#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB11	8647	genome.wustl.edu	37	2	169791842	169791842	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr2:169791842G>A	ENST00000263817.6	-	23	3032	c.2908C>T	c.(2908-2910)Ccc>Tcc	p.P970S		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	970	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	GTCTTGAAGGGCTTCTCCAGC	0.453																																						dbGAP											0													140.0	136.0	137.0					2																	169791842		1926	4133	6059	-	-	-	SO:0001583	missense	0			AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.2908C>T	2.37:g.169791842G>A	ENSP00000263817:p.Pro970Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TL2|Q9UNB2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.P970S	ENST00000263817.6	37	c.2908	CCDS46444.1	2	.	.	.	.	.	.	.	.	.	.	G	15.09	2.730600	0.48939	.	.	ENSG00000073734	ENST00000263817	T	0.79845	-1.31	5.78	3.57	0.40892	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.435514	0.28566	N	0.014881	D	0.82949	0.5148	L	0.54965	1.715	0.58432	D	0.999995	B;B	0.34147	0.438;0.05	P;B	0.49853	0.624;0.099	T	0.80979	-0.1140	10	0.44086	T	0.13	.	10.5012	0.44806	0.1913:0.0:0.8087:0.0	.	412;970	B4DZQ8;O95342	.;ABCBB_HUMAN	S	970	ENSP00000263817:P970S	ENSP00000263817:P970S	P	-	1	0	ABCB11	169500088	1.000000	0.71417	0.998000	0.56505	0.559000	0.35586	5.697000	0.68295	1.057000	0.40506	0.655000	0.94253	CCC	ABCB11	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000073734		0.453	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB11	HGNC	protein_coding	OTTHUMT00000333616.2	81	0.00	0	G	NM_003742		169791842	169791842	-1	no_errors	ENST00000263817	ensembl	human	known	69_37n	missense	84	15.15	15	SNP	1.000	A
ABCG4	64137	genome.wustl.edu	37	11	119029289	119029289	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr11:119029289T>G	ENST00000449422.2	+	11	1378	c.1190T>G	c.(1189-1191)aTg>aGg	p.M397R	ABCG4_ENST00000531739.1_Missense_Mutation_p.M397R|ABCG4_ENST00000307417.3_Missense_Mutation_p.M397R|AP002956.1_ENST00000599663.1_5'Flank	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	397	ABC transmembrane type-2.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CTACGGTTCATGTCCCACGTG	0.567																																						dbGAP											0													222.0	199.0	207.0					11																	119029289		2200	4295	6495	-	-	-	SO:0001583	missense	0			AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.1190T>G	11.37:g.119029289T>G	ENSP00000406874:p.Met397Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Missense_Mutation	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.M397R	ENST00000449422.2	37	c.1190	CCDS8415.1	11	.	.	.	.	.	.	.	.	.	.	T	9.568	1.120147	0.20877	.	.	ENSG00000172350	ENST00000307417;ENST00000449422;ENST00000531739	T;T;T	0.71817	-0.6;-0.6;-0.6	5.63	4.5	0.54988	ABC-2 type transporter (1);	0.402035	0.33477	N	0.004873	T	0.71685	0.3369	L	0.61218	1.895	0.49389	D	0.999787	P	0.35433	0.501	P	0.44359	0.447	T	0.66392	-0.5935	10	0.26408	T	0.33	-0.7237	10.98	0.47488	0.0:0.0737:0.0:0.9263	.	397	Q9H172	ABCG4_HUMAN	R	397	ENSP00000304111:M397R;ENSP00000406874:M397R;ENSP00000434318:M397R	ENSP00000304111:M397R	M	+	2	0	ABCG4	118534499	1.000000	0.71417	0.703000	0.30354	0.195000	0.23768	2.295000	0.43576	0.962000	0.38057	0.533000	0.62120	ATG	ABCG4	-	pfam_ABC_2_trans	ENSG00000172350		0.567	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ABCG4	HGNC	protein_coding	OTTHUMT00000388215.1	88	0.00	0	T	NM_022169		119029289	119029289	+1	no_errors	ENST00000307417	ensembl	human	known	69_37n	missense	65	14.47	11	SNP	0.998	G
ABL2	27	genome.wustl.edu	37	1	179090960	179090960	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr1:179090960G>A	ENST00000502732.1	-	5	933	c.730C>T	c.(730-732)Ctt>Ttt	p.L244F	ABL2_ENST00000504405.1_Missense_Mutation_p.L208F|ABL2_ENST00000392043.3_Missense_Mutation_p.L223F|ABL2_ENST00000367623.4_Missense_Mutation_p.L223F|ABL2_ENST00000512653.1_Missense_Mutation_p.L229F|ABL2_ENST00000511413.1_Missense_Mutation_p.L244F|ABL2_ENST00000408940.3_Missense_Mutation_p.L208F|ABL2_ENST00000507173.1_Missense_Mutation_p.L223F|ABL2_ENST00000344730.3_Missense_Mutation_p.L229F	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	244	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	TGGTGTACAAGCTCTGCCAAG	0.448			T	ETV6	AML																																	dbGAP		Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	0													67.0	60.0	62.0					1																	179090960		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.730C>T	1.37:g.179090960G>A	ENSP00000427562:p.Leu244Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_F-actin_binding,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,pfam_SH3-like_bac,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.L244F	ENST00000502732.1	37	c.730	CCDS30947.1	1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611780	0.87258	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405;ENST00000367623;ENST00000507173;ENST00000511413;ENST00000392043	T;T;T;T;T;T;T;T;T	0.59502	0.26;0.26;0.26;0.26;0.26;0.26;0.26;0.26;0.26	5.2	5.2	0.72013	SH2 motif (5);	0.000000	0.46442	D	0.000294	T	0.81588	0.4854	M	0.91459	3.21	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.97110	0.996;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0	D	0.86098	0.1554	10	0.87932	D	0	.	17.7116	0.88323	0.0:0.0:1.0:0.0	.	223;223;244;208;208;223;208;244;229;208;229	P42684-6;P42684-7;P42684-5;P42684-4;P42684-9;P42684-8;P42684-2;P42684;P42684-3;D1MPS6;P42684-10	.;.;.;.;.;.;.;ABL2_HUMAN;.;.;.	F	244;208;229;229;208;223;223;244;223	ENSP00000427562:L244F;ENSP00000386152:L208F;ENSP00000339209:L229F;ENSP00000423578:L229F;ENSP00000426831:L208F;ENSP00000356595:L223F;ENSP00000423413:L223F;ENSP00000424697:L244F;ENSP00000375897:L223F	ENSP00000339209:L229F	L	-	1	0	ABL2	177357583	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.914000	0.87478	2.418000	0.82041	0.655000	0.94253	CTT	ABL2	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	ENSG00000143322		0.448	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABL2	HGNC	protein_coding	OTTHUMT00000085174.3	103	0.00	0	G	NM_005158		179090960	179090960	-1	no_errors	ENST00000502732	ensembl	human	known	69_37n	missense	77	20.62	20	SNP	1.000	A
ACSM4	341392	genome.wustl.edu	37	12	7480932	7480932	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr12:7480932G>A	ENST00000399422.4	+	13	1754	c.1706G>A	c.(1705-1707)cGc>cAc	p.R569H		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	569					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						AAAATCAAACGCAACGTTTTA	0.368																																						dbGAP											0													77.0	69.0	71.0					12																	7480932		1841	4095	5936	-	-	-	SO:0001583	missense	0				CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.1706G>A	12.37:g.7480932G>A	ENSP00000382349:p.Arg569His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTI6	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.R569H	ENST00000399422.4	37	c.1706	CCDS44825.1	12	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203271	0.58234	.	.	ENSG00000215009	ENST00000399422	T	0.20598	2.06	2.64	1.74	0.24563	.	0.000000	0.36134	U	0.002761	T	0.32704	0.0838	M	0.88979	2.995	0.45056	D	0.998079	D	0.57571	0.98	P	0.47075	0.536	T	0.29971	-0.9994	10	0.87932	D	0	-0.6711	7.4675	0.27330	0.1391:0.0:0.8609:0.0	.	569	P0C7M7	ACSM4_HUMAN	H	569	ENSP00000382349:R569H	ENSP00000382349:R569H	R	+	2	0	ACSM4	7372199	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.074000	0.71253	0.678000	0.31325	0.591000	0.81541	CGC	ACSM4	-	NULL	ENSG00000215009		0.368	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ACSM4	HGNC	protein_coding	OTTHUMT00000337866.2	72	0.00	0	G	NM_001080454		7480932	7480932	+1	no_errors	ENST00000399422	ensembl	human	novel	69_37n	missense	67	22.99	20	SNP	1.000	A
ACTN4	81	genome.wustl.edu	37	19	39219642	39219642	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr19:39219642G>A	ENST00000252699.2	+	20	2501	c.2425G>A	c.(2425-2427)Gcc>Acc	p.A809T	ACTN4_ENST00000497637.1_3'UTR|ACTN4_ENST00000424234.2_Missense_Mutation_p.A419T|ACTN4_ENST00000390009.3_Missense_Mutation_p.A590T	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	809	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.|Mediates interaction with MICALL2. {ECO:0000250}.				actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCAGGGTGAGGCCGAGTTCAA	0.632																																					Colon(168;199 1940 10254 46213 46384)	dbGAP											0													98.0	77.0	84.0					19																	39219642		2203	4300	6503	-	-	-	SO:0001583	missense	0			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.2425G>A	19.37:g.39219642G>A	ENSP00000252699:p.Ala809Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4K467|D6PXK4|O76048	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,pfscan_CH-domain,pfscan_EF_HAND_2	p.A809T	ENST00000252699.2	37	c.2425	CCDS12518.1	19	.	.	.	.	.	.	.	.	.	.	G	11.69	1.713911	0.30413	.	.	ENSG00000130402	ENST00000252699;ENST00000424234;ENST00000390009;ENST00000440400	T;T;T;T	0.78481	-0.07;-0.07;-0.07;-1.18	3.81	3.81	0.43845	EF-hand-like domain (1);	0.147080	0.43110	D	0.000607	T	0.75722	0.3888	M	0.66939	2.045	0.52099	D	0.999949	B	0.10296	0.003	B	0.16722	0.016	T	0.74940	-0.3493	10	0.44086	T	0.13	.	14.9532	0.71091	0.0:0.0:1.0:0.0	.	809	O43707	ACTN4_HUMAN	T	809;419;590;240	ENSP00000252699:A809T;ENSP00000411187:A419T;ENSP00000439497:A590T;ENSP00000398393:A240T	ENSP00000252699:A809T	A	+	1	0	ACTN4	43911482	1.000000	0.71417	0.193000	0.23327	0.229000	0.25112	7.714000	0.84703	2.130000	0.65690	0.491000	0.48974	GCC	ACTN4	-	pfscan_EF_HAND_2	ENSG00000130402		0.632	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	HGNC	protein_coding	OTTHUMT00000268091.1	31	0.00	0	G			39219642	39219642	+1	no_errors	ENST00000252699	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	0.951	A
ADAM21P1	145241	genome.wustl.edu	37	14	70714144	70714144	+	RNA	SNP	A	A	G	rs111296958		TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr14:70714144A>G	ENST00000530196.1	-	0	374					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		AGAGCTTCTTAACCCTCATAT	0.502																																						dbGAP											0																																										-	-	-			0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70714144A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			ADAM21P1	-	-	ENSG00000235812		0.502	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1	78	0.00	0	A	NG_002467		70714144	70714144	-1	no_errors	ENST00000530196	ensembl	human	known	69_37n	rna	73	12.05	10	SNP	0.121	G
AFF3	3899	genome.wustl.edu	37	2	100199290	100199290	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr2:100199290G>T	ENST00000409236.2	-	15	2875	c.2763C>A	c.(2761-2763)agC>agA	p.S921R	AFF3_ENST00000409579.1_Missense_Mutation_p.S946R|AFF3_ENST00000356421.2_Missense_Mutation_p.S946R|AFF3_ENST00000317233.4_Missense_Mutation_p.S921R			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	921					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GCTGCAGCTGGCTGTCGGCCT	0.483																																						dbGAP											0													131.0	120.0	124.0					2																	100199290		2203	4300	6503	-	-	-	SO:0001583	missense	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.2763C>A	2.37:g.100199290G>T	ENSP00000387207:p.Ser921Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.S946R	ENST00000409236.2	37	c.2838	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	G	14.26	2.483049	0.44147	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236	T;T;T;T	0.60548	0.18;0.18;0.18;0.18	5.93	2.66	0.31614	.	0.639192	0.15736	N	0.247145	T	0.44052	0.1275	L	0.40543	1.245	0.35064	D	0.761825	B;P	0.36909	0.25;0.573	B;B	0.34093	0.175;0.165	T	0.51576	-0.8688	10	0.32370	T	0.25	.	9.5593	0.39360	0.1463:0.1207:0.733:0.0	.	921;946	P51826;P51826-2	AFF3_HUMAN;.	R	921;946;946;921	ENSP00000317421:S921R;ENSP00000348793:S946R;ENSP00000386834:S946R;ENSP00000387207:S921R	ENSP00000317421:S921R	S	-	3	2	AFF3	99565722	0.999000	0.42202	0.879000	0.34478	0.968000	0.65278	2.839000	0.48207	0.810000	0.34279	0.655000	0.94253	AGC	AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.483	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	126	0.00	0	G	NM_002285		100199290	100199290	-1	no_errors	ENST00000356421	ensembl	human	known	69_37n	missense	127	14.77	22	SNP	0.583	T
ARID1A	8289	genome.wustl.edu	37	1	27106230	27106230	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr1:27106230G>T	ENST00000324856.7	+	20	6212	c.5841G>T	c.(5839-5841)caG>caT	p.Q1947H	ARID1A_ENST00000540690.1_Missense_Mutation_p.Q275H|ARID1A_ENST00000457599.2_Missense_Mutation_p.Q1730H|ARID1A_ENST00000374152.2_Missense_Mutation_p.Q1564H	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1947					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.H1949fs*16(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCCCAGCACAGAGCCACCGGA	0.532			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	dbGAP		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	1	Insertion - Frameshift(1)	large_intestine(1)											167.0	148.0	154.0					1																	27106230		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5841G>T	1.37:g.27106230G>T	ENSP00000320485:p.Gln1947His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	pfam_DUF3518,superfamily_ARM-type_fold	p.E844*	ENST00000324856.7	37	c.2530	CCDS285.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.46|16.46	3.130291|3.130291	0.56721|0.56721	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000430799|ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	.|T;T;T;T	.|0.10382	.|4.4;4.25;4.22;2.88	5.02|5.02	5.02|5.02	0.67125|0.67125	.|.	.|0.263023	.|0.39687	.|N	.|0.001300	.|T	.|0.21186	.|0.0510	L|L	0.50333|0.50333	1.59|1.59	0.36441|0.36441	D|D	0.865489|0.865489	.|D;P;D	.|0.65815	.|0.995;0.947;0.969	.|P;P;P	.|0.58172	.|0.834;0.556;0.66	.|T	.|0.01420	.|-1.1359	.|10	.|0.48119	.|T	.|0.1	-6.3757|-6.3757	12.2569|12.2569	0.54629|0.54629	0.0779:0.0:0.9221:0.0|0.0779:0.0:0.9221:0.0	.|.	.|1564;1947;1730	.|O14497-3;O14497;O14497-2	.|.;ARI1A_HUMAN;.	X|H	844|1947;1730;1564;275	.|ENSP00000320485:Q1947H;ENSP00000387636:Q1730H;ENSP00000363267:Q1564H;ENSP00000442437:Q275H	.|ENSP00000320485:Q1947H	E|Q	+|+	1|3	0|2	ARID1A|ARID1A	26978817|26978817	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	4.021000|4.021000	0.57196|0.57196	2.769000|2.769000	0.95229|0.95229	0.491000|0.491000	0.48974|0.48974	GAG|CAG	ARID1A	-	NULL	ENSG00000117713		0.532	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	69	0.00	0	G	NM_139135		27106230	27106230	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000430799	ensembl	human	novel	69_37n	nonsense	54	20.59	14	SNP	1.000	T
B3GALTL	145173	genome.wustl.edu	37	13	31891805	31891805	+	Silent	SNP	C	C	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr13:31891805C>T	ENST00000343307.4	+	13	1316	c.1167C>T	c.(1165-1167)taC>taT	p.Y389Y		NM_194318.3	NP_919299.3	Q6Y288	B3GLT_HUMAN	beta 1,3-galactosyltransferase-like	389					fucose metabolic process (GO:0006004)|protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)		GCTACAGCTACATCACGGGAG	0.532																																						dbGAP											0													112.0	104.0	107.0					13																	31891805		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB101481	CCDS9341.1	13q12.3	2014-03-24			ENSG00000187676	ENSG00000187676		"""Beta 3-glycosyltransferases"""	20207	protein-coding gene	gene with protein product		610308				12943678, 16899492, 17032646	Standard	NM_194318		Approved	B3GTL, B3Glc-T	uc010aaz.3	Q6Y288	OTTHUMG00000016688	ENST00000343307.4:c.1167C>T	13.37:g.31891805C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5F8|Q5W0H2|Q6NUI3	Silent	SNP	pfam_Fringe-like	p.Y389	ENST00000343307.4	37	c.1167	CCDS9341.1	13																																																																																			B3GALTL	-	pfam_Fringe-like	ENSG00000187676		0.532	B3GALTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALTL	HGNC	protein_coding	OTTHUMT00000044396.3	65	0.00	0	C	NM_194318		31891805	31891805	+1	no_errors	ENST00000343307	ensembl	human	known	69_37n	silent	45	16.67	9	SNP	0.998	T
BCAR1	9564	genome.wustl.edu	37	16	75267803	75267803	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr16:75267803C>A	ENST00000162330.5	-	6	2167	c.2041G>T	c.(2041-2043)Gag>Tag	p.E681*	BCAR1_ENST00000546196.1_Nonsense_Mutation_p.E652*|BCAR1_ENST00000542031.2_Nonsense_Mutation_p.E679*|BCAR1_ENST00000535626.2_Nonsense_Mutation_p.E533*|BCAR1_ENST00000566982.1_5'UTR|BCAR1_ENST00000418647.3_Nonsense_Mutation_p.E727*|BCAR1_ENST00000420641.3_Nonsense_Mutation_p.E699*|BCAR1_ENST00000538440.2_Nonsense_Mutation_p.E681*|BCAR1_ENST00000393422.2_Nonsense_Mutation_p.E699*|BCAR1_ENST00000393420.6_Nonsense_Mutation_p.E699*	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	681					actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		TCCAGCAGCTCCTTCTGGGTC	0.642																																						dbGAP											0													44.0	39.0	41.0					16																	75267803		2198	4299	6497	-	-	-	SO:0001587	stop_gained	0			AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.2041G>T	16.37:g.75267803C>A	ENSP00000162330:p.Glu681*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Nonsense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.E727*	ENST00000162330.5	37	c.2179	CCDS10915.1	16	.	.	.	.	.	.	.	.	.	.	C	41	8.886680	0.98990	.	.	ENSG00000050820	ENST00000162330;ENST00000393422;ENST00000420641;ENST00000538440;ENST00000418647;ENST00000535626;ENST00000393420;ENST00000542031;ENST00000546196	.	.	.	5.34	5.34	0.76211	.	0.062472	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-47.9416	16.9051	0.86124	0.0:1.0:0.0:0.0	.	.	.	.	X	681;699;699;681;727;533;699;679;652	.	ENSP00000162330:E681X	E	-	1	0	BCAR1	73825304	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.223000	0.58587	2.668000	0.90789	0.655000	0.94253	GAG	BCAR1	-	pfam_CAS_DUF3513	ENSG00000050820		0.642	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAR1	HGNC	protein_coding	OTTHUMT00000269017.1	26	0.00	0	C	NM_014567		75267803	75267803	-1	no_errors	ENST00000418647	ensembl	human	known	69_37n	nonsense	24	29.41	10	SNP	1.000	A
