#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABTB2	25841	genome.wustl.edu	37	11	34192619	34192619	+	Splice_Site	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr11:34192619C>T	ENST00000435224.2	-	5	1822		c.e5-1		ABTB2_ENST00000298992.2_Splice_Site|ABTB2_ENST00000530814.1_5'Flank	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2						cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				GTGTTCGGGTCTGCCCAGAAG	0.517																																						dbGAP											0													69.0	60.0	63.0					11																	34192619		2202	4298	6500	-	-	-	SO:0001630	splice_region_variant	0			AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.1398-1G>A	11.37:g.34192619C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Splice_Site	SNP	-	e5-1	ENST00000435224.2	37	c.1398-1	CCDS7890.2	11	.	.	.	.	.	.	.	.	.	.	C	24.7	4.556718	0.86231	.	.	ENSG00000166016	ENST00000435224;ENST00000298992	.	.	.	5.03	5.03	0.67393	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3507	0.90337	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABTB2	34149195	1.000000	0.71417	0.997000	0.53966	0.911000	0.54048	7.625000	0.83145	2.329000	0.79093	0.491000	0.48974	.	ABTB2	-	-	ENSG00000166016		0.517	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABTB2	HGNC	protein_coding	OTTHUMT00000388703.3	42	0.00	0	C	NM_145804	Intron	34192619	34192619	-1	no_errors	ENST00000435224	ensembl	human	known	69_37n	splice_site	6	73.91	17	SNP	1.000	T
ADAMTS20	80070	genome.wustl.edu	37	12	43823449	43823449	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr12:43823449C>T	ENST00000389420.3	-	24	3459	c.3460G>A	c.(3460-3462)Gca>Aca	p.A1154T	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.A1154T|ADAMTS20_ENST00000395541.2_Intron	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1154	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CGCCATTGTGCCATCTTTTTT	0.363																																						dbGAP											0													63.0	58.0	59.0					12																	43823449		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.3460G>A	12.37:g.43823449C>T	ENSP00000374071:p.Ala1154Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.A1154T	ENST00000389420.3	37	c.3460	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	C	6.989	0.552654	0.13374	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.60797	0.16;0.16	4.89	2.07	0.26955	.	0.412865	0.20323	N	0.094598	T	0.27594	0.0678	N	0.11106	0.095	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.19451	-1.0305	10	0.02654	T	1	.	5.4978	0.16811	0.0:0.5237:0.0:0.4763	.	1154	P59510	ATS20_HUMAN	T	1154	ENSP00000374071:A1154T;ENSP00000448341:A1154T	ENSP00000374068:A1154T	A	-	1	0	ADAMTS20	42109716	0.778000	0.28640	0.031000	0.17742	0.677000	0.39632	1.073000	0.30691	0.733000	0.32492	0.591000	0.81541	GCA	ADAMTS20	-	superfamily_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000173157		0.363	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	71	0.00	0	C	NM_025003		43823449	43823449	-1	no_errors	ENST00000389420	ensembl	human	known	69_37n	missense	66	26.67	24	SNP	0.644	T
ASTN1	460	genome.wustl.edu	37	1	176863701	176863701	+	Silent	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr1:176863701C>T	ENST00000367654.3	-	17	3172	c.2961G>A	c.(2959-2961)caG>caA	p.Q987Q	ASTN1_ENST00000367657.3_Silent_p.Q979Q|ASTN1_ENST00000361833.2_Silent_p.Q979Q|ASTN1_ENST00000424564.2_Silent_p.Q979Q	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	987					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CTCTTACCCTCTGGGTCTGGT	0.567																																						dbGAP											0													57.0	62.0	60.0					1																	176863701		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2961G>A	1.37:g.176863701C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	superfamily_Fibronectin_type3,smart_EGF-like,smart_MACPF,pfscan_Fibronectin_type3	p.Q987	ENST00000367654.3	37	c.2961		1																																																																																			ASTN1	-	smart_MACPF	ENSG00000152092		0.567	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		78	0.00	0	C	NM_004319		176863701	176863701	-1	no_errors	ENST00000367654	ensembl	human	known	69_37n	silent	90	20.35	23	SNP	1.000	T
AXIN2	8313	genome.wustl.edu	37	17	63554225	63554225	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr17:63554225C>G	ENST00000375702.5	-	1	622	c.514G>C	c.(514-516)Gac>Cac	p.D172H	CTD-2535L24.2_ENST00000577662.1_3'UTR|AXIN2_ENST00000307078.5_Missense_Mutation_p.D172H			Q9Y2T1	AXIN2_HUMAN	axin 2	172	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						TGCGCCTGGTCAAACATGATG	0.473									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																													dbGAP											0													181.0	160.0	167.0					17																	63554225		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.514G>C	17.37:g.63554225C>G	ENSP00000364854:p.Asp172His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	pfam_DIX,pfam_Regulat_G_prot_signal,pfam_Axin_b-cat-bd,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_DIX,pfscan_DIX,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.D172H	ENST00000375702.5	37	c.514		17	.	.	.	.	.	.	.	.	.	.	C	11.81	1.751176	0.31046	.	.	ENSG00000168646	ENST00000307078;ENST00000375702	T;T	0.02121	4.44;4.44	4.59	4.59	0.56863	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.047763	0.85682	D	0.000000	T	0.14098	0.0341	M	0.81682	2.555	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.00948	-1.1504	10	0.87932	D	0	-34.6377	17.4003	0.87458	0.0:1.0:0.0:0.0	.	172;172;172	B7ZKL5;Q9Y2T1;E7ES00	.;AXIN2_HUMAN;.	H	172	ENSP00000302625:D172H;ENSP00000364854:D172H	ENSP00000302625:D172H	D	-	1	0	AXIN2	60984687	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.703000	0.84585	2.084000	0.62774	0.455000	0.32223	GAC	AXIN2	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	ENSG00000168646		0.473	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	AXIN2	HGNC	protein_coding	OTTHUMT00000445901.1	162	0.00	0	C	NM_004655		63554225	63554225	-1	no_errors	ENST00000307078	ensembl	human	known	69_37n	missense	107	32.70	52	SNP	1.000	G
RP11-464F9.1	0	genome.wustl.edu	37	10	75481226	75481226	+	RNA	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr10:75481226C>T	ENST00000399449.3	-	0	732				RP11-574K11.28_ENST00000580790.1_RNA|BMS1P4_ENST00000584747.1_RNA																							TGATATTCTCCATGCACCATT	0.358																																						dbGAP											0																																										-	-	-			0																															10.37:g.75481226C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000399449.3	37	NULL		10																																																																																			RP11-464F9.1	-	-	ENSG00000242288		0.358	RP11-464F9.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	BMS1P4	Clone_based_vega_gene	processed_transcript	OTTHUMT00000048674.2	48	0.00	0	C			75481226	75481226	-1	no_errors	ENST00000399449	ensembl	human	known	69_37n	rna	30	18.92	7	SNP	1.000	T
C1orf226	400793	genome.wustl.edu	37	1	162351892	162351892	+	Silent	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr1:162351892G>A	ENST00000458626.2	+	1	373	c.201G>A	c.(199-201)agG>agA	p.R67R	RP11-565P22.6_ENST00000431696.1_Silent_p.R176R|C1orf226_ENST00000426197.2_Silent_p.R110R	NM_001085375.1	NP_001078844.1	A1L170	CA226_HUMAN	chromosome 1 open reading frame 226	67										central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12						ACTTCCTGAGGAGAAAGGAGC	0.622																																						dbGAP											0													12.0	15.0	14.0					1																	162351892		2031	4182	6213	-	-	-	SO:0001819	synonymous_variant	0			AI480219, AK023199, AK125122, AL512785, BC127743	CCDS44268.1, CCDS53422.1	1q23.3	2013-10-11			ENSG00000239887	ENSG00000239887			34351	protein-coding gene	gene with protein product						14702039	Standard	NM_001085375		Approved	FLJ13137	uc010pkt.1	A1L170	OTTHUMG00000031376	ENST00000458626.2:c.201G>A	1.37:g.162351892G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF31	Silent	SNP	NULL	p.R110	ENST00000458626.2	37	c.330	CCDS53422.1	1																																																																																			C1orf226	-	NULL	ENSG00000239887		0.622	C1orf226-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C1orf226	HGNC	protein_coding	OTTHUMT00000076793.2	14	0.00	0	G	NM_001085375		162351892	162351892	+1	no_errors	ENST00000426197	ensembl	human	known	69_37n	silent	15	54.55	18	SNP	0.999	A
C1orf198	84886	genome.wustl.edu	37	1	230979431	230979431	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr1:230979431C>T	ENST00000366663.5	-	3	736	c.596G>A	c.(595-597)cGa>cAa	p.R199Q	C1orf198_ENST00000427697.2_5'UTR|C1orf198_ENST00000470540.1_Missense_Mutation_p.R161Q|C1orf198_ENST00000523410.1_Missense_Mutation_p.R69Q	NM_032800.2	NP_116189.1	Q9H425	CA198_HUMAN	chromosome 1 open reading frame 198	199						cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	17	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				CCCCTCCCCTCGGGACCGCTC	0.627																																						dbGAP											0													82.0	82.0	82.0					1																	230979431		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC066649	CCDS1587.1, CCDS44330.1, CCDS44331.1	1q42.2	2008-02-05			ENSG00000119280	ENSG00000119280			25900	protein-coding gene	gene with protein product							Standard	NM_032800		Approved	FLJ14525, MGC10710, FLJ16283, DKFZp667D152, FLJ38847	uc001hub.3	Q9H425	OTTHUMG00000037790	ENST00000366663.5:c.596G>A	1.37:g.230979431C>T	ENSP00000355623:p.Arg199Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8R8|B3KTW1|G5EA08	Missense_Mutation	SNP	NULL	p.R199Q	ENST00000366663.5	37	c.596	CCDS1587.1	1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812883	0.70912	.	.	ENSG00000119280	ENST00000366663;ENST00000470540;ENST00000523410;ENST00000522201	T;T;T	0.37584	1.34;1.35;1.19	4.61	4.61	0.57282	.	0.132651	0.45126	D	0.000389	T	0.46112	0.1376	L	0.60455	1.87	0.35783	D	0.821772	D	0.71674	0.998	P	0.62014	0.897	T	0.54662	-0.8260	10	0.30854	T	0.27	-29.8056	6.0147	0.19596	0.0:0.7512:0.0:0.2488	.	199	Q9H425	CA198_HUMAN	Q	199;161;69;156	ENSP00000355623:R199Q;ENSP00000428172:R161Q;ENSP00000430967:R69Q	ENSP00000355623:R199Q	R	-	2	0	C1orf198	229046054	1.000000	0.71417	0.999000	0.59377	0.654000	0.38779	3.678000	0.54627	2.100000	0.63781	0.462000	0.41574	CGA	C1orf198	-	NULL	ENSG00000119280		0.627	C1orf198-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C1orf198	HGNC	protein_coding	OTTHUMT00000092236.2	40	0.00	0	C	NM_032800		230979431	230979431	-1	no_errors	ENST00000366663	ensembl	human	known	69_37n	missense	50	26.47	18	SNP	1.000	T
CAMK2A	815	genome.wustl.edu	37	5	149637130	149637130	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr5:149637130C>T	ENST00000348628.6	-	4	933	c.268G>A	c.(268-270)Gac>Aac	p.D90N	CAMK2A_ENST00000398376.3_Missense_Mutation_p.D90N	NM_015981.3|NM_171825.2	NP_057065.2|NP_741960.1	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II alpha	90	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|kinase activity (GO:0016301)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)	15		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACTCACAGGTCGAAGATCAGG	0.592																																						dbGAP											0													94.0	112.0	106.0					5																	149637130		2034	4206	6240	-	-	-	SO:0001583	missense	0			AB023185	CCDS43386.1, CCDS43387.1	5q32	2013-09-20	2008-10-30		ENSG00000070808	ENSG00000070808	2.7.11.17		1460	protein-coding gene	gene with protein product	"""CaM-kinase II alpha chain"", ""calcium/calmodulin-dependent protein kinase II alpha-B subunit"", ""CaM kinase II alpha subunit"", ""CaMK-II alpha subunit"", ""calcium/calmodulin-dependent protein kinase type II alpha chain"""	114078	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha"""	CAMKA		10231032, 3475713	Standard	NM_015981		Approved	KIAA0968, CaMKIINalpha	uc003lrt.2	Q9UQM7	OTTHUMG00000134281	ENST00000348628.6:c.268G>A	5.37:g.149637130C>T	ENSP00000261793:p.Asp90Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UL21|Q9Y2H4|Q9Y352	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ca/CaM-dep_prot_kinase-assoc,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D90N	ENST00000348628.6	37	c.268	CCDS43386.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.310886	0.97462	.	.	ENSG00000070808	ENST00000348628;ENST00000398376;ENST00000510347	T;T;T	0.27104	1.69;1.69;1.69	5.97	5.97	0.96955	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.49321	0.1550	M	0.62209	1.925	0.80722	D	1	D;P;D	0.65815	0.994;0.688;0.995	P;B;P	0.61940	0.832;0.309;0.896	T	0.41288	-0.9517	10	0.87932	D	0	.	20.0086	0.97443	0.0:1.0:0.0:0.0	.	90;90;90	Q9UQM7-2;Q9UQM7;A8K161	.;KCC2A_HUMAN;.	N	90	ENSP00000261793:D90N;ENSP00000381412:D90N;ENSP00000426607:D90N	ENSP00000261793:D90N	D	-	1	0	CAMK2A	149617323	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.168000	0.77570	2.835000	0.97688	0.591000	0.81541	GAC	CAMK2A	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000070808		0.592	CAMK2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK2A	HGNC	protein_coding	OTTHUMT00000258869.2	74	0.00	0	C	NM_015981		149637130	149637130	-1	no_errors	ENST00000398376	ensembl	human	known	69_37n	missense	51	37.04	30	SNP	1.000	T
CAMSAP3	57662	genome.wustl.edu	37	19	7676908	7676908	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr19:7676908C>T	ENST00000160298.4	+	11	1630	c.1529C>T	c.(1528-1530)tCc>tTc	p.S510F	CAMSAP3_ENST00000446248.2_Missense_Mutation_p.S537F	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	510	Pro-rich.				epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						AAACCACTGTCCGACAGGCCC	0.672																																						dbGAP											0													50.0	59.0	56.0					19																	7676908		2028	4159	6187	-	-	-	SO:0001583	missense	0			AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.1529C>T	19.37:g.7676908C>T	ENSP00000160298:p.Ser510Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDF1	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrell-like,superfamily_CH-domain	p.S537F	ENST00000160298.4	37	c.1610	CCDS42489.1	19	.	.	.	.	.	.	.	.	.	.	c	0.442	-0.898271	0.02472	.	.	ENSG00000076826	ENST00000446248;ENST00000160298	T;T	0.15017	2.46;2.46	2.14	2.14	0.27477	.	1.370120	0.04503	N	0.381513	T	0.11836	0.0288	N	0.14661	0.345	0.09310	N	1	D;D	0.57899	0.981;0.972	B;P	0.44811	0.374;0.461	T	0.17107	-1.0380	10	0.35671	T	0.21	-2.3293	4.7485	0.13049	0.0:0.8176:0.0:0.1824	.	510;537	Q9P1Y5;Q9P1Y5-2	CAMP3_HUMAN;.	F	537;510	ENSP00000416797:S537F;ENSP00000160298:S510F	ENSP00000160298:S510F	S	+	2	0	KIAA1543	7582908	0.001000	0.12720	0.004000	0.12327	0.045000	0.14185	0.499000	0.22546	1.478000	0.48253	0.544000	0.68410	TCC	CAMSAP3	-	NULL	ENSG00000076826		0.672	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CAMSAP3	HGNC	protein_coding	OTTHUMT00000459300.1	38	0.00	0	C	XM_048362		7676908	7676908	+1	no_errors	ENST00000446248	ensembl	human	known	69_37n	missense	16	51.52	17	SNP	0.095	T
CATSPER2	117155	genome.wustl.edu	37	15	43940189	43940189	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr15:43940189T>A	ENST00000321596.5	-	2	270	c.71A>T	c.(70-72)gAt>gTt	p.D24V	CATSPER2_ENST00000396879.1_Missense_Mutation_p.D24V|CATSPER2_ENST00000355438.2_Missense_Mutation_p.D24V|CATSPER2_ENST00000464721.1_Intron|CATSPER2_ENST00000354127.4_Missense_Mutation_p.D24V|STRC_ENST00000541030.1_Intron|CATSPER2_ENST00000381761.1_Missense_Mutation_p.D30V			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2	24					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		AGAGAAAGTATCGATGAGACG	0.478																																						dbGAP											0													205.0	204.0	205.0					15																	43940189		2199	4296	6495	-	-	-	SO:0001583	missense	0			AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.71A>T	15.37:g.43940189T>A	ENSP00000321463:p.Asp24Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHT9|Q96P54|Q96P55	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.D24V	ENST00000321596.5	37	c.71	CCDS10099.1	15	.	.	.	.	.	.	.	.	.	.	T	15.55	2.867025	0.51588	.	.	ENSG00000166762	ENST00000396879;ENST00000299989;ENST00000381761;ENST00000321596;ENST00000354127;ENST00000355438;ENST00000432420;ENST00000409481;ENST00000419473	T;T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18;1.18	2.64	2.64	0.31445	.	.	.	.	.	T	0.54046	0.1834	M	0.73598	2.24	0.49915	D	0.99983	D;D;D	0.76494	0.999;0.994;0.99	D;P;P	0.76071	0.987;0.907;0.81	T	0.55412	-0.8145	9	0.72032	D	0.01	.	7.0877	0.25267	0.0:0.0:0.0:1.0	.	24;30;24	Q96P56-4;F8W9H2;Q96P56	.;.;CTSR2_HUMAN	V	24;24;30;24;24;24;24;24;24	ENSP00000380088:D24V;ENSP00000371180:D30V;ENSP00000321463:D24V;ENSP00000339137:D24V;ENSP00000347613:D24V;ENSP00000407694:D24V;ENSP00000386595:D24V	ENSP00000299989:D24V	D	-	2	0	CATSPER2	41727481	1.000000	0.71417	0.998000	0.56505	0.719000	0.41307	3.580000	0.53907	1.219000	0.43474	0.155000	0.16302	GAT	CATSPER2	-	NULL	ENSG00000166762		0.478	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPER2	HGNC	protein_coding	OTTHUMT00000133151.2	83	0.00	0	T	NM_054020		43940189	43940189	-1	no_errors	ENST00000299989	ensembl	human	known	69_37n	missense	49	40.24	33	SNP	0.998	A
CD19	930	genome.wustl.edu	37	16	28948602	28948605	+	Frame_Shift_Del	DEL	AGAG	AGAG	-			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	AGAG	AGAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr16:28948602_28948605delAGAG	ENST00000324662.3	+	9	1253_1256	c.1209_1212delAGAG	c.(1207-1212)gaagagfs	p.EE403fs	CD19_ENST00000538922.1_Frame_Shift_Del_p.EE403fs|CD19_ENST00000567541.1_Frame_Shift_Del_p.EE403fs			P15391	CD19_HUMAN	CD19 molecule	403					B cell receptor signaling pathway (GO:0050853)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(4)|urinary_tract(1)	29						GCCCAGAAGAAGAGGAAGGGGAGG	0.613																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS10644.1, CCDS53998.1	16p11.2	2014-09-17	2006-03-28		ENSG00000177455	ENSG00000177455		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1633	protein-coding gene	gene with protein product		107265	"""CD19 antigen"""				Standard	NM_001770		Approved		uc010byo.2	P15391	OTTHUMG00000097049	ENST00000324662.3:c.1209_1212delAGAG	16.37:g.28948602_28948605delAGAG	ENSP00000313419:p.Glu403fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0P9|F5H635|Q96S68|Q9BRD6	Frame_Shift_Del	DEL	smart_Ig_sub,pfscan_Ig-like	p.E404fs	ENST00000324662.3	37	c.1209_1212	CCDS10644.1	16																																																																																			CD19	-	NULL	ENSG00000177455		0.613	CD19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD19	HGNC	protein_coding	OTTHUMT00000214152.2	23	0.00	0	AGAG			28948602	28948605	+1	no_errors	ENST00000538922	ensembl	human	known	69_37n	frame_shift_del	26	45.83	22	DEL	0.993:0.996:0.999:1.000	-
