#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABLIM1	3983	genome.wustl.edu	37	10	116233707	116233707	+	Silent	SNP	C	C	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr10:116233707C>T	ENST00000277895.5	-	9	1147	c.1050G>A	c.(1048-1050)agG>agA	p.R350R	ABLIM1_ENST00000369253.2_Intron|ABLIM1_ENST00000369252.4_Silent_p.R290R|ABLIM1_ENST00000392952.3_Silent_p.R62R|ABLIM1_ENST00000369266.3_Silent_p.R62R|ABLIM1_ENST00000533213.2_Silent_p.R290R	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	350					axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		CCGAGGATGTCCTGGTAGGCT	0.433																																						dbGAP											0													87.0	86.0	86.0					10																	116233707		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.1050G>A	10.37:g.116233707C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Znf_LIM,smart_Villin_headpiece,pfscan_Villin_headpiece,pfscan_Znf_LIM	p.G259E	ENST00000277895.5	37	c.776	CCDS7590.1	10	.	.	.	.	.	.	.	.	.	.	C	10.09	1.254729	0.22965	.	.	ENSG00000099204	ENST00000392955	.	.	.	5.01	3.13	0.36017	.	.	.	.	.	T	0.55986	0.1955	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51624	-0.8682	4	.	.	.	.	7.2347	0.26064	0.0:0.6996:0.0:0.3004	.	.	.	.	E	259	.	.	G	-	2	0	ABLIM1	116223697	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.477000	0.45180	1.239000	0.43787	0.655000	0.94253	GGA	ABLIM1	-	NULL	ENSG00000099204		0.433	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABLIM1	HGNC	protein_coding	OTTHUMT00000050469.3	112	0.00	0	C			116233707	116233707	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000392955	ensembl	human	known	69_37n	missense	53	15.87	10	SNP	1.000	T
ADAMTSL3	57188	genome.wustl.edu	37	15	84651456	84651456	+	Silent	SNP	T	T	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr15:84651456T>C	ENST00000286744.5	+	21	3300	c.3076T>C	c.(3076-3078)Ttg>Ctg	p.L1026L	ADAMTSL3_ENST00000567476.1_Silent_p.L1026L	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1026						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGCCAATAGTTTGGGAGTCAC	0.488																																						dbGAP											0													81.0	80.0	80.0					15																	84651456		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.3076T>C	15.37:g.84651456T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A566|A1A567|Q9ULI7	Silent	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like,prints_Peptidase_M12B_ADAM-TS	p.L1026	ENST00000286744.5	37	c.3076	CCDS10326.1	15																																																																																			ADAMTSL3	-	NULL	ENSG00000156218		0.488	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	HGNC	protein_coding	OTTHUMT00000304007.2	75	0.00	0	T	NM_207517		84651456	84651456	+1	no_errors	ENST00000286744	ensembl	human	known	69_37n	silent	50	15.25	9	SNP	0.209	C
ANGEL1	23357	genome.wustl.edu	37	14	77274333	77274333	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr14:77274333G>C	ENST00000251089.2	-	3	920	c.808C>G	c.(808-810)Cca>Gca	p.P270A	ANGEL1_ENST00000554941.1_5'Flank	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	270										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		AGGATGTCTGGATGGCAATGT	0.507																																						dbGAP											0													117.0	101.0	107.0					14																	77274333		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.808C>G	14.37:g.77274333G>C	ENSP00000251089:p.Pro270Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWL7|O94859|Q8NCS9	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.P270A	ENST00000251089.2	37	c.808	CCDS9852.1	14	.	.	.	.	.	.	.	.	.	.	G	14.58	2.576608	0.45902	.	.	ENSG00000013523	ENST00000251089	T	0.25085	1.82	5.43	5.43	0.79202	Endonuclease/exonuclease/phosphatase (2);	0.239274	0.41294	D	0.000902	T	0.33352	0.0860	L	0.50333	1.59	0.42385	D	0.992508	P	0.36647	0.563	P	0.45276	0.475	T	0.03630	-1.1018	10	0.36615	T	0.2	-4.4217	14.8078	0.69971	0.0:0.1437:0.8563:0.0	.	270	Q9UNK9	ANGE1_HUMAN	A	270	ENSP00000251089:P270A	ENSP00000251089:P270A	P	-	1	0	ANGEL1	76344086	1.000000	0.71417	0.943000	0.38184	0.941000	0.58515	6.418000	0.73341	2.560000	0.86352	0.561000	0.74099	CCA	ANGEL1	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	ENSG00000013523		0.507	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL1	HGNC	protein_coding	OTTHUMT00000413712.2	98	0.00	0	G	NM_015305		77274333	77274333	-1	no_errors	ENST00000251089	ensembl	human	known	69_37n	missense	41	29.31	17	SNP	0.359	C
ARFGEF1	10565	genome.wustl.edu	37	8	68123739	68123739	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr8:68123739T>C	ENST00000262215.3	-	34	5187	c.4798A>G	c.(4798-4800)Agc>Ggc	p.S1600G	ARFGEF1_ENST00000518230.1_Missense_Mutation_p.S438G|ARFGEF1_ENST00000520381.1_Missense_Mutation_p.S1054G	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1600					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TTAATTTTGCTGACTTCTTCA	0.323																																						dbGAP											0													50.0	51.0	51.0					8																	68123739		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.4798A>G	8.37:g.68123739T>C	ENSP00000262215:p.Ser1600Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	pfam_Sec7,pfam_DUF1981_SEC7_assoc,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.S1600G	ENST00000262215.3	37	c.4798	CCDS6199.1	8	.	.	.	.	.	.	.	.	.	.	T	10.35	1.324700	0.24080	.	.	ENSG00000066777	ENST00000520381;ENST00000262215;ENST00000518230	T;T;T	0.44482	0.92;0.92;0.92	5.29	1.6	0.23607	.	0.419215	0.27486	N	0.019148	T	0.27559	0.0677	L	0.36672	1.1	0.32154	N	0.583894	B;B;B	0.16396	0.0;0.017;0.004	B;B;B	0.18263	0.0;0.021;0.009	T	0.25222	-1.0138	10	0.18710	T	0.47	.	7.7385	0.28827	0.0:0.2443:0.0:0.7557	.	1600;1078;1054	Q9Y6D6;Q59FY5;E5RIF2	BIG1_HUMAN;.;.	G	1054;1600;438	ENSP00000428429:S1054G;ENSP00000262215:S1600G;ENSP00000430891:S438G	ENSP00000262215:S1600G	S	-	1	0	ARFGEF1	68286293	0.961000	0.32948	0.988000	0.46212	0.915000	0.54546	1.555000	0.36277	0.403000	0.25479	0.533000	0.62120	AGC	ARFGEF1	-	NULL	ENSG00000066777		0.323	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF1	HGNC	protein_coding	OTTHUMT00000379441.4	47	0.00	0	T	NM_006421		68123739	68123739	-1	no_errors	ENST00000262215	ensembl	human	known	69_37n	missense	64	11.11	8	SNP	0.765	C
ARHGAP15	55843	genome.wustl.edu	37	2	144314050	144314050	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr2:144314050C>A	ENST00000295095.6	+	11	1166	c.999C>A	c.(997-999)aaC>aaA	p.N333K	RP11-570L15.1_ENST00000553076.1_RNA|RP11-570L15.2_ENST00000546678.1_RNA	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	333	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		TTATTGTCAACCAAGGTAAGT	0.318																																						dbGAP											0													164.0	169.0	167.0					2																	144314050		2203	4297	6500	-	-	-	SO:0001583	missense	0			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.999C>A	2.37:g.144314050C>A	ENSP00000295095:p.Asn333Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.N333K	ENST00000295095.6	37	c.999	CCDS2184.1	2	.	.	.	.	.	.	.	.	.	.	C	11.65	1.702589	0.30232	.	.	ENSG00000075884	ENST00000295095	T	0.12672	2.66	5.08	4.07	0.47477	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.053938	0.64402	D	0.000001	T	0.35770	0.0943	M	0.89095	3.005	0.51767	D	0.999937	D	0.89917	1.0	D	0.81914	0.995	T	0.29579	-1.0007	10	0.87932	D	0	.	3.3199	0.07047	0.0:0.6001:0.0:0.3998	.	333	Q53QZ3	RHG15_HUMAN	K	333	ENSP00000295095:N333K	ENSP00000295095:N333K	N	+	3	2	ARHGAP15	144030520	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.293000	0.43558	2.328000	0.79073	0.555000	0.69702	AAC	ARHGAP15	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000075884		0.318	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP15	HGNC	protein_coding	OTTHUMT00000254793.2	200	0.00	0	C	NM_018460		144314050	144314050	+1	no_errors	ENST00000295095	ensembl	human	known	69_37n	missense	94	17.54	20	SNP	1.000	A
ARHGAP24	83478	genome.wustl.edu	37	4	86844830	86844830	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr4:86844830C>T	ENST00000395184.1	+	4	764	c.298C>T	c.(298-300)Cat>Tat	p.H100Y	ARHGAP24_ENST00000395183.2_Missense_Mutation_p.H5Y|ARHGAP24_ENST00000503995.1_Missense_Mutation_p.H100Y	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	100	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		GACAGCAAATCATGAAAGCTA	0.498																																						dbGAP											0													99.0	90.0	93.0					4																	86844830		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.298C>T	4.37:g.86844830C>T	ENSP00000378611:p.His100Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.H100Y	ENST00000395184.1	37	c.298	CCDS34025.1	4	.	.	.	.	.	.	.	.	.	.	C	22.3	4.268645	0.80469	.	.	ENSG00000138639	ENST00000395184;ENST00000503995;ENST00000512201;ENST00000395183;ENST00000514229	T;T;T;T;T	0.17370	2.56;2.45;2.28;2.28;2.28	6.03	6.03	0.97812	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.095769	0.64402	D	0.000001	T	0.29684	0.0741	M	0.71581	2.175	0.80722	D	1	B;B;B	0.31227	0.245;0.007;0.314	B;B;B	0.36335	0.222;0.026;0.073	T	0.02150	-1.1205	10	0.54805	T	0.06	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	5;100;100	Q8N264-3;Q8N264;Q8N264-4	.;RHG24_HUMAN;.	Y	100;100;5;5;15	ENSP00000378611:H100Y;ENSP00000423206:H100Y;ENSP00000426105:H5Y;ENSP00000378610:H5Y;ENSP00000425589:H15Y	ENSP00000378610:H5Y	H	+	1	0	ARHGAP24	87063854	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.056000	0.71111	2.854000	0.98071	0.655000	0.94253	CAT	ARHGAP24	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000138639		0.498	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP24	HGNC	protein_coding	OTTHUMT00000252815.2	64	0.00	0	C	NM_031305		86844830	86844830	+1	no_errors	ENST00000395184	ensembl	human	known	69_37n	missense	34	29.17	14	SNP	1.000	T
ARHGEF35	445328	genome.wustl.edu	37	7	143884086	143884086	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr7:143884086G>T	ENST00000378115.2	-	2	1520	c.1391C>A	c.(1390-1392)tCt>tAt	p.S464Y	ARHGEF35_ENST00000543357.1_Missense_Mutation_p.S464Y	NM_001003702.2	NP_001003702.2	A5YM69	ARG35_HUMAN	Rho guanine nucleotide exchange factor (GEF) 35	464										kidney(1)|large_intestine(1)|lung(3)|stomach(1)	6						GCCCAGTAGAGAAATGGGCTG	0.488																																						dbGAP											0													25.0	25.0	25.0					7																	143884086		2130	4139	6269	-	-	-	SO:0001583	missense	0			AK125680	CCDS34770.1	7q35	2012-07-24	2010-04-13	2010-04-13	ENSG00000213214	ENSG00000213214		"""Rho guanine nucleotide exchange factors"""	33846	protein-coding gene	gene with protein product			"""Rho guanine nucleotide exchange factor (GEF) 5-like"""	ARHGEF5L			Standard	NM_001003702		Approved	FLJ43692, CTAGE4	uc003wdz.2	A5YM69	OTTHUMG00000158010	ENST00000378115.2:c.1391C>A	7.37:g.143884086G>T	ENSP00000367355:p.Ser464Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZUI2	Missense_Mutation	SNP	NULL	p.S464Y	ENST00000378115.2	37	c.1391	CCDS34770.1	7	.	.	.	.	.	.	.	.	.	.	.	9.016	0.983601	0.18889	.	.	ENSG00000213214	ENST00000378115;ENST00000543357	.	.	.	2.45	2.45	0.29901	.	.	.	.	.	T	0.48572	0.1507	L	0.32530	0.975	0.09310	N	1	D	0.89917	1.0	D	0.68621	0.959	T	0.23261	-1.0193	8	0.72032	D	0.01	.	8.4364	0.32789	0.0:0.0:1.0:0.0	.	464	A5YM69	ARG35_HUMAN	Y	464	.	ENSP00000367355:S464Y	S	-	2	0	ARHGEF35	143515019	0.203000	0.23435	0.010000	0.14722	0.170000	0.22686	1.819000	0.39022	1.374000	0.46228	0.184000	0.17185	TCT	ARHGEF35	-	NULL	ENSG00000213214		0.488	ARHGEF35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF35	HGNC	protein_coding	OTTHUMT00000349997.1	48	0.00	0	G	NM_001003702		143884086	143884086	-1	no_errors	ENST00000378115	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	0.010	T
AXDND1	126859	genome.wustl.edu	37	1	179335674	179335674	+	Silent	SNP	G	G	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:179335674G>T	ENST00000367618.3	+	2	417	c.30G>T	c.(28-30)ccG>ccT	p.P10P	AXDND1_ENST00000461179.2_Intron|AXDND1_ENST00000457238.2_Silent_p.P10P|RN7SL374P_ENST00000577343.1_RNA	NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	10										NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						CCTCCACCCCGCTAAACTCTA	0.398																																						dbGAP											0													88.0	85.0	86.0					1																	179335674		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.30G>T	1.37:g.179335674G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AWB2|Q96LJ3|Q96M01	Silent	SNP	pfam_Axonemal_dynein_light_chain	p.P10	ENST00000367618.3	37	c.30	CCDS30948.1	1																																																																																			AXDND1	-	NULL	ENSG00000162779		0.398	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	AXDND1	HGNC	protein_coding	OTTHUMT00000085312.1	83	0.00	0	G	NM_144696		179335674	179335674	+1	no_errors	ENST00000367618	ensembl	human	known	69_37n	silent	76	14.61	13	SNP	0.000	T
BCL11B	64919	genome.wustl.edu	37	14	99640525	99640525	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr14:99640525G>T	ENST00000357195.3	-	4	2657	c.2648C>A	c.(2647-2649)aCt>aAt	p.T883N	BCL11B_ENST00000345514.2_Missense_Mutation_p.T812N|BCL11B_ENST00000443726.2_Missense_Mutation_p.T689N	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	883					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		GACGTCGTTAGTCAGCAAGTG	0.602			T	TLX3	T-ALL																																	dbGAP		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	0													91.0	75.0	81.0					14																	99640525		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.2648C>A	14.37:g.99640525G>T	ENSP00000349723:p.Thr883Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H162	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T883N	ENST00000357195.3	37	c.2648	CCDS9950.1	14	.	.	.	.	.	.	.	.	.	.	G	15.95	2.985258	0.53934	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.11385	2.78;2.79;2.8	4.87	4.87	0.63330	.	0.164890	0.37136	N	0.002237	T	0.10208	0.0250	L	0.35644	1.08	0.58432	D	0.99999	B;B	0.29766	0.256;0.063	B;B	0.24006	0.039;0.05	T	0.18999	-1.0319	10	0.21014	T	0.42	-4.9354	17.9895	0.89164	0.0:0.0:1.0:0.0	.	812;883	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	N	883;812;689	ENSP00000349723:T883N;ENSP00000280435:T812N;ENSP00000387419:T689N	ENSP00000280435:T812N	T	-	2	0	BCL11B	98710278	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.986000	0.93492	2.266000	0.75297	0.313000	0.20887	ACT	BCL11B	-	NULL	ENSG00000127152		0.602	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL11B	HGNC	protein_coding	OTTHUMT00000072332.2	72	0.00	0	G	NM_138576		99640525	99640525	-1	no_errors	ENST00000357195	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	1.000	T
BIRC6	57448	genome.wustl.edu	37	2	32743984	32743984	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr2:32743984C>T	ENST00000421745.2	+	57	11728	c.11594C>T	c.(11593-11595)aCa>aTa	p.T3865I		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	3865					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GTCTCAACAACATTATCAGAT	0.363																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											0													86.0	79.0	81.0					2																	32743984		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.11594C>T	2.37:g.32743984C>T	ENSP00000393596:p.Thr3865Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.T3865I	ENST00000421745.2	37	c.11594	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581296	0.86748	.	.	ENSG00000115760	ENST00000421745	T	0.80304	-1.36	5.44	5.44	0.79542	.	0.115461	0.56097	D	0.000021	T	0.73729	0.3624	L	0.32530	0.975	0.80722	D	1	P	0.48911	0.917	B	0.38803	0.282	T	0.79037	-0.1967	10	0.87932	D	0	.	19.2669	0.93990	0.0:1.0:0.0:0.0	.	3865	Q9NR09	BIRC6_HUMAN	I	3865	ENSP00000393596:T3865I	ENSP00000393596:T3865I	T	+	2	0	BIRC6	32597488	1.000000	0.71417	0.968000	0.41197	0.997000	0.91878	5.731000	0.68554	2.537000	0.85549	0.655000	0.94253	ACA	BIRC6	-	NULL	ENSG00000115760		0.363	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	135	0.00	0	C	NM_016252		32743984	32743984	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	missense	83	15.31	15	SNP	0.998	T