TRAPPC3L	100128327	genome.wustl.edu	37	6	116821736	116821736	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr6:116821736G>T	ENST00000368602.3	-	4	429	c.334C>A	c.(334-336)Ctg>Atg	p.L112M	TRAPPC3L_ENST00000356128.4_Missense_Mutation_p.L28M	NM_001139444.2	NP_001132916.1	Q5T215	TPC3L_HUMAN	trafficking protein particle complex 3-like	112					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)											AACTCCACCAGGGGATTCTTC	0.443																																						dbGAP											0													65.0	56.0	59.0					6																	116821736		692	1591	2283	-	-	-	SO:0001583	missense	0			AK002042	CCDS47468.1	6q22.31	2013-05-01	2013-05-01	2013-05-01	ENSG00000173626	ENSG00000173626			21090	protein-coding gene	gene with protein product		614137	"""BET3 like (S. cerevisiae)"""	BET3L		21525244	Standard	NM_001139444		Approved	bA259P20.2, FLJ11180		Q5T215	OTTHUMG00000015440	ENST00000368602.3:c.334C>A	6.37:g.116821736G>T	ENSP00000357591:p.Leu112Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T213|Q5T214	Missense_Mutation	SNP	pfam_TRAPP_component,superfamily_NO_sig/Golgi_transp_ligand-bd,pirsf_TRAPP_I_complex_Bet3	p.L112M	ENST00000368602.3	37	c.334	CCDS47468.1	6	.	.	.	.	.	.	.	.	.	.	G	17.16	3.319037	0.60524	.	.	ENSG00000173626	ENST00000356128;ENST00000437098;ENST00000368602	T;T;T	0.52983	0.64;0.64;0.64	5.3	2.01	0.26516	NO signalling/Golgi transport  ligand-binding domain (1);	0.132361	0.34046	N	0.004305	T	0.36468	0.0968	M	0.86028	2.79	0.49582	D	0.9998	B	0.18968	0.032	B	0.29716	0.106	T	0.41963	-0.9479	10	0.66056	D	0.02	-0.1673	7.7195	0.28723	0.2331:0.0:0.6363:0.1305	.	112	Q5T215	TPC3L_HUMAN	M	28;98;112	ENSP00000348445:L28M;ENSP00000395769:L98M;ENSP00000357591:L112M	ENSP00000348445:L28M	L	-	1	2	BET3L	116928429	0.998000	0.40836	0.999000	0.59377	0.995000	0.86356	2.409000	0.44583	0.588000	0.29660	0.655000	0.94253	CTG	BET3L	-	pfam_TRAPP_component,superfamily_NO_sig/Golgi_transp_ligand-bd,pirsf_TRAPP_I_complex_Bet3	ENSG00000173626		0.443	TRAPPC3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BET3L	HGNC	protein_coding	OTTHUMT00000101701.1	42	0.00	0	G	XM_166322		116821736	116821736	-1	no_errors	ENST00000368602	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	0.963	T
C17orf104	284071	genome.wustl.edu	37	17	42744064	42744064	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr17:42744064A>C	ENST00000409122.2	+	5	927	c.785A>C	c.(784-786)gAa>gCa	p.E262A	C17orf104_ENST00000409464.1_Missense_Mutation_p.E96A|C17orf104_ENST00000359945.3_Missense_Mutation_p.E262A	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	262										autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						ACATTCCAAGAATATCCACTT	0.363																																						dbGAP											0													58.0	53.0	55.0					17																	42744064		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.785A>C	17.37:g.42744064A>C	ENSP00000386452:p.Glu262Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Missense_Mutation	SNP	NULL	p.E262A	ENST00000409122.2	37	c.785	CCDS45703.2	17	.	.	.	.	.	.	.	.	.	.	A	11.81	1.750273	0.30955	.	.	ENSG00000180336	ENST00000359945;ENST00000409122;ENST00000432494;ENST00000456912;ENST00000409464	T;T;T;T	0.35973	1.33;1.33;1.28;1.35	5.54	5.54	0.83059	.	0.312019	0.31554	N	0.007451	T	0.30324	0.0761	L	0.34521	1.04	0.33112	D	0.540671	B;B;B	0.30361	0.277;0.277;0.277	B;B;B	0.26864	0.074;0.074;0.074	T	0.44667	-0.9313	10	0.56958	D	0.05	-7.4801	15.967	0.79984	1.0:0.0:0.0:0.0	.	262;262;96	A2RUB1-5;A2RUB1;A2RUB1-1	.;CQ104_HUMAN;.	A	262;262;96;96;96	ENSP00000353028:E262A;ENSP00000386452:E262A;ENSP00000399809:E96A;ENSP00000386586:E96A	ENSP00000353028:E262A	E	+	2	0	C17orf104	40099590	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.635000	0.54309	2.220000	0.72140	0.482000	0.46254	GAA	C17orf104	-	NULL	ENSG00000180336		0.363	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf104	HGNC	protein_coding	OTTHUMT00000329171.2	41	0.00	0	A	NM_001145080		42744064	42744064	+1	no_errors	ENST00000409122	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	1.000	C
CAPG	822	genome.wustl.edu	37	2	85628923	85628923	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr2:85628923G>C	ENST00000409921.1	-	3	247	c.181C>G	c.(181-183)Ctg>Gtg	p.L61V	CAPG_ENST00000483659.1_5'Flank|CAPG_ENST00000263867.4_Missense_Mutation_p.L61V|CAPG_ENST00000409724.1_Missense_Mutation_p.L61V|CAPG_ENST00000409670.1_Missense_Mutation_p.L61V			Q9BPX3	CND3_HUMAN	capping protein (actin filament), gelsolin-like	0					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)	11						CACAGGTGCAGATGGGAAACC	0.612																																						dbGAP											0													88.0	84.0	85.0					2																	85628923		2203	4300	6503	-	-	-	SO:0001583	missense	0			M94345	CCDS1974.1, CCDS58715.1	2p11.2	2008-06-04			ENSG00000042493	ENSG00000042493			1474	protein-coding gene	gene with protein product	"""macrophage capping protein"""	153615		AFCP		1322908, 12754261	Standard	NM_001747		Approved	MCP	uc010fgi.2	P40121	OTTHUMG00000130183	ENST00000409921.1:c.181C>G	2.37:g.85628923G>C	ENSP00000387063:p.Leu61Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	pfam_Gelsolin_dom,smart_Gelsolin,prints_Gelsolin	p.L61V	ENST00000409921.1	37	c.181	CCDS58715.1	2	.	.	.	.	.	.	.	.	.	.	G	15.02	2.708413	0.48517	.	.	ENSG00000042493	ENST00000542681;ENST00000263867;ENST00000409921;ENST00000409670;ENST00000409724;ENST00000439385;ENST00000449030;ENST00000447219;ENST00000409275	T;T;T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4	5.85	4.97	0.65823	Gelsolin domain (1);	0.135003	0.50627	D	0.000107	T	0.51109	0.1655	L	0.35854	1.095	0.40751	D	0.982918	P;B	0.51351	0.944;0.016	P;B	0.51918	0.684;0.051	T	0.48937	-0.8990	10	0.31617	T	0.26	.	11.0768	0.48036	0.0852:0.0:0.9148:0.0	.	61;61	B8ZZS7;P40121	.;CAPG_HUMAN	V	61	ENSP00000263867:L61V;ENSP00000387063:L61V;ENSP00000386315:L61V;ENSP00000386965:L61V;ENSP00000391923:L61V;ENSP00000403330:L61V;ENSP00000398232:L61V;ENSP00000386596:L61V	ENSP00000263867:L61V	L	-	1	2	CAPG	85482434	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	4.058000	0.57463	1.477000	0.48234	0.563000	0.77884	CTG	CAPG	-	pfam_Gelsolin_dom,smart_Gelsolin,prints_Gelsolin	ENSG00000042493		0.612	CAPG-004	NOVEL	basic|exp_conf|CCDS	protein_coding	CAPG	HGNC	protein_coding	OTTHUMT00000329383.1	66	0.00	0	G	NM_001747		85628923	85628923	-1	no_errors	ENST00000263867	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	C
CDK14	5218	genome.wustl.edu	37	7	90585061	90585061	+	Silent	SNP	G	G	C			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr7:90585061G>C	ENST00000380050.3	+	9	1007	c.876G>C	c.(874-876)gtG>gtC	p.V292V	CDK14_ENST00000436577.2_Silent_p.V163V|CDK14_ENST00000406263.1_Silent_p.V246V|CDK14_ENST00000265741.3_Silent_p.V274V			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	292	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						CCAACGAAGTGGTTACCTTGT	0.433																																					GBM(83;1228 1256 8311 16577 31299)	dbGAP											0													189.0	163.0	172.0					7																	90585061		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.876G>C	7.37:g.90585061G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V292	ENST00000380050.3	37	c.876		7																																																																																			CDK14	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000058091		0.433	CDK14-001	KNOWN	basic|appris_principal	protein_coding	CDK14	HGNC	protein_coding	OTTHUMT00000059970.5	58	0.00	0	G	NM_012395		90585061	90585061	+1	no_errors	ENST00000380050	ensembl	human	known	69_37n	silent	50	41.86	36	SNP	1.000	C
CDYL2	124359	genome.wustl.edu	37	16	80667011	80667011	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr16:80667011A>C	ENST00000570137.2	-	3	894	c.739T>G	c.(739-741)Tgt>Ggt	p.C247G	CDYL2_ENST00000562812.1_Missense_Mutation_p.C248G|CDYL2_ENST00000563890.1_Missense_Mutation_p.C248G|CDYL2_ENST00000566173.1_Missense_Mutation_p.C248G	NM_152342.2	NP_689555.2	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	247						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	21						CGAAACCGACAGTTGCTTTCA	0.512																																						dbGAP											0													195.0	154.0	168.0					16																	80667011		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096185	CCDS32493.1	16q23.2	2008-02-05	2003-09-12			ENSG00000166446			23030	protein-coding gene	gene with protein product			"""chromodomain Y-like protein 2"""			12837688	Standard	NM_152342		Approved	FLJ38866	uc002ffs.3	Q8N8U2		ENST00000570137.2:c.739T>G	16.37:g.80667011A>C	ENSP00000476295:p.Cys247Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5I8	Missense_Mutation	SNP	pfam_Crotonase_core,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.C247G	ENST00000570137.2	37	c.739	CCDS32493.1	16	.	.	.	.	.	.	.	.	.	.	A	10.10	1.258869	0.23051	.	.	ENSG00000166446	ENST00000299564	T	0.56103	0.48	4.86	4.86	0.63082	.	0.164596	0.56097	D	0.000039	T	0.39332	0.1074	N	0.19112	0.55	0.58432	D	0.999997	P	0.38863	0.65	B	0.39660	0.306	T	0.24012	-1.0172	10	0.27082	T	0.32	.	13.7681	0.63008	1.0:0.0:0.0:0.0	.	247	Q8N8U2	CDYL2_HUMAN	G	247	ENSP00000299564:C247G	ENSP00000299564:C247G	C	-	1	0	CDYL2	79224512	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.500000	0.90498	2.038000	0.60285	0.402000	0.26972	TGT	CDYL2	-	NULL	ENSG00000166446		0.512	CDYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDYL2	HGNC	protein_coding	OTTHUMT00000434727.2	64	0.00	0	A	NM_152342		80667011	80667011	-1	no_errors	ENST00000299564	ensembl	human	known	69_37n	missense	16	57.89	22	SNP	1.000	C
CILP	8483	genome.wustl.edu	37	15	65494258	65494258	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr15:65494258T>C	ENST00000261883.4	-	8	1304	c.1138A>G	c.(1138-1140)Agt>Ggt	p.S380G		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	380	Ig-like C2-type.				negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						CCAGCATCACTCTGGGCCTTG	0.572																																						dbGAP											0													77.0	69.0	72.0					15																	65494258		2201	4299	6500	-	-	-	SO:0001583	missense	0			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.1138A>G	15.37:g.65494258T>C	ENSP00000261883:p.Ser380Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.S380G	ENST00000261883.4	37	c.1138	CCDS10203.1	15	.	.	.	.	.	.	.	.	.	.	T	13.97	2.397038	0.42512	.	.	ENSG00000138615	ENST00000261883	T	0.42900	0.96	5.71	4.51	0.55191	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.217254	0.56097	D	0.000025	T	0.38108	0.1028	L	0.52823	1.66	0.32651	N	0.519431	B	0.06786	0.001	B	0.09377	0.004	T	0.48328	-0.9045	10	0.44086	T	0.13	-32.6364	12.0899	0.53719	0.0:0.0:0.1432:0.8568	.	380	O75339	CILP1_HUMAN	G	380	ENSP00000261883:S380G	ENSP00000261883:S380G	S	-	1	0	CILP	63281311	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.822000	0.55708	2.301000	0.77427	0.523000	0.50628	AGT	CILP	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000138615		0.572	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	HGNC	protein_coding	OTTHUMT00000256829.1	46	0.00	0	T	NM_003613		65494258	65494258	-1	no_errors	ENST00000261883	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	1.000	C
COL6A3	1293	genome.wustl.edu	37	2	238283417	238283417	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr2:238283417G>A	ENST00000295550.4	-	8	3769	c.3317C>T	c.(3316-3318)cCc>cTc	p.P1106L	COL6A3_ENST00000346358.4_Missense_Mutation_p.P906L|COL6A3_ENST00000392004.3_Missense_Mutation_p.P900L|COL6A3_ENST00000392003.2_Missense_Mutation_p.P699L|COL6A3_ENST00000472056.1_Missense_Mutation_p.P499L|COL6A3_ENST00000347401.3_Missense_Mutation_p.P905L|COL6A3_ENST00000409809.1_Missense_Mutation_p.P900L|COL6A3_ENST00000353578.4_Missense_Mutation_p.P900L	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1106	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCCGGTGTTGGGGGTCGGCCC	0.617																																						dbGAP											0													49.0	52.0	51.0					2																	238283417		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.3317C>T	2.37:g.238283417G>A	ENSP00000295550:p.Pro1106Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.P1106L	ENST00000295550.4	37	c.3317	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	G	0.485	-0.878117	0.02550	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003	T;T;T;T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62	5.33	4.21	0.49690	von Willebrand factor, type A (3);	0.129164	0.34932	N	0.003579	T	0.09686	0.0238	N	0.00079	-2.23	0.48288	D	0.999626	B;B;B;B;B	0.18968	0.032;0.001;0.001;0.013;0.001	B;B;B;B;B	0.29663	0.105;0.009;0.013;0.063;0.003	T	0.41556	-0.9502	10	0.06757	T	0.87	.	3.8699	0.09031	0.3326:0.0:0.6674:0.0	.	499;699;900;900;1106	E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;CO6A3_HUMAN	L	1106;905;900;499;900;906;900;699	ENSP00000295550:P1106L;ENSP00000315609:P905L;ENSP00000315873:P900L;ENSP00000418285:P499L;ENSP00000386844:P900L;ENSP00000295546:P906L;ENSP00000375861:P900L;ENSP00000375860:P699L	ENSP00000295550:P1106L	P	-	2	0	COL6A3	237948156	0.984000	0.35163	0.998000	0.56505	0.231000	0.25187	2.095000	0.41729	2.652000	0.90054	0.655000	0.94253	CCC	COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.617	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	34	0.00	0	G	NM_004369		238283417	238283417	-1	no_errors	ENST00000295550	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.999	A
CSPG4	1464	genome.wustl.edu	37	15	75977998	75977998	+	Silent	SNP	C	C	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr15:75977998C>A	ENST00000308508.5	-	4	3926	c.3834G>T	c.(3832-3834)gtG>gtT	p.V1278V		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1278	Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GTGGGCTCTTCACTGAGAATA	0.632																																						dbGAP											0													14.0	16.0	15.0					15																	75977998		2156	4156	6312	-	-	-	SO:0001819	synonymous_variant	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.3834G>T	15.37:g.75977998C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW77|Q92675	Silent	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	p.V1278	ENST00000308508.5	37	c.3834	CCDS10284.1	15																																																																																			CSPG4	-	NULL	ENSG00000173546		0.632	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	17	0.00	0	C	NM_001897		75977998	75977998	-1	no_errors	ENST00000308508	ensembl	human	known	69_37n	silent	13	35.00	7	SNP	0.886	A
CYP21A2	1589	genome.wustl.edu	37	6	32007206	32007206	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr6:32007206G>A	ENST00000418967.2	+	4	679	c.521G>A	c.(520-522)tGt>tAt	p.C174Y	CYP21A2_ENST00000435122.2_Missense_Mutation_p.C144Y	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	173					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)	p.C174Y(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	AGCATCATCTGTTACCTCACC	0.582																																					Melanoma(174;1669 1998 3915 34700 46447)	dbGAP											1	Substitution - Missense(1)	large_intestine(1)											60.0	52.0	55.0					6																	32007206		2203	4299	6502	-	-	-	SO:0001583	missense	0			X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.521G>A	6.37:g.32007206G>A	ENSP00000408860:p.Cys174Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.C174Y	ENST00000418967.2	37	c.521	CCDS4735.1	6	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021652	0.54576	.	.	ENSG00000231852	ENST00000418967;ENST00000478281;ENST00000471671;ENST00000435122	T;T;T;T	0.69806	-0.42;-0.43;-0.42;-0.42	4.69	3.81	0.43845	.	0.474215	0.17898	N	0.158294	T	0.70254	0.3203	M	0.76838	2.35	0.22796	N	0.998726	D;D	0.63880	0.984;0.993	D;D	0.63381	0.914;0.914	T	0.64563	-0.6378	10	0.87932	D	0	.	11.0699	0.47997	0.0:0.1869:0.8131:0.0	.	144;174	Q5ST44;Q16874	.;.	Y	174;185;174;144	ENSP00000408860:C174Y;ENSP00000419572:C185Y;ENSP00000418561:C174Y;ENSP00000415043:C144Y	ENSP00000408860:C174Y	C	+	2	0	CYP21A2	32115185	0.993000	0.37304	0.709000	0.30452	0.969000	0.65631	1.980000	0.40618	0.942000	0.37525	0.655000	0.94253	TGT	CYP21A2	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000231852		0.582	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP21A2	HGNC	protein_coding	OTTHUMT00000268768.2	73	0.00	0	G	NM_000500		32007206	32007206	+1	no_errors	ENST00000418967	ensembl	human	known	69_37n	missense	53	22.06	15	SNP	0.603	A
DEFB133	403339	genome.wustl.edu	37	6	49917113	49917113	+	Silent	SNP	G	G	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr6:49917113G>T	ENST00000398721.2	-	1	44	c.45C>A	c.(43-45)gtC>gtA	p.V15V		NM_001166478.1	NP_001159950.1	Q30KQ1	DB133_HUMAN	defensin, beta 133	15					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)											TGGCAATGGGGACCAGAAAGA	0.398																																						dbGAP											0													137.0	116.0	122.0					6																	49917113		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0					6p12.3	2011-03-29			ENSG00000214643	ENSG00000214643		"""Defensins, beta"""	31331	protein-coding gene	gene with protein product							Standard	NM_001166478		Approved		uc003ozy.2	Q30KQ1		ENST00000398721.2:c.45C>A	6.37:g.49917113G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4QY39	Silent	SNP	NULL	p.V15	ENST00000398721.2	37	c.45		6																																																																																			DEFB133	-	NULL	ENSG00000214643		0.398	DEFB133-201	KNOWN	basic|appris_principal	protein_coding	DEFB133	HGNC	protein_coding		78	0.00	0	G	NM_001166478		49917113	49917113	-1	no_errors	ENST00000398721	ensembl	human	known	69_37n	silent	50	26.09	18	SNP	0.001	T
DNAH11	8701	genome.wustl.edu	37	7	21640549	21640549	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr7:21640549G>A	ENST00000409508.3	+	16	3286		c.e16+1		DNAH11_ENST00000328843.6_Splice_Site	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CAAAGAACAGGCAAGGAAAAC	0.378									Kartagener syndrome																													dbGAP											0													99.0	92.0	94.0					7																	21640549		1841	4092	5933	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.3255+1G>A	7.37:g.21640549G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJ82	Splice_Site	SNP	-	e16+1	ENST00000409508.3	37	c.3255+1		7	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166986	0.78339	.	.	ENSG00000105877	ENST00000328843	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8366	0.92165	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH11	21607074	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	9.113000	0.94321	2.563000	0.86464	0.563000	0.77884	.	DNAH11	-	-	ENSG00000105877		0.378	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	99	0.00	0	G	NM_003777	Intron	21640549	21640549	+1	no_errors	ENST00000328843	ensembl	human	known	69_37n	splice_site	44	24.14	14	SNP	1.000	A
