	2006-11-07	ENSG00000138190	ENSG00000138190			23196	protein-coding gene	gene with protein product		609672	"""SEC15-like 1 (S. cerevisiae)"""	SEC15L1		8889548	Standard	NM_001013848		Approved	SEC15L, FLJ1125, DKFZp761I2124, MGC33397, Sec15p, EXOC6A	uc001kig.3	Q8TAG9	OTTHUMG00000018767	ENST00000260762.6:c.181G>A	10.37:g.94653185G>A	ENSP00000260762:p.Glu61Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PHI3|Q5VXH8|Q9NZ24	Missense_Mutation	SNP	pfam_Sec15,pirsf_Sec15	p.E77K	ENST00000260762.6	37	c.229	CCDS7424.2	10	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112289	0.77210	.	.	ENSG00000138190	ENST00000371547;ENST00000371552;ENST00000371543;ENST00000443748;ENST00000260762	T;T;T;T;T	0.31510	1.64;1.64;1.49;1.64;1.64	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.59487	0.2197	M	0.74881	2.28	0.43214	D	0.995081	B;D;P;P;P	0.69078	0.361;0.997;0.564;0.564;0.564	B;D;B;B;B	0.73380	0.077;0.98;0.11;0.168;0.168	T	0.58747	-0.7582	10	0.72032	D	0.01	-19.398	20.6397	0.99537	0.0:0.0:1.0:0.0	.	77;61;53;61;56	F2Z2Q3;E7EW84;B4DEZ1;Q8TAG9;E9PHI3	.;.;.;EXOC6_HUMAN;.	K	77;56;61;61;61	ENSP00000360602:E77K;ENSP00000360607:E56K;ENSP00000360598:E61K;ENSP00000396206:E61K;ENSP00000260762:E61K	ENSP00000260762:E61K	E	+	1	0	EXOC6	94643165	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.750000	0.98875	2.880000	0.98712	0.650000	0.86243	GAA	EXOC6	-	pirsf_Sec15	ENSG00000138190		0.348	EXOC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC6	HGNC	protein_coding	OTTHUMT00000049410.2	158	0.00	0	G	NM_019053		94653185	94653185	+1	no_errors	ENST00000371547	ensembl	human	known	69_37n	missense	119	15.00	21	SNP	1.000	A
FAM135A	57579	genome.wustl.edu	37	6	71235917	71235917	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr6:71235917G>T	ENST00000418814.2	+	15	3744	c.3130G>T	c.(3130-3132)Ggt>Tgt	p.G1044C	FAM135A_ENST00000505769.1_Missense_Mutation_p.G624C|FAM135A_ENST00000361499.3_Missense_Mutation_p.G848C|FAM135A_ENST00000457062.2_Missense_Mutation_p.G831C|FAM135A_ENST00000505868.1_Missense_Mutation_p.G1044C|FAM135A_ENST00000370479.3_Missense_Mutation_p.G831C	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	1044										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						AAATTATTTTGGTTCTCAAAG	0.383																																						dbGAP											0													62.0	62.0	62.0					6																	71235917		2202	4297	6499	-	-	-	SO:0001583	missense	0			AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.3130G>T	6.37:g.71235917G>T	ENSP00000410768:p.Gly1044Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like,pfam_LACT/PDAT_acylTrfase	p.G1044C	ENST00000418814.2	37	c.3130	CCDS55028.1	6	.	.	.	.	.	.	.	.	.	.	G	18.75	3.689727	0.68271	.	.	ENSG00000082269	ENST00000418814;ENST00000370479;ENST00000505769;ENST00000457062;ENST00000361499;ENST00000505868	T;T;T;T;T;T	0.35236	1.6;1.57;1.32;1.57;1.55;1.54	5.85	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.48169	0.1485	L	0.61218	1.895	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.52555	-0.8560	10	0.54805	T	0.06	.	15.2349	0.73422	0.0677:0.0:0.9323:0.0	.	1044;1044;848;831	Q9P2D6-4;Q9P2D6;Q9P2D6-2;Q9P2D6-3	.;F135A_HUMAN;.;.	C	1044;831;624;831;848;1044	ENSP00000410768:G1044C;ENSP00000359510:G831C;ENSP00000423785:G624C;ENSP00000409201:G831C;ENSP00000354913:G848C;ENSP00000423307:G1044C	ENSP00000354913:G848C	G	+	1	0	FAM135A	71292638	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	6.666000	0.74446	1.471000	0.48121	0.655000	0.94253	GGT	FAM135A	-	NULL	ENSG00000082269		0.383	FAM135A-001	KNOWN	basic|CCDS	protein_coding	FAM135A	HGNC	protein_coding	OTTHUMT00000041137.2	65	0.00	0	G	NM_020819		71235917	71235917	+1	no_errors	ENST00000418814	ensembl	human	known	69_37n	missense	45	23.73	14	SNP	1.000	T
FAM135B	51059	genome.wustl.edu	37	8	139268993	139268993	+	Missense_Mutation	SNP	C	C	A	rs369404911		TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr8:139268993C>A	ENST00000395297.1	-	5	477	c.307G>T	c.(307-309)Gca>Tca	p.A103S		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	103								p.A103T(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TCACTCAGTGCGTCTTCCATC	0.403										HNSCC(54;0.14)																												dbGAP											2	Substitution - Missense(2)	endometrium(2)											103.0	95.0	97.0					8																	139268993		1923	4141	6064	-	-	-	SO:0001583	missense	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.307G>T	8.37:g.139268993C>A	ENSP00000378710:p.Ala103Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.A103S	ENST00000395297.1	37	c.307	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	C	15.81	2.944565	0.53079	.	.	ENSG00000147724	ENST00000395297;ENST00000160713	T	0.14144	2.53	5.35	4.48	0.54585	.	0.063247	0.64402	D	0.000007	T	0.10594	0.0259	L	0.32530	0.975	0.51012	D	0.999908	P	0.36974	0.576	B	0.39027	0.288	T	0.02539	-1.1144	10	0.02654	T	1	-4.7378	13.4644	0.61245	0.0:0.9241:0.0:0.0759	.	103	Q49AJ0	F135B_HUMAN	S	103	ENSP00000378710:A103S	ENSP00000160713:A103S	A	-	1	0	FAM135B	139338175	1.000000	0.71417	0.379000	0.26080	0.537000	0.34900	4.639000	0.61361	1.398000	0.46701	0.655000	0.94253	GCA	FAM135B	-	NULL	ENSG00000147724		0.403	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3	133	0.00	0	C	NM_015912		139268993	139268993	-1	no_errors	ENST00000395297	ensembl	human	known	69_37n	missense	129	34.52	68	SNP	0.996	A
SPATA31D5P	347127	genome.wustl.edu	37	9	84532284	84532284	+	RNA	SNP	A	A	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr9:84532284A>G	ENST00000527857.1	+	0	2306					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		CTTCCCTAGAAGCTTCCACGA	0.463																																						dbGAP											0																																										-	-	-			0					9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84532284A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000527857.1	37	NULL		9																																																																																			FAM75D5	-	-	ENSG00000240632		0.463	SPATA31D5P-002	KNOWN	basic	processed_transcript	FAM75D5	HGNC	pseudogene	OTTHUMT00000052810.2	181	0.00	0	A	NR_026851		84532284	84532284	+1	no_errors	ENST00000527857	ensembl	human	known	69_37n	rna	115	28.12	45	SNP	0.005	G
FAM86B2	653333	genome.wustl.edu	37	8	12285064	12285064	+	Intron	SNP	A	A	G	rs576838439	byFrequency	TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr8:12285064A>G	ENST00000262365.4	-	7	892				FAM86B2_ENST00000393715.3_Missense_Mutation_p.S104P|FAM86B2_ENST00000309608.5_Intron|FAM86B2_ENST00000351291.4_Intron	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2											endometrium(1)|kidney(2)	3						GGGAGTGTGGAGCATCCTAGC	0.657													a|||	924	0.184505	0.0333	0.1916	5008	,	,		10112	0.3254		0.2515	False		,,,				2504	0.1697					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.892+101T>C	8.37:g.12285064A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S104P	ENST00000262365.4	37	c.310	CCDS59092.1	8	.	.	.	.	.	.	.	.	.	.	g	2.713	-0.268266	0.05716	.	.	ENSG00000145002	ENST00000393715	T	0.28666	1.6	1.16	1.16	0.20824	.	.	.	.	.	T	0.20292	0.0488	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25779	-1.0122	6	0.28530	T	0.3	.	3.7905	0.08718	0.2594:0.0:0.7406:0.0	.	.	.	.	P	104	ENSP00000377318:S104P	ENSP00000377318:S104P	S	-	1	0	FAM86B2	12329435	0.019000	0.18553	0.001000	0.08648	0.028000	0.11728	0.316000	0.19469	0.065000	0.16485	-1.680000	0.00737	TCC	FAM86B2	-	NULL	ENSG00000145002		0.657	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	HGNC	protein_coding		9	0.00	0	A	XM_928336		12285064	12285064	-1	no_errors	ENST00000393715	ensembl	human	known	69_37n	missense	10	47.37	9	SNP	0.001	G
FBLN1	2192	genome.wustl.edu	37	22	45972921	45972921	+	Missense_Mutation	SNP	C	C	A	rs375974965		TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr22:45972921C>A	ENST00000327858.6	+	16	2000	c.1905C>A	c.(1903-1905)gaC>gaA	p.D635E	FBLN1_ENST00000348697.2_Missense_Mutation_p.D635E	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	635					embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TCATCTTCGACATCACGGAAG	0.562																																						dbGAP											0													185.0	143.0	157.0					22																	45972921		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1905C>A	22.37:g.45972921C>A	ENSP00000331544:p.Asp635Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_Anaphylatoxin/fibulin,smart_Anaphylatoxin/fibulin,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibulin-1,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.D635E	ENST00000327858.6	37	c.1905	CCDS14067.1	22	.	.	.	.	.	.	.	.	.	.	C	17.21	3.330384	0.60743	.	.	ENSG00000077942	ENST00000348697;ENST00000327858	D;D	0.82893	-1.56;-1.66	4.54	3.52	0.40303	.	0.131570	0.49305	D	0.000142	T	0.62073	0.2398	N	0.24115	0.695	0.40515	D	0.980779	P	0.35328	0.495	B	0.27608	0.081	T	0.61797	-0.6989	10	0.02654	T	1	.	7.3683	0.26787	0.0:0.7961:0.0:0.2039	.	635	P23142	FBLN1_HUMAN	E	635	ENSP00000262723:D635E;ENSP00000331544:D635E	ENSP00000331544:D635E	D	+	3	2	FBLN1	44351585	1.000000	0.71417	0.998000	0.56505	0.778000	0.44026	1.611000	0.36879	1.031000	0.39867	0.462000	0.41574	GAC	FBLN1	-	pirsf_Fibulin-1	ENSG00000077942		0.562	FBLN1-001	KNOWN	basic|CCDS	protein_coding	FBLN1	HGNC	protein_coding	OTTHUMT00000322287.1	114	0.00	0	C	NM_006486		45972921	45972921	+1	no_errors	ENST00000327858	ensembl	human	known	69_37n	missense	116	23.68	36	SNP	1.000	A
FBXL4	26235	genome.wustl.edu	37	6	99374449	99374449	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr6:99374449G>C	ENST00000369244.2	-	4	844	c.416C>G	c.(415-417)gCt>gGt	p.A139G	FBXL4_ENST00000229971.1_Missense_Mutation_p.A139G	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	139					ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		AACATGTACAGCTGTAGGATA	0.443																																						dbGAP											0													98.0	81.0	87.0					6																	99374449		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.416C>G	6.37:g.99374449G>C	ENSP00000358247:p.Ala139Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.A139G	ENST00000369244.2	37	c.416	CCDS5041.1	6	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686200	0.47991	.	.	ENSG00000112234	ENST00000369244;ENST00000229971	T;T	0.14516	2.5;2.5	5.52	5.52	0.82312	.	0.046997	0.85682	D	0.000000	T	0.05823	0.0152	L	0.28115	0.83	0.80722	D	1	B	0.14012	0.009	B	0.14578	0.011	T	0.30031	-0.9992	10	0.21540	T	0.41	.	19.8176	0.96576	0.0:0.0:1.0:0.0	.	139	Q9UKA2	FBXL4_HUMAN	G	139	ENSP00000358247:A139G;ENSP00000229971:A139G	ENSP00000229971:A139G	A	-	2	0	FBXL4	99481170	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.472000	0.80996	2.765000	0.95021	0.650000	0.86243	GCT	FBXL4	-	NULL	ENSG00000112234		0.443	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL4	HGNC	protein_coding	OTTHUMT00000041587.2	64	0.00	0	G			99374449	99374449	-1	no_errors	ENST00000229971	ensembl	human	known	69_37n	missense	57	35.23	31	SNP	1.000	C
FGD6	55785	genome.wustl.edu	37	12	95546743	95546743	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr12:95546743T>G	ENST00000343958.4	-	4	2836	c.2613A>C	c.(2611-2613)aaA>aaC	p.K871N	FGD6_ENST00000549499.1_Missense_Mutation_p.K871N|FGD6_ENST00000546711.1_Missense_Mutation_p.K871N	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	871	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						TATGATGAACTTTACTTTTCA	0.363																																						dbGAP											0													155.0	150.0	152.0					12																	95546743		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.2613A>C	12.37:g.95546743T>G	ENSP00000344446:p.Lys871Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.K871N	ENST00000343958.4	37	c.2613	CCDS31878.1	12	.	.	.	.	.	.	.	.	.	.	T	19.28	3.796428	0.70567	.	.	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000549499	T;T;T	0.37584	1.19;1.19;1.19	6.04	3.68	0.42216	Dbl homology (DH) domain (3);	0.000000	0.52532	D	0.000073	T	0.56077	0.1961	M	0.71036	2.16	0.47276	D	0.999379	D	0.89917	1.0	D	0.87578	0.998	T	0.59005	-0.7535	10	0.87932	D	0	-28.8105	10.4108	0.44291	0.0:0.1888:0.0:0.8112	.	871	Q6ZV73	FGD6_HUMAN	N	871	ENSP00000344446:K871N;ENSP00000450342:K871N;ENSP00000449005:K871N	ENSP00000344446:K871N	K	-	3	2	FGD6	94070874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.096000	0.41738	1.121000	0.41925	0.459000	0.35465	AAA	FGD6	-	superfamily_DH-domain,pfscan_DH-domain	ENSG00000180263		0.363	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD6	HGNC	protein_coding	OTTHUMT00000407600.1	278	0.00	0	T	NM_018351		95546743	95546743	-1	no_errors	ENST00000343958	ensembl	human	known	69_37n	missense	201	22.99	60	SNP	1.000	G
FLT4	2324	genome.wustl.edu	37	5	180045774	180045774	+	Silent	SNP	T	T	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr5:180045774T>C	ENST00000261937.6	-	21	3075	c.2997A>G	c.(2995-2997)caA>caG	p.Q999Q	FLT4_ENST00000502649.1_Silent_p.Q999Q|FLT4_ENST00000424276.2_5'Flank|FLT4_ENST00000393347.3_Silent_p.Q999Q	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	999	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTCACCTTCTTGGTCTGGAG	0.667																																					Colon(97;1075 1466 27033 27547 35871)	dbGAP											0													18.0	25.0	23.0					5																	180045774		2181	4290	6471	-	-	-	SO:0001819	synonymous_variant	0			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2997A>G	5.37:g.180045774T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR3_rcpt_N,prints_Tyr_kinase_VEGFR_rcpt_N	p.Q999	ENST00000261937.6	37	c.2997	CCDS4457.1	5																																																																																			FLT4	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000037280		0.667	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT4	HGNC	protein_coding	OTTHUMT00000253527.4	35	0.00	0	T			180045774	180045774	-1	no_errors	ENST00000261937	ensembl	human	known	69_37n	silent	13	39.13	9	SNP	0.022	C
FRMD7	90167	genome.wustl.edu	37	X	131233522	131233522	+	Nonsense_Mutation	SNP	A	A	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chrX:131233522A>T	ENST00000298542.4	-	3	354	c.179T>A	c.(178-180)tTg>tAg	p.L60*	FRMD7_ENST00000464296.1_Nonsense_Mutation_p.L60*	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	60	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					TATGGGCTTCAAAAGCTCCAG	0.348																																						dbGAP											0													119.0	114.0	116.0					X																	131233522		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.179T>A	X.37:g.131233522A>T	ENSP00000298542:p.Leu60*	Somatic		WXS	Illumina GAIIx	Phase_IV	C0LLJ3|Q5JX99	Nonsense_Mutation	SNP	pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM-adjacent,pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.L60*	ENST00000298542.4	37	c.179	CCDS35397.1	X	.	.	.	.	.	.	.	.	.	.	A	26.1	4.703836	0.88924	.	.	ENSG00000165694	ENST00000298542;ENST00000464296	.	.	.	5.02	5.02	0.67125	.	0.076409	0.51477	D	0.000083	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.655	0.56782	1.0:0.0:0.0:0.0	.	.	.	.	X	60	.	ENSP00000298542:L60X	L	-	2	0	FRMD7	131061203	1.000000	0.71417	0.999000	0.59377	0.358000	0.29455	6.776000	0.75023	1.666000	0.50821	0.478000	0.44815	TTG	FRMD7	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000165694		0.348	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD7	HGNC	protein_coding	OTTHUMT00000355031.1	125	0.00	0	A	NM_194277		131233522	131233522	-1	no_errors	ENST00000298542	ensembl	human	known	69_37n	nonsense	104	10.34	12	SNP	1.000	T
GFPT2	9945	genome.wustl.edu	37	5	179744011	179744011	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr5:179744011A>C	ENST00000253778.8	-	11	1175	c.1006T>G	c.(1006-1008)Tca>Gca	p.S336A	GFPT2_ENST00000520165.1_5'UTR	NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	336					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	TTGAAAACTGATTCTGGCTGT	0.433																																						dbGAP											0													149.0	144.0	145.0					5																	179744011		1873	4095	5968	-	-	-	SO:0001583	missense	0			AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.1006T>G	5.37:g.179744011A>C	ENSP00000253778:p.Ser336Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XM2|Q9BWS4	Missense_Mutation	SNP	pfam_SIS,pfam_GATase_dom,tigrfam_GlmS_trans	p.S336A	ENST00000253778.8	37	c.1006	CCDS43411.1	5	.	.	.	.	.	.	.	.	.	.	A	19.22	3.785301	0.70337	.	.	ENSG00000131459	ENST00000253778	T	0.45276	0.9	5.89	5.89	0.94794	.	0.057512	0.64402	D	0.000001	T	0.57095	0.2030	M	0.62723	1.935	0.80722	D	1	P	0.51791	0.948	P	0.56700	0.804	T	0.55515	-0.8129	9	.	.	.	-15.0725	16.3123	0.82883	1.0:0.0:0.0:0.0	.	336	O94808	GFPT2_HUMAN	A	336	ENSP00000253778:S336A	.	S	-	1	0	GFPT2	179676617	1.000000	0.71417	0.513000	0.27749	0.376000	0.30014	7.276000	0.78559	2.254000	0.74563	0.459000	0.35465	TCA	GFPT2	-	tigrfam_GlmS_trans	ENSG00000131459		0.433	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFPT2	HGNC	protein_coding	OTTHUMT00000373444.4	189	0.00	0	A	NM_005110		179744011	179744011	-1	no_errors	ENST00000253778	ensembl	human	known	69_37n	missense	166	13.54	26	SNP	1.000	C
GOLGB1	2804	genome.wustl.edu	37	3	121417739	121417739	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr3:121417739G>T	ENST00000340645.5	-	13	1741	c.1616C>A	c.(1615-1617)tCt>tAt	p.S539Y	GOLGB1_ENST00000393667.3_Missense_Mutation_p.S544Y	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	539					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TTCCTCAGCAGAAGAGCTCCT	0.303																																						dbGAP											0													66.0	71.0	69.0					3																	121417739		2190	4268	6458	-	-	-	SO:0001583	missense	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.1616C>A	3.37:g.121417739G>T	ENSP00000341848:p.Ser539Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.S539Y	ENST00000340645.5	37	c.1616	CCDS3004.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.28|11.28	1.592624|1.592624	0.28357|0.28357	.|.	.|.	ENSG00000173230|ENSG00000173230	ENST00000489400|ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235	.|T;T;T	.|0.25250	.|2.4;2.4;1.81	5.43|5.43	2.64|2.64	0.31445|0.31445	.|.	.|0.435793	.|0.21595	.|N	.|0.072035	T|T	0.28300|0.28300	0.0699|0.0699	M|M	0.63428|0.63428	1.95|1.95	0.09310|0.09310	N|N	1|1	.|P;D;P;P;P	.|0.59767	.|0.925;0.986;0.925;0.925;0.925	.|P;P;P;P;P	.|0.48141	.|0.568;0.568;0.568;0.568;0.568	T|T	0.16364|0.16364	-1.0405|-1.0405	5|10	.|0.59425	.|D	.|0.04	.|.	4.7218|4.7218	0.12922|0.12922	0.177:0.0:0.651:0.172|0.177:0.0:0.651:0.172	.|.	.|464;503;544;544;539	.|F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.|.;.;.;.;GOGB1_HUMAN	M|Y	410|539;544;503;351	.|ENSP00000341848:S539Y;ENSP00000377275:S544Y;ENSP00000418231:S503Y	.|ENSP00000341848:S539Y	L|S	-|-	1|2	2|0	GOLGB1|GOLGB1	122900429|122900429	0.068000|0.068000	0.21057|0.21057	0.138000|0.138000	0.22173|0.22173	0.145000|0.145000	0.21501|0.21501	1.551000|1.551000	0.36233|0.36233	0.398000|0.398000	0.25338|0.25338	-0.136000|-0.136000	0.14681|0.14681	CTG|TCT	GOLGB1	-	NULL	ENSG00000173230		0.303	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	57	0.00	0	G	NM_004487		121417739	121417739	-1	no_errors	ENST00000340645	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	0.019	T
HEXIM1	10614	genome.wustl.edu	37	17	43227034	43227034	+	Silent	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr17:43227034G>A	ENST00000332499.2	+	1	2351	c.477G>A	c.(475-477)aaG>aaA	p.K159K	AC002117.1_ENST00000452741.1_RNA|AC002117.1_ENST00000589950.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	159	Basic region; mediates nuclear localization and interaction with 7SK snRNA and NR3C1.				heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GCCCGTCCAAGAAGAAGCGGC	0.557											OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													48.0	55.0	52.0					17																	43227034		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.477G>A	17.37:g.43227034G>A		Somatic	914	WXS	Illumina GAIIx	Phase_IV	B2R8Y5	Silent	SNP	NULL	p.K159	ENST00000332499.2	37	c.477	CCDS11495.1	17																																																																																			HEXIM1	-	NULL	ENSG00000186834		0.557	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEXIM1	HGNC	protein_coding	OTTHUMT00000449821.2	33	0.00	0	G	NM_006460		43227034	43227034	+1	no_errors	ENST00000332499	ensembl	human	known	69_37n	silent	34	24.44	11	SNP	1.000	A