C11orf88	399949	genome.wustl.edu	37	11	111385611	111385611	+	Silent	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr11:111385611C>G	ENST00000375618.4	+	1	102	c.102C>G	c.(100-102)gcC>gcG	p.A34A	C11orf88_ENST00000529167.1_Silent_p.A34A|C11orf88_ENST00000332814.6_Silent_p.A34A|BTG4_ENST00000356018.2_5'Flank|BTG4_ENST00000525791.1_5'Flank|RP11-794P6.6_ENST00000530283.1_RNA|MIR34C_ENST00000384831.1_RNA|MIR34B_ENST00000385076.1_RNA	NM_001100388.1	NP_001093858.1	Q6PI97	CK088_HUMAN	chromosome 11 open reading frame 88	34										endometrium(1)|large_intestine(3)|lung(2)	6						AACAAGATGCCAACTTGGCTA	0.587											OREG0021329	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													65.0	71.0	69.0					11																	111385611		2020	4211	6231	-	-	-	SO:0001819	synonymous_variant	0			BC039505, AK128145	CCDS41712.1, CCDS41713.1	11q23.1	2012-08-10			ENSG00000183644	ENSG00000183644			25061	protein-coding gene	gene with protein product	"""hypothetical gene supported by BC039505"""					12477932	Standard	NM_001100388		Approved	FLJ46266	uc009yyd.3	Q6PI97	OTTHUMG00000166720	ENST00000375618.4:c.102C>G	11.37:g.111385611C>G		Somatic	1434	WXS	Illumina GAIIx	Phase_IV	E9PAN0|Q6ZRL3	Silent	SNP	NULL	p.A34	ENST00000375618.4	37	c.102	CCDS41713.1	11																																																																																			C11orf88	-	NULL	ENSG00000183644		0.587	C11orf88-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf88	HGNC	protein_coding	OTTHUMT00000391181.1	39	0.00	0	C	NM_001100388		111385611	111385611	+1	no_errors	ENST00000529167	ensembl	human	known	69_37n	silent	40	13.04	6	SNP	0.000	G
ERICH3	127254	genome.wustl.edu	37	1	75037347	75037347	+	Silent	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:75037347C>A	ENST00000326665.5	-	14	4265	c.4047G>T	c.(4045-4047)acG>acT	p.T1349T	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1349	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CTGTTTCTGCCGTTTCACCAC	0.532																																						dbGAP											0													178.0	177.0	177.0					1																	75037347		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000326665.5:c.4047G>T	1.37:g.75037347C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	NULL	p.T1349	ENST00000326665.5	37	c.4047	CCDS30755.1	1																																																																																			C1orf173	-	NULL	ENSG00000178965		0.532	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	148	0.00	0	C			75037347	75037347	-1	no_errors	ENST00000326665	ensembl	human	known	69_37n	silent	108	32.50	52	SNP	0.000	A
CCRL2	9034	genome.wustl.edu	37	3	46450435	46450435	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr3:46450435G>A	ENST00000399036.3	+	2	1217	c.865G>A	c.(865-867)Gcc>Acc	p.A289T	RP11-24F11.2_ENST00000451485.1_RNA|CCRL2_ENST00000400882.2_Missense_Mutation_p.A289T|CCRL2_ENST00000400880.3_Missense_Mutation_p.A289T|CCRL2_ENST00000357392.4_Missense_Mutation_p.A301T	NM_003965.4	NP_003956.2	O00421	CCRL2_HUMAN	chemokine (C-C motif) receptor-like 2	289					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	CCR chemokine receptor binding (GO:0048020)|chemokine receptor activity (GO:0004950)|chemokine receptor binding (GO:0042379)			lung(3)|ovary(1)|urinary_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)		TAAACTCATCGCCACCACCCA	0.468																																						dbGAP											0													230.0	238.0	235.0					3																	46450435		2188	4279	6467	-	-	-	SO:0001583	missense	0			AF014958	CCDS43079.1, CCDS46814.1	3p21	2013-07-18	2013-07-18	2013-07-18	ENSG00000121797	ENSG00000121797		"""GPCR / Class A : Chemokine receptors : Atypical"""	1612	protein-coding gene	gene with protein product	"""atypical chemokine receptor 5"""	608379				9473515	Standard	NM_001130910		Approved	HCR, CRAM-B, CKRX, CRAM-A, ACKR5	uc003cpp.4	O00421	OTTHUMG00000156318	ENST00000399036.3:c.865G>A	3.37:g.46450435G>A	ENSP00000381994:p.Ala289Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKQ8|O75307|Q4VBB0|Q6IPX0|Q7KYQ9|Q96KP5|Q9UPG0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt	p.A301T	ENST00000399036.3	37	c.901	CCDS43079.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.391448	0.95988	.	.	ENSG00000121797	ENST00000399036;ENST00000357392;ENST00000400880;ENST00000400882	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	5.38	5.38	0.77491	GPCR, rhodopsin-like superfamily (1);	0.092366	0.44902	D	0.000401	T	0.69655	0.3135	M	0.86740	2.835	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.83275	0.993;0.996	T	0.74581	-0.3618	10	0.59425	D	0.04	.	16.6251	0.84968	0.0:0.0:1.0:0.0	.	301;289	O00421-2;O00421	.;CCRL2_HUMAN	T	289;301;289;289	ENSP00000381994:A289T;ENSP00000349967:A301T;ENSP00000383677:A289T;ENSP00000383678:A289T	ENSP00000349967:A301T	A	+	1	0	CCRL2	46425439	0.982000	0.34865	0.118000	0.21660	0.340000	0.28889	4.103000	0.57783	2.525000	0.85131	0.484000	0.47621	GCC	CCRL2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt	ENSG00000121797		0.468	CCRL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCRL2	HGNC	protein_coding	OTTHUMT00000343909.2	98	0.00	0	G			46450435	46450435	+1	no_errors	ENST00000357392	ensembl	human	known	69_37n	missense	85	36.03	49	SNP	0.912	A
CCDC50	152137	genome.wustl.edu	37	3	191093233	191093233	+	Intron	SNP	C	C	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr3:191093233C>T	ENST00000392455.3	+	6	1046				CCDC50_ENST00000392456.3_Silent_p.P277P	NM_174908.3	NP_777568.1	Q8IVM0	CCD50_HUMAN	coiled-coil domain containing 50							cytoplasm (GO:0005737)	ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|stomach(1)	23	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)		GACTTTCACCCAAGTCCTCAC	0.478																																						dbGAP											0													91.0	85.0	87.0					3																	191093233		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AJ416916	CCDS33912.1, CCDS33913.1	3q28	2010-12-24		2005-12-23	ENSG00000152492	ENSG00000152492			18111	protein-coding gene	gene with protein product		611051	"""deafness, autosomal dominant 44"""	C3orf6, DFNA44		16803894, 17503326	Standard	NM_178335		Approved	Ymer	uc003fsv.3	Q8IVM0	OTTHUMG00000156177	ENST00000392455.3:c.449-4715C>T	3.37:g.191093233C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VH7	Silent	SNP	NULL	p.P277	ENST00000392455.3	37	c.831	CCDS33913.1	3																																																																																			CCDC50	-	NULL	ENSG00000152492		0.478	CCDC50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC50	HGNC	protein_coding	OTTHUMT00000343315.1	111	0.00	0	C	NM_174908		191093233	191093233	+1	no_errors	ENST00000392456	ensembl	human	known	69_37n	silent	87	12.12	12	SNP	0.890	T
CDC20	991	genome.wustl.edu	37	1	43828729	43828729	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:43828729C>G	ENST00000372462.1	+	10	1632	c.1429C>G	c.(1429-1431)Cct>Gct	p.P477A	ELOVL1_ENST00000470769.1_5'Flank|CDC20_ENST00000310955.6_Missense_Mutation_p.P477A			Q12834	CDC20_HUMAN	cell division cycle 20	477					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle (GO:0007049)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of dendrite development (GO:0050773)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|spindle (GO:0005819)	enzyme binding (GO:0019899)|protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TGAGTTGGACCCTGCGCGGCG	0.602																																					Esophageal Squamous(137;1154 1759 10362 10401 46925)	dbGAP											0													82.0	88.0	86.0					1																	43828729		2203	4300	6503	-	-	-	SO:0001583	missense	0			U05340	CCDS484.1	1p34.1	2013-01-17	2013-01-17		ENSG00000117399	ENSG00000117399		"""WD repeat domain containing"""	1723	protein-coding gene	gene with protein product		603618	"""CDC20 (cell division cycle 20, S. cerevisiae, homolog)"", ""CDC20 cell division cycle 20 homolog (S. cerevisiae)"", ""cell division cycle 20 homolog (S. cerevisiae)"""			7513050, 9353311	Standard	NM_001255		Approved	p55CDC, CDC20A	uc001cix.3	Q12834	OTTHUMG00000007420	ENST00000372462.1:c.1429C>G	1.37:g.43828729C>G	ENSP00000361540:p.Pro477Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Z6|D3DPJ1|Q5JUY4|Q9BW56|Q9UQI9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P477A	ENST00000372462.1	37	c.1429	CCDS484.1	1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.037843	0.75617	.	.	ENSG00000117399	ENST00000437896;ENST00000310955;ENST00000372462	T;T	0.56941	0.43;0.43	5.62	4.7	0.59300	WD40-repeat-containing domain (1);	0.205018	0.52532	D	0.000073	T	0.60470	0.2271	N	0.22421	0.69	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.63853	-0.6543	10	0.48119	T	0.1	-6.6713	16.6968	0.85338	0.0:0.8705:0.1295:0.0	.	477	Q12834	CDC20_HUMAN	A	453;477;477	ENSP00000308450:P477A;ENSP00000361540:P477A	ENSP00000308450:P477A	P	+	1	0	CDC20	43601316	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	3.793000	0.55484	1.365000	0.46057	0.561000	0.74099	CCT	CDC20	-	pfscan_WD40_repeat_dom	ENSG00000117399		0.602	CDC20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDC20	HGNC	protein_coding	OTTHUMT00000019488.1	51	0.00	0	C	NM_001255		43828729	43828729	+1	no_errors	ENST00000310955	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	1.000	G
CDH7	1005	genome.wustl.edu	37	18	63476962	63476962	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr18:63476962G>C	ENST00000397968.2	+	3	659	c.233G>C	c.(232-234)gGa>gCa	p.G78A	CDH7_ENST00000323011.3_Missense_Mutation_p.G78A|CDH7_ENST00000536984.2_Missense_Mutation_p.G78A	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	78	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				GTTGATAAAGGAGATGGTTCC	0.373																																						dbGAP											0													88.0	85.0	86.0					18																	63476962		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.233G>C	18.37:g.63476962G>C	ENSP00000381058:p.Gly78Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H157	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G78A	ENST00000397968.2	37	c.233	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572443	0.86542	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.64618	-0.11;-0.11;-0.11	5.94	5.94	0.96194	Cadherin (4);Cadherin-like (1);	0.205840	0.43260	D	0.000592	D	0.83312	0.5227	M	0.87758	2.905	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.85130	0.961;0.997	D	0.84932	0.0860	10	0.87932	D	0	.	20.3771	0.98923	0.0:0.0:1.0:0.0	.	78;78	F5H5X9;Q9ULB5	.;CADH7_HUMAN	A	78	ENSP00000319166:G78A;ENSP00000443030:G78A;ENSP00000381058:G78A	ENSP00000319166:G78A	G	+	2	0	CDH7	61627942	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.542000	0.82095	2.824000	0.97209	0.650000	0.86243	GGA	CDH7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000081138		0.373	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2	90	0.00	0	G	NM_033646		63476962	63476962	+1	no_errors	ENST00000323011	ensembl	human	known	69_37n	missense	64	20.00	16	SNP	1.000	C
CDHR1	92211	genome.wustl.edu	37	10	85970822	85970822	+	Silent	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr10:85970822C>G	ENST00000372117.3	+	13	1489	c.1386C>G	c.(1384-1386)ctC>ctG	p.L462L	CDHR1_ENST00000440770.2_Intron|CDHR1_ENST00000332904.3_Silent_p.L462L	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	462	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						TGATCCAGCTCCTGGACACCA	0.567																																						dbGAP											0													134.0	129.0	131.0					10																	85970822		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.1386C>G	10.37:g.85970822C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YZ8|Q8IXY5	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L462	ENST00000372117.3	37	c.1386	CCDS7372.1	10																																																																																			CDHR1	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000148600		0.567	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR1	HGNC	protein_coding	OTTHUMT00000049111.1	55	0.00	0	C	NM_033100		85970822	85970822	+1	no_errors	ENST00000372117	ensembl	human	known	69_37n	silent	30	31.82	14	SNP	1.000	G
CDS1	1040	genome.wustl.edu	37	4	85538784	85538784	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr4:85538784A>T	ENST00000295887.5	+	4	833	c.410A>T	c.(409-411)tAt>tTt	p.Y137F		NM_001263.3	NP_001254.2	O96017	CHK2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	0	FHA. {ECO:0000255|PROSITE- ProRule:PRU00086}.		R -> Q (might influence susceptibility to breast cancer; does not cause protein abrogation in familial colorectal cancer). {ECO:0000269|PubMed:12454775, ECO:0000269|PubMed:15818573}.		cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|ovary(1)	20		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		TATCATTCTTATGATCTACCA	0.328																																						dbGAP											0													125.0	121.0	123.0					4																	85538784		2203	4295	6498	-	-	-	SO:0001583	missense	0			U65887	CCDS3608.1	4q21	2008-02-05			ENSG00000163624	ENSG00000163624	2.7.7.41		1800	protein-coding gene	gene with protein product		603548				9806839, 9115637	Standard	NM_001263		Approved		uc011ccv.2	Q92903	OTTHUMG00000130428	ENST00000295887.5:c.410A>T	4.37:g.85538784A>T	ENSP00000295887:p.Tyr137Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	pfam_PC_trans,pirsf_PC_Trfase_euk	p.Y137F	ENST00000295887.5	37	c.410	CCDS3608.1	4	.	.	.	.	.	.	.	.	.	.	A	17.12	3.307823	0.60305	.	.	ENSG00000163624	ENST00000295887	T	0.42513	0.97	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.55097	0.1899	L	0.39245	1.2	0.80722	D	1	D	0.67145	0.996	D	0.70487	0.969	T	0.53500	-0.8430	10	0.42905	T	0.14	-14.607	15.6755	0.77316	1.0:0.0:0.0:0.0	.	137	Q92903	CDS1_HUMAN	F	137	ENSP00000295887:Y137F	ENSP00000295887:Y137F	Y	+	2	0	CDS1	85757808	1.000000	0.71417	0.103000	0.21229	0.047000	0.14425	9.317000	0.96327	2.106000	0.64143	0.533000	0.62120	TAT	CDS1	-	pfam_PC_trans,pirsf_PC_Trfase_euk	ENSG00000163624		0.328	CDS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDS1	HGNC	protein_coding	OTTHUMT00000252817.2	157	0.00	0	A			85538784	85538784	+1	no_errors	ENST00000295887	ensembl	human	known	69_37n	missense	95	26.36	34	SNP	1.000	T
CENPE	1062	genome.wustl.edu	37	4	104061038	104061038	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr4:104061038C>G	ENST00000265148.3	-	38	6201	c.6112G>C	c.(6112-6114)Gct>Cct	p.A2038P	CENPE_ENST00000380026.3_Intron	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2038					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CTTTCTTTAGCTACAATTCTT	0.368																																						dbGAP											0													151.0	145.0	147.0					4																	104061038		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.6112G>C	4.37:g.104061038C>G	ENSP00000265148:p.Ala2038Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.A2038P	ENST00000265148.3	37	c.6112	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	C	17.26	3.345008	0.61073	.	.	ENSG00000138778	ENST00000265148;ENST00000394771	T	0.70869	-0.52	5.21	1.9	0.25705	.	.	.	.	.	T	0.70307	0.3209	L	0.50333	1.59	0.19300	N	0.999976	D	0.67145	0.996	P	0.56788	0.806	T	0.56691	-0.7937	9	0.32370	T	0.25	.	4.3606	0.11201	0.3791:0.4765:0.0:0.1444	.	2038	Q02224	CENPE_HUMAN	P	2038	ENSP00000265148:A2038P	ENSP00000265148:A2038P	A	-	1	0	CENPE	104280487	0.011000	0.17503	0.911000	0.35937	0.981000	0.71138	0.107000	0.15375	0.523000	0.28482	0.643000	0.83706	GCT	CENPE	-	NULL	ENSG00000138778		0.368	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		215	0.00	0	C			104061038	104061038	-1	no_errors	ENST00000265148	ensembl	human	known	69_37n	missense	146	22.75	43	SNP	0.555	G
CFH	3075	genome.wustl.edu	37	1	196643014	196643014	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:196643014C>A	ENST00000359637.2	+	3	334	c.272C>A	c.(271-273)aCt>aAt	p.T91N	CFH_ENST00000439155.2_Missense_Mutation_p.T91N|CFH_ENST00000367429.4_Missense_Mutation_p.T91N			P08603	CFAH_HUMAN	complement factor H	155	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						CCTGGAGATACTCCTTTTGGT	0.363																																						dbGAP											0													156.0	163.0	161.0					1																	196643014		2203	4299	6502	-	-	-	SO:0001583	missense	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.272C>A	1.37:g.196643014C>A	ENSP00000352658:p.Thr91Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.T91N	ENST00000359637.2	37	c.272		1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.767419	0.31320	.	.	ENSG00000000971	ENST00000367429;ENST00000439155;ENST00000391986;ENST00000359637	T;T;T	0.64803	-0.12;-0.12;-0.12	5.47	0.975	0.19721	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.74997	0.3790	M	0.80616	2.505	0.18873	N	0.999987	D;D;D;D	0.89917	0.998;1.0;0.999;0.998	D;D;D;D	0.74023	0.968;0.982;0.968;0.949	T	0.60835	-0.7184	9	0.62326	D	0.03	.	6.2064	0.20606	0.0:0.5105:0.0:0.4895	.	91;91;91;91	Q5TFM2;P08603-2;P08603;F8WDX4	.;.;CFAH_HUMAN;.	N	91	ENSP00000356399:T91N;ENSP00000402656:T91N;ENSP00000352658:T91N	ENSP00000352658:T91N	T	+	2	0	CFH	194909637	0.146000	0.22672	0.158000	0.22627	0.589000	0.36550	0.997000	0.29731	0.299000	0.22661	-0.150000	0.13652	ACT	CFH	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.363	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000087502.1	271	0.00	0	C	NM_000186		196643014	196643014	+1	no_errors	ENST00000367429	ensembl	human	known	69_37n	missense	156	20.00	39	SNP	0.123	A