GALNT7	51809	genome.wustl.edu	37	4	174169552	174169552	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr4:174169552T>A	ENST00000265000.4	+	2	631	c.548T>A	c.(547-549)aTc>aAc	p.I183N	GALNT7_ENST00000512285.1_Missense_Mutation_p.I183N	NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	183					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		AGTGACATGATCTCACTGGAC	0.428																																						dbGAP											0													94.0	91.0	92.0					4																	174169552		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.548T>A	4.37:g.174169552T>A	ENSP00000265000:p.Ile183Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQU3|Q7Z5W7|Q9UJ28	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.I183N	ENST00000265000.4	37	c.548	CCDS3815.1	4	.	.	.	.	.	.	.	.	.	.	T	24.8	4.572451	0.86542	.	.	ENSG00000109586	ENST00000265000;ENST00000512285	T;T	0.68025	-0.3;0.67	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.85915	0.5808	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.89290	0.3618	10	0.87932	D	0	.	16.3943	0.83563	0.0:0.0:0.0:1.0	.	183	Q86SF2	GALT7_HUMAN	N	183	ENSP00000265000:I183N;ENSP00000427050:I183N	ENSP00000265000:I183N	I	+	2	0	GALNT7	174406127	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.040000	0.89188	2.281000	0.76405	0.533000	0.62120	ATC	GALNT7	-	NULL	ENSG00000109586		0.428	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT7	HGNC	protein_coding	OTTHUMT00000362456.2	42	0.00	0	T	NM_017423		174169552	174169552	+1	no_errors	ENST00000265000	ensembl	human	known	69_37n	missense	51	16.39	10	SNP	1.000	A
GIP	2695	genome.wustl.edu	37	17	47044526	47044526	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr17:47044526C>G	ENST00000357424.2	-	2	169	c.69G>C	c.(67-69)aaG>aaC	p.K23N		NM_004123.2	NP_004114.1	P09681	GIP_HUMAN	gastric inhibitory polypeptide	23					adult locomotory behavior (GO:0008344)|cellular protein metabolic process (GO:0044267)|digestive system development (GO:0055123)|endocrine pancreas development (GO:0031018)|exploration behavior (GO:0035640)|female pregnancy (GO:0007565)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of glucagon secretion (GO:0070094)|positive regulation of glucose transport (GO:0010828)|positive regulation of insulin secretion (GO:0032024)|regulation of insulin secretion (GO:0050796)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to lipid (GO:0033993)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|response to selenium ion (GO:0010269)|response to starvation (GO:0042594)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|secretory granule lumen (GO:0034774)	hormone activity (GO:0005179)			lung(2)|skin(1)|stomach(1)	4						GACCCTCTTTCTTCTCTCCTA	0.527																																						dbGAP											0													101.0	93.0	96.0					17																	47044526		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11542.1	17q21.3-q22	2013-02-26			ENSG00000159224	ENSG00000159224		"""Endogenous ligands"""	4270	protein-coding gene	gene with protein product	"""glucose-dependent insulinotropic polypeptide"""	137240				2739653	Standard	NM_004123		Approved		uc002iol.1	P09681	OTTHUMG00000161171	ENST00000357424.2:c.69G>C	17.37:g.47044526C>G	ENSP00000350005:p.Lys23Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VB42|Q6NTD3	Missense_Mutation	SNP	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP	p.K23N	ENST00000357424.2	37	c.69	CCDS11542.1	17	.	.	.	.	.	.	.	.	.	.	C	15.76	2.928793	0.52759	.	.	ENSG00000159224	ENST00000357424	T	0.26660	1.72	5.15	2.1	0.27182	.	0.184523	0.37761	N	0.001953	T	0.15392	0.0371	L	0.27053	0.805	0.09310	N	1	P	0.44877	0.845	B	0.41860	0.368	T	0.12319	-1.0552	10	0.24483	T	0.36	-14.6058	6.5687	0.22527	0.0:0.6999:0.0:0.3001	.	23	P09681	GIP_HUMAN	N	23	ENSP00000350005:K23N	ENSP00000350005:K23N	K	-	3	2	GIP	44399525	0.124000	0.22315	0.288000	0.24862	0.969000	0.65631	0.374000	0.20501	0.337000	0.23665	0.643000	0.83706	AAG	GIP	-	NULL	ENSG00000159224		0.527	GIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIP	HGNC	protein_coding	OTTHUMT00000364044.1	70	0.00	0	C	NM_004123		47044526	47044526	-1	no_errors	ENST00000357424	ensembl	human	known	69_37n	missense	67	16.05	13	SNP	0.081	G
GPRIN3	285513	genome.wustl.edu	37	4	90169141	90169141	+	Silent	SNP	G	G	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr4:90169141G>T	ENST00000609438.1	-	2	2639	c.2121C>A	c.(2119-2121)atC>atA	p.I707I	GPRIN3_ENST00000333209.4_Silent_p.I707I	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	707										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		TCTGGATCGCGATTCCCAGGG	0.483																																						dbGAP											0													77.0	74.0	75.0					4																	90169141		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.2121C>A	4.37:g.90169141G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVE4	Silent	SNP	NULL	p.I707	ENST00000609438.1	37	c.2121	CCDS34030.1	4																																																																																			GPRIN3	-	NULL	ENSG00000185477		0.483	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN3	HGNC	protein_coding	OTTHUMT00000363540.2	52	0.00	0	G	NM_198281		90169141	90169141	-1	no_errors	ENST00000333209	ensembl	human	known	69_37n	silent	49	22.22	14	SNP	0.705	T
HGSNAT	138050	genome.wustl.edu	37	8	43046629	43046629	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr8:43046629C>G	ENST00000458501.2	+	12	1225	c.1225C>G	c.(1225-1227)Ctt>Gtt	p.L409V	HGSNAT_ENST00000297798.7_Missense_Mutation_p.L113V|HGSNAT_ENST00000379644.4_Missense_Mutation_p.L381V|HGSNAT_ENST00000521576.1_Missense_Mutation_p.L98V			Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase	409					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lysosomal transport (GO:0007041)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	heparan-alpha-glucosaminide N-acetyltransferase activity (GO:0015019)|transferase activity, transferring acyl groups (GO:0016746)			cervix(1)|endometrium(2)|large_intestine(4)|lung(6)	13	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			GAGGAGCTGCCTTTCTCTTCG	0.537																																						dbGAP											0													154.0	155.0	155.0					8																	43046629		1989	4174	6163	-	-	-	SO:0001583	missense	0				CCDS47852.1	8p11.1	2011-11-16	2006-09-05	2006-08-16	ENSG00000165102	ENSG00000165102	2.3.1.78		26527	protein-coding gene	gene with protein product		610453	"""transmembrane protein 76"""	TMEM76		17033958, 16960811	Standard	NM_152419		Approved	FLJ32731, HGNAT	uc003xpx.4	Q68CP4	OTTHUMG00000164102	ENST00000458501.2:c.1225C>G	8.37:g.43046629C>G	ENSP00000389524:p.Leu409Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2V0	Missense_Mutation	SNP	pfam_DUF1624	p.L409V	ENST00000458501.2	37	c.1225		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.248|0.248	-1.008959|-1.008959	0.02112|0.02112	.|.	.|.	ENSG00000165102|ENSG00000165102	ENST00000458501;ENST00000379644;ENST00000521576;ENST00000297798|ENST00000522082;ENST00000524016	T;T;T;T|.	0.24538|.	2.18;2.18;1.85;1.86|.	5.15|5.15	-2.9|-2.9	0.05648|0.05648	.|.	1.981250|.	0.02076|.	N|.	0.051934|.	T|T	0.18045|0.18045	0.0433|0.0433	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B|.	0.15473|.	0.013|.	B|.	0.14578|.	0.011|.	T|T	0.26155|0.26155	-1.0111|-1.0111	10|6	0.17369|0.59425	T|D	0.5|0.04	0.1097|0.1097	1.6204|1.6204	0.02712|0.02712	0.1319:0.192:0.1199:0.5563|0.1319:0.192:0.1199:0.5563	.|.	409|.	Q68CP4|.	HGNAT_HUMAN|.	V|R	409;381;98;113|150;82	ENSP00000389524:L409V;ENSP00000368965:L381V;ENSP00000429029:L98V;ENSP00000297798:L113V|.	ENSP00000297798:L113V|ENSP00000430151:P150R	L|P	+|+	1|2	0|0	HGSNAT|HGSNAT	43165786|43165786	0.030000|0.030000	0.19436|0.19436	0.000000|0.000000	0.03702|0.03702	0.025000|0.025000	0.11179|0.11179	-0.415000|-0.415000	0.07106|0.07106	-0.349000|-0.349000	0.08274|0.08274	-0.355000|-0.355000	0.07637|0.07637	CTT|CCT	HGSNAT	-	NULL	ENSG00000165102		0.537	HGSNAT-202	KNOWN	basic	protein_coding	HGSNAT	HGNC	protein_coding		92	0.00	0	C	XM_372038		43046629	43046629	+1	no_errors	ENST00000458501	ensembl	human	known	69_37n	missense	64	37.86	39	SNP	0.001	G
HS6ST1	9394	genome.wustl.edu	37	2	129025860	129025860	+	Missense_Mutation	SNP	C	C	T	rs147436494		TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr2:129025860C>T	ENST00000259241.6	-	2	1125	c.1112G>A	c.(1111-1113)cGc>cAc	p.R371H		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	371					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		GCTCCTCAGGCGCTGCTCCCT	0.677																																						dbGAP											0													32.0	41.0	38.0					2																	129025860		2097	4251	6348	-	-	-	SO:0001583	missense	0			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.1112G>A	2.37:g.129025860C>T	ENSP00000259241:p.Arg371His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	pfam_Sulfotransferase	p.R371H	ENST00000259241.6	37	c.1112	CCDS42748.1	2	591	0.2706043956043956	87	0.17682926829268292	106	0.292817679558011	168	0.2937062937062937	230	0.3034300791556728	C	28.0	4.883726	0.91814	.	.	ENSG00000136720	ENST00000259241	D	0.85339	-1.97	4.3	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.00039	0.0001	M	0.74647	2.275	0.09310	P	0.99999999795479	D	0.76494	0.999	D	0.76071	0.987	T	0.00000	-1.3594	8	.	.	.	-12.2845	17.1367	0.86742	0.0:1.0:0.0:0.0	.	371	O60243	H6ST1_HUMAN	H	371	ENSP00000259241:R371H	.	R	-	2	0	HS6ST1	128742330	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	7.243000	0.78219	2.099000	0.63709	0.462000	0.41574	CGC	HS6ST1	-	NULL	ENSG00000136720		0.677	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST1	HGNC	protein_coding	OTTHUMT00000331572.1	16	0.00	0	C	NM_004807		129025860	129025860	-1	no_errors	ENST00000259241	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	1.000	T
HSPD1	3329	genome.wustl.edu	37	2	198363501	198363501	+	Silent	SNP	C	C	T	rs201599915	byFrequency	TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr2:198363501C>T	ENST00000388968.3	-	2	339	c.72G>A	c.(70-72)cgG>cgA	p.R24R	HSPD1_ENST00000544407.1_Silent_p.R24R|HSPE1_ENST00000233893.5_5'Flank|HSPD1_ENST00000345042.2_Silent_p.R24R|HSPE1_ENST00000409468.1_5'Flank|HSPE1_ENST00000409729.1_5'Flank|HSPE1-MOB4_ENST00000604458.1_5'Flank	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)	24					'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)	p.R24R(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			TGGCATAAGCCCGAGTGAGAT	0.502																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											59.0	60.0	59.0					2																	198363501		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.72G>A	2.37:g.198363501C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5M6|B7Z712|Q38L19|Q9UCR6	Silent	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaprnin_Cpn60,prints_Chaperone_TCP-1,tigrfam_Chaprnin_Cpn60	p.R24	ENST00000388968.3	37	c.72	CCDS33357.1	2																																																																																			HSPD1	-	NULL	ENSG00000144381		0.502	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPD1	HGNC	protein_coding	OTTHUMT00000335324.2	60	0.00	0	C	NM_002156		198363501	198363501	-1	no_errors	ENST00000345042	ensembl	human	known	69_37n	silent	39	27.78	15	SNP	0.995	T
IKBKE	9641	genome.wustl.edu	37	1	206658614	206658614	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr1:206658614G>T	ENST00000367120.3	+	15	1960	c.1587G>T	c.(1585-1587)aaG>aaT	p.K529N	IKBKE_ENST00000537984.1_Missense_Mutation_p.K444N	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	529	Interaction with DDX3X.				immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)	p.K529K(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					AGCTGGTGAAGAGCCGGGATC	0.577																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											59.0	52.0	54.0					1																	206658614		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.1587G>T	1.37:g.206658614G>T	ENSP00000356087:p.Lys529Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT78|Q3B754|Q3KR43|Q5JTS6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K529N	ENST00000367120.3	37	c.1587	CCDS30996.1	1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.087993	0.36855	.	.	ENSG00000143466	ENST00000367120;ENST00000537984	T;T	0.22134	1.97;1.97	4.8	4.8	0.61643	.	0.239092	0.41500	D	0.000874	T	0.40247	0.1109	L	0.60455	1.87	0.36740	D	0.882178	D;D	0.89917	0.999;1.0	D;D	0.71656	0.922;0.974	T	0.37454	-0.9705	10	0.27082	T	0.32	-26.2722	15.0333	0.71725	0.0:0.0:1.0:0.0	.	444;529	Q3B754;Q14164	.;IKKE_HUMAN	N	529;444	ENSP00000356087:K529N;ENSP00000444529:K444N	ENSP00000356087:K529N	K	+	3	2	IKBKE	204725237	1.000000	0.71417	0.995000	0.50966	0.845000	0.48019	3.922000	0.56462	2.201000	0.70794	0.462000	0.41574	AAG	IKBKE	-	NULL	ENSG00000143466		0.577	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKE	HGNC	protein_coding	OTTHUMT00000088484.1	41	0.00	0	G			206658614	206658614	+1	no_errors	ENST00000367120	ensembl	human	known	69_37n	missense	65	14.47	11	SNP	0.997	T
IL5RA	3568	genome.wustl.edu	37	3	3144387	3144387	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr3:3144387A>T	ENST00000446632.2	-	4	774	c.200T>A	c.(199-201)gTg>gAg	p.V67E	IL5RA_ENST00000438560.1_Missense_Mutation_p.V67E|IL5RA_ENST00000311981.8_Missense_Mutation_p.V67E|IL5RA_ENST00000430514.2_Missense_Mutation_p.V67E|IL5RA_ENST00000256452.3_Missense_Mutation_p.V67E|IL5RA_ENST00000445864.2_Missense_Mutation_p.V67E|IL5RA_ENST00000383846.1_Missense_Mutation_p.V67E|IL5RA_ENST00000418488.2_Missense_Mutation_p.V67E|SNORA43_ENST00000517240.1_RNA|IL5RA_ENST00000456302.1_Missense_Mutation_p.V67E	NM_175726.3	NP_783853.1	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha	67	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-5-mediated signaling pathway (GO:0038043)|regulation of interleukin-5 production (GO:0032674)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-5 receptor activity (GO:0004914)			cervix(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	24				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		GTTTATTTTCACTTGATATTC	0.308																																					GBM(169;430 2801 24955 28528)	dbGAP											0													87.0	87.0	87.0					3																	3144387		2203	4300	6503	-	-	-	SO:0001583	missense	0			M96652	CCDS2559.1, CCDS2560.1, CCDS46739.1, CCDS58813.1	3p26-p24	2008-01-11			ENSG00000091181	ENSG00000091181		"""Interleukins and interleukin receptors"", ""CD molecules"""	6017	protein-coding gene	gene with protein product		147851		IL5R		1732409	Standard	NM_175727		Approved	CDw125, CD125	uc010hbs.3	Q01344	OTTHUMG00000090245	ENST00000446632.2:c.200T>A	3.37:g.3144387A>T	ENSP00000412209:p.Val67Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3IU77|B4E2G0|Q14633|Q15469|Q6ISX9	Missense_Mutation	SNP	pfam_IL6_recept-bd,superfamily_Fibronectin_type3	p.V67E	ENST00000446632.2	37	c.200	CCDS2559.1	3	.	.	.	.	.	.	.	.	.	.	A	19.90	3.913118	0.72983	.	.	ENSG00000091181	ENST00000446632;ENST00000438560;ENST00000256452;ENST00000418488;ENST00000445864;ENST00000383846;ENST00000311981;ENST00000430514;ENST00000456302;ENST00000445701;ENST00000427088	T;T;T;D;D;T;T;T;T;D;T	0.99150	0.37;0.37;0.37;-5.49;-5.49;0.37;0.37;0.37;0.37;-5.49;0.37	5.01	5.01	0.66863	Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000034	D	0.99074	0.9682	M	0.75264	2.295	0.53688	D	0.99997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.998;0.999;0.999;0.998;0.999;0.998	D	0.99537	1.0962	10	0.72032	D	0.01	-19.0295	12.4169	0.55498	1.0:0.0:0.0:0.0	.	67;67;67;67;67;67	B4E2G0;Q01344-3;Q01344-2;Q01344;B3IU77;E7ERY4	.;.;.;IL5RA_HUMAN;.;.	E	67	ENSP00000412209:V67E;ENSP00000390753:V67E;ENSP00000256452:V67E;ENSP00000388858:V67E;ENSP00000402598:V67E;ENSP00000373358:V67E;ENSP00000309196:V67E;ENSP00000400400:V67E;ENSP00000392059:V67E;ENSP00000398117:V67E;ENSP00000391274:V67E	ENSP00000256452:V67E	V	-	2	0	IL5RA	3119387	1.000000	0.71417	0.952000	0.39060	0.837000	0.47467	5.513000	0.67037	2.006000	0.58801	0.455000	0.32223	GTG	IL5RA	-	NULL	ENSG00000091181		0.308	IL5RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL5RA	HGNC	protein_coding	OTTHUMT00000337537.2	74	0.00	0	A			3144387	3144387	-1	no_errors	ENST00000256452	ensembl	human	known	69_37n	missense	63	17.11	13	SNP	1.000	T
IQCD	115811	genome.wustl.edu	37	12	113633598	113633598	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr12:113633598G>A	ENST00000416617.2	-	5	1322	c.1132C>T	c.(1132-1134)Cag>Tag	p.Q378*	IQCD_ENST00000299732.2_Nonsense_Mutation_p.Q276*			Q96DY2	IQCD_HUMAN	IQ motif containing D	378										endometrium(2)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						TCCCGGATCTGCGCAAACTCT	0.602																																						dbGAP											0													115.0	102.0	107.0					12																	113633598		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC013151	CCDS9167.1	12q24.21	2014-07-18				ENSG00000166578			25168	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 10"""					23427265, 24804578	Standard	NM_138451		Approved	DRC10, CFAP84	uc001tuu.3	Q96DY2		ENST00000416617.2:c.1132C>T	12.37:g.113633598G>A	ENSP00000400669:p.Gln378*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZSU0	Nonsense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.Q378*	ENST00000416617.2	37	c.1132		12	.	.	.	.	.	.	.	.	.	.	G	15.95	2.982584	0.53827	.	.	ENSG00000166578	ENST00000299732;ENST00000416617	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-10.923	15.6583	0.77162	0.0:0.0:1.0:0.0	.	.	.	.	X	276;378	.	ENSP00000299732:Q276X	Q	-	1	0	IQCD	112117981	1.000000	0.71417	0.924000	0.36721	0.031000	0.12232	4.839000	0.62810	2.224000	0.72417	0.561000	0.74099	CAG	IQCD	-	NULL	ENSG00000166578		0.602	IQCD-004	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	IQCD	HGNC	protein_coding	OTTHUMT00000405327.1	87	0.00	0	G	NM_138451		113633598	113633598	-1	no_errors	ENST00000416617	ensembl	human	known	69_37n	nonsense	63	18.99	15	SNP	0.986	A