HIF3A	64344	genome.wustl.edu	37	19	46823710	46823710	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr19:46823710G>C	ENST00000377670.4	+	9	1067	c.1036G>C	c.(1036-1038)Gag>Cag	p.E346Q	AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000300862.3_Missense_Mutation_p.E344Q|HIF3A_ENST00000600383.1_Missense_Mutation_p.E277Q|HIF3A_ENST00000339613.2_Missense_Mutation_p.E290Q|HIF3A_ENST00000420102.2_Missense_Mutation_p.E295Q|HIF3A_ENST00000472815.1_Missense_Mutation_p.E277Q|HIF3A_ENST00000244303.6_Missense_Mutation_p.E277Q	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	346					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		CCAGGTGGAAGAGACCGGAGT	0.607																																						dbGAP											0													78.0	73.0	75.0					19																	46823710		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1036G>C	19.37:g.46823710G>C	ENSP00000366898:p.Glu346Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HIF_alpha_subunit,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,tigrfam_PAS	p.E346Q	ENST00000377670.4	37	c.1036	CCDS12681.2	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.16|13.16	2.152883|2.152883	0.38021|0.38021	.|.	.|.	ENSG00000124440|ENSG00000124440	ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102|ENST00000472815	T;T;T;T;T|T	0.66460|0.11169	0.59;-0.2;0.47;0.59;-0.21|2.8	4.85|4.85	4.85|4.85	0.62838|0.62838	.|.	0.000000|.	0.47093|.	D|.	0.000247|.	T|T	0.12008|0.12008	0.0292|0.0292	N|N	0.24115|0.24115	0.695|0.695	0.45822|0.45822	D|D	0.998696|0.998696	B;D;P;D;B;B;D|.	0.71674|.	0.198;0.998;0.537;0.995;0.402;0.402;0.993|.	B;D;B;D;B;B;D|.	0.78314|.	0.234;0.991;0.302;0.911;0.159;0.159;0.979|.	T|T	0.25433|0.25433	-1.0132|-1.0132	10|6	0.22706|.	T|.	0.39|.	.|.	13.8263|13.8263	0.63352|0.63352	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	295;277;344;295;290;346;346|.	F5H884;B4DNA2;Q9Y2N7-2;B4DSD9;A8MPQ1;Q9Y2N7;B0M185|.	.;.;.;.;.;HIF3A_HUMAN;.|.	Q|T	346;346;277;290;290;344;295|318	ENSP00000366898:E346Q;ENSP00000244303:E277Q;ENSP00000341877:E290Q;ENSP00000300862:E344Q;ENSP00000407771:E295Q|ENSP00000434653:R318T	ENSP00000244302:E346Q|.	E|R	+|+	1|2	0|0	HIF3A|HIF3A	51515550|51515550	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.833000|0.833000	0.47200|0.47200	4.959000|4.959000	0.63666|0.63666	2.415000|2.415000	0.81967|0.81967	0.561000|0.561000	0.74099|0.74099	GAG|AGA	HIF3A	-	NULL	ENSG00000124440		0.607	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIF3A	HGNC	protein_coding	OTTHUMT00000280556.3	48	0.00	0	G			46823710	46823710	+1	no_errors	ENST00000377670	ensembl	human	known	69_37n	missense	28	30.00	12	SNP	1.000	C
HLA-F	3134	genome.wustl.edu	37	6	29692892	29692892	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr6:29692892C>G	ENST00000376861.1	+	5	1079	c.695C>G	c.(694-696)gCg>gGg	p.A232G	HLA-F_ENST00000259951.7_Missense_Mutation_p.A232G|HLA-F_ENST00000334668.4_Missense_Mutation_p.A232G|HLA-F_ENST00000434407.2_Intron|HLA-F_ENST00000440587.2_Missense_Mutation_p.A114G			P30511	HLAF_HUMAN	major histocompatibility complex, class I, F	232	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						TTCTACCCTGCGGAGATCACG	0.612																																						dbGAP											0													52.0	49.0	50.0					6																	29692892		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY253269	CCDS43437.1, CCDS43438.1, CCDS43439.1	6p21.3	2013-01-11			ENSG00000204642	ENSG00000204642		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4963	protein-coding gene	gene with protein product		143110				1688605	Standard	NM_018950		Approved		uc003nno.4	P30511	OTTHUMG00000031156	ENST00000376861.1:c.695C>G	6.37:g.29692892C>G	ENSP00000366057:p.Ala232Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JQI8|Q5JQJ1|Q5SPT5|Q860R0|Q8MGQ1|Q8WLP5|Q95HC0|Q9TP68	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.A232G	ENST00000376861.1	37	c.695	CCDS43438.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	13.14|13.14	2.147977|2.147977	0.37923|0.37923	.|.	.|.	ENSG00000204642|ENSG00000204642	ENST00000376861;ENST00000449921;ENST00000334668;ENST00000259951;ENST00000399258;ENST00000440587|ENST00000429294	T;T;T;T|.	0.14144|.	2.53;2.53;2.53;2.53|.	1.92|1.92	0.964|0.964	0.19655|0.19655	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);|.	0.399304|.	0.17850|.	U|.	0.159915|.	T|T	0.28599|0.28599	0.0708|0.0708	M|M	0.75447|0.75447	2.3|2.3	0.21762|0.21762	N|N	0.999553|0.999553	D;D;B|.	0.65815|.	0.995;0.99;0.105|.	D;P;B|.	0.63488|.	0.915;0.654;0.029|.	T|T	0.28933|0.28933	-1.0028|-1.0028	10|5	0.87932|.	D|.	0|.	.|.	5.4003|5.4003	0.16293|0.16293	0.3326:0.6674:0.0:0.0|0.3326:0.6674:0.0:0.0	.|.	232;232;232|.	A8MVU7;P30511;P30511-3|.	.;HLAF_HUMAN;.|.	G|G	232;209;232;232;146;114|111	ENSP00000366057:A232G;ENSP00000334263:A232G;ENSP00000259951:A232G;ENSP00000404130:A114G|.	ENSP00000259951:A232G|.	A|R	+|+	2|1	0|2	HLA-F|HLA-F	29800871|29800871	0.000000|0.000000	0.05858|0.05858	0.842000|0.842000	0.33263|0.33263	0.547000|0.547000	0.35210|0.35210	-0.426000|-0.426000	0.07008|0.07008	0.105000|0.105000	0.17753|0.17753	0.436000|0.436000	0.28706|0.28706	GCG|CGG	HLA-F	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000204642		0.612	HLA-F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-F	HGNC	protein_coding	OTTHUMT00000195083.1	85	0.00	0	C	NM_018950		29692892	29692892	+1	no_errors	ENST00000259951	ensembl	human	known	69_37n	missense	122	14.08	20	SNP	0.962	G
IFI44L	10964	genome.wustl.edu	37	1	79107183	79107183	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:79107183G>C	ENST00000370751.5	+	8	1392	c.1213G>C	c.(1213-1215)Gct>Cct	p.A405P	IFI44L_ENST00000476521.1_3'UTR|IFI44L_ENST00000342282.3_Missense_Mutation_p.A147P	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	405					defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)				endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						TGGAAATTATGCTTCAGATTT	0.393																																						dbGAP											0													94.0	91.0	92.0					1																	79107183		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.1213G>C	1.37:g.79107183G>C	ENSP00000359787:p.Ala405Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86TE1|Q96B64|Q99984	Missense_Mutation	SNP	NULL	p.A405P	ENST00000370751.5	37	c.1213	CCDS687.2	1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.839044	0.51057	.	.	ENSG00000137959	ENST00000370751;ENST00000342282	T;T	0.31510	3.07;1.49	4.1	0.858	0.19030	.	0.469819	0.21405	N	0.075064	T	0.22820	0.0551	L	0.54323	1.7	0.26501	N	0.974775	D	0.64830	0.994	P	0.62298	0.9	T	0.03597	-1.1021	10	0.49607	T	0.09	-8.9915	3.1514	0.06489	0.2265:0.0:0.4858:0.2878	.	405	Q53G44	IF44L_HUMAN	P	405;147	ENSP00000359787:A405P;ENSP00000342833:A147P	ENSP00000342833:A147P	A	+	1	0	IFI44L	78879771	0.016000	0.18221	0.969000	0.41365	0.611000	0.37282	-0.273000	0.08548	0.467000	0.27218	0.551000	0.68910	GCT	IFI44L	-	NULL	ENSG00000137959		0.393	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFI44L	HGNC	protein_coding	OTTHUMT00000026834.3	149	0.00	0	G	NM_006820		79107183	79107183	+1	no_errors	ENST00000370751	ensembl	human	known	69_37n	missense	159	16.75	32	SNP	0.653	C
IGLC2	3538	genome.wustl.edu	37	22	23241754	23241754	+	RNA	SNP	G	G	T	rs66963410		TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr22:23241754G>T	ENST00000390323.2	+	0	0				IGLJ2_ENST00000390322.2_RNA			P0CG05	LAC2_HUMAN	immunoglobulin lambda constant 2 (Kern-Oz- marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										GGCTGGGGCTGGGGCATCCCA	0.622																																						dbGAP											0													48.0	58.0	55.0					22																	23241754		1876	4100	5976	-	-	-			0			J00253		22q11.2	2012-02-08			ENSG00000211677	ENSG00000211677		"""Immunoglobulins / IGL locus"""	5856	other	immunoglobulin gene				IGLC			Standard	NG_000002		Approved			P0CG05	OTTHUMG00000151214		22.37:g.23241754G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0M8Q4|P80423	Missense_Mutation	SNP	NULL	p.G21W	ENST00000390323.2	37	c.61		22																																																																																			IGLJ2	-	NULL	ENSG00000211676		0.622	IGLC2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGLJ2	HGNC	IG_C_gene	OTTHUMT00000321818.3	164	0.00	0	G	NG_000002		23241754	23241754	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390322	ensembl	human	known	69_37n	missense	177	29.48	74	SNP	0.001	T
IGSF21	84966	genome.wustl.edu	37	1	18618477	18618477	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:18618477G>T	ENST00000251296.1	+	3	684	c.301G>T	c.(301-303)Gtg>Ttg	p.V101L		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	101	Ig-like 1.					extracellular region (GO:0005576)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		CCAGTCCACTGTGAGGTGAGT	0.597																																						dbGAP											0													109.0	100.0	103.0					1																	18618477		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.301G>T	1.37:g.18618477G>T	ENSP00000251296:p.Val101Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NBR8	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.V101L	ENST00000251296.1	37	c.301	CCDS184.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.601|8.601	0.886842|0.886842	0.17540|0.17540	.|.	.|.	ENSG00000117154|ENSG00000117154	ENST00000412684|ENST00000251296	.|T	.|0.04360	.|3.64	5.01|5.01	5.01|5.01	0.66863|0.66863	.|Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.309813	.|0.29451	.|N	.|0.012119	T|T	0.02610|0.02610	0.0079|0.0079	N|N	0.05383|0.05383	-0.06|-0.06	0.58432|0.58432	D|D	0.999999|0.999999	.|B	.|0.23128	.|0.08	.|B	.|0.20384	.|0.029	T|T	0.31420|0.31420	-0.9944|-0.9944	5|10	.|0.02654	.|T	.|1	-10.0189|-10.0189	13.8181|13.8181	0.63303|0.63303	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|101	.|Q96ID5	.|IGS21_HUMAN	F|L	53|101	.|ENSP00000251296:V101L	.|ENSP00000251296:V101L	C|V	+|+	2|1	0|0	IGSF21|IGSF21	18491064|18491064	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.979000|0.979000	0.70002|0.70002	8.329000|8.329000	0.90017|0.90017	2.325000|2.325000	0.78763|0.78763	0.561000|0.561000	0.74099|0.74099	TGT|GTG	IGSF21	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000117154		0.597	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF21	HGNC	protein_coding	OTTHUMT00000006924.1	51	0.00	0	G	NM_032880		18618477	18618477	+1	no_errors	ENST00000251296	ensembl	human	known	69_37n	missense	41	18.00	9	SNP	1.000	T
INTS3	65123	genome.wustl.edu	37	1	153736642	153736642	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:153736642G>A	ENST00000318967.2	+	18	2438	c.1870G>A	c.(1870-1872)Gag>Aag	p.E624K	INTS3_ENST00000512605.1_Missense_Mutation_p.E418K|INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000456435.1_Missense_Mutation_p.E418K|INTS3_ENST00000435409.2_Missense_Mutation_p.E624K	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	625					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTGCCTACAGGAGCTCTTCAA	0.567																																						dbGAP											0													132.0	123.0	126.0					1																	153736642		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.1870G>A	1.37:g.153736642G>A	ENSP00000318641:p.Glu624Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	pfam_Integrator_3	p.E624K	ENST00000318967.2	37	c.1870	CCDS1052.1	1	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927022	0.73327	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.59335	0.2186	L	0.43152	1.355	0.58432	D	0.999994	D;P;D	0.67145	0.996;0.956;0.974	D;P;D	0.76071	0.987;0.899;0.953	T	0.57365	-0.7824	9	0.37606	T	0.19	.	13.3443	0.60564	0.0:0.0:1.0:0.0	.	418;625;624	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	K	624;418;624;418	.	ENSP00000318641:E624K	E	+	1	0	INTS3	152003266	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.187000	0.94912	2.526000	0.85167	0.462000	0.41574	GAG	INTS3	-	NULL	ENSG00000143624		0.567	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS3	HGNC	protein_coding	OTTHUMT00000090045.2	160	0.00	0	G	NM_023015		153736642	153736642	+1	no_errors	ENST00000318967	ensembl	human	known	69_37n	missense	126	51.91	136	SNP	1.000	A
IP6K3	117283	genome.wustl.edu	37	6	33703104	33703104	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr6:33703104G>C	ENST00000293756.4	-	2	476	c.150C>G	c.(148-150)ttC>ttG	p.F50L	IP6K3_ENST00000451316.1_Missense_Mutation_p.F50L	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	50					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			skin(1)	1						GGGATTCATAGAACCTCTGCT	0.627																																						dbGAP											0													59.0	42.0	48.0					6																	33703104		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.150C>G	6.37:g.33703104G>C	ENSP00000293756:p.Phe50Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MQ9	Missense_Mutation	SNP	pfam_IPK	p.F50L	ENST00000293756.4	37	c.150	CCDS34435.1	6	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369333	0.82463	.	.	ENSG00000161896	ENST00000451316;ENST00000293756	T;T	0.67698	-0.28;-0.28	5.43	5.43	0.79202	.	0.244453	0.36703	N	0.002456	T	0.64670	0.2619	M	0.92970	3.365	0.52501	D	0.999955	P	0.34562	0.457	B	0.31390	0.129	T	0.74609	-0.3608	10	0.72032	D	0.01	-30.008	12.6323	0.56665	0.0754:0.0:0.9245:0.0	.	50	Q96PC2	IP6K3_HUMAN	L	50	ENSP00000398861:F50L;ENSP00000293756:F50L	ENSP00000293756:F50L	F	-	3	2	IP6K3	33811082	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.035000	0.88872	2.548000	0.85928	0.650000	0.86243	TTC	IP6K3	-	NULL	ENSG00000161896		0.627	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IP6K3	HGNC	protein_coding	OTTHUMT00000040203.1	26	0.00	0	G	NM_054111		33703104	33703104	-1	no_errors	ENST00000293756	ensembl	human	known	69_37n	missense	28	34.88	15	SNP	1.000	C
IQCG	84223	genome.wustl.edu	37	3	197619514	197619514	+	Silent	SNP	T	T	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr3:197619514T>C	ENST00000265239.6	-	10	1504	c.1080A>G	c.(1078-1080)caA>caG	p.Q360Q	IQCG_ENST00000455191.1_Silent_p.Q360Q|RNU6-858P_ENST00000362436.1_RNA	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	360						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		TTGCCAGGTCTTGAAGGTGTG	0.468																																						dbGAP											0													363.0	328.0	340.0					3																	197619514		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.1080A>G	3.37:g.197619514T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BST2|Q9HAG8	Silent	SNP	pfam_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.Q360	ENST00000265239.6	37	c.1080	CCDS3331.1	3																																																																																			IQCG	-	NULL	ENSG00000114473		0.468	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCG	HGNC	protein_coding	OTTHUMT00000339730.1	567	0.18	1	T	NM_032263		197619514	197619514	-1	no_errors	ENST00000265239	ensembl	human	known	69_37n	silent	1011	10.69	121	SNP	0.998	C
KCNH6	81033	genome.wustl.edu	37	17	61601567	61601567	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr17:61601567C>G	ENST00000583023.1	+	2	155	c.144C>G	c.(142-144)ttC>ttG	p.F48L	KCNH6_ENST00000456941.2_Missense_Mutation_p.F48L|KCNH6_ENST00000314672.5_Missense_Mutation_p.F48L|KCNH6_ENST00000581784.1_Missense_Mutation_p.F48L|KCNH6_ENST00000580652.1_Missense_Mutation_p.F48L	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	48	PAS.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	ACGACGGCTTCTGCGAACTCT	0.592																																						dbGAP											0													203.0	184.0	191.0					17																	61601567		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.144C>G	17.37:g.61601567C>G	ENSP00000463533:p.Phe48Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BRD7	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_ELK,prints_2pore_dom_K_chnl,pfscan_cNMP-bd_dom	p.F48L	ENST00000583023.1	37	c.144	CCDS11638.1	17	.	.	.	.	.	.	.	.	.	.	C	12.06	1.825283	0.32237	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D;D	0.99598	-6.26;-6.26	5.34	4.16	0.48862	PAS fold (1);	0.000000	0.51477	D	0.000099	D	0.99588	0.9851	M	0.90145	3.09	0.38098	D	0.93716	P;D;D	0.76494	0.715;0.999;0.97	P;D;D	0.79784	0.686;0.993;0.973	D	0.98081	1.0404	10	0.66056	D	0.02	.	11.2165	0.48830	0.0:0.8379:0.0:0.1621	.	48;48;48	Q9H252-2;Q9H252;Q9H252-3	.;KCNH6_HUMAN;.	L	48	ENSP00000318212:F48L;ENSP00000396900:F48L	ENSP00000318212:F48L	F	+	3	2	KCNH6	58955299	1.000000	0.71417	1.000000	0.80357	0.369000	0.29798	2.149000	0.42244	2.500000	0.84329	0.561000	0.74099	TTC	KCNH6	-	pfam_PAS_fold	ENSG00000173826		0.592	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH6	HGNC	protein_coding	OTTHUMT00000443853.1	117	0.00	0	C	NM_030779		61601567	61601567	+1	no_errors	ENST00000583023	ensembl	human	known	69_37n	missense	181	19.20	43	SNP	1.000	G
LGR4	55366	genome.wustl.edu	37	11	27406878	27406878	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr11:27406878T>C	ENST00000379214.4	-	5	982	c.539A>G	c.(538-540)cAg>cGg	p.Q180R	LGR4_ENST00000480977.2_Missense_Mutation_p.Q132R|LGR4_ENST00000389858.4_Missense_Mutation_p.Q156R	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	180					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						GGTCAGCGCCTGTAGGGTGGG	0.498																																						dbGAP											0													113.0	114.0	114.0					11																	27406878		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.539A>G	11.37:g.27406878T>C	ENSP00000368516:p.Gln180Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCH3|G5E9B3|Q8N537|Q9NYD1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pfscan_GPCR_Rhodpsn_supfam,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.Q180R	ENST00000379214.4	37	c.539	CCDS31449.1	11	.	.	.	.	.	.	.	.	.	.	T	21.1	4.096610	0.76870	.	.	ENSG00000205213	ENST00000379214;ENST00000389858;ENST00000480977	T;T;D	0.83335	3.68;3.15;-1.71	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.83658	0.5302	N	0.12182	0.205	0.58432	D	0.999999	D;P	0.52996	0.957;0.718	D;P	0.70016	0.967;0.782	D	0.86340	0.1704	10	0.54805	T	0.06	.	16.3908	0.83537	0.0:0.0:0.0:1.0	.	156;180	G5E9B3;Q9BXB1	.;LGR4_HUMAN	R	180;156;132	ENSP00000368516:Q180R;ENSP00000374508:Q156R;ENSP00000431650:Q132R	ENSP00000368516:Q180R	Q	-	2	0	LGR4	27363454	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	6.139000	0.71728	2.269000	0.75478	0.455000	0.32223	CAG	LGR4	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000205213		0.498	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR4	HGNC	protein_coding	OTTHUMT00000257467.1	139	0.00	0	T	NM_018490		27406878	27406878	-1	no_errors	ENST00000379214	ensembl	human	known	69_37n	missense	109	16.79	22	SNP	1.000	C
LGR6	59352	genome.wustl.edu	37	1	202287825	202287825	+	Silent	SNP	G	G	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:202287825G>T	ENST00000367278.3	+	18	2483	c.2394G>T	c.(2392-2394)ctG>ctT	p.L798L	LGR6_ENST00000255432.7_Silent_p.L746L|LGR6_ENST00000439764.2_Silent_p.L659L	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	798					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						CCTCCATGCTGGGCCTCTTCC	0.647																																						dbGAP											0													101.0	83.0	89.0					1																	202287825		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.2394G>T	1.37:g.202287825G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Silent	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.L798	ENST00000367278.3	37	c.2394	CCDS30971.1	1																																																																																			LGR6	-	pfam_7TM_GPCR_Rhodpsn	ENSG00000133067		0.647	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR6	HGNC	protein_coding	OTTHUMT00000099143.1	84	0.00	0	G	NM_021636		202287825	202287825	+1	no_errors	ENST00000367278	ensembl	human	known	69_37n	silent	38	58.70	54	SNP	0.998	T