CHD2	1106	genome.wustl.edu	37	15	93540500	93540500	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr15:93540500G>A	ENST00000394196.4	+	30	4820	c.3752G>A	c.(3751-3753)cGt>cAt	p.R1251H	CHD2_ENST00000557381.1_Missense_Mutation_p.R1251H	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1251					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TTAACCTGTCGTGTCAAAGCT	0.398																																						dbGAP											0													129.0	128.0	128.0					15																	93540500		2197	4298	6495	-	-	-	SO:0001583	missense	0			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.3752G>A	15.37:g.93540500G>A	ENSP00000377747:p.Arg1251His	Somatic		WXS	Illumina GAIIx	Phase_IV	C6G482|Q96IP5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R1251H	ENST00000394196.4	37	c.3752	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622830	0.46840	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	D;D	0.89617	-2.54;-2.54	5.1	4.18	0.49190	.	0.000000	0.34652	U	0.003792	T	0.80999	0.4732	L	0.31845	0.965	0.80722	D	1	B;B	0.32396	0.027;0.369	B;B	0.22880	0.007;0.042	T	0.77365	-0.2615	10	0.25751	T	0.34	-5.5679	13.5985	0.62004	0.0751:0.0:0.9249:0.0	.	1251;1251	O14647;O14647-2	CHD2_HUMAN;.	H	1251	ENSP00000377747:R1251H;ENSP00000451366:R1251H	ENSP00000377747:R1251H	R	+	2	0	CHD2	91341504	1.000000	0.71417	0.555000	0.28281	0.996000	0.88848	6.300000	0.72776	1.284000	0.44531	0.650000	0.86243	CGT	CHD2	-	superfamily_Homeodomain-like	ENSG00000173575		0.398	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3	198	0.00	0	G	NM_001271		93540500	93540500	+1	no_errors	ENST00000557381	ensembl	human	putative	69_37n	missense	92	14.02	15	SNP	0.999	A
CPED1	79974	genome.wustl.edu	37	7	120740066	120740066	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr7:120740066C>T	ENST00000310396.5	+	7	1303	c.836C>T	c.(835-837)aCg>aTg	p.T279M	CPED1_ENST00000423795.1_Missense_Mutation_p.T59M|CPED1_ENST00000450913.2_Missense_Mutation_p.T279M	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	279						endoplasmic reticulum (GO:0005783)											GTGTTGGTGACGTCCTTAACC	0.423																																						dbGAP											0													186.0	157.0	167.0					7																	120740066		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.836C>T	7.37:g.120740066C>T	ENSP00000309772:p.Thr279Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	NULL	p.T279M	ENST00000310396.5	37	c.836	CCDS34739.1	7	.	.	.	.	.	.	.	.	.	.	C	22.7	4.328151	0.81690	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913;ENST00000423795;ENST00000443817	T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94	5.58	5.58	0.84498	.	0.053580	0.64402	D	0.000001	T	0.66607	0.2806	M	0.77103	2.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.69950	-0.5006	10	0.87932	D	0	.	16.4822	0.84160	0.0:1.0:0.0:0.0	.	59;279;279	G5E9U2;A4D0V7-2;A4D0V7	.;.;CG058_HUMAN	M	279;279;279;59;59	ENSP00000309772:T279M;ENSP00000398082:T279M;ENSP00000406122:T279M;ENSP00000415573:T59M;ENSP00000391952:T59M	ENSP00000309772:T279M	T	+	2	0	C7orf58	120527302	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.585000	0.60977	2.641000	0.89580	0.585000	0.79938	ACG	CPED1	-	NULL	ENSG00000106034		0.423	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1	163	0.00	0	C	NM_024913		120740066	120740066	+1	no_errors	ENST00000310396	ensembl	human	known	69_37n	missense	165	17.09	34	SNP	1.000	T
CPVL	54504	genome.wustl.edu	37	7	29135737	29135737	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr7:29135737C>A	ENST00000409850.1	-	8	1031	c.385G>T	c.(385-387)Gtc>Ttc	p.V129F	CPVL_ENST00000396276.3_Missense_Mutation_p.V129F|CPVL_ENST00000265394.5_Missense_Mutation_p.V129F|CPVL_ENST00000488891.2_5'UTR			Q9H3G5	CPVL_HUMAN	carboxypeptidase, vitellogenic-like	129						extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)	28						TTACTTGTGACAACATAAGGC	0.448																																						dbGAP											0													184.0	173.0	177.0					7																	29135737		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF106704	CCDS5419.1	7p15.1	2012-02-10			ENSG00000106066	ENSG00000106066			14399	protein-coding gene	gene with protein product	"""carboxypeptidase WUG"", ""vitellogenic carboxypeptidase-like protein"", ""CP-Mac carboxypeptidase"""	609780				11401439	Standard	XM_005249786		Approved		uc003szw.3	Q9H3G5	OTTHUMG00000023669	ENST00000409850.1:c.385G>T	7.37:g.29135737C>A	ENSP00000387164:p.Val129Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1A4|Q6UX20|Q8NBL7|Q96AR7|Q9HB41	Missense_Mutation	SNP	pfam_Peptidase_S10,prints_Peptidase_S10	p.V129F	ENST00000409850.1	37	c.385	CCDS5419.1	7	.	.	.	.	.	.	.	.	.	.	C	14.30	2.494803	0.44352	.	.	ENSG00000106066	ENST00000265394;ENST00000396276;ENST00000409850;ENST00000542995;ENST00000448959;ENST00000458405;ENST00000447426	D;D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23;-2.23;-2.23	5.4	2.6	0.31112	.	0.131413	0.52532	D	0.000064	D	0.91529	0.7325	M	0.78916	2.43	0.49051	D	0.999748	D	0.67145	0.996	D	0.65773	0.938	D	0.90160	0.4227	10	0.72032	D	0.01	-2.9947	9.9295	0.41514	0.0:0.7841:0.0:0.2159	.	129	Q9H3G5	CPVL_HUMAN	F	129;129;129;13;59;13;59	ENSP00000265394:V129F;ENSP00000379572:V129F;ENSP00000387164:V129F;ENSP00000409036:V59F;ENSP00000417015:V13F;ENSP00000395690:V59F	ENSP00000265394:V129F	V	-	1	0	CPVL	29102262	1.000000	0.71417	0.478000	0.27316	0.856000	0.48823	2.587000	0.46128	0.248000	0.21435	-0.339000	0.08088	GTC	CPVL	-	pfam_Peptidase_S10	ENSG00000106066		0.448	CPVL-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPVL	HGNC	protein_coding	OTTHUMT00000328305.1	53	0.00	0	C	NM_019029		29135737	29135737	-1	no_errors	ENST00000265394	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	1.000	A
CPED1	79974	genome.wustl.edu	37	7	120935519	120935519	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr7:120935519A>T	ENST00000310396.5	+	23	3361	c.2894A>T	c.(2893-2895)gAa>gTa	p.E965V		NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	965						endoplasmic reticulum (GO:0005783)											TTATCCAAAGAATATAACTTT	0.313																																						dbGAP											0													39.0	38.0	38.0					7																	120935519		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2894A>T	7.37:g.120935519A>T	ENSP00000309772:p.Glu965Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	NULL	p.E965V	ENST00000310396.5	37	c.2894	CCDS34739.1	7	.	.	.	.	.	.	.	.	.	.	A	20.6	4.020520	0.75275	.	.	ENSG00000106034	ENST00000310396	T	0.20332	2.08	5.77	4.6	0.57074	.	0.361197	0.27932	N	0.017277	T	0.35335	0.0928	L	0.54323	1.7	0.80722	D	1	D	0.58970	0.984	P	0.56960	0.81	T	0.05354	-1.0890	10	0.56958	D	0.05	.	13.241	0.59997	0.8677:0.1323:0.0:0.0	.	965	A4D0V7	CG058_HUMAN	V	965	ENSP00000309772:E965V	ENSP00000309772:E965V	E	+	2	0	C7orf58	120722755	0.996000	0.38824	0.753000	0.31225	0.920000	0.55202	3.535000	0.53575	0.977000	0.38444	0.533000	0.62120	GAA	CPED1	-	NULL	ENSG00000106034		0.313	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1	87	0.00	0	A	NM_024913		120935519	120935519	+1	no_errors	ENST00000310396	ensembl	human	known	69_37n	missense	71	18.39	16	SNP	0.620	T
CR1	1378	genome.wustl.edu	37	1	207697077	207697077	+	Silent	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:207697077G>A	ENST00000367049.4	+	5	609	c.609G>A	c.(607-609)aaG>aaA	p.K203K	CR1_ENST00000367052.1_Silent_p.K203K|CR1_ENST00000400960.2_Silent_p.K203K|CR1_ENST00000367051.1_Intron|CR1_ENST00000367050.4_3'UTR|CR1_ENST00000367053.1_Silent_p.K203K	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	203	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GAGGGAGAAAGGTGTTTGAGC	0.517																																						dbGAP											0													24.0	21.0	22.0					1																	207697077		1774	4030	5804	-	-	-	SO:0001819	synonymous_variant	0			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.609G>A	1.37:g.207697077G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R179K	ENST00000367049.4	37	c.536	CCDS44308.1	1	.	.	.	.	.	.	.	.	.	.	G	1.947	-0.442081	0.04604	.	.	ENSG00000203710	ENST00000529814	.	.	.	3.07	1.09	0.20402	.	.	.	.	.	T	0.24005	0.0581	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23511	-1.0186	4	.	.	.	.	3.7841	0.08692	0.1362:0.0:0.6257:0.2381	.	.	.	.	K	179	.	.	R	+	2	0	CR1	205763700	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.148000	0.10219	0.152000	0.19188	-0.864000	0.03007	AGG	CR1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000203710		0.517	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	HGNC	protein_coding	OTTHUMT00000382527.1	105	0.00	0	G	NM_000573		207697077	207697077	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000529814	ensembl	human	novel	69_37n	missense	94	19.66	23	SNP	0.000	A
CSMD1	64478	genome.wustl.edu	37	8	3224613	3224613	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr8:3224613T>C	ENST00000520002.1	-	21	3614	c.3059A>G	c.(3058-3060)cAg>cGg	p.Q1020R	CSMD1_ENST00000602723.1_Missense_Mutation_p.Q1020R|CSMD1_ENST00000400186.3_Missense_Mutation_p.Q1020R|CSMD1_ENST00000602557.1_Missense_Mutation_p.Q1020R|CSMD1_ENST00000539096.1_Missense_Mutation_p.Q1019R|CSMD1_ENST00000542608.1_Missense_Mutation_p.Q1019R|CSMD1_ENST00000537824.1_Missense_Mutation_p.Q1019R			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1020	CUB 6. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AAACCGAAGCTGGGCAGTGAA	0.483																																						dbGAP											0													74.0	78.0	77.0					8																	3224613		1903	4117	6020	-	-	-	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3059A>G	8.37:g.3224613T>C	ENSP00000430733:p.Gln1020Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.Q1020R	ENST00000520002.1	37	c.3059		8	.	.	.	.	.	.	.	.	.	.	T	23.1	4.373973	0.82573	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7	5.09	5.09	0.68999	CUB (5);	0.000000	0.64402	D	0.000001	T	0.36413	0.0966	N	0.21194	0.64	0.58432	D	0.999999	D;D;P	0.89917	0.989;1.0;0.938	D;D;P	0.91635	0.985;0.999;0.837	T	0.12734	-1.0536	10	0.36615	T	0.2	.	14.8559	0.70338	0.0:0.0:0.0:1.0	.	1020;1020;1020	E5RIG2;Q96PZ7;Q96PZ7-4	.;CSMD1_HUMAN;.	R	1020;1020;882;1019;1019;1019	ENSP00000383047:Q1020R;ENSP00000430733:Q1020R;ENSP00000441462:Q1019R;ENSP00000446243:Q1019R;ENSP00000441675:Q1019R	ENSP00000320445:Q882R	Q	-	2	0	CSMD1	3212020	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	7.852000	0.86927	1.916000	0.55485	0.374000	0.22700	CAG	CSMD1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000183117		0.483	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	109	0.00	0	T	NM_033225		3224613	3224613	-1	no_errors	ENST00000520002	ensembl	human	known	69_37n	missense	76	20.83	20	SNP	1.000	C
DNAH3	55567	genome.wustl.edu	37	16	20970646	20970646	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr16:20970646T>C	ENST00000261383.3	-	54	10680	c.10681A>G	c.(10681-10683)Att>Gtt	p.I3561V	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3561	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTGGCAGCAATAGGGCCTTGG	0.532																																						dbGAP											0													155.0	143.0	147.0					16																	20970646		2201	4300	6501	-	-	-	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10681A>G	16.37:g.20970646T>C	ENSP00000261383:p.Ile3561Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.I3561V	ENST00000261383.3	37	c.10681	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	T	12.36	1.915169	0.33815	.	.	ENSG00000158486	ENST00000261383	T	0.08896	3.04	5.41	3.14	0.36123	Dynein heavy chain (1);	0.057066	0.64402	D	0.000003	T	0.05273	0.0140	L	0.35288	1.05	0.80722	D	1	P	0.37955	0.612	B	0.35470	0.203	T	0.50294	-0.8845	10	0.23302	T	0.38	.	3.8185	0.08825	0.268:0.1436:0.0:0.5884	.	3561	Q8TD57	DYH3_HUMAN	V	3561	ENSP00000261383:I3561V	ENSP00000261383:I3561V	I	-	1	0	DNAH3	20878147	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.434000	0.52841	0.339000	0.23719	-0.327000	0.08410	ATT	DNAH3	-	pfam_Dynein_heavy	ENSG00000158486		0.532	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	121	0.00	0	T	NM_017539		20970646	20970646	-1	no_errors	ENST00000261383	ensembl	human	known	69_37n	missense	84	25.00	28	SNP	0.994	C
DNAH5	1767	genome.wustl.edu	37	5	13735385	13735385	+	Silent	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr5:13735385G>A	ENST00000265104.4	-	68	11720	c.11616C>T	c.(11614-11616)atC>atT	p.I3872I		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3872					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCATGTGCTCGATGATATTAG	0.443									Kartagener syndrome																													dbGAP											0													102.0	88.0	93.0					5																	13735385		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.11616C>T	5.37:g.13735385G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.I3872	ENST00000265104.4	37	c.11616	CCDS3882.1	5																																																																																			DNAH5	-	NULL	ENSG00000039139		0.443	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	74	0.00	0	G	NM_001369		13735385	13735385	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	silent	77	12.50	11	SNP	0.001	A
DNAH7	56171	genome.wustl.edu	37	2	196723282	196723282	+	Silent	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr2:196723282G>A	ENST00000312428.6	-	43	8083	c.7983C>T	c.(7981-7983)atC>atT	p.I2661I		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2661	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						ACTCATCTTTGATGGCTTTGG	0.443																																						dbGAP											0													102.0	97.0	99.0					2																	196723282		1938	4153	6091	-	-	-	SO:0001819	synonymous_variant	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.7983C>T	2.37:g.196723282G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.I2661	ENST00000312428.6	37	c.7983	CCDS42794.1	2																																																																																			DNAH7	-	NULL	ENSG00000118997		0.443	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	136	0.00	0	G	NM_018897		196723282	196723282	-1	no_errors	ENST00000312428	ensembl	human	known	69_37n	silent	102	36.65	59	SNP	0.998	A
DYRK4	8798	genome.wustl.edu	37	12	4721739	4721739	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr12:4721739C>A	ENST00000540757.2	+	12	1336	c.1176C>A	c.(1174-1176)gaC>gaA	p.D392E	DYRK4_ENST00000543431.1_Missense_Mutation_p.D392E|DYRK4_ENST00000545342.1_Missense_Mutation_p.D29E|RP11-500M8.7_ENST00000536588.1_Intron|DYRK4_ENST00000010132.5_Missense_Mutation_p.D392E	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4	392	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			TGACCCCGGACCAGGCCCTCA	0.468																																						dbGAP											0													82.0	79.0	80.0					12																	4721739		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.1176C>A	12.37:g.4721739C>A	ENSP00000441755:p.Asp392Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8F7|Q8NEF2|Q92631	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D392E	ENST00000540757.2	37	c.1176	CCDS8530.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.430|9.430	1.085208|1.085208	0.20390|0.20390	.|.	.|.	ENSG00000010219|ENSG00000010219	ENST00000542744;ENST00000540757;ENST00000010132;ENST00000543431;ENST00000545342|ENST00000544671	T;T;T;T;T|.	0.72835|.	-0.02;-0.02;-0.02;-0.02;-0.69|.	5.81|5.81	-0.859|-0.859	0.10685|0.10685	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.197909|.	0.51477|.	N|.	0.000088|.	T|T	0.14787|0.14787	0.0357|0.0357	N|N	0.01668|0.01668	-0.77|-0.77	0.58432|0.58432	D|D	0.999999|0.999999	B;B;B;B|.	0.19817|.	0.005;0.039;0.002;0.001|.	B;B;B;B|.	0.27796|.	0.006;0.083;0.003;0.006|.	T|T	0.09335|0.09335	-1.0679|-1.0679	10|5	0.14656|.	T|.	0.56|.	.|.	4.1309|4.1309	0.10149|0.10149	0.1019:0.3122:0.3989:0.187|0.1019:0.3122:0.3989:0.187	.|.	507;106;392;392|.	F5H6L9;B4E1A4;Q9NR20-2;Q9NR20|.	.;.;.;DYRK4_HUMAN|.	E|T	507;392;392;392;29|54	ENSP00000437534:D507E;ENSP00000441755:D392E;ENSP00000010132:D392E;ENSP00000439697:D392E;ENSP00000446005:D29E|.	ENSP00000010132:D392E|.	D|P	+|+	3|1	2|0	DYRK4|DYRK4	4592000|4592000	0.846000|0.846000	0.29590|0.29590	0.994000|0.994000	0.49952|0.49952	0.991000|0.991000	0.79684|0.79684	-0.087000|-0.087000	0.11215|0.11215	-0.130000|-0.130000	0.11599|0.11599	-0.175000|-0.175000	0.13238|0.13238	GAC|CCA	DYRK4	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000010219		0.468	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYRK4	HGNC	protein_coding	OTTHUMT00000398780.2	60	0.00	0	C			4721739	4721739	+1	no_errors	ENST00000010132	ensembl	human	known	69_37n	missense	47	24.19	15	SNP	0.812	A