CEMIP	57214	genome.wustl.edu	37	15	81212548	81212548	+	Silent	SNP	C	C	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr15:81212548C>A	ENST00000394685.3	+	15	2330	c.1911C>A	c.(1909-1911)acC>acA	p.T637T	RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Silent_p.T637T|KIAA1199_ENST00000356249.5_Silent_p.T637T			Q8WUJ3	CEMIP_HUMAN		637					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)	p.T637T(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						AGTCTGGAACCCTCCTCCCCT	0.557																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											163.0	109.0	127.0					15																	81212548		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000394685.3:c.1911C>A	15.37:g.81212548C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.T637	ENST00000394685.3	37	c.1911	CCDS10315.1	15																																																																																			KIAA1199	-	superfamily_Pectin_lyase_fold/virulence	ENSG00000103888		0.557	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1199	HGNC	protein_coding	OTTHUMT00000291389.1	49	0.00	0	C			81212548	81212548	+1	no_errors	ENST00000220244	ensembl	human	known	69_37n	silent	53	22.06	15	SNP	1.000	A
KIF1A	547	genome.wustl.edu	37	2	241710387	241710387	+	Splice_Site	SNP	C	C	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr2:241710387C>A	ENST00000320389.7	-	14	1473		c.e14+1		KIF1A_ENST00000498729.2_Splice_Site	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GGTGCCCTCACCTTCAGTCTT	0.652																																						dbGAP											0													43.0	50.0	48.0					2																	241710387		2041	4206	6247	-	-	-	SO:0001630	splice_region_variant	0			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.1314+1G>T	2.37:g.241710387C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Splice_Site	SNP	-	e14+1	ENST00000320389.7	37	c.1341+1	CCDS46561.1	2	.	.	.	.	.	.	.	.	.	.	C	19.89	3.910445	0.72983	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283	.	.	.	4.11	4.11	0.48088	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3652	0.83317	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIF1A	241359060	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.589000	0.82641	1.848000	0.53677	0.555000	0.69702	.	KIF1A	-	-	ENSG00000130294		0.652	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1A	HGNC	protein_coding	OTTHUMT00000324536.3	44	0.00	0	C	NM_138483	Intron	241710387	241710387	-1	no_errors	ENST00000498729	ensembl	human	known	69_37n	splice_site	44	12.00	6	SNP	1.000	A
KIF22	3835	genome.wustl.edu	37	16	29815348	29815348	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr16:29815348G>A	ENST00000160827.4	+	11	1679	c.1639G>A	c.(1639-1641)Gag>Aag	p.E547K	MAZ_ENST00000566906.2_5'Flank|KIF22_ENST00000400751.5_Missense_Mutation_p.E479K|MAZ_ENST00000563402.1_5'Flank|MAZ_ENST00000562337.1_5'Flank|MAZ_ENST00000219782.6_5'Flank|KIF22_ENST00000400750.2_Missense_Mutation_p.E52K|AC009133.15_ENST00000566537.1_RNA|KIF22_ENST00000561482.1_Missense_Mutation_p.E479K|KIF22_ENST00000569382.2_Missense_Mutation_p.E479K|MAZ_ENST00000322945.6_5'Flank|MAZ_ENST00000545521.1_5'Flank	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	547					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						CCCAAATGCCGAGATCCACAT	0.522																																						dbGAP											0													76.0	76.0	76.0					16																	29815348		2197	4296	6493	-	-	-	SO:0001583	missense	0			D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1639G>A	16.37:g.29815348G>A	ENSP00000160827:p.Glu547Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_RuvA_2-like,smart_Kinesin_motor_dom,smart_Hlx-hairpin-Hlx_DNA-bd_motif,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E547K	ENST00000160827.4	37	c.1639	CCDS10653.1	16	.	.	.	.	.	.	.	.	.	.	G	5.963	0.361589	0.11296	.	.	ENSG00000079616	ENST00000160827;ENST00000400750;ENST00000400751	T;T	0.73363	-0.66;-0.74	5.42	-6.46	0.01908	.	.	.	.	.	T	0.45696	0.1355	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31166	-0.9953	9	0.19147	T	0.46	.	7.1261	0.25473	0.5883:0.2463:0.1653:0.0	.	479;479;547	B7Z265;B7Z9T5;Q14807	.;.;KIF22_HUMAN	K	547;52;479	ENSP00000160827:E547K;ENSP00000383562:E479K	ENSP00000160827:E547K	E	+	1	0	KIF22	29722849	0.157000	0.22836	0.000000	0.03702	0.753000	0.42808	0.307000	0.19296	-0.954000	0.03640	0.561000	0.74099	GAG	KIF22	-	NULL	ENSG00000079616		0.522	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF22	HGNC	protein_coding	OTTHUMT00000215012.2	55	0.00	0	G			29815348	29815348	+1	no_errors	ENST00000160827	ensembl	human	known	69_37n	missense	44	21.43	12	SNP	0.000	A
KRTAP4-7	100132476	genome.wustl.edu	37	17	39240627	39240627	+	Missense_Mutation	SNP	T	T	C	rs189343211		TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr17:39240627T>C	ENST00000391417.4	+	1	169	c.169T>C	c.(169-171)Tct>Cct	p.S57P		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	57	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.S57P(4)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						GTGCTGCCAGTCTGTGTGCTG	0.667																																						dbGAP											4	Substitution - Missense(4)	urinary_tract(2)|kidney(2)											18.0	28.0	25.0					17																	39240627		691	1590	2281	-	-	-	SO:0001583	missense	0			AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.169T>C	17.37:g.39240627T>C	ENSP00000375236:p.Ser57Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	pfam_Keratin-assoc	p.S57P	ENST00000391417.4	37	c.169	CCDS45673.1	17	.	.	.	.	.	.	.	.	.	.	.	0.387	-0.925721	0.02377	.	.	ENSG00000240871;ENSG00000212722	ENST00000391417;ENST00000377734	T	0.01272	5.07	3.6	-0.386	0.12466	.	1.254490	0.05892	N	0.628448	T	0.00695	0.0023	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.43572	-0.9383	9	0.02654	T	1	.	4.4551	0.11639	0.0:0.4346:0.1731:0.3923	.	57	Q9BYR0	KRA47_HUMAN	P	57	ENSP00000375236:S57P	ENSP00000375236:S57P	S	+	1	0	KRTAP4-9;KRTAP4-7	36494153	0.000000	0.05858	0.033000	0.17914	0.157000	0.22087	-0.806000	0.04525	0.004000	0.14682	0.374000	0.22700	TCT	KRTAP4-7	-	pfam_Keratin-assoc	ENSG00000240871		0.667	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-7	HGNC	protein_coding	OTTHUMT00000257686.1	43	0.00	0	T			39240627	39240627	+1	no_errors	ENST00000391417	ensembl	human	known	69_37n	missense	74	10.84	9	SNP	0.032	C
MAGEE1	57692	genome.wustl.edu	37	X	75649889	75649890	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chrX:75649889_75649890delTA	ENST00000361470.2	+	1	1844_1845	c.1566_1567delTA	c.(1564-1569)gttaaafs	p.K523fs		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	523	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						AATATATTGTTAAAGAATATCG	0.48																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.1566_1567delTA	X.37:g.75649889_75649890delTA	ENSP00000354912:p.Lys523fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Frame_Shift_Del	DEL	pfam_MAGE,pfscan_MAGE	p.K523fs	ENST00000361470.2	37	c.1566_1567	CCDS14433.1	X																																																																																			MAGEE1	-	pfam_MAGE,pfscan_MAGE	ENSG00000198934		0.480	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	29	0.00	0	TA	NM_020932		75649889	75649890	+1	no_errors	ENST00000361470	ensembl	human	known	69_37n	frame_shift_del	22	17.86	5	DEL	0.022:0.119	-
MED12	9968	genome.wustl.edu	37	X	70357654	70357654	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chrX:70357654T>C	ENST00000374080.3	+	41	5937	c.5905T>C	c.(5905-5907)Tcc>Ccc	p.S1969P	MED12_ENST00000374102.1_Missense_Mutation_p.S1968P|MED12_ENST00000333646.6_Missense_Mutation_p.S1972P			Q93074	MED12_HUMAN	mediator complex subunit 12	1969	Gln-rich.|Interaction with CTNNB1 and GLI3.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CCCCAGCTACTCCAGCCAGCC	0.572			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													50.0	53.0	52.0					X																	70357654		2066	4166	6232	-	-	-	SO:0001583	missense	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.5905T>C	X.37:g.70357654T>C	ENSP00000363193:p.Ser1969Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.S1972P	ENST00000374080.3	37	c.5914	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	-	12.76	2.034216	0.35893	.	.	ENSG00000184634	ENST00000333646;ENST00000374102;ENST00000374080;ENST00000439750	D;D;D;T	0.85088	-1.94;-1.94;-1.94;1.94	5.0	2.35	0.29111	Mediator complex, subunit Med12, catenin-binding (1);	0.128418	0.53938	D	0.000053	D	0.82793	0.5114	L	0.36672	1.1	0.36762	D	0.883357	D;D;D	0.55385	0.971;0.965;0.971	P;P;P	0.55303	0.773;0.461;0.597	T	0.81182	-0.1049	10	0.30854	T	0.27	-15.7861	8.9527	0.35799	0.4316:0.0:0.0:0.5684	.	1819;1968;1969	Q7Z3Z5;Q93074-3;Q93074	.;.;MED12_HUMAN	P	1972;1968;1969;717	ENSP00000333125:S1972P;ENSP00000363215:S1968P;ENSP00000363193:S1969P;ENSP00000408388:S717P	ENSP00000333125:S1972P	S	+	1	0	MED12	70274379	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.603000	0.54074	0.666000	0.31087	0.430000	0.28490	TCC	MED12	-	pfam_Mediator_Med12_catenin-bd	ENSG00000184634		0.572	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	77	0.00	0	T	NM_005120		70357654	70357654	+1	no_errors	ENST00000333646	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	1.000	C
NCOR1	9611	genome.wustl.edu	37	17	15961915	15961915	+	Splice_Site	DEL	T	T	-			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr17:15961915delT	ENST00000268712.3	-	38	6139		c.e38-2		NCOR1_ENST00000395857.3_Splice_Site|NCOR1_ENST00000395851.1_Splice_Site	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1						CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GAGAAGATACTTTAAGAAAAG	0.418																																						dbGAP											0													78.0	80.0	80.0					17																	15961915		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.5882-2A>-	17.37:g.15961915delT		Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Splice_Site	DEL	-	e37-2	ENST00000268712.3	37	c.5882-2	CCDS11175.1	17																																																																																			NCOR1	-	-	ENSG00000141027		0.418	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	60	0.00	0	T	NM_006311	Intron	15961915	15961915	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	splice_site_del	31	29.55	13	DEL	1.000	-
NEBL	10529	genome.wustl.edu	37	10	21177025	21177025	+	Splice_Site	SNP	C	C	A	rs368105518		TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr10:21177025C>A	ENST00000377122.4	-	4	766		c.e4+1		NEBL_ENST00000377159.4_Intron|NEBL_ENST00000377119.1_Splice_Site|NEBL_ENST00000417816.2_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette						cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						AAAAACCCTACCTCACTCTGG	0.363																																						dbGAP											0													87.0	88.0	88.0					10																	21177025		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.369+1G>T	10.37:g.21177025C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Splice_Site	SNP	-	e4+1	ENST00000377122.4	37	c.369+1	CCDS7134.1	10	.	.	.	.	.	.	.	.	.	.	C	18.71	3.681415	0.68042	.	.	ENSG00000078114	ENST00000377122;ENST00000377119;ENST00000434381	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3552	0.98837	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NEBL	21217031	1.000000	0.71417	0.998000	0.56505	0.725000	0.41563	5.677000	0.68142	2.812000	0.96745	0.557000	0.71058	.	NEBL	-	-	ENSG00000078114		0.363	NEBL-004	KNOWN	basic|CCDS	protein_coding	NEBL	HGNC	protein_coding	OTTHUMT00000047113.1	105	0.00	0	C	NM_006393	Intron	21177025	21177025	-1	no_errors	ENST00000377122	ensembl	human	known	69_37n	splice_site	94	12.96	14	SNP	1.000	A
NFYC	4802	genome.wustl.edu	37	1	41236337	41236337	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr1:41236337C>T	ENST00000308733.5	+	10	1220	c.1214C>T	c.(1213-1215)cCt>cTt	p.P405L	NFYC_ENST00000440226.3_Intron|NFYC_ENST00000372653.1_Intron|NFYC_ENST00000372652.1_Missense_Mutation_p.P386L|NFYC_ENST00000447388.3_Intron|NFYC_ENST00000427410.2_Intron|NFYC_ENST00000456393.2_Intron|NFYC_ENST00000425457.2_Intron|NFYC_ENST00000372651.1_Intron|NFYC_ENST00000372654.1_Intron			Q13952	NFYC_HUMAN	nuclear transcription factor Y, gamma	405					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(1)|prostate(1)|skin(2)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)			CTGCATGCCCCTCTCCCAGGG	0.637																																						dbGAP											0													76.0	69.0	71.0					1																	41236337		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78774	CCDS455.1, CCDS44120.1, CCDS44121.1, CCDS44122.1, CCDS44123.1	1p32	2008-11-11			ENSG00000066136	ENSG00000066136			7806	protein-coding gene	gene with protein product		605344				8921405, 9249075	Standard	NM_014223		Approved	CBF-C, NF-YC	uc009vwd.3	Q13952	OTTHUMG00000007729	ENST00000308733.5:c.1214C>T	1.37:g.41236337C>T	ENSP00000312617:p.Pro405Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUS6|B4DW63|D3DPV9|F8VWM3|Q59GY4|Q5T6K8|Q5T6K9|Q5T6L1|Q5TZR6|Q92869|Q9HBX1|Q9NXB5|Q9UM67|Q9UML0|Q9UMT7	Missense_Mutation	SNP	pfam_CBFA_NFYB_domain,pfam_Histone_core_D,superfamily_Histone-fold	p.P405L	ENST00000308733.5	37	c.1214		1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.720057	0.68844	.	.	ENSG00000066136	ENST00000372652;ENST00000308733	T;T	0.40756	1.02;1.22	5.67	4.76	0.60689	.	0.450553	0.18991	N	0.125592	T	0.34948	0.0915	.	.	.	0.35602	D	0.807928	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.42189	-0.9466	9	0.87932	D	0	.	10.7818	0.46382	0.0:0.9121:0.0:0.0879	.	405;386	Q13952;Q13952-3	NFYC_HUMAN;.	L	386;405	ENSP00000361736:P386L;ENSP00000312617:P405L	ENSP00000312617:P405L	P	+	2	0	NFYC	41008924	0.007000	0.16637	1.000000	0.80357	0.997000	0.91878	0.191000	0.17076	1.526000	0.49068	0.655000	0.94253	CCT	NFYC	-	NULL	ENSG00000066136		0.637	NFYC-007	KNOWN	basic	protein_coding	NFYC	HGNC	protein_coding	OTTHUMT00000020802.1	35	0.00	0	C	NM_014223		41236337	41236337	+1	no_errors	ENST00000308733	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	0.996	T
NPFFR2	10886	genome.wustl.edu	37	4	73013422	73013422	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr4:73013422C>G	ENST00000308744.6	+	4	1560	c.1462C>G	c.(1462-1464)Caa>Gaa	p.Q488E	NPFFR2_ENST00000358749.3_Missense_Mutation_p.Q386E|NPFFR2_ENST00000395999.1_Missense_Mutation_p.Q389E|NPFFR2_ENST00000506359.1_3'UTR|NPFFR2_ENST00000344413.5_3'UTR	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	488					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			ATCTACATTTCAAAACCCTCA	0.393																																						dbGAP											0													68.0	75.0	73.0					4																	73013422		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.1462C>G	4.37:g.73013422C>G	ENSP00000307822:p.Gln488Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96RV1|Q9NR49	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_NPFF_rcpt_2,prints_NPFF_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.Q488E	ENST00000308744.6	37	c.1462	CCDS3551.1	4	.	.	.	.	.	.	.	.	.	.	C	10.88	1.476807	0.26511	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.71817	-0.6;-0.47;-0.49	5.6	3.85	0.44370	.	0.504809	0.17148	N	0.185196	T	0.56077	0.1961	L	0.48642	1.525	0.09310	N	1	B;B	0.24882	0.063;0.113	B;B	0.24701	0.055;0.036	T	0.41998	-0.9477	10	0.07482	T	0.82	.	5.6414	0.17567	0.1525:0.6413:0.1315:0.0747	.	389;488	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	E	488;389;386	ENSP00000307822:Q488E;ENSP00000379321:Q389E;ENSP00000351599:Q386E	ENSP00000307822:Q488E	Q	+	1	0	NPFFR2	73232286	0.023000	0.18921	0.005000	0.12908	0.073000	0.16967	0.837000	0.27558	0.700000	0.31782	0.563000	0.77884	CAA	NPFFR2	-	NULL	ENSG00000056291		0.393	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	NPFFR2	HGNC	protein_coding	OTTHUMT00000252170.2	41	0.00	0	C	NM_004885		73013422	73013422	+1	no_errors	ENST00000308744	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	0.012	G
NPHP4	261734	genome.wustl.edu	37	1	5940238	5940238	+	Silent	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr1:5940238G>A	ENST00000378156.4	-	19	2812	c.2547C>T	c.(2545-2547)gtC>gtT	p.V849V	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	849					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CGTTTGAGATGACCCGAGATC	0.532																																						dbGAP											0													76.0	85.0	82.0					1																	5940238		2079	4198	6277	-	-	-	SO:0001819	synonymous_variant	0			AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.2547C>T	1.37:g.5940238G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWC0	Silent	SNP	NULL	p.V849	ENST00000378156.4	37	c.2547	CCDS44052.1	1																																																																																			NPHP4	-	NULL	ENSG00000131697		0.532	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	NPHP4	HGNC	protein_coding	OTTHUMT00000001715.2	52	0.00	0	G			5940238	5940238	-1	no_errors	ENST00000378156	ensembl	human	known	69_37n	silent	27	34.15	14	SNP	1.000	A
OR10H4	126541	genome.wustl.edu	37	19	16060202	16060202	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr19:16060202C>A	ENST00000322107.1	+	1	385	c.385C>A	c.(385-387)Cac>Aac	p.H129N		NM_001004465.1	NP_001004465.1	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H, member 4	129						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	17						GGCCATCTGCCACCCACTGCG	0.547																																						dbGAP											0													252.0	214.0	227.0					19																	16060202		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC011517	CCDS32941.1	19p13.12	2013-09-24			ENSG00000176231	ENSG00000176231		"""GPCR / Class A : Olfactory receptors"""	15388	protein-coding gene	gene with protein product							Standard	NM_001004465		Approved		uc010xov.2	Q8NGA5	OTTHUMG00000182268	ENST00000322107.1:c.385C>A	19.37:g.16060202C>A	ENSP00000318834:p.His129Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFJ2|Q96R57	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.H129N	ENST00000322107.1	37	c.385	CCDS32941.1	19	.	.	.	.	.	.	.	.	.	.	c	1.023	-0.684328	0.03353	.	.	ENSG00000176231	ENST00000322107	T	0.00484	7.08	1.53	1.53	0.23141	GPCR, rhodopsin-like superfamily (1);	0.355540	0.20183	U	0.097471	T	0.00300	0.0009	N	0.21194	0.64	0.26755	N	0.970119	P	0.40660	0.726	P	0.47786	0.557	T	0.26395	-1.0104	10	0.02654	T	1	.	4.988	0.14200	0.3523:0.6477:0.0:0.0	.	129	Q8NGA5	O10H4_HUMAN	N	129	ENSP00000318834:H129N	ENSP00000318834:H129N	H	+	1	0	OR10H4	15921202	0.000000	0.05858	0.988000	0.46212	0.796000	0.44982	-1.071000	0.03437	0.828000	0.34709	0.471000	0.43371	CAC	OR10H4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176231		0.547	OR10H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H4	HGNC	protein_coding	OTTHUMT00000460311.1	298	0.00	0	C			16060202	16060202	+1	no_errors	ENST00000322107	ensembl	human	known	69_37n	missense	249	15.02	44	SNP	1.000	A