LMF2	91289	genome.wustl.edu	37	22	50945100	50945100	+	Intron	SNP	G	G	A	rs536209520		TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr22:50945100G>A	ENST00000474879.2	-	3	364				NCAPH2_ENST00000420993.2_5'Flank|LMF2_ENST00000216080.5_Intron|LMF2_ENST00000505981.1_Intron|NCAPH2_ENST00000395698.3_5'Flank|NCAPH2_ENST00000395701.3_5'Flank|NCAPH2_ENST00000299821.11_5'Flank|LMF2_ENST00000380796.3_Intron	NM_033200.2	NP_149977.2	Q9BU23	LMF2_HUMAN	lipase maturation factor 2							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GCCCACCTGCGGAGAGAGGGG	0.647													.|||	1	0.000199681	0.0	0.0	5008	,	,		15461	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													60.0	67.0	65.0					22																	50945100		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC002942	CCDS14093.1, CCDS14093.2	22q13.33	2008-02-04	2007-11-29	2007-11-29	ENSG00000100258	ENSG00000100258			25096	protein-coding gene	gene with protein product			"""transmembrane protein 153"", ""transmembrane protein 112B"""	TMEM153, TMEM112B		12477932	Standard	NM_033200		Approved		uc003blp.2	Q9BU23	OTTHUMG00000150206	ENST00000474879.2:c.349-5C>T	22.37:g.50945100G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEZ0|Q13392|Q6ZNR2|Q8WU74|Q96C62	Silent	SNP	pfam_LMF	p.S121	ENST00000474879.2	37	c.363	CCDS14093.2	22																																																																																			LMF2	-	NULL	ENSG00000100258		0.647	LMF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LMF2	HGNC	protein_coding	OTTHUMT00000316833.2	68	0.00	0	G	NM_033200		50945100	50945100	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000487499	ensembl	human	putative	69_37n	silent	56	23.29	17	SNP	0.652	A
LMTK2	22853	genome.wustl.edu	37	7	97823289	97823289	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr7:97823289C>G	ENST00000297293.5	+	11	3805	c.3512C>G	c.(3511-3513)tCc>tGc	p.S1171C		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1171					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					TTGCACAACTCCAGTGACCTG	0.592																																						dbGAP											0													51.0	52.0	51.0					7																	97823289		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.3512C>G	7.37:g.97823289C>G	ENSP00000297293:p.Ser1171Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S1171C	ENST00000297293.5	37	c.3512	CCDS5654.1	7	.	.	.	.	.	.	.	.	.	.	C	14.52	2.558735	0.45590	.	.	ENSG00000164715	ENST00000297293	T	0.79033	-1.23	5.16	5.16	0.70880	.	0.731381	0.13599	N	0.375997	T	0.76744	0.4030	L	0.60455	1.87	0.21652	N	0.999607	B	0.10296	0.003	B	0.10450	0.005	T	0.68462	-0.5402	10	0.72032	D	0.01	.	16.2025	0.82095	0.0:1.0:0.0:0.0	.	1171	Q8IWU2	LMTK2_HUMAN	C	1171	ENSP00000297293:S1171C	ENSP00000297293:S1171C	S	+	2	0	LMTK2	97661225	0.024000	0.19004	0.194000	0.23346	0.134000	0.20937	2.119000	0.41958	2.699000	0.92147	0.650000	0.86243	TCC	LMTK2	-	NULL	ENSG00000164715		0.592	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMTK2	HGNC	protein_coding	OTTHUMT00000334560.1	25	0.00	0	C	NM_014916		97823289	97823289	+1	no_errors	ENST00000297293	ensembl	human	known	69_37n	missense	27	35.71	15	SNP	0.434	G
LOXL3	84695	genome.wustl.edu	37	2	74777385	74777385	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr2:74777385G>A	ENST00000264094.3	-	3	475	c.404C>T	c.(403-405)aCg>aTg	p.T135M	LOXL3_ENST00000393937.2_Missense_Mutation_p.T135M|LOXL3_ENST00000409986.1_Missense_Mutation_p.T135M|LOXL3_ENST00000409549.1_Missense_Mutation_p.T135M|LOXL3_ENST00000484369.1_5'UTR|DOK1_ENST00000409429.1_Intron|LOXL3_ENST00000409249.1_Missense_Mutation_p.T135M	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	135	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						CTCATCGTGCGTACAGTCACT	0.577																																						dbGAP											0													116.0	99.0	105.0					2																	74777385		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.404C>T	2.37:g.74777385G>A	ENSP00000264094:p.Thr135Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Missense_Mutation	SNP	pfam_Lysyl_oxidase,pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Lysyl_oxidase,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.T135M	ENST00000264094.3	37	c.404	CCDS1953.1	2	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368166	0.61513	.	.	ENSG00000115318	ENST00000264094;ENST00000409249;ENST00000393937;ENST00000409549;ENST00000409986;ENST00000413469	T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53	4.98	4.04	0.47022	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.050131	0.85682	D	0.000000	T	0.55768	0.1941	M	0.83852	2.665	0.80722	D	1	D;D;P;D	0.89917	0.991;0.997;0.898;1.0	P;P;B;D	0.87578	0.803;0.86;0.117;0.998	T	0.58261	-0.7667	10	0.46703	T	0.11	.	12.133	0.53955	0.0:0.0:0.8279:0.1721	.	135;135;135;135	B9A025;E7END4;Q6IPL7;P58215	.;.;.;LOXL3_HUMAN	M	135	ENSP00000264094:T135M;ENSP00000387103:T135M;ENSP00000377512:T135M;ENSP00000386696:T135M;ENSP00000386545:T135M;ENSP00000398260:T135M	ENSP00000264094:T135M	T	-	2	0	LOXL3	74630893	0.999000	0.42202	1.000000	0.80357	0.717000	0.41224	1.923000	0.40055	2.470000	0.83445	0.462000	0.41574	ACG	LOXL3	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000115318		0.577	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL3	HGNC	protein_coding	OTTHUMT00000252215.1	61	0.00	0	G	NM_032603		74777385	74777385	-1	no_errors	ENST00000264094	ensembl	human	known	69_37n	missense	42	17.65	9	SNP	0.995	A
LPPR2	64748	genome.wustl.edu	37	19	11468358	11468358	+	Silent	SNP	A	A	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr19:11468358A>G	ENST00000251473.5	+	3	385	c.9A>G	c.(7-9)ggA>ggG	p.G3G	DKFZP761J1410_ENST00000591608.1_Silent_p.G3G|DKFZP761J1410_ENST00000586431.1_3'UTR	NM_001170635.1|NM_022737.2	NP_001164106.1|NP_073574.2																					CCATGGCGGGAGGGAGACCGC	0.637																																						dbGAP											0													127.0	89.0	102.0					19																	11468358		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000251473.5:c.9A>G	19.37:g.11468358A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.G3	ENST00000251473.5	37	c.9	CCDS12258.1	19																																																																																			LPPR2	-	NULL	ENSG00000105520		0.637	DKFZP761J1410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR2	Clone_based_vega_gene	protein_coding	OTTHUMT00000458779.1	99	0.00	0	A			11468358	11468358	+1	no_errors	ENST00000591608	ensembl	human	known	69_37n	silent	115	33.53	58	SNP	0.996	G
LRRIQ1	84125	genome.wustl.edu	37	12	85546835	85546835	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr12:85546835T>A	ENST00000393217.2	+	21	4514	c.4453T>A	c.(4453-4455)Ttt>Att	p.F1485I		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1485										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TGATACTTCATTTAATTTACC	0.284																																						dbGAP											0													76.0	72.0	73.0					12																	85546835		1812	4054	5866	-	-	-	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4453T>A	12.37:g.85546835T>A	ENSP00000376910:p.Phe1485Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.F1485I	ENST00000393217.2	37	c.4453	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	T	0.676	-0.800180	0.02841	.	.	ENSG00000133640	ENST00000393217	T	0.49720	0.77	5.33	3.28	0.37604	.	.	.	.	.	T	0.25938	0.0632	N	0.14661	0.345	0.09310	N	0.999997	B	0.19706	0.038	B	0.14023	0.01	T	0.22208	-1.0223	9	0.18710	T	0.47	.	5.3877	0.16227	0.1533:0.6551:0.0:0.1917	.	1485	Q96JM4	LRIQ1_HUMAN	I	1485	ENSP00000376910:F1485I	ENSP00000376910:F1485I	F	+	1	0	LRRIQ1	84070966	0.141000	0.22595	0.016000	0.15963	0.022000	0.10575	0.394000	0.20834	0.461000	0.27071	-0.334000	0.08254	TTT	LRRIQ1	-	NULL	ENSG00000133640		0.284	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	108	0.00	0	T	NM_032165		85546835	85546835	+1	no_errors	ENST00000393217	ensembl	human	known	69_37n	missense	59	14.49	10	SNP	0.523	A
MAGEE1	57692	genome.wustl.edu	37	X	75649513	75649513	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chrX:75649513C>G	ENST00000361470.2	+	1	1468	c.1190C>G	c.(1189-1191)cCt>cGt	p.P397R		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	397	Pro-rich.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						CCCACCGCCCCTGACGGACCG	0.647																																						dbGAP											0													52.0	33.0	39.0					X																	75649513		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.1190C>G	X.37:g.75649513C>G	ENSP00000354912:p.Pro397Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.P397R	ENST00000361470.2	37	c.1190	CCDS14433.1	X	.	.	.	.	.	.	.	.	.	.	C	4.168	0.029790	0.08101	.	.	ENSG00000198934	ENST00000361470	T	0.09163	3.01	1.42	0.525	0.17072	.	.	.	.	.	T	0.04137	0.0115	N	0.08118	0	0.09310	N	1	B	0.27594	0.182	B	0.16289	0.015	T	0.45440	-0.9261	9	0.18276	T	0.48	.	5.4833	0.16735	0.0:0.7849:0.0:0.2151	.	397	Q9HCI5	MAGE1_HUMAN	R	397	ENSP00000354912:P397R	ENSP00000354912:P397R	P	+	2	0	MAGEE1	75565917	0.001000	0.12720	0.001000	0.08648	0.000000	0.00434	0.518000	0.22847	0.083000	0.17047	-0.322000	0.08575	CCT	MAGEE1	-	NULL	ENSG00000198934		0.647	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	50	0.00	0	C	NM_020932		75649513	75649513	+1	no_errors	ENST00000361470	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	0.007	G
MAGEC1	9947	genome.wustl.edu	37	X	140993500	140993500	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chrX:140993500G>C	ENST00000285879.4	+	4	596	c.310G>C	c.(310-312)Gag>Cag	p.E104Q	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	104										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GAGTTCTCCTGAGGGGAAGGA	0.562										HNSCC(15;0.026)																												dbGAP											0													78.0	77.0	78.0					X																	140993500		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.310G>C	X.37:g.140993500G>C	ENSP00000285879:p.Glu104Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.E104Q	ENST00000285879.4	37	c.310	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	g	8.817	0.936590	0.18206	.	.	ENSG00000155495	ENST00000285879	T	0.02974	4.09	.	.	.	.	.	.	.	.	T	0.02047	0.0064	N	0.08118	0	0.49051	D	0.999748	P	0.39094	0.659	B	0.42959	0.403	T	0.64537	-0.6384	7	0.33940	T	0.23	.	.	.	.	.	104	O60732	MAGC1_HUMAN	Q	104	ENSP00000285879:E104Q	ENSP00000285879:E104Q	E	+	1	0	MAGEC1	140821166	0.002000	0.14202	0.013000	0.15412	0.013000	0.08279	0.140000	0.16056	0.108000	0.17862	0.110000	0.15639	GAG	MAGEC1	-	NULL	ENSG00000155495		0.562	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	HGNC	protein_coding	OTTHUMT00000058604.1	123	0.00	0	G	NM_005462		140993500	140993500	+1	no_errors	ENST00000285879	ensembl	human	known	69_37n	missense	73	19.78	18	SNP	0.834	C
MARCH6	10299	genome.wustl.edu	37	5	10410284	10410284	+	Silent	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr5:10410284G>A	ENST00000274140.5	+	18	1719	c.1587G>A	c.(1585-1587)ctG>ctA	p.L529L	MARCH6_ENST00000503788.1_Silent_p.L424L|MARCH6_ENST00000449913.2_Silent_p.L481L|MARCH6_ENST00000510792.1_Silent_p.L227L	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	529					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						CCCTCGAGCTGCTTCTGCTTC	0.488																																						dbGAP											0													169.0	149.0	156.0					5																	10410284		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.1587G>A	5.37:g.10410284G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.L529	ENST00000274140.5	37	c.1587	CCDS34135.1	5																																																																																			MARCH6	-	NULL	ENSG00000145495		0.488	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH6	HGNC	protein_coding	OTTHUMT00000366919.2	166	0.00	0	G	NM_005885		10410284	10410284	+1	no_errors	ENST00000274140	ensembl	human	known	69_37n	silent	91	23.53	28	SNP	1.000	A
MCRS1	10445	genome.wustl.edu	37	12	49957250	49957250	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr12:49957250C>T	ENST00000550165.1	-	8	903	c.637G>A	c.(637-639)Gag>Aag	p.E213K	MCRS1_ENST00000547182.1_5'Flank|MCRS1_ENST00000357123.4_Missense_Mutation_p.E226K|MCRS1_ENST00000546244.1_Missense_Mutation_p.E22K|MCRS1_ENST00000343810.4_Missense_Mutation_p.E213K			Q96EZ8	MCRS1_HUMAN	microspherule protein 1	213					cellular protein modification process (GO:0006464)|chromatin organization (GO:0006325)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)	23						AGCTGCTCCTCAGCCTTGCTA	0.582																																						dbGAP											0													91.0	72.0	79.0					12																	49957250		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC011794	CCDS8787.1, CCDS31795.1, CCDS61118.1	12q13.12	2011-07-06				ENSG00000187778		"""INO80 complex subunits"""	6960	protein-coding gene	gene with protein product	"""INO80 complex subunit Q"""	609504				9765390, 9654073	Standard	NM_006337		Approved	ICP22BP, MSP58, P78, MCRS2, INO80Q	uc001rui.1	Q96EZ8		ENST00000550165.1:c.637G>A	12.37:g.49957250C>T	ENSP00000448056:p.Glu213Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O14742|O75497|Q6VN53|Q7Z372	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.E226K	ENST00000550165.1	37	c.676	CCDS8787.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.915079	0.97099	.	.	ENSG00000187778	ENST00000546244;ENST00000343810;ENST00000550165;ENST00000357123;ENST00000553173	.	.	.	5.92	5.92	0.95590	.	0.087790	0.85682	D	0.000000	T	0.77157	0.4089	M	0.79614	2.46	0.80722	D	1	P;P;D	0.54207	0.793;0.956;0.965	B;P;P	0.57152	0.396;0.666;0.814	T	0.79286	-0.1866	9	0.87932	D	0	-30.4899	17.8152	0.88630	0.0:1.0:0.0:0.0	.	200;213;226	F8W126;Q96EZ8;Q96EZ8-2	.;MCRS1_HUMAN;.	K	22;213;213;226;200	.	ENSP00000345358:E213K	E	-	1	0	MCRS1	48243517	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.376000	0.79658	2.804000	0.96469	0.655000	0.94253	GAG	MCRS1	-	NULL	ENSG00000187778		0.582	MCRS1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MCRS1	HGNC	protein_coding	OTTHUMT00000405102.1	118	0.00	0	C	NM_006337		49957250	49957250	-1	no_errors	ENST00000357123	ensembl	human	known	69_37n	missense	115	24.34	37	SNP	1.000	T
MEGF8	1954	genome.wustl.edu	37	19	42841097	42841097	+	Silent	SNP	G	G	T	rs146980004		TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr19:42841097G>T	ENST00000251268.6	+	7	1383	c.1383G>T	c.(1381-1383)gtG>gtT	p.V461V	MEGF8_ENST00000334370.4_Silent_p.V461V	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	461					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				ATTACATGGTGGTCTATGGTG	0.647																																						dbGAP											0													105.0	72.0	83.0					19																	42841097		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.1383G>T	19.37:g.42841097G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAY0|O75097	Silent	SNP	pfam_CUB,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB,superfamily_Plexin-like_fold,smart_CUB,smart_EGF-like,smart_Plexin-like,smart_EGF-like_Ca-bd,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin	p.V461	ENST00000251268.6	37	c.1383		19																																																																																			MEGF8	-	NULL	ENSG00000105429		0.647	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	73	0.00	0	G	NM_001410		42841097	42841097	+1	no_errors	ENST00000251268	ensembl	human	known	69_37n	silent	105	17.97	23	SNP	0.998	T
MORC2	22880	genome.wustl.edu	37	22	31338115	31338115	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr22:31338115C>G	ENST00000397641.3	-	7	978	c.570G>C	c.(568-570)aaG>aaC	p.K190N	MORC2_ENST00000469915.1_5'UTR|MORC2_ENST00000215862.4_Missense_Mutation_p.K128N			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	190						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						CCCCAGGAATCTTCATAAACT	0.507																																						dbGAP											0													91.0	90.0	90.0					22																	31338115		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.570G>C	22.37:g.31338115C>G	ENSP00000380763:p.Lys190Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	pfam_Znf_CW,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Carb-bd_dom,pfscan_Znf_CW	p.K190N	ENST00000397641.3	37	c.570		22	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856923	0.71834	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.14266	2.52;2.52	5.47	5.47	0.80525	ATPase-like, ATP-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.36166	0.0957	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.07233	-1.0783	10	0.22109	T	0.4	.	12.6414	0.56712	0.0:0.9241:0.0:0.0759	.	190	Q9Y6X9	MORC2_HUMAN	N	190;128	ENSP00000380763:K190N;ENSP00000215862:K128N	ENSP00000215862:K128N	K	-	3	2	MORC2	29668115	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	1.879000	0.39618	2.577000	0.86979	0.555000	0.69702	AAG	MORC2	-	superfamily_ATPase-like_ATP-bd	ENSG00000133422		0.507	MORC2-001	KNOWN	basic|appris_principal	protein_coding	MORC2	HGNC	protein_coding	OTTHUMT00000321710.2	100	0.00	0	C	NM_014941		31338115	31338115	-1	no_errors	ENST00000397641	ensembl	human	known	69_37n	missense	80	17.53	17	SNP	1.000	G
MRC1	4360	genome.wustl.edu	37	10	18112248	18112248	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr10:18112248A>G	ENST00000239761.3	+	2	369	c.266A>G	c.(265-267)tAt>tGt	p.Y89C		NM_002438.2	NP_002429.1	P22897	MRC1_HUMAN	mannose receptor, C type 1	89	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	mannose binding (GO:0005537)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|kidney(1)|lung(2)|prostate(1)|urinary_tract(1)	6						ATCACTCTCTATGCCTGTGAC	0.398																																					GBM(115;1153 1594 28187 28781 35884)	dbGAP											0													93.0	95.0	94.0					10																	18112248		1307	2725	4032	-	-	-	SO:0001583	missense	0			J05550	CCDS7123.1, CCDS7123.2	10p13	2014-04-10			ENSG00000120586	ENSG00000260314		"""CD molecules"", ""C-type lectin domain containing"""	7228	protein-coding gene	gene with protein product		153618	"""mannose receptor, C type 1-like 1"""	MRC1L1		1294118	Standard	NM_002438		Approved	CLEC13D, CD206, bA541I19.1, CLEC13DL	uc031ptj.1	P22897	OTTHUMG00000174646	ENST00000239761.3:c.266A>G	10.37:g.18112248A>G	ENSP00000239761:p.Tyr89Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKW3|Q5VSJ2|Q5VSK2	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Ricin_B_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.Y89C	ENST00000239761.3	37	c.266	CCDS7123.1	10	.	.	.	.	.	.	.	.	.	.	A	10.34	1.322173	0.23994	.	.	ENSG00000120586	ENST00000239761	T	0.34275	1.37	4.12	2.87	0.33458	Ricin B-related lectin (1);Ricin B lectin (3);	0.143112	0.31113	N	0.008229	T	0.35970	0.0950	N	0.14661	0.345	0.29309	N	0.868123	D	0.89917	1.0	D	0.70487	0.969	T	0.09552	-1.0669	10	0.66056	D	0.02	.	7.0843	0.25249	0.7089:0.1479:0.0:0.1432	.	89	P22897	MRC1_HUMAN	C	89	ENSP00000239761:Y89C	ENSP00000239761:Y89C	Y	+	2	0	MRC1	18152254	0.185000	0.23213	0.803000	0.32268	0.207000	0.24258	3.742000	0.55097	1.627000	0.50400	0.352000	0.21897	TAT	MRC1	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000120586		0.398	MRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC1	HGNC	protein_coding	OTTHUMT00000047057.1	147	0.00	0	A	NM_002438		18112248	18112248	+1	no_errors	ENST00000239761	ensembl	human	known	69_37n	missense	104	40.23	70	SNP	0.700	G
MTCH1	23787	genome.wustl.edu	37	6	36937843	36937843	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr6:36937843A>G	ENST00000373627.5	-	11	1194	c.1070T>C	c.(1069-1071)aTt>aCt	p.I357T	MTCH1_ENST00000538808.1_Missense_Mutation_p.I184T|MTCH1_ENST00000471737.1_5'UTR|MTCH1_ENST00000373616.5_Missense_Mutation_p.I340T	NM_001271641.1	NP_001258570.1	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier 1	357					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|neuronal ion channel clustering (GO:0045161)|positive regulation of apoptotic process (GO:0043065)|regulation of signal transduction (GO:0009966)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						CCAGCAGTGAATCCAGGATTT	0.547																																						dbGAP											0													49.0	45.0	46.0					6																	36937843		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151822	CCDS4828.1, CCDS64411.1	6p21.2	2013-05-22	2011-05-19		ENSG00000137409	ENSG00000137409		"""Solute carriers"""	17586	protein-coding gene	gene with protein product	"""solute carrier family 25, member 49"""	610449	"""mitochondrial carrier homolog 1 (C. elegans)"""			12377771	Standard	NM_014341		Approved	CGI-64, PSAP, SLC25A49	uc003ond.2	Q9NZJ7	OTTHUMG00000014614	ENST00000373627.5:c.1070T>C	6.37:g.36937843A>G	ENSP00000362730:p.Ile357Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAX5|B2RCE3|Q6PK60|Q6UX45|Q7L465|Q9BW23|Q9NZR6|Q9UJZ5	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.I357T	ENST00000373627.5	37	c.1070		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.10|15.10	2.734161|2.734161	0.48939|0.48939	.|.	.|.	ENSG00000137409|ENSG00000137409	ENST00000418541|ENST00000373616;ENST00000373627;ENST00000337855;ENST00000460219;ENST00000538808	.|T;T;T;T	.|0.39229	.|1.09;1.09;1.09;1.09	5.52|5.52	5.52|5.52	0.82312|0.82312	.|Mitochondrial carrier domain (2);	.|0.165945	.|0.39985	.|N	.|0.001211	T|T	0.40372|0.40372	0.1114|0.1114	L|L	0.46157|0.46157	1.445|1.445	0.37973|0.37973	D|D	0.933363|0.933363	.|D;D;D;D	.|0.61697	.|0.979;0.985;0.979;0.99	.|P;P;P;P	.|0.56216	.|0.747;0.643;0.702;0.794	T|T	0.33828|0.33828	-0.9853|-0.9853	5|10	.|0.45353	.|T	.|0.12	-16.0567|-16.0567	14.2274|14.2274	0.65868|0.65868	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|184;339;357;340	.|B4E0C5;Q8IW90;Q9NZJ7;Q9NZJ7-2	.|.;.;MTCH1_HUMAN;.	L|T	171|340;357;276;324;184	.|ENSP00000362718:I340T;ENSP00000362730:I357T;ENSP00000419739:I324T;ENSP00000437660:I184T	.|ENSP00000338712:I276T	F|I	-|-	1|2	0|0	MTCH1|MTCH1	37045821|37045821	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	3.900000|3.900000	0.56295|0.56295	2.100000|2.100000	0.63781|0.63781	0.533000|0.533000	0.62120|0.62120	TTC|ATT	MTCH1	-	superfamily_Mt_carrier_dom	ENSG00000137409		0.547	MTCH1-008	KNOWN	basic|appris_principal	protein_coding	MTCH1	HGNC	protein_coding	OTTHUMT00000040396.1	57	0.00	0	A	NM_014341		36937843	36937843	-1	no_errors	ENST00000373627	ensembl	human	known	69_37n	missense	48	30.43	21	SNP	1.000	G