EIF2AK4	440275	genome.wustl.edu	37	15	40308734	40308734	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr15:40308734A>C	ENST00000263791.5	+	28	3834	c.3791A>C	c.(3790-3792)aAg>aCg	p.K1264T	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.K1236T	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	1264	Histidyl-tRNA synthetase-like.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		ATTGAACAGAAGGGAGATTTG	0.443																																						dbGAP											0													92.0	91.0	91.0					15																	40308734		1995	4189	6184	-	-	-	SO:0001583	missense	0			AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.3791A>C	15.37:g.40308734A>C	ENSP00000263791:p.Lys1264Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RWD-domain,superfamily_Kinase-like_dom,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Anticodon-bd,smart_RWD-domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_GCN2,pfscan_RWD-domain,pfscan_Prot_kinase_cat_dom	p.K1264T	ENST00000263791.5	37	c.3791	CCDS42016.1	15	.	.	.	.	.	.	.	.	.	.	A	22.1	4.238312	0.79800	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.43294	0.95;0.95	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.59018	0.2163	L	0.54323	1.7	0.52099	D	0.999941	D	0.89917	1.0	D	0.97110	1.0	T	0.53802	-0.8387	10	0.26408	T	0.33	-27.3322	15.9507	0.79835	1.0:0.0:0.0:0.0	.	1264	Q9P2K8	E2AK4_HUMAN	T	1264;1236	ENSP00000263791:K1264T;ENSP00000372174:K1236T	ENSP00000263791:K1264T	K	+	2	0	EIF2AK4	38096026	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.411000	0.80078	2.221000	0.72209	0.523000	0.50628	AAG	EIF2AK4	-	pirsf_Ser/Thr_kinase_GCN2	ENSG00000128829		0.443	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2AK4	HGNC	protein_coding	OTTHUMT00000418395.1	106	0.00	0	A			40308734	40308734	+1	no_errors	ENST00000263791	ensembl	human	known	69_37n	missense	76	15.56	14	SNP	1.000	C
PPY2P	23614	genome.wustl.edu	37	17	26574486	26574486	+	lincRNA	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr17:26574486G>A	ENST00000579045.1	-	0	546				PPY2_ENST00000583761.1_RNA																							GCCGCATGCCGCTGCCTCTCC	0.642																																						dbGAP											0																																										-	-	-			0																															17.37:g.26574486G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000579045.1	37	NULL		17																																																																																			CTD-2008P7.8	-	-	ENSG00000266830		0.642	CTD-2008P7.8-001	KNOWN	basic	lincRNA	ENSG00000266830	Clone_based_vega_gene	lincRNA	OTTHUMT00000446190.1	32	0.00	0	G			26574486	26574486	-1	no_errors	ENST00000579045	ensembl	human	known	69_37n	rna	27	22.86	8	SNP	0.226	A
KRT18P55	284085	genome.wustl.edu	37	17	26603520	26603520	+	RNA	SNP	G	G	A	rs532278870		TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr17:26603520G>A	ENST00000577198.1	-	0	1441				AC061975.8_ENST00000385109.1_RNA	NR_028334.1				keratin 18 pseudogene 55																		GGCAGACTGCGTGGTGACAAC	0.557													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21962	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0					17q11.2	2013-06-25			ENSG00000265480	ENSG00000265480			26874	pseudogene	pseudogene							Standard	NR_028334		Approved		uc002has.3		OTTHUMG00000179422		17.37:g.26603520G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000577198.1	37	NULL		17																																																																																			AC061975.8	-	-	ENSG00000207844		0.557	KRT18P55-002	KNOWN	basic	processed_transcript	ENSG00000207844	Clone_based_ensembl_gene	pseudogene	OTTHUMT00000446194.1	15	0.00	0	G	NR_028334		26603520	26603520	-1	no_errors	ENST00000385109	ensembl	human	known	69_37n	rna	11	26.67	4	SNP	0.425	A
FAM25A	643161	genome.wustl.edu	37	10	88784395	88784395	+	Silent	SNP	C	C	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr10:88784395C>T	ENST00000343959.4	+	3	253	c.234C>T	c.(232-234)acC>acT	p.T78T	RP11-96C23.14_ENST00000444180.3_RNA	NM_001146157.2	NP_001139629.1	B3EWG3	FM25A_HUMAN	family with sequence similarity 25, member A	78										stomach(1)	1						ATGCCATCACCCATGCAGCAG	0.488																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS44451.1	10q23.2	2008-08-13			ENSG00000188100	ENSG00000188100			23436	protein-coding gene	gene with protein product							Standard	NM_001146157		Approved	bA96C23.5	uc010qmo.2	B3EWG3	OTTHUMG00000018664	ENST00000343959.4:c.234C>T	10.37:g.88784395C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RV02|Q5VTM1	Silent	SNP	prints_FAM25	p.T78	ENST00000343959.4	37	c.234	CCDS44451.1	10	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975288	0.34848	.	.	ENSG00000188100	ENST00000343959	.	.	.	3.14	1.15	0.20763	.	.	.	.	.	T	0.51261	0.1664	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	T	0.38067	-0.9678	4	.	.	.	-3.1079	5.0509	0.14508	0.2689:0.5089:0.2223:0.0	.	.	.	.	S	85	.	.	P	+	1	0	FAM25A	88774375	0.728000	0.28080	0.755000	0.31263	0.961000	0.63080	-0.373000	0.07494	0.316000	0.23135	0.478000	0.44815	CCA	FAM25A	-	prints_FAM25	ENSG00000188100		0.488	FAM25A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM25A	HGNC	protein_coding	OTTHUMT00000049182.2	582	0.00	0	C			88784395	88784395	+1	no_errors	ENST00000343959	ensembl	human	known	69_37n	silent	412	41.64	294	SNP	0.846	T
FBXO10	26267	genome.wustl.edu	37	9	37521593	37521593	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr9:37521593C>G	ENST00000432825.2	-	8	2221	c.2173G>C	c.(2173-2175)Gag>Cag	p.E725Q	RP11-613M10.8_ENST00000544475.1_5'UTR|FBXO10_ENST00000543968.1_5'Flank|FBXO10_ENST00000541829.1_Missense_Mutation_p.E250Q	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	725					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		CTGTTAGACTCAACAAGAGCT	0.517																																						dbGAP											0													52.0	56.0	55.0					9																	37521593		1948	4144	6092	-	-	-	SO:0001583	missense	0			AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.2173G>C	9.37:g.37521593C>G	ENSP00000403802:p.Glu725Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_Pectin_lyase_fold/virulence,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_PbH1,smart_Carb-bd_sugar_hydrolysis-dom,pfscan_F-box_dom_cyclin-like,tigrfam_Para_beta_helix_rpt-2	p.E725Q	ENST00000432825.2	37	c.2173	CCDS47966.1	9	.	.	.	.	.	.	.	.	.	.	C	26.8	4.777017	0.90195	.	.	ENSG00000147912	ENST00000432825;ENST00000541829	T	0.48836	0.8	4.84	4.84	0.62591	Carbohydrate-binding/sugar hydrolysis domain (1);Pectin lyase fold (1);	0.054484	0.64402	D	0.000001	T	0.58047	0.2095	L	0.29908	0.895	0.80722	D	1	D;D;D	0.71674	0.998;0.985;0.986	D;P;P	0.78314	0.991;0.655;0.825	T	0.63010	-0.6732	10	0.72032	D	0.01	-14.1169	16.7219	0.85412	0.0:1.0:0.0:0.0	.	604;250;725	Q59F51;Q08AL4;Q9UK96	.;.;FBX10_HUMAN	Q	725;250	ENSP00000403802:E725Q	ENSP00000403802:E725Q	E	-	1	0	FBXO10	37511593	1.000000	0.71417	0.913000	0.36048	0.942000	0.58702	5.269000	0.65542	2.227000	0.72691	0.561000	0.74099	GAG	FBXO10	-	smart_Carb-bd_sugar_hydrolysis-dom,smart_PbH1	ENSG00000147912		0.517	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO10	HGNC	protein_coding	OTTHUMT00000052472.3	56	0.00	0	C			37521593	37521593	-1	no_errors	ENST00000432825	ensembl	human	known	69_37n	missense	7	58.82	10	SNP	1.000	G
FHAD1	114827	genome.wustl.edu	37	1	15687065	15687065	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:15687065A>C	ENST00000375998.4	+	20	2762	c.2762A>C	c.(2761-2763)gAg>gCg	p.E921A	FHAD1_ENST00000375999.3_Missense_Mutation_p.E921A|FHAD1_ENST00000417793.1_Missense_Mutation_p.E885A|FHAD1_ENST00000314740.8_Missense_Mutation_p.E174A|FHAD1_ENST00000358897.4_Missense_Mutation_p.E921A|FHAD1_ENST00000471347.1_3'UTR			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	921										skin(1)|stomach(1)	2						TTTGAAGAAGAGATCATGGAA	0.463																																						dbGAP											0													121.0	112.0	115.0					1																	15687065		692	1591	2283	-	-	-	SO:0001583	missense	0			AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.2762A>C	1.37:g.15687065A>C	ENSP00000365166:p.Glu921Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.E921A	ENST00000375998.4	37	c.2762		1	.	.	.	.	.	.	.	.	.	.	A	18.55	3.649087	0.67358	.	.	ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000529606;ENST00000314740;ENST00000314668	T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;2.25;2.25;2.25	5.35	5.35	0.76521	.	.	.	.	.	T	0.58177	0.2104	M	0.71581	2.175	0.09310	N	1	D;D;P	0.57257	0.971;0.979;0.952	P;P;P	0.57960	0.572;0.83;0.527	T	0.54430	-0.8295	9	0.66056	D	0.02	.	11.7335	0.51752	1.0:0.0:0.0:0.0	.	174;921;921	B7WPP2;B1AJZ9-3;B1AJZ9	.;.;FHAD1_HUMAN	A	921;885;921;921;192;174;156	ENSP00000351770:E921A;ENSP00000407615:E885A;ENSP00000365167:E921A;ENSP00000365166:E921A;ENSP00000434909:E192A;ENSP00000322979:E174A;ENSP00000318812:E156A	ENSP00000318812:E156A	E	+	2	0	FHAD1	15559652	0.997000	0.39634	0.016000	0.15963	0.005000	0.04900	5.293000	0.65680	2.034000	0.60081	0.460000	0.39030	GAG	FHAD1	-	NULL	ENSG00000142621		0.463	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	FHAD1	HGNC	protein_coding	OTTHUMT00000393400.2	97	0.00	0	A	NM_052929		15687065	15687065	+1	no_errors	ENST00000375999	ensembl	human	known	69_37n	missense	63	22.22	18	SNP	0.081	C
FLG	2312	genome.wustl.edu	37	1	152279767	152279767	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:152279767G>A	ENST00000368799.1	-	3	7630	c.7595C>T	c.(7594-7596)tCg>tTg	p.S2532L	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2532	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGGTGACGCGACCCTGAGTG	0.597									Ichthyosis																													dbGAP											0													272.0	280.0	277.0					1																	152279767		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7595C>T	1.37:g.152279767G>A	ENSP00000357789:p.Ser2532Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.S2532L	ENST00000368799.1	37	c.7595	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	10.21	1.286546	0.23478	.	.	ENSG00000143631	ENST00000368799	T	0.05925	3.37	2.09	1.12	0.20585	.	.	.	.	.	T	0.03651	0.0104	M	0.80028	2.48	0.09310	N	1	D	0.61080	0.989	P	0.45913	0.497	T	0.35001	-0.9806	9	0.24483	T	0.36	.	4.7065	0.12853	0.2019:0.0:0.7981:0.0	.	2532	P20930	FILA_HUMAN	L	2532	ENSP00000357789:S2532L	ENSP00000357789:S2532L	S	-	2	0	FLG	150546391	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.984000	0.29565	0.215000	0.20761	0.306000	0.20318	TCG	FLG	-	pfam_Filaggrin	ENSG00000143631		0.597	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	258	0.00	0	G	NM_002016		152279767	152279767	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	258	54.26	306	SNP	0.001	A
FRG1B	284802	genome.wustl.edu	37	20	29612353	29612353	+	Intron	SNP	C	C	T	rs28724289		TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr20:29612353C>T	ENST00000278882.3	+	1	257				FRG1B_ENST00000468180.2_Intron|FRG1B_ENST00000439954.2_Intron|FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGCCCCGTACCCACGAGTTTG	0.602																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-124+240C>T	20.37:g.29612353C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C4AME5	RNA	SNP	-	NULL	ENST00000278882.3	37	NULL		20																																																																																			FRG1B	-	-	ENSG00000149531		0.602	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	23	0.00	0	C	NR_003579		29612353	29612353	+1	no_errors	ENST00000482423	ensembl	human	known	69_37n	rna	13	23.53	4	SNP	0.005	T
FUT4	2526	genome.wustl.edu	37	11	94278568	94278568	+	Silent	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr11:94278568C>A	ENST00000358752.2	+	1	1552	c.1269C>A	c.(1267-1269)acC>acA	p.T423T	RP11-867G2.8_ENST00000536540.1_RNA|RP11-867G2.8_ENST00000537874.1_RNA	NM_002033.3	NP_002024.1	P22083	FUT4_HUMAN	fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)	423					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	cell periphery (GO:0071944)|cell surface (GO:0009986)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			central_nervous_system(2)|endometrium(2)|lung(1)|skin(2)|upper_aerodigestive_tract(1)	8		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ATTATATCACCGAGAAGCTCT	0.652																																						dbGAP											0													37.0	35.0	36.0					11																	94278568		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0				CCDS8301.1	11q21	2013-02-26			ENSG00000196371	ENSG00000196371		"""CD molecules"", ""Fucosyltransferases"""	4015	protein-coding gene	gene with protein product	"""ELAM ligand fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	104230		CD15, FCT3A, ELFT		1702034	Standard	NM_002033		Approved	FUC-TIV	uc001pez.3	P22083	OTTHUMG00000167795	ENST00000358752.2:c.1269C>A	11.37:g.94278568C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMS0	Silent	SNP	pfam_Glyco_trans_10	p.T423	ENST00000358752.2	37	c.1269	CCDS8301.1	11																																																																																			FUT4	-	pfam_Glyco_trans_10	ENSG00000196371		0.652	FUT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT4	HGNC	protein_coding	OTTHUMT00000396327.2	28	0.00	0	C	NM_002033		94278568	94278568	+1	no_errors	ENST00000358752	ensembl	human	known	69_37n	silent	13	45.83	11	SNP	0.004	A
GPR174	84636	genome.wustl.edu	37	X	78427212	78427212	+	Silent	SNP	A	A	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chrX:78427212A>G	ENST00000276077.1	+	1	744	c.708A>G	c.(706-708)gcA>gcG	p.A236A		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						TAACCTGTGCAGGGGTATTCC	0.408										HNSCC(63;0.18)																												dbGAP											0													100.0	94.0	96.0					X																	78427212		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.708A>G	X.37:g.78427212A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3F7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.A236	ENST00000276077.1	37	c.708	CCDS14443.1	X																																																																																			GPR174	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000147138		0.408	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR174	HGNC	protein_coding	OTTHUMT00000057327.1	104	0.00	0	A	NM_032553		78427212	78427212	+1	no_errors	ENST00000276077	ensembl	human	known	69_37n	silent	63	19.23	15	SNP	0.004	G
GRM8	2918	genome.wustl.edu	37	7	126079180	126079180	+	Nonsense_Mutation	SNP	G	G	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr7:126079180G>C	ENST00000339582.2	-	11	3528	c.2720C>G	c.(2719-2721)tCa>tGa	p.S907*	GRM8_ENST00000444921.2_Nonsense_Mutation_p.S907*|GRM8_ENST00000358373.3_3'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	907					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GTTTCAGATTGAATGATTGCT	0.338										HNSCC(24;0.065)																												dbGAP											0													204.0	204.0	204.0					7																	126079180		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.2720C>G	7.37:g.126079180G>C	ENSP00000344173:p.Ser907*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Nonsense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.S907*	ENST00000339582.2	37	c.2720	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	G	41	8.534396	0.98852	.	.	ENSG00000179603	ENST00000339582;ENST00000444921	.	.	.	4.89	4.89	0.63831	.	0.966682	0.08530	N	0.932140	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	17.029	0.86456	0.0:0.0:1.0:0.0	.	.	.	.	X	907	.	ENSP00000344173:S907X	S	-	2	0	GRM8	125866416	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.153000	0.94687	2.258000	0.74832	0.491000	0.48974	TCA	GRM8	-	prints_GPCR_3_mtglu_rcpt_4	ENSG00000179603		0.338	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	327	0.00	0	G			126079180	126079180	-1	no_errors	ENST00000339582	ensembl	human	known	69_37n	nonsense	267	15.51	49	SNP	1.000	C