CD300LG	146894	genome.wustl.edu	37	17	41939193	41939193	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr17:41939193C>T	ENST00000317310.4	+	7	954	c.913C>T	c.(913-915)Cag>Tag	p.Q305*		NM_145273.3	NP_660316.2	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g	305					immune system process (GO:0002376)|immunoglobulin transcytosis in epithelial cells (GO:0002414)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|skin(4)	19		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		AGCCCCTTCCCAGGCCCCTGA	0.607																																						dbGAP											0													43.0	41.0	42.0					17																	41939193		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC025395	CCDS11470.1, CCDS54131.1, CCDS54132.1, CCDS54133.1	17q21.31	2013-01-11	2006-03-29					"""Immunoglobulin superfamily / V-set domain containing"""	30455	protein-coding gene	gene with protein product	"""nepmucin"""	610520	"""CD300 antigen like family member G"""			16876123, 16754720	Standard	NM_001168322		Approved	Trem4, CLM9	uc002iem.3	Q6UXG3		ENST00000317310.4:c.913C>T	17.37:g.41939193C>T	ENSP00000321005:p.Gln305*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNY5|F5H7P9|F8W9M3|Q8IX38|Q8IX39|Q8TA95	Nonsense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.Q305*	ENST00000317310.4	37	c.913	CCDS11470.1	17	.	.	.	.	.	.	.	.	.	.	C	15.30	2.793345	0.50102	.	.	ENSG00000161649	ENST00000317310	.	.	.	4.18	3.19	0.36642	.	0.662492	0.12564	N	0.457958	.	.	.	.	.	.	0.48762	D	0.999707	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9852	0.41837	0.0:0.7945:0.2055:0.0	.	.	.	.	X	305	.	ENSP00000321005:Q305X	Q	+	1	0	CD300LG	39294719	0.008000	0.16893	0.007000	0.13788	0.059000	0.15707	2.973000	0.49264	1.322000	0.45245	0.655000	0.94253	CAG	CD300LG	-	NULL	ENSG00000161649		0.607	CD300LG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD300LG	HGNC	protein_coding	OTTHUMT00000457646.1	29	0.00	0	C	NM_145273		41939193	41939193	+1	no_errors	ENST00000317310	ensembl	human	known	69_37n	nonsense	30	33.33	15	SNP	0.008	T
CNTN6	27255	genome.wustl.edu	37	3	1414111	1414111	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr3:1414111G>A	ENST00000446702.2	+	13	2248	c.1621G>A	c.(1621-1623)Gtc>Atc	p.V541I	CNTN6_ENST00000539053.1_Missense_Mutation_p.V469I|CNTN6_ENST00000350110.2_Missense_Mutation_p.V541I			Q9UQ52	CNTN6_HUMAN	contactin 6	541	Ig-like C2-type 6.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CAATGGAGATGTCATAGACTT	0.373																																						dbGAP											0													123.0	120.0	121.0					3																	1414111		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.1621G>A	3.37:g.1414111G>A	ENSP00000407822:p.Val541Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHM2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V541I	ENST00000446702.2	37	c.1621	CCDS2557.1	3	.	.	.	.	.	.	.	.	.	.	G	2.375	-0.343530	0.05243	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.67523	-0.27;-0.27;-0.27	5.8	-4.96	0.03038	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.296810	0.05208	N	0.506158	T	0.44138	0.1279	N	0.16567	0.415	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.16988	-1.0384	10	0.35671	T	0.21	.	4.4509	0.11619	0.4325:0.2134:0.2814:0.0728	.	541	Q9UQ52	CNTN6_HUMAN	I	541;469;541	ENSP00000407822:V541I;ENSP00000442791:V469I;ENSP00000341882:V541I	ENSP00000341882:V541I	V	+	1	0	CNTN6	1389111	0.000000	0.05858	0.001000	0.08648	0.471000	0.32888	-0.144000	0.10280	-1.188000	0.02705	-0.813000	0.03139	GTC	CNTN6	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000134115		0.373	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	134	0.00	0	G	NM_014461		1414111	1414111	+1	no_errors	ENST00000350110	ensembl	human	known	69_37n	missense	86	35.82	48	SNP	0.000	A
CTCF	10664	genome.wustl.edu	37	16	67662443	67662443	+	Silent	SNP	A	A	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr16:67662443A>T	ENST00000264010.4	+	9	2133	c.1689A>T	c.(1687-1689)acA>acT	p.T563T	CTCF_ENST00000401394.1_Silent_p.T235T	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	563					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.T563T(1)		breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		GTGGGAAAACATTTACACGTC	0.463																																					Colon(175;1200 1966 6945 23069 27405)	dbGAP											1	Substitution - coding silent(1)	lung(1)											206.0	189.0	195.0					16																	67662443		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.1689A>T	16.37:g.67662443A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MC38|Q53XI7|Q59EL8	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T563	ENST00000264010.4	37	c.1689	CCDS10841.1	16																																																																																			CTCF	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000102974		0.463	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTCF	HGNC	protein_coding	OTTHUMT00000268870.2	141	0.00	0	A	NM_006565		67662443	67662443	+1	no_errors	ENST00000264010	ensembl	human	known	69_37n	silent	40	48.72	38	SNP	1.000	T
CYP11B1	1584	genome.wustl.edu	37	8	143957771	143957771	+	Silent	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr8:143957771G>A	ENST00000292427.4	-	5	872	c.840C>T	c.(838-840)ttC>ttT	p.F280F	CYP11B1_ENST00000517471.1_Silent_p.F280F|CYP11B1_ENST00000377675.3_Silent_p.F351F	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	280					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	GAGGGCGGCTGAAGGCCAGTT	0.562									Familial Hyperaldosteronism type I																													dbGAP											0													112.0	94.0	100.0					8																	143957771		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.840C>T	8.37:g.143957771G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B,prints_Cyt_P450	p.F280	ENST00000292427.4	37	c.840	CCDS6392.1	8																																																																																			CYP11B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000160882		0.562	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B1	HGNC	protein_coding	OTTHUMT00000379475.2	102	0.00	0	G			143957771	143957771	-1	no_errors	ENST00000292427	ensembl	human	known	69_37n	silent	131	18.63	30	SNP	0.000	A
DAB2	1601	genome.wustl.edu	37	5	39383284	39383284	+	Silent	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr5:39383284G>A	ENST00000320816.6	-	10	1244	c.777C>T	c.(775-777)ggC>ggT	p.G259G	DAB2_ENST00000509337.1_Silent_p.G238G|DAB2_ENST00000339788.6_Intron|DAB2_ENST00000512525.1_5'Flank|DAB2_ENST00000545653.1_Silent_p.G238G	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	259	Required for localization to clathrin- coated pits. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			AGGAGGTGATGCCGTTTGTTA	0.423																																						dbGAP											0													157.0	168.0	164.0					5																	39383284		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.777C>T	5.37:g.39383284G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NES5|Q13598|Q9BTY0|Q9UK04	Silent	SNP	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	p.G259	ENST00000320816.6	37	c.777	CCDS34149.1	5																																																																																			DAB2	-	NULL	ENSG00000153071		0.423	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAB2	HGNC	protein_coding	OTTHUMT00000367014.1	109	0.00	0	G	NM_001343		39383284	39383284	-1	no_errors	ENST00000320816	ensembl	human	known	69_37n	silent	76	33.91	39	SNP	1.000	A
DNAH3	55567	genome.wustl.edu	37	16	20976523	20976523	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr16:20976523C>T	ENST00000261383.3	-	53	8682	c.8683G>A	c.(8683-8685)Gat>Aat	p.D2895N	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2895	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GCCACGCGATCGTACACCTCC	0.562																																						dbGAP											0													120.0	109.0	113.0					16																	20976523		2201	4300	6501	-	-	-	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.8683G>A	16.37:g.20976523C>T	ENSP00000261383:p.Asp2895Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.D2895N	ENST00000261383.3	37	c.8683	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867920	0.91587	.	.	ENSG00000158486	ENST00000261383	T	0.74002	-0.8	5.77	5.77	0.91146	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	D	0.85911	0.5807	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.81404	-0.0948	10	0.18276	T	0.48	.	19.9961	0.97386	0.0:1.0:0.0:0.0	.	2895	Q8TD57	DYH3_HUMAN	N	2895	ENSP00000261383:D2895N	ENSP00000261383:D2895N	D	-	1	0	DNAH3	20884024	1.000000	0.71417	0.130000	0.21974	0.947000	0.59692	7.794000	0.85869	2.744000	0.94065	0.561000	0.74099	GAT	DNAH3	-	NULL	ENSG00000158486		0.562	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	69	0.00	0	C	NM_017539		20976523	20976523	-1	no_errors	ENST00000261383	ensembl	human	known	69_37n	missense	34	62.22	56	SNP	1.000	T
EPOR	2057	genome.wustl.edu	37	19	11489402	11489402	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr19:11489402C>G	ENST00000222139.6	-	7	984	c.880G>C	c.(880-882)Gaa>Caa	p.E294Q	EPOR_ENST00000592375.2_Missense_Mutation_p.E294Q	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	294					brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)	p.E294Q(1)		endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	AAGAGGCCTTCAAACTCGCTC	0.527																																						dbGAP											1	Substitution - Missense(1)	urinary_tract(1)											105.0	97.0	99.0					19																	11489402		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.880G>C	19.37:g.11489402C>G	ENSP00000222139:p.Glu294Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCG4|Q15443|Q2M205	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pirsf_Erythropoietin_rcpt,pfscan_Fibronectin_type3	p.E294Q	ENST00000222139.6	37	c.880	CCDS12260.1	19	.	.	.	.	.	.	.	.	.	.	C	6.273	0.418475	0.11870	.	.	ENSG00000187266	ENST00000222139	T	0.80033	-1.33	5.42	2.1	0.27182	.	0.431733	0.25247	N	0.032056	T	0.56381	0.1981	N	0.17723	0.515	0.26580	N	0.973401	P	0.34864	0.473	B	0.24848	0.056	T	0.45041	-0.9288	10	0.12430	T	0.62	-37.4542	5.2144	0.15334	0.0:0.5454:0.1413:0.3133	.	294	P19235	EPOR_HUMAN	Q	294	ENSP00000222139:E294Q	ENSP00000222139:E294Q	E	-	1	0	EPOR	11350402	0.968000	0.33430	0.997000	0.53966	0.459000	0.32528	0.250000	0.18235	0.667000	0.31107	-0.150000	0.13652	GAA	EPOR	-	pirsf_Erythropoietin_rcpt	ENSG00000187266		0.527	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPOR	HGNC	protein_coding	OTTHUMT00000458791.1	58	0.00	0	C			11489402	11489402	-1	no_errors	ENST00000222139	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	0.957	G
EYA4	2070	genome.wustl.edu	37	6	133783840	133783840	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr6:133783840G>A	ENST00000367895.5	+	9	1126	c.662G>A	c.(661-663)aGt>aAt	p.S221N	EYA4_ENST00000355167.3_Missense_Mutation_p.S221N|EYA4_ENST00000355286.6_Missense_Mutation_p.S198N|EYA4_ENST00000525849.1_Missense_Mutation_p.S198N|EYA4_ENST00000431403.2_Missense_Mutation_p.S221N|EYA4_ENST00000531901.1_Missense_Mutation_p.S221N|EYA4_ENST00000452339.2_Missense_Mutation_p.S167N|EYA4_ENST00000430974.2_Missense_Mutation_p.S167N	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	221					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		GGCTGCCTCAGTTACAGCCCA	0.473																																					Melanoma(57;398 1237 3528 4702 7415)	dbGAP											0													81.0	75.0	77.0					6																	133783840		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.662G>A	6.37:g.133783840G>A	ENSP00000356870:p.Ser221Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_EYA	p.S221N	ENST00000367895.5	37	c.662	CCDS5165.1	6	.	.	.	.	.	.	.	.	.	.	G	24.9	4.581337	0.86748	.	.	ENSG00000112319	ENST00000452339;ENST00000430974;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	D;D;D;D;D;D;D;D	0.91631	-2.8;-2.73;-2.86;-2.86;-2.87;-2.88;-2.87;-2.86	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.89553	0.6748	M	0.66939	2.045	0.80722	D	1	P;B;B;B;B;B	0.35944	0.529;0.149;0.095;0.2;0.09;0.09	B;B;B;B;B;B	0.37387	0.248;0.17;0.034;0.051;0.192;0.12	D	0.88625	0.3165	10	0.35671	T	0.21	0.1121	19.6818	0.95967	0.0:0.0:1.0:0.0	.	221;167;167;198;221;221	F2Z2Y1;E7ESD5;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;.;EYA4_HUMAN	N	167;167;221;221;198;221;198;221	ENSP00000395916:S167N;ENSP00000388670:S167N;ENSP00000356870:S221N;ENSP00000347294:S221N;ENSP00000347434:S198N;ENSP00000432770:S221N;ENSP00000433219:S198N;ENSP00000404558:S221N	ENSP00000347294:S221N	S	+	2	0	EYA4	133825533	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.471000	0.97696	2.644000	0.89710	0.650000	0.86243	AGT	EYA4	-	NULL	ENSG00000112319		0.473	EYA4-001	KNOWN	basic|CCDS	protein_coding	EYA4	HGNC	protein_coding	OTTHUMT00000042282.2	72	0.00	0	G	NM_004100		133783840	133783840	+1	no_errors	ENST00000355167	ensembl	human	known	69_37n	missense	38	33.33	19	SNP	1.000	A
F8	2157	genome.wustl.edu	37	X	154124399	154124399	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chrX:154124399C>A	ENST00000360256.4	-	22	6582	c.6382G>T	c.(6382-6384)Ggg>Tgg	p.G2128W		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	2128	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CACTTCTTCCCATCAAGACTA	0.418																																						dbGAP											0													160.0	154.0	156.0					X																	154124399		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.6382G>T	X.37:g.154124399C>A	ENSP00000353393:p.Gly2128Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.G2128W	ENST00000360256.4	37	c.6382	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	c	18.23	3.578867	0.65878	.	.	ENSG00000185010	ENST00000360256	D	0.99405	-5.84	5.65	5.65	0.86999	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.159187	0.56097	D	0.000023	D	0.99658	0.9873	M	0.93594	3.435	0.48395	D	0.999646	D	0.89917	1.0	D	0.97110	1.0	D	0.97687	1.0176	10	0.87932	D	0	-17.2822	17.1744	0.86837	0.0:1.0:0.0:0.0	.	2128	P00451	FA8_HUMAN	W	2128	ENSP00000353393:G2128W	ENSP00000353393:G2128W	G	-	1	0	F8	153777593	1.000000	0.71417	0.947000	0.38551	0.940000	0.58332	3.804000	0.55568	2.370000	0.80446	0.600000	0.82982	GGG	F8	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000185010		0.418	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	68	0.00	0	C			154124399	154124399	-1	no_errors	ENST00000360256	ensembl	human	known	69_37n	missense	47	32.86	23	SNP	1.000	A
FAM227B	196951	genome.wustl.edu	37	15	49659665	49659665	+	Silent	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr15:49659665G>A	ENST00000299338.6	-	13	1554	c.1251C>T	c.(1249-1251)ctC>ctT	p.L417L		NM_152647.2	NP_689860.2	Q96M60	F227B_HUMAN	family with sequence similarity 227, member B	417																	ATATCTTAGTGAGTTTAATCT	0.303																																						dbGAP											0													96.0	107.0	103.0					15																	49659665		2195	4295	6490	-	-	-	SO:0001819	synonymous_variant	0				CCDS32237.1	15q21.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000166262	ENSG00000166262			26543	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 33"""	C15orf33			Standard	NM_152647		Approved	FLJ32800	uc001zxl.2	Q96M60	OTTHUMG00000172328	ENST00000299338.6:c.1251C>T	15.37:g.49659665G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86WS2	Silent	SNP	NULL	p.L417	ENST00000299338.6	37	c.1251	CCDS32237.1	15																																																																																			FAM227B	-	NULL	ENSG00000166262		0.303	FAM227B-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	FAM227B	HGNC	protein_coding	OTTHUMT00000417872.1	91	0.00	0	G	NM_152647		49659665	49659665	-1	no_errors	ENST00000299338	ensembl	human	known	69_37n	silent	73	24.74	24	SNP	0.169	A
FAM81B	153643	genome.wustl.edu	37	5	94749730	94749730	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr5:94749730A>G	ENST00000283357.5	+	4	419	c.373A>G	c.(373-375)Ata>Gta	p.I125V		NM_152548.2	NP_689761	Q96LP2	FA81B_HUMAN	family with sequence similarity 81, member B	125						nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		GGCGCGTACCATAGCTTTCCT	0.507																																						dbGAP											0													105.0	110.0	108.0					5																	94749730		2011	4179	6190	-	-	-	SO:0001583	missense	0				CCDS43341.1	5q15	2008-02-05			ENSG00000153347	ENSG00000153347			26335	protein-coding gene	gene with protein product							Standard	NM_152548		Approved	FLJ25333	uc003kla.1	Q96LP2	OTTHUMG00000162837	ENST00000283357.5:c.373A>G	5.37:g.94749730A>G	ENSP00000283357:p.Ile125Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.I125V	ENST00000283357.5	37	c.373	CCDS43341.1	5	.	.	.	.	.	.	.	.	.	.	A	4.584	0.108462	0.08780	.	.	ENSG00000153347	ENST00000283357	T	0.18810	2.19	5.53	0.275	0.15659	.	0.304822	0.35708	N	0.003033	T	0.12305	0.0299	L	0.34521	1.04	0.20563	N	0.999889	B	0.18863	0.031	B	0.19666	0.026	T	0.39272	-0.9622	10	0.07644	T	0.81	-10.7582	9.8441	0.41017	0.7572:0.0:0.2428:0.0	.	125	Q96LP2	FA81B_HUMAN	V	125	ENSP00000283357:I125V	ENSP00000283357:I125V	I	+	1	0	FAM81B	94775486	0.355000	0.24921	0.952000	0.39060	0.148000	0.21650	1.449000	0.35123	-0.167000	0.10871	-1.080000	0.02220	ATA	FAM81B	-	NULL	ENSG00000153347		0.507	FAM81B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM81B	HGNC	protein_coding	OTTHUMT00000370690.1	94	0.00	0	A	NM_152548		94749730	94749730	+1	no_errors	ENST00000283357	ensembl	human	known	69_37n	missense	75	34.78	40	SNP	0.719	G