OR6P1	128366	genome.wustl.edu	37	1	158532878	158532878	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr1:158532878T>A	ENST00000334632.1	-	1	516	c.517A>T	c.(517-519)Att>Ttt	p.I173F		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						TGGTTGATAATGTTGGGTCCA	0.493																																						dbGAP											0													101.0	91.0	94.0					1																	158532878		692	1591	2283	-	-	-	SO:0001583	missense	0			BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.517A>T	1.37:g.158532878T>A	ENSP00000334721:p.Ile173Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFR9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I173F	ENST00000334632.1	37	c.517	CCDS53391.1	1	.	.	.	.	.	.	.	.	.	.	T	8.597	0.885905	0.17540	.	.	ENSG00000186440	ENST00000334632	T	0.00211	8.54	5.11	0.101	0.14517	GPCR, rhodopsin-like superfamily (1);	0.474803	0.17377	N	0.176426	T	0.00073	0.0002	L	0.53671	1.685	0.09310	N	0.999999	P	0.37914	0.611	B	0.41860	0.368	T	0.05852	-1.0860	10	0.51188	T	0.08	.	5.8011	0.18414	0.0:0.3029:0.1324:0.5647	.	173	Q8NGX9	OR6P1_HUMAN	F	173	ENSP00000334721:I173F	ENSP00000334721:I173F	I	-	1	0	OR6P1	156799502	0.000000	0.05858	0.598000	0.28837	0.004000	0.04260	-1.559000	0.02162	0.098000	0.17522	-0.342000	0.07992	ATT	OR6P1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186440		0.493	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6P1	HGNC	protein_coding	OTTHUMT00000051848.1	67	0.00	0	T			158532878	158532878	-1	no_errors	ENST00000334632	ensembl	human	known	69_37n	missense	34	24.44	11	SNP	0.003	A
PALM	5064	genome.wustl.edu	37	19	731114	731114	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr19:731114G>T	ENST00000338448.5	+	5	335	c.289G>T	c.(289-291)Gtg>Ttg	p.V97L	PALM_ENST00000264560.7_Missense_Mutation_p.V97L|PALM_ENST00000593172.1_3'UTR	NM_002579.2	NP_002570.2	O75781	PALM_HUMAN	paralemmin	97					cellular component movement (GO:0006928)|cellular response to electrical stimulus (GO:0071257)|cytoskeleton organization (GO:0007010)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of filopodium assembly (GO:0051491)|protein targeting to plasma membrane (GO:0072661)|regulation of cell shape (GO:0008360)|synapse maturation (GO:0060074)	apicolateral plasma membrane (GO:0016327)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cytoplasmic membrane-bounded vesicle (GO:0016023)|dendrite membrane (GO:0032590)|dendritic spine membrane (GO:0032591)|filopodium membrane (GO:0031527)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_epithelial(18;2.19e-21)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)|Lung(535;0.201)		GGAAATTGAGGTGCTGGAGCG	0.682																																						dbGAP											0													30.0	31.0	31.0					19																	731114		2191	4290	6481	-	-	-	SO:0001583	missense	0			Y16270	CCDS32857.1, CCDS32858.1	19p13.3	2008-07-17				ENSG00000099864			8594	protein-coding gene	gene with protein product		608134				9615234, 9813098	Standard	XM_005259565		Approved	KIAA0270	uc002lpm.1	O75781		ENST00000338448.5:c.289G>T	19.37:g.731114G>T	ENSP00000341911:p.Val97Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O43359|O95673|Q92559|Q9UPJ4|Q9UQS2|Q9UQS3	Missense_Mutation	SNP	pfam_Paralemmin	p.V97L	ENST00000338448.5	37	c.289	CCDS32857.1	19	.	.	.	.	.	.	.	.	.	.	G	3.858	-0.030415	0.07543	.	.	ENSG00000099864	ENST00000338448;ENST00000264560	T;T	0.16597	2.33;2.33	4.39	2.19	0.27852	.	1.118960	0.06883	N	0.802854	T	0.15003	0.0362	L	0.46157	1.445	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.10450	0.005;0.002;0.003	T	0.33650	-0.9860	10	0.28530	T	0.3	-12.0454	4.3913	0.11341	0.202:0.0:0.6226:0.1754	.	97;97;97	B7Z649;O75781-2;O75781	.;.;PALM_HUMAN	L	97	ENSP00000341911:V97L;ENSP00000264560:V97L	ENSP00000264560:V97L	V	+	1	0	PALM	682114	0.285000	0.24296	0.193000	0.23327	0.274000	0.26718	1.106000	0.31098	0.842000	0.35045	0.511000	0.50034	GTG	PALM	-	pfam_Paralemmin	ENSG00000099864		0.682	PALM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALM	HGNC	protein_coding	OTTHUMT00000457592.1	16	0.00	0	G	NM_002579		731114	731114	+1	no_errors	ENST00000338448	ensembl	human	known	69_37n	missense	10	31.25	5	SNP	0.070	T
PDE3B	5140	genome.wustl.edu	37	11	14854289	14854289	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr11:14854289G>C	ENST00000282096.4	+	10	2469	c.2116G>C	c.(2116-2118)Gac>Cac	p.D706H	PDE3B_ENST00000455098.2_Missense_Mutation_p.D655H	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	706					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	CTTATTTCAAGACACTGGTTT	0.264																																						dbGAP											0													46.0	54.0	51.0					11																	14854289		2187	4245	6432	-	-	-	SO:0001583	missense	0			U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.2116G>C	11.37:g.14854289G>C	ENSP00000282096:p.Asp706His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.D706H	ENST00000282096.4	37	c.2116	CCDS7817.1	11	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460433	0.84317	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	T;T	0.77098	-1.07;-1.07	5.47	5.47	0.80525	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.105826	0.64402	D	0.000005	D	0.87720	0.6248	M	0.65677	2.01	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88498	0.3080	10	0.87932	D	0	.	19.3282	0.94273	0.0:0.0:1.0:0.0	.	655;706	B7ZM37;Q13370	.;PDE3B_HUMAN	H	706;655	ENSP00000282096:D706H;ENSP00000388644:D655H	ENSP00000282096:D706H	D	+	1	0	PDE3B	14810865	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.068000	0.93961	2.566000	0.86566	0.563000	0.77884	GAC	PDE3B	-	NULL	ENSG00000152270		0.264	PDE3B-001	KNOWN	basic|CCDS	protein_coding	PDE3B	HGNC	protein_coding	OTTHUMT00000386974.1	40	0.00	0	G	NM_000922		14854289	14854289	+1	no_errors	ENST00000282096	ensembl	human	known	69_37n	missense	55	16.67	11	SNP	1.000	C
PEX11G	92960	genome.wustl.edu	37	19	7550870	7550870	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr19:7550870G>T	ENST00000221480.1	-	2	111	c.103C>A	c.(103-105)Ctg>Atg	p.L35M	PEX11G_ENST00000599519.1_5'Flank|PEX11G_ENST00000593942.1_De_novo_Start_InFrame	NM_001270539.1|NM_080662.3	NP_001257468.1|NP_542393.1	Q96HA9	PX11C_HUMAN	peroxisomal biogenesis factor 11 gamma	35					peroxisome fission (GO:0016559)|regulation of peroxisome size (GO:0044375)	integral component of peroxisomal membrane (GO:0005779)|intrinsic component of peroxisomal membrane (GO:0031231)|peroxisome (GO:0005777)|protein complex (GO:0043234)				central_nervous_system(1)|cervix(1)|endometrium(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	7						TGTTCAACCAGAACTCCACCA	0.572																																						dbGAP											0													74.0	59.0	64.0					19																	7550870		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008780	CCDS12178.1	19p13.2	2008-02-05				ENSG00000104883			20208	protein-coding gene	gene with protein product		607583				12417726	Standard	NM_080662		Approved		uc002mgk.2	Q96HA9		ENST00000221480.1:c.103C>A	19.37:g.7550870G>T	ENSP00000221480:p.Leu35Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDM0	Missense_Mutation	SNP	pfam_PEX11	p.L35M	ENST00000221480.1	37	c.103	CCDS12178.1	19	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548054	0.45383	.	.	ENSG00000104883	ENST00000221480	T	0.55760	0.5	5.52	4.49	0.54785	.	0.062767	0.64402	D	0.000003	T	0.63189	0.2490	M	0.67625	2.065	0.47214	D	0.999352	D	0.64830	0.994	D	0.63957	0.92	T	0.64504	-0.6392	10	0.54805	T	0.06	-13.3687	6.3898	0.21581	0.0903:0.0:0.7269:0.1828	.	35	Q96HA9	PX11C_HUMAN	M	35	ENSP00000221480:L35M	ENSP00000221480:L35M	L	-	1	2	PEX11G	7456870	1.000000	0.71417	0.736000	0.30914	0.385000	0.30292	1.936000	0.40183	2.600000	0.87896	0.561000	0.74099	CTG	PEX11G	-	pfam_PEX11	ENSG00000104883		0.572	PEX11G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX11G	HGNC	protein_coding	OTTHUMT00000458965.1	44	0.00	0	G	NM_080662		7550870	7550870	-1	no_errors	ENST00000221480	ensembl	human	known	69_37n	missense	39	11.36	5	SNP	0.979	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	59	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	71	23.66	22	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178938934	178938934	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr3:178938934G>A	ENST00000263967.3	+	14	2333	c.2176G>A	c.(2176-2178)Gaa>Aaa	p.E726K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	726			E -> K (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E726K(8)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAGAAGGATGAAACACAAAA	0.428		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	8	Substitution - Missense(8)	lung(4)|large_intestine(2)|breast(2)											89.0	78.0	82.0					3																	178938934		1917	4118	6035	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2176G>A	3.37:g.178938934G>A	ENSP00000263967:p.Glu726Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E726K	ENST00000263967.3	37	c.2176	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308869	0.60305	.	.	ENSG00000121879	ENST00000263967	T	0.80653	-1.4	5.67	5.67	0.87782	Protein kinase-like domain (1);	0.166180	0.38778	U	0.001568	T	0.73450	0.3588	L	0.36672	1.1	0.80722	D	1	P	0.46064	0.872	B	0.42738	0.396	T	0.71401	-0.4604	10	0.02654	T	1	-19.3819	19.7612	0.96319	0.0:0.0:1.0:0.0	.	726	P42336	PK3CA_HUMAN	K	726	ENSP00000263967:E726K	ENSP00000263967:E726K	E	+	1	0	PIK3CA	180421628	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.476000	0.97823	2.670000	0.90874	0.655000	0.94253	GAA	PIK3CA	-	superfamily_Kinase-like_dom	ENSG00000121879		0.428	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	88	0.00	0	G			178938934	178938934	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	68	27.66	26	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178951957	178951957	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr3:178951957G>A	ENST00000263967.3	+	21	3169	c.3012G>A	c.(3010-3012)atG>atA	p.M1004I	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1004	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.M1004I(4)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TTTTCTCAATGATGCTTGGCT	0.388		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	4	Substitution - Missense(4)	large_intestine(1)|lung(1)|endometrium(1)|central_nervous_system(1)											113.0	103.0	106.0					3																	178951957		1889	4106	5995	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3012G>A	3.37:g.178951957G>A	ENSP00000263967:p.Met1004Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.M1004I	ENST00000263967.3	37	c.3012	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047054	0.55110	.	.	ENSG00000121879	ENST00000263967	T	0.74526	-0.85	6.07	6.07	0.98685	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	T	0.68751	0.3035	L	0.31294	0.92	0.80722	D	1	B	0.24092	0.097	B	0.23574	0.047	T	0.64300	-0.6440	10	0.72032	D	0.01	-19.3218	20.6525	0.99598	0.0:0.0:1.0:0.0	.	1004	P42336	PK3CA_HUMAN	I	1004	ENSP00000263967:M1004I	ENSP00000263967:M1004I	M	+	3	0	PIK3CA	180434651	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.325000	0.96381	2.890000	0.99128	0.585000	0.79938	ATG	PIK3CA	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.388	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	66	0.00	0	G			178951957	178951957	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	87	27.50	33	SNP	1.000	A
PKD1L1	168507	genome.wustl.edu	37	7	47925506	47925506	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr7:47925506C>T	ENST00000289672.2	-	18	3033	c.2983G>A	c.(2983-2985)Gtg>Atg	p.V995M		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	995	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CCAAGGGTCACGGGTGAAGGT	0.577																																						dbGAP											0													88.0	83.0	85.0					7																	47925506		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.2983G>A	7.37:g.47925506C>T	ENSP00000289672:p.Val995Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWK1	Missense_Mutation	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.V995M	ENST00000289672.2	37	c.2983	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	C	6.521	0.464301	0.12402	.	.	ENSG00000158683	ENST00000289672	T	0.19669	2.13	4.41	-8.82	0.00810	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	432.053000	0.00166	N	0.000000	T	0.12178	0.0296	L	0.29908	0.895	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.12837	-1.0532	10	0.46703	T	0.11	5.7039	2.3086	0.04181	0.1687:0.1047:0.2694:0.4572	.	995	Q8TDX9	PK1L1_HUMAN	M	995	ENSP00000289672:V995M	ENSP00000289672:V995M	V	-	1	0	PKD1L1	47892031	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.882000	0.00714	-3.086000	0.00249	-0.916000	0.02749	GTG	PKD1L1	-	pfam_PKD/REJ-like,pfscan_REJ-like	ENSG00000158683		0.577	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	67	0.00	0	C	NM_138295		47925506	47925506	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	missense	37	24.49	12	SNP	0.000	T
PKN2	5586	genome.wustl.edu	37	1	89294223	89294223	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr1:89294223G>C	ENST00000370521.3	+	19	2838	c.2479G>C	c.(2479-2481)Gaa>Caa	p.E827Q	PKN2_ENST00000370505.3_Missense_Mutation_p.E670Q|PKN2_ENST00000544045.1_Missense_Mutation_p.E501Q|PKN2_ENST00000370513.5_Missense_Mutation_p.E779Q	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	827	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		TCTTGCCCCAGAAGTATTAAC	0.388																																						dbGAP											0													99.0	91.0	93.0					1																	89294223		1831	4089	5920	-	-	-	SO:0001583	missense	0			U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.2479G>C	1.37:g.89294223G>C	ENSP00000359552:p.Glu827Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_HR1_rho-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.E827Q	ENST00000370521.3	37	c.2479	CCDS714.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.7|27.7	4.850667|4.850667	0.91277|0.91277	.|.	.|.	ENSG00000065243|ENSG00000065243	ENST00000370521;ENST00000370505;ENST00000370513;ENST00000544045;ENST00000544215|ENST00000449189	T;T;T;T|.	0.66280|.	-0.2;-0.2;-0.2;-0.2|.	5.16|5.16	5.16|5.16	0.70880|0.70880	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.45867|.	U|.	0.000328|.	D|D	0.85944|0.85944	0.5815|0.5815	H|H	0.94542|0.94542	3.55|3.55	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;0.999|.	D;D;P|.	0.79108|.	0.992;0.969;0.896|.	D|D	0.89333|0.89333	0.3648|0.3648	10|5	0.87932|.	D|.	0|.	.|.	18.8312|18.8312	0.92141|0.92141	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	811;779;827|.	B4DTP5;E7ESL7;Q16513|.	.;.;PKN2_HUMAN|.	Q|T	827;670;779;501;81|34	ENSP00000359552:E827Q;ENSP00000359536:E670Q;ENSP00000359544:E779Q;ENSP00000439643:E501Q|.	ENSP00000359536:E670Q|.	E|R	+|+	1|2	0|0	PKN2|PKN2	89066811|89066811	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.263000|9.263000	0.95617|0.95617	2.702000|2.702000	0.92279|0.92279	0.655000|0.655000	0.94253|0.94253	GAA|AGA	PKN2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000065243		0.388	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN2	HGNC	protein_coding	OTTHUMT00000027828.3	104	0.00	0	G	NM_006256		89294223	89294223	+1	no_errors	ENST00000370521	ensembl	human	known	69_37n	missense	86	10.42	10	SNP	1.000	C
PLEKHM1	9842	genome.wustl.edu	37	17	43516865	43516865	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr17:43516865A>C	ENST00000430334.3	-	11	3170	c.3037T>G	c.(3037-3039)Ttt>Gtt	p.F1013V	PLEKHM1_ENST00000421073.2_Missense_Mutation_p.F924V|PLEKHM1_ENST00000580404.1_5'UTR	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	1013					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					TCAAACTCAAAGGGGAAGATG	0.612																																						dbGAP											0													108.0	88.0	95.0					17																	43516865		2203	4300	6503	-	-	-	SO:0001583	missense	0			X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.3037T>G	17.37:g.43516865A>C	ENSP00000389913:p.Phe1013Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	pfam_Run,superfamily_Znf_FYVE_PHD,smart_Run,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Pleckstrin_homology,pfscan_Run,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.F1013V	ENST00000430334.3	37	c.3037	CCDS32671.1	17	.	.	.	.	.	.	.	.	.	.	A	28.7	4.940939	0.92526	.	.	ENSG00000225190	ENST00000430334;ENST00000421073	D;D	0.83755	-1.76;-1.73	5.08	5.08	0.68730	Protein kinase C-like, phorbol ester/diacylglycerol binding (2);	0.000000	0.85682	D	0.000000	D	0.92577	0.7642	M	0.92412	3.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.94009	0.7282	10	0.87932	D	0	.	12.9041	0.58141	1.0:0.0:0.0:0.0	.	924;1013	F8W648;Q9Y4G2	.;PKHM1_HUMAN	V	1013;924	ENSP00000389913:F1013V;ENSP00000414352:F924V	ENSP00000414352:F924V	F	-	1	0	PLEKHM1	40872648	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	9.064000	0.93933	2.143000	0.66587	0.374000	0.22700	TTT	PLEKHM1	-	superfamily_Znf_FYVE_PHD,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000225190		0.612	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM1	HGNC	protein_coding	OTTHUMT00000444659.1	90	0.00	0	A	NM_014798		43516865	43516865	-1	no_errors	ENST00000430334	ensembl	human	known	69_37n	missense	85	16.67	17	SNP	1.000	C