HECW2	57520	genome.wustl.edu	37	2	197081766	197081766	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr2:197081766C>A	ENST00000260983.3	-	27	4642	c.4460G>T	c.(4459-4461)aGa>aTa	p.R1487I	snoU13_ENST00000459047.1_RNA|HECW2_ENST00000409111.1_Missense_Mutation_p.R1131I	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1487	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						ATTGTTGAATCTTTCCACTGC	0.328																																						dbGAP											0													186.0	173.0	178.0					2																	197081766		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.4460G>T	2.37:g.197081766C>A	ENSP00000260983:p.Arg1487Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.R1487I	ENST00000260983.3	37	c.4460	CCDS33354.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.342549	0.95783	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.45276	0.9;0.9	5.36	5.36	0.76844	HECT (4);	0.148919	0.64402	D	0.000010	T	0.60064	0.2240	L	0.47716	1.5	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.60551	-0.7241	10	0.72032	D	0.01	.	19.2924	0.94105	0.0:1.0:0.0:0.0	.	1487	Q9P2P5	HECW2_HUMAN	I	1131;1487	ENSP00000386775:R1131I;ENSP00000260983:R1487I	ENSP00000260983:R1487I	R	-	2	0	HECW2	196790011	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.320000	0.79064	2.783000	0.95769	0.655000	0.94253	AGA	HECW2	-	pfam_HECT,smart_HECT,pfscan_HECT	ENSG00000138411		0.328	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	HGNC	protein_coding	OTTHUMT00000335199.3	144	0.00	0	C	NM_020760		197081766	197081766	-1	no_errors	ENST00000260983	ensembl	human	known	69_37n	missense	99	40.36	67	SNP	1.000	A
HLA-C	3107	genome.wustl.edu	37	6	31239446	31239446	+	Silent	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr6:31239446G>A	ENST00000376228.5	-	2	287	c.273C>T	c.(271-273)taC>taT	p.Y91Y	HLA-C_ENST00000383329.3_Silent_p.Y91Y	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	91	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CCTGGCGCTTGTACTTCTGTG	0.697																																						dbGAP											0													48.0	48.0	48.0					6																	31239446		1511	2709	4220	-	-	-	SO:0001819	synonymous_variant	0			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.273C>T	6.37:g.31239446G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O02864|O02958|Q29643|Q9MY30	Nonsense_Mutation	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a_a1/a2	p.Q91*	ENST00000376228.5	37	c.271	CCDS34393.1	6	.	.	.	.	.	.	.	.	.	.	-	4.992	0.184265	0.09495	.	.	ENSG00000204525	ENST00000415537	.	.	.	2.75	2.75	0.32379	.	.	.	.	.	.	.	.	.	.	.	0.31869	N	0.619969	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.1283	0.36830	0.0:0.0:1.0:0.0	.	.	.	.	X	91	.	.	Q	-	1	0	HLA-C	31347425	0.000000	0.05858	0.023000	0.16930	0.001000	0.01503	-1.161000	0.03144	1.850000	0.53721	0.195000	0.17529	CAA	HLA-C	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a_a1/a2	ENSG00000204525		0.697	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-C	HGNC	protein_coding	OTTHUMT00000076281.3	96	0.00	0	G	NM_002117		31239446	31239446	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000415537	ensembl	human	novel	69_37n	nonsense	69	20.69	18	SNP	0.025	A
HOXA13	3209	genome.wustl.edu	37	7	27238809	27238809	+	Silent	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr7:27238809C>G	ENST00000222753.4	-	1	916	c.888G>C	c.(886-888)gcG>gcC	p.A296A	HOTTIP_ENST00000472494.1_RNA|HOTTIP_ENST00000605136.1_RNA|HOTTIP_ENST00000421733.1_RNA|HOTTIP_ENST00000521028.2_RNA	NM_000522.4	NP_000513.2	P31271	HXA13_HUMAN	homeobox A13	296					artery morphogenesis (GO:0048844)|branching involved in prostate gland morphogenesis (GO:0060442)|embryonic forelimb morphogenesis (GO:0035115)|endothelial cell fate specification (GO:0060847)|endothelial cell morphogenesis (GO:0001886)|inner ear development (GO:0048839)|male genitalia development (GO:0030539)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of BMP signaling pathway (GO:0030510)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|ventricular septum development (GO:0003281)	intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	6						GGGGAGGCTGCGCCTGCTCTT	0.627			T	NUP98	AML																																	dbGAP		Dom	yes		7	7p15-p14.2	3209	homeo box A13		L	0													57.0	58.0	57.0					7																	27238809		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5412.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106031	ENSG00000106031		"""Homeoboxes / ANTP class : HOXL subclass"""	5102	protein-coding gene	gene with protein product		142959	"""homeo box A13"""	HOX1J, HOX1		1973146, 1358459	Standard	NM_000522		Approved		uc003szb.1	P31271	OTTHUMG00000023438	ENST00000222753.4:c.888G>C	7.37:g.27238809C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D188|O43371	Silent	SNP	pfam_HoxA13_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Antifreeze_1	p.A296	ENST00000222753.4	37	c.888	CCDS5412.1	7																																																																																			HOXA13	-	superfamily_Homeodomain-like	ENSG00000106031		0.627	HOXA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA13	HGNC	protein_coding	OTTHUMT00000358752.3	70	0.00	0	C			27238809	27238809	-1	no_errors	ENST00000222753	ensembl	human	known	69_37n	silent	16	20.00	4	SNP	1.000	G
HYOU1	10525	genome.wustl.edu	37	11	118926221	118926221	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr11:118926221T>C	ENST00000404233.3	-	4	372	c.248A>G	c.(247-249)gAc>gGc	p.D83G	HYOU1_ENST00000529972.1_Missense_Mutation_p.D83G|HYOU1_ENST00000543287.1_5'UTR|HYOU1_ENST00000525859.1_Missense_Mutation_p.D83G	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	83					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		TGCTGCACTGTCTCCAAAGAA	0.527																																						dbGAP											0													102.0	102.0	102.0					11																	118926221		2200	4295	6495	-	-	-	SO:0001583	missense	0			U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.248A>G	11.37:g.118926221T>C	ENSP00000384144:p.Asp83Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.D83G	ENST00000404233.3	37	c.248	CCDS8408.1	11	.	.	.	.	.	.	.	.	.	.	T	27.0	4.788284	0.90367	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000541069;ENST00000529972;ENST00000536103;ENST00000525859;ENST00000544701;ENST00000530473	T;T;T;T	0.01043	5.41;5.41;5.41;5.41	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.06645	0.0170	M	0.75777	2.31	0.80722	D	1	D;D;D	0.89917	0.984;1.0;1.0	P;D;D	0.75484	0.87;0.986;0.986	T	0.05435	-1.0885	10	0.62326	D	0.03	-30.6667	15.1658	0.72825	0.0:0.0:0.0:1.0	.	127;83;83	B7Z2N4;Q9Y4L1;A8C1Z0	.;HYOU1_HUMAN;.	G	83;74;83;83;83;83;126;83	ENSP00000384144:D83G;ENSP00000437313:D83G;ENSP00000433397:D83G;ENSP00000431874:D83G	ENSP00000278752:D74G	D	-	2	0	HYOU1	118431431	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.522000	0.81844	2.153000	0.67306	0.533000	0.62120	GAC	HYOU1	-	pfam_Hsp_70_fam	ENSG00000149428		0.527	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	HYOU1	HGNC	protein_coding	OTTHUMT00000389353.1	72	0.00	0	T	NM_006389		118926221	118926221	-1	no_errors	ENST00000404233	ensembl	human	known	69_37n	missense	61	29.07	25	SNP	1.000	C
IDS	3423	genome.wustl.edu	37	X	148568556	148568556	+	Silent	SNP	T	T	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chrX:148568556T>G	ENST00000340855.6	-	8	1289	c.1080A>C	c.(1078-1080)atA>atC	p.I360I	IDS_ENST00000541269.1_Silent_p.I149I|IDS_ENST00000537071.1_Intron|IDS_ENST00000422081.2_Silent_p.I149I|IDS_ENST00000490775.1_5'Flank	NM_000202.5|NM_001166550.1	NP_000193.1|NP_001160022.1	P22304	IDS_HUMAN	iduronate 2-sulfatase	360					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	lysosomal lumen (GO:0043202)	iduronate-2-sulfatase activity (GO:0004423)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(5)|large_intestine(2)|lung(8)|prostate(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GAACATAGAATATCAGGGGAA	0.488																																						dbGAP											0													89.0	78.0	82.0					X																	148568556		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M58342	CCDS14685.1, CCDS14686.1	Xq27.3-q28	2012-10-02	2008-08-01		ENSG00000010404	ENSG00000010404	3.1.6.13		5389	protein-coding gene	gene with protein product	"""Hunter syndrome"""	300823		SIDS			Standard	NM_006123		Approved		uc011mxe.2	P22304	OTTHUMG00000022615	ENST00000340855.6:c.1080A>C	X.37:g.148568556T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWT4|Q14604|Q9BRM3	Silent	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.I360	ENST00000340855.6	37	c.1080	CCDS14685.1	X																																																																																			IDS	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000010404		0.488	IDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDS	HGNC	protein_coding	OTTHUMT00000058677.3	61	0.00	0	T			148568556	148568556	-1	no_errors	ENST00000340855	ensembl	human	known	69_37n	silent	35	28.57	14	SNP	1.000	G
IL6ST	3572	genome.wustl.edu	37	5	55237584	55237584	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr5:55237584C>A	ENST00000381298.2	-	17	2395	c.2083G>T	c.(2083-2085)Gaa>Taa	p.E695*	IL6ST_ENST00000536319.1_3'UTR|IL6ST_ENST00000381287.4_3'UTR|IL6ST_ENST00000502326.3_Nonsense_Mutation_p.E695*|CTD-2031P19.5_ENST00000576302.1_RNA|IL6ST_ENST00000381294.3_Nonsense_Mutation_p.E634*|IL6ST_ENST00000336909.5_Nonsense_Mutation_p.E695*	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	695					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				GCTTCTATTTCCACAACACTT	0.323			O		hepatocellular ca																																	dbGAP		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	0													85.0	92.0	90.0					5																	55237584		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.2083G>T	5.37:g.55237584C>A	ENSP00000370698:p.Glu695*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0L4|Q5FC04|Q9UQ41	Nonsense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,pfam_IL6_recept-bd,pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.E695*	ENST00000381298.2	37	c.2083	CCDS3971.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.067906	0.97251	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294	.	.	.	5.53	5.53	0.82687	.	0.219737	0.47093	D	0.000248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	19.8389	0.96675	0.0:1.0:0.0:0.0	.	.	.	.	X	695;695;634	.	ENSP00000338799:E695X	E	-	1	0	IL6ST	55273341	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.960000	0.56752	2.755000	0.94549	0.650000	0.86243	GAA	IL6ST	-	NULL	ENSG00000134352		0.323	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IL6ST	HGNC	protein_coding	OTTHUMT00000214146.3	49	0.00	0	C	NM_002184		55237584	55237584	-1	no_errors	ENST00000336909	ensembl	human	known	69_37n	nonsense	34	24.44	11	SNP	1.000	A
INHA	3623	genome.wustl.edu	37	2	220437265	220437265	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr2:220437265delC	ENST00000243786.2	+	1	349	c.169delC	c.(169-171)cggfs	p.R57fs	OBSL1_ENST00000265318.4_5'Flank|OBSL1_ENST00000404537.1_5'Flank|OBSL1_ENST00000289656.3_5'Flank|OBSL1_ENST00000603926.1_5'Flank|OBSL1_ENST00000491370.1_5'Flank|OBSL1_ENST00000373876.1_5'Flank|OBSL1_ENST00000373873.4_5'Flank|INHA_ENST00000489456.1_Intron	NM_002191.3	NP_002182.1	P05111	INHA_HUMAN	inhibin, alpha	57					cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|erythrocyte differentiation (GO:0030218)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|ovarian follicle development (GO:0001541)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|regulation of cell cycle (GO:0051726)|regulation of cell proliferation (GO:0042127)|response to external stimulus (GO:0009605)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|inhibin A complex (GO:0043512)|inhibin-betaglycan-ActRII complex (GO:0034673)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|receptor binding (GO:0005102)			large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10		Renal(207;0.0183)		Epithelial(149;4.58e-07)|all cancers(144;4.31e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		TGGAGTCAGGCGGCTGCCCCG	0.662											OREG0003991	type=REGULATORY REGION|Gene=BC045558|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													11.0	12.0	12.0					2																	220437265		2186	4266	6452	-	-	-	SO:0001589	frameshift_variant	0				CCDS2444.1	2q35	2013-09-19			ENSG00000123999	ENSG00000123999			6065	protein-coding gene	gene with protein product		147380				3345731	Standard	NM_002191		Approved		uc002vmk.2	P05111	OTTHUMG00000059237	ENST00000243786.2:c.169delC	2.37:g.220437265delC	ENSP00000243786:p.Arg57fs	Somatic	2266	WXS	Illumina GAIIx	Phase_IV	A8K8H5	Frame_Shift_Del	DEL	pfam_TGF-b_C,smart_TGF-b_C,pirsf_Inhibin_asu_subgr,prints_Inhibin_asu	p.R57fs	ENST00000243786.2	37	c.169	CCDS2444.1	2																																																																																			INHA	-	pirsf_Inhibin_asu_subgr	ENSG00000123999		0.662	INHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHA	HGNC	protein_coding	OTTHUMT00000131425.1	11	0.00	0	C			220437265	220437265	+1	no_errors	ENST00000243786	ensembl	human	known	69_37n	frame_shift_del	6	45.45	5	DEL	0.993	-
KAT6B	23522	genome.wustl.edu	37	10	76735881	76735881	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr10:76735881C>G	ENST00000287239.4	+	8	2275	c.1786C>G	c.(1786-1788)Cgg>Ggg	p.R596G	KAT6B_ENST00000372724.1_Intron|KAT6B_ENST00000372714.1_Intron|KAT6B_ENST00000372725.1_Intron|KAT6B_ENST00000372711.1_Intron	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	596	Negatively regulates HAT activity.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TATTAGAAGTCGGTTTATTTC	0.423																																						dbGAP											0													76.0	76.0	76.0					10																	76735881		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.1786C>G	10.37:g.76735881C>G	ENSP00000287239:p.Arg596Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,pfam_Histone_H1/H5,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.R596G	ENST00000287239.4	37	c.1786	CCDS7345.1	10	.	.	.	.	.	.	.	.	.	.	C	8.404	0.842651	0.16963	.	.	ENSG00000156650	ENST00000287239	T	0.79247	-1.25	6.08	4.96	0.65561	.	0.000000	0.51477	D	0.000091	T	0.74527	0.3728	N	0.08118	0	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	T	0.73773	-0.3877	9	.	.	.	-11.6266	12.2193	0.54425	0.8512:0.1488:0.0:0.0	.	596	Q8WYB5	KAT6B_HUMAN	G	596	ENSP00000287239:R596G	.	R	+	1	2	KAT6B	76405887	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.629000	0.54266	1.127000	0.42034	-0.262000	0.10625	CGG	KAT6B	-	NULL	ENSG00000156650		0.423	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6B	HGNC	protein_coding	OTTHUMT00000048771.1	64	0.00	0	C	NM_012330		76735881	76735881	+1	no_errors	ENST00000287239	ensembl	human	known	69_37n	missense	53	10.17	6	SNP	1.000	G
KCND2	3751	genome.wustl.edu	37	7	119915360	119915360	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr7:119915360A>G	ENST00000331113.4	+	1	1639	c.674A>G	c.(673-675)tAt>tGt	p.Y225C		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	225					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	GGAGAGCGGTATGCTGTGGCC	0.537																																						dbGAP											0													132.0	117.0	122.0					7																	119915360		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.674A>G	7.37:g.119915360A>G	ENSP00000333496:p.Tyr225Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.Y225C	ENST00000331113.4	37	c.674	CCDS5776.1	7	.	.	.	.	.	.	.	.	.	.	A	15.92	2.974907	0.53720	.	.	ENSG00000184408	ENST00000331113	D	0.97620	-4.46	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000001	D	0.98052	0.9358	M	0.91249	3.19	0.58432	D	0.999997	P	0.46621	0.881	P	0.50136	0.632	D	0.98597	1.0657	9	.	.	.	.	15.7621	0.78091	1.0:0.0:0.0:0.0	.	225	Q9NZV8	KCND2_HUMAN	C	225	ENSP00000333496:Y225C	.	Y	+	2	0	KCND2	119702596	1.000000	0.71417	0.939000	0.37840	0.843000	0.47879	9.339000	0.96797	2.134000	0.65973	0.460000	0.39030	TAT	KCND2	-	prints_K_chnl_volt-dep_Kv4	ENSG00000184408		0.537	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND2	HGNC	protein_coding	OTTHUMT00000346996.1	112	0.00	0	A	NM_012281		119915360	119915360	+1	no_errors	ENST00000331113	ensembl	human	known	69_37n	missense	103	26.95	38	SNP	1.000	G