FANCG	2189	genome.wustl.edu	37	9	35076497	35076497	+	Silent	SNP	T	T	C			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr9:35076497T>C	ENST00000378643.3	-	8	1499	c.1008A>G	c.(1006-1008)tcA>tcG	p.S336S	FANCG_ENST00000476212.1_Intron	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	336					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AATGAAGGGGTGAGGCTAGGT	0.517			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																														dbGAP	yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	0													148.0	112.0	124.0					9																	35076497		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.1008A>G	9.37:g.35076497T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	superfamily_Sig_transdc_His_kin_Hpt_dom,smart_TPR_repeat	p.S336	ENST00000378643.3	37	c.1008	CCDS6574.1	9																																																																																			FANCG	-	NULL	ENSG00000221829		0.517	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCG	HGNC	protein_coding	OTTHUMT00000052269.1	84	0.00	0	T	NM_004629		35076497	35076497	-1	no_errors	ENST00000378643	ensembl	human	known	69_37n	silent	22	54.17	26	SNP	0.768	C
FBXO32	114907	genome.wustl.edu	37	8	124526556	124526556	+	Silent	SNP	T	T	C	rs368380550		TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr8:124526556T>C	ENST00000517956.1	-	5	581	c.390A>G	c.(388-390)gcA>gcG	p.A130A	FBXO32_ENST00000443022.2_Intron	NM_058229.3|NM_148177.2	NP_478136.1|NP_680482.1	Q969P5	FBX32_HUMAN	F-box protein 32	130					cellular response to dexamethasone stimulus (GO:0071549)|protein ubiquitination (GO:0016567)|response to denervation involved in regulation of muscle adaptation (GO:0014894)	nucleolus (GO:0005730)|Z disc (GO:0030018)				autonomic_ganglia(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)|stomach(1)	21	Lung NSC(37;1.13e-13)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GCTGTGACTTTGCTATCAGCT	0.433																																						dbGAP											0													74.0	65.0	68.0					8																	124526556		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ420108	CCDS6345.1, CCDS56553.1	8q24.13	2008-01-28	2004-06-15		ENSG00000156804	ENSG00000156804		"""F-boxes /  ""other"""""	16731	protein-coding gene	gene with protein product		606604	"""F-box only protein 32"""			11679633, 11717410	Standard	NM_058229		Approved	MAFbx, ATROGIN1, Fbx32	uc003yqr.3	Q969P5	OTTHUMG00000164981	ENST00000517956.1:c.390A>G	8.37:g.124526556T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4KYM0	Silent	SNP	superfamily_F-box_dom_cyclin-like	p.A130	ENST00000517956.1	37	c.390	CCDS6345.1	8																																																																																			FBXO32	-	NULL	ENSG00000156804		0.433	FBXO32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO32	HGNC	protein_coding	OTTHUMT00000381281.1	67	0.00	0	T			124526556	124526556	-1	no_errors	ENST00000517956	ensembl	human	known	69_37n	silent	47	63.85	83	SNP	1.000	C
FREM3	166752	genome.wustl.edu	37	4	144617794	144617794	+	Silent	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr4:144617794G>A	ENST00000329798.5	-	1	4034	c.4035C>T	c.(4033-4035)gtC>gtT	p.V1345V		NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	1345					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						CAGAATGGAGGACAAAACTGA	0.468																																						dbGAP											0													142.0	122.0	128.0					4																	144617794		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.4035C>T	4.37:g.144617794G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.V1345	ENST00000329798.5	37	c.4035	CCDS54808.1	4																																																																																			FREM3	-	NULL	ENSG00000183090		0.468	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	134	0.00	0	G	XM_094074		144617794	144617794	-1	no_errors	ENST00000329798	ensembl	human	putative	69_37n	silent	88	29.60	37	SNP	0.997	A
GOPC	57120	genome.wustl.edu	37	6	117894762	117894762	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr6:117894762C>T	ENST00000368498.2	-	5	759	c.684G>A	c.(682-684)atG>atA	p.M228I	GOPC_ENST00000467125.1_5'Flank|GOPC_ENST00000052569.6_Missense_Mutation_p.M220I|GOPC_ENST00000535237.1_Missense_Mutation_p.M228I	NM_020399.3	NP_065132.1	Q9HD26	GOPC_HUMAN	golgi-associated PDZ and coiled-coil motif containing	228					apical protein localization (GO:0045176)|cytoplasmic sequestering of CFTR protein (GO:0043004)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi to plasma membrane transport (GO:0006893)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|spermatid nucleus differentiation (GO:0007289)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|trans-Golgi network transport vesicle (GO:0030140)	ion channel binding (GO:0044325)|small GTPase regulator activity (GO:0005083)		GOPC/ROS1(14)	endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)		CAGGTCCCTTCATATCTCGTC	0.388			O	ROS1	glioblastoma																																	dbGAP		Dom	yes		6	6q21	57120	golgi associated PDZ and coiled-coil motif containing		O	0													247.0	220.0	229.0					6																	117894762		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF287894	CCDS5117.1, CCDS34523.1	6q21	2010-02-12	2010-02-12		ENSG00000047932	ENSG00000047932			17643	protein-coding gene	gene with protein product		606845				11162552, 11520064	Standard	NM_020399		Approved	dJ94G16.2, PIST, FIG, GOPC1, CAL		Q9HD26	OTTHUMG00000015457	ENST00000368498.2:c.684G>A	6.37:g.117894762C>T	ENSP00000357484:p.Met228Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM30|Q59FS4|Q969U8	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.M228I	ENST00000368498.2	37	c.684	CCDS5117.1	6	.	.	.	.	.	.	.	.	.	.	C	21.8	4.205934	0.79127	.	.	ENSG00000047932	ENST00000052569;ENST00000368498;ENST00000535237	T;T;T	0.17054	2.3;2.31;2.32	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.10852	0.0265	L	0.52126	1.63	0.80722	D	1	P;P;P	0.39352	0.669;0.539;0.532	B;B;B	0.34093	0.175;0.085;0.175	T	0.05920	-1.0856	9	.	.	.	-16.1726	20.6208	0.99490	0.0:1.0:0.0:0.0	.	220;228;228	Q9HD26-2;Q9HD26;F5H1Y4	.;GOPC_HUMAN;.	I	220;228;228	ENSP00000052569:M220I;ENSP00000357484:M228I;ENSP00000445690:M228I	.	M	-	3	0	GOPC	118001455	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	ATG	GOPC	-	NULL	ENSG00000047932		0.388	GOPC-002	KNOWN	basic|CCDS	protein_coding	GOPC	HGNC	protein_coding	OTTHUMT00000041988.1	203	0.00	0	C	NM_020399		117894762	117894762	-1	no_errors	ENST00000368498	ensembl	human	known	69_37n	missense	107	36.69	62	SNP	1.000	T
GRIN2A	2903	genome.wustl.edu	37	16	9857878	9857878	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr16:9857878C>T	ENST00000396573.2	-	14	3832	c.3523G>A	c.(3523-3525)Gaa>Aaa	p.E1175K	GRIN2A_ENST00000330684.3_Missense_Mutation_p.E1175K|GRIN2A_ENST00000535259.1_Missense_Mutation_p.E1018K|GRIN2A_ENST00000562109.1_Missense_Mutation_p.E1175K|GRIN2A_ENST00000396575.2_Missense_Mutation_p.E1175K|GRIN2A_ENST00000404927.2_Missense_Mutation_p.E1175K	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1175			E -> K (found in a cutaneous malignant melanoma sample; somatic mutation). {ECO:0000269|PubMed:21499247}.		directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.E1175K(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AGCCCCTCTTCATTATGCAAG	0.557																																						dbGAP											1	Substitution - Missense(1)	skin(1)											194.0	190.0	191.0					16																	9857878		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3523G>A	16.37:g.9857878C>T	ENSP00000379818:p.Glu1175Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00669|Q17RZ6	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E1175K	ENST00000396573.2	37	c.3523	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	C	0.412	-0.912523	0.02415	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.10960	2.83;2.82;2.82;2.83;2.83	5.19	5.19	0.71726	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.352416	0.34828	N	0.003657	T	0.13586	0.0329	L	0.42245	1.32	0.20638	N	0.999877	B;B;B	0.31655	0.132;0.16;0.334	B;B;B	0.35770	0.098;0.21;0.185	T	0.14868	-1.0457	9	.	.	.	.	17.7092	0.88317	0.0:1.0:0.0:0.0	.	1018;1175;1175	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	K	1175;1175;1018;1175;1175	ENSP00000379818:E1175K;ENSP00000385872:E1175K;ENSP00000441572:E1018K;ENSP00000332549:E1175K;ENSP00000379820:E1175K	.	E	-	1	0	GRIN2A	9765379	0.925000	0.31364	0.312000	0.25196	0.012000	0.07955	2.693000	0.47027	2.406000	0.81754	0.650000	0.86243	GAA	GRIN2A	-	pfam_NMDAR2_C	ENSG00000183454		0.557	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	111	0.00	0	C			9857878	9857878	-1	no_errors	ENST00000330684	ensembl	human	known	69_37n	missense	93	23.77	29	SNP	0.351	T
HADH	3033	genome.wustl.edu	37	4	108954346	108954346	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr4:108954346G>A	ENST00000309522.3	+	7	873	c.724G>A	c.(724-726)Gaa>Aaa	p.E242K	HADH_ENST00000403312.1_Missense_Mutation_p.E318K|HADH_ENST00000603302.1_Missense_Mutation_p.E259K|HADH_ENST00000510728.1_3'UTR|HADH_ENST00000505878.1_Missense_Mutation_p.E246K|HADH_ENST00000454409.2_Missense_Mutation_p.E246K	NM_005327.4	NP_005318	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase	571					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	15		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)		CGCATCCAAAGAAGACATTGA	0.468																																						dbGAP											0													140.0	133.0	135.0					4																	108954346		2203	4300	6503	-	-	-	SO:0001583	missense	0			X96752	CCDS3678.1, CCDS54790.1	4q22-q26	2012-10-02	2010-04-30		ENSG00000138796	ENSG00000138796	1.1.1.35		4799	protein-coding gene	gene with protein product		601609	"""L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain"", ""hydroxyacyl-Coenzyme A dehydrogenase"""	HADHSC		975867, 16176262	Standard	NM_001184705		Approved	HADH1, SCHAD	uc010ilx.3	Q16836	OTTHUMG00000131810	ENST00000309522.3:c.724G>A	4.37:g.108954346G>A	ENSP00000312288:p.Glu242Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_3HC_DH_C,pfam_AlaDH/PNT_NAD(H)-bd,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_UDP-Glc/GDP-Man_DH_N,superfamily_6-PGluconate_DH_C-like	p.E259K	ENST00000309522.3	37	c.775	CCDS3678.1	4	.	.	.	.	.	.	.	.	.	.	G	18.62	3.662650	0.67700	.	.	ENSG00000138796	ENST00000403312;ENST00000309522;ENST00000505878;ENST00000454409	D;D;D	0.90676	-2.71;-2.71;-2.71	5.86	5.86	0.93980	3-hydroxyacyl-CoA dehydrogenase, C-terminal (1);Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	D	0.89487	0.6729	L	0.37800	1.135	0.80722	D	1	B;B;B	0.30824	0.296;0.154;0.082	B;B;B	0.38803	0.13;0.282;0.102	D	0.88165	0.2860	10	0.87932	D	0	-36.8096	18.9646	0.92691	0.0:0.0:1.0:0.0	.	318;246;242	Q16836-2;E9PF18;Q16836	.;.;HCDH_HUMAN	K	259;242;246;246	ENSP00000312288:E242K;ENSP00000425952:E246K;ENSP00000395167:E246K	ENSP00000312288:E242K	E	+	1	0	HADH	109173795	1.000000	0.71417	0.998000	0.56505	0.710000	0.40934	9.548000	0.98103	2.771000	0.95319	0.563000	0.77884	GAA	HADH	-	pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like	ENSG00000138796		0.468	HADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HADH	HGNC	protein_coding	OTTHUMT00000254750.2	119	0.00	0	G	NM_005327		108954346	108954346	+1	no_errors	ENST00000403312	ensembl	human	known	69_37n	missense	71	34.86	38	SNP	1.000	A
HCFC1	3054	genome.wustl.edu	37	X	153219201	153219201	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chrX:153219201C>T	ENST00000310441.7	-	18	5320	c.4354G>A	c.(4354-4356)Gat>Aat	p.D1452N	HCFC1_ENST00000354233.3_Missense_Mutation_p.D1383N|HCFC1_ENST00000369984.4_Missense_Mutation_p.D1452N	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1452					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCTCCCTGATCGCTGGCAGCA	0.662																																						dbGAP											0													33.0	32.0	32.0					X																	153219201		2119	4212	6331	-	-	-	SO:0001583	missense	0				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.4354G>A	X.37:g.153219201C>T	ENSP00000309555:p.Asp1452Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P4G5	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.D1452N	ENST00000310441.7	37	c.4354	CCDS44020.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.71|13.71	2.318166|2.318166	0.40996|0.40996	.|.	.|.	ENSG00000172534|ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233|ENST00000444191	T;T;T|.	0.03004|.	4.09;4.1;4.08|.	5.94|5.94	5.07|5.07	0.68467|0.68467	.|.	0.260918|.	0.38058|.	N|.	0.001840|.	T|T	0.22126|0.22126	0.0533|0.0533	N|N	0.08118|0.08118	0|0	0.27572|0.27572	N|N	0.949861|0.949861	P|.	0.36438|.	0.553|.	B|.	0.25884|.	0.064|.	T|T	0.13150|0.13150	-1.0520|-1.0520	10|5	0.33940|.	T|.	0.23|.	.|.	11.729|11.729	0.51726|0.51726	0.0:0.9132:0.0:0.0868|0.0:0.9132:0.0:0.0868	.|.	1452|.	P51610|.	HCFC1_HUMAN|.	N|Q	1452;1452;1383|26	ENSP00000309555:D1452N;ENSP00000359001:D1452N;ENSP00000346174:D1383N|.	ENSP00000309555:D1452N|.	D|R	-|-	1|2	0|0	HCFC1|HCFC1	152872395|152872395	0.044000|0.044000	0.20184|0.20184	0.931000|0.931000	0.37212|0.37212	0.276000|0.276000	0.26787|0.26787	2.290000|2.290000	0.43531|0.43531	2.509000|2.509000	0.84616|0.84616	0.529000|0.529000	0.55759|0.55759	GAT|CGA	HCFC1	-	NULL	ENSG00000172534		0.662	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	HGNC	protein_coding	OTTHUMT00000061099.4	33	0.00	0	C	NM_005334		153219201	153219201	-1	no_errors	ENST00000310441	ensembl	human	known	69_37n	missense	21	36.36	12	SNP	0.969	T
IL18R1	8809	genome.wustl.edu	37	2	102998106	102998106	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr2:102998106C>G	ENST00000409599.1	+	7	1008	c.652C>G	c.(652-654)Ctt>Gtt	p.L218V	IL18R1_ENST00000233957.1_Missense_Mutation_p.L218V			Q13478	IL18R_HUMAN	interleukin 18 receptor 1	218					immune response (GO:0006955)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|signal transduction (GO:0007165)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-18 receptor activity (GO:0042008)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						TCCGGTTCTTCTTGGACCAAA	0.353																																						dbGAP											0													134.0	122.0	126.0					2																	102998106		2203	4300	6503	-	-	-	SO:0001583	missense	0			U43672	CCDS2060.1	2q12	2013-01-29			ENSG00000115604	ENSG00000115604		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5988	protein-coding gene	gene with protein product		604494				8626725, 10191101	Standard	NM_003855		Approved	IL1RRP, IL-1Rrp, CD218a	uc010fiy.3	Q13478	OTTHUMG00000130780	ENST00000409599.1:c.652C>G	2.37:g.102998106C>G	ENSP00000387211:p.Leu218Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9Y5|Q52LC9	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_IL1_rcpt_I/II	p.L218V	ENST00000409599.1	37	c.652	CCDS2060.1	2	.	.	.	.	.	.	.	.	.	.	C	12.76	2.033303	0.35893	.	.	ENSG00000115604	ENST00000410040;ENST00000409599;ENST00000233957	T;T;T	0.02863	4.13;4.13;4.13	5.03	-0.141	0.13452	.	1.561420	0.03487	N	0.215960	T	0.06188	0.0160	M	0.73962	2.25	0.30640	N	0.756538	P;P	0.49559	0.925;0.925	P;P	0.45071	0.468;0.468	T	0.35574	-0.9783	10	0.35671	T	0.21	.	4.0344	0.09724	0.1614:0.4484:0.0:0.3902	.	218;218	B7ZKV7;Q13478	.;IL18R_HUMAN	V	218	ENSP00000386663:L218V;ENSP00000387211:L218V;ENSP00000233957:L218V	ENSP00000233957:L218V	L	+	1	0	IL18R1	102364538	0.011000	0.17503	0.589000	0.28718	0.266000	0.26442	-0.486000	0.06513	-0.016000	0.14127	0.650000	0.86243	CTT	IL18R1	-	NULL	ENSG00000115604		0.353	IL18R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL18R1	HGNC	protein_coding	OTTHUMT00000253294.2	163	0.00	0	C	NM_003855		102998106	102998106	+1	no_errors	ENST00000233957	ensembl	human	known	69_37n	missense	78	30.97	35	SNP	0.549	G
IL20	50604	genome.wustl.edu	37	1	207039354	207039354	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr1:207039354G>A	ENST00000367098.1	+	2	520	c.157G>A	c.(157-159)Gtg>Atg	p.V53M	IL20_ENST00000367096.3_Missense_Mutation_p.V53M|IL20_ENST00000391930.2_Missense_Mutation_p.V53M			Q9UHF5	IL17B_HUMAN	interleukin 20	0					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			endometrium(2)|large_intestine(3)|lung(2)|pancreas(1)|urinary_tract(1)	9	Breast(84;0.201)			OV - Ovarian serous cystadenocarcinoma(81;0.00459)		ACGGGGCAGTGTGGTACGTAA	0.463																																						dbGAP											0													79.0	80.0	80.0					1																	207039354		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF224266	CCDS1470.1	1q32	2008-02-05			ENSG00000162891	ENSG00000162891		"""Interleukins and interleukin receptors"""	6002	protein-coding gene	gene with protein product		605619				11163236	Standard	NM_018724		Approved	ZCYTO10, IL10D, IL-20	uc001her.3	Q9NYY1	OTTHUMG00000036456	ENST00000367098.1:c.157G>A	1.37:g.207039354G>A	ENSP00000356065:p.Val53Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CE5	Missense_Mutation	SNP	pfam_Interleukin-10/19/20/24,superfamily_4_helix_cytokine-like_core,smart_Interleukin-10/19/20/24,prints_Interleukin-20,prints_Interleukin-24	p.V53M	ENST00000367098.1	37	c.157	CCDS1470.1	1	.	.	.	.	.	.	.	.	.	.	G	11.31	1.600508	0.28534	.	.	ENSG00000162891	ENST00000367098;ENST00000367096;ENST00000391930	T;T;T	0.63580	-0.05;-0.05;2.21	4.56	2.7	0.31948	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.403355	0.25820	N	0.028082	T	0.52092	0.1713	L	0.58583	1.82	0.33896	D	0.637901	B;B	0.34103	0.383;0.437	B;B	0.31547	0.081;0.132	T	0.59947	-0.7358	10	0.48119	T	0.1	-10.6617	6.8324	0.23917	0.208:0.0:0.792:0.0	.	53;53	Q2THG6;Q9NYY1	.;IL20_HUMAN	M	53	ENSP00000356065:V53M;ENSP00000356063:V53M;ENSP00000375796:V53M	ENSP00000356063:V53M	V	+	1	0	IL20	205105977	0.965000	0.33210	0.555000	0.28281	0.702000	0.40608	1.692000	0.37731	0.564000	0.29238	0.655000	0.94253	GTG	IL20	-	pfam_Interleukin-10/19/20/24,superfamily_4_helix_cytokine-like_core,smart_Interleukin-10/19/20/24,prints_Interleukin-24	ENSG00000162891		0.463	IL20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL20	HGNC	protein_coding	OTTHUMT00000088676.1	57	0.00	0	G	NM_018724		207039354	207039354	+1	no_errors	ENST00000367096	ensembl	human	known	69_37n	missense	61	21.79	17	SNP	0.694	A