MTMR10	54893	genome.wustl.edu	37	15	31239429	31239429	+	Silent	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr15:31239429G>C	ENST00000435680.1	-	14	1549	c.1452C>G	c.(1450-1452)tcC>tcG	p.S484S	MTMR10_ENST00000425768.1_3'UTR|MTMR10_ENST00000314404.8_Silent_p.S236S|MTMR10_ENST00000563714.1_Silent_p.S402S	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	484	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.						phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		GGTAGGTTTCGGAGAACTCAA	0.478																																						dbGAP											0													140.0	140.0	140.0					15																	31239429		1897	4140	6037	-	-	-	SO:0001819	synonymous_variant	0			AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.1452C>G	15.37:g.31239429G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P4Q6	Silent	SNP	pfam_Myotubularin_assoc,pfam_Myotub-related	p.S484	ENST00000435680.1	37	c.1452	CCDS45204.1	15																																																																																			MTMR10	-	NULL	ENSG00000166912		0.478	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR10	HGNC	protein_coding	OTTHUMT00000430747.1	154	0.00	0	G	NM_017762		31239429	31239429	-1	no_errors	ENST00000435680	ensembl	human	known	69_37n	silent	109	39.78	72	SNP	0.000	C
MUC4	4585	genome.wustl.edu	37	3	195510877	195510877	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr3:195510877T>A	ENST00000463781.3	-	2	8033	c.7574A>T	c.(7573-7575)gAc>gTc	p.D2525V	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2525V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGGGTGGTGTCACCTGTGGA	0.582																																						dbGAP											0													96.0	84.0	88.0					3																	195510877		654	1591	2245	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7574A>T	3.37:g.195510877T>A	ENSP00000417498:p.Asp2525Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.D2525V	ENST00000463781.3	37	c.7574	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	5.516	0.280205	0.10458	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32988	1.5;1.43	.	.	.	.	.	.	.	.	T	0.15349	0.0370	N	0.19112	0.55	0.09310	N	0.999999	B	0.11235	0.004	B	0.01281	0.0	T	0.27706	-1.0066	7	.	.	.	.	3.3966	0.07308	0.5934:0.0:0.0:0.4066	.	2525	E7ESK3	.	V	2525	ENSP00000417498:D2525V;ENSP00000420243:D2525V	.	D	-	2	0	MUC4	196995272	0.007000	0.16637	0.004000	0.12327	0.000000	0.00434	-1.041000	0.03542	0.342000	0.23796	0.000000	0.15137	GAC	MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	380	0.00	0	T	NM_018406		195510877	195510877	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	627	12.66	91	SNP	0.139	A
MXRA5	25878	genome.wustl.edu	37	X	3241892	3241892	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chrX:3241892T>A	ENST00000217939.6	-	5	1988	c.1834A>T	c.(1834-1836)Att>Ttt	p.I612F		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	612	Ig-like C2-type 2.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TTTGGAAGAATCCAGCTAAGG	0.458																																						dbGAP											0													85.0	74.0	77.0					X																	3241892		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.1834A>T	X.37:g.3241892T>A	ENSP00000217939:p.Ile612Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.I612F	ENST00000217939.6	37	c.1834	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	T	11.30	1.597270	0.28445	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.01484	4.84	3.95	-4.82	0.03171	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.643517	0.12506	U	0.462869	T	0.02767	0.0083	L	0.39692	1.235	0.32906	D	0.513881	P	0.52577	0.954	P	0.57720	0.826	T	0.38779	-0.9645	10	0.16420	T	0.52	.	6.8069	0.23782	0.0:0.3436:0.1289:0.5275	.	612	Q9NR99	MXRA5_HUMAN	F	612	ENSP00000217939:I612F	ENSP00000217939:I612F	I	-	1	0	MXRA5	3251892	1.000000	0.71417	0.135000	0.22099	0.327000	0.28475	1.818000	0.39012	-0.783000	0.04534	0.427000	0.28365	ATT	MXRA5	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000101825		0.458	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	194	0.00	0	T	NM_015419		3241892	3241892	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	missense	107	23.57	33	SNP	0.994	A
MYC	4609	genome.wustl.edu	37	8	128753130	128753130	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr8:128753130G>A	ENST00000377970.2	+	3	1801	c.1291G>A	c.(1291-1293)Gaa>Aaa	p.E431K	MYC_ENST00000524013.1_Missense_Mutation_p.E430K	NM_002467.4	NP_002458	P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	416	Leucine-zipper.				branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	GCTCATTTCTGAAGAGGACTT	0.443		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""																																	dbGAP		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	0													85.0	91.0	89.0					8																	128753130		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000377970.2:c.1291G>A	8.37:g.128753130G>A	ENSP00000367207:p.Glu431Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8WFE7|P01107|Q14026	Missense_Mutation	SNP	pfam_Tscrpt_reg_Myc_N,pfam_Myc-LZ,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd,prints_Tscrpt_reg_Myc	p.E431K	ENST00000377970.2	37	c.1291	CCDS6359.2	8	.	.	.	.	.	.	.	.	.	.	G	13.26	2.184600	0.38609	.	.	ENSG00000136997	ENST00000377970;ENST00000524013;ENST00000454617	D;D	0.88586	-2.4;-2.4	5.39	5.39	0.77823	Helix-loop-helix DNA-binding (2);Leucine zipper, Myc (1);	0.222394	0.46758	D	0.000277	D	0.87865	0.6285	L	0.50333	1.59	0.80722	D	1	B	0.31459	0.324	B	0.34536	0.185	D	0.87278	0.2290	10	0.66056	D	0.02	-13.1156	18.133	0.89608	0.0:0.0:1.0:0.0	.	416	P01106	MYC_HUMAN	K	431;430;397	ENSP00000367207:E431K;ENSP00000430235:E430K	ENSP00000367207:E431K	E	+	1	0	MYC	128822312	0.996000	0.38824	0.882000	0.34594	0.102000	0.19082	2.564000	0.45931	2.519000	0.84933	0.650000	0.86243	GAA	MYC	-	pfam_Myc-LZ,superfamily_HLH_DNA-bd	ENSG00000136997		0.443	MYC-001	KNOWN	basic|CCDS	protein_coding	MYC	HGNC	protein_coding	OTTHUMT00000250277.3	29	0.00	0	G			128753130	128753130	+1	no_errors	ENST00000377970	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	0.964	A
MYO15A	51168	genome.wustl.edu	37	17	18082136	18082136	+	Silent	SNP	C	C	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr17:18082136C>A	ENST00000205890.5	+	66	10883	c.10545C>A	c.(10543-10545)gcC>gcA	p.A3515A	RP11-258F1.1_ENST00000577847.1_RNA|MYO15A_ENST00000451725.2_3'UTR|RP11-258F1.1_ENST00000583062.1_RNA|MYO15A_ENST00000418233.3_Missense_Mutation_p.P797T	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	3515	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					TGCTCAGTGCCCATGAGAAGC	0.617																																						dbGAP											0													123.0	138.0	133.0					17																	18082136		2143	4264	6407	-	-	-	SO:0001819	synonymous_variant	0			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.10545C>A	17.37:g.18082136C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFC7	Missense_Mutation	SNP	pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,superfamily_FERM_central,superfamily_SH3_domain,smart_SH3_domain,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom	p.P797T	ENST00000205890.5	37	c.2389	CCDS42271.1	17																																																																																			MYO15A	-	pfscan_FERM_domain	ENSG00000091536		0.617	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	212	0.00	0	C	NM_016239		18082136	18082136	+1	no_errors	ENST00000418233	ensembl	human	novel	69_37n	missense	69	57.32	94	SNP	1.000	A
MYO7B	4648	genome.wustl.edu	37	2	128346067	128346067	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr2:128346067A>C	ENST00000409816.2	+	14	1823	c.1791A>C	c.(1789-1791)ttA>ttC	p.L597F	MYO7B_ENST00000428314.1_Missense_Mutation_p.L597F|MYO7B_ENST00000389524.4_Missense_Mutation_p.L597F			Q6PIF6	MYO7B_HUMAN	myosin VIIB	597	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		ACTTGGAGTTAGCAGAGACCA	0.547																																						dbGAP											0													76.0	82.0	80.0					2																	128346067		1973	4138	6111	-	-	-	SO:0001583	missense	0				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.1791A>C	2.37:g.128346067A>C	ENSP00000386461:p.Leu597Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14786|Q8TEE1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.L597F	ENST00000409816.2	37	c.1791	CCDS46405.1	2	.	.	.	.	.	.	.	.	.	.	a	6.336	0.430088	0.11987	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	D;D;D	0.88586	-2.4;-2.4;-2.4	5.1	-10.2	0.00374	Myosin head, motor domain (2);	1.382370	0.04569	N	0.392994	D	0.84911	0.5577	L	0.48260	1.515	0.09310	N	1	P	0.43477	0.808	P	0.48738	0.588	T	0.80719	-0.1257	10	0.56958	D	0.05	.	4.7495	0.13054	0.3145:0.0:0.2546:0.4309	.	597	Q6PIF6	MYO7B_HUMAN	F	597	ENSP00000374175:L597F;ENSP00000415090:L597F;ENSP00000386461:L597F	ENSP00000374175:L597F	L	+	3	2	MYO7B	128062537	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-3.889000	0.00341	-1.942000	0.01040	-1.231000	0.01572	TTA	MYO7B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000169994		0.547	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	84	0.00	0	A	XM_291001		128346067	128346067	+1	no_errors	ENST00000389524	ensembl	human	known	69_37n	missense	85	26.09	30	SNP	0.000	C
NDRG1	10397	genome.wustl.edu	37	8	134260979	134260979	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr8:134260979C>G	ENST00000414097.2	-	11	1601	c.734G>C	c.(733-735)gGa>gCa	p.G245A	NDRG1_ENST00000518066.1_Intron|NDRG1_ENST00000522476.1_Missense_Mutation_p.G179A|NDRG1_ENST00000518176.1_Intron|NDRG1_ENST00000537882.1_Missense_Mutation_p.G164A|NDRG1_ENST00000354944.5_Missense_Mutation_p.G175A|NDRG1_ENST00000323851.7_Missense_Mutation_p.G245A|NDRG1_ENST00000521414.1_5'UTR	NM_001135242.1	NP_001128714.1	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	245					cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|mast cell activation (GO:0045576)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of spindle checkpoint (GO:0090232)|response to metal ion (GO:0010038)	cell-cell adherens junction (GO:0005913)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	cadherin binding (GO:0045296)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|Rab GTPase binding (GO:0017137)		NDRG1/ERG(5)	endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(4)|prostate(1)|skin(1)	17	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			TGTGTGGGTTCCCGGCATTGG	0.587			T	ERG	prostate																																	dbGAP		Dom	yes		8	8q24.3	10397	N-myc downstream regulated 1		E	0													115.0	111.0	113.0					8																	134260979		2203	4300	6503	-	-	-	SO:0001583	missense	0			X92845	CCDS34945.1, CCDS59112.1, CCDS59113.1	8q24	2014-09-17	2008-09-12		ENSG00000104419	ENSG00000104419			7679	protein-coding gene	gene with protein product		605262		CAP43		9251681, 8939898, 18455888	Standard	NM_006096		Approved	DRG1, RTP, TDD5, NDR1	uc003yue.2	Q92597	OTTHUMG00000164441	ENST00000414097.2:c.734G>C	8.37:g.134260979C>G	ENSP00000404854:p.Gly245Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR80|B7Z446|O15207|Q6IBG2|Q9NYR6|Q9UK29	Missense_Mutation	SNP	pfam_Ndr	p.G245A	ENST00000414097.2	37	c.734	CCDS34945.1	8	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951444	0.53186	.	.	ENSG00000104419	ENST00000323851;ENST00000354944;ENST00000414097;ENST00000537882;ENST00000535532;ENST00000522476	T;T;T;T;T	0.16457	2.34;2.34;2.34;2.34;2.34	5.87	4.94	0.65067	.	0.046716	0.85682	D	0.000000	T	0.30448	0.0765	M	0.90650	3.135	0.80722	D	1	B	0.29037	0.231	B	0.29267	0.1	T	0.14337	-1.0476	10	0.41790	T	0.15	-10.4889	15.5923	0.76543	0.0:0.8623:0.1377:0.0	.	245	Q92597	NDRG1_HUMAN	A	245;175;245;164;73;179	ENSP00000319977:G245A;ENSP00000347028:G175A;ENSP00000404854:G245A;ENSP00000437443:G164A;ENSP00000427894:G179A	ENSP00000319977:G245A	G	-	2	0	NDRG1	134330161	1.000000	0.71417	0.712000	0.30502	0.552000	0.35366	5.061000	0.64319	2.780000	0.95670	0.655000	0.94253	GGA	NDRG1	-	pfam_Ndr	ENSG00000104419		0.587	NDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDRG1	HGNC	protein_coding	OTTHUMT00000378805.1	64	0.00	0	C			134260979	134260979	-1	no_errors	ENST00000323851	ensembl	human	known	69_37n	missense	95	12.04	13	SNP	0.994	G
OR10T2	128360	genome.wustl.edu	37	1	158368709	158368709	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:158368709G>T	ENST00000334438.1	-	1	547	c.548C>A	c.(547-549)gCa>gAa	p.A183E		NM_001004475.1	NP_001004475.1	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T, member 2	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_hematologic(112;0.0378)					GATAACAGGTGCCATGTCACA	0.458																																						dbGAP											0													53.0	50.0	51.0					1																	158368709		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065643	CCDS30895.1	1q23.1	2012-08-09			ENSG00000186306	ENSG00000186306		"""GPCR / Class A : Olfactory receptors"""	14816	protein-coding gene	gene with protein product							Standard	NM_001004475		Approved		uc010pih.2	Q8NGX3	OTTHUMG00000017521	ENST00000334438.1:c.548C>A	1.37:g.158368709G>T	ENSP00000334115:p.Ala183Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF98	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A183E	ENST00000334438.1	37	c.548	CCDS30895.1	1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.165189	0.38217	.	.	ENSG00000186306	ENST00000334438	T	0.00115	8.71	4.57	4.57	0.56435	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41712	D	0.000822	T	0.00178	0.0005	L	0.58810	1.83	0.09310	N	1	P	0.51933	0.949	P	0.56343	0.796	T	0.50882	-0.8775	10	0.72032	D	0.01	.	16.2855	0.82717	0.0:0.0:1.0:0.0	.	183	Q8NGX3	O10T2_HUMAN	E	183	ENSP00000334115:A183E	ENSP00000334115:A183E	A	-	2	0	OR10T2	156635333	0.037000	0.19845	0.787000	0.31911	0.808000	0.45660	1.851000	0.39338	2.359000	0.80004	0.655000	0.94253	GCA	OR10T2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000186306		0.458	OR10T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10T2	HGNC	protein_coding	OTTHUMT00000046371.1	59	0.00	0	G	NM_001004475		158368709	158368709	-1	no_errors	ENST00000334438	ensembl	human	known	69_37n	missense	54	23.94	17	SNP	0.128	T
NPHS2	7827	genome.wustl.edu	37	1	179520518	179520518	+	Silent	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:179520518G>A	ENST00000367615.4	-	8	1010	c.942C>T	c.(940-942)ggC>ggT	p.G314G	NPHS2_ENST00000367616.4_Silent_p.G246G|AXDND1_ENST00000367618.3_Intron|RP11-545A16.1_ENST00000569644.1_RNA	NM_014625.2	NP_055440.1	Q9NP85	PODO_HUMAN	nephrosis 2, idiopathic, steroid-resistant (podocin)	314					actin cytoskeleton reorganization (GO:0031532)|excretion (GO:0007588)|metanephric glomerular visceral epithelial cell development (GO:0072249)	cell-cell junction (GO:0005911)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)				NS(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	20						CAGCAGGGGTGCCTGACAGAA	0.502																																						dbGAP											0													86.0	85.0	86.0					1																	179520518		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ279254	CCDS1331.1, CCDS72988.1	1q25-q31	2014-06-27			ENSG00000116218	ENSG00000116218			13394	protein-coding gene	gene with protein product		604766				8589695, 10742096	Standard	XM_005245483		Approved	SRN1, PDCN	uc001gmq.4	Q9NP85	OTTHUMG00000035252	ENST00000367615.4:c.942C>T	1.37:g.179520518G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM32|B1AM33|Q8N6Q5	Silent	SNP	pfam_Band_7,smart_Band_7,prints_Stomatin	p.G314	ENST00000367615.4	37	c.942	CCDS1331.1	1																																																																																			NPHS2	-	prints_Stomatin	ENSG00000116218		0.502	NPHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS2	HGNC	protein_coding	OTTHUMT00000085283.1	86	0.00	0	G			179520518	179520518	-1	no_errors	ENST00000367615	ensembl	human	known	69_37n	silent	45	39.19	29	SNP	0.352	A
OR4X2	119764	genome.wustl.edu	37	11	48266932	48266932	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr11:48266932delC	ENST00000302329.3	+	1	325	c.277delC	c.(277-279)cttfs	p.L93fs		NM_001004727.1	NP_001004727.1	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X, member 2	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(4)|lung(12)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	20						CATGGCACAGCTTTTCTTCTT	0.517																																						dbGAP											0													123.0	118.0	120.0					11																	48266932		2201	4298	6499	-	-	-	SO:0001589	frameshift_variant	0			AB065847	CCDS31486.1	11p11.2	2012-08-09			ENSG00000172208	ENSG00000172208		"""GPCR / Class A : Olfactory receptors"""	15184	protein-coding gene	gene with protein product							Standard	NM_001004727		Approved		uc001ngs.1	Q8NGF9	OTTHUMG00000165302	ENST00000302329.3:c.277delC	11.37:g.48266932delC	ENSP00000307751:p.Leu93fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNK3|Q6IF73|Q96R63	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L93fs	ENST00000302329.3	37	c.277	CCDS31486.1	11																																																																																			OR4X2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000172208		0.517	OR4X2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4X2	HGNC	protein_coding	OTTHUMT00000383376.2	148	0.00	0	C	NM_001004727		48266932	48266932	+1	no_errors	ENST00000302329	ensembl	human	known	69_37n	frame_shift_del	150	19.90	38	DEL	0.002	-
OR5I1	10798	genome.wustl.edu	37	11	55703108	55703108	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr11:55703108G>A	ENST00000301532.3	-	1	768	c.769C>T	c.(769-771)Ctc>Ttc	p.L257F		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	257					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						ATAAAGAGGAGAGTCCCTTGG	0.443																																						dbGAP											0													76.0	75.0	76.0					11																	55703108		2201	4296	6497	-	-	-	SO:0001583	missense	0			BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.769C>T	11.37:g.55703108G>A	ENSP00000301532:p.Leu257Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEU4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L257F	ENST00000301532.3	37	c.769	CCDS7949.1	11	.	.	.	.	.	.	.	.	.	.	G	11.95	1.791671	0.31685	.	.	ENSG00000167825	ENST00000301532	T	0.00174	8.62	5.16	0.778	0.18543	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41823	D	0.000803	T	0.00300	0.0009	L	0.54965	1.715	0.09310	N	1	D	0.63880	0.993	P	0.61070	0.883	T	0.50767	-0.8789	10	0.87932	D	0	.	4.9476	0.13997	0.0796:0.2712:0.5099:0.1394	.	257	Q13606	OR5I1_HUMAN	F	257	ENSP00000301532:L257F	ENSP00000301532:L257F	L	-	1	0	OR5I1	55459684	0.000000	0.05858	0.002000	0.10522	0.119000	0.20118	-0.914000	0.04038	0.251000	0.21505	0.643000	0.83706	CTC	OR5I1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000167825		0.443	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5I1	HGNC	protein_coding	OTTHUMT00000391528.1	149	0.00	0	G	NM_006637		55703108	55703108	-1	no_errors	ENST00000301532	ensembl	human	known	69_37n	missense	91	35.92	51	SNP	0.002	A