KDM3A	55818	genome.wustl.edu	37	2	86718115	86718115	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr2:86718115C>G	ENST00000409556.1	+	25	4050	c.3685C>G	c.(3685-3687)Caa>Gaa	p.Q1229E	KDM3A_ENST00000542128.1_Missense_Mutation_p.Q1177E|KDM3A_ENST00000312912.5_Missense_Mutation_p.Q1229E|KDM3A_ENST00000409064.1_Missense_Mutation_p.Q1229E			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	1229	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.Q1229*(4)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						GTATGGAGTTCAAGGCTGGGC	0.423																																					NSCLC(96;1150 1523 6936 46253 49736)	dbGAP											4	Substitution - Nonsense(4)	lung(4)											126.0	118.0	121.0					2																	86718115		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.3685C>G	2.37:g.86718115C>G	ENSP00000386660:p.Gln1229Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.Q1229E	ENST00000409556.1	37	c.3685	CCDS1990.1	2	.	.	.	.	.	.	.	.	.	.	C	19.28	3.797347	0.70567	.	.	ENSG00000115548	ENST00000409556;ENST00000540058;ENST00000312912;ENST00000409064;ENST00000542128	T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41	4.89	4.89	0.63831	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.64402	D	0.000004	T	0.53594	0.1806	N	0.04320	-0.23	0.58432	D	0.999998	P;B	0.40083	0.702;0.169	P;B	0.50617	0.646;0.351	T	0.52283	-0.8596	10	0.05525	T	0.97	.	17.4252	0.87525	0.0:1.0:0.0:0.0	.	1177;1229	F5H070;Q9Y4C1	.;KDM3A_HUMAN	E	1229;1229;1229;1229;1177	ENSP00000386660:Q1229E;ENSP00000323659:Q1229E;ENSP00000386516:Q1229E;ENSP00000438324:Q1177E	ENSP00000323659:Q1229E	Q	+	1	0	KDM3A	86571626	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.427000	0.82271	0.655000	0.94253	CAA	KDM3A	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000115548		0.423	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3A	HGNC	protein_coding	OTTHUMT00000252522.2	114	0.00	0	C	NM_018433		86718115	86718115	+1	no_errors	ENST00000312912	ensembl	human	known	69_37n	missense	103	10.43	12	SNP	1.000	G
KIF27	55582	genome.wustl.edu	37	9	86514613	86514613	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr9:86514613A>G	ENST00000297814.2	-	5	1708	c.1565T>C	c.(1564-1566)gTa>gCa	p.V522A	KIF27_ENST00000413982.1_Missense_Mutation_p.V522A|KIF27_ENST00000334204.2_Missense_Mutation_p.V522A	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	522					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						TTTCAAAGATACAGCATGCCC	0.383																																						dbGAP											0													161.0	123.0	136.0					9																	86514613		2203	4298	6501	-	-	-	SO:0001583	missense	0			AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.1565T>C	9.37:g.86514613A>G	ENSP00000297814:p.Val522Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V522A	ENST00000297814.2	37	c.1565	CCDS6665.1	9	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.450675	0.01080	.	.	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204	T;T;T	0.50813	0.73;0.73;0.73	3.97	3.97	0.46021	.	0.796579	0.10431	N	0.675467	T	0.29321	0.0730	N	0.25286	0.73	0.09310	N	1	B;B;B	0.20671	0.034;0.047;0.022	B;B;B	0.19391	0.025;0.019;0.01	T	0.27365	-1.0076	10	0.07990	T	0.79	.	7.0584	0.25111	0.6384:0.0:0.0:0.3616	.	522;522;522	Q86VH2-3;Q86VH2-2;Q86VH2	.;.;KIF27_HUMAN	A	522	ENSP00000297814:V522A;ENSP00000401688:V522A;ENSP00000333928:V522A	ENSP00000297814:V522A	V	-	2	0	KIF27	85704433	0.001000	0.12720	0.432000	0.26747	0.702000	0.40608	0.963000	0.29293	1.662000	0.50781	0.477000	0.44152	GTA	KIF27	-	NULL	ENSG00000165115		0.383	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF27	HGNC	protein_coding	OTTHUMT00000052861.1	168	0.00	0	A	NM_017576		86514613	86514613	-1	no_errors	ENST00000297814	ensembl	human	known	69_37n	missense	165	12.23	23	SNP	0.101	G
KNTC1	9735	genome.wustl.edu	37	12	123107016	123107016	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr12:123107016G>C	ENST00000333479.7	+	62	6554	c.6377G>C	c.(6376-6378)aGt>aCt	p.S2126T	KNTC1_ENST00000450485.2_Missense_Mutation_p.S1051T|KNTC1_ENST00000436959.3_Missense_Mutation_p.S47T|KNTC1_ENST00000534995.1_Missense_Mutation_p.S47T|KNTC1_ENST00000537348.1_3'UTR|HCAR1_ENST00000356987.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	2126					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TAGATTAGAAGTCTGATTTTG	0.313																																						dbGAP											0													40.0	38.0	39.0					12																	123107016		1824	4074	5898	-	-	-	SO:0001583	missense	0				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.6377G>C	12.37:g.123107016G>C	ENSP00000328236:p.Ser2126Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C4|B3KSG2	Missense_Mutation	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.S2126T	ENST00000333479.7	37	c.6377	CCDS45002.1	12	.	.	.	.	.	.	.	.	.	.	G	10.01	1.234540	0.22626	.	.	ENSG00000184445	ENST00000450485;ENST00000333479;ENST00000436959;ENST00000534995	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	5.0	0.809	0.18725	RZZ complex, subunit KNTC1/ROD, C-terminal (1);	0.822574	0.11795	N	0.528751	T	0.37892	0.1020	L	0.47716	1.5	0.58432	D	0.999992	D;B	0.60160	0.987;0.234	P;B	0.60012	0.867;0.075	T	0.20174	-1.0283	10	0.40728	T	0.16	-5.8872	5.3921	0.16249	0.4371:0.1405:0.4225:0.0	.	1051;2126	E7ES84;P50748	.;KNTC1_HUMAN	T	1051;2126;47;47	ENSP00000397992:S1051T;ENSP00000328236:S2126T;ENSP00000408760:S47T;ENSP00000437344:S47T	ENSP00000328236:S2126T	S	+	2	0	KNTC1	121672969	0.996000	0.38824	0.986000	0.45419	0.364000	0.29643	0.319000	0.19522	-0.077000	0.12752	0.557000	0.71058	AGT	KNTC1	-	pfam_RZZ-complex_KNTC1/ROD_C	ENSG00000184445		0.313	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	63	0.00	0	G			123107016	123107016	+1	no_errors	ENST00000333479	ensembl	human	known	69_37n	missense	61	14.08	10	SNP	0.908	C
KRT20	54474	genome.wustl.edu	37	17	39034526	39034526	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr17:39034526G>T	ENST00000167588.3	-	6	1051	c.1010C>A	c.(1009-1011)gCc>gAc	p.A337D		NM_019010.2	NP_061883.1	P35900	K1C20_HUMAN	keratin 20	337	Coil 2.|Rod.				apoptotic process (GO:0006915)|cellular response to stress (GO:0033554)|intermediate filament organization (GO:0045109)|regulation of protein secretion (GO:0050708)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	14		Breast(137;0.000301)|Ovarian(249;0.15)				CATCAGTTGGGCCTCCAGAGA	0.483																																						dbGAP											0													184.0	155.0	165.0					17																	39034526		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC031559	CCDS11379.1	17q21.2	2013-01-16			ENSG00000171431	ENSG00000171431		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	20412	protein-coding gene	gene with protein product		608218				8359595, 12515621, 16831889	Standard	NM_019010		Approved	CK20, K20, MGC35423	uc002hvl.3	P35900	OTTHUMG00000133366	ENST00000167588.3:c.1010C>A	17.37:g.39034526G>T	ENSP00000167588:p.Ala337Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6W7	Missense_Mutation	SNP	pfam_F,prints_Keratin_I	p.A337D	ENST00000167588.3	37	c.1010	CCDS11379.1	17	.	.	.	.	.	.	.	.	.	.	G	9.594	1.126973	0.20959	.	.	ENSG00000171431	ENST00000167588	D	0.89123	-2.47	5.21	-2.16	0.07080	Filament (1);	1.001790	0.08049	N	0.996405	T	0.77711	0.4171	N	0.25245	0.725	0.20821	N	0.999847	B	0.15141	0.012	B	0.14578	0.011	T	0.60796	-0.7192	10	0.30854	T	0.27	.	4.7487	0.13050	0.0898:0.1045:0.2778:0.5278	.	337	P35900	K1C20_HUMAN	D	337	ENSP00000167588:A337D	ENSP00000167588:A337D	A	-	2	0	KRT20	36288052	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-1.174000	0.03105	-0.259000	0.09432	-0.293000	0.09583	GCC	KRT20	-	pfam_F,prints_Keratin_I	ENSG00000171431		0.483	KRT20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT20	HGNC	protein_coding	OTTHUMT00000257202.2	200	0.00	0	G			39034526	39034526	-1	no_errors	ENST00000167588	ensembl	human	known	69_37n	missense	116	22.67	34	SNP	0.029	T
LMOD1	25802	genome.wustl.edu	37	1	201868906	201868906	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:201868906A>G	ENST00000367288.4	-	2	1481	c.1235T>C	c.(1234-1236)cTc>cCc	p.L412P	RP11-307B6.3_ENST00000414927.1_RNA|RP11-307B6.3_ENST00000458139.1_RNA	NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	412					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GTTGTTCTGGAGGAGGGCCCG	0.562																																						dbGAP											0													122.0	125.0	124.0					1																	201868906		2182	4286	6468	-	-	-	SO:0001583	missense	0			X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.1235T>C	1.37:g.201868906A>G	ENSP00000356257:p.Leu412Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APV6|C4AMB1|Q68EN2	Missense_Mutation	SNP	pfam_Tropomodulin,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.L412P	ENST00000367288.4	37	c.1235	CCDS53457.1	1	.	.	.	.	.	.	.	.	.	.	A	14.23	2.472866	0.43942	.	.	ENSG00000163431	ENST00000367288;ENST00000400965;ENST00000412469	D	0.90676	-2.71	4.47	4.47	0.54385	.	0.000000	0.35677	N	0.003050	T	0.81706	0.4879	L	0.37750	1.13	0.80722	D	1	P;P	0.39250	0.476;0.665	B;B	0.29663	0.076;0.105	T	0.80487	-0.1361	10	0.45353	T	0.12	-20.2024	7.4375	0.27164	0.8066:0.0:0.0:0.1934	.	361;412	B4E3S9;P29536	.;LMOD1_HUMAN	P	412;412;361	ENSP00000356257:L412P	ENSP00000356257:L412P	L	-	2	0	LMOD1	200135529	0.999000	0.42202	0.993000	0.49108	0.993000	0.82548	3.788000	0.55446	1.626000	0.50381	0.491000	0.48974	CTC	LMOD1	-	NULL	ENSG00000163431		0.562	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	LMOD1	HGNC	protein_coding	OTTHUMT00000087085.2	194	0.00	0	A			201868906	201868906	-1	no_errors	ENST00000367288	ensembl	human	known	69_37n	missense	147	28.29	58	SNP	0.980	G
LPP	4026	genome.wustl.edu	37	3	188584023	188584023	+	Silent	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr3:188584023C>G	ENST00000312675.4	+	9	1692	c.1446C>G	c.(1444-1446)ccC>ccG	p.P482P	LPP_ENST00000543006.1_Silent_p.P482P	NM_001167672.1|NM_005578.3	NP_001161144.1|NP_005569.1	Q93052	LPP_HUMAN	LIM domain containing preferred translocation partner in lipoma	482	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)		HMGA2/LPP(161)	NS(1)|breast(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		GTTCCAAGCCCATCATGGAGC	0.557			T	"""HMGA2, MLL, C12orf9"""	"""lipoma, leukemia"""																																	dbGAP		Dom	yes		3	3q28	4026	LIM domain containing preferred translocation partner in lipoma		"""L, M"""	0													164.0	141.0	149.0					3																	188584023		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL833171	CCDS3291.1	3q27-q28	2004-03-02	2002-01-14		ENSG00000145012	ENSG00000145012			6679	protein-coding gene	gene with protein product		600700	"""LIM domain-containing preferred translocation partner in lipoma"""			8812423	Standard	XM_005247453		Approved		uc003frs.2	Q93052	OTTHUMG00000156387	ENST00000312675.4:c.1446C>G	3.37:g.188584023C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4L6|D3DNV6|Q8NFX5	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.P482	ENST00000312675.4	37	c.1446	CCDS3291.1	3																																																																																			LPP	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000145012		0.557	LPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPP	HGNC	protein_coding	OTTHUMT00000344030.1	119	0.00	0	C	NM_005578		188584023	188584023	+1	no_errors	ENST00000312675	ensembl	human	known	69_37n	silent	139	13.66	22	SNP	1.000	G
LRRC7	57554	genome.wustl.edu	37	1	70225882	70225882	+	5'UTR	SNP	C	C	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:70225882C>T	ENST00000035383.5	+	0	25				LRRC7_ENST00000370958.1_Silent_p.L37L|LRRC7_ENST00000310961.5_Silent_p.L4L|LRRC7_ENST00000415775.2_5'UTR	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7							cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						AGTGCAGTGCCTGGAGATGAC	0.418																																						dbGAP											0													34.0	35.0	34.0					1																	70225882		2203	4298	6501	-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.-6C>T	1.37:g.70225882C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Silent	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.L4	ENST00000035383.5	37	c.10	CCDS645.1	1																																																																																			LRRC7	-	NULL	ENSG00000033122		0.418	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	25	0.00	0	C	NM_020794		70225882	70225882	+1	no_errors	ENST00000310961	ensembl	human	known	69_37n	silent	26	18.75	6	SNP	1.000	T
MAP2	4133	genome.wustl.edu	37	2	210565003	210565003	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr2:210565003G>A	ENST00000360351.4	+	10	5031	c.4525G>A	c.(4525-4527)Gca>Aca	p.A1509T	MAP2_ENST00000447185.1_Missense_Mutation_p.A1505T|MAP2_ENST00000199940.6_Missense_Mutation_p.A153T|MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000392194.1_Missense_Mutation_p.A153T|MAP2_ENST00000361559.4_Missense_Mutation_p.A153T	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1509					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TTCAACAGCAGCAGGTGGGGA	0.373																																					Pancreas(27;423 979 28787 29963)	dbGAP											0													123.0	121.0	122.0					2																	210565003		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4525G>A	2.37:g.210565003G>A	ENSP00000353508:p.Ala1509Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_Tau/MAP_tubulin-bd_rpt	p.A1509T	ENST00000360351.4	37	c.4525	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	G	11.47	1.649208	0.29336	.	.	ENSG00000078018	ENST00000199940;ENST00000360351;ENST00000361559;ENST00000392194;ENST00000447185;ENST00000452717	T;T;T;T;T;T	0.45276	2.06;3.2;2.09;2.09;3.2;0.9	5.56	1.74	0.24563	.	0.361702	0.23282	N	0.049894	T	0.20495	0.0493	N	0.08118	0	0.39031	D	0.959931	B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0	B;B;B;B;B	0.10450	0.005;0.002;0.001;0.002;0.001	T	0.05370	-1.0889	10	0.30854	T	0.27	-4.9087	8.7535	0.34633	0.3555:0.0:0.6445:0.0	.	1505;153;154;1509;153	P11137-3;P11137-2;Q59FX9;P11137;Q8IUX2	.;.;.;MAP2_HUMAN;.	T	153;1509;153;153;1505;79	ENSP00000199940:A153T;ENSP00000353508:A1509T;ENSP00000355290:A153T;ENSP00000376032:A153T;ENSP00000392164:A1505T;ENSP00000388824:A79T	ENSP00000199940:A153T	A	+	1	0	MAP2	210273248	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.165000	0.31822	0.300000	0.22699	0.563000	0.77884	GCA	MAP2	-	NULL	ENSG00000078018		0.373	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	138	0.00	0	G	NM_001039538		210565003	210565003	+1	no_errors	ENST00000360351	ensembl	human	known	69_37n	missense	92	22.69	27	SNP	1.000	A
MBD3L1	85509	genome.wustl.edu	37	19	8953820	8953820	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr19:8953820A>C	ENST00000595891.1	+	3	697	c.466A>C	c.(466-468)Aaa>Caa	p.K156Q	MBD3L1_ENST00000305625.2_Missense_Mutation_p.K156Q			Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like 1	156					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	12						AGATATCAGGAAACAGGAAGG	0.493																																						dbGAP											0													42.0	38.0	39.0					19																	8953820		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY038022	CCDS12209.1	19p13.2	2011-01-31	2003-03-19	2003-03-21	ENSG00000170948	ENSG00000170948			15774	protein-coding gene	gene with protein product		607963	"""methyl-CpG binding domain protein 3-like"""	MBD3L		12504854	Standard	NM_145208		Approved		uc002mko.2	Q8WWY6		ENST00000595891.1:c.466A>C	19.37:g.8953820A>C	ENSP00000471575:p.Lys156Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BUM6|Q2M291	Missense_Mutation	SNP	NULL	p.K156Q	ENST00000595891.1	37	c.466	CCDS12209.1	19	.	.	.	.	.	.	.	.	.	.	A	10.60	1.394862	0.25205	.	.	ENSG00000170948	ENST00000305625	T	0.49720	0.77	3.92	2.91	0.33838	.	0.435365	0.15840	N	0.242097	T	0.43144	0.1234	L	0.54323	1.7	0.09310	N	0.999999	P	0.44946	0.846	P	0.44359	0.447	T	0.26395	-1.0104	10	0.45353	T	0.12	-4.643	6.1729	0.20427	0.8855:0.0:0.1145:0.0	.	156	Q8WWY6	MB3L1_HUMAN	Q	156	ENSP00000304198:K156Q	ENSP00000304198:K156Q	K	+	1	0	MBD3L1	8814820	0.013000	0.17824	0.023000	0.16930	0.538000	0.34931	1.264000	0.33015	0.842000	0.35045	0.533000	0.62120	AAA	MBD3L1	-	NULL	ENSG00000170948		0.493	MBD3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3L1	HGNC	protein_coding	OTTHUMT00000459973.1	29	0.00	0	A	NM_145208		8953820	8953820	+1	no_errors	ENST00000305625	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	0.034	C