KCNQ3	3786	genome.wustl.edu	37	8	133192479	133192479	+	Silent	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr8:133192479G>A	ENST00000388996.4	-	4	1122	c.702C>T	c.(700-702)atC>atT	p.I234I	KCNQ3_ENST00000521134.1_Silent_p.I114I|KCNQ3_ENST00000519445.1_Silent_p.I234I	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	234					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GCATGCGCAGGATCTGCAGGA	0.582																																						dbGAP											0													102.0	92.0	96.0					8																	133192479		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.702C>T	8.37:g.133192479G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCT8|B4DJY4|E7EQ89	Silent	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ3,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.I234	ENST00000388996.4	37	c.702	CCDS34943.1	8																																																																																			KCNQ3	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000184156		0.582	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	HGNC	protein_coding	OTTHUMT00000268621.2	39	0.00	0	G	NM_004519		133192479	133192479	-1	no_errors	ENST00000388996	ensembl	human	known	69_37n	silent	66	25.84	23	SNP	1.000	A
KCNQ4	9132	genome.wustl.edu	37	1	41300696	41300696	+	Silent	SNP	C	C	T	rs542936837		TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr1:41300696C>T	ENST00000347132.5	+	12	1753	c.1671C>T	c.(1669-1671)gaC>gaT	p.D557D	KCNQ4_ENST00000506017.1_3'UTR|KCNQ4_ENST00000509682.2_Silent_p.D503D	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	557	A-domain (Tetramerization).				inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.D557D(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	GACCGTACGACGTGAAGGACG	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		19977	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											128.0	114.0	119.0					1																	41300696		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.1671C>T	1.37:g.41300696C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O96025	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.R418C	ENST00000347132.5	37	c.1252	CCDS456.1	1	.	.	.	.	.	.	.	.	.	.	C	9.365	1.068929	0.20147	.	.	ENSG00000117013	ENST00000443478	.	.	.	5.12	1.45	0.22620	.	.	.	.	.	T	0.52354	0.1729	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42085	-0.9472	4	.	.	.	-29.3638	5.9979	0.19505	0.0:0.3712:0.0:0.6288	.	.	.	.	C	418	.	.	R	+	1	0	KCNQ4	41073283	0.504000	0.26123	1.000000	0.80357	0.994000	0.84299	-0.251000	0.08818	0.565000	0.29255	0.551000	0.68910	CGT	KCNQ4	-	pfam_K_chnl_volt-dep_KCNQ_C	ENSG00000117013		0.587	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KCNQ4	HGNC	protein_coding	OTTHUMT00000020812.1	25	0.00	0	C	NM_004700		41300696	41300696	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000443478	ensembl	human	novel	69_37n	missense	22	26.67	8	SNP	1.000	T
KIAA1210	57481	genome.wustl.edu	37	X	118215410	118215410	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chrX:118215410C>T	ENST00000402510.2	-	14	5011	c.5012G>A	c.(5011-5013)cGa>cAa	p.R1671Q		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1671										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						AGTTGAAGATCGTTTGGTTTC	0.478																																						dbGAP											0													168.0	154.0	159.0					X																	118215410		1895	4104	5999	-	-	-	SO:0001583	missense	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.5012G>A	X.37:g.118215410C>T	ENSP00000384670:p.Arg1671Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NULL	p.R1671Q	ENST00000402510.2	37	c.5012	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	C	11.13	1.549337	0.27652	.	.	ENSG00000250423	ENST00000402510	T	0.13089	2.62	5.0	-4.26	0.03755	.	.	.	.	.	T	0.07548	0.0190	N	0.25332	0.735	0.09310	N	1	B	0.27498	0.18	B	0.17979	0.02	T	0.30001	-0.9993	9	0.33940	T	0.23	.	7.6247	0.28206	0.1327:0.2067:0.0:0.6607	.	1671	Q9ULL0	K1210_HUMAN	Q	1671	ENSP00000384670:R1671Q	ENSP00000384670:R1671Q	R	-	2	0	RP13-347D8.6	118099438	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-2.156000	0.01283	-1.121000	0.02949	-0.315000	0.08773	CGA	KIAA1210	-	NULL	ENSG00000250423		0.478	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	177	0.00	0	C	NM_020721		118215410	118215410	-1	no_errors	ENST00000402510	ensembl	human	known	69_37n	missense	92	48.02	85	SNP	0.000	T
KIAA2018	205717	genome.wustl.edu	37	3	113375166	113375166	+	Missense_Mutation	SNP	C	C	T	rs201006777		TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr3:113375166C>T	ENST00000478658.1	-	5	5380	c.5363G>A	c.(5362-5364)cGt>cAt	p.R1788H	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.R1788H			Q68DE3	K2018_HUMAN	KIAA2018	1788						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TCTCTTTTGACGGTCAATTGG	0.433																																						dbGAP											0													175.0	173.0	174.0					3																	113375166		1894	4115	6009	-	-	-	SO:0001583	missense	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.5363G>A	3.37:g.113375166C>T	ENSP00000420721:p.Arg1788His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.R1788H	ENST00000478658.1	37	c.5363	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	C	19.58	3.853698	0.71719	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.22336	1.96;1.96	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.30854	0.0778	L	0.32530	0.975	0.51482	D	0.999929	D	0.71674	0.998	P	0.59948	0.866	T	0.00589	-1.1656	10	0.42905	T	0.14	-13.3743	13.4901	0.61390	0.0:0.9289:0.0:0.0711	.	1788	Q68DE3	K2018_HUMAN	H	1788	ENSP00000320794:R1788H;ENSP00000420721:R1788H	ENSP00000320794:R1788H	R	-	2	0	KIAA2018	114857856	0.998000	0.40836	1.000000	0.80357	0.993000	0.82548	3.152000	0.50677	2.802000	0.96397	0.655000	0.94253	CGT	KIAA2018	-	NULL	ENSG00000176542		0.433	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1	55	0.00	0	C	NM_001009899		113375166	113375166	-1	no_errors	ENST00000316407	ensembl	human	known	69_37n	missense	37	36.21	21	SNP	1.000	T
KIF23	9493	genome.wustl.edu	37	15	69733225	69733225	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr15:69733225G>C	ENST00000260363.4	+	18	2303	c.2186G>C	c.(2185-2187)tGg>tCg	p.W729S	KIF23_ENST00000559279.1_Intron|KIF23_ENST00000352331.4_Intron|KIF23_ENST00000537891.1_Intron|KIF23_ENST00000395392.2_Missense_Mutation_p.W729S|KIF23_ENST00000558585.1_Intron	NM_138555.2	NP_612565.1	Q02241	KIF23_HUMAN	kinesin family member 23	729					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle elongation (GO:0000022)|positive regulation of cytokinesis (GO:0032467)|spindle midzone assembly involved in mitosis (GO:0051256)	centralspindlin complex (GO:0097149)|centrosome (GO:0005813)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercellular bridge (GO:0045171)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(6)|prostate(2)|skin(1)	21						ATTTCGGAATGGGAGCAGAAA	0.488																																						dbGAP											0													79.0	70.0	73.0					15																	69733225		2199	4298	6497	-	-	-	SO:0001583	missense	0			X67155	CCDS32278.1, CCDS32279.1	15q23	2008-03-03	2003-01-13	2003-01-17		ENSG00000137807		"""Kinesins"""	6392	protein-coding gene	gene with protein product		605064	"""kinesin-like 5 (mitotic kinesin-like protein 1)"""	KNSL5		1406973	Standard	NM_138555		Approved	MKLP1, MKLP-1	uc002asb.3	Q02241		ENST00000260363.4:c.2186G>C	15.37:g.69733225G>C	ENSP00000260363:p.Trp729Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WVP0	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.W729S	ENST00000260363.4	37	c.2186	CCDS32278.1	15	.	.	.	.	.	.	.	.	.	.	G	17.71	3.457808	0.63401	.	.	ENSG00000137807	ENST00000260363;ENST00000395392	T;T	0.74737	-0.87;-0.87	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.79246	0.4413	L	0.38175	1.15	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.71111	-0.4687	10	0.07813	T	0.8	.	18.7421	0.91777	0.0:0.0:1.0:0.0	.	729	Q02241	KIF23_HUMAN	S	729	ENSP00000260363:W729S;ENSP00000378790:W729S	ENSP00000260363:W729S	W	+	2	0	KIF23	67520279	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.667000	0.98616	2.740000	0.93945	0.650000	0.86243	TGG	KIF23	-	NULL	ENSG00000137807		0.488	KIF23-201	KNOWN	basic|CCDS	protein_coding	KIF23	HGNC	protein_coding		73	0.00	0	G			69733225	69733225	+1	no_errors	ENST00000260363	ensembl	human	known	69_37n	missense	63	26.74	23	SNP	1.000	C
LRP4	4038	genome.wustl.edu	37	11	46920500	46920500	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr11:46920500C>G	ENST00000378623.1	-	6	873	c.631G>C	c.(631-633)Gat>Cat	p.D211H		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	211	LDL-receptor class A 5. {ECO:0000255|PROSITE-ProRule:PRU00124}.				dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		TCGTCGCCATCGCAGTGGTAG	0.622																																						dbGAP											0													50.0	42.0	45.0					11																	46920500		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.631G>C	11.37:g.46920500C>G	ENSP00000367888:p.Asp211His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.D211H	ENST00000378623.1	37	c.631	CCDS31478.1	11	.	.	.	.	.	.	.	.	.	.	C	33	5.229686	0.95173	.	.	ENSG00000134569	ENST00000378623	D	0.98717	-5.09	4.96	4.96	0.65561	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99521	0.9829	H	0.98111	4.15	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.971	D	0.97877	1.0289	10	0.87932	D	0	.	18.2359	0.89949	0.0:1.0:0.0:0.0	.	256;211	C9JRN7;O75096	.;LRP4_HUMAN	H	211	ENSP00000367888:D211H	ENSP00000367888:D211H	D	-	1	0	LRP4	46877076	1.000000	0.71417	0.998000	0.56505	0.950000	0.60333	7.610000	0.82949	2.312000	0.78011	0.491000	0.48974	GAT	LRP4	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000134569		0.622	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP4	HGNC	protein_coding	OTTHUMT00000391133.1	27	0.00	0	C	NM_002334		46920500	46920500	-1	no_errors	ENST00000378623	ensembl	human	known	69_37n	missense	6	50.00	6	SNP	1.000	G
LRRIQ1	84125	genome.wustl.edu	37	12	85438525	85438525	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr12:85438525C>T	ENST00000393217.2	+	4	335	c.274C>T	c.(274-276)Cat>Tat	p.H92Y		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	92										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TTCTAATAATCATATGCATTT	0.269																																						dbGAP											0													57.0	62.0	60.0					12																	85438525		2192	4250	6442	-	-	-	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.274C>T	12.37:g.85438525C>T	ENSP00000376910:p.His92Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.H92Y	ENST00000393217.2	37	c.274	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	C	2.800	-0.249277	0.05867	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393212;ENST00000393217	T;T	0.52983	1.48;0.64	4.79	2.96	0.34315	.	0.287844	0.24737	N	0.036005	T	0.42381	0.1200	L	0.53249	1.67	0.20703	N	0.999869	B;B	0.32693	0.38;0.203	B;B	0.37422	0.249;0.163	T	0.35674	-0.9779	10	0.49607	T	0.09	.	6.8087	0.23792	0.0:0.7274:0.1772:0.0953	.	92;92	Q96JM4;C9JI57	LRIQ1_HUMAN;.	Y	92	ENSP00000376906:H92Y;ENSP00000376910:H92Y	ENSP00000256007:H92Y	H	+	1	0	LRRIQ1	83962656	0.867000	0.29959	0.468000	0.27192	0.021000	0.10359	0.849000	0.27723	0.729000	0.32403	-0.384000	0.06662	CAT	LRRIQ1	-	NULL	ENSG00000133640		0.269	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	58	0.00	0	C	NM_032165		85438525	85438525	+1	no_errors	ENST00000393217	ensembl	human	known	69_37n	missense	57	25.00	19	SNP	0.587	T
MAB21L3	126868	genome.wustl.edu	37	1	116670894	116670894	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr1:116670894G>C	ENST00000369500.3	+	6	1054	c.789G>C	c.(787-789)atG>atC	p.M263I		NM_152367.2	NP_689580.2	Q8N8X9	MB213_HUMAN	mab-21-like 3 (C. elegans)	263										breast(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|urinary_tract(1)	19						TTCAGGTCATGAGGCACCTGA	0.572																																						dbGAP											0													62.0	57.0	59.0					1																	116670894		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096035	CCDS886.1	1p13.1	2011-02-23	2011-02-23	2011-02-23	ENSG00000173212	ENSG00000173212			26787	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 161"""	C1orf161		14702039	Standard	NM_152367		Approved	FLJ38716	uc001egc.1	Q8N8X9	OTTHUMG00000012110	ENST00000369500.3:c.789G>C	1.37:g.116670894G>C	ENSP00000358512:p.Met263Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDL7	Missense_Mutation	SNP	pfam_Mab-21_dom	p.M263I	ENST00000369500.3	37	c.789	CCDS886.1	1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299076	0.40694	.	.	ENSG00000173212	ENST00000369500	T	0.09723	2.95	5.36	4.44	0.53790	.	1.062450	0.07380	N	0.887328	T	0.05960	0.0155	L	0.59436	1.845	0.24652	N	0.993519	B	0.20671	0.047	B	0.18871	0.023	T	0.17440	-1.0369	10	0.56958	D	0.05	-0.1956	9.3917	0.38376	0.0736:0.0:0.7859:0.1405	.	263	Q8N8X9	MB213_HUMAN	I	263	ENSP00000358512:M263I	ENSP00000358512:M263I	M	+	3	0	MAB21L3	116472417	1.000000	0.71417	0.977000	0.42913	0.596000	0.36781	2.783000	0.47766	2.541000	0.85698	0.585000	0.79938	ATG	MAB21L3	-	pfam_Mab-21_dom	ENSG00000173212		0.572	MAB21L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L3	HGNC	protein_coding	OTTHUMT00000033486.1	103	0.00	0	G	NM_152367		116670894	116670894	+1	no_errors	ENST00000369500	ensembl	human	known	69_37n	missense	34	54.05	40	SNP	0.997	C
MMP14	4323	genome.wustl.edu	37	14	23311622	23311622	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr14:23311622C>G	ENST00000311852.6	+	4	645	c.384C>G	c.(382-384)atC>atG	p.I128M	MMP14_ENST00000548162.1_3'UTR	NM_004995.2	NP_004986.1	P50281	MMP14_HUMAN	matrix metallopeptidase 14 (membrane-inserted)	128					angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|branching morphogenesis of an epithelial tube (GO:0048754)|chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|endodermal cell differentiation (GO:0035987)|endothelial cell proliferation (GO:0001935)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|male gonad development (GO:0008584)|negative regulation of focal adhesion assembly (GO:0051895)|ovarian follicle development (GO:0001541)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|tissue remodeling (GO:0048771)|zymogen activation (GO:0031638)	extracellular matrix (GO:0031012)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|peptidase activator activity (GO:0016504)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)	Marimastat(DB00786)	ACCTCAGCATCCAGAATTACA	0.612																																						dbGAP											0													68.0	49.0	55.0					14																	23311622		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9577.1	14q11-q12	2011-06-29	2005-08-08		ENSG00000157227	ENSG00000157227			7160	protein-coding gene	gene with protein product	"""membrane type 1 metalloprotease"""	600754	"""matrix metalloproteinase 14 (membrane-inserted)"""			8015608	Standard	NM_004995		Approved	MT1-MMP	uc001whc.3	P50281	OTTHUMG00000028704	ENST00000311852.6:c.384C>G	14.37:g.23311622C>G	ENSP00000308208:p.Ile128Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5L0|Q6GSF3|Q92678	Missense_Mutation	SNP	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.I128M	ENST00000311852.6	37	c.384	CCDS9577.1	14	.	.	.	.	.	.	.	.	.	.	C	16.69	3.194403	0.58017	.	.	ENSG00000157227	ENST00000311852;ENST00000548761	T;T	0.29655	1.56;1.56	4.89	3.03	0.35002	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.57961	0.2089	M	0.89968	3.075	0.58432	D	0.999997	D	0.56968	0.978	D	0.73708	0.981	T	0.61307	-0.7089	10	0.87932	D	0	.	8.8461	0.35170	0.0:0.8188:0.0:0.1812	.	128	P50281	MMP14_HUMAN	M	128;134	ENSP00000308208:I128M;ENSP00000446989:I134M	ENSP00000308208:I128M	I	+	3	3	MMP14	22381462	0.990000	0.36364	1.000000	0.80357	0.998000	0.95712	0.451000	0.21779	0.639000	0.30564	0.561000	0.74099	ATC	MMP14	-	pirsf_Pept_M10A_matrix_strom,pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo	ENSG00000157227		0.612	MMP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP14	HGNC	protein_coding	OTTHUMT00000071660.3	39	0.00	0	C	NM_004995		23311622	23311622	+1	no_errors	ENST00000311852	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	1.000	G
MPI	4351	genome.wustl.edu	37	15	75188521	75188521	+	Silent	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr15:75188521C>T	ENST00000352410.4	+	6	766	c.699C>T	c.(697-699)atC>atT	p.I233I	MPI_ENST00000564003.1_Silent_p.I122I|MPI_ENST00000535694.1_Silent_p.I183I|MPI_ENST00000566377.1_Silent_p.I233I|MPI_ENST00000323744.6_Silent_p.I172I|MPI_ENST00000563422.1_Silent_p.I233I|MPI_ENST00000562606.1_Silent_p.I213I|MPI_ENST00000563786.1_Silent_p.I213I			P34949	MPI_HUMAN	mannose phosphate isomerase	233					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	mannose-6-phosphate isomerase activity (GO:0004476)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						TGGAGGACATCTTTGGGGAGC	0.562																																						dbGAP											0													132.0	119.0	123.0					15																	75188521		2197	4295	6492	-	-	-	SO:0001819	synonymous_variant	0				CCDS10272.1, CCDS73756.1, CCDS73757.1, CCDS73758.1	15q24.1	2013-09-19			ENSG00000178802	ENSG00000178802	5.3.1.8		7216	protein-coding gene	gene with protein product	"""mannose-6-phosphate isomerase"""	154550					Standard	NM_002435		Approved		uc002azc.1	P34949	OTTHUMG00000142826	ENST00000352410.4:c.699C>T	15.37:g.75188521C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8K9|Q96AB0	Silent	SNP	pfam_Man6P_Isoase-1,superfamily_RmlC_Cupin,pirsf_Mannose-6-P_Isomerase,prints_Mannose-6-P_Isomerase,tigrfam_Man6P_Isoase-1	p.I233	ENST00000352410.4	37	c.699	CCDS10272.1	15																																																																																			MPI	-	pfam_Man6P_Isoase-1,superfamily_RmlC_Cupin,pirsf_Mannose-6-P_Isomerase,tigrfam_Man6P_Isoase-1	ENSG00000178802		0.562	MPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPI	HGNC	protein_coding	OTTHUMT00000286418.4	74	0.00	0	C			75188521	75188521	+1	no_errors	ENST00000352410	ensembl	human	known	69_37n	silent	40	32.20	19	SNP	0.068	T