PACS1	55690	genome.wustl.edu	37	11	65983634	65983634	+	Silent	SNP	C	C	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr11:65983634C>T	ENST00000320580.4	+	5	738	c.705C>T	c.(703-705)caC>caT	p.H235H		NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	235					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)		RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						TTGGCCTACACAGCAACGTGA	0.522																																						dbGAP											0													123.0	102.0	109.0					11																	65983634		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.705C>T	11.37:g.65983634C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Silent	SNP	pfam_Phosphofurin_acidic_CS-1	p.H235	ENST00000320580.4	37	c.705	CCDS8129.1	11																																																																																			PACS1	-	NULL	ENSG00000175115		0.522	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PACS1	HGNC	protein_coding	OTTHUMT00000391690.2	97	0.00	0	C	NM_018026		65983634	65983634	+1	no_errors	ENST00000320580	ensembl	human	known	69_37n	silent	45	32.84	22	SNP	1.000	T
PDE4B	5142	genome.wustl.edu	37	1	66838157	66838157	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:66838157G>T	ENST00000329654.4	+	17	2194	c.2007G>T	c.(2005-2007)agG>agT	p.R669S	PDE4B_ENST00000371045.5_Missense_Mutation_p.R497S|PDE4B_ENST00000371049.3_Missense_Mutation_p.R669S|PDE4B_ENST00000423207.2_Missense_Mutation_p.R654S|PDE4B_ENST00000480109.2_Missense_Mutation_p.R436S	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	669					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	AGCAGAACAGGGACTGCCAGG	0.488																																						dbGAP											0													86.0	81.0	83.0					1																	66838157		2203	4300	6503	-	-	-	SO:0001583	missense	0			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.2007G>T	1.37:g.66838157G>T	ENSP00000332116:p.Arg669Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.R669S	ENST00000329654.4	37	c.2007	CCDS632.1	1	.	.	.	.	.	.	.	.	.	.	G	10.87	1.472939	0.26423	.	.	ENSG00000184588	ENST00000329654;ENST00000341517;ENST00000371049;ENST00000423207;ENST00000371045;ENST00000480109	T;T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4;-0.4	5.14	-3.98	0.04082	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.394868	0.30723	N	0.009004	T	0.17959	0.0431	N	0.08118	0	0.29770	N	0.834887	B;B;B;B;B	0.06786	0.0;0.0;0.001;0.0;0.0	B;B;B;B;B	0.14578	0.0;0.001;0.011;0.001;0.004	T	0.34675	-0.9819	10	0.09843	T	0.71	.	14.3866	0.66949	0.4675:0.0:0.5325:0.0	.	436;654;539;659;669	A5YW33;Q07343-3;Q13945;Q59GM8;Q07343	.;.;.;.;PDE4B_HUMAN	S	669;669;669;654;497;436	ENSP00000332116:R669S;ENSP00000342637:R669S;ENSP00000360088:R669S;ENSP00000392947:R654S;ENSP00000360084:R497S;ENSP00000432592:R436S	ENSP00000332116:R669S	R	+	3	2	PDE4B	66610745	0.949000	0.32298	0.978000	0.43139	0.966000	0.64601	0.338000	0.19858	-0.619000	0.05648	-0.782000	0.03352	AGG	PDE4B	-	NULL	ENSG00000184588		0.488	PDE4B-001	KNOWN	basic|CCDS	protein_coding	PDE4B	HGNC	protein_coding	OTTHUMT00000025188.3	73	0.00	0	G	NM_002600		66838157	66838157	+1	no_errors	ENST00000329654	ensembl	human	known	69_37n	missense	53	13.11	8	SNP	0.728	T
PDLIM7	9260	genome.wustl.edu	37	5	176910945	176910945	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr5:176910945C>G	ENST00000355841.2	-	12	1276	c.1210G>C	c.(1210-1212)Gac>Cac	p.D404H	PDLIM7_ENST00000359895.2_Missense_Mutation_p.D370H|PDLIM7_ENST00000356618.4_3'UTR|PDLIM7_ENST00000505746.1_5'UTR	NM_005451.3	NP_005442.2	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 (enigma)	404	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of osteoblast differentiation (GO:0045669)|receptor-mediated endocytosis (GO:0006898)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ruffle (GO:0001726)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	10	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATCTTGAAGTCACAGCCATGG	0.587																																						dbGAP											0													71.0	71.0	71.0					5																	176910945		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001093	CCDS4422.1, CCDS4423.1, CCDS4424.1	5q35.3	2008-02-05			ENSG00000196923	ENSG00000196923			22958	protein-coding gene	gene with protein product		605903				11874232	Standard	NM_005451		Approved	ENIGMA	uc003mhc.1	Q9NR12	OTTHUMG00000130853	ENST00000355841.2:c.1210G>C	5.37:g.176910945C>G	ENSP00000348099:p.Asp404His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14250|Q5XG82|Q6NVZ5|Q96C91|Q9BXB8|Q9BXB9	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.D404H	ENST00000355841.2	37	c.1210	CCDS4422.1	5	.	.	.	.	.	.	.	.	.	.	C	23.0	4.358837	0.82353	.	.	ENSG00000196923	ENST00000359895;ENST00000355841	D;D	0.87650	-2.28;-2.28	5.55	4.67	0.58626	Zinc finger, LIM-type (5);	0.000000	0.64402	D	0.000003	D	0.90246	0.6950	L	0.45422	1.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.90128	0.4204	10	0.54805	T	0.06	.	13.8481	0.63479	0.0:0.923:0.0:0.077	.	404;370	Q9NR12;Q9NR12-2	PDLI7_HUMAN;.	H	370;404	ENSP00000352964:D370H;ENSP00000348099:D404H	ENSP00000348099:D404H	D	-	1	0	PDLIM7	176843551	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.815000	0.62634	2.640000	0.89533	0.555000	0.69702	GAC	PDLIM7	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000196923		0.587	PDLIM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDLIM7	HGNC	protein_coding	OTTHUMT00000253423.1	54	0.00	0	C	NM_005451		176910945	176910945	-1	no_errors	ENST00000355841	ensembl	human	known	69_37n	missense	56	19.72	14	SNP	1.000	G
PEBP1	5037	genome.wustl.edu	37	12	118582484	118582484	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr12:118582484G>T	ENST00000261313.2	+	4	792	c.440G>T	c.(439-441)gGc>gTc	p.G147V	PEBP1_ENST00000542939.1_3'UTR	NM_002567.2	NP_002558.1	P30086	PEBP1_HUMAN	phosphatidylethanolamine binding protein 1	147						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GACCACCGTGGCAAATTCAAG	0.587																																					NSCLC(44;94 1357 12187 49467)	dbGAP											0													61.0	59.0	59.0					12																	118582484		2203	4300	6503	-	-	-	SO:0001583	missense	0			X85033	CCDS9187.1	12q24	2009-06-16	2006-02-16	2006-02-16	ENSG00000089220	ENSG00000089220			8630	protein-coding gene	gene with protein product	"""Raf kinase inhibitory protein"", ""hippocampal cholinergic neurostimulating peptide"""	604591	"""prostatic binding protein"""	PBP		15782137	Standard	NM_002567		Approved	RKIP, HCNP, PEBP	uc001twu.1	P30086	OTTHUMG00000168860	ENST00000261313.2:c.440G>T	12.37:g.118582484G>T	ENSP00000261313:p.Gly147Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4S1	Missense_Mutation	SNP	pfam_PtdEtn-bd_prot_PEBP,superfamily_PtdEtn-bd_prot_PEBP	p.G147V	ENST00000261313.2	37	c.440	CCDS9187.1	12	.	.	.	.	.	.	.	.	.	.	G	17.93	3.508018	0.64410	.	.	ENSG00000089220	ENST00000261313	T	0.42131	0.98	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.38480	0.1042	M	0.62723	1.935	0.80722	D	1	P	0.38167	0.621	B	0.34138	0.176	T	0.18935	-1.0321	10	0.30078	T	0.28	.	13.2148	0.59854	0.0767:0.0:0.9233:0.0	.	147	P30086	PEBP1_HUMAN	V	147	ENSP00000261313:G147V	ENSP00000261313:G147V	G	+	2	0	PEBP1	117066867	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.370000	0.79589	2.754000	0.94517	0.655000	0.94253	GGC	PEBP1	-	pfam_PtdEtn-bd_prot_PEBP,superfamily_PtdEtn-bd_prot_PEBP	ENSG00000089220		0.587	PEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEBP1	HGNC	protein_coding	OTTHUMT00000401405.1	92	0.00	0	G	NM_002567		118582484	118582484	+1	no_errors	ENST00000261313	ensembl	human	known	69_37n	missense	76	20.00	19	SNP	1.000	T
PEG3	5178	genome.wustl.edu	37	19	57325217	57325217	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr19:57325217G>C	ENST00000326441.9	-	10	4956	c.4593C>G	c.(4591-4593)atC>atG	p.I1531M	PEG3_ENST00000598410.1_Missense_Mutation_p.I1407M|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.I1405M|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.I1531M|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1531					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GCTCAAATATGATCATGCTGG	0.478																																						dbGAP											0													166.0	146.0	153.0					19																	57325217		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4593C>G	19.37:g.57325217G>C	ENSP00000326581:p.Ile1531Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.I1531M	ENST00000326441.9	37	c.4593	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	G	10.52	1.373554	0.24857	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02525	4.26;4.26	3.95	0.518	0.17030	.	0.158705	0.29900	N	0.010914	T	0.03390	0.0098	N	0.14661	0.345	.	.	.	P;B;B	0.50617	0.937;0.275;0.158	P;B;B	0.51806	0.68;0.11;0.038	T	0.42832	-0.9428	9	0.49607	T	0.09	-9.0682	11.608	0.51043	0.0:0.0:0.7775:0.2225	.	1407;1531;1466	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	M	1531	ENSP00000326581:I1531M;ENSP00000403051:I1531M	ENSP00000326581:I1531M	I	-	3	3	ZIM2	62017029	0.003000	0.15002	0.001000	0.08648	0.978000	0.69477	-0.474000	0.06607	0.156000	0.19299	0.591000	0.81541	ATC	PEG3	-	NULL	ENSG00000198300		0.478	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	180	0.00	0	G			57325217	57325217	-1	no_errors	ENST00000326441	ensembl	human	known	69_37n	missense	140	22.10	40	SNP	0.004	C
PHLPP1	23239	genome.wustl.edu	37	18	60642850	60642850	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr18:60642850A>G	ENST00000262719.5	+	16	4210	c.3976A>G	c.(3976-3978)Atc>Gtc	p.I1326V	PHLPP1_ENST00000400316.4_Missense_Mutation_p.I814V			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1326	PP2C-like.				apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						CAAGGCCATTATCACTGAGGT	0.493																																						dbGAP											0													93.0	90.0	91.0					18																	60642850		1986	4163	6149	-	-	-	SO:0001583	missense	0			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.3976A>G	18.37:g.60642850A>G	ENSP00000262719:p.Ile1326Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	pfam_PP2C-like,pfam_Leu-rich_rpt,superfamily_PP2C-like,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like,pfscan_Pleckstrin_homology	p.I1326V	ENST00000262719.5	37	c.3976	CCDS45881.2	18	.	.	.	.	.	.	.	.	.	.	A	12.64	1.999342	0.35226	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.12039	2.72;2.72	4.91	-1.51	0.08664	Protein phosphatase 2C-like (4);	.	.	.	.	T	0.06005	0.0156	N	0.16037	0.36	0.46927	D	0.999259	B	0.28026	0.198	B	0.30316	0.114	T	0.40757	-0.9546	9	0.02654	T	1	-8.5205	9.5568	0.39343	0.636:0.0:0.364:0.0	.	1326	O60346	PHLP1_HUMAN	V	814;1326	ENSP00000383170:I814V;ENSP00000262719:I1326V	ENSP00000262719:I1326V	I	+	1	0	PHLPP1	58793830	0.979000	0.34478	0.673000	0.29887	0.937000	0.57800	1.508000	0.35769	-0.426000	0.07360	0.454000	0.30748	ATC	PHLPP1	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000081913		0.493	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP1	HGNC	protein_coding	OTTHUMT00000319249.2	64	0.00	0	A	NM_194449		60642850	60642850	+1	no_errors	ENST00000262719	ensembl	human	known	69_37n	missense	51	17.74	11	SNP	0.997	G
PKHD1L1	93035	genome.wustl.edu	37	8	110499050	110499050	+	Splice_Site	DEL	G	G	-	rs372993231		TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr8:110499050delG	ENST00000378402.5	+	59	9984	c.9880delG	c.(9880-9882)gga>ga	p.G3294fs		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3294					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GACATTTAAAGGTTGGTATCA	0.338										HNSCC(38;0.096)																												dbGAP											0													173.0	167.0	169.0					8																	110499050		1879	4099	5978	-	-	-	SO:0001630	splice_region_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.9880+1G>-	8.37:g.110499050delG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Frame_Shift_Del	DEL	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.G3294fs	ENST00000378402.5	37	c.9880	CCDS47911.1	8																																																																																			PKHD1L1	-	superfamily_Pectin_lyase_fold/virulence,smart_PbH1	ENSG00000205038		0.338	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	192	0.00	0	G	NM_177531	Frame_Shift_Del	110499050	110499050	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	frame_shift_del	157	30.74	71	DEL	1.000	-
PPIP5K2	23262	genome.wustl.edu	37	5	102526670	102526670	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr5:102526670G>C	ENST00000358359.3	+	29	3989	c.3480G>C	c.(3478-3480)aaG>aaC	p.K1160N	PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.K1139N|PPIP5K2_ENST00000321521.9_Missense_Mutation_p.K1139N	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	1160					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TTCCACGGAAGACCGCTGAAA	0.348																																						dbGAP											0													113.0	113.0	113.0					5																	102526670		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.3480G>C	5.37:g.102526670G>C	ENSP00000351126:p.Lys1160Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2	p.K1160N	ENST00000358359.3	37	c.3480		5	.	.	.	.	.	.	.	.	.	.	G	6.158	0.397260	0.11638	.	.	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217;ENST00000509597	T;T;T;T	0.23950	2.48;2.48;2.48;1.88	5.15	4.28	0.50868	.	0.302778	0.31797	N	0.007051	T	0.20088	0.0483	L	0.36672	1.1	0.33106	D	0.539923	B;B;B	0.14438	0.005;0.008;0.01	B;B;B	0.20184	0.017;0.015;0.028	T	0.18871	-1.0323	10	0.17832	T	0.49	-15.102	12.6099	0.56546	0.0781:0.0:0.9219:0.0	.	1195;1139;1160	E9PGM8;O43314-2;O43314	.;.;VIP2_HUMAN	N	1139;1160;1195;1139;315	ENSP00000313070:K1139N;ENSP00000351126:K1160N;ENSP00000416016:K1139N;ENSP00000424948:K315N	ENSP00000313070:K1139N	K	+	3	2	PPIP5K2	102554569	0.980000	0.34600	0.989000	0.46669	0.095000	0.18619	1.428000	0.34892	1.493000	0.48517	0.655000	0.94253	AAG	PPIP5K2	-	NULL	ENSG00000145725		0.348	PPIP5K2-003	KNOWN	basic	protein_coding	PPIP5K2	HGNC	protein_coding	OTTHUMT00000370487.1	200	0.00	0	G	NM_015216		102526670	102526670	+1	no_errors	ENST00000358359	ensembl	human	known	69_37n	missense	75	32.43	36	SNP	1.000	C
PPP2CB	5516	genome.wustl.edu	37	8	30657145	30657145	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr8:30657145C>A	ENST00000221138.4	-	2	679	c.229G>T	c.(229-231)Gat>Tat	p.D77Y	PPP2CB_ENST00000518564.1_Intron|PPP2CB_ENST00000520500.1_5'UTR	NM_001009552.1	NP_001009552.1	P62714	PP2AB_HUMAN	protein phosphatase 2, catalytic subunit, beta isozyme	77					apoptotic mitochondrial changes (GO:0008637)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of Ras protein signal transduction (GO:0046580)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|regulation of gene expression (GO:0010468)|response to antibiotic (GO:0046677)|response to endoplasmic reticulum stress (GO:0034976)|response to hydrogen peroxide (GO:0042542)	chromosome, centromeric region (GO:0000775)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	9				KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	Vitamin E(DB00163)	TAGTTTGTATCCGGTGATTTT	0.378																																						dbGAP											0													138.0	135.0	136.0					8																	30657145		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6079.1	8p12	2011-05-24	2010-03-05		ENSG00000104695	ENSG00000104695	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9300	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, beta isoform"""	176916	"""protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform"""			8383590	Standard	NM_001009552		Approved	PP2Abeta	uc003xik.3	P62714	OTTHUMG00000163949	ENST00000221138.4:c.229G>T	8.37:g.30657145C>A	ENSP00000221138:p.Asp77Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSV4|P11082|Q6FHK5	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.D77Y	ENST00000221138.4	37	c.229	CCDS6079.1	8	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266903	0.80469	.	.	ENSG00000104695	ENST00000221138;ENST00000406655;ENST00000518243;ENST00000520056	D;D;D	0.85013	-1.93;-1.93;-1.93	4.47	4.47	0.54385	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.87521	0.6198	M	0.76328	2.33	0.80722	D	1	B	0.31054	0.306	B	0.38921	0.285	D	0.88764	0.3259	10	0.87932	D	0	-14.6476	17.0986	0.86642	0.0:1.0:0.0:0.0	.	77	P62714	PP2AB_HUMAN	Y	77;77;30;12	ENSP00000221138:D77Y;ENSP00000428618:D30Y;ENSP00000428866:D12Y	ENSP00000221138:D77Y	D	-	1	0	PPP2CB	30776687	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.814000	0.86154	2.165000	0.68154	0.655000	0.94253	GAT	PPP2CB	-	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	ENSG00000104695		0.378	PPP2CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2CB	HGNC	protein_coding	OTTHUMT00000376527.2	203	0.00	0	C	NM_001009552		30657145	30657145	-1	no_errors	ENST00000221138	ensembl	human	known	69_37n	missense	102	32.45	49	SNP	1.000	A
PQBP1	10084	genome.wustl.edu	37	X	48760064	48760064	+	Silent	SNP	C	C	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chrX:48760064C>T	ENST00000376563.1	+	6	833	c.633C>T	c.(631-633)gaC>gaT	p.D211D	PQBP1_ENST00000396763.1_Silent_p.D211D|PQBP1_ENST00000473764.1_3'UTR|PQBP1_ENST00000247140.4_Silent_p.D116D|PQBP1_ENST00000447146.2_Silent_p.D211D|PQBP1_ENST00000218224.4_Silent_p.D211D|PQBP1_ENST00000376566.4_Silent_p.D116D	NM_001032381.1|NM_001032382.1|NM_001032383.1|NM_001167989.1	NP_001027553.1|NP_001027554.1|NP_001027555.1|NP_001161461.1	O60828	PQBP1_HUMAN	polyglutamine binding protein 1	211	Intrinsically disordered.				alternative mRNA splicing, via spliceosome (GO:0000380)|neuron projection development (GO:0031175)|regulation of dendrite morphogenesis (GO:0048814)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|neuronal ribonucleoprotein granule (GO:0071598)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ribonucleoprotein complex binding (GO:0043021)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)	11						CATACTCAGACGCCCCCCGGT	0.572																																						dbGAP											0													117.0	81.0	93.0					X																	48760064		2202	4295	6497	-	-	-	SO:0001819	synonymous_variant	0			AJ005893	CCDS14309.1, CCDS55412.1	Xp11.23	2014-01-31			ENSG00000102103	ENSG00000102103			9330	protein-coding gene	gene with protein product		300463	"""Sutherland-Haan X-linked mental retardation syndrome"", ""mental retardation, X-linked 55"", ""mental retardation, X-linked 2 (non-dysmorphic)"""	RENS1, MRXS8, SHS, MRX55, MRX2		9875212, 15024694, 14634649	Standard	NM_144495		Approved		uc004dlg.3	O60828	OTTHUMG00000024128	ENST00000376563.1:c.633C>T	X.37:g.48760064C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VY25|Q4VY26|Q4VY27|Q4VY29|Q4VY30|Q4VY34|Q4VY35|Q4VY36|Q4VY37|Q4VY38|Q9GZP2|Q9GZU4|Q9GZZ4	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.T105M	ENST00000376563.1	37	c.314	CCDS14309.1	X	.	.	.	.	.	.	.	.	.	.	T	7.424	0.637338	0.14386	.	.	ENSG00000102103	ENST00000456306	.	.	.	5.34	-1.21	0.09524	.	.	.	.	.	T	0.54631	0.1870	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46898	-0.9158	4	.	.	.	-11.0983	9.1795	0.37131	0.0:0.4225:0.0:0.5775	.	.	.	.	M	105	.	.	T	+	2	0	PQBP1	48645008	0.980000	0.34600	0.975000	0.42487	0.774000	0.43823	0.040000	0.13905	-0.497000	0.06641	-1.079000	0.02226	ACG	PQBP1	-	NULL	ENSG00000102103		0.572	PQBP1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	PQBP1	HGNC	protein_coding	OTTHUMT00000060777.1	158	0.00	0	C	NM_001032381.1		48760064	48760064	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000456306	ensembl	human	known	69_37n	missense	202	16.53	40	SNP	0.994	T
RABGGTB	5876	genome.wustl.edu	37	1	76254953	76254953	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:76254953T>A	ENST00000319942.3	+	3	292	c.221T>A	c.(220-222)tTt>tAt	p.F74Y	RABGGTB_ENST00000496055.1_3'UTR|SNORD45C_ENST00000383893.1_RNA|RABGGTB_ENST00000535300.1_5'UTR|SNORD45B_ENST00000364617.1_RNA|SNORD45A_ENST00000384512.1_RNA|RABGGTB_ENST00000370826.3_Missense_Mutation_p.F74Y	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit	74					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						ATTCTGGCATTTATTAAGTCT	0.393																																						dbGAP											0													155.0	143.0	147.0					1																	76254953		2203	4300	6503	-	-	-	SO:0001583	missense	0			U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.221T>A	1.37:g.76254953T>A	ENSP00000317473:p.Phe74Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q92697	Missense_Mutation	SNP	pfam_Prenyltrans,superfamily_Terpenoid_cyclase/PrenylTrfase	p.F74Y	ENST00000319942.3	37	c.221	CCDS669.1	1	.	.	.	.	.	.	.	.	.	.	T	17.58	3.425894	0.62733	.	.	ENSG00000137955	ENST00000319942;ENST00000370824;ENST00000370826	T;T	0.41065	1.77;1.01	4.79	4.79	0.61399	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.000000	0.85682	D	0.000000	T	0.32496	0.0831	L	0.48218	1.51	0.80722	D	1	B;B	0.22146	0.065;0.025	B;B	0.39339	0.297;0.122	T	0.30822	-0.9965	10	0.44086	T	0.13	-21.4333	14.3162	0.66452	0.0:0.0:0.0:1.0	.	74;74	Q59GT6;P53611	.;PGTB2_HUMAN	Y	74	ENSP00000317473:F74Y;ENSP00000359862:F74Y	ENSP00000317473:F74Y	F	+	2	0	RABGGTB	76027541	1.000000	0.71417	0.955000	0.39395	0.591000	0.36615	7.671000	0.83941	1.782000	0.52362	0.460000	0.39030	TTT	RABGGTB	-	pfam_Prenyltrans,superfamily_Terpenoid_cyclase/PrenylTrfase	ENSG00000137955		0.393	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGGTB	HGNC	protein_coding	OTTHUMT00000026972.1	159	0.00	0	T	NM_004582		76254953	76254953	+1	no_errors	ENST00000319942	ensembl	human	known	69_37n	missense	168	28.81	68	SNP	1.000	A