MCF2L	23263	genome.wustl.edu	37	13	113742701	113742701	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr13:113742701C>G	ENST00000375608.3	+	25	2897	c.2839C>G	c.(2839-2841)Cag>Gag	p.Q947E	MCF2L_ENST00000434480.2_Missense_Mutation_p.Q923E|MCF2L_ENST00000442652.2_Missense_Mutation_p.Q947E|MCF2L_ENST00000397030.1_Missense_Mutation_p.Q950E|MCF2L_ENST00000375604.2_Missense_Mutation_p.Q974E|MCF2L_ENST00000375601.3_Missense_Mutation_p.Q921E|MCF2L_ENST00000421756.1_Missense_Mutation_p.Q921E|MCF2L_ENST00000375597.4_Missense_Mutation_p.Q915E|MCF2L_ENST00000423482.2_Missense_Mutation_p.Q915E|MCF2L_ENST00000535094.2_Missense_Mutation_p.Q917E			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	947					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				GCTGACCAGCCAGCTGCAGGC	0.532																																						dbGAP											0													103.0	103.0	103.0					13																	113742701		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.2839C>G	13.37:g.113742701C>G	ENSP00000364758:p.Gln947Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	pfam_DH-domain,pfam_Spectrin_repeat,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.Q974E	ENST00000375608.3	37	c.2920		13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.20|13.20	2.165819|2.165819	0.38217|0.38217	.|.	.|.	ENSG00000126217|ENSG00000126217	ENST00000397017;ENST00000453297;ENST00000439475|ENST00000375608;ENST00000442652;ENST00000375604;ENST00000397030;ENST00000535094;ENST00000421756;ENST00000375601;ENST00000434480;ENST00000423482;ENST00000375597;ENST00000440749	.|T;T;T;T;T;T;T;T;T;T	.|0.19250	.|2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16	4.14|4.14	3.3|3.3	0.37823|0.37823	.|Pleckstrin homology-type (1);Pleckstrin homology domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.45458|0.45458	0.1343|0.1343	M|M	0.77103|0.77103	2.36|2.36	0.53005|0.53005	D|D	0.999965|0.999965	.|D;D;D;D;D	.|0.76494	.|0.999;0.999;0.999;0.998;0.999	.|D;D;D;D;D	.|0.85130	.|0.997;0.997;0.997;0.991;0.994	T|T	0.45673|0.45673	-0.9245|-0.9245	5|10	.|0.87932	.|D	.|0	.|.	11.7123|11.7123	0.51633|0.51633	0.0:0.9129:0.0:0.0871|0.0:0.9129:0.0:0.0871	.|.	.|915;917;974;915;947	.|E9PDN8;O15068-9;G5E9A1;O15068-4;O15068	.|.;.;.;.;MCF2L_HUMAN	R|E	577;71;22|947;947;974;950;917;921;921;923;915;915;758	.|ENSP00000364758:Q947E;ENSP00000401422:Q947E;ENSP00000364754:Q974E;ENSP00000380225:Q950E;ENSP00000440374:Q917E;ENSP00000397285:Q921E;ENSP00000364751:Q921E;ENSP00000407722:Q923E;ENSP00000405639:Q915E;ENSP00000364747:Q915E	.|ENSP00000364747:Q915E	P|Q	+|+	2|1	0|0	MCF2L|MCF2L	112790702|112790702	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.088000|0.088000	0.18126|0.18126	6.860000|6.860000	0.75473|0.75473	0.742000|0.742000	0.32697|0.32697	-0.251000|-0.251000	0.11542|0.11542	CCA|CAG	MCF2L	-	smart_Pleckstrin_homology	ENSG00000126217		0.532	MCF2L-001	KNOWN	basic	protein_coding	MCF2L	HGNC	protein_coding	OTTHUMT00000045849.4	67	0.00	0	C			113742701	113742701	+1	no_errors	ENST00000375604	ensembl	human	known	69_37n	missense	124	17.88	27	SNP	1.000	G
MOV10	4343	genome.wustl.edu	37	1	113232573	113232573	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:113232573G>A	ENST00000413052.2	+	5	1079	c.689G>A	c.(688-690)gGc>gAc	p.G230D	MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000369644.1_Missense_Mutation_p.G174D|MOV10_ENST00000369645.1_Missense_Mutation_p.G230D|MOV10_ENST00000357443.2_Missense_Mutation_p.G230D	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	230					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		GAAGGAGCCGGCACATTCTAC	0.612																																						dbGAP											0													70.0	74.0	73.0					1																	113232573		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.689G>A	1.37:g.113232573G>A	ENSP00000399797:p.Gly230Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Missense_Mutation	SNP	NULL	p.G230D	ENST00000413052.2	37	c.689	CCDS853.1	1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.646102	0.29246	.	.	ENSG00000155363	ENST00000413052;ENST00000369645;ENST00000285733;ENST00000369644;ENST00000357443;ENST00000369648	D;D;D;D	0.91180	-2.8;-2.8;-2.78;-2.8	5.25	2.29	0.28610	.	0.698917	0.14972	N	0.287748	T	0.70762	0.3261	L	0.34521	1.04	0.80722	D	1	B;B;B	0.15930	0.015;0.012;0.012	B;B;B	0.17722	0.008;0.019;0.006	T	0.61237	-0.7103	10	0.13470	T	0.59	-8.3324	6.9403	0.24488	0.2969:0.0:0.7031:0.0	.	174;230;230	Q5JR04;Q9H8T8;Q9HCE1	.;.;MOV10_HUMAN	D	230;230;230;174;230;168	ENSP00000399797:G230D;ENSP00000358659:G230D;ENSP00000358658:G174D;ENSP00000350028:G230D	ENSP00000285733:G230D	G	+	2	0	MOV10	113034096	0.659000	0.27411	1.000000	0.80357	0.975000	0.68041	0.538000	0.23160	0.785000	0.33685	0.561000	0.74099	GGC	MOV10	-	NULL	ENSG00000155363		0.612	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOV10	HGNC	protein_coding	OTTHUMT00000032906.1	43	0.00	0	G	NM_020963		113232573	113232573	+1	no_errors	ENST00000357443	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	0.989	A
MYH8	4626	genome.wustl.edu	37	17	10300124	10300124	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr17:10300124T>C	ENST00000403437.2	-	31	4452	c.4358A>G	c.(4357-4359)gAc>gGc	p.D1453G	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1453					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GGCCACCTTGTCAAAGTTCCT	0.443									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																													dbGAP											0													106.0	100.0	102.0					17																	10300124		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4358A>G	17.37:g.10300124T>C	ENSP00000384330:p.Asp1453Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14910	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D1453G	ENST00000403437.2	37	c.4358	CCDS11153.1	17	.	.	.	.	.	.	.	.	.	.	T	23.7	4.448692	0.84101	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.83419	-1.72	5.26	5.26	0.73747	Myosin tail (1);	0.000000	0.44097	U	0.000497	D	0.92916	0.7746	M	0.92077	3.27	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	D	0.94214	0.7461	10	0.59425	D	0.04	.	15.3476	0.74350	0.0:0.0:0.0:1.0	.	1453	P13535	MYH8_HUMAN	G	1453	ENSP00000384330:D1453G	ENSP00000252173:D1453G	D	-	2	0	MYH8	10240849	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.716000	0.84723	2.215000	0.71742	0.528000	0.53228	GAC	MYH8	-	pfam_Myosin_tail	ENSG00000133020		0.443	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	148	0.00	0	T	NM_002472		10300124	10300124	-1	no_errors	ENST00000403437	ensembl	human	known	69_37n	missense	116	17.73	25	SNP	1.000	C
MYT1	4661	genome.wustl.edu	37	20	62871224	62871224	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr20:62871224C>A	ENST00000328439.1	+	22	3569	c.3205C>A	c.(3205-3207)Caa>Aaa	p.Q1069K	MYT1_ENST00000536311.1_Missense_Mutation_p.Q1096K	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					GGCCCTCATCCAAAGTCTCGC	0.597																																					GBM(59;481 1041 20555 21139 33705)	dbGAP											0													111.0	114.0	113.0					20																	62871224		2203	4300	6503	-	-	-	SO:0001583	missense	0			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.3205C>A	20.37:g.62871224C>A	ENSP00000327465:p.Gln1069Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.Q1096K	ENST00000328439.1	37	c.3286	CCDS13558.1	20	.	.	.	.	.	.	.	.	.	.	C	19.53	3.844696	0.71488	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.40756	1.02;1.02	5.91	5.91	0.95273	.	0.067521	0.64402	D	0.000006	T	0.34395	0.0896	N	0.22421	0.69	0.80722	D	1	P;B	0.40230	0.708;0.255	B;B	0.40702	0.338;0.07	T	0.03969	-1.0988	10	0.13470	T	0.59	-8.3768	20.3053	0.98627	0.0:1.0:0.0:0.0	.	1096;1069	F5H7M8;Q01538	.;MYT1_HUMAN	K	1069;1096	ENSP00000327465:Q1069K;ENSP00000442412:Q1096K	ENSP00000327465:Q1069K	Q	+	1	0	MYT1	62341668	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.955000	0.70306	2.808000	0.96608	0.655000	0.94253	CAA	MYT1	-	NULL	ENSG00000196132		0.597	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYT1	HGNC	protein_coding	OTTHUMT00000080297.1	39	0.00	0	C	NM_004535		62871224	62871224	+1	no_errors	ENST00000536311	ensembl	human	known	69_37n	missense	10	65.52	19	SNP	1.000	A
NBEA	26960	genome.wustl.edu	37	13	35770032	35770032	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr13:35770032A>T	ENST00000400445.3	+	31	5493	c.4959A>T	c.(4957-4959)aaA>aaT	p.K1653N	NBEA_ENST00000379939.2_Missense_Mutation_p.K1650N|NBEA_ENST00000540320.1_Missense_Mutation_p.K1653N|NBEA_ENST00000310336.4_Missense_Mutation_p.K1653N	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1653					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		ACACCATAAAAGAAAAAGAAA	0.358																																						dbGAP											0													51.0	51.0	51.0					13																	35770032		1808	4081	5889	-	-	-	SO:0001583	missense	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4959A>T	13.37:g.35770032A>T	ENSP00000383295:p.Lys1653Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.K1653N	ENST00000400445.3	37	c.4959	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	A	5.740	0.321048	0.10845	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.87	0.288	0.15719	.	0.105878	0.64402	D	0.000005	T	0.28928	0.0718	N	0.14661	0.345	0.80722	D	1	B;B	0.23650	0.089;0.073	B;B	0.23716	0.01;0.048	T	0.04005	-1.0985	10	0.18710	T	0.47	.	8.3976	0.32566	0.6905:0.0:0.3095:0.0	.	1653;1650	Q8NFP9;Q5T321	NBEA_HUMAN;.	N	1653;1653;1650;1653;280	ENSP00000440951:K1653N;ENSP00000383295:K1653N;ENSP00000369271:K1650N;ENSP00000308534:K1653N	ENSP00000308534:K1653N	K	+	3	2	NBEA	34668032	1.000000	0.71417	0.983000	0.44433	0.065000	0.16274	1.366000	0.34193	0.114000	0.18032	-1.054000	0.02325	AAA	NBEA	-	NULL	ENSG00000172915		0.358	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		11	0.00	0	A	NM_015678		35770032	35770032	+1	no_errors	ENST00000310336	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	1.000	T
OR6T1	219874	genome.wustl.edu	37	11	123813968	123813968	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr11:123813968T>C	ENST00000321252.2	-	1	612	c.578A>G	c.(577-579)cAc>cGc	p.H193R		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TTTCAGCAGGTGGGTGTCCCC	0.537																																						dbGAP											0													75.0	67.0	69.0					11																	123813968		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.578A>G	11.37:g.123813968T>C	ENSP00000325203:p.His193Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFE7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.H193R	ENST00000321252.2	37	c.578	CCDS31700.1	11	.	.	.	.	.	.	.	.	.	.	T	0	-2.837745	0.00069	.	.	ENSG00000181499	ENST00000321252	T	0.00099	8.73	3.46	-6.33	0.01988	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.16833	0.445	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.02975	-1.1087	9	0.14252	T	0.57	-0.758	6.322	0.21223	0.0:0.4095:0.2308:0.3597	.	193	Q8NGN1	OR6T1_HUMAN	R	193	ENSP00000325203:H193R	ENSP00000325203:H193R	H	-	2	0	OR6T1	123319178	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-3.458000	0.00464	-1.451000	0.01933	-2.504000	0.00190	CAC	OR6T1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181499		0.537	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6T1	HGNC	protein_coding	OTTHUMT00000387264.1	33	0.00	0	T	NM_001005187		123813968	123813968	-1	no_errors	ENST00000321252	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.000	C
OR10G9	219870	genome.wustl.edu	37	11	123894114	123894114	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr11:123894114C>A	ENST00000375024.1	+	1	395	c.395C>A	c.(394-396)aCc>aAc	p.T132N		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CTCAGGTACACCAGCATGATG	0.527																																						dbGAP											0													61.0	57.0	58.0					11																	123894114		2201	4284	6485	-	-	-	SO:0001583	missense	0			AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.395C>A	11.37:g.123894114C>A	ENSP00000364164:p.Thr132Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T132N	ENST00000375024.1	37	c.395	CCDS31703.1	11	.	.	.	.	.	.	.	.	.	.	C	3.268	-0.149750	0.06585	.	.	ENSG00000236981	ENST00000375024	T	0.01347	4.99	3.48	0.952	0.19584	GPCR, rhodopsin-like superfamily (1);	1.014080	0.07917	N	0.975267	T	0.02193	0.0068	L	0.33753	1.03	0.09310	N	1	B	0.24092	0.097	B	0.28991	0.097	T	0.49881	-0.8892	10	0.72032	D	0.01	.	14.4069	0.67088	0.0:0.4473:0.5527:0.0	.	132	Q8NGN4	O10G9_HUMAN	N	132	ENSP00000364164:T132N	ENSP00000364164:T132N	T	+	2	0	OR10G9	123399324	0.000000	0.05858	0.153000	0.22517	0.213000	0.24496	-1.720000	0.01871	0.064000	0.16427	0.655000	0.94253	ACC	OR10G9	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000236981		0.527	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G9	HGNC	protein_coding	OTTHUMT00000387269.1	106	0.00	0	C	NM_001001953		123894114	123894114	+1	no_errors	ENST00000375024	ensembl	human	known	69_37n	missense	66	54.48	79	SNP	0.004	A
PABPN1L	390748	genome.wustl.edu	37	16	88932941	88932941	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr16:88932941G>T	ENST00000419291.2	-	1	85	c.74C>A	c.(73-75)cCt>cAt	p.P25H	PABPN1L_ENST00000427766.1_Missense_Mutation_p.P25H|PABPN1L_ENST00000411789.2_Missense_Mutation_p.P25H|PABPN1L_ENST00000378358.4_Missense_Mutation_p.P25H	NM_001080487.2	NP_001073956.2	A6NDY0	EPAB2_HUMAN	poly(A) binding protein, nuclear 1-like (cytoplasmic)	25						cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			kidney(1)	1						CTGGGCCTCAGGGTCTGAGGA	0.657																																						dbGAP											0													21.0	22.0	22.0					16																	88932941		1792	3978	5770	-	-	-	SO:0001583	missense	0				CCDS45547.1, CCDS45547.2, CCDS73925.1	16q24.3	2013-02-12	2009-12-17		ENSG00000205022	ENSG00000205022		"""RNA binding motif (RRM) containing"""	37237	protein-coding gene	gene with protein product	"""embryonic poly(A) binding protein 2"""					18483763	Standard	NM_001080487		Approved	ePABP2	uc010vpe.2	A6NDY0		ENST00000419291.2:c.74C>A	16.37:g.88932941G>T	ENSP00000408598:p.Pro25His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3B3|A2VDI2	Missense_Mutation	SNP	NULL	p.P25H	ENST00000419291.2	37	c.74	CCDS45547.2	16	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098547	0.56183	.	.	ENSG00000205022	ENST00000378358;ENST00000419291;ENST00000427766;ENST00000411789;ENST00000547152	T;T	0.18502	2.21;2.51	4.58	3.54	0.40534	.	0.320990	0.29253	N	0.012686	T	0.26268	0.0641	L	0.29908	0.895	0.23036	N	0.998392	D;D;D;D	0.89917	0.995;1.0;1.0;1.0	P;D;D;D	0.91635	0.766;0.982;0.987;0.999	T	0.01424	-1.1358	10	0.72032	D	0.01	-28.4443	9.3727	0.38264	0.0:0.0:0.7869:0.2131	.	25;25;25;25	A6NDY0;A6NDY0-4;C9JEK9;A6NDY0-2	EPAB2_HUMAN;.;.;.	H	25	ENSP00000367609:P25H;ENSP00000408598:P25H	ENSP00000367609:P25H	P	-	2	0	PABPN1L	87460442	0.976000	0.34144	0.826000	0.32828	0.708000	0.40852	2.248000	0.43160	2.264000	0.75181	0.561000	0.74099	CCT	PABPN1L	-	NULL	ENSG00000205022		0.657	PABPN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPN1L	HGNC	protein_coding	OTTHUMT00000407502.1	56	0.00	0	G	NM_001080487		88932941	88932941	-1	no_errors	ENST00000427766	ensembl	human	known	69_37n	missense	18	41.94	13	SNP	0.733	T
PARP1	142	genome.wustl.edu	37	1	226579990	226579990	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:226579990G>T	ENST00000366794.5	-	3	455	c.312C>A	c.(310-312)agC>agA	p.S104R	PARP1_ENST00000366792.1_3'UTR	NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	104					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		TCTCTGCCTTGCTACCAATTC	0.493								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																														dbGAP											0													193.0	174.0	180.0					1																	226579990		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.312C>A	1.37:g.226579990G>T	ENSP00000355759:p.Ser104Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Poly(ADP-ribose)pol_reg_dom,pfam_Znf_PARP,pfam_PADR1,pfam_WGR_domain,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_WGR_domain,superfamily_BRCT_dom,smart_BRCT_dom,smart_WGR_domain,pirsf_NAD_ADPRT,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.S104R	ENST00000366794.5	37	c.312	CCDS1554.1	1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.586713	0.28268	.	.	ENSG00000143799	ENST00000432338;ENST00000366794	T	0.09445	2.98	5.02	2.06	0.26882	.	0.240506	0.48767	D	0.000166	T	0.08980	0.0222	L	0.42245	1.32	0.80722	D	1	B	0.10296	0.003	B	0.17098	0.017	T	0.18555	-1.0333	10	0.16896	T	0.51	.	10.0928	0.42458	0.2415:0.0:0.7585:0.0	.	104	P09874	PARP1_HUMAN	R	104	ENSP00000355759:S104R	ENSP00000355759:S104R	S	-	3	2	PARP1	224646613	0.998000	0.40836	0.939000	0.37840	0.931000	0.56810	1.136000	0.31467	0.635000	0.30488	0.313000	0.20887	AGC	PARP1	-	pirsf_NAD_ADPRT	ENSG00000143799		0.493	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP1	HGNC	protein_coding	OTTHUMT00000091519.1	179	0.56	1	G	NM_001618		226579990	226579990	-1	no_errors	ENST00000366794	ensembl	human	known	69_37n	missense	99	34.44	52	SNP	1.000	T