MRPL3	11222	genome.wustl.edu	37	3	131188558	131188558	+	Silent	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr3:131188558C>T	ENST00000264995.3	-	8	945	c.798G>A	c.(796-798)agG>agA	p.R266R	MRPL3_ENST00000425847.2_Silent_p.R293R	NM_007208.3	NP_009139.1	P09001	RM03_HUMAN	mitochondrial ribosomal protein L3	266					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	10						CATATTCTGTCCTGTATATGT	0.348																																						dbGAP											0													130.0	113.0	119.0					3																	131188558		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X06323	CCDS3071.1	3q21-q23	2012-09-13			ENSG00000114686	ENSG00000114686		"""Mitochondrial ribosomal proteins / large subunits"""	10379	protein-coding gene	gene with protein product		607118		RPML3		2891103	Standard	NM_007208		Approved	MRL3	uc003eoh.3	P09001	OTTHUMG00000159607	ENST00000264995.3:c.798G>A	3.37:g.131188558C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IBT2	Missense_Mutation	SNP	pfam_Ribosomal_L3,superfamily_Transl_elong_init/rib_B-barrel,tigrfam_Ribosomal_L3_bac/org-type	p.D281N	ENST00000264995.3	37	c.841	CCDS3071.1	3	.	.	.	.	.	.	.	.	.	.	C	0.260	-1.000465	0.02128	.	.	ENSG00000114686	ENST00000511168	.	.	.	5.41	4.35	0.52113	.	.	.	.	.	T	0.68815	0.3042	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67133	-0.5747	4	.	.	.	-11.5559	13.9654	0.64205	0.0:0.9107:0.0:0.0893	.	.	.	.	N	281	.	.	D	-	1	0	MRPL3	132671248	1.000000	0.71417	0.997000	0.53966	0.030000	0.12068	1.475000	0.35409	2.538000	0.85594	0.650000	0.86243	GAC	MRPL3	-	pfam_Ribosomal_L3,superfamily_Transl_elong_init/rib_B-barrel,tigrfam_Ribosomal_L3_bac/org-type	ENSG00000114686		0.348	MRPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL3	HGNC	protein_coding	OTTHUMT00000356471.3	120	0.00	0	C	NM_007208		131188558	131188558	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000511168	ensembl	human	putative	69_37n	missense	78	24.27	25	SNP	0.991	T
MRPL53	116540	genome.wustl.edu	37	2	74699368	74699368	+	Missense_Mutation	SNP	G	G	A	rs202083153		TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr2:74699368G>A	ENST00000258105.7	-	3	878	c.217C>T	c.(217-219)Cgc>Tgc	p.R73C	MRPL53_ENST00000409710.1_Missense_Mutation_p.S35L	NM_053050.4	NP_444278.1	Q96EL3	RM53_HUMAN	mitochondrial ribosomal protein L53	73						mitochondrion (GO:0005739)|ribosome (GO:0005840)				central_nervous_system(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5						ATAATCAGGCGATGCCCGTCT	0.682																																						dbGAP											0													30.0	31.0	31.0					2																	74699368		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC012163	CCDS1944.1	2p13.1	2012-09-13			ENSG00000204822	ENSG00000204822		"""Mitochondrial ribosomal proteins / large subunits"""	16684	protein-coding gene	gene with protein product		611857				11551941	Standard	NM_053050		Approved		uc002sln.3	Q96EL3	OTTHUMG00000129961	ENST00000258105.7:c.217C>T	2.37:g.74699368G>A	ENSP00000258105:p.Arg73Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ribosomal_L53_mit,superfamily_Thioredoxin-like_fold	p.R73C	ENST00000258105.7	37	c.217	CCDS1944.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.4|27.4	4.824230|4.824230	0.90955|0.90955	.|.	.|.	ENSG00000204822|ENSG00000204822	ENST00000258105|ENST00000409710	T|T	0.50001|0.49720	0.76|0.77	4.92|4.92	4.92|4.92	0.64577|0.64577	.|.	0.055231|.	0.64402|.	D|.	0.000001|.	T|T	0.57359|0.57359	0.2048|0.2048	L|L	0.55481|0.55481	1.735|1.735	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.73708|.	0.981|.	T|T	0.60105|0.60105	-0.7328|-0.7328	10|7	0.87932|0.87932	D|D	0|0	-36.2575|-36.2575	13.4829|13.4829	0.61348|0.61348	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	73|.	Q96EL3|.	RM53_HUMAN|.	C|L	73|35	ENSP00000258105:R73C|ENSP00000386920:S35L	ENSP00000258105:R73C|ENSP00000386920:S35L	R|S	-|-	1|2	0|0	MRPL53|MRPL53	74552876|74552876	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.913000|0.913000	0.54294|0.54294	4.076000|4.076000	0.57591|0.57591	2.558000|2.558000	0.86282|0.86282	0.596000|0.596000	0.82720|0.82720	CGC|TCG	MRPL53	-	superfamily_Thioredoxin-like_fold	ENSG00000204822		0.682	MRPL53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL53	HGNC	protein_coding	OTTHUMT00000252225.2	20	0.00	0	G	NM_053050		74699368	74699368	-1	no_errors	ENST00000258105	ensembl	human	known	69_37n	missense	24	31.43	11	SNP	1.000	A
MRPS25	64432	genome.wustl.edu	37	3	15094076	15094076	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr3:15094076G>A	ENST00000253686.2	-	4	534	c.394C>T	c.(394-396)Cga>Tga	p.R132*	MRPS25_ENST00000449354.2_Intron|MRPS25_ENST00000496484.1_5'Flank|MRPS25_ENST00000444840.2_Silent_p.L102L	NM_022497.3	NP_071942.1	P82663	RT25_HUMAN	mitochondrial ribosomal protein S25	132						mitochondrion (GO:0005739)|ribosome (GO:0005840)				large_intestine(1)|lung(1)	2						CAGTACTTTCGAGGGCCGAAG	0.577																																						dbGAP											0													186.0	189.0	188.0					3																	15094076		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB061208	CCDS2622.1	3p25	2012-09-13			ENSG00000131368	ENSG00000131368		"""Mitochondrial ribosomal proteins / small subunits"""	14511	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S25"""	611987				11279123	Standard	NM_022497		Approved	MRP-S25, FLJ00023, DKFZp313H0817, RPMS25	uc003bzl.3	P82663	OTTHUMG00000129836	ENST00000253686.2:c.394C>T	3.37:g.15094076G>A	ENSP00000253686:p.Arg132*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFJ5|B4DQG6|Q9H7P5	Nonsense_Mutation	SNP	pfam_Ribosome/NADH_DH,superfamily_Thioredoxin-like_fold,smart_Ribosome/NADH_DH	p.R132*	ENST00000253686.2	37	c.394	CCDS2622.1	3	.	.	.	.	.	.	.	.	.	.	G	26.5	4.741317	0.89573	.	.	ENSG00000131368	ENST00000253686	.	.	.	5.74	4.8	0.61643	.	0.260854	0.35207	N	0.003362	.	.	.	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-11.699	13.1265	0.59358	0.0:0.0:0.7816:0.2184	.	.	.	.	X	132	.	ENSP00000253686:R132X	R	-	1	2	MRPS25	15069080	1.000000	0.71417	0.948000	0.38648	0.955000	0.61496	3.626000	0.54245	2.721000	0.93114	0.491000	0.48974	CGA	MRPS25	-	NULL	ENSG00000131368		0.577	MRPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS25	HGNC	protein_coding	OTTHUMT00000252076.2	59	0.00	0	G	NM_022497		15094076	15094076	-1	no_errors	ENST00000253686	ensembl	human	known	69_37n	nonsense	44	48.24	41	SNP	0.836	A
MVP	9961	genome.wustl.edu	37	16	29853120	29853120	+	Silent	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr16:29853120C>T	ENST00000357402.5	+	9	1533	c.1395C>T	c.(1393-1395)aaC>aaT	p.N465N	MVP_ENST00000395353.1_Silent_p.N465N|MVP_ENST00000452209.2_3'UTR	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	465					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						TGCCCCACAACGCTGCGGTGC	0.652																																						dbGAP											0													45.0	41.0	42.0					16																	29853120		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.1395C>T	16.37:g.29853120C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Silent	SNP	pfam_Vault_N,pfam_MVP_shoulder	p.N465	ENST00000357402.5	37	c.1395	CCDS10656.1	16																																																																																			MVP	-	NULL	ENSG00000013364		0.652	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVP	HGNC	protein_coding	OTTHUMT00000109711.3	21	0.00	0	C	NM_005115		29853120	29853120	+1	no_errors	ENST00000357402	ensembl	human	known	69_37n	silent	18	37.93	11	SNP	0.079	T
MYH13	8735	genome.wustl.edu	37	17	10265677	10265677	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr17:10265677G>A	ENST00000418404.3	-	3	511	c.348C>T	c.(346-348)taC>taT	p.Y116Y	MYH13_ENST00000252172.4_Splice_Site_p.Y116Y			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	116	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						AGACACTCACGTAGATCATCC	0.443																																						dbGAP											0													217.0	197.0	204.0					17																	10265677		2203	4298	6501	-	-	-	SO:0001630	splice_region_variant	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.348+1C>T	17.37:g.10265677G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95252|Q9P0U8	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.Y116	ENST00000418404.3	37	c.348	CCDS45613.1	17																																																																																			MYH13	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000006788		0.443	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	246	0.00	0	G	NM_003802	Silent	10265677	10265677	-1	no_errors	ENST00000252172	ensembl	human	known	69_37n	silent	78	56.18	100	SNP	0.997	A
MYH8	4626	genome.wustl.edu	37	17	10312639	10312639	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr17:10312639C>A	ENST00000403437.2	-	16	1948	c.1854G>T	c.(1852-1854)aaG>aaT	p.K618N	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	618	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TGGCTAGAGTCTTCATTGCAG	0.423									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																													dbGAP											0													68.0	69.0	69.0					17																	10312639		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.1854G>T	17.37:g.10312639C>A	ENSP00000384330:p.Lys618Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14910	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K618N	ENST00000403437.2	37	c.1854	CCDS11153.1	17	.	.	.	.	.	.	.	.	.	.	C	18.85	3.710614	0.68730	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.87729	-2.29	5.22	3.1	0.35709	Myosin head, motor domain (2);	0.000000	0.43416	U	0.000563	D	0.89726	0.6798	M	0.79123	2.44	0.47276	D	0.999377	B	0.32128	0.357	P	0.46975	0.533	D	0.88923	0.3367	10	0.52906	T	0.07	.	9.0538	0.36392	0.0:0.7447:0.0:0.2553	.	618	P13535	MYH8_HUMAN	N	618	ENSP00000384330:K618N	ENSP00000252173:K618N	K	-	3	2	MYH8	10253364	0.825000	0.29262	1.000000	0.80357	0.967000	0.64934	0.213000	0.17521	1.419000	0.47118	0.650000	0.86243	AAG	MYH8	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000133020		0.423	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	63	0.00	0	C	NM_002472		10312639	10312639	-1	no_errors	ENST00000403437	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	1.000	A
NAMPT	10135	genome.wustl.edu	37	7	105893591	105893591	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr7:105893591C>G	ENST00000222553.3	-	10	1544	c.1237G>C	c.(1237-1239)Gtc>Ctc	p.V413L		NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	413					cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						TCCTTGAAGACGTTAATCTGA	0.383																																						dbGAP											0													59.0	60.0	60.0					7																	105893591		2203	4299	6502	-	-	-	SO:0001583	missense	0			U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.1237G>C	7.37:g.105893591C>G	ENSP00000222553:p.Val413Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	Missense_Mutation	SNP	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nicotinamide_PRibTrfase	p.V413L	ENST00000222553.3	37	c.1237	CCDS5737.1	7	.	.	.	.	.	.	.	.	.	.	C	34	5.306506	0.95629	.	.	ENSG00000105835	ENST00000222553	.	.	.	5.58	5.58	0.84498	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79851	0.4517	M	0.75150	2.29	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	T	0.77824	-0.2444	9	0.41790	T	0.15	-10.1583	19.9261	0.97102	0.0:1.0:0.0:0.0	.	413	P43490	NAMPT_HUMAN	L	413	.	ENSP00000222553:V413L	V	-	1	0	NAMPT	105680827	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.046000	0.76592	2.789000	0.95967	0.655000	0.94253	GTC	NAMPT	-	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nicotinamide_PRibTrfase	ENSG00000105835		0.383	NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAMPT	HGNC	protein_coding	OTTHUMT00000277146.1	91	0.00	0	C	NM_182790		105893591	105893591	-1	no_errors	ENST00000222553	ensembl	human	known	69_37n	missense	59	29.76	25	SNP	1.000	G
NCR1	9437	genome.wustl.edu	37	19	55420647	55420647	+	Silent	SNP	A	A	G			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr19:55420647A>G	ENST00000291890.4	+	4	437	c.399A>G	c.(397-399)gaA>gaG	p.E133E	NCR1_ENST00000350790.5_Silent_p.E38E|NCR1_ENST00000338835.5_Silent_p.E133E|NCR1_ENST00000598576.1_Silent_p.E121E|NCR1_ENST00000594765.1_Silent_p.E133E|NCR1_ENST00000447255.1_Silent_p.E133E|NCR1_ENST00000357397.5_Silent_p.E26E	NM_004829.5	NP_004820.2	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	133	Ig-like 2.				cellular defense response (GO:0006968)|intracellular signal transduction (GO:0035556)|natural killer cell activation (GO:0030101)|regulation of natural killer cell mediated cytotoxicity (GO:0042269)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|SWI/SNF complex (GO:0016514)	receptor signaling protein activity (GO:0005057)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(193;0.0449)		CTGGACCCGAAGTGATCTCGG	0.532																																						dbGAP											0													96.0	78.0	84.0					19																	55420647		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ001383	CCDS12911.1, CCDS46181.1, CCDS46182.1, CCDS56103.1	19q13.42	2013-09-20	2002-11-13	2002-11-15	ENSG00000189430	ENSG00000189430		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6731	protein-coding gene	gene with protein product		604530	"""lymphocyte antigen 94 (mouse) homolog (activating NK-receptor; NK-p46)"""	LY94		9730896	Standard	NM_001145457		Approved	NK-p46, NKP46, CD335	uc002qib.2	O76036	OTTHUMG00000183212	ENST00000291890.4:c.399A>G	19.37:g.55420647A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B0V3L2|B0V3L3|B0V3L4|B0V3L5|B8JL03|O76016|O76017|O76018	Silent	SNP	smart_Ig_sub	p.E133	ENST00000291890.4	37	c.399	CCDS12911.1	19																																																																																			NCR1	-	smart_Ig_sub	ENSG00000189430		0.532	NCR1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCR1	HGNC	protein_coding	OTTHUMT00000465680.1	44	0.00	0	A			55420647	55420647	+1	no_errors	ENST00000291890	ensembl	human	known	69_37n	silent	38	33.33	19	SNP	0.033	G
NIPBL	25836	genome.wustl.edu	37	5	37020923	37020923	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr5:37020923C>T	ENST00000282516.8	+	27	5771	c.5272C>T	c.(5272-5274)Cga>Tga	p.R1758*	NIPBL_ENST00000448238.2_Nonsense_Mutation_p.R1758*	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1758					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CTTGATTGTTCGATACTTGGC	0.343																																						dbGAP											0			GRCh37	CM042515	NIPBL	M							226.0	221.0	223.0					5																	37020923		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.5272C>T	5.37:g.37020923C>T	ENSP00000282516:p.Arg1758*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.R1758*	ENST00000282516.8	37	c.5272	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	C	48	14.431938	0.99795	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	.	.	.	5.76	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.5158	17.516	0.87773	0.1323:0.8677:0.0:0.0	.	.	.	.	X	1758	.	ENSP00000282516:R1758X	R	+	1	2	NIPBL	37056680	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.697000	0.54764	2.711000	0.92665	0.650000	0.86243	CGA	NIPBL	-	superfamily_ARM-type_fold	ENSG00000164190		0.343	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	126	0.00	0	C	NM_015384		37020923	37020923	+1	no_errors	ENST00000282516	ensembl	human	known	69_37n	nonsense	104	27.27	39	SNP	1.000	T
NKAIN2	154215	genome.wustl.edu	37	6	124604227	124604227	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr6:124604227T>A	ENST00000368417.1	+	2	191	c.131T>A	c.(130-132)aTt>aAt	p.I44N	NKAIN2_ENST00000545433.1_Missense_Mutation_p.I29N|NKAIN2_ENST00000368416.1_Missense_Mutation_p.I44N|NKAIN2_ENST00000476571.1_3'UTR|NKAIN2_ENST00000546092.1_Missense_Mutation_p.I44N	NM_001040214.1	NP_001035304.1	Q5VXU1	NKAI2_HUMAN	Na+/K+ transporting ATPase interacting 2	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|large_intestine(3)|lung(12)|skin(2)	19				GBM - Glioblastoma multiforme(226;0.104)		TTTGTACATATTATTATCGTC	0.358																																						dbGAP											0													190.0	181.0	184.0					6																	124604227		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB070452	CCDS34526.1	6q21	2008-02-05	2007-10-04	2007-10-04	ENSG00000188580	ENSG00000188580		"""Na+/K+ transporting ATPase interacting"""	16443	protein-coding gene	gene with protein product		609758	"""T-cell lymphoma breakpoint associated target 1"""	TCBA1		17606467	Standard	XM_005266833		Approved	FAM77B	uc003pzo.3	Q5VXU1	OTTHUMG00000015500	ENST00000368417.1:c.131T>A	6.37:g.124604227T>A	ENSP00000357402:p.Ile44Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYR4|Q8TF67	Missense_Mutation	SNP	pfam_Na/K-Atpase_Interacting	p.I44N	ENST00000368417.1	37	c.131	CCDS34526.1	6	.	.	.	.	.	.	.	.	.	.	T	24.0	4.488002	0.84854	.	.	ENSG00000188580	ENST00000368416;ENST00000368417;ENST00000546092;ENST00000539866;ENST00000545433	T;T;T;T	0.26067	1.76;1.76;1.76;1.76	5.7	5.7	0.88788	.	0.143550	0.53938	D	0.000054	T	0.50854	0.1640	M	0.88979	2.995	0.80722	D	1	D;D;D;D	0.89917	0.988;0.988;0.991;1.0	D;D;D;D	0.80764	0.977;0.984;0.986;0.994	T	0.62196	-0.6905	10	0.87932	D	0	-12.1549	15.9645	0.79956	0.0:0.0:0.0:1.0	.	44;43;44;44	F5GY48;Q5VXU1-3;Q5VXU1;Q5VXU1-2	.;.;NKAI2_HUMAN;.	N	44;44;44;43;29	ENSP00000357401:I44N;ENSP00000357402:I44N;ENSP00000440287:I44N;ENSP00000437798:I29N	ENSP00000357401:I44N	I	+	2	0	NKAIN2	124645926	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.936000	0.87665	2.174000	0.68829	0.533000	0.62120	ATT	NKAIN2	-	pfam_Na/K-Atpase_Interacting	ENSG00000188580		0.358	NKAIN2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAIN2	HGNC	protein_coding	OTTHUMT00000042057.1	193	0.00	0	T	NM_001040214		124604227	124604227	+1	no_errors	ENST00000368417	ensembl	human	known	69_37n	missense	113	34.68	60	SNP	1.000	A