SCN11A	11280	genome.wustl.edu	37	3	38951660	38951660	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr3:38951660A>G	ENST00000302328.3	-	8	1196	c.998T>C	c.(997-999)aTt>aCt	p.I333T	SCN11A_ENST00000450244.1_Missense_Mutation_p.I333T|SCN11A_ENST00000456224.3_Missense_Mutation_p.I333T|SCN11A_ENST00000444237.2_Missense_Mutation_p.I333T|AC116038.1_ENST00000401122.1_RNA	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	333					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTCAGGATTAATTTTGGTGTG	0.378																																						dbGAP											0													113.0	104.0	107.0					3																	38951660		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.998T>C	3.37:g.38951660A>G	ENSP00000307599:p.Ile333Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.I333T	ENST00000302328.3	37	c.998	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	A	5.958	0.360822	0.11296	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98362	-4.89;-4.89;-4.89;-4.89	4.97	-9.94	0.00449	Ion transport (1);	7.708540	0.00166	N	0.000009	D	0.91161	0.7216	N	0.11789	0.175	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	D	0.88206	0.2887	10	0.13470	T	0.59	.	1.0803	0.01641	0.1348:0.2804:0.1955:0.3893	.	333	Q9UI33	SCNBA_HUMAN	T	333	ENSP00000307599:I333T;ENSP00000400945:I333T;ENSP00000416757:I333T;ENSP00000408028:I333T	ENSP00000307599:I333T	I	-	2	0	SCN11A	38926664	0.000000	0.05858	0.000000	0.03702	0.448000	0.32197	-2.258000	0.01179	-2.592000	0.00456	-0.374000	0.07098	ATT	SCN11A	-	pfam_Ion_trans_dom	ENSG00000168356		0.378	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	120	0.00	0	A	NM_014139		38951660	38951660	-1	no_errors	ENST00000302328	ensembl	human	known	69_37n	missense	42	48.78	40	SNP	0.000	G
RBM6	10180	genome.wustl.edu	37	3	50005040	50005040	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr3:50005040C>T	ENST00000266022.4	+	3	441	c.182C>T	c.(181-183)tCg>tTg	p.S61L	RBM6_ENST00000441115.1_Intron|RBM6_ENST00000539992.1_Intron|RBM6_ENST00000422955.1_Intron|RBM6_ENST00000442092.1_Intron|RBM6_ENST00000443081.1_5'UTR	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	61					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		CAGGGGCATTCGGGGCCTCCT	0.517																																						dbGAP											0													88.0	95.0	93.0					3																	50005040		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.182C>T	3.37:g.50005040C>T	ENSP00000266022:p.Ser61Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O60549|O75524|Q86SS3	Missense_Mutation	SNP	pfam_G_patch_dom,smart_RRM_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_RRM_dom	p.S61L	ENST00000266022.4	37	c.182	CCDS2809.1	3	.	.	.	.	.	.	.	.	.	.	C	13.47	2.246962	0.39697	.	.	ENSG00000004534	ENST00000266022;ENST00000416583;ENST00000433811	T	0.33865	1.39	6.04	6.04	0.98038	.	0.303789	0.28821	N	0.014029	T	0.15739	0.0379	N	0.08118	0	0.80722	D	1	P	0.41131	0.739	B	0.22753	0.041	T	0.14035	-1.0487	9	.	.	.	-4.0181	15.3129	0.74048	0.1398:0.8602:0.0:0.0	.	61	P78332	RBM6_HUMAN	L	61	ENSP00000266022:S61L	.	S	+	2	0	RBM6	49980044	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.783000	0.55409	2.873000	0.98535	0.561000	0.74099	TCG	RBM6	-	NULL	ENSG00000004534		0.517	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM6	HGNC	protein_coding	OTTHUMT00000345528.4	143	0.00	0	C	NM_005777		50005040	50005040	+1	no_errors	ENST00000266022	ensembl	human	known	69_37n	missense	92	17.12	19	SNP	1.000	T
SCYL2	55681	genome.wustl.edu	37	12	100729669	100729669	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr12:100729669G>C	ENST00000360820.2	+	16	2447	c.2010G>C	c.(2008-2010)caG>caC	p.Q670H		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	670					endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						ACGGGTTACAGAATAAACATA	0.368																																						dbGAP											0													74.0	81.0	78.0					12																	100729669		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.2010G>C	12.37:g.100729669G>C	ENSP00000354061:p.Gln670His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.Q670H	ENST00000360820.2	37	c.2010	CCDS9076.1	12	.	.	.	.	.	.	.	.	.	.	G	8.506	0.865453	0.17250	.	.	ENSG00000136021	ENST00000549687;ENST00000360820	T;T	0.30714	1.83;1.52	5.21	-1.33	0.09172	.	0.835960	0.11040	N	0.606265	T	0.16811	0.0404	L	0.27053	0.805	0.09310	N	1	P	0.35600	0.511	B	0.31191	0.125	T	0.13202	-1.0518	10	0.45353	T	0.12	.	6.7149	0.23298	0.3326:0.2133:0.4541:0.0	.	670	Q6P3W7	SCYL2_HUMAN	H	670	ENSP00000448366:Q670H;ENSP00000354061:Q670H	ENSP00000354061:Q670H	Q	+	3	2	SCYL2	99253800	0.950000	0.32346	0.444000	0.26895	0.573000	0.36030	-0.045000	0.12003	-0.210000	0.10140	-0.176000	0.13171	CAG	SCYL2	-	NULL	ENSG00000136021		0.368	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL2	HGNC	protein_coding	OTTHUMT00000408493.2	74	0.00	0	G	NM_017988		100729669	100729669	+1	no_errors	ENST00000360820	ensembl	human	known	69_37n	missense	33	42.11	24	SNP	0.064	C
SEMA6B	10501	genome.wustl.edu	37	19	4555004	4555004	+	Silent	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr19:4555004G>A	ENST00000586582.1	-	8	976	c.666C>T	c.(664-666)gaC>gaT	p.D222D	SEMA6B_ENST00000586965.1_Silent_p.D222D|SEMA6B_ENST00000301293.3_Silent_p.D222D	NM_032108.3	NP_115484.2	Q9H3T3	SEM6B_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B	222	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCACTTGGAGTCATGTTTCA	0.562																																						dbGAP											0													111.0	97.0	102.0					19																	4555004		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB022433	CCDS12131.1	19p13.3	2008-07-22				ENSG00000167680		"""Semaphorins"""	10739	protein-coding gene	gene with protein product	"""Sema VIb"", ""semaphorin Z"", ""semaphorin VIB"""	608873		SEMAN		9361278	Standard	NM_032108		Approved	semaZ, SEMA-VIB, SEM-SEMA-Y	uc010dud.2	Q9H3T3		ENST00000586582.1:c.666C>T	19.37:g.4555004G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKU4|F6IB19|Q9NRK9	Silent	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	p.D222	ENST00000586582.1	37	c.666	CCDS12131.1	19																																																																																			SEMA6B	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000167680		0.562	SEMA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6B	HGNC	protein_coding	OTTHUMT00000458656.2	102	0.00	0	G	NM_032108		4555004	4555004	-1	no_errors	ENST00000301293	ensembl	human	known	69_37n	silent	62	25.30	21	SNP	1.000	A
SETBP1	26040	genome.wustl.edu	37	18	42643634	42643634	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr18:42643634C>G	ENST00000282030.5	+	6	5058	c.4762C>G	c.(4762-4764)Cga>Gga	p.R1588G		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1588						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GAGGAAGTCCCGAGGGAGTGA	0.682									Schinzel-Giedion syndrome																													dbGAP											0													13.0	17.0	16.0					18																	42643634		2132	4121	6253	-	-	-	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4762C>G	18.37:g.42643634C>G	ENSP00000282030:p.Arg1588Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.R1588G	ENST00000282030.5	37	c.4762	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	C	16.84	3.235093	0.58886	.	.	ENSG00000152217	ENST00000282030	T	0.72167	-0.63	4.97	3.04	0.35103	.	0.000000	0.44097	D	0.000492	T	0.71117	0.3302	N	0.24115	0.695	0.28267	N	0.924599	D	0.67145	0.996	D	0.63381	0.914	T	0.68021	-0.5519	10	0.87932	D	0	.	13.2539	0.60068	0.3645:0.6355:0.0:0.0	.	1588	Q9Y6X0	SETBP_HUMAN	G	1588	ENSP00000282030:R1588G	ENSP00000282030:R1588G	R	+	1	2	SETBP1	40897632	0.080000	0.21391	1.000000	0.80357	0.995000	0.86356	0.223000	0.17719	1.180000	0.42898	0.655000	0.94253	CGA	SETBP1	-	NULL	ENSG00000152217		0.682	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	22	0.00	0	C	NM_001130110		42643634	42643634	+1	no_errors	ENST00000282030	ensembl	human	known	69_37n	missense	4	63.64	7	SNP	1.000	G
SGK223	157285	genome.wustl.edu	37	8	8175701	8175701	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr8:8175701G>A	ENST00000520004.1	-	6	4448	c.4184C>T	c.(4183-4185)tCg>tTg	p.S1395L	SGK223_ENST00000330777.4_Missense_Mutation_p.S1395L			Q86YV5	SG223_HUMAN		0							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GAGCTTCAGCGACTGTAAGAG	0.652																																					GBM(34;731 755 10259 33573 33867)	dbGAP											0													23.0	30.0	28.0					8																	8175701		1980	4149	6129	-	-	-	SO:0001583	missense	0																														ENST00000520004.1:c.4184C>T	8.37:g.8175701G>A	ENSP00000428054:p.Ser1395Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N3N5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.S1395L	ENST00000520004.1	37	c.4184	CCDS43706.1	8	.	.	.	.	.	.	.	.	.	.	G	14.28	2.487684	0.44249	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.56611	0.45;0.45	5.48	5.48	0.80851	.	0.112952	0.64402	D	0.000020	T	0.34279	0.0892	N	0.08118	0	0.41904	D	0.990435	B	0.31837	0.342	B	0.22753	0.041	T	0.29397	-1.0013	10	0.51188	T	0.08	.	18.7301	0.91731	0.0:0.0:1.0:0.0	.	1395	Q86YV5	SG223_HUMAN	L	1395	ENSP00000330930:S1395L;ENSP00000428054:S1395L	ENSP00000330930:S1395L	S	-	2	0	AC068353.1	8213111	1.000000	0.71417	0.799000	0.32177	0.674000	0.39518	7.887000	0.87295	2.748000	0.94277	0.462000	0.41574	TCG	PRAGMIN	-	NULL	ENSG00000182319		0.652	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	Clone_based_vega_gene	protein_coding	OTTHUMT00000374864.1	24	0.00	0	G			8175701	8175701	-1	no_errors	ENST00000330777	ensembl	human	known	69_37n	missense	9	72.73	24	SNP	0.995	A
SNAP91	9892	genome.wustl.edu	37	6	84303249	84303249	+	Silent	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr6:84303249G>A	ENST00000439399.2	-	18	1960	c.1644C>T	c.(1642-1644)acC>acT	p.T548T	SNAP91_ENST00000369694.2_Silent_p.T548T|SNAP91_ENST00000521485.1_Silent_p.T548T|SNAP91_ENST00000428679.2_Silent_p.T548T|SNAP91_ENST00000521743.1_Silent_p.T548T|SNAP91_ENST00000520302.1_Silent_p.T546T|SNAP91_ENST00000195649.6_Silent_p.T548T|SNAP91_ENST00000437520.1_Intron|SNAP91_ENST00000520213.1_Intron	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	548	Ala-rich.|Thr-rich.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		cagcggaggtggtggtagtgg	0.572																																						dbGAP											0													18.0	23.0	21.0					6																	84303249		2090	4146	6236	-	-	-	SO:0001819	synonymous_variant	0			AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.1644C>T	6.37:g.84303249G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Silent	SNP	pfam_ANTH,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.T548	ENST00000439399.2	37	c.1644	CCDS47455.1	6																																																																																			SNAP91	-	NULL	ENSG00000065609		0.572	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SNAP91	HGNC	protein_coding	OTTHUMT00000375296.1	97	0.00	0	G			84303249	84303249	-1	no_errors	ENST00000369694	ensembl	human	known	69_37n	silent	75	48.28	70	SNP	1.000	A
SNX8	29886	genome.wustl.edu	37	7	2304030	2304030	+	Missense_Mutation	SNP	A	A	G	rs372187631		TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr7:2304030A>G	ENST00000222990.3	-	6	727	c.685T>C	c.(685-687)Tac>Cac	p.Y229H		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	229					early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		AAGCTATTGTAGATGTTCCGG	0.552																																						dbGAP											0													78.0	71.0	73.0					7																	2304030		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.685T>C	7.37:g.2304030A>G	ENSP00000222990:p.Tyr229His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D207|Q96I67	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.Y229H	ENST00000222990.3	37	c.685	CCDS5331.1	7	.	.	.	.	.	.	.	.	.	.	A	10.17	1.276923	0.23307	.	.	ENSG00000106266	ENST00000222990;ENST00000435060;ENST00000457286	.	.	.	5.04	5.04	0.67666	.	0.070543	0.64402	D	0.000017	T	0.27278	0.0669	N	0.02315	-0.6	0.41211	D	0.986446	B	0.06786	0.001	B	0.08055	0.003	T	0.13019	-1.0525	9	0.16420	T	0.52	.	14.7885	0.69821	1.0:0.0:0.0:0.0	.	229	Q9Y5X2	SNX8_HUMAN	H	229;215;176	.	ENSP00000222990:Y229H	Y	-	1	0	SNX8	2270556	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	6.513000	0.73742	1.897000	0.54924	0.533000	0.62120	TAC	SNX8	-	NULL	ENSG00000106266		0.552	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX8	HGNC	protein_coding	OTTHUMT00000322949.2	57	0.00	0	A			2304030	2304030	-1	no_errors	ENST00000222990	ensembl	human	known	69_37n	missense	30	54.41	37	SNP	1.000	G
SPOP	8405	genome.wustl.edu	37	17	47688699	47688699	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr17:47688699C>G	ENST00000393328.2	-	7	966	c.601G>C	c.(601-603)Gac>Cac	p.D201H	SPOP_ENST00000393331.3_Missense_Mutation_p.D201H|SPOP_ENST00000504102.1_Missense_Mutation_p.D201H|SPOP_ENST00000347630.2_Missense_Mutation_p.D201H|SPOP_ENST00000503676.1_Missense_Mutation_p.D201H	NM_003563.3	NP_003554.1	O43791	SPOP_HUMAN	speckle-type POZ protein	201	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.|Important for homodimerization.				glucose homeostasis (GO:0042593)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			endometrium(18)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(3)|prostate(33)	63						AAGCAGCAGTCTGTGAACCGG	0.463										Prostate(2;0.17)																												dbGAP											0													127.0	131.0	129.0					17																	47688699		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ000644	CCDS11551.1	17q21.33	2013-01-09			ENSG00000121067	ENSG00000121067		"""BTB/POZ domain containing"""	11254	protein-coding gene	gene with protein product		602650				9414087	Standard	NM_001007227		Approved	TEF2, BTBD32	uc002ipg.3	O43791	OTTHUMG00000161496	ENST00000393328.2:c.601G>C	17.37:g.47688699C>G	ENSP00000377001:p.Asp201His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6S3|D3DTW7|Q53HJ1	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_MATH,superfamily_TRAF-like,superfamily_BTB/POZ_fold,smart_MATH,smart_BTB/POZ-like,pfscan_BTB/POZ-like,pfscan_MATH	p.D201H	ENST00000393328.2	37	c.601	CCDS11551.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.226290	0.95173	.	.	ENSG00000121067	ENST00000393328;ENST00000393331;ENST00000347630;ENST00000504102;ENST00000503536;ENST00000503676;ENST00000513872;ENST00000509079;ENST00000505581	D;D;D;D;D;D;D	0.91407	-2.84;-2.84;-2.84;-2.84;-2.84;-2.84;-2.84	5.46	5.46	0.80206	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.97623	0.9221	H	0.98738	4.315	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98720	1.0708	10	0.87932	D	0	-35.0774	19.0836	0.93192	0.0:1.0:0.0:0.0	.	201	O43791	SPOP_HUMAN	H	201;201;201;201;85;201;154;201;201	ENSP00000377001:D201H;ENSP00000377004:D201H;ENSP00000240327:D201H;ENSP00000425905:D201H;ENSP00000420908:D201H;ENSP00000426986:D201H;ENSP00000420960:D201H	ENSP00000240327:D201H	D	-	1	0	SPOP	45043698	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.603000	0.82811	2.847000	0.97988	0.591000	0.81541	GAC	SPOP	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000121067		0.463	SPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPOP	HGNC	protein_coding	OTTHUMT00000365154.2	95	0.00	0	C	NM_003563		47688699	47688699	-1	no_errors	ENST00000347630	ensembl	human	known	69_37n	missense	78	17.89	17	SNP	1.000	G
SPAG9	9043	genome.wustl.edu	37	17	49091680	49091680	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr17:49091680C>G	ENST00000262013.7	-	9	1334	c.1126G>C	c.(1126-1128)Gat>Cat	p.D376H	SPAG9_ENST00000510283.1_Missense_Mutation_p.D219H|SPAG9_ENST00000505279.1_Missense_Mutation_p.D362H|SPAG9_ENST00000357122.4_Missense_Mutation_p.D362H	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	376					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			GTATTGCGATCAAAAGCTTTG	0.398																																						dbGAP											0													147.0	130.0	135.0					17																	49091680		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.1126G>C	17.37:g.49091680C>G	ENSP00000262013:p.Asp376His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.D376H	ENST00000262013.7	37	c.1126	CCDS45740.1	17	.	.	.	.	.	.	.	.	.	.	C	24.6	4.547617	0.86022	.	.	ENSG00000008294	ENST00000262013;ENST00000376407;ENST00000357804;ENST00000357791;ENST00000510283;ENST00000505279;ENST00000357122;ENST00000511795	T;T;T;T	0.25250	1.84;1.81;1.84;1.84	5.63	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.44787	0.1310	L	0.55481	1.735	0.80722	D	1	D;P;B;B;D;B	0.76494	0.999;0.936;0.372;0.141;0.999;0.24	D;P;P;B;D;P	0.69307	0.963;0.839;0.569;0.365;0.946;0.569	T	0.36648	-0.9739	10	0.49607	T	0.09	-17.3	14.6818	0.69023	0.0:0.9303:0.0:0.0697	.	362;376;362;376;362;219	O60271-5;O60271-3;O60271-2;O60271;O60271-4;E7ENU2	.;.;.;JIP4_HUMAN;.;.	H	376;132;118;118;219;362;362;46	ENSP00000262013:D376H;ENSP00000423165:D219H;ENSP00000426900:D362H;ENSP00000349636:D362H	ENSP00000262013:D376H	D	-	1	0	SPAG9	46446679	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.984000	0.70548	1.521000	0.48983	0.591000	0.81541	GAT	SPAG9	-	NULL	ENSG00000008294		0.398	SPAG9-001	KNOWN	basic|CCDS	protein_coding	SPAG9	HGNC	protein_coding	OTTHUMT00000368543.2	169	0.00	0	C	NM_003971		49091680	49091680	-1	no_errors	ENST00000262013	ensembl	human	known	69_37n	missense	139	16.27	27	SNP	1.000	G
SPRTN	83932	genome.wustl.edu	37	1	231488731	231488731	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:231488731C>G	ENST00000295050.7	+	5	1430	c.1094C>G	c.(1093-1095)tCt>tGt	p.S365C	SPRTN_ENST00000391858.4_3'UTR	NM_001010984.2|NM_032018.5	NP_001010984.1|NP_114407.3	Q9H040	SPRTN_HUMAN	SprT-like N-terminal domain	365					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of protein ubiquitination (GO:0031398)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|ubiquitin binding (GO:0043130)										AACTCAGTCTCTTCTAGTTCT	0.408																																						dbGAP											0													90.0	92.0	91.0					1																	231488731		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL512744	CCDS1594.1, CCDS31054.1, CCDS58066.1	1q42.12-q43	2013-01-30	2012-06-18	2012-06-18	ENSG00000010072	ENSG00000010072			25356	protein-coding gene	gene with protein product	"""SprT-like domain at the N terminus"", ""DNA damage-targeting VCP (p97) adaptor"""		"""chromosome 1 open reading frame 124"""	C1orf124		22681887	Standard	NM_032018		Approved	DKFZP547N043, Spartan, DVC1	uc001hur.4	Q9H040	OTTHUMG00000038022	ENST00000295050.7:c.1094C>G	1.37:g.231488731C>G	ENSP00000295050:p.Ser365Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKT0|B5MEF7|Q5TE78|Q6UWW6|Q96BC5|Q96KA0	Missense_Mutation	SNP	pfam_SprT-like_domain,smart_SprT-like_domain,smart_Znf_Rad18_put	p.S365C	ENST00000295050.7	37	c.1094	CCDS1594.1	1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.760975	0.49468	.	.	ENSG00000010072	ENST00000295050	T	0.48836	0.8	4.2	4.2	0.49525	.	0.269349	0.37178	N	0.002206	T	0.47710	0.1460	L	0.29908	0.895	0.27419	N	0.954355	D	0.67145	0.996	P	0.57371	0.819	T	0.33979	-0.9847	10	0.45353	T	0.12	-3.4181	10.5521	0.45095	0.0:0.9093:0.0:0.0907	.	365	Q9H040	CA124_HUMAN	C	365	ENSP00000295050:S365C	ENSP00000295050:S365C	S	+	2	0	C1orf124	229555354	0.009000	0.17119	0.006000	0.13384	0.024000	0.10985	2.346000	0.44027	2.648000	0.89879	0.643000	0.83706	TCT	SPRTN	-	NULL	ENSG00000010072		0.408	SPRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRTN	HGNC	protein_coding	OTTHUMT00000092858.1	114	0.00	0	C	NM_032018		231488731	231488731	+1	no_errors	ENST00000295050	ensembl	human	known	69_37n	missense	188	18.26	42	SNP	0.005	G