PMFBP1	83449	genome.wustl.edu	37	16	72157496	72157496	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr16:72157496C>T	ENST00000537792.1	-	2	139	c.140G>A	c.(139-141)cGa>cAa	p.R47Q	PMFBP1_ENST00000537465.1_Missense_Mutation_p.R886Q|PMFBP1_ENST00000355636.6_Missense_Mutation_p.R736Q|PMFBP1_ENST00000237353.10_Missense_Mutation_p.R881Q			Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	886						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				ATCATTCCCTCGGTAGAGCCT	0.557																																						dbGAP											0													106.0	91.0	96.0					16																	72157496		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000537792.1:c.140G>A	16.37:g.72157496C>T	ENSP00000443366:p.Arg47Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	NULL	p.R886Q	ENST00000537792.1	37	c.2657		16	.	.	.	.	.	.	.	.	.	.	C	9.912	1.209917	0.22289	.	.	ENSG00000118557	ENST00000537792;ENST00000537465;ENST00000237353;ENST00000355636	T;T;T;T	0.51817	0.69;2.5;2.5;2.55	4.95	1.82	0.25136	.	0.192260	0.26096	N	0.026379	T	0.29491	0.0735	L	0.43701	1.375	0.22489	N	0.999054	B;B;B	0.27117	0.168;0.086;0.168	B;B;B	0.20384	0.016;0.029;0.016	T	0.05194	-1.0900	10	0.16420	T	0.52	-3.529	3.8956	0.09138	0.19:0.613:0.0:0.197	.	886;881;886	Q8TBY8;Q8TBY8-2;G3V1Q7	PMFBP_HUMAN;.;.	Q	47;886;881;736	ENSP00000443366:R47Q;ENSP00000443817:R886Q;ENSP00000237353:R881Q;ENSP00000347854:R736Q	ENSP00000237353:R881Q	R	-	2	0	PMFBP1	70714997	0.219000	0.23619	0.993000	0.49108	0.007000	0.05969	-0.205000	0.09411	1.320000	0.45209	0.650000	0.86243	CGA	PMFBP1	-	NULL	ENSG00000118557		0.557	PMFBP1-011	PUTATIVE	basic|exp_conf	protein_coding	PMFBP1	HGNC	protein_coding	OTTHUMT00000396523.1	107	0.00	0	C	NM_031293		72157496	72157496	-1	no_errors	ENST00000537465	ensembl	human	known	69_37n	missense	51	22.73	15	SNP	0.946	T
RAB4A	5867	genome.wustl.edu	37	1	229434758	229434758	+	Silent	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr1:229434758G>A	ENST00000366690.4	+	6	688	c.480G>A	c.(478-480)ggG>ggA	p.G160G	RAB4A_ENST00000473894.1_3'UTR	NM_004578.2	NP_004569.2	P20338	RAB4A_HUMAN	RAB4A, member RAS oncogene family	160					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein transporter activity (GO:0008565)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)				CGCTCACAGGGGAGAATGTAG	0.338																																					Esophageal Squamous(11;250 603 9619 16563)	dbGAP											0													119.0	117.0	118.0					1																	229434758		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC004309	CCDS31050.1, CCDS73046.1	1q42-q43	2014-04-03		2002-02-28	ENSG00000168118	ENSG00000168118		"""RAB, member RAS oncogene"""	9781	protein-coding gene	gene with protein product		179511		RAB4			Standard	NM_004578		Approved	HRES-1/RAB4	uc001hth.4	P20338	OTTHUMG00000037627	ENST00000366690.4:c.480G>A	1.37:g.229434758G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T7P7|Q9BQ44	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_Gtr1_RagA,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.G160	ENST00000366690.4	37	c.480	CCDS31050.1	1																																																																																			RAB4A	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000168118		0.338	RAB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB4A	HGNC	protein_coding	OTTHUMT00000091727.3	103	0.00	0	G	NM_004578		229434758	229434758	+1	no_errors	ENST00000366690	ensembl	human	known	69_37n	silent	132	28.26	52	SNP	1.000	A
RAP1GDS1	5910	genome.wustl.edu	37	4	99358139	99358139	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr4:99358139A>G	ENST00000408927.3	+	14	1729	c.1616A>G	c.(1615-1617)cAt>cGt	p.H539R	RAP1GDS1_ENST00000408900.3_Missense_Mutation_p.H490R|RAP1GDS1_ENST00000264572.7_Missense_Mutation_p.H448R|RAP1GDS1_ENST00000380158.4_Missense_Mutation_p.H491R|RAP1GDS1_ENST00000453712.2_Missense_Mutation_p.H539R|RAP1GDS1_ENST00000339360.5_Missense_Mutation_p.H540R	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	539					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		CAGATTTTACATAGACTGCTA	0.378			T	NUP98	T-ALL																																	dbGAP		Dom	yes		4	4q21-q25	5910	"""RAP1, GTP-GDP dissociation stimulator 1"""		L	0													134.0	127.0	129.0					4																	99358139		1864	4093	5957	-	-	-	SO:0001583	missense	0				CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.1616A>G	4.37:g.99358139A>G	ENSP00000386153:p.His539Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.H540R	ENST00000408927.3	37	c.1619	CCDS43253.1	4	.	.	.	.	.	.	.	.	.	.	A	16.24	3.066212	0.55539	.	.	ENSG00000138698	ENST00000380158;ENST00000264572;ENST00000408927;ENST00000453712;ENST00000408900;ENST00000339360	T;T;T;T;T;T	0.50001	0.76;1.59;0.76;0.76;0.76;0.76	5.96	5.96	0.96718	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.30947	0.0781	N	0.24115	0.695	0.58432	D	0.999995	P;B;B;P;B;B	0.48764	0.839;0.232;0.149;0.915;0.112;0.21	B;B;B;B;B;B	0.36666	0.218;0.101;0.047;0.23;0.054;0.109	T	0.12811	-1.0533	10	0.12766	T	0.61	-3.0583	16.4338	0.83864	1.0:0.0:0.0:0.0	.	448;490;491;539;540;539	E9PH06;P52306-2;Q499L7;P52306;Q4QQI8;G5E9P9	.;.;.;GDS1_HUMAN;.;.	R	491;448;539;539;490;540	ENSP00000369503:H491R;ENSP00000264572:H448R;ENSP00000386153:H539R;ENSP00000407157:H539R;ENSP00000386223:H490R;ENSP00000340454:H540R	ENSP00000264572:H448R	H	+	2	0	RAP1GDS1	99577162	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.350000	0.90069	2.270000	0.75569	0.533000	0.62120	CAT	RAP1GDS1	-	superfamily_ARM-type_fold	ENSG00000138698		0.378	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAP1GDS1	HGNC	protein_coding	OTTHUMT00000363273.2	117	0.00	0	A	NM_001100426		99358139	99358139	+1	no_errors	ENST00000339360	ensembl	human	known	69_37n	missense	103	21.37	28	SNP	1.000	G
SAMD14	201191	genome.wustl.edu	37	17	48191628	48191628	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr17:48191628G>T	ENST00000330175.4	-	8	1182	c.865C>A	c.(865-867)Ccc>Acc	p.P289T	SAMD14_ENST00000503131.1_Missense_Mutation_p.P317T|SAMD14_ENST00000503734.1_5'Flank	NM_001257359.1	NP_001244288.1	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	289										breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	15						GGGATCTTGGGGCTGCTGCTG	0.587																																						dbGAP											0													51.0	51.0	51.0					17																	48191628		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11560.1, CCDS58562.1	17q21.33	2013-01-10				ENSG00000167100		"""Sterile alpha motif (SAM) domain containing"""	27312	protein-coding gene	gene with protein product						8619474	Standard	NM_174920		Approved	FLJ36890	uc002iqg.4	Q8IZD0		ENST00000330175.4:c.865C>A	17.37:g.48191628G>T	ENSP00000329144:p.Pro289Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8V1|Q8N2X0	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.P317T	ENST00000330175.4	37	c.949	CCDS58562.1	17	.	.	.	.	.	.	.	.	.	.	G	16.30	3.085371	0.55861	.	.	ENSG00000167100	ENST00000330175;ENST00000285206;ENST00000503131	.	.	.	5.24	5.24	0.73138	.	0.352017	0.24172	N	0.040888	T	0.68815	0.3042	L	0.51422	1.61	0.41441	D	0.987924	P;D	0.89917	0.9;1.0	B;D	0.87578	0.334;0.998	T	0.62709	-0.6797	9	0.15952	T	0.53	-28.9086	15.7525	0.77997	0.0:0.0:1.0:0.0	.	289;317	Q8IZD0;Q8IZD0-2	SAM14_HUMAN;.	T	289;301;317	.	ENSP00000285206:P301T	P	-	1	0	SAMD14	45546627	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.157000	0.42320	2.448000	0.82819	0.561000	0.74099	CCC	SAMD14	-	NULL	ENSG00000167100		0.587	SAMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD14	HGNC	protein_coding	OTTHUMT00000366661.1	49	0.00	0	G	NM_174920		48191628	48191628	-1	no_errors	ENST00000503131	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	T
SDSL	113675	genome.wustl.edu	37	12	113875830	113875830	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr12:113875830C>A	ENST00000403593.4	+	8	1198	c.936C>A	c.(934-936)aaC>aaA	p.N312K	SDSL_ENST00000345635.4_Missense_Mutation_p.N312K			Q96GA7	SDSL_HUMAN	serine dehydratase-like	312					cellular amino acid metabolic process (GO:0006520)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	L-serine ammonia-lyase activity (GO:0003941)|L-threonine ammonia-lyase activity (GO:0004794)|pyridoxal phosphate binding (GO:0030170)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	15						GTGGAGGCAACAACATCAACA	0.617																																						dbGAP											0													123.0	129.0	127.0					12																	113875830		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF134473	CCDS9170.1	12q24.21	2014-06-24				ENSG00000139410			30404	protein-coding gene	gene with protein product						16580895	Standard	NM_138432		Approved	SDS-RS1, cSDH	uc001tvi.3	Q96GA7		ENST00000403593.4:c.936C>A	12.37:g.113875830C>A	ENSP00000385790:p.Asn312Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PyrdxlP-dep_enz_bsu,superfamily_PyrdxlP-dep_enz_bsu	p.N312K	ENST00000403593.4	37	c.936	CCDS9170.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.62|12.62	1.992870|1.992870	0.35131|0.35131	.|.	.|.	ENSG00000139410|ENSG00000139410	ENST00000403593;ENST00000345635|ENST00000546672	.|.	.|.	.|.	4.34|4.34	2.5|2.5	0.30297|0.30297	Pyridoxal phosphate-dependent enzyme, beta subunit (1);|.	0.111999|.	0.56097|.	D|.	0.000022|.	T|T	0.62146|0.62146	0.2404|0.2404	M|M	0.80183|0.80183	2.485|2.485	0.33630|0.33630	D|D	0.605953|0.605953	D|.	0.62365|.	0.991|.	P|.	0.52627|.	0.704|.	T|T	0.68903|0.68903	-0.5286|-0.5286	9|5	0.72032|.	D|.	0.01|.	-20.3706|-20.3706	8.054|8.054	0.30593|0.30593	0.0:0.7432:0.0:0.2568|0.0:0.7432:0.0:0.2568	.|.	312|.	Q96GA7|.	SDSL_HUMAN|.	K|K	312|208	.|.	ENSP00000341117:N312K|.	N|T	+|+	3|2	2|0	SDSL|SDSL	112360213|112360213	0.997000|0.997000	0.39634|0.39634	0.272000|0.272000	0.24630|0.24630	0.016000|0.016000	0.09150|0.09150	1.968000|1.968000	0.40500|0.40500	0.409000|0.409000	0.25649|0.25649	0.561000|0.561000	0.74099|0.74099	AAC|ACA	SDSL	-	superfamily_PyrdxlP-dep_enz_bsu	ENSG00000139410		0.617	SDSL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SDSL	HGNC	protein_coding	OTTHUMT00000404782.1	58	0.00	0	C	NM_138432		113875830	113875830	+1	no_errors	ENST00000345635	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	0.990	A
SLC36A2	153201	genome.wustl.edu	37	5	150704868	150704868	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr5:150704868C>T	ENST00000335244.4	-	8	1118	c.989G>A	c.(988-990)aGc>aAc	p.S330N	SLC36A2_ENST00000450886.1_Missense_Mutation_p.S54N|SLC36A2_ENST00000521967.1_Missense_Mutation_p.S330N	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	330					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	CAGGTTAAGGCTTATGCTGGC	0.537																																						dbGAP											0													89.0	67.0	74.0					5																	150704868		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.989G>A	5.37:g.150704868C>T	ENSP00000334223:p.Ser330Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.S330N	ENST00000335244.4	37	c.989	CCDS4315.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.89|17.89	3.500004|3.500004	0.64298|0.64298	.|.	.|.	ENSG00000186335|ENSG00000186335	ENST00000523044|ENST00000335244;ENST00000450886;ENST00000521967	.|T;T;T	.|0.02323	.|4.34;4.34;4.34	4.6|4.6	3.72|3.72	0.42706|0.42706	.|.	.|0.152874	.|0.56097	.|D	.|0.000027	T|T	0.03739|0.03739	0.0106|0.0106	N|N	0.24115|0.24115	0.695|0.695	0.33465|0.33465	D|D	0.585489|0.585489	.|B;B	.|0.27951	.|0.091;0.195	.|B;B	.|0.35770	.|0.21;0.21	T|T	0.22730|0.22730	-1.0208|-1.0208	5|10	.|0.87932	.|D	.|0	-40.4765|-40.4765	14.812|14.812	0.70003|0.70003	0.0:0.1516:0.8484:0.0|0.0:0.1516:0.8484:0.0	.|.	.|330;330	.|E5RJJ5;Q495M3	.|.;S36A2_HUMAN	T|N	83|330;54;330	.|ENSP00000334223:S330N;ENSP00000399479:S54N;ENSP00000430535:S330N	.|ENSP00000334223:S330N	A|S	-|-	1|2	0|0	SLC36A2|SLC36A2	150685061|150685061	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.881000|0.881000	0.50899|0.50899	7.356000|7.356000	0.79445|0.79445	1.277000|1.277000	0.44412|0.44412	0.313000|0.313000	0.20887|0.20887	GCC|AGC	SLC36A2	-	pfam_AA_transpt_TM	ENSG00000186335		0.537	SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC36A2	HGNC	protein_coding	OTTHUMT00000252437.1	72	0.00	0	C			150704868	150704868	-1	no_errors	ENST00000335244	ensembl	human	known	69_37n	missense	52	18.75	12	SNP	1.000	T
SLC34A1	6569	genome.wustl.edu	37	5	176815139	176815139	+	Silent	SNP	T	T	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr5:176815139T>A	ENST00000324417.5	+	7	880	c.789T>A	c.(787-789)gcT>gcA	p.A263A	SLC34A1_ENST00000512593.1_Silent_p.A263A	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	263					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCGTGATGCTCCTGACCTGC	0.607																																						dbGAP											0													76.0	66.0	69.0					5																	176815139		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.789T>A	5.37:g.176815139T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPE3	Silent	SNP	pfam_Na/Pi_transpt,tigrfam_Na/Pi_transpt	p.A263	ENST00000324417.5	37	c.789	CCDS4418.1	5																																																																																			SLC34A1	-	tigrfam_Na/Pi_transpt	ENSG00000131183		0.607	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC34A1	HGNC	protein_coding	OTTHUMT00000253431.1	66	0.00	0	T	NM_003052		176815139	176815139	+1	no_errors	ENST00000324417	ensembl	human	known	69_37n	silent	34	32.00	16	SNP	0.998	A
SLFN13	146857	genome.wustl.edu	37	17	33768644	33768644	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr17:33768644A>C	ENST00000285013.6	-	5	2135	c.1860T>G	c.(1858-1860)ttT>ttG	p.F620L	SLFN13_ENST00000534689.1_Missense_Mutation_p.F302L|SLFN13_ENST00000542635.1_Missense_Mutation_p.F620L|SLFN13_ENST00000360502.2_Missense_Mutation_p.F302L|SLFN13_ENST00000526861.1_Missense_Mutation_p.F620L|SLFN13_ENST00000533791.1_Missense_Mutation_p.F620L	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	620						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CCTCACAGTGAAACACATTCC	0.443																																						dbGAP											0													41.0	44.0	43.0					17																	33768644		2190	4280	6470	-	-	-	SO:0001583	missense	0			AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.1860T>G	17.37:g.33768644A>C	ENSP00000285013:p.Phe620Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P645|Q658M1|Q6ZS51|Q96A81	Missense_Mutation	SNP	pfam_ATPase_AAA-4,pfam_DUF2075	p.F620L	ENST00000285013.6	37	c.1860	CCDS32620.1	17	.	.	.	.	.	.	.	.	.	.	a	9.291	1.050568	0.19827	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689	T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74	2.94	0.576	0.17380	Domain of unknown function DUF2075 (1);	0.284396	0.25250	N	0.032023	T	0.79936	0.4532	M	0.85197	2.74	0.27379	N	0.955477	D;P	0.60160	0.987;0.664	P;B	0.56648	0.803;0.189	T	0.70938	-0.4736	10	0.59425	D	0.04	.	4.5903	0.12304	0.6597:0.0:0.3403:0.0	.	302;620	Q68D06-2;Q68D06	.;SLN13_HUMAN	L	620;302;620;620;302	ENSP00000285013:F620L;ENSP00000353692:F302L;ENSP00000434439:F620L;ENSP00000444016:F620L;ENSP00000435442:F302L	ENSP00000285013:F620L	F	-	3	2	SLFN13	30792757	0.000000	0.05858	0.264000	0.24511	0.204000	0.24138	-0.450000	0.06803	-0.020000	0.14032	0.172000	0.16884	TTT	SLFN13	-	pfam_DUF2075	ENSG00000154760		0.443	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN13	HGNC	protein_coding	OTTHUMT00000381883.1	57	0.00	0	A	NM_144682		33768644	33768644	-1	no_errors	ENST00000285013	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	0.850	C
SMEK2	57223	genome.wustl.edu	37	2	55825928	55825928	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr2:55825928C>G	ENST00000345102.5	-	4	846	c.545G>C	c.(544-546)tGc>tCc	p.C182S	SMEK2_ENST00000272313.5_Missense_Mutation_p.C182S|SMEK2_ENST00000407823.3_Missense_Mutation_p.C182S	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	182					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TAGGTTCTCGCAAGCTTGGAA	0.393																																						dbGAP											0													74.0	79.0	78.0					2																	55825928		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.545G>C	2.37:g.55825928C>G	ENSP00000339769:p.Cys182Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	pfam_DUF625,superfamily_ARM-type_fold	p.C182S	ENST00000345102.5	37	c.545	CCDS46289.1	2	.	.	.	.	.	.	.	.	.	.	C	25.9	4.687869	0.88639	.	.	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	T;T;T	0.45668	0.89;0.89;0.89	5.74	5.74	0.90152	Domain of unknown function DUF625 (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75280	0.3828	M	0.93638	3.44	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.997;0.999	D;D;D;D	0.97110	0.988;1.0;0.962;0.991	T	0.80677	-0.1276	10	0.59425	D	0.04	-8.9456	19.9219	0.97089	0.0:1.0:0.0:0.0	.	182;182;182;182	Q5MIZ7-2;Q5MIZ7;Q5MIZ7-3;B4DKA9	.;P4R3B_HUMAN;.;.	S	182	ENSP00000272313:C182S;ENSP00000385912:C182S;ENSP00000339769:C182S	ENSP00000272313:C182S	C	-	2	0	SMEK2	55679432	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.814000	0.86154	2.697000	0.92050	0.655000	0.94253	TGC	SMEK2	-	pfam_DUF625,superfamily_ARM-type_fold	ENSG00000138041		0.393	SMEK2-002	NOVEL	basic|CCDS	protein_coding	SMEK2	HGNC	protein_coding	OTTHUMT00000251483.1	85	0.00	0	C	NM_020463		55825928	55825928	-1	no_errors	ENST00000272313	ensembl	human	known	69_37n	missense	59	16.90	12	SNP	1.000	G
SMYD4	114826	genome.wustl.edu	37	17	1707930	1707930	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr17:1707930C>T	ENST00000305513.7	-	4	526	c.359G>A	c.(358-360)gGt>gAt	p.G120D		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	120							metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						CTCATACTGACCCAGGTGGAA	0.502																																						dbGAP											0													142.0	115.0	124.0					17																	1707930		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.359G>A	17.37:g.1707930C>T	ENSP00000304360:p.Gly120Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.G120D	ENST00000305513.7	37	c.359	CCDS11013.1	17	.	.	.	.	.	.	.	.	.	.	C	12.89	2.073077	0.36566	.	.	ENSG00000186532	ENST00000305513	T	0.71817	-0.6	5.54	2.18	0.27775	Tetratricopeptide-like helical (1);	0.276637	0.40302	N	0.001129	T	0.66790	0.2825	M	0.65320	2	0.46113	D	0.99887	P	0.34864	0.473	B	0.38712	0.28	T	0.63242	-0.6681	10	0.34782	T	0.22	-7.7078	10.6691	0.45747	0.0:0.7444:0.1194:0.1361	.	120	Q8IYR2	SMYD4_HUMAN	D	120	ENSP00000304360:G120D	ENSP00000304360:G120D	G	-	2	0	SMYD4	1654680	0.745000	0.28261	1.000000	0.80357	0.497000	0.33675	0.733000	0.26087	0.709000	0.31976	0.467000	0.42956	GGT	SMYD4	-	NULL	ENSG00000186532		0.502	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	HGNC	protein_coding	OTTHUMT00000207108.4	59	0.00	0	C	XM_056082		1707930	1707930	-1	no_errors	ENST00000305513	ensembl	human	known	69_37n	missense	50	13.79	8	SNP	0.999	T