NLGN4X	57502	genome.wustl.edu	37	X	5811360	5811360	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chrX:5811360G>A	ENST00000381095.3	-	6	2576	c.1949C>T	c.(1948-1950)tCt>tTt	p.S650F	NLGN4X_ENST00000275857.6_Missense_Mutation_p.S650F|NLGN4X_ENST00000538097.1_Missense_Mutation_p.S650F|NLGN4X_ENST00000381093.2_Missense_Mutation_p.S670F|NLGN4X_ENST00000381092.1_Missense_Mutation_p.S650F	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	650					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						AGGGTCCTTAGAGTGTTTGGG	0.522																																						dbGAP											0													195.0	181.0	186.0					X																	5811360		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1949C>T	X.37:g.5811360G>A	ENSP00000370485:p.Ser650Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UX10|Q9ULG0	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.S670F	ENST00000381095.3	37	c.2009	CCDS14126.1	X	.	.	.	.	.	.	.	.	.	.	G	7.055	0.565234	0.13498	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.67698	-0.28;-0.27;-0.28;-0.28;-0.28	4.0	4.0	0.46444	.	1.763190	0.03444	N	0.209684	T	0.69378	0.3104	L	0.39898	1.24	0.32660	N	0.518212	B;B;B	0.28419	0.167;0.004;0.211	B;B;B	0.37304	0.125;0.01;0.246	T	0.60772	-0.7197	10	0.62326	D	0.03	.	14.5538	0.68086	0.0:0.0:1.0:0.0	.	707;650;670	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	F	650;670;650;650;650	ENSP00000370485:S650F;ENSP00000370483:S670F;ENSP00000275857:S650F;ENSP00000370482:S650F;ENSP00000439203:S650F	ENSP00000275857:S650F	S	-	2	0	NLGN4X	5821360	0.005000	0.15991	0.994000	0.49952	0.764000	0.43329	1.234000	0.32660	1.594000	0.50039	0.513000	0.50165	TCT	NLGN4X	-	NULL	ENSG00000146938		0.522	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	NLGN4X	HGNC	protein_coding	OTTHUMT00000055673.1	189	0.00	0	G	NM_020742		5811360	5811360	-1	no_errors	ENST00000381093	ensembl	human	known	69_37n	missense	95	29.63	40	SNP	0.997	A
OR2V1	26693	genome.wustl.edu	37	5	180551416	180551416	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr5:180551416delC	ENST00000329365.2	-	1	888	c.889delG	c.(889-891)gagfs	p.E297fs		NM_001258283.1	NP_001245212.1	Q8NHB1	OR2V1_HUMAN	olfactory receptor, family 2, subfamily V, member 1	297						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(4)	4						CCCATCACCTCCCCATTCCTC	0.597																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB065465	CCDS58992.1	5q35.3	2012-08-09		2004-03-10	ENSG00000185372	ENSG00000185372		"""GPCR / Class A : Olfactory receptors"""	8280	protein-coding gene	gene with protein product				OR2V1P			Standard	NM_001258283		Approved	OST265	uc031smg.1	Q8NHB1	OTTHUMG00000162118	ENST00000329365.2:c.889delG	5.37:g.180551416delC	ENSP00000404102:p.Glu297fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.E297fs	ENST00000329365.2	37	c.889	CCDS58992.1	5																																																																																			OR2V1	-	prints_7TM_GPCR_Rhodpsn	ENSG00000185372		0.597	OR2V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2V1	HGNC	protein_coding	OTTHUMT00000367367.1	30	0.00	0	C			180551416	180551416	-1	no_errors	ENST00000329365	ensembl	human	known	69_37n	frame_shift_del	21	25.00	7	DEL	0.989	-
P4HA3	283208	genome.wustl.edu	37	11	73978162	73978162	+	3'UTR	SNP	C	C	T	rs533764229		TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr11:73978162C>T	ENST00000331597.4	-	0	1811				P4HA3_ENST00000427714.2_Missense_Mutation_p.A587T	NM_182904.3	NP_878907.1	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha polypeptide III							endoplasmic reticulum (GO:0005783)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			NS(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(1)	15	Breast(11;2.31e-05)					CTCTGATTTGCGAGGCACAGA	0.532																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AY327887	CCDS8230.1, CCDS73347.1	11q13	2008-12-09	2008-12-09			ENSG00000149380			30135	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(III)"""	608987	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III"""			14500733	Standard	XM_005273924		Approved	C-P4Halpha(III)	uc001ouz.3	Q7Z4N8		ENST00000331597.4:c.*131G>A	11.37:g.73978162C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV13|B4DUD3|Q5EBL3|Q5JPA9	Missense_Mutation	SNP	pfam_Pro_4_hyd_alph_N,smart_Pro_4_hyd_alph	p.A587T	ENST00000331597.4	37	c.1759	CCDS8230.1	11	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131363	0.56828	.	.	ENSG00000149380	ENST00000427714	T	0.57752	0.38	4.55	0.243	0.15503	.	.	.	.	.	T	0.35128	0.0921	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.33369	-0.9871	8	0.87932	D	0	.	1.7324	0.02934	0.1647:0.488:0.1601:0.1872	.	587	B4DUD3	.	T	587	ENSP00000401749:A587T	ENSP00000401749:A587T	A	-	1	0	P4HA3	73655810	0.000000	0.05858	0.000000	0.03702	0.132000	0.20833	-0.370000	0.07523	-0.027000	0.13873	0.650000	0.86243	GCA	P4HA3	-	NULL	ENSG00000149380		0.532	P4HA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P4HA3	HGNC	protein_coding	OTTHUMT00000382988.1	17	0.00	0	C	NM_182904		73978162	73978162	-1	no_errors	ENST00000427714	ensembl	human	putative	69_37n	missense	19	55.81	24	SNP	0.000	T
PCDHB3	56132	genome.wustl.edu	37	5	140482555	140482555	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr5:140482555C>A	ENST00000231130.2	+	1	2322	c.2322C>A	c.(2320-2322)ttC>ttA	p.F774L	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	774					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCCCAACTTCGTTGCTCAGG	0.507																																						dbGAP											0													78.0	81.0	80.0					5																	140482555		2202	4297	6499	-	-	-	SO:0001583	missense	0			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.2322C>A	5.37:g.140482555C>A	ENSP00000231130:p.Phe774Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8P2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F774L	ENST00000231130.2	37	c.2322	CCDS4245.1	5	.	.	.	.	.	.	.	.	.	.	C	1.860	-0.462986	0.04476	.	.	ENSG00000113205	ENST00000231130	T	0.10860	2.83	3.12	-3.4	0.04853	.	.	.	.	.	T	0.03136	0.0092	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.43360	-0.9396	9	0.02654	T	1	.	5.7557	0.18172	0.0:0.4714:0.1575:0.3711	.	774	Q9Y5E6	PCDB3_HUMAN	L	774	ENSP00000231130:F774L	ENSP00000231130:F774L	F	+	3	2	PCDHB3	140462739	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-2.495000	0.00971	-0.704000	0.05042	-0.339000	0.08088	TTC	PCDHB3	-	NULL	ENSG00000113205		0.507	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	HGNC	protein_coding	OTTHUMT00000251817.2	144	0.00	0	C	NM_018937		140482555	140482555	+1	no_errors	ENST00000231130	ensembl	human	known	69_37n	missense	89	32.58	43	SNP	0.000	A
PCLO	27445	genome.wustl.edu	37	7	82544011	82544011	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr7:82544011C>G	ENST00000333891.9	-	7	13628	c.13291G>C	c.(13291-13293)Gac>Cac	p.D4431H	PCLO_ENST00000423517.2_Missense_Mutation_p.D4431H|PCLO_ENST00000437081.1_Missense_Mutation_p.D1151H	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCTTCACTGTCTGACATGGCA	0.428																																						dbGAP											0													64.0	60.0	62.0					7																	82544011		1966	4163	6129	-	-	-	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.13291G>C	7.37:g.82544011C>G	ENSP00000334319:p.Asp4431His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.D4431H	ENST00000333891.9	37	c.13291	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	18.02	3.531227	0.64972	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.34072	1.38;1.39	5.75	5.75	0.90469	.	.	.	.	.	T	0.63792	0.2541	M	0.74647	2.275	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	T	0.65446	-0.6166	9	0.87932	D	0	.	19.9522	0.97203	0.0:1.0:0.0:0.0	.	4362;4431;4431	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	H	4431;4431;1151	ENSP00000334319:D4431H;ENSP00000388393:D4431H	ENSP00000334319:D4431H	D	-	1	0	PCLO	82381947	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.725000	0.93324	0.655000	0.94253	GAC	PCLO	-	NULL	ENSG00000186472		0.428	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	71	0.00	0	C	NM_014510		82544011	82544011	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	missense	51	34.62	27	SNP	1.000	G
PDZD2	23037	genome.wustl.edu	37	5	31799670	31799670	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr5:31799670G>C	ENST00000438447.1	+	2	703	c.315G>C	c.(313-315)aaG>aaC	p.K105N	PDZD2_ENST00000282493.3_Missense_Mutation_p.K105N			O15018	PDZD2_HUMAN	PDZ domain containing 2	105	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.K105N(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GGGGCAAGAAGAGGAAAACCC	0.587																																						dbGAP											1	Substitution - Missense(1)	lung(1)											70.0	78.0	75.0					5																	31799670		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.315G>C	5.37:g.31799670G>C	ENSP00000402033:p.Lys105Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.K105N	ENST00000438447.1	37	c.315	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925723	0.73213	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.68903	-0.36;-0.36	5.52	5.52	0.82312	PDZ/DHR/GLGF (3);	0.000000	0.48286	D	0.000188	T	0.67998	0.2953	N	0.19112	0.55	0.40876	D	0.983958	D	0.89917	1.0	D	0.74023	0.982	T	0.71451	-0.4589	10	0.62326	D	0.03	.	10.371	0.44053	0.0889:0.0:0.9111:0.0	.	105	O15018	PDZD2_HUMAN	N	105	ENSP00000402033:K105N;ENSP00000282493:K105N	ENSP00000282493:K105N	K	+	3	2	PDZD2	31835427	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.213000	0.58520	2.585000	0.87301	0.655000	0.94253	AAG	PDZD2	-	superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000133401		0.587	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	87	0.00	0	G			31799670	31799670	+1	no_errors	ENST00000282493	ensembl	human	known	69_37n	missense	55	29.49	23	SNP	1.000	C
PIK3CB	5291	genome.wustl.edu	37	3	138374293	138374293	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr3:138374293C>T	ENST00000477593.1	-	23	3224	c.3151G>A	c.(3151-3153)Gaa>Aaa	p.E1051K	PIK3CB_ENST00000289153.2_Missense_Mutation_p.E1051K|PIK3CB_ENST00000544716.1_Missense_Mutation_p.E502K			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	1051	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)	p.E1051K(2)		NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	GTCCAGCTTTCCCTGAGCGCC	0.423																																						dbGAP											2	Substitution - Missense(2)	urinary_tract(1)|lung(1)											127.0	118.0	121.0					3																	138374293		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.3151G>A	3.37:g.138374293C>T	ENSP00000418143:p.Glu1051Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNF0|Q24JU2	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_adapt-bd_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_ARM-type_fold,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E1051K	ENST00000477593.1	37	c.3151	CCDS3104.1	3	.	.	.	.	.	.	.	.	.	.	C	17.20	3.327746	0.60743	.	.	ENSG00000051382	ENST00000477593;ENST00000544716;ENST00000289153	T;T;T	0.80566	-1.39;-1.39;-1.39	5.4	5.4	0.78164	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (2);	0.000000	0.85682	D	0.000000	T	0.70316	0.3210	N	0.12637	0.245	0.80722	D	1	P;P;B	0.51449	0.945;0.613;0.394	P;B;B	0.44732	0.459;0.358;0.106	T	0.69000	-0.5261	10	0.21014	T	0.42	-29.6367	19.3757	0.94508	0.0:1.0:0.0:0.0	.	1051;638;502	P42338;B4DZI3;Q68DL0	PK3CB_HUMAN;.;.	K	1051;502;1051	ENSP00000418143:E1051K;ENSP00000438259:E502K;ENSP00000289153:E1051K	ENSP00000289153:E1051K	E	-	1	0	PIK3CB	139856983	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.651000	0.83577	2.814000	0.96858	0.655000	0.94253	GAA	PIK3CB	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom	ENSG00000051382		0.423	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CB	HGNC	protein_coding	OTTHUMT00000358019.1	61	0.00	0	C			138374293	138374293	-1	no_errors	ENST00000289153	ensembl	human	known	69_37n	missense	67	30.21	29	SNP	1.000	T
POLI	11201	genome.wustl.edu	37	18	51795958	51795960	+	In_Frame_Del	DEL	CGA	CGA	-	rs78943519|rs10584411|rs3729509	byFrequency	TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	CGA	CGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr18:51795958_51795960delCGA	ENST00000579534.1	+	1	185_187	c.42_44delCGA	c.(40-45)ggcgac>ggc	p.D17del	POLI_ENST00000217800.5_5'Flank|POLI_ENST00000406285.3_In_Frame_Del_p.D17del|POLI_ENST00000579434.1_5'UTR	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	17					DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.D17delD(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		AAGGCGGCGGCGACGACGACGAG	0.729								DNA polymerases (catalytic subunits)						3926	0.783946	0.9705	0.6427	5008	,	,		12312	0.7054		0.7078	False		,,,				2504	0.7914					dbGAP											1	Deletion - In frame(1)	large_intestine(1)								3523,343		1644,235,54						1.5	0.0		dbSNP_119	14	5235,2405		1985,1265,570	no	coding	POLI	NM_007195.2		3629,1500,624	A1A1,A1R,RR		31.4791,8.8722,23.8832				8758,2748				-	-	-	SO:0001651	inframe_deletion	0				CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.42_44delCGA	18.37:g.51795967_51795969delCGA	ENSP00000462664:p.Asp17del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N590|Q9H0S1|Q9NYH6	In_Frame_Del	DEL	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,superfamily_DNA_pol_Y-fam_little_finger,pfscan_DNA_repair_prot_UmuC-like_N	p.D17in_frame_del	ENST00000579534.1	37	c.42_44	CCDS11954.2	18																																																																																			POLI	-	NULL	ENSG00000101751		0.729	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLI	HGNC	protein_coding	OTTHUMT00000256002.3	9	0.00	0	CGA	NM_007195		51795958	51795960	+1	no_errors	ENST00000579534	ensembl	human	known	69_37n	in_frame_del	4	33.33	2	DEL	0.000:0.000:0.000	-
POTEM	641455	genome.wustl.edu	37	14	20020113	20020113	+	Silent	SNP	C	C	T	rs199622050		TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr14:20020113C>T	ENST00000551509.1	-	1	159	c.108G>A	c.(106-108)agG>agA	p.R36R		NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	36										endometrium(4)|kidney(1)|lung(4)	9						TGCCGCTCCCCCTGCACCAGG	0.587																																						dbGAP											0													5.0	6.0	6.0					14																	20020113		197	578	775	-	-	-	SO:0001819	synonymous_variant	0				CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.108G>A	14.37:g.20020113C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R36	ENST00000551509.1	37	c.108	CCDS45076.1	14																																																																																			POTEM	-	NULL	ENSG00000187537		0.587	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	HGNC	protein_coding	OTTHUMT00000409490.3	12	0.00	0	C	NM_001145442		20020113	20020113	-1	no_errors	ENST00000547848	ensembl	human	known	69_37n	silent	11	35.29	6	SNP	0.101	T
PPAPDC1B	84513	genome.wustl.edu	37	8	38124737	38124737	+	Intron	SNP	C	C	G			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr8:38124737C>G	ENST00000424479.2	-	5	484				PPAPDC1B_ENST00000419686.2_Missense_Mutation_p.E171Q|PPAPDC1B_ENST00000422581.2_Intron|PPAPDC1B_ENST00000531823.1_Intron|PPAPDC1B_ENST00000529359.1_Intron|PPAPDC1B_ENST00000530588.1_5'Flank	NM_001102559.1	NP_001096029.1	Q8NEB5	PPC1B_HUMAN	phosphatidic acid phosphatase type 2 domain containing 1B						phospholipid dephosphorylation (GO:0046839)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			kidney(1)|lung(1)	2	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)	BRCA - Breast invasive adenocarcinoma(5;3.04e-26)|COAD - Colon adenocarcinoma(9;0.188)			AGGTTAAATTCAATGATGTGA	0.403																																						dbGAP											0													75.0	71.0	72.0					8																	38124737		1846	4101	5947	-	-	-	SO:0001627	intron_variant	0			AF212238	CCDS47841.1, CCDS47842.1, CCDS47843.1	8p12	2005-08-09			ENSG00000147535	ENSG00000147535			25026	protein-coding gene	gene with protein product		610626					Standard	NM_032483		Approved	HTPAP	uc003xlf.4	Q8NEB5	OTTHUMG00000165104	ENST00000424479.2:c.463+47G>C	8.37:g.38124737C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JKF5|Q3KQX6|Q9BY45	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase	p.E171Q	ENST00000424479.2	37	c.511	CCDS47841.1	8	.	.	.	.	.	.	.	.	.	.	C	7.534	0.659325	0.14645	.	.	ENSG00000147535	ENST00000419686	.	.	.	3.06	2.16	0.27623	.	.	.	.	.	T	0.16342	0.0393	N	0.08118	0	0.09310	N	1	B	0.26445	0.149	B	0.23150	0.044	T	0.22243	-1.0222	8	0.25106	T	0.35	.	5.9138	0.19043	0.0:0.8476:0.0:0.1524	.	171	C9JKF5	.	Q	171	.	ENSP00000414522:E171Q	E	-	1	0	PPAPDC1B	38243894	0.069000	0.21087	0.025000	0.17156	0.011000	0.07611	1.024000	0.30077	0.618000	0.30179	0.557000	0.71058	GAA	PPAPDC1B	-	NULL	ENSG00000147535		0.403	PPAPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAPDC1B	HGNC	protein_coding	OTTHUMT00000381832.2	72	0.00	0	C	NM_032483		38124737	38124737	-1	no_errors	ENST00000419686	ensembl	human	known	69_37n	missense	203	35.74	114	SNP	0.043	G
PVRL4	81607	genome.wustl.edu	37	1	161043062	161043062	+	Missense_Mutation	SNP	C	C	G	rs558365881		TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr1:161043062C>G	ENST00000368012.3	-	8	1563	c.1261G>C	c.(1261-1263)Gag>Cag	p.E421Q	PVRL4_ENST00000453926.2_Intron|PVRL4_ENST00000486694.1_Intron	NM_030916.2	NP_112178.2	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4	421					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|urinary_tract(1)	20	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GGGTGGCCCTCGGCTCTCAGC	0.657																																					NSCLC(76;1160 1387 14476 16172 29359)	dbGAP											0													73.0	69.0	70.0					1																	161043062		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF426163	CCDS1216.1	1q22-q23.2	2013-01-14			ENSG00000143217	ENSG00000143217		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19688	protein-coding gene	gene with protein product		609607				11544254	Standard	NM_030916		Approved	nectin-4, PRR4, LNIR	uc001fxo.2	Q96NY8	OTTHUMG00000031475	ENST00000368012.3:c.1261G>C	1.37:g.161043062C>G	ENSP00000356991:p.Glu421Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQW3|Q96K15	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E421Q	ENST00000368012.3	37	c.1261	CCDS1216.1	1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.055676	0.75960	.	.	ENSG00000143217	ENST00000368012	T	0.41400	1.0	4.58	4.58	0.56647	.	0.000000	0.46758	D	0.000278	T	0.22666	0.0547	N	0.14661	0.345	0.80722	D	1	D	0.59357	0.985	P	0.51657	0.676	T	0.03068	-1.1076	10	0.29301	T	0.29	.	12.8862	0.58045	0.0:1.0:0.0:0.0	.	421	Q96NY8	PVRL4_HUMAN	Q	421	ENSP00000356991:E421Q	ENSP00000356991:E421Q	E	-	1	0	PVRL4	159309686	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.386000	0.59620	2.081000	0.62600	0.655000	0.94253	GAG	PVRL4	-	NULL	ENSG00000143217		0.657	PVRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL4	HGNC	protein_coding	OTTHUMT00000077074.1	31	0.00	0	C	NM_030916		161043062	161043062	-1	no_errors	ENST00000368012	ensembl	human	known	69_37n	missense	41	25.45	14	SNP	1.000	G