SPTBN5	51332	genome.wustl.edu	37	15	42144921	42144921	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr15:42144921C>G	ENST00000320955.6	-	61	10587	c.10360G>C	c.(10360-10362)Gat>Cat	p.D3454H	RNA5SP393_ENST00000363423.1_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	3454					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		AACTCCACATCTGACACTGAG	0.592																																						dbGAP											0													140.0	144.0	143.0					15																	42144921		1984	4166	6150	-	-	-	SO:0001583	missense	0			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.10360G>C	15.37:g.42144921C>G	ENSP00000317790:p.Asp3454His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.D3454H	ENST00000320955.6	37	c.10360		15	.	.	.	.	.	.	.	.	.	.	.	15.64	2.893371	0.52121	.	.	ENSG00000137877	ENST00000320955	T	0.66995	-0.24	4.73	3.81	0.43845	.	0.153273	0.42172	D	0.000756	T	0.74619	0.3740	L	0.58669	1.825	0.22001	N	0.999421	D	0.89917	1.0	D	0.79108	0.992	T	0.63305	-0.6667	10	0.38643	T	0.18	.	8.4525	0.32880	0.0:0.8176:0.0:0.1824	.	3454	Q9NRC6	SPTN5_HUMAN	H	3454	ENSP00000317790:D3454H	ENSP00000317790:D3454H	D	-	1	0	SPTBN5	39932213	0.966000	0.33281	0.290000	0.24890	0.182000	0.23217	3.146000	0.50631	0.975000	0.38392	0.655000	0.94253	GAT	SPTBN5	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000137877		0.592	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	SPTBN5	HGNC	protein_coding	OTTHUMT00000420237.1	69	0.00	0	C	NM_016642		42144921	42144921	-1	no_errors	ENST00000320955	ensembl	human	known	69_37n	missense	32	40.74	22	SNP	0.567	G
SRP68	6730	genome.wustl.edu	37	17	74068454	74068454	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr17:74068454T>C	ENST00000307877.2	-	1	280	c.119A>G	c.(118-120)gAa>gGa	p.E40G	GALR2_ENST00000329003.3_5'Flank|SRP68_ENST00000539137.1_Missense_Mutation_p.E40G|SRP68_ENST00000355113.5_5'UTR	NM_014230.3	NP_055045.2	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	40					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|ribosome (GO:0005840)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			NS(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|lung(4)|ovary(2)|prostate(3)	23						GCGTTCGTTTTCTTTATTTTC	0.622																																						dbGAP											0													142.0	146.0	145.0					17																	74068454		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF195951	CCDS11738.1, CCDS58600.1, CCDS58601.1	17q25.1	2010-04-30	2002-08-29		ENSG00000167881	ENSG00000167881			11302	protein-coding gene	gene with protein product		604858	"""signal recognition particle 68kD"""			10618370	Standard	NM_014230		Approved		uc002jqk.2	Q9UHB9		ENST00000307877.2:c.119A>G	17.37:g.74068454T>C	ENSP00000312066:p.Glu40Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUU5|B3KWY7|G3V1U4|Q8NCJ4|Q8WUK2	Missense_Mutation	SNP	NULL	p.E40G	ENST00000307877.2	37	c.119	CCDS11738.1	17	.	.	.	.	.	.	.	.	.	.	T	20.7	4.037467	0.75617	.	.	ENSG00000167881	ENST00000539137;ENST00000540937;ENST00000307877;ENST00000304220	.	.	.	5.1	5.1	0.69264	.	0.176075	0.42682	D	0.000670	T	0.63426	0.2510	L	0.28115	0.83	0.80722	D	1	D;D	0.61080	0.989;0.989	D;D	0.70487	0.969;0.969	T	0.66260	-0.5968	9	0.54805	T	0.06	-22.5173	13.7677	0.63006	0.0:0.0:0.0:1.0	.	40;40	G3V1U4;Q9UHB9	.;SRP68_HUMAN	G	40	.	ENSP00000307756:E40G	E	-	2	0	SRP68	71580049	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.142000	0.64820	2.053000	0.61076	0.443000	0.29094	GAA	SRP68	-	NULL	ENSG00000167881		0.622	SRP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP68	HGNC	protein_coding	OTTHUMT00000449487.1	46	0.00	0	T	NM_014230		74068454	74068454	-1	no_errors	ENST00000307877	ensembl	human	known	69_37n	missense	54	55.37	67	SNP	1.000	C
SRPK1	6732	genome.wustl.edu	37	6	35836837	35836837	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr6:35836837C>T	ENST00000373825.2	-	12	1747	c.1462G>A	c.(1462-1464)Gca>Aca	p.A488T	SRPK1_ENST00000423325.2_Missense_Mutation_p.A472T|SRPK1_ENST00000373822.1_Missense_Mutation_p.A381T					SRSF protein kinase 1											endometrium(2)|large_intestine(10)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21						AGCTTTTCTGCATTTTTTGGC	0.398																																					NSCLC(31;67 978 16289 24856 26454)	dbGAP											0													90.0	88.0	88.0					6																	35836837		2048	4251	6299	-	-	-	SO:0001583	missense	0			U09564	CCDS47415.1	6p21.31	2010-06-23	2010-06-23		ENSG00000096063	ENSG00000096063			11305	protein-coding gene	gene with protein product	"""SR protein kinase 1"", ""serine/arginine-rich splicing factor kinase 1"""	601939	"""SFRS protein kinase 1"""			8208298, 10198174	Standard	NM_003137		Approved	SFRSK1	uc003olj.3	Q96SB4	OTTHUMG00000014583	ENST00000373825.2:c.1462G>A	6.37:g.35836837C>T	ENSP00000362931:p.Ala488Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A488T	ENST00000373825.2	37	c.1462	CCDS47415.1	6	.	.	.	.	.	.	.	.	.	.	C	28.9	4.957951	0.92726	.	.	ENSG00000096063	ENST00000373825;ENST00000361690;ENST00000423325;ENST00000373822	T;T;T;T	0.20069	2.1;2.1;2.1;2.1	6.08	6.08	0.98989	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.28433	0.0703	N	0.25890	0.77	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.87578	0.995;0.998	T	0.01729	-1.1286	9	0.42905	T	0.14	-13.8709	20.6634	0.99662	0.0:1.0:0.0:0.0	.	472;488	B4DS61;Q96SB4	.;SRPK1_HUMAN	T	488;504;472;381	ENSP00000362931:A488T;ENSP00000354674:A504T;ENSP00000391069:A472T;ENSP00000362928:A381T	ENSP00000354674:A504T	A	-	1	0	SRPK1	35944815	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.548000	0.67255	2.894000	0.99253	0.655000	0.94253	GCA	SRPK1	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000096063		0.398	SRPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPK1	HGNC	protein_coding	OTTHUMT00000040319.3	209	0.00	0	C	NM_003137		35836837	35836837	-1	no_errors	ENST00000373825	ensembl	human	known	69_37n	missense	143	47.43	129	SNP	1.000	T
ST8SIA6	338596	genome.wustl.edu	37	10	17363189	17363189	+	Missense_Mutation	SNP	C	C	A	rs190435399		TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr10:17363189C>A	ENST00000377602.4	-	8	959	c.885G>T	c.(883-885)aaG>aaT	p.K295N		NM_001004470.1	NP_001004470.1	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6	295					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycolipid biosynthetic process (GO:0009247)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked glycosylation (GO:0006493)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			endometrium(3)|kidney(3)|large_intestine(4)|liver(1)|lung(24)|ovary(1)|skin(1)	37						AAAATAGAACCTTTTGTCTTG	0.448																																						dbGAP											0													173.0	177.0	176.0					10																	17363189		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31158.1	10p13	2013-03-01	2005-02-07	2005-02-07	ENSG00000148488	ENSG00000148488		"""Sialyltransferases"""	23317	protein-coding gene	gene with protein product	"""ST8Sia VI"""	610139	"""sialyltransferase 8F (alpha-2, 8-sialyltransferase)"""	SIAT8F		11980897	Standard	XR_242697		Approved		uc001ipd.3	P61647	OTTHUMG00000017748	ENST00000377602.4:c.885G>T	10.37:g.17363189C>A	ENSP00000366827:p.Lys295Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ97|B9EH72|Q5VZH4	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.K295N	ENST00000377602.4	37	c.885	CCDS31158.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.11|16.11	3.029601|3.029601	0.54790|0.54790	.|.	.|.	ENSG00000148488|ENSG00000148488	ENST00000377610;ENST00000377602|ENST00000440449	T|.	0.34472|.	1.36|.	5.18|5.18	1.34|1.34	0.21922|0.21922	.|.	0.204960|.	0.51477|.	D|.	0.000081|.	T|T	0.60457|0.60457	0.2270|0.2270	M|M	0.64997|0.64997	1.995|1.995	0.35363|0.35363	D|D	0.788373|0.788373	D|.	0.54772|.	0.968|.	P|.	0.55303|.	0.773|.	T|T	0.63937|0.63937	-0.6524|-0.6524	10|5	0.54805|.	T|.	0.06|.	-6.527|-6.527	9.4078|9.4078	0.38473|0.38473	0.0:0.6836:0.0:0.3164|0.0:0.6836:0.0:0.3164	.|.	295|.	P61647|.	SIA8F_HUMAN|.	N|L	125;295|116	ENSP00000366827:K295N|.	ENSP00000366827:K295N|.	K|V	-|-	3|1	2|0	ST8SIA6|ST8SIA6	17403195|17403195	0.986000|0.986000	0.35501|0.35501	0.929000|0.929000	0.37066|0.37066	0.992000|0.992000	0.81027|0.81027	0.627000|0.627000	0.24506|0.24506	0.164000|0.164000	0.19529|0.19529	0.650000|0.650000	0.86243|0.86243	AAG|GTG	ST8SIA6	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000148488		0.448	ST8SIA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST8SIA6	HGNC	protein_coding	OTTHUMT00000047036.1	141	0.00	0	C	NM_001004470		17363189	17363189	-1	no_errors	ENST00000377602	ensembl	human	known	69_37n	missense	85	28.57	34	SNP	0.893	A
STX12	23673	genome.wustl.edu	37	1	28128254	28128254	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:28128254G>T	ENST00000373943.4	+	4	479	c.354G>T	c.(352-354)caG>caT	p.Q118H	STX12_ENST00000468761.1_3'UTR	NM_177424.2	NP_803173.1	Q86Y82	STX12_HUMAN	syntaxin 12	118					cholesterol efflux (GO:0033344)|intracellular protein transport (GO:0006886)|protein stabilization (GO:0050821)|synaptic vesicle exocytosis (GO:0016079)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|central_nervous_system(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|all_lung(284;9.43e-05)|Lung NSC(340;0.000185)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;3.96e-24)|Colorectal(126;3.46e-08)|COAD - Colon adenocarcinoma(152;1.83e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00258)|KIRC - Kidney renal clear cell carcinoma(1967;0.00302)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0649)		ACAATTTCCAGGCTGTGCAGA	0.433																																					Ovarian(5;5 342 2097 9488 34083)	dbGAP											0													72.0	70.0	71.0					1																	28128254		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC046999	CCDS310.1	1p35.3	2008-05-14			ENSG00000117758	ENSG00000117758			11430	protein-coding gene	gene with protein product		606892				9507000	Standard	NM_177424		Approved	STX13, STX14	uc001bou.4	Q86Y82	OTTHUMG00000003730	ENST00000373943.4:c.354G>T	1.37:g.28128254G>T	ENSP00000363054:p.Gln118His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AJQ7|O95564	Missense_Mutation	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.Q118H	ENST00000373943.4	37	c.354	CCDS310.1	1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.286064	0.59867	.	.	ENSG00000117758	ENST00000373943;ENST00000440806	T	0.46451	0.87	5.4	3.53	0.40419	t-SNARE (1);Syntaxin, N-terminal (1);	0.095984	0.64402	D	0.000001	T	0.64260	0.2582	M	0.85197	2.74	0.35239	D	0.777643	D	0.76494	0.999	D	0.91635	0.999	T	0.73341	-0.4013	10	0.72032	D	0.01	1.2804	8.7842	0.34809	0.3521:0.0:0.6479:0.0	.	118	Q86Y82	STX12_HUMAN	H	118	ENSP00000363054:Q118H	ENSP00000363054:Q118H	Q	+	3	2	STX12	28000841	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	0.762000	0.26503	0.660000	0.30964	-0.424000	0.05967	CAG	STX12	-	superfamily_t-SNARE,smart_Syntaxin_N	ENSG00000117758		0.433	STX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX12	HGNC	protein_coding	OTTHUMT00000010519.1	55	0.00	0	G	NM_177424		28128254	28128254	+1	no_errors	ENST00000373943	ensembl	human	known	69_37n	missense	48	20.00	12	SNP	1.000	T
SZT2	23334	genome.wustl.edu	37	1	43907741	43907744	+	Frame_Shift_Del	DEL	GAGC	GAGC	-			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	GAGC	GAGC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:43907741_43907744delGAGC	ENST00000562955.1	+	55	7642_7645	c.7642_7645delGAGC	c.(7642-7647)gagcggfs	p.ER2548fs	SZT2_ENST00000372442.1_Frame_Shift_Del_p.ER1706fs	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2605					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)		p.E1706K(2)		NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CCCTGCAGCTGAGCGGCATCTGCT	0.637																																						dbGAP											2	Substitution - Missense(2)	upper_aerodigestive_tract(2)																																								-	-	-	SO:0001589	frameshift_variant	0			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.7642_7645delGAGC	1.37:g.43907741_43907744delGAGC	ENSP00000457168:p.Glu2548fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Frame_Shift_Del	DEL	NULL	p.E2548fs	ENST00000562955.1	37	c.7642_7645	CCDS30694.2	1																																																																																			SZT2	-	NULL	ENSG00000198198		0.637	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	HGNC	protein_coding	OTTHUMT00000019517.3	74	0.00	0	GAGC	NM_015284		43907741	43907744	+1	no_errors	ENST00000562955	ensembl	human	known	69_37n	frame_shift_del	51	27.14	19	DEL	0.941:0.951:0.949:0.947	-
TAC1	6863	genome.wustl.edu	37	7	97361936	97361936	+	Silent	SNP	C	C	G	rs201382322	byFrequency	TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr7:97361936C>G	ENST00000319273.5	+	2	309	c.12C>G	c.(10-12)ctC>ctG	p.L4L	TAC1_ENST00000346867.4_Silent_p.L4L|TAC1_ENST00000350485.4_Silent_p.L4L	NM_003182.2	NP_003173.1	P20366	TKN1_HUMAN	tachykinin, precursor 1	4					associative learning (GO:0008306)|cell-cell signaling (GO:0007267)|detection of abiotic stimulus (GO:0009582)|inflammatory response (GO:0006954)|insemination (GO:0007320)|long-term memory (GO:0007616)|negative regulation of heart rate (GO:0010459)|neuropeptide signaling pathway (GO:0007218)|positive regulation of action potential (GO:0045760)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of ossification (GO:0045778)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of saliva secretion (GO:0046878)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of blood pressure (GO:0008217)|response to hormone (GO:0009725)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)|tachykinin receptor signaling pathway (GO:0007217)	axon (GO:0030424)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				large_intestine(4)|lung(6)|urinary_tract(1)	11	all_cancers(62;3.95e-09)|all_epithelial(64;1.1e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0358)|all_lung(186;0.0384)					TGAAAATCCTCGTGGCCTTGG	0.443													C|||	28	0.00559105	0.0	0.0	5008	,	,		18750	0.0		0.0	False		,,,				2504	0.0286					dbGAP											0													167.0	160.0	163.0					7																	97361936		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M68907	CCDS5649.1, CCDS5650.1, CCDS5651.1	7q21-q22	2013-02-26	2008-01-17		ENSG00000006128	ENSG00000006128		"""Endogenous ligands"""	11517	protein-coding gene	gene with protein product	"""substance K"", ""substance P"", ""neurokinin 1"", ""neurokinin 2"", ""neuromedin L"", ""neurokinin alpha"", ""neuropeptide K"", ""neuropeptide gamma"", ""preprotachykinin"""	162320	"""tachykinin, precursor 1 (substance K, substance P, neurokinin 1, neurokinin 2, neuromedin L, neurokinin alpha, neuropeptide K, neuropeptide gamma)"""	TAC2, NKNA		1708336	Standard	NM_003182		Approved	NPK	uc003uop.4	P20366	OTTHUMG00000154069	ENST00000319273.5:c.12C>G	7.37:g.97361936C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O60600|O60601|Q00072|Q53GH4|Q549V0|Q549V1|Q549V2|Q6FHM1	Silent	SNP	smart_Tachykinin,prints_Protachykinin	p.L4	ENST00000319273.5	37	c.12	CCDS5649.1	7																																																																																			TAC1	-	prints_Protachykinin	ENSG00000006128		0.443	TAC1-001	KNOWN	basic|CCDS	protein_coding	TAC1	HGNC	protein_coding	OTTHUMT00000333696.1	209	0.48	1	C	NM_003182		97361936	97361936	+1	no_errors	ENST00000319273	ensembl	human	known	69_37n	silent	123	37.88	75	SNP	1.000	G
TDRD10	126668	genome.wustl.edu	37	1	154516883	154516883	+	Silent	SNP	C	C	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr1:154516883C>A	ENST00000368480.3	+	10	772	c.687C>A	c.(685-687)acC>acA	p.T229T	TDRD10_ENST00000479937.1_3'UTR|TDRD10_ENST00000368482.4_Silent_p.T229T			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	229	Tudor.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGTTTAGCACCCTGGCTCAGG	0.612																																						dbGAP											0													32.0	24.0	27.0					1																	154516883		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.687C>A	1.37:g.154516883C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Silent	SNP	pfam_Tudor,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.T229	ENST00000368480.3	37	c.687	CCDS41406.1	1																																																																																			TDRD10	-	pfam_Tudor	ENSG00000163239		0.612	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD10	HGNC	protein_coding	OTTHUMT00000090700.2	28	0.00	0	C	NM_182499		154516883	154516883	+1	no_errors	ENST00000368480	ensembl	human	known	69_37n	silent	34	49.25	33	SNP	0.025	A
TET1	80312	genome.wustl.edu	37	10	70405672	70405672	+	Silent	SNP	T	T	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr10:70405672T>C	ENST00000373644.4	+	4	3395	c.3186T>C	c.(3184-3186)gaT>gaC	p.D1062D		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1062					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						ACTCAGATGATCTATCATGTC	0.378																																						dbGAP											0													125.0	118.0	120.0					10																	70405672		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.3186T>C	10.37:g.70405672T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Silent	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.D1062	ENST00000373644.4	37	c.3186	CCDS7281.1	10																																																																																			TET1	-	NULL	ENSG00000138336		0.378	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1	84	0.00	0	T	NM_030625		70405672	70405672	+1	no_errors	ENST00000373644	ensembl	human	known	69_37n	silent	70	38.60	44	SNP	0.000	C
TP53	7157	genome.wustl.edu	37	17	7578403	7578403	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr17:7578403C>A	ENST00000269305.4	-	5	716	c.527G>T	c.(526-528)tGc>tTc	p.C176F	TP53_ENST00000445888.2_Missense_Mutation_p.C176F|TP53_ENST00000413465.2_Missense_Mutation_p.C176F|TP53_ENST00000455263.2_Missense_Mutation_p.C176F|TP53_ENST00000359597.4_Missense_Mutation_p.C176F|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.C176F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176F(129)|p.C176Y(63)|p.C83F(9)|p.C44F(9)|p.C176S(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C44Y(3)|p.C83Y(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*3(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGTGGGGGCAGCGCCTCAC	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	267	Substitution - Missense(224)|Deletion - Frameshift(18)|Deletion - In frame(13)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	lung(42)|large_intestine(38)|upper_aerodigestive_tract(36)|oesophagus(26)|breast(26)|liver(20)|ovary(19)|haematopoietic_and_lymphoid_tissue(13)|stomach(10)|central_nervous_system(9)|bone(9)|urinary_tract(7)|genital_tract(2)|skin(2)|pancreas(2)|prostate(2)|adrenal_gland(1)|vulva(1)|biliary_tract(1)|endometrium(1)											49.0	49.0	49.0					17																	7578403		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.527G>T	17.37:g.7578403C>A	ENSP00000269305:p.Cys176Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C176F	ENST00000269305.4	37	c.527	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	23.6	4.433429	0.83776	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61	5.59	4.61	0.57282	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99981	0.9994	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.994;0.996;0.998;0.997;0.995;0.997	D	0.96187	0.9135	10	0.87932	D	0	-18.1821	13.8336	0.63395	0.1543:0.8457:0.0:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176F;ENSP00000352610:C176F;ENSP00000269305:C176F;ENSP00000398846:C176F;ENSP00000391127:C176F;ENSP00000391478:C176F;ENSP00000425104:C44F;ENSP00000423862:C83F	ENSP00000269305:C176F	C	-	2	0	TP53	7519128	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	7.775000	0.85489	1.472000	0.48140	0.655000	0.94253	TGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	72	0.00	0	C	NM_000546		7578403	7578403	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	31	56.94	41	SNP	1.000	A