SREBF1	6720	genome.wustl.edu	37	17	17721600	17721600	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr17:17721600C>G	ENST00000261646.5	-	6	1341	c.1157G>C	c.(1156-1158)aGt>aCt	p.S386T	SREBF1_ENST00000435530.2_Missense_Mutation_p.S386T|SREBF1_ENST00000355815.4_Missense_Mutation_p.S416T|SREBF1_ENST00000583732.1_5'Flank|SREBF1_ENST00000395757.1_Missense_Mutation_p.S132T|SREBF1_ENST00000338854.5_Missense_Mutation_p.S386T	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	386	Interaction with LMNA. {ECO:0000250}.|Leucine-zipper.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						AGTGCGCAGACTTAGGTTCTC	0.542																																						dbGAP											0													137.0	111.0	120.0					17																	17721600		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.1157G>C	17.37:g.17721600C>G	ENSP00000261646:p.Ser386Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.S416T	ENST00000261646.5	37	c.1247	CCDS11189.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.162|8.162	0.789741|0.789741	0.16258|0.16258	.|.	.|.	ENSG00000072310|ENSG00000072310	ENST00000395751|ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000418712;ENST00000423161;ENST00000435530	.|T;T;T;T;D;T	.|0.97924	.|0.65;0.64;0.65;1.06;-4.61;-1.02	5.13|5.13	1.76|1.76	0.24704|0.24704	.|Helix-loop-helix DNA-binding (2);	.|0.267616	.|0.42682	.|N	.|0.000664	D|D	0.90758|0.90758	0.7099|0.7099	N|N	0.19112|0.19112	0.55|0.55	0.27247|0.27247	N|N	0.959009|0.959009	.|B;B;B;B	.|0.15141	.|0.002;0.004;0.004;0.012	.|B;B;B;B	.|0.16289	.|0.003;0.005;0.004;0.015	T|T	0.79581|0.79581	-0.1744|-0.1744	5|10	.|0.05351	.|T	.|0.99	-6.0768|-6.0768	4.6046|4.6046	0.12371|0.12371	0.1154:0.3336:0.4551:0.0958|0.1154:0.3336:0.4551:0.0958	.|.	.|386;362;386;416	.|B0I4X3;B0I4X4;P36956;P36956-4	.|.;.;SRBP1_HUMAN;.	N|T	393|386;416;386;132;223;312;386	.|ENSP00000345822:S386T;ENSP00000348069:S416T;ENSP00000261646:S386T;ENSP00000379106:S132T;ENSP00000411516:S312T;ENSP00000413389:S386T	.|ENSP00000261646:S386T	K|S	-|-	3|2	2|0	SREBF1|SREBF1	17662325|17662325	0.000000|0.000000	0.05858|0.05858	0.991000|0.991000	0.47740|0.47740	0.949000|0.949000	0.60115|0.60115	0.883000|0.883000	0.28200|0.28200	0.530000|0.530000	0.28619|0.28619	0.561000|0.561000	0.74099|0.74099	AAG|AGT	SREBF1	-	superfamily_HLH_DNA-bd	ENSG00000072310		0.542	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF1	HGNC	protein_coding	OTTHUMT00000131771.1	65	0.00	0	C	NM_004176		17721600	17721600	-1	no_errors	ENST00000355815	ensembl	human	known	69_37n	missense	56	33.33	28	SNP	0.996	G
SSX6	280657	genome.wustl.edu	37	X	47969393	47969393	+	IGR	SNP	A	A	G			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chrX:47969393A>G								snoU13 (28154 upstream) : SSX6 (7072 downstream)																							TTGCAAAGAGACCCAGGGATG	0.557																																						dbGAP											0													122.0	100.0	107.0					X																	47969393		2195	4288	6483	-	-	-	SO:0001628	intergenic_variant	0																															X.37:g.47969393A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_SSXRD_motif,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.R10		37	c.30		X																																																																																			SSX6	-	NULL	ENSG00000171483	0	0.557					SSX6	HGNC			226	0.00	0	A			47969393	47969393	+1	no_errors	ENST00000376932	ensembl	human	known	69_37n	silent	188	11.74	25	SNP	0.000	G
STAM	8027	genome.wustl.edu	37	10	17686365	17686365	+	Silent	SNP	C	C	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr10:17686365C>T	ENST00000377524.3	+	1	242	c.27C>T	c.(25-27)ttC>ttT	p.F9F	STAM_ENST00000540523.1_5'UTR|RP11-390B4.5_ENST00000563601.1_RNA	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	9					endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26						CCAATCCCTTCGATCAGGATG	0.612																																						dbGAP											0													171.0	112.0	132.0					10																	17686365		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738			11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899				8780729	Standard	NM_003473		Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	ENST00000377524.3:c.27C>T	10.37:g.17686365C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ99|D3DRU5|Q8N6D9	Silent	SNP	pfam_VHS,pfam_SH3_domain,pfam_SH3_2,pfam_Ubiquitin-int_motif,superfamily_ENTH_VHS,superfamily_SH3_domain,smart_VHS_subgr,smart_SH3_domain,pfscan_SH3_domain,pfscan_Ubiquitin-int_motif,pfscan_VHS,prints_SH3_domain,prints_p67phox	p.F9	ENST00000377524.3	37	c.27	CCDS7122.1	10																																																																																			STAM	-	pfam_VHS,superfamily_ENTH_VHS,smart_VHS_subgr	ENSG00000136738		0.612	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAM	HGNC	protein_coding	OTTHUMT00000047039.1	97	0.00	0	C	NM_003473		17686365	17686365	+1	no_errors	ENST00000377524	ensembl	human	known	69_37n	silent	68	39.82	45	SNP	1.000	T
STARD8	9754	genome.wustl.edu	37	X	67937723	67937723	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chrX:67937723G>C	ENST00000252336.6	+	5	1099	c.727G>C	c.(727-729)Gat>Cat	p.D243H	STARD8_ENST00000374599.3_Missense_Mutation_p.D323H|STARD8_ENST00000374597.3_Missense_Mutation_p.D243H	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	243					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						GTGTCCTGAGGATGGACACCG	0.647																																						dbGAP											0													36.0	24.0	28.0					X																	67937723		2202	4300	6502	-	-	-	SO:0001583	missense	0			D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.727G>C	X.37:g.67937723G>C	ENSP00000252336:p.Asp243His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	pfam_START_lipid-bd,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd,pfscan_START_lipid-bd,pfscan_RhoGAP_dom	p.D323H	ENST00000252336.6	37	c.967	CCDS14390.1	X	.	.	.	.	.	.	.	.	.	.	g	10.86	1.469629	0.26423	.	.	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.08807	3.05;3.05;3.05	4.4	1.6	0.23607	.	0.577322	0.18134	N	0.150633	T	0.09992	0.0245	M	0.65498	2.005	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.20974	-1.0259	10	0.59425	D	0.04	.	7.176	0.25744	0.0969:0.3191:0.584:0.0	.	323;243	Q92502-2;Q92502	.;STAR8_HUMAN	H	243;323;243	ENSP00000252336:D243H;ENSP00000363727:D323H;ENSP00000363725:D243H	ENSP00000252336:D243H	D	+	1	0	STARD8	67854448	0.000000	0.05858	0.020000	0.16555	0.672000	0.39443	0.331000	0.19733	0.023000	0.15187	-0.222000	0.12452	GAT	STARD8	-	NULL	ENSG00000130052		0.647	STARD8-201	KNOWN	basic|CCDS	protein_coding	STARD8	HGNC	protein_coding	OTTHUMT00000057026.2	32	0.00	0	G	NM_014725		67937723	67937723	+1	no_errors	ENST00000374599	ensembl	human	known	69_37n	missense	74	11.90	10	SNP	0.000	C
SYNE1	23345	genome.wustl.edu	37	6	152671436	152671436	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr6:152671436T>G	ENST00000367255.5	-	72	12369	c.11768A>C	c.(11767-11769)gAc>gCc	p.D3923A	SYNE1_ENST00000341594.5_Missense_Mutation_p.D3847A|SYNE1_ENST00000265368.4_Missense_Mutation_p.D3923A|SYNE1_ENST00000423061.1_Intron|SYNE1_ENST00000448038.1_Intron	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3923					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTCTTCATGGTCTTTGACTTT	0.488										HNSCC(10;0.0054)																												dbGAP											0													110.0	100.0	104.0					6																	152671436		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.11768A>C	6.37:g.152671436T>G	ENSP00000356224:p.Asp3923Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.D3923A	ENST00000367255.5	37	c.11768	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	15.47	2.841948	0.51057	.	.	ENSG00000131018	ENST00000367255;ENST00000265368;ENST00000341594	T;T;T	0.35048	1.33;1.33;1.33	5.93	5.93	0.95920	.	0.090393	0.47455	D	0.000234	T	0.12817	0.0311	N	0.22421	0.69	0.80722	D	1	B;B;B	0.24533	0.105;0.105;0.105	B;B;B	0.25140	0.058;0.058;0.058	T	0.08932	-1.0698	10	0.11182	T	0.66	.	16.3943	0.83563	0.0:0.0:0.0:1.0	.	3923;3923;3923	B7ZBC3;Q8NF91;E7EQI5	.;SYNE1_HUMAN;.	A	3923;3923;3847	ENSP00000356224:D3923A;ENSP00000265368:D3923A;ENSP00000341887:D3847A	ENSP00000265368:D3923A	D	-	2	0	SYNE1	152713129	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.676000	0.84012	2.281000	0.76405	0.533000	0.62120	GAC	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1	ENSG00000131018		0.488	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	69	0.00	0	T	NM_182961		152671436	152671436	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	53	22.06	15	SNP	1.000	G
TAF7L	54457	genome.wustl.edu	37	X	100530996	100530996	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chrX:100530996T>A	ENST00000372907.3	-	11	1287	c.1276A>T	c.(1276-1278)Aca>Tca	p.T426S	TAF7L_ENST00000356784.1_Missense_Mutation_p.T340S|TAF7L_ENST00000372905.2_Missense_Mutation_p.T266S|TAF7L_ENST00000324762.6_Missense_Mutation_p.T266S	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	426					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						ACCTTGAGTGTCAGGTTTTCC	0.378																																					Ovarian(104;431 1530 3210 15406 18594)	dbGAP											0													173.0	144.0	154.0					X																	100530996		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.1276A>T	X.37:g.100530996T>A	ENSP00000361998:p.Thr426Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Missense_Mutation	SNP	pfam_TAFII55_prot_cons_reg	p.T426S	ENST00000372907.3	37	c.1276	CCDS35347.1	X	.	.	.	.	.	.	.	.	.	.	t	14.04	2.417768	0.42918	.	.	ENSG00000102387	ENST00000372907;ENST00000372905;ENST00000324762;ENST00000356784	T;T;T;T	0.22539	3.72;1.95;1.95;3.72	5.02	-3.99	0.04069	.	0.756910	0.11582	N	0.549651	T	0.15305	0.0369	L	0.59436	1.845	0.09310	N	1	P;B	0.40731	0.728;0.228	B;B	0.35114	0.196;0.121	T	0.15407	-1.0438	10	0.24483	T	0.36	-0.0882	8.8693	0.35305	0.0:0.5824:0.2759:0.1417	.	426;266	Q5H9L4;Q5H9L4-3	TAF7L_HUMAN;.	S	426;266;266;340	ENSP00000361998:T426S;ENSP00000361996:T266S;ENSP00000320283:T266S;ENSP00000349235:T340S	ENSP00000320283:T266S	T	-	1	0	TAF7L	100417652	0.920000	0.31207	0.000000	0.03702	0.968000	0.65278	1.195000	0.32186	-0.764000	0.04651	0.378000	0.23410	ACA	TAF7L	-	NULL	ENSG00000102387		0.378	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAF7L	HGNC	protein_coding	OTTHUMT00000057526.2	193	0.00	0	T			100530996	100530996	-1	no_errors	ENST00000372907	ensembl	human	known	69_37n	missense	183	12.44	26	SNP	0.448	A
DNASE1L1	1774	genome.wustl.edu	37	X	153642519	153642519	+	5'Flank	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chrX:153642519G>A	ENST00000393638.1	-	0	0				TAZ_ENST00000351413.4_Missense_Mutation_p.R151K|TAZ_ENST00000475699.1_Missense_Mutation_p.R151K|TAZ_ENST00000369790.4_Intron|TAZ_ENST00000369776.4_Intron|TAZ_ENST00000350743.4_Intron|TAZ_ENST00000299328.5_Missense_Mutation_p.R151K|DNASE1L1_ENST00000369809.1_5'Flank	NM_001009934.1	NP_001009934.1	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1						DNA metabolic process (GO:0006259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			lung(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGAAAAAGAAGAGAGAAAGGT	0.512																																						dbGAP											0													99.0	73.0	82.0					X																	153642519		2202	4300	6502	-	-	-	SO:0001631	upstream_gene_variant	0			L40817	CCDS14747.1	Xq28	2008-02-05			ENSG00000013563	ENSG00000013563			2957	protein-coding gene	gene with protein product	"""DNase X"""	300081		DNL1L		8541839, 8654957	Standard	XM_005277829		Approved	DNAS1L1, XIB, DNASEX	uc004fkw.1	P49184	OTTHUMG00000033188		X.37:g.153642519G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWW7|Q5HY41	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase,prints_Tafazzin	p.R151K	ENST00000393638.1	37	c.452	CCDS14747.1	X	.	.	.	.	.	.	.	.	.	.	G	6.948	0.544770	0.13312	.	.	ENSG00000102125	ENST00000426834;ENST00000299328;ENST00000351413;ENST00000475699	D;D;D;D	0.97976	-4.64;-2.93;-2.93;-4.29	1.66	1.66	0.24008	Phospholipid/glycerol acyltransferase (2);	3.297410	0.01650	U	0.024483	D	0.92440	0.7600	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	D	0.87047	0.2144	10	0.02654	T	1	.	6.2408	0.20789	0.0:0.0:1.0:0.0	.	169;151;151	A6XNE1;Q16635-5;Q16635	.;.;TAZ_HUMAN	K	169;151;151;151	ENSP00000411182:R169K;ENSP00000299328:R151K;ENSP00000218246:R151K;ENSP00000419854:R151K	ENSP00000299328:R151K	R	+	2	0	TAZ	153295713	0.001000	0.12720	0.008000	0.14137	0.093000	0.18481	0.041000	0.13927	1.128000	0.42052	0.400000	0.26472	AGA	TAZ	-	pfam_Acyltransferase,smart_Acyltransferase	ENSG00000102125		0.512	DNASE1L1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TAZ	HGNC	protein_coding	OTTHUMT00000080928.2	42	0.00	0	G			153642519	153642519	+1	no_errors	ENST00000299328	ensembl	human	known	69_37n	missense	49	18.33	11	SNP	0.007	A
TLN2	83660	genome.wustl.edu	37	15	63097800	63097800	+	Splice_Site	SNP	T	T	G			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr15:63097800T>G	ENST00000561311.1	+	50	6709	c.6479T>G	c.(6478-6480)gTg>gGg	p.V2160G	TLN2_ENST00000306829.6_Splice_Site_p.V2160G			Q9Y4G6	TLN2_HUMAN	talin 2	2160					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GACTTCCAGGTGTTCCAGTCA	0.413																																						dbGAP											0													41.0	39.0	40.0					15																	63097800		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.6478-1T>G	15.37:g.63097800T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLB8	Missense_Mutation	SNP	pfam_Talin_cent,pfam_ILWEQ,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.V2160G	ENST00000561311.1	37	c.6479	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	T	16.01	3.001703	0.54254	.	.	ENSG00000171914	ENST00000306829	T	0.69926	-0.44	5.93	5.93	0.95920	.	0.247991	0.39407	N	0.001365	T	0.59662	0.2210	L	0.59436	1.845	0.80722	D	1	P	0.39847	0.691	B	0.30105	0.111	T	0.60821	-0.7187	10	0.28530	T	0.3	-14.2398	16.3943	0.83563	0.0:0.0:0.0:1.0	.	2160	Q9Y4G6	TLN2_HUMAN	G	2160	ENSP00000303476:V2160G	ENSP00000303476:V2160G	V	+	2	0	TLN2	60884853	1.000000	0.71417	0.996000	0.52242	0.532000	0.34746	7.997000	0.88414	2.281000	0.76405	0.533000	0.62120	GTG	TLN2	-	NULL	ENSG00000171914		0.413	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	35	0.00	0	T		Missense_Mutation	63097800	63097800	+1	no_errors	ENST00000306829	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	1.000	G
TMEM170A	124491	genome.wustl.edu	37	16	75485730	75485730	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr16:75485730C>T	ENST00000561878.1	-	2	238	c.141G>A	c.(139-141)tgG>tgA	p.W47*	RP11-77K12.1_ENST00000567194.1_Nonsense_Mutation_p.W47*|RP11-77K12.1_ENST00000561887.1_Intron|TMEM170A_ENST00000569540.1_Nonsense_Mutation_p.W9*|TMEM170A_ENST00000566980.1_Nonsense_Mutation_p.W2*|TMEM170A_ENST00000357613.4_Nonsense_Mutation_p.W47*|TMEM170A_ENST00000567796.1_Nonsense_Mutation_p.W2*|TMEM170A_ENST00000569276.1_Nonsense_Mutation_p.W47*	NM_145254.1	NP_660297.1	Q8WVE7	T170A_HUMAN	transmembrane protein 170A	47						integral component of membrane (GO:0016021)				endometrium(1)	1						ATACACCATACCACATCTCTA	0.458																																						dbGAP											0													110.0	88.0	96.0					16																	75485730		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0			BX648484	CCDS10917.1	16q23.1	2008-06-10	2008-06-10	2008-06-10	ENSG00000166822	ENSG00000166822			29577	protein-coding gene	gene with protein product			"""transmembrane protein 170"""	TMEM170		12477932	Standard	NM_145254		Approved	FLJ37611	uc002fee.1	Q8WVE7	OTTHUMG00000137614	ENST00000561878.1:c.141G>A	16.37:g.75485730C>T	ENSP00000454404:p.Trp47*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4R3|B4DPS4|D3DUK2|Q7Z6F3	Nonsense_Mutation	SNP	pfam_Transmembrane_pr_170	p.W47*	ENST00000561878.1	37	c.141	CCDS10917.1	16	.	.	.	.	.	.	.	.	.	.	C	14.58	2.576442	0.45902	.	.	ENSG00000166822	ENST00000357613	.	.	.	5.86	4.91	0.64330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.9965	12.7536	0.57321	0.0:0.9209:0.0:0.0791	.	.	.	.	X	47	.	ENSP00000350230:W47X	W	-	3	0	TMEM170A	74043231	1.000000	0.71417	1.000000	0.80357	0.108000	0.19459	7.449000	0.80643	1.495000	0.48549	-0.229000	0.12294	TGG	TMEM170A	-	pfam_Transmembrane_pr_170	ENSG00000166822		0.458	TMEM170A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM170A	HGNC	protein_coding	OTTHUMT00000269030.2	59	0.00	0	C	NM_145254		75485730	75485730	-1	no_errors	ENST00000561878	ensembl	human	known	69_37n	nonsense	25	53.70	29	SNP	1.000	T
TRAPPC4	51399	genome.wustl.edu	37	11	118895746	118895746	+	IGR	DEL	G	G	-			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr11:118895746delG	ENST00000533632.1	+	0	1759				SLC37A4_ENST00000538950.1_Frame_Shift_Del_p.A315fs|SLC37A4_ENST00000357590.5_Frame_Shift_Del_p.A410fs|SLC37A4_ENST00000525102.1_5'UTR|TRAPPC4_ENST00000533058.1_Frame_Shift_Del_p.W254fs|SLC37A4_ENST00000545985.1_Frame_Shift_Del_p.A388fs|SLC37A4_ENST00000330775.7_Frame_Shift_Del_p.A409fs	NM_016146.4	NP_057230.1	Q9Y296	TPPC4_HUMAN	trafficking protein particle complex 4						dendrite development (GO:0016358)|ER to Golgi vesicle-mediated transport (GO:0006888)|extracellular matrix organization (GO:0030198)	cis-Golgi network (GO:0005801)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi stack (GO:0005795)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)|TRAPP complex (GO:0030008)				NS(1)|endometrium(1)|large_intestine(2)|lung(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		TGTAGTGCTTGGCAATGGTGC	0.582																																						dbGAP											0													58.0	60.0	60.0					11																	118895746		2005	4177	6182	-	-	-	SO:0001628	intergenic_variant	0			AF078862	CCDS8407.1	11q23.3	2011-10-10				ENSG00000196655		"""Trafficking protein particle complex"""	19943	protein-coding gene	gene with protein product		610971				10810093	Standard	NM_016146		Approved	TRS23, SBDN, PTD009	uc010ryo.2	Q9Y296			11.37:g.118895746delG		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3A5|B4DME1	Frame_Shift_Del	DEL	pfam_Sybindin,pfam_Sedlin,superfamily_Longin-like_dom	p.W254fs	ENST00000533632.1	37	c.761	CCDS8407.1	11																																																																																			TRAPPC4	-	NULL	ENSG00000196655		0.582	TRAPPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAPPC4	HGNC	protein_coding	OTTHUMT00000389332.1	25	0.00	0	G	NM_016146		118895746	118895746	+1	no_errors	ENST00000533058	ensembl	human	putative	69_37n	frame_shift_del	24	17.24	5	DEL	1.000	-