PRG4	10216	genome.wustl.edu	37	1	186280194	186280194	+	Silent	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr1:186280194C>T	ENST00000445192.2	+	9	3573	c.3528C>T	c.(3526-3528)ttC>ttT	p.F1176F	RNU6-1240P_ENST00000365155.1_RNA|PRG4_ENST00000367483.4_Silent_p.F1135F|PRG4_ENST00000367486.3_Silent_p.F1133F|PRG4_ENST00000367484.3_Silent_p.F705F|PRG4_ENST00000367485.4_Silent_p.F1083F	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	1176					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						TAAGTCCATTCAGTCCACCAT	0.383																																						dbGAP											0													134.0	129.0	131.0					1																	186280194		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.3528C>T	1.37:g.186280194C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	pfam_Somatomedin_B_dom,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Somatomedin_B_dom,smart_Hemopexin/matrixin_repeat,prints_Somatomedin_B_chordata,pfscan_Somatomedin_B_dom	p.F1176	ENST00000445192.2	37	c.3528	CCDS1369.1	1																																																																																			PRG4	-	superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat	ENSG00000116690		0.383	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRG4	HGNC	protein_coding	OTTHUMT00000086346.1	163	0.00	0	C	NM_005807		186280194	186280194	+1	no_errors	ENST00000445192	ensembl	human	known	69_37n	silent	150	28.91	61	SNP	0.005	T
RALGAPA1	253959	genome.wustl.edu	37	14	36192403	36192403	+	Nonsense_Mutation	SNP	A	A	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr14:36192403A>T	ENST00000389698.3	-	15	2324	c.1934T>A	c.(1933-1935)tTa>tAa	p.L645*	RALGAPA1_ENST00000382366.3_Nonsense_Mutation_p.L645*|RALGAPA1_ENST00000554704.1_5'UTR|RALGAPA1_ENST00000258840.6_Nonsense_Mutation_p.L645*|RALGAPA1_ENST00000307138.6_Nonsense_Mutation_p.L645*	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	645					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TACTGACAGTAAGTCATCCCA	0.373																																						dbGAP											0													64.0	59.0	61.0					14																	36192403		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.1934T>A	14.37:g.36192403A>T	ENSP00000374348:p.Leu645*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Nonsense_Mutation	SNP	pfam_Rap_GAP,superfamily_ARM-type_fold,pfscan_Rap_GAP	p.L645*	ENST00000389698.3	37	c.1934	CCDS32065.1	14	.	.	.	.	.	.	.	.	.	.	A	44	11.139574	0.99522	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	.	.	.	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-9.3366	15.5018	0.75705	1.0:0.0:0.0:0.0	.	.	.	.	X	645	.	ENSP00000258840:L645X	L	-	2	0	RALGAPA1	35262154	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	9.339000	0.96797	2.077000	0.62373	0.482000	0.46254	TTA	RALGAPA1	-	NULL	ENSG00000174373		0.373	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	RALGAPA1	HGNC	protein_coding	OTTHUMT00000409829.1	65	0.00	0	A	XM_210022		36192403	36192403	-1	no_errors	ENST00000258840	ensembl	human	known	69_37n	nonsense	61	35.11	33	SNP	1.000	T
RASAL2	9462	genome.wustl.edu	37	1	178408562	178408562	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr1:178408562G>A	ENST00000462775.1	+	4	361	c.236G>A	c.(235-237)cGt>cAt	p.R79H	RASAL2_ENST00000367649.3_Missense_Mutation_p.R227H|RASAL2_ENST00000448150.3_Missense_Mutation_p.R209H	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	79	PH.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						TTTAGGTCTCGTGGGCTGCCT	0.428																																						dbGAP											0													108.0	94.0	99.0					1																	178408562		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.236G>A	1.37:g.178408562G>A	ENSP00000420558:p.Arg79His	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PP1_inhibitor,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.R227H	ENST00000462775.1	37	c.680	CCDS1322.1	1	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878332	0.72294	.	.	ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775	T;T;T	0.21543	2.0;2.0;2.04	6.16	6.16	0.99307	Pleckstrin homology domain (1);	0.335009	0.33732	N	0.004611	T	0.17534	0.0421	L	0.35593	1.075	0.80722	D	1	B;P	0.36125	0.02;0.538	B;B	0.27715	0.005;0.082	T	0.03453	-1.1035	10	0.22109	T	0.4	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	79;227	Q9UJF2;F8W755	NGAP_HUMAN;.	H	209;227;79	ENSP00000407768:R209H;ENSP00000356621:R227H;ENSP00000420558:R79H	ENSP00000356621:R227H	R	+	2	0	RASAL2	176675185	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.115000	0.57865	2.937000	0.99478	0.650000	0.86243	CGT	RASAL2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000075391		0.428	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RASAL2	HGNC	protein_coding	OTTHUMT00000084758.3	77	0.00	0	G	NM_170692		178408562	178408562	+1	no_errors	ENST00000367649	ensembl	human	known	69_37n	missense	46	45.24	38	SNP	1.000	A
RBM12B	389677	genome.wustl.edu	37	8	94747082	94747082	+	Silent	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr8:94747082G>A	ENST00000399300.2	-	3	1770	c.1557C>T	c.(1555-1557)taC>taT	p.Y519Y	RBM12B_ENST00000520961.1_Intron|RBM12B_ENST00000517700.1_Silent_p.Y519Y|RP11-10N23.4_ENST00000517998.1_RNA	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	519							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			CACCAACTGAGTATATTGGTG	0.458																																						dbGAP											0													109.0	104.0	105.0					8																	94747082		1854	4099	5953	-	-	-	SO:0001819	synonymous_variant	0				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.1557C>T	8.37:g.94747082G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYB5	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Y519	ENST00000399300.2	37	c.1557	CCDS43755.1	8																																																																																			RBM12B	-	NULL	ENSG00000183808		0.458	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM12B	HGNC	protein_coding	OTTHUMT00000383603.1	53	0.00	0	G	NM_203390		94747082	94747082	-1	no_errors	ENST00000399300	ensembl	human	known	69_37n	silent	50	48.45	47	SNP	0.000	A
RBM6	10180	genome.wustl.edu	37	3	50091779	50091779	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr3:50091779C>G	ENST00000266022.4	+	8	1903	c.1644C>G	c.(1642-1644)aaC>aaG	p.N548K	RBM6_ENST00000539992.1_5'UTR|RBM6_ENST00000422955.1_Missense_Mutation_p.N26K|RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000442092.1_Missense_Mutation_p.N26K|RBM6_ENST00000443081.1_Missense_Mutation_p.N416K	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	548					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		GTAAGGCAAACATTGGTGGGC	0.383																																						dbGAP											0													198.0	204.0	202.0					3																	50091779		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.1644C>G	3.37:g.50091779C>G	ENSP00000266022:p.Asn548Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O60549|O75524|Q86SS3	Missense_Mutation	SNP	pfam_G_patch_dom,smart_RRM_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_RRM_dom	p.N548K	ENST00000266022.4	37	c.1644	CCDS2809.1	3	.	.	.	.	.	.	.	.	.	.	C	10.53	1.375981	0.24857	.	.	ENSG00000004534	ENST00000442092;ENST00000266022;ENST00000443081;ENST00000422955;ENST00000446471	T;T;T;T;D	0.82081	1.02;1.63;1.64;1.02;-1.57	5.42	3.6	0.41247	.	0.716368	0.14751	N	0.300573	T	0.66925	0.2839	N	0.14661	0.345	0.58432	D	0.999998	B;B	0.12630	0.006;0.003	B;B	0.14023	0.01;0.006	T	0.59778	-0.7390	9	.	.	.	0.0026	9.1967	0.37233	0.0:0.8126:0.0:0.1874	.	416;548	E9PGM9;P78332	.;RBM6_HUMAN	K	26;548;416;26;26	ENSP00000393530:N26K;ENSP00000266022:N548K;ENSP00000396466:N416K;ENSP00000392939:N26K;ENSP00000394336:N26K	.	N	+	3	2	RBM6	50066783	0.230000	0.23740	0.883000	0.34634	0.550000	0.35303	0.251000	0.18257	2.542000	0.85734	0.650000	0.86243	AAC	RBM6	-	NULL	ENSG00000004534		0.383	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM6	HGNC	protein_coding	OTTHUMT00000345528.4	107	0.00	0	C	NM_005777		50091779	50091779	+1	no_errors	ENST00000266022	ensembl	human	known	69_37n	missense	30	61.54	48	SNP	0.672	G
RMND5A	64795	genome.wustl.edu	37	2	86993049	86993049	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr2:86993049C>A	ENST00000283632.4	+	6	1251	c.756C>A	c.(754-756)caC>caA	p.H252Q	RMND5A_ENST00000472843.1_3'UTR	NM_022780.3	NP_073617.1	Q9H871	RMD5A_HUMAN	required for meiotic nuclear division 5 homolog A (S. cerevisiae)	252										kidney(1)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	17						CATATGTTCACCTACTTGATG	0.478																																						dbGAP											0													166.0	137.0	147.0					2																	86993049		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012165	CCDS1991.1	2p11.2	2012-07-20			ENSG00000153561	ENSG00000153561			25850	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog A"""					12477932	Standard	NM_022780		Approved	FLJ13910, RMD5, GID2, GID2A	uc002srs.4	Q9H871	OTTHUMG00000130262	ENST00000283632.4:c.756C>A	2.37:g.86993049C>A	ENSP00000283632:p.His252Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5M6|Q6NTF0|Q9H6W5|Q9H9H2	Missense_Mutation	SNP	smart_LisH_dimerisation,smart_CTLH_C,smart_CRA_dom,pfscan_LisH_dimerisation,pfscan_CTLH_C	p.H252Q	ENST00000283632.4	37	c.756	CCDS1991.1	2	.	.	.	.	.	.	.	.	.	.	C	18.59	3.657880	0.67586	.	.	ENSG00000153561	ENST00000283632	.	.	.	5.54	5.54	0.83059	Ran binding protein-like, CRA domain (1);	0.075176	0.53938	D	0.000048	T	0.49081	0.1536	L	0.39467	1.215	0.50313	D	0.999864	B	0.32467	0.372	B	0.39771	0.309	T	0.44421	-0.9329	9	0.25106	T	0.35	-7.4121	7.2554	0.26173	0.0:0.7977:0.0:0.2023	.	252	Q9H871	RMD5A_HUMAN	Q	252	.	ENSP00000283632:H252Q	H	+	3	2	RMND5A	86846560	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	0.979000	0.29500	2.626000	0.88956	0.585000	0.79938	CAC	RMND5A	-	smart_CRA_dom	ENSG00000153561		0.478	RMND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RMND5A	HGNC	protein_coding	OTTHUMT00000252591.2	136	0.00	0	C	NM_022780		86993049	86993049	+1	no_errors	ENST00000283632	ensembl	human	known	69_37n	missense	65	35.00	35	SNP	1.000	A
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037843	10037843	+	RNA	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chrY:10037843C>T	ENST00000515896.1	+	0	80									RNA, 5.8S ribosomal pseudogene 6																		AATTGCAGGACACATTGATCA	0.512																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037843C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.512	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		20	0.00	0	C			10037843	10037843	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	11	26.67	4	SNP	1.000	T
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037883	10037883	+	RNA	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chrY:10037883G>A	ENST00000515896.1	+	0	120									RNA, 5.8S ribosomal pseudogene 6																		TGCGGCCCGGGTTCCTCCCAG	0.577																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037883G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.577	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		17	0.00	0	G			10037883	10037883	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	9	30.77	4	SNP	1.000	A
SACS	26278	genome.wustl.edu	37	13	23915127	23915127	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr13:23915127G>C	ENST00000382292.3	-	9	3161	c.2888C>G	c.(2887-2889)tCt>tGt	p.S963C	SACS_ENST00000382298.3_Missense_Mutation_p.S963C|SACS_ENST00000402364.1_Missense_Mutation_p.S213C			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	963					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TACTGAAATAGAAAGTCGCAG	0.363																																						dbGAP											0													68.0	68.0	68.0					13																	23915127		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.2888C>G	13.37:g.23915127G>C	ENSP00000371729:p.Ser963Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin,superfamily_ATPase-like_ATP-bd,superfamily_DnaJ_N,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_N,pfscan_Ubiquitin_supergroup	p.S963C	ENST00000382292.3	37	c.2888	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	G	24.8	4.575053	0.86542	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.88664	-2.27;-2.41;-2.27	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	D	0.91754	0.7392	L	0.34521	1.04	0.58432	D	0.999999	D	0.63880	0.993	D	0.66351	0.943	D	0.91784	0.5438	10	0.66056	D	0.02	.	20.6013	0.99457	0.0:0.0:1.0:0.0	.	963	Q9NZJ4	SACS_HUMAN	C	963;213;963	ENSP00000371729:S963C;ENSP00000385844:S213C;ENSP00000371735:S963C	ENSP00000371729:S963C	S	-	2	0	SACS	22813127	1.000000	0.71417	0.913000	0.36048	0.990000	0.78478	9.476000	0.97823	2.878000	0.98634	0.650000	0.86243	TCT	SACS	-	NULL	ENSG00000151835		0.363	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	53	0.00	0	G	NM_014363		23915127	23915127	-1	no_errors	ENST00000382292	ensembl	human	known	69_37n	missense	12	66.67	24	SNP	1.000	C
SLC4A3	6508	genome.wustl.edu	37	2	220501075	220501075	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr2:220501075C>A	ENST00000358055.3	+	15	2755	c.2243C>A	c.(2242-2244)gCt>gAt	p.A748D	SLC4A3_ENST00000373760.2_Missense_Mutation_p.A748D|SLC4A3_ENST00000317151.3_Missense_Mutation_p.A748D|SLC4A3_ENST00000373762.3_Missense_Mutation_p.A775D|SLC4A3_ENST00000273063.6_Missense_Mutation_p.A775D			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	748	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTGTCCACCGCTGTGCTCGGC	0.612																																						dbGAP											0													127.0	106.0	113.0					2																	220501075		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.2243C>A	2.37:g.220501075C>A	ENSP00000350756:p.Ala748Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange_3,prints_Anion_exchange,tigrfam_HCO3_transpt_euk	p.A775D	ENST00000358055.3	37	c.2324	CCDS2445.1	2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102577	0.76983	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000356251;ENST00000317151	D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51	4.39	4.39	0.52855	Bicarbonate transporter, C-terminal (1);	0.178593	0.49305	D	0.000145	D	0.91606	0.7348	M	0.92077	3.27	0.53688	D	0.999979	P;D;P	0.55605	0.848;0.972;0.909	P;D;P	0.65874	0.692;0.939;0.847	D	0.93816	0.7114	10	0.87932	D	0	.	17.5069	0.87748	0.0:1.0:0.0:0.0	.	452;748;775	P48751-2;P48751;P48751-3	.;B3A3_HUMAN;.	D	748;748;775;775;11;748	ENSP00000350756:A748D;ENSP00000362865:A748D;ENSP00000273063:A775D;ENSP00000362867:A775D;ENSP00000314006:A748D	ENSP00000273063:A775D	A	+	2	0	SLC4A3	220209319	0.783000	0.28701	0.995000	0.50966	0.941000	0.58515	5.673000	0.68109	2.415000	0.81967	0.542000	0.68232	GCT	SLC4A3	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000114923		0.612	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC4A3	HGNC	protein_coding	OTTHUMT00000316472.1	51	0.00	0	C	NM_005070		220501075	220501075	+1	no_errors	ENST00000273063	ensembl	human	known	69_37n	missense	33	32.65	16	SNP	0.983	A
SMC4	10051	genome.wustl.edu	37	3	160141276	160141276	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr3:160141276G>C	ENST00000357388.3	+	14	2534	c.2083G>C	c.(2083-2085)Gat>Cat	p.D695H	SMC4_ENST00000462787.1_Missense_Mutation_p.D695H|SMC4_ENST00000344722.5_Missense_Mutation_p.D695H|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000360111.2_Missense_Mutation_p.D695H|SMC4_ENST00000469762.1_Missense_Mutation_p.D670H	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	695	Flexible hinge.				kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TCGTTTATTTGATTTAGTAAA	0.343																																						dbGAP											0													70.0	81.0	77.0					3																	160141276		2187	4291	6478	-	-	-	SO:0001583	missense	0			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.2083G>C	3.37:g.160141276G>C	ENSP00000349961:p.Asp695His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_Chemotax_Me-accpt_rcpt_lig-bd,superfamily_Prefoldin,smart_SMC_hinge	p.D695H	ENST00000357388.3	37	c.2083	CCDS3189.1	3	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744518	0.89663	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000469762;ENST00000462787;ENST00000344722;ENST00000545277	D;D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5;-2.5	5.96	5.09	0.68999	SMCs flexible hinge (3);RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.96911	0.8991	H	0.98276	4.19	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;P;D	0.97110	1.0;0.999;0.855;0.998	D	0.98676	1.0690	10	0.87932	D	0	-32.6549	16.6876	0.85312	0.0:0.0:0.8694:0.1306	.	695;670;670;695	Q9NTJ3-2;B3KXX5;E9PD53;Q9NTJ3	.;.;.;SMC4_HUMAN	H	695;695;670;695;695;289	ENSP00000349961:D695H;ENSP00000353225:D695H;ENSP00000417964:D670H;ENSP00000420734:D695H;ENSP00000341382:D695H	ENSP00000341382:D695H	D	+	1	0	SMC4	161623970	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.624000	0.98398	1.520000	0.48965	0.650000	0.86243	GAT	SMC4	-	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge	ENSG00000113810		0.343	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC4	HGNC	protein_coding	OTTHUMT00000352862.1	68	0.00	0	G			160141276	160141276	+1	no_errors	ENST00000344722	ensembl	human	known	69_37n	missense	57	27.85	22	SNP	1.000	C