TPD52L1	7164	genome.wustl.edu	37	6	125569511	125569511	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr6:125569511A>G	ENST00000534000.1	+	4	664	c.368A>G	c.(367-369)aAg>aGg	p.K123R	TPD52L1_ENST00000304877.13_Missense_Mutation_p.K123R|TPD52L1_ENST00000534199.1_Missense_Mutation_p.K94R|TPD52L1_ENST00000532429.1_Missense_Mutation_p.K94R|HDDC2_ENST00000608456.1_Intron|TPD52L1_ENST00000524679.1_Missense_Mutation_p.K94R|TPD52L1_ENST00000392482.2_Missense_Mutation_p.K94R|TPD52L1_ENST00000530868.1_3'UTR|TPD52L1_ENST00000528193.1_Missense_Mutation_p.K123R|TPD52L1_ENST00000368402.5_Missense_Mutation_p.K123R|TPD52L1_ENST00000527711.1_Missense_Mutation_p.K123R|TPD52L1_ENST00000368388.2_Missense_Mutation_p.K123R	NM_003287.2	NP_003278.1	Q16890	TPD53_HUMAN	tumor protein D52-like 1	123					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(2)|prostate(1)	5			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		GCCATCAGCAAGAAGTTCGGA	0.483																																						dbGAP											0													127.0	103.0	111.0					6																	125569511		2203	4300	6503	-	-	-	SO:0001583	missense	0			U44427	CCDS5130.1, CCDS34527.1, CCDS34528.1, CCDS43502.1, CCDS75513.1, CCDS75514.1	6q22-q23	2008-07-29			ENSG00000111907	ENSG00000111907			12006	protein-coding gene	gene with protein product		604069				8812487, 16112108	Standard	NM_003287		Approved	D53, hD53	uc003pzu.1	Q16890	OTTHUMG00000015505	ENST00000534000.1:c.368A>G	6.37:g.125569511A>G	ENSP00000434142:p.Lys123Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K757|A8K772|A8MUD2|A8MUJ7|A8MW70|F6V707|O43397|Q5TC99|Q5TDQ0|Q9BUQ6|Q9C054	Missense_Mutation	SNP	pfam_TPD52	p.K123R	ENST00000534000.1	37	c.368	CCDS5130.1	6	.	.	.	.	.	.	.	.	.	.	A	5.743	0.321501	0.10845	.	.	ENSG00000111907	ENST00000304877;ENST00000534000;ENST00000368402;ENST00000368388;ENST00000527711;ENST00000528193;ENST00000532429;ENST00000534199;ENST00000392482;ENST00000524679;ENST00000392484	T;T;T;T;T;T;T;T;T;T	0.24538	1.85;2.0;2.0;1.85;1.85;2.0;1.85;1.85;1.85;1.85	5.58	0.448	0.16614	.	0.181713	0.64402	N	0.000016	T	0.04048	0.0113	N	0.11106	0.095	0.41886	D	0.990343	B;B;B;B	0.11235	0.004;0.0;0.0;0.003	B;B;B;B	0.17722	0.009;0.001;0.001;0.019	T	0.30297	-0.9983	9	.	.	.	-24.7894	9.4893	0.38948	0.7245:0.0:0.2755:0.0	.	123;123;123;123	E9PPQ1;Q16890-3;Q16890-2;Q16890	.;.;.;TPD53_HUMAN	R	123;123;123;123;123;123;94;94;94;94;123	ENSP00000306285:K123R;ENSP00000434142:K123R;ENSP00000357387:K123R;ENSP00000357373:K123R;ENSP00000436953:K123R;ENSP00000434743:K123R;ENSP00000435447:K94R;ENSP00000432590:K94R;ENSP00000376273:K94R;ENSP00000432787:K94R	.	K	+	2	0	TPD52L1	125611210	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.921000	0.40035	0.123000	0.18342	0.528000	0.53228	AAG	TPD52L1	-	pfam_TPD52	ENSG00000111907		0.483	TPD52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPD52L1	HGNC	protein_coding	OTTHUMT00000042065.2	99	1.00	1	A			125569511	125569511	+1	no_errors	ENST00000534000	ensembl	human	known	69_37n	missense	85	14.14	14	SNP	1.000	G
TRIM6	117854	genome.wustl.edu	37	11	5624731	5624731	+	Nonsense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr11:5624731C>G	ENST00000278302.5	+	2	329	c.189C>G	c.(187-189)taC>taG	p.Y63*	TRIM6_ENST00000515022.1_Intron|TRIM6_ENST00000445329.1_Intron|AC015691.13_ENST00000394793.2_RNA|HBG2_ENST00000380259.2_Intron|TRIM6-TRIM34_ENST00000354852.5_Nonsense_Mutation_p.Y91*|TRIM6_ENST00000380107.1_Nonsense_Mutation_p.Y63*|TRIM6_ENST00000380097.3_Nonsense_Mutation_p.Y91*|TRIM6_ENST00000507320.1_Intron|TRIM6_ENST00000506134.1_Intron	NM_001198645.1|NM_058166.4	NP_001185574.1|NP_477514.1	Q9C030	TRIM6_HUMAN	tripartite motif containing 6	63					protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|prostate(2)|stomach(1)	22		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		AGACCAGCTACCAGCCAGGGA	0.567																																						dbGAP											0													86.0	82.0	84.0					11																	5624731		2201	4297	6498	-	-	-	SO:0001587	stop_gained	0			AF220030	CCDS31389.1, CCDS31390.1, CCDS55738.1	11p15	2013-01-09	2011-01-25		ENSG00000121236	ENSG00000121236		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16277	protein-coding gene	gene with protein product		607564	"""tripartite motif-containing 6"""			11331580	Standard	NM_058166		Approved	RNF89		Q9C030	OTTHUMG00000150029	ENST00000278302.5:c.189C>G	11.37:g.5624731C>G	ENSP00000278302:p.Tyr63*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2A7|B4DDQ5|Q86WZ8|Q9HCR1	Nonsense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.Y91*	ENST00000278302.5	37	c.273	CCDS31390.1	11	.	.	.	.	.	.	.	.	.	.	C	17.07	3.295991	0.60086	.	.	ENSG00000121236;ENSG00000121236;ENSG00000121236;ENSG00000258659;ENSG00000258588	ENST00000278302;ENST00000380107;ENST00000380097;ENST00000337072;ENST00000354852	.	.	.	4.4	3.47	0.39725	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.1899	0.48679	0.0:0.9074:0.0:0.0926	.	.	.	.	X	63;63;91;91;91	.	ENSP00000278302:Y63X	Y	+	3	2	TRIM34;TRIM6;TRIM6-TRIM34	5581307	0.002000	0.14202	0.925000	0.36789	0.018000	0.09664	0.409000	0.21082	1.412000	0.46977	0.655000	0.94253	TAC	TRIM34	-	NULL	ENSG00000258659		0.567	TRIM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM34	HGNC	protein_coding	OTTHUMT00000143376.2	125	0.00	0	C	NM_001003818		5624731	5624731	+1	no_errors	ENST00000337072	ensembl	human	known	69_37n	nonsense	116	22.00	33	SNP	0.975	G
TSC2	7249	genome.wustl.edu	37	16	2112513	2112513	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr16:2112513A>T	ENST00000219476.3	+	13	1903	c.1273A>T	c.(1273-1275)Aac>Tac	p.N425Y	TSC2_ENST00000401874.2_Missense_Mutation_p.N425Y|TSC2_ENST00000350773.4_Missense_Mutation_p.N425Y|TSC2_ENST00000353929.4_Missense_Mutation_p.N425Y|TSC2_ENST00000568454.1_Missense_Mutation_p.N436Y|TSC2_ENST00000382538.6_Missense_Mutation_p.N376Y|TSC2_ENST00000439673.2_Missense_Mutation_p.N388Y	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	425					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CTCCCTCCTGAACCTGATCTC	0.602			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													dbGAP	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0													48.0	48.0	48.0					16																	2112513		2197	4299	6496	-	-	-	SO:0001583	missense	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.1273A>T	16.37:g.2112513A>T	ENSP00000219476:p.Asn425Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	pfam_Tuberin-type_domain,pfam_Tuberin_N,pfam_Rap_GAP,superfamily_ARM-type_fold,prints_Tuberin,pfscan_Rap_GAP	p.N425Y	ENST00000219476.3	37	c.1273	CCDS10458.1	16	.	.	.	.	.	.	.	.	.	.	.	13.48	2.248757	0.39797	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	T;T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41;-0.41	5.24	4.13	0.48395	Armadillo-type fold (1);Tuberin, N-terminal (1);	0.104879	0.64402	D	0.000005	T	0.71256	0.3318	L	0.50333	1.59	0.47183	D	0.99934	D;D;D;D;D;D	0.76494	0.995;0.997;0.98;0.997;0.997;0.999	D;D;P;D;D;D	0.87578	0.953;0.976;0.815;0.976;0.979;0.998	T	0.69194	-0.5209	10	0.02654	T	1	-38.5257	11.3906	0.49811	0.8642:0.0:0.0:0.1358	.	376;388;425;425;425;425	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	Y	425;425;425;388;376;425	ENSP00000219476:N425Y;ENSP00000384468:N425Y;ENSP00000248099:N425Y;ENSP00000399232:N388Y;ENSP00000371978:N376Y;ENSP00000344383:N425Y	ENSP00000219476:N425Y	N	+	1	0	TSC2	2052514	1.000000	0.71417	0.653000	0.29593	0.066000	0.16364	8.956000	0.93066	0.805000	0.34159	-0.333000	0.08304	AAC	TSC2	-	pfam_Tuberin_N,superfamily_ARM-type_fold	ENSG00000103197		0.602	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSC2	HGNC	protein_coding	OTTHUMT00000250657.2	85	0.00	0	A	NM_000548		2112513	2112513	+1	no_errors	ENST00000219476	ensembl	human	known	69_37n	missense	61	22.78	18	SNP	1.000	T
TTC3	7267	genome.wustl.edu	37	21	38525425	38525425	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr21:38525425G>A	ENST00000399017.2	+	27	5335	c.2588G>A	c.(2587-2589)aGa>aAa	p.R863K	TTC3_ENST00000355666.1_Missense_Mutation_p.R863K|TTC3_ENST00000354749.2_Missense_Mutation_p.R863K|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000540756.1_Missense_Mutation_p.R553K	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	863					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TTTTCTAGCAGAAATTTTCTA	0.348																																					Ovarian(38;194 1649 35661)	dbGAP											0													81.0	89.0	86.0					21																	38525425		2203	4300	6503	-	-	-	SO:0001583	missense	0			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.2588G>A	21.37:g.38525425G>A	ENSP00000381981:p.Arg863Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_DEATH-like,smart_TPR_repeat,smart_Znf_RING,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.R863K	ENST00000399017.2	37	c.2588	CCDS13651.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.722|9.722	1.159972|1.159972	0.21454|0.21454	.|.	.|.	ENSG00000182670|ENSG00000182670	ENST00000414818;ENST00000411496|ENST00000418766;ENST00000438055;ENST00000355666;ENST00000540756;ENST00000399017;ENST00000354749	.|T;T;T;T;T;T	.|0.40225	.|2.85;2.85;3.22;1.04;3.22;3.22	4.79|4.79	-0.373|-0.373	0.12516|0.12516	.|.	.|0.647462	.|0.15179	.|N	.|0.276206	T|T	0.24084|0.24084	0.0583|0.0583	L|L	0.31294|0.31294	0.92|0.92	0.09310|0.09310	N|N	1|1	.|B;B	.|0.10296	.|0.0;0.003	.|B;B	.|0.06405	.|0.0;0.002	T|T	0.30357|0.30357	-0.9981|-0.9981	5|10	.|0.07990	.|T	.|0.79	-11.7584|-11.7584	9.1193|9.1193	0.36778|0.36778	0.3865:0.0:0.6135:0.0|0.3865:0.0:0.6135:0.0	.|.	.|553;863	.|B4DSZ9;P53804	.|.;TTC3_HUMAN	K|K	227;1|863;845;863;553;863;863	.|ENSP00000403943:R863K;ENSP00000391891:R845K;ENSP00000347889:R863K;ENSP00000442875:R553K;ENSP00000381981:R863K;ENSP00000346791:R863K	.|ENSP00000346791:R863K	E|R	+|+	1|2	0|0	TTC3|TTC3	37447295|37447295	0.999000|0.999000	0.42202|0.42202	0.992000|0.992000	0.48379|0.48379	0.989000|0.989000	0.77384|0.77384	2.681000|2.681000	0.46926|0.46926	-0.170000|-0.170000	0.10816|0.10816	-0.142000|-0.142000	0.14014|0.14014	GAA|AGA	TTC3	-	superfamily_DEATH-like	ENSG00000182670		0.348	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	HGNC	protein_coding	OTTHUMT00000194776.1	95	0.00	0	G			38525425	38525425	+1	no_errors	ENST00000354749	ensembl	human	known	69_37n	missense	75	14.77	13	SNP	0.190	A
TTN	7273	genome.wustl.edu	37	2	179443774	179443774	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr2:179443774C>G	ENST00000591111.1	-	270	63284	c.63060G>C	c.(63058-63060)atG>atC	p.M21020I	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.M22661I|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.M13721I|TTN_ENST00000460472.2_Missense_Mutation_p.M13596I|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.M13788I|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.M20093I|TTN-AS1_ENST00000586831.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21020	Fibronectin type-III 52. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTTTAAGGTCATGGCTTCTG	0.478																																						dbGAP											0													93.0	91.0	92.0					2																	179443774		1958	4134	6092	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63060G>C	2.37:g.179443774C>G	ENSP00000465570:p.Met21020Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.M20093I	ENST00000591111.1	37	c.60279		2	.	.	.	.	.	.	.	.	.	.	C	9.721	1.159791	0.21454	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.67	-2.69	0.06022	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.18215	0.0437	N	0.02865	-0.47	0.28154	N	0.929281	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.001	T	0.21965	-1.0230	9	0.87932	D	0	.	9.2621	0.37619	0.0915:0.4979:0.0:0.4106	.	13596;13721;13788;21020	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	20093;13596;13788;13721;13594	ENSP00000343764:M20093I;ENSP00000434586:M13596I;ENSP00000340554:M13788I;ENSP00000352154:M13721I	ENSP00000340554:M13788I	M	-	3	0	TTN	179152020	0.004000	0.15560	0.989000	0.46669	0.999000	0.98932	-1.272000	0.02826	-0.347000	0.08299	0.650000	0.86243	ATG	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.478	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	179	0.56	1	C	NM_133378		179443774	179443774	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	213	12.35	30	SNP	0.510	G
UNC80	285175	genome.wustl.edu	37	2	210761052	210761052	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr2:210761052G>C	ENST00000439458.1	+	27	4378	c.4298G>C	c.(4297-4299)aGt>aCt	p.S1433T	UNC80_ENST00000272845.6_Missense_Mutation_p.S1428T	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1433					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AGTCCTTGGAGTGCAAGCGAG	0.488																																						dbGAP											0													134.0	125.0	127.0					2																	210761052		692	1591	2283	-	-	-	SO:0001583	missense	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.4298G>C	2.37:g.210761052G>C	ENSP00000391088:p.Ser1433Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.S1433T	ENST00000439458.1	37	c.4298	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595282	0.66219	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.30714	1.52;1.52	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.47469	0.1447	L	0.47190	1.495	0.80722	D	1	D	0.56035	0.974	D	0.70487	0.969	T	0.14117	-1.0484	10	0.09084	T	0.74	-13.8348	19.7959	0.96481	0.0:0.0:1.0:0.0	.	1433	Q8N2C7	UNC80_HUMAN	T	1433;1428	ENSP00000391088:S1433T;ENSP00000272845:S1428T	ENSP00000272845:S1428T	S	+	2	0	UNC80	210469297	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.374000	0.97172	2.689000	0.91719	0.655000	0.94253	AGT	UNC80	-	NULL	ENSG00000144406		0.488	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		202	0.00	0	G	NM_182587		210761052	210761052	+1	no_errors	ENST00000439458	ensembl	human	known	69_37n	missense	81	48.73	77	SNP	1.000	C
EPPIN	57119	genome.wustl.edu	37	20	44168036	44168036	+	IGR	SNP	G	G	T	rs553341164		TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr20:44168036G>T	ENST00000354280.4	-	0	1987				WFDC6_ENST00000372670.3_Nonsense_Mutation_p.S4*|EPPIN_ENST00000555685.1_Intron|EPPIN-WFDC6_ENST00000504988.1_Intron|WFDC6_ENST00000600168.1_Nonsense_Mutation_p.S4*	NM_020398.3	NP_065131.1	O95925	EPPI_HUMAN	epididymal peptidase inhibitor						defense response to bacterium (GO:0042742)|negative regulation of peptidase activity (GO:0010466)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										CAGAAGTCCTGAGAGTCCCAT	0.532																																						dbGAP											0													116.0	104.0	108.0					20																	44168036		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AF286370	CCDS13359.1	20q13.12	2014-01-21	2012-08-22	2012-08-22	ENSG00000101448	ENSG00000101448		"""WAP four-disulfide core domain containing"""	15932	protein-coding gene	gene with protein product	"""epididymal protease inhibitor"", ""cancer/testis antigen 72"""	609031	"""serine protease inhibitor-like, with Kunitz and WAP domains 1 (eppin)"", ""serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin)"""	SPINLW1		11404006, 12206714	Standard	NM_020398		Approved	EPPIN1, EPPIN2, EPPIN3, dJ461P17.2, WAP7, WFDC7, CT71		O95925	OTTHUMG00000032588		20.37:g.44168036G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVD6|Q86TP9|Q96SD7|Q9HD30	Nonsense_Mutation	SNP	pfam_Whey_acidic_protein_4-diS_core,superfamily_Whey_acidic_protein_4-diS_core	p.S4*	ENST00000354280.4	37	c.11	CCDS13359.1	20	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093578	0.36952	.	.	ENSG00000243543	ENST00000372670;ENST00000372665	.	.	.	3.42	-6.83	0.01693	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	8.6579	0.34075	0.1841:0.2737:0.5422:0.0	.	.	.	.	X	4	.	ENSP00000361750:S4X	S	-	2	0	WFDC6	43601450	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.718000	0.04980	-1.986000	0.00983	-1.255000	0.01485	TCA	WFDC6	-	NULL	ENSG00000243543		0.532	EPPIN-001	KNOWN	basic|CCDS	protein_coding	WFDC6	HGNC	protein_coding	OTTHUMT00000079467.4	111	0.00	0	G			44168036	44168036	-1	no_errors	ENST00000372670	ensembl	human	known	69_37n	nonsense	169	14.21	28	SNP	0.000	T
ZNF512B	57473	genome.wustl.edu	37	20	62597959	62597959	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr20:62597959T>A	ENST00000450537.1	-	5	629	c.569A>T	c.(568-570)aAg>aTg	p.K190M	ZNF512B_ENST00000369888.1_Missense_Mutation_p.K190M|ZNF512B_ENST00000217130.3_Missense_Mutation_p.K190M			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	190					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TCCGATGGGCTTGCTGACCCC	0.607																																						dbGAP											0													96.0	93.0	94.0					20																	62597959		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.569A>T	20.37:g.62597959T>A	ENSP00000393795:p.Lys190Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AK9|Q9ULM4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K190M	ENST00000450537.1	37	c.569	CCDS13548.1	20	.	.	.	.	.	.	.	.	.	.	T	17.82	3.483431	0.63962	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.25912	1.77;1.77;1.77	5.87	3.58	0.41010	.	0.100345	0.43747	D	0.000538	T	0.23492	0.0568	L	0.59436	1.845	0.28648	N	0.906812	B	0.25609	0.13	B	0.23852	0.049	T	0.17077	-1.0381	10	0.51188	T	0.08	-23.3588	7.056	0.25099	0.0:0.078:0.1494:0.7726	.	190	Q96KM6	Z512B_HUMAN	M	190	ENSP00000358904:K190M;ENSP00000393795:K190M;ENSP00000217130:K190M	ENSP00000217130:K190M	K	-	2	0	ZNF512B	62068403	0.208000	0.23494	1.000000	0.80357	0.986000	0.74619	-0.083000	0.11286	0.470000	0.27294	0.477000	0.44152	AAG	ZNF512B	-	NULL	ENSG00000196700		0.607	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF512B	HGNC	protein_coding	OTTHUMT00000080246.1	99	0.00	0	T	NM_020713		62597959	62597959	-1	no_errors	ENST00000217130	ensembl	human	known	69_37n	missense	213	16.08	41	SNP	1.000	A
ZNF536	9745	genome.wustl.edu	37	19	31039063	31039063	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr19:31039063C>T	ENST00000355537.3	+	4	2684	c.2537C>T	c.(2536-2538)cCt>cTt	p.P846L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	846					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.P846H(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AAGGGTCTCCCTGGAATCGAC	0.572																																						dbGAP											1	Substitution - Missense(1)	lung(1)											64.0	72.0	69.0					19																	31039063		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2537C>T	19.37:g.31039063C>T	ENSP00000347730:p.Pro846Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P846L	ENST00000355537.3	37	c.2537	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	C	12.68	2.011868	0.35511	.	.	ENSG00000198597	ENST00000355537	T	0.10288	2.89	5.98	4.95	0.65309	.	0.173657	0.52532	D	0.000061	T	0.10937	0.0267	L	0.32530	0.975	0.53005	D	0.999966	B;B	0.22851	0.076;0.076	B;B	0.20184	0.028;0.028	T	0.04678	-1.0934	10	0.87932	D	0	-16.6064	15.2108	0.73222	0.0:0.9327:0.0:0.0673	.	846;846	A7E228;O15090	.;ZN536_HUMAN	L	846	ENSP00000347730:P846L	ENSP00000347730:P846L	P	+	2	0	ZNF536	35730903	1.000000	0.71417	0.963000	0.40424	0.964000	0.63967	5.403000	0.66338	1.537000	0.49254	0.591000	0.81541	CCT	ZNF536	-	NULL	ENSG00000198597		0.572	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	43	0.00	0	C	NM_014717		31039063	31039063	+1	no_errors	ENST00000355537	ensembl	human	known	69_37n	missense	97	16.38	19	SNP	0.996	T
ZNF780A	284323	genome.wustl.edu	37	19	40581287	40581287	+	Silent	SNP	A	A	G			TCGA-D8-A147-01A-11D-A10Y-09	TCGA-D8-A147-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f292323-cafc-4e45-bb4e-f5428e1a3276	4e55052d-a439-4da0-b799-29bd2d174444	g.chr19:40581287A>G	ENST00000595687.2	-	6	1271	c.1062T>C	c.(1060-1062)atT>atC	p.I354I	ZNF780A_ENST00000414720.2_Intron|ZNF780A_ENST00000340963.5_Silent_p.I354I|ZNF780A_ENST00000594395.1_Silent_p.I355I|AC005614.5_ENST00000595508.1_RNA|ZNF780A_ENST00000450241.2_Silent_p.I320I|ZNF780A_ENST00000455521.1_Silent_p.I355I	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	354					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CACCAGTATGAATCTTCTGAT	0.408																																						dbGAP											0													85.0	86.0	85.0					19																	40581287		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.1062T>C	19.37:g.40581287A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PB48|Q6ZN87	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I355	ENST00000595687.2	37	c.1065	CCDS33026.2	19																																																																																			ZNF780A	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197782		0.408	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF780A	HGNC	protein_coding	OTTHUMT00000470066.1	174	0.57	1	A	NM_001010880		40581287	40581287	-1	no_errors	ENST00000455521	ensembl	human	known	69_37n	silent	251	12.24	35	SNP	0.336	G