TRAPPC8	22878	genome.wustl.edu	37	18	29426707	29426707	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr18:29426707T>A	ENST00000283351.4	-	26	4144	c.3809A>T	c.(3808-3810)aAa>aTa	p.K1270I	RP11-210K20.2_ENST00000582269.1_RNA|TRAPPC8_ENST00000582539.1_Missense_Mutation_p.K1216I	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	1270					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AAAGGCTTCTTTTCCTATAGT	0.363																																						dbGAP											0													203.0	204.0	203.0					18																	29426707		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.3809A>T	18.37:g.29426707T>A	ENSP00000283351:p.Lys1270Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	NULL	p.K1270I	ENST00000283351.4	37	c.3809	CCDS11901.1	18	.	.	.	.	.	.	.	.	.	.	T	12.25	1.880276	0.33162	.	.	ENSG00000153339	ENST00000283351	T	0.15952	2.38	5.12	2.28	0.28536	.	0.195402	0.53938	D	0.000060	T	0.13586	0.0329	L	0.38531	1.155	0.80722	D	1	B	0.33826	0.427	B	0.37198	0.243	T	0.06588	-1.0818	10	0.52906	T	0.07	.	7.1958	0.25851	0.0:0.082:0.2705:0.6475	.	1270	Q9Y2L5	TPPC8_HUMAN	I	1270	ENSP00000283351:K1270I	ENSP00000283351:K1270I	K	-	2	0	TRAPPC8	27680705	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.541000	0.45735	0.760000	0.33108	0.459000	0.35465	AAA	TRAPPC8	-	NULL	ENSG00000153339		0.363	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	TRAPPC8	HGNC	protein_coding	OTTHUMT00000255355.1	87	0.00	0	T	NM_014939		29426707	29426707	-1	no_errors	ENST00000283351	ensembl	human	known	69_37n	missense	72	21.74	20	SNP	1.000	A
TSG101	7251	genome.wustl.edu	37	11	18503243	18503243	+	Silent	SNP	T	T	C			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr11:18503243T>C	ENST00000251968.3	-	9	1432	c.1017A>G	c.(1015-1017)gaA>gaG	p.E339E	TSG101_ENST00000536719.1_Silent_p.E339E|TSG101_ENST00000357193.3_Silent_p.E234E	NM_006292.3	NP_006283.1	Q99816	TS101_HUMAN	tumor susceptibility 101	339	SB. {ECO:0000255|PROSITE- ProRule:PRU00644}.				cell cycle arrest (GO:0007050)|cell division (GO:0051301)|cellular protein modification process (GO:0006464)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|keratinocyte differentiation (GO:0030216)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell growth (GO:0001558)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral budding (GO:0046755)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transcription corepressor activity (GO:0003714)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	22						AGATAGTGTCTTCAATAGCGT	0.378																																					GBM(99;1348 1396 8611 26475 50572)	dbGAP											0													145.0	136.0	139.0					11																	18503243		2199	4293	6492	-	-	-	SO:0001819	synonymous_variant	0			U82130	CCDS7842.1	11p15	2013-08-22	2013-08-22		ENSG00000074319	ENSG00000074319			15971	protein-coding gene	gene with protein product		601387	"""tumor susceptibility gene 10"", ""tumor susceptibility gene 101"""	TSG10		9019400, 9241264	Standard	NM_006292		Approved	VPS23	uc001mor.3	Q99816	OTTHUMG00000167725	ENST00000251968.3:c.1017A>G	11.37:g.18503243T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUM5	Missense_Mutation	SNP	pfam_Steadiness_box	p.R26G	ENST00000251968.3	37	c.76	CCDS7842.1	11																																																																																			TSG101	-	pfam_Steadiness_box	ENSG00000074319		0.378	TSG101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSG101	HGNC	protein_coding	OTTHUMT00000395906.1	97	0.00	0	T	NM_006292		18503243	18503243	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000584526	ensembl	human	known	69_37n	missense	114	12.31	16	SNP	1.000	C
VAV2	7410	genome.wustl.edu	37	9	136649470	136649470	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr9:136649470T>G	ENST00000371850.3	-	18	1634	c.1603A>C	c.(1603-1605)Acc>Ccc	p.T535P	VAV2_ENST00000406606.3_Missense_Mutation_p.T525P|VAV2_ENST00000371851.1_Missense_Mutation_p.T525P	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	535					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		TTGCAGTTGGTGGTCTTGTCA	0.552																																						dbGAP											0													431.0	372.0	392.0					9																	136649470		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.1603A>C	9.37:g.136649470T>G	ENSP00000360916:p.Thr535Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH3_domain,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH2,prints_SH3_domain	p.T535P	ENST00000371850.3	37	c.1603	CCDS48053.1	9	.	.	.	.	.	.	.	.	.	.	T	20.8	4.055530	0.75960	.	.	ENSG00000160293	ENST00000371850;ENST00000371851;ENST00000406606;ENST00000325440	D;D;D	0.93906	-3.31;-3.31;-3.31	3.9	3.9	0.45041	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.96790	0.8952	M	0.88241	2.94	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	0.995;1.0;0.992	D	0.97177	0.9848	10	0.72032	D	0.01	.	12.7302	0.57193	0.0:0.0:0.0:1.0	.	525;535;525	P52735-2;P52735;P52735-3	.;VAV2_HUMAN;.	P	535;525;525;525	ENSP00000360916:T535P;ENSP00000360917:T525P;ENSP00000385362:T525P	ENSP00000317258:T525P	T	-	1	0	VAV2	135639291	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.866000	0.87056	1.390000	0.46547	0.379000	0.24179	ACC	VAV2	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000160293		0.552	VAV2-001	KNOWN	basic|CCDS	protein_coding	VAV2	HGNC	protein_coding	OTTHUMT00000054939.1	432	0.23	1	T			136649470	136649470	-1	no_errors	ENST00000371850	ensembl	human	known	69_37n	missense	360	10.67	43	SNP	1.000	G
WDFY4	57705	genome.wustl.edu	37	10	50036827	50036827	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr10:50036827C>G	ENST00000325239.5	+	36	6253	c.6226C>G	c.(6226-6228)Cca>Gca	p.P2076A	WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2076						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CACTAGTTACCCAGAAGGATT	0.353																																						dbGAP											0													92.0	87.0	88.0					10																	50036827		692	1591	2283	-	-	-	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.6226C>G	10.37:g.50036827C>G	ENSP00000320563:p.Pro2076Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P2076A	ENST00000325239.5	37	c.6226	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.85|13.85	2.361153|2.361153	0.41801|0.41801	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000426033;ENST00000325239|ENST00000312002	T|.	0.56103|.	0.48|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.697753|0.697753	0.13018|0.13018	N|N	0.420315|0.420315	T|T	0.72128|0.72128	0.3422|0.3422	M|M	0.67953|0.67953	2.075|2.075	0.80722|0.80722	D|D	1|1	D|.	0.54397|.	0.966|.	P|.	0.48598|.	0.583|.	T|T	0.67538|0.67538	-0.5645|-0.5645	9|6	.|.	.|.	.|.	.|.	12.7211|12.7211	0.57142|0.57142	0.0:0.9229:0.0:0.0771|0.0:0.9229:0.0:0.0771	.|.	2076|.	Q6ZS81|.	WDFY4_HUMAN|.	A|R	2076|1166	ENSP00000320563:P2076A|.	.|.	P|P	+|+	1|2	0|0	WDFY4|WDFY4	49706833|49706833	0.998000|0.998000	0.40836|0.40836	0.997000|0.997000	0.53966|0.53966	0.822000|0.822000	0.46500|0.46500	2.714000|2.714000	0.47202|0.47202	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	CCA|CCC	WDFY4	-	NULL	ENSG00000128815		0.353	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		41	0.00	0	C	XM_033379		50036827	50036827	+1	no_errors	ENST00000325239	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	1.000	G
WDR93	56964	genome.wustl.edu	37	15	90270408	90270408	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr15:90270408C>A	ENST00000268130.7	+	9	1002	c.901C>A	c.(901-903)Ctg>Atg	p.L301M	WDR93_ENST00000444934.2_Missense_Mutation_p.L18M|WDR93_ENST00000560294.1_Missense_Mutation_p.L301M	NM_020212.1	NP_064597.1	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	301					electron transport chain (GO:0022900)		oxidoreductase activity, acting on NAD(P)H (GO:0016651)			NS(1)|breast(3)|endometrium(2)|kidney(4)|large_intestine(5)|liver(2)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	33	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			CAAAAGCCCCCTGGAAGTCTT	0.478																																						dbGAP											0													53.0	53.0	53.0					15																	90270408		2200	4299	6499	-	-	-	SO:0001583	missense	0				CCDS32326.1, CCDS66862.1, CCDS73779.1	15q26.1	2012-11-02						"""WD repeat domain containing"""	26924	protein-coding gene	gene with protein product							Standard	NM_020212		Approved		uc002boj.3	Q6P2C0		ENST00000268130.7:c.901C>A	15.37:g.90270408C>A	ENSP00000268130:p.Leu301Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N7Y8|Q9NP89	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.L301M	ENST00000268130.7	37	c.901	CCDS32326.1	15	.	.	.	.	.	.	.	.	.	.	C	16.82	3.228939	0.58777	.	.	ENSG00000140527	ENST00000268130;ENST00000444934	T;T	0.52754	1.68;0.65	5.59	1.4	0.22301	WD40 repeat-like-containing domain (1);	0.203246	0.31554	N	0.007453	T	0.57344	0.2047	M	0.65975	2.015	0.25169	N	0.990291	D;D	0.76494	0.999;0.999	D;D	0.71656	0.952;0.974	T	0.44559	-0.9320	10	0.46703	T	0.11	-3.0285	4.7231	0.12927	0.0:0.5684:0.1578:0.2738	.	301;301	Q6P2C0-2;Q6P2C0	.;WDR93_HUMAN	M	301;18	ENSP00000268130:L301M;ENSP00000403871:L18M	ENSP00000268130:L301M	L	+	1	2	WDR93	88071412	0.105000	0.21958	0.997000	0.53966	0.997000	0.91878	-0.107000	0.10873	0.297000	0.22615	0.563000	0.77884	CTG	WDR93	-	superfamily_WD40_repeat_dom	ENSG00000140527		0.478	WDR93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR93	HGNC	protein_coding	OTTHUMT00000416369.1	39	0.00	0	C	NM_020212		90270408	90270408	+1	no_errors	ENST00000268130	ensembl	human	known	69_37n	missense	31	27.27	12	SNP	0.976	A
XCR1	2829	genome.wustl.edu	37	3	46063167	46063167	+	Silent	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr3:46063167G>A	ENST00000309285.3	-	2	629	c.273C>T	c.(271-273)taC>taT	p.Y91Y	XCR1_ENST00000542109.1_Silent_p.Y91Y	NM_001024644.1	NP_001019815.1	P46094	XCR1_HUMAN	chemokine (C motif) receptor 1	91					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol (GO:0051209)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		AGCCCCAGTGGTATGGGGAGA	0.532																																						dbGAP											0													97.0	105.0	102.0					3																	46063167		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2736.1	3p21.3-p21.1	2012-11-19	2006-01-13	2002-08-23	ENSG00000173578	ENSG00000173578		"""GPCR / Class A : Chemokine receptors : X-C motif"""	1625	protein-coding gene	gene with protein product		600552	"""chemokine (C motif) XC receptor 1"""	GPR5, CCXCR1		7832990, 10400311	Standard	NM_005283		Approved		uc003cpf.3	P46094	OTTHUMG00000133449	ENST00000309285.3:c.273C>T	3.37:g.46063167G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_lymphotactin_XCR1,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Brdyknn_rcpt	p.Y91	ENST00000309285.3	37	c.273	CCDS2736.1	3																																																																																			XCR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000173578		0.532	XCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XCR1	HGNC	protein_coding	OTTHUMT00000257322.2	113	0.00	0	G			46063167	46063167	-1	no_errors	ENST00000309285	ensembl	human	known	69_37n	silent	77	35.83	43	SNP	0.085	A
ZFP91	80829	genome.wustl.edu	37	11	58384907	58384907	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr11:58384907G>A	ENST00000316059.6	+	11	1612	c.1441G>A	c.(1441-1443)Gag>Aag	p.E481K	ZFP91-CNTF_ENST00000389919.4_Missense_Mutation_p.E481K	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	481					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				CACTAACCCAGAGTCCCTGAC	0.547																																						dbGAP											0													67.0	62.0	64.0					11																	58384907		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.1441G>A	11.37:g.58384907G>A	ENSP00000339030:p.Glu481Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E481K	ENST00000316059.6	37	c.1441	CCDS31553.1	11	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354149	0.82243	.	.	ENSG00000186660	ENST00000316059;ENST00000389918	T	0.11169	2.8	6.16	6.16	0.99307	.	0.142948	0.49305	D	0.000149	T	0.18593	0.0446	L	0.29908	0.895	0.45427	D	0.998407	D;D	0.69078	0.974;0.997	D;D	0.73380	0.969;0.98	T	0.06023	-1.0850	10	0.13108	T	0.6	-20.0001	12.8889	0.58058	0.0746:0.0:0.9254:0.0	.	481;481	Q96JP5-2;Q96JP5	.;ZFP91_HUMAN	K	481	ENSP00000339030:E481K	ENSP00000374569:E481K	E	+	1	0	ZFP91	58141483	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.421000	0.59848	2.937000	0.99478	0.650000	0.86243	GAG	ZFP91	-	NULL	ENSG00000186660		0.547	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP91	HGNC	protein_coding	OTTHUMT00000268674.1	70	0.00	0	G	NM_053023		58384907	58384907	+1	no_errors	ENST00000316059	ensembl	human	known	69_37n	missense	44	10.00	5	SNP	1.000	A
ZNF624	57547	genome.wustl.edu	37	17	16526967	16526967	+	Missense_Mutation	SNP	A	A	T	rs147992031		TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr17:16526967A>T	ENST00000311331.7	-	6	1324	c.1233T>A	c.(1231-1233)aaT>aaA	p.N411K		NM_020787.3	NP_065838.2	Q9P2J8	ZN624_HUMAN	zinc finger protein 624	411					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	26				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		GTTTCTCACCATTGTGAGTTT	0.388																																					NSCLC(186;1023 2134 13330 38202 39800)	dbGAP											0													126.0	124.0	124.0					17																	16526967		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037770	CCDS11180.1	17p11.2	2013-01-08			ENSG00000197566	ENSG00000197566		"""Zinc fingers, C2H2-type"", ""-"""	29254	protein-coding gene	gene with protein product						10718198	Standard	NM_020787		Approved	KIAA1349	uc010cpi.2	Q9P2J8	OTTHUMG00000058996	ENST00000311331.7:c.1233T>A	17.37:g.16526967A>T	ENSP00000310472:p.Asn411Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY62|Q3SY63|Q6ZN27	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N411K	ENST00000311331.7	37	c.1233	CCDS11180.1	17	.	.	.	.	.	.	.	.	.	.	A	9.584	1.124366	0.20959	.	.	ENSG00000197566	ENST00000311331	T	0.16324	2.35	2.78	1.65	0.23941	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09291	0.0229	N	0.16602	0.42	0.27083	N	0.963037	B	0.06786	0.001	B	0.11329	0.006	T	0.29549	-1.0008	9	0.87932	D	0	.	2.5249	0.04689	0.6322:0.0:0.1354:0.2324	.	411	Q9P2J8	ZN624_HUMAN	K	411	ENSP00000310472:N411K	ENSP00000310472:N411K	N	-	3	2	ZNF624	16467692	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	-1.392000	0.02523	0.450000	0.26774	0.455000	0.32223	AAT	ZNF624	-	pfscan_Znf_C2H2	ENSG00000197566		0.388	ZNF624-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF624	HGNC	protein_coding	OTTHUMT00000130512.3	103	0.00	0	A	XM_047617		16526967	16526967	-1	no_errors	ENST00000311331	ensembl	human	known	69_37n	missense	122	14.08	20	SNP	0.995	T
ZNF726	730087	genome.wustl.edu	37	19	24116095	24116095	+	Frame_Shift_Del	DEL	G	G	-			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr19:24116095delG	ENST00000594466.1	+	4	1282	c.1177delG	c.(1177-1179)ggafs	p.G393fs	CTB-92J24.3_ENST00000596326.1_RNA|ZNF726_ENST00000575986.1_Intron|ZNF726_ENST00000322487.7_Frame_Shift_Del_p.G393fs|ZNF726_ENST00000334589.5_Intron	NM_001244038.1	NP_001230967.1	A6NNF4	ZN726_HUMAN	zinc finger protein 726	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GATTCACACTGGAGAGAAACC	0.368																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			DQ036016, BC046415	CCDS59372.1	19p12	2013-01-08			ENSG00000213967	ENSG00000213967		"""Zinc fingers, C2H2-type"", ""-"""	32462	protein-coding gene	gene with protein product							Standard	NM_001244038		Approved		uc021urw.1	A6NNF4	OTTHUMG00000167681	ENST00000594466.1:c.1177delG	19.37:g.24116095delG	ENSP00000471516:p.Gly393fs	Somatic		WXS	Illumina GAIIx	Phase_IV	M0R0X8|Q86Y87	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G393fs	ENST00000594466.1	37	c.1177	CCDS59372.1	19																																																																																			ZNF726	-	pfscan_Znf_C2H2	ENSG00000213967		0.368	ZNF726-005	PUTATIVE	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF726	HGNC	protein_coding	OTTHUMT00000466443.1	21	0.00	0	G	XM_001715134		24116095	24116095	+1	no_errors	ENST00000322487	ensembl	human	known	69_37n	frame_shift_del	14	33.33	7	DEL	1.000	-
ZNF790	388536	genome.wustl.edu	37	19	37309690	37309690	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JD-01A-11D-A13L-09	TCGA-D8-A1JD-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7df92725-fa63-494d-af9d-65c6ed76e023	c27dea12-3973-44a8-b150-da7a22ff80e3	g.chr19:37309690G>A	ENST00000356725.4	-	5	1676	c.1556C>T	c.(1555-1557)tCa>tTa	p.S519L	CTD-2162K18.5_ENST00000588906.1_RNA|CTD-2162K18.5_ENST00000587278.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	519					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AGTAAGTTGTGAACCCCAGAG	0.408																																						dbGAP											0													121.0	114.0	116.0					19																	37309690		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.1556C>T	19.37:g.37309690G>A	ENSP00000349161:p.Ser519Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S519L	ENST00000356725.4	37	c.1556	CCDS12496.1	19	.	.	.	.	.	.	.	.	.	.	G	13.52	2.261859	0.39995	.	.	ENSG00000197863	ENST00000356725	T	0.07908	3.15	2.82	2.82	0.32997	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14442	0.0349	M	0.74258	2.255	0.09310	N	1	P	0.47409	0.895	P	0.44394	0.448	T	0.08700	-1.0709	9	0.51188	T	0.08	.	10.9131	0.47120	0.0:0.0:1.0:0.0	.	519	Q6PG37	ZN790_HUMAN	L	519	ENSP00000349161:S519L	ENSP00000349161:S519L	S	-	2	0	ZNF790	42001530	0.000000	0.05858	0.192000	0.23308	0.990000	0.78478	0.239000	0.18023	1.583000	0.49898	0.491000	0.48974	TCA	ZNF790	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197863		0.408	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF790	HGNC	protein_coding	OTTHUMT00000385341.2	88	0.00	0	G	NM_206894		37309690	37309690	-1	no_errors	ENST00000356725	ensembl	human	known	69_37n	missense	76	10.59	9	SNP	0.024	A