RPL30	6156	genome.wustl.edu	37	8	99053990	99053990	+	3'UTR	SNP	G	G	A	rs7004887	byFrequency	TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr8:99053990G>A	ENST00000521291.1	-	0	533				RPL30_ENST00000287038.3_3'UTR|RPL30_ENST00000396070.2_3'UTR|KB-1208A12.3_ENST00000501016.2_RNA|RPL30_ENST00000518164.1_Intron|SNORA72_ENST00000384339.1_RNA			P62888	RL30_HUMAN	ribosomal protein L30						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(2)|lung(4)|skin(1)	7	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			AATTTTGCAGGTTTAAGGTTT	0.294																																						dbGAP											0													53.0	56.0	55.0					8																	99053990		2202	4299	6501	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS34928.1	8q22	2013-05-09			ENSG00000156482	ENSG00000156482		"""L ribosomal proteins"""	10333	protein-coding gene	gene with protein product		180467				1577483	Standard	NM_000989		Approved	L30	uc003yif.3	P62888	OTTHUMG00000164796	ENST00000521291.1:c.*39C>T	8.37:g.99053990G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R591|P04645|Q502Z6	RNA	SNP	-	NULL	ENST00000521291.1	37	NULL	CCDS34928.1	8																																																																																			KB-1208A12.3	-	-	ENSG00000245970		0.294	RPL30-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNORA72	Clone_based_vega_gene	protein_coding	OTTHUMT00000380450.1	96	0.00	0	G			99053990	99053990	+1	no_errors	ENST00000501016	ensembl	human	known	69_37n	rna	139	22.78	41	SNP	0.119	A
SRGAP2	23380	genome.wustl.edu	37	1	206619542	206619542	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr1:206619542G>C	ENST00000414007.1	+	14	1576	c.1576G>C	c.(1576-1578)Gag>Cag	p.E526Q	SRGAP2_ENST00000419187.2_5'UTR|SRGAP2_ENST00000471256.1_3'UTR			O75044	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	666	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament severing (GO:0051014)|axon guidance (GO:0007411)|dendritic spine development (GO:0060996)|extension of a leading process involved in cell motility in cerebral cortex radial glia guided migration (GO:0021816)|filopodium assembly (GO:0046847)|lamellipodium assembly involved in ameboidal cell migration (GO:0003363)|negative regulation of neuron migration (GO:2001223)|neuron projection morphogenesis (GO:0048812)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine head (GO:0044327)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein homodimerization activity (GO:0042803)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			NS(1)|breast(1)|kidney(1)|lung(1)	4	Breast(84;0.137)					CCACGTGAATGAGCTGATCAA	0.567																																						dbGAP											0													132.0	137.0	135.0					1																	206619542		2180	4286	6466	-	-	-	SO:0001583	missense	0			AB007925	CCDS73017.1	1q32.1	2014-08-13	2004-11-12	2004-11-12	ENSG00000163486	ENSG00000266028		"""Rho GTPase activating proteins"""	19751	protein-coding gene	gene with protein product		606524	"""formin binding protein 2"""	FNBP2		15046868, 11672528	Standard	XM_005277510		Approved	KIAA0456, ARHGAP34, SRGAP2A	uc001hdy.3	O75044	OTTHUMG00000184381	ENST00000414007.1:c.1576G>C	1.37:g.206619542G>C	ENSP00000390898:p.Glu526Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_RhoGAP_dom,smart_SH3_domain,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.E526Q	ENST00000414007.1	37	c.1576		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.07|19.07	3.755079|3.755079	0.69648|0.69648	.|.	.|.	ENSG00000163486|ENSG00000163486	ENST00000414359;ENST00000414007;ENST00000439126|ENST00000295713	T;T|.	0.42513|.	0.97;0.97|.	5.7|5.7	5.7|5.7	0.88788|0.88788	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.79793|.	0.4507|.	.|.	.|.	.|.	0.46185|.	D|.	0.998914|.	P;P|.	0.44429|.	0.835;0.614|.	B;B|.	0.43386|.	0.195;0.418|.	T|.	0.77840|.	-0.2438|.	8|.	0.21540|.	T|.	0.41|.	.|.	19.8077|19.8077	0.96536|0.96536	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	513;666|.	B4DDU0;O75044|.	.;FNBP2_HUMAN|.	Q|S	579;526;280|579	ENSP00000390898:E526Q;ENSP00000403036:E280Q|.	ENSP00000390898:E526Q|.	E|X	+|+	1|2	0|2	SRGAP2|SRGAP2	204686165|204686165	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.951000|0.951000	0.60555|0.60555	9.864000|9.864000	0.99589|0.99589	2.674000|2.674000	0.91012|0.91012	0.655000|0.655000	0.94253|0.94253	GAG|TGA	SRGAP2	-	superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000163486		0.567	SRGAP2-201	KNOWN	basic	protein_coding	SRGAP2	HGNC	protein_coding		63	0.00	0	G	NM_015326		206619542	206619542	+1	no_start_codon	ENST00000414007	ensembl	human	known	69_37n	missense	68	19.77	17	SNP	1.000	C
TBX18	9096	genome.wustl.edu	37	6	85466511	85466511	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr6:85466511G>A	ENST00000369663.5	-	4	1013	c.676C>T	c.(676-678)Cca>Tca	p.P226S	TBX18_ENST00000606521.1_5'UTR|TBX18_ENST00000606784.1_Missense_Mutation_p.P68S	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	226					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		GGCGAGTCTGGATGAATGTAC	0.522																																						dbGAP											0													135.0	100.0	112.0					6																	85466511		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.676C>T	6.37:g.85466511G>A	ENSP00000358677:p.Pro226Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU13|Q7Z6U4|Q9UJI6	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.P226S	ENST00000369663.5	37	c.676	CCDS34495.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.461797	0.96240	.	.	ENSG00000112837	ENST00000416980;ENST00000369663	D	0.81908	-1.55	6.06	6.06	0.98353	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.096213	0.64402	D	0.000001	D	0.93628	0.7965	M	0.93150	3.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.94013	0.7286	10	0.87932	D	0	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	142;226	Q8IW86;O95935	.;TBX18_HUMAN	S	141;226	ENSP00000358677:P226S	ENSP00000358677:P226S	P	-	1	0	TBX18	85523230	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.869000	0.99810	2.882000	0.98803	0.655000	0.94253	CCA	TBX18	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	ENSG00000112837		0.522	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX18	HGNC	protein_coding	OTTHUMT00000041378.2	46	0.00	0	G	NM_001080508		85466511	85466511	-1	no_errors	ENST00000369663	ensembl	human	known	69_37n	missense	26	49.02	25	SNP	1.000	A
TC2N	123036	genome.wustl.edu	37	14	92268677	92268677	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr14:92268677G>C	ENST00000435962.2	-	4	713	c.390C>G	c.(388-390)ttC>ttG	p.F130L	TC2N_ENST00000556018.1_Missense_Mutation_p.F130L|TC2N_ENST00000340892.5_Missense_Mutation_p.F130L|TC2N_ENST00000360594.5_Missense_Mutation_p.F130L	NM_001128596.1	NP_001122068	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear	130					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(5)|skin(1)|upper_aerodigestive_tract(2)	18				COAD - Colon adenocarcinoma(157;0.218)		GATACATATAGAATGGGTTAT	0.438																																						dbGAP											0													141.0	113.0	122.0					14																	92268677		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA243837	CCDS9897.1, CCDS73679.1	14q32.12	2007-10-17	2007-08-17	2007-08-17		ENSG00000165929			19859	protein-coding gene	gene with protein product	"""C2 calcium-dependent domain containing 1"""		"""chromosome 14 open reading frame 47"", ""membrane targeting (tandem) C2 domain containing 1"""	C14orf47, MTAC2D1		11526914	Standard	NM_001128596		Approved	FLJ36557, Tac2-N, C2CD1	uc001xzt.4	Q8N9U0		ENST00000435962.2:c.390C>G	14.37:g.92268677G>C	ENSP00000387882:p.Phe130Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.F130L	ENST00000435962.2	37	c.390	CCDS9897.1	14	.	.	.	.	.	.	.	.	.	.	G	10.68	1.419680	0.25552	.	.	ENSG00000165929	ENST00000435962;ENST00000340892;ENST00000360594;ENST00000556018	T;T;T;T	0.13657	3.45;3.45;3.45;2.57	5.36	4.46	0.54185	.	0.492714	0.23770	N	0.044728	T	0.10208	0.0250	L	0.29908	0.895	0.33493	D	0.588949	B;B	0.14012	0.001;0.009	B;B	0.09377	0.003;0.004	T	0.09997	-1.0649	10	0.11485	T	0.65	-2.7772	14.4263	0.67218	0.0726:0.0:0.9273:0.0	.	130;130	Q8N9U0-2;Q8N9U0	.;TAC2N_HUMAN	L	130	ENSP00000387882:F130L;ENSP00000343199:F130L;ENSP00000353802:F130L;ENSP00000451317:F130L	ENSP00000343199:F130L	F	-	3	2	TC2N	91338430	1.000000	0.71417	0.925000	0.36789	0.823000	0.46562	5.102000	0.64572	2.494000	0.84150	0.650000	0.86243	TTC	TC2N	-	NULL	ENSG00000165929		0.438	TC2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TC2N	HGNC	protein_coding	OTTHUMT00000411778.1	68	0.00	0	G	NM_152332		92268677	92268677	-1	no_errors	ENST00000340892	ensembl	human	known	69_37n	missense	47	24.19	15	SNP	0.992	C
TET1	80312	genome.wustl.edu	37	10	70333071	70333071	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr10:70333071G>A	ENST00000373644.4	+	2	1185	c.976G>A	c.(976-978)Gta>Ata	p.V326I		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	326					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						TCCTACCTCTGTAATAAAATT	0.453																																						dbGAP											0													99.0	107.0	104.0					10																	70333071		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.976G>A	10.37:g.70333071G>A	ENSP00000362748:p.Val326Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.V326I	ENST00000373644.4	37	c.976	CCDS7281.1	10	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333527	0.41297	.	.	ENSG00000138336	ENST00000373644	T	0.06528	3.29	5.65	0.862	0.19056	.	0.765412	0.10561	N	0.660237	T	0.03011	0.0089	N	0.08118	0	0.22199	N	0.999292	B	0.19817	0.039	B	0.14023	0.01	T	0.46978	-0.9152	10	0.27785	T	0.31	.	4.6805	0.12732	0.0:0.3028:0.189:0.5082	.	326	Q8NFU7	TET1_HUMAN	I	326	ENSP00000362748:V326I	ENSP00000362748:V326I	V	+	1	0	TET1	70003077	0.986000	0.35501	0.995000	0.50966	0.994000	0.84299	0.402000	0.20965	0.121000	0.18284	0.563000	0.77884	GTA	TET1	-	NULL	ENSG00000138336		0.453	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1	46	0.00	0	G	NM_030625		70333071	70333071	+1	no_errors	ENST00000373644	ensembl	human	known	69_37n	missense	29	39.58	19	SNP	0.985	A
TGM1	7051	genome.wustl.edu	37	14	24729190	24729190	+	Missense_Mutation	SNP	C	C	T	rs121918725		TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr14:24729190C>T	ENST00000206765.6	-	5	955	c.832G>A	c.(832-834)Ggg>Agg	p.G278R	TGM1_ENST00000544573.1_Intron	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	278			G -> R (in ARCI1).		cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GCTTCGGTCCCGTAGTAAATT	0.557																																						dbGAP											0			GRCh37	CM014106	TGM1	M	rs121918725						98.0	88.0	92.0					14																	24729190		2203	4300	6503	-	-	-	SO:0001583	missense	0			D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.832G>A	14.37:g.24729190C>T	ENSP00000206765:p.Gly278Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWR7|Q197M4	Missense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.G278R	ENST00000206765.6	37	c.832	CCDS9622.1	14	.	.	.	.	.	.	.	.	.	.	C	28.4	4.914582	0.92178	.	.	ENSG00000092295	ENST00000206765	D	0.96168	-3.93	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.98498	0.9499	H	0.95470	3.675	0.80722	A	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99334	1.0910	9	0.87932	D	0	-26.117	18.0881	0.89464	0.0:1.0:0.0:0.0	.	278	P22735	TGM1_HUMAN	R	278	ENSP00000206765:G278R	ENSP00000206765:G278R	G	-	1	0	TGM1	23799030	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	7.491000	0.81471	2.800000	0.96347	0.650000	0.86243	GGG	TGM1	-	NULL	ENSG00000092295		0.557	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM1	HGNC	protein_coding	OTTHUMT00000073160.6	46	0.00	0	C	NM_000359		24729190	24729190	-1	no_errors	ENST00000206765	ensembl	human	known	69_37n	missense	22	37.14	13	SNP	1.000	T
THAP9	79725	genome.wustl.edu	37	4	83839429	83839429	+	Silent	SNP	C	C	T	rs150289561	byFrequency	TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr4:83839429C>T	ENST00000302236.5	+	5	2115	c.2064C>T	c.(2062-2064)caC>caT	p.H688H	LIN54_ENST00000505905.1_Intron	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	688					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				CTGTCTTTCACGAAGAGGGTA	0.423													C|||	2	0.000399361	0.0	0.0	5008	,	,		21718	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													119.0	112.0	114.0					4																	83839429		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.2064C>T	4.37:g.83839429C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRE2|Q59AC9	Silent	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.H688	ENST00000302236.5	37	c.2064	CCDS3598.1	4																																																																																			THAP9	-	NULL	ENSG00000168152		0.423	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP9	HGNC	protein_coding	OTTHUMT00000252633.1	42	0.00	0	C	NM_024672		83839429	83839429	+1	no_errors	ENST00000302236	ensembl	human	known	69_37n	silent	31	38.00	19	SNP	0.001	T
TRIML1	339976	genome.wustl.edu	37	4	189061035	189061035	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr4:189061035A>T	ENST00000332517.3	+	1	463	c.323A>T	c.(322-324)gAc>gTc	p.D108V	RP11-366H4.3_ENST00000501322.2_RNA	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	108					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		CTCTCCGATGACGAGCAGGGT	0.632																																					Melanoma(31;213 1036 16579 23968 32372)	dbGAP											0													44.0	43.0	43.0					4																	189061035		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.323A>T	4.37:g.189061035A>T	ENSP00000327738:p.Asp108Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BE5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.D108V	ENST00000332517.3	37	c.323	CCDS3851.1	4	.	.	.	.	.	.	.	.	.	.	A	16.88	3.243607	0.58995	.	.	ENSG00000184108	ENST00000332517	T	0.63255	-0.03	5.06	5.06	0.68205	.	0.885835	0.09616	N	0.778240	T	0.59032	0.2164	L	0.50333	1.59	0.09310	N	0.999994	B	0.23650	0.089	B	0.26969	0.075	T	0.50004	-0.8878	10	0.38643	T	0.18	-3.7292	11.7723	0.51967	1.0:0.0:0.0:0.0	.	108	Q8N9V2	TRIML_HUMAN	V	108	ENSP00000327738:D108V	ENSP00000327738:D108V	D	+	2	0	TRIML1	189298029	0.443000	0.25641	0.004000	0.12327	0.004000	0.04260	2.821000	0.48065	2.208000	0.71279	0.459000	0.35465	GAC	TRIML1	-	NULL	ENSG00000184108		0.632	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIML1	HGNC	protein_coding	OTTHUMT00000359813.1	19	0.00	0	A	NM_178556		189061035	189061035	+1	no_errors	ENST00000332517	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	0.005	T
TRMT10C	54931	genome.wustl.edu	37	3	101284455	101284455	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chr3:101284455C>T	ENST00000309922.6	+	2	984	c.830C>T	c.(829-831)tCt>tTt	p.S277F		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	277	SAM-dependent MTase TRM10-type. {ECO:0000255|PROSITE-ProRule:PRU01012}.				mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										ACAGAAAAGTCTCATGTAGAT	0.328																																						dbGAP											0													76.0	76.0	76.0					3																	101284455		1826	4070	5896	-	-	-	SO:0001583	missense	0			AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.830C>T	3.37:g.101284455C>T	ENSP00000312356:p.Ser277Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NRG5|Q9NX54|Q9Y596	Missense_Mutation	SNP	pfam_tRNA_m1G_MeTrfase	p.S277F	ENST00000309922.6	37	c.830	CCDS43122.1	3	.	.	.	.	.	.	.	.	.	.	C	17.29	3.351177	0.61183	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	T;T	0.22945	1.93;1.93	6.17	5.3	0.74995	.	0.380726	0.30742	N	0.008976	T	0.56731	0.2005	M	0.89715	3.055	0.44282	D	0.997145	D	0.89917	1.0	D	0.79108	0.992	T	0.65376	-0.6183	10	0.72032	D	0.01	-15.4913	11.8426	0.52364	0.0:0.8011:0.1312:0.0677	.	277	Q7L0Y3	MRRP1_HUMAN	F	277	ENSP00000312356:S277F;ENSP00000419389:S277F	ENSP00000312356:S277F	S	+	2	0	RG9MTD1	102767145	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	3.064000	0.49986	1.630000	0.50440	0.655000	0.94253	TCT	TRMT10C	-	pfam_tRNA_m1G_MeTrfase	ENSG00000174173		0.328	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT10C	HGNC	protein_coding	OTTHUMT00000353400.2	39	0.00	0	C	NM_017819		101284455	101284455	+1	no_errors	ENST00000309922	ensembl	human	known	69_37n	missense	33	32.65	16	SNP	0.978	T
VSIG4	11326	genome.wustl.edu	37	X	65247938	65247938	+	Silent	SNP	G	G	A			TCGA-D8-A1JC-01A-11D-A13L-09	TCGA-D8-A1JC-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	63a9d14f-d91a-47af-8ef6-8124193aa110	d6936adf-adbc-4cb1-b7cb-c7ef255864d1	g.chrX:65247938G>A	ENST00000374737.4	-	4	819	c.711C>T	c.(709-711)ctC>ctT	p.L237L	VSIG4_ENST00000455586.2_Silent_p.L237L|VSIG4_ENST00000412866.2_Silent_p.L143L	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	237					complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TCTTGGTCTTGAGTAGCTTTG	0.448																																						dbGAP											0													205.0	162.0	177.0					X																	65247938		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.711C>T	X.37:g.65247938G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXI4	Nonsense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q164*	ENST00000374737.4	37	c.490	CCDS14383.1	X	.	.	.	.	.	.	.	.	.	.	G	0.086	-1.175637	0.01646	.	.	ENSG00000155659	ENST00000427538	.	.	.	4.41	-3.72	0.04411	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.5155	5.8698	0.18797	0.5676:0.0:0.2931:0.1393	.	.	.	.	X	164	.	.	Q	-	1	0	VSIG4	65164663	0.000000	0.05858	0.000000	0.03702	0.218000	0.24690	-0.503000	0.06383	-0.919000	0.03803	0.523000	0.50628	CAA	VSIG4	-	NULL	ENSG00000155659		0.448	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VSIG4	HGNC	protein_coding	OTTHUMT00000056986.1	185	0.00	0	G	NM_007268		65247938	65247938	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000427538	ensembl	human	known	69_37n	nonsense	80	44.06	63	SNP	0.000	A