PAXIP1	22976	genome.wustl.edu	37	7	154753359	154753359	+	Splice_Site	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr7:154753359C>G	ENST00000404141.1	-	11	2282		c.e11-1		PAXIP1_ENST00000473219.1_Splice_Site|PAXIP1_ENST00000397192.1_Splice_Site			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1						adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		CAGAAATAATCTAAGAAAAAA	0.318																																						dbGAP											0													33.0	31.0	32.0					7																	154753359		1806	4072	5878	-	-	-	SO:0001630	splice_region_variant	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.2128-1G>C	7.37:g.154753359C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Splice_Site	SNP	-	e11-1	ENST00000404141.1	37	c.2128-1	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	C	19.67	3.871451	0.72065	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6296	0.91355	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PAXIP1	154384292	1.000000	0.71417	0.990000	0.47175	0.960000	0.62799	7.158000	0.77470	2.457000	0.83068	0.591000	0.81541	.	PAXIP1	-	-	ENSG00000157212		0.318	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1	90	0.00	0	C	NM_007349	Intron	154753359	154753359	-1	no_errors	ENST00000397192	ensembl	human	known	69_37n	splice_site	69	27.37	26	SNP	1.000	G
PCDHB1	29930	genome.wustl.edu	37	5	140431880	140431880	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr5:140431880A>T	ENST00000306549.3	+	1	902	c.825A>T	c.(823-825)aaA>aaT	p.K275N		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	275	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCACCAACAAAGCGATAACTT	0.507																																						dbGAP											0													65.0	64.0	64.0					5																	140431880		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.825A>T	5.37:g.140431880A>T	ENSP00000307234:p.Lys275Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M257	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K275N	ENST00000306549.3	37	c.825	CCDS4243.1	5	.	.	.	.	.	.	.	.	.	.	A	9.854	1.194560	0.22037	.	.	ENSG00000171815	ENST00000306549	T	0.01705	4.68	6.17	2.42	0.29668	Cadherin (4);Cadherin-like (1);	0.275059	0.25830	N	0.028022	T	0.01489	0.0048	L	0.33792	1.035	0.21325	N	0.999722	P	0.38677	0.642	B	0.36808	0.233	T	0.48647	-0.9017	10	0.87932	D	0	.	2.5742	0.04802	0.32:0.1083:0.4606:0.111	.	275	Q9Y5F3	PCDB1_HUMAN	N	275	ENSP00000307234:K275N	ENSP00000307234:K275N	K	+	3	2	PCDHB1	140412064	0.001000	0.12720	0.982000	0.44146	0.525000	0.34531	-0.572000	0.05881	0.482000	0.27582	-0.242000	0.12053	AAA	PCDHB1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000171815		0.507	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	HGNC	protein_coding	OTTHUMT00000251822.2	53	0.00	0	A	NM_013340		140431880	140431880	+1	no_errors	ENST00000306549	ensembl	human	known	69_37n	missense	34	30.61	15	SNP	0.219	T
PLCL1	5334	genome.wustl.edu	37	2	198949886	198949886	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr2:198949886G>C	ENST00000428675.1	+	2	2043	c.1645G>C	c.(1645-1647)Gat>Cat	p.D549H	PLCL1_ENST00000437704.2_Missense_Mutation_p.D451H	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	549	Interaction with GABA A beta subunit. {ECO:0000250}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	TTCTGATCCAGATGTGTTAGA	0.413																																						dbGAP											0													62.0	60.0	61.0					2																	198949886		2203	4300	6503	-	-	-	SO:0001583	missense	0			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.1645G>C	2.37:g.198949886G>C	ENSP00000402861:p.Asp549His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,prints_Pinositol_PLipase_C,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.D549H	ENST00000428675.1	37	c.1645	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	G	10.72	1.428938	0.25726	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.54675	0.56;0.56	6.04	4.24	0.50183	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);	0.080442	0.53938	D	0.000056	T	0.47192	0.1432	L	0.43152	1.355	0.09310	N	0.999992	P;P	0.44478	0.836;0.585	B;B	0.43990	0.438;0.438	T	0.38564	-0.9655	9	.	.	.	.	11.7154	0.51650	0.1919:0.0:0.8081:0.0	.	549;475	Q15111;B4DYZ4	PLCL1_HUMAN;.	H	549;451	ENSP00000402861:D549H;ENSP00000414138:D451H	.	D	+	1	0	PLCL1	198658131	0.596000	0.26866	0.899000	0.35326	0.965000	0.64279	2.554000	0.45845	1.568000	0.49683	0.561000	0.74099	GAT	PLCL1	-	superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000115896		0.413	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1	59	0.00	0	G	NM_006226		198949886	198949886	+1	no_errors	ENST00000428675	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	0.004	C
POLR3D	661	genome.wustl.edu	37	8	22106154	22106154	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr8:22106154C>G	ENST00000397802.4	+	5	862	c.647C>G	c.(646-648)gCt>gGt	p.A216G	POLR3D_ENST00000306433.4_Missense_Mutation_p.A216G			P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide D, 44kDa	216					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	13				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		GACATACCTGCTGTGAAAGGT	0.522																																						dbGAP											0													114.0	100.0	105.0					8																	22106154		2203	4300	6503	-	-	-	SO:0001583	missense	0			M17754	CCDS34858.1	8q21	2013-01-21	2003-04-01	2003-04-04	ENSG00000168495	ENSG00000168495		"""RNA polymerase subunits"""	1080	protein-coding gene	gene with protein product		187280	"""BN51 (BHK21) temperature sensitivity complementing"""	BN51T		12391170, 11279001	Standard	NM_001722		Approved	TSBN51, RPC4	uc003xbl.3	P05423	OTTHUMG00000163778	ENST00000397802.4:c.647C>G	8.37:g.22106154C>G	ENSP00000380904:p.Ala216Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FI28|Q9BPV7|Q9BPZ1|Q9BXB3	Missense_Mutation	SNP	pfam_RNA_pol_III_Rpc4	p.A216G	ENST00000397802.4	37	c.647	CCDS34858.1	8	.	.	.	.	.	.	.	.	.	.	C	3.310	-0.140972	0.06669	.	.	ENSG00000168495	ENST00000306433;ENST00000397802	.	.	.	5.88	-3.37	0.04898	.	1.178000	0.05884	N	0.627003	T	0.26304	0.0642	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24225	-1.0166	9	0.23302	T	0.38	0.6621	15.1527	0.72713	0.0:0.8286:0.0888:0.0825	.	216	P05423	RPC4_HUMAN	G	216	.	ENSP00000303088:A216G	A	+	2	0	POLR3D	22162099	0.001000	0.12720	0.143000	0.22291	0.343000	0.28985	1.165000	0.31822	-0.903000	0.03881	-1.058000	0.02302	GCT	POLR3D	-	NULL	ENSG00000168495		0.522	POLR3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3D	HGNC	protein_coding	OTTHUMT00000375434.2	61	0.00	0	C	NM_001722		22106154	22106154	+1	no_errors	ENST00000397802	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	0.001	G
RAB19	401409	genome.wustl.edu	37	7	140110775	140110775	+	Intron	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr7:140110775C>A	ENST00000356407.3	+	2	269				RAB19_ENST00000537763.1_Intron|RAB19_ENST00000275874.5_Missense_Mutation_p.N68K			A4D1S5	RAB19_HUMAN	RAB19, member RAS oncogene family						protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(3)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	9	Melanoma(164;0.0142)					AAAATCAGAACAGTTCGGCCA	0.453																																						dbGAP											0													204.0	200.0	201.0					7																	140110775		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS34762.1, CCDS34762.2	7q34	2014-05-09			ENSG00000146955	ENSG00000146955		"""RAB, member RAS oncogene"""	19982	protein-coding gene	gene with protein product							Standard	NM_001008749		Approved	RAB19B	uc010lni.2	A4D1S5	OTTHUMG00000157410	ENST00000356407.3:c.202-899C>A	7.37:g.140110775C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1S6|B2RTS6|B5MDR2|Q9UL27	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.N68K	ENST00000356407.3	37	c.204	CCDS34762.2	7	.	.	.	.	.	.	.	.	.	.	C	9.337	1.062070	0.19987	.	.	ENSG00000146955	ENST00000275874	T	0.63096	-0.02	2.34	2.34	0.29019	.	.	.	.	.	T	0.58278	0.2111	.	.	.	0.22127	N	0.999345	.	.	.	.	.	.	T	0.51872	-0.8650	6	0.51188	T	0.08	.	8.2805	0.31898	0.0:1.0:0.0:0.0	.	.	.	.	K	68	ENSP00000275874:N68K	ENSP00000275874:N68K	N	+	3	2	RAB19	139757244	0.000000	0.05858	0.016000	0.15963	0.004000	0.04260	-0.211000	0.09332	1.646000	0.50622	0.579000	0.79373	AAC	RAB19	-	pfam_MIRO-like,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000146955		0.453	RAB19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB19	HGNC	protein_coding	OTTHUMT00000348740.1	100	0.00	0	C			140110775	140110775	+1	no_errors	ENST00000275874	ensembl	human	known	69_37n	missense	89	11.88	12	SNP	0.017	A
RAB37	326624	genome.wustl.edu	37	17	72725505	72725505	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr17:72725505G>A	ENST00000340415.3	+	2	1192	c.183G>A	c.(181-183)acG>acA	p.T61T	RAB37_ENST00000402449.4_Splice_Site_p.T61T	NM_175738.4	NP_783865.1	Q96AX2	RAB37_HUMAN	RAB37, member RAS oncogene family	68					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|secretory granule (GO:0030141)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	12						TCGGATTCACGGTAAGCACTG	0.597																																						dbGAP											0													125.0	105.0	112.0					17																	72725505		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC040547	CCDS11703.1, CCDS32722.1, CCDS54161.1, CCDS54162.1	17q25.2	2008-02-05			ENSG00000172794	ENSG00000172794		"""RAB, member RAS oncogene"""	30268	protein-coding gene	gene with protein product		609956				10722846	Standard	NM_175738		Approved		uc002jlk.3	Q96AX2	OTTHUMG00000134282	ENST00000340415.3:c.183+1G>A	17.37:g.72725505G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXF5|A8MYT0|Q8IWA7	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.T61	ENST00000340415.3	37	c.183		17																																																																																			RAB37	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000172794		0.597	RAB37-005	PUTATIVE	basic	protein_coding	RAB37	HGNC	protein_coding	OTTHUMT00000258876.2	81	0.00	0	G	NM_175738	Silent	72725505	72725505	+1	no_errors	ENST00000402449	ensembl	human	known	69_37n	silent	76	15.56	14	SNP	0.972	A
RAD51AP2	729475	genome.wustl.edu	37	2	17696790	17696790	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr2:17696790T>C	ENST00000399080.2	-	1	2916	c.2893A>G	c.(2893-2895)Aag>Gag	p.K965E		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	965										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AATTTTCTCTTCATCTCAAAA	0.343																																						dbGAP											0													41.0	39.0	40.0					2																	17696790		1796	4067	5863	-	-	-	SO:0001583	missense	0			AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.2893A>G	2.37:g.17696790T>C	ENSP00000382030:p.Lys965Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.K965E	ENST00000399080.2	37	c.2893	CCDS42656.1	2	.	.	.	.	.	.	.	.	.	.	T	16.73	3.204716	0.58234	.	.	ENSG00000214842	ENST00000399080	T	0.40225	1.04	5.17	5.17	0.71159	.	.	.	.	.	T	0.48429	0.1499	L	0.29908	0.895	0.32005	N	0.602836	D	0.64830	0.994	P	0.57960	0.83	T	0.58918	-0.7551	9	0.87932	D	0	-3.1938	14.4931	0.67665	0.0:0.0:0.0:1.0	.	965	Q09MP3	R51A2_HUMAN	E	965	ENSP00000382030:K965E	ENSP00000382030:K965E	K	-	1	0	RAD51AP2	17560271	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.461000	0.66699	2.088000	0.63022	0.533000	0.62120	AAG	RAD51AP2	-	NULL	ENSG00000214842		0.343	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD51AP2	HGNC	protein_coding	OTTHUMT00000323801.3	66	0.00	0	T	NM_001099218		17696790	17696790	-1	no_errors	ENST00000399080	ensembl	human	known	69_37n	missense	44	24.14	14	SNP	1.000	C
RBP4	5950	genome.wustl.edu	37	10	95353681	95353681	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr10:95353681G>A	ENST00000371467.1	-	5	786	c.467C>T	c.(466-468)tCc>tTc	p.S156F	FFAR4_ENST00000604414.1_Intron|RBP4_ENST00000371469.2_Missense_Mutation_p.S154F|RBP4_ENST00000371464.3_Missense_Mutation_p.S156F			P02753	RET4_HUMAN	retinol binding protein 4, plasma	156					cardiac muscle tissue development (GO:0048738)|detection of light stimulus involved in visual perception (GO:0050908)|embryonic organ morphogenesis (GO:0048562)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic skeletal system development (GO:0048706)|eye development (GO:0001654)|female genitalia morphogenesis (GO:0048807)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|lung development (GO:0030324)|maintenance of gastrointestinal epithelium (GO:0030277)|male gonad development (GO:0008584)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|phototransduction, visible light (GO:0007603)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of insulin secretion (GO:0032024)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to retinoic acid (GO:0032526)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|retinol transport (GO:0034633)|spermatogenesis (GO:0007283)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	retinal binding (GO:0016918)|retinol binding (GO:0019841)|retinol transporter activity (GO:0034632)			large_intestine(1)|lung(3)|skin(1)	5		Colorectal(252;0.122)			Vitamin A(DB00162)	GGGGTCCCGGGAAAACACGAA	0.607																																					Pancreas(5;160 256 1117 46697 50185)	dbGAP											0													124.0	119.0	121.0					10																	95353681		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020633	CCDS31249.1	10q23.33	2014-01-22	2001-11-28		ENSG00000138207	ENSG00000138207		"""Lipocalins"""	9922	protein-coding gene	gene with protein product		180250	"""retinol-binding protein 4, plasma"""				Standard	XM_005270023		Approved		uc001kit.3	P02753	OTTHUMG00000018773	ENST00000371467.1:c.467C>T	10.37:g.95353681G>A	ENSP00000360522:p.Ser156Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DR38|O43478|O43479|Q5VY24|Q8WWA3|Q9P178	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,pirsf_Lipocalin_ApoD,prints_Retinol-bd,prints_Lipocalin	p.S156F	ENST00000371467.1	37	c.467	CCDS31249.1	10	.	.	.	.	.	.	.	.	.	.	G	22.3	4.277894	0.80692	.	.	ENSG00000138207	ENST00000371464;ENST00000371469;ENST00000371467;ENST00000371463	D;D	0.86497	-2.13;-2.13	5.95	5.02	0.67125	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.364735	0.35436	N	0.003216	D	0.93864	0.8037	M	0.84948	2.725	0.58432	D	0.999999	D	0.56035	0.974	D	0.67548	0.952	D	0.94783	0.7955	10	0.87932	D	0	-16.0439	17.05	0.86516	0.0:0.1271:0.8729:0.0	.	156	P02753	RET4_HUMAN	F	156;154;156;154	ENSP00000360519:S156F;ENSP00000360522:S156F	ENSP00000360518:S154F	S	-	2	0	RBP4	95343671	1.000000	0.71417	0.321000	0.25320	0.830000	0.47004	9.731000	0.98807	1.466000	0.48025	0.655000	0.94253	TCC	RBP4	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,pirsf_Lipocalin_ApoD,prints_Retinol-bd,prints_Lipocalin	ENSG00000138207		0.607	RBP4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBP4	HGNC	protein_coding	OTTHUMT00000049431.1	45	0.00	0	G	NM_006744		95353681	95353681	-1	no_errors	ENST00000371464	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	0.993	A
RFFL	117584	genome.wustl.edu	37	17	33348610	33348610	+	Missense_Mutation	SNP	C	C	G	rs149820180		TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr17:33348610C>G	ENST00000315249.7	-	3	593	c.371G>C	c.(370-372)cGg>cCg	p.R124P	RFFL_ENST00000394597.2_Missense_Mutation_p.R124P|RFFL_ENST00000378516.2_Missense_Mutation_p.R124P|RFFL_ENST00000447669.2_Missense_Mutation_p.R124P|RFFL_ENST00000268850.7_Missense_Mutation_p.R124P|RFFL_ENST00000413582.2_Missense_Mutation_p.R124P|RFFL_ENST00000415395.2_Missense_Mutation_p.R124P|RAD51L3-RFFL_ENST00000593039.1_Intron|RFFL_ENST00000584655.1_Missense_Mutation_p.R124P					ring finger and FYVE-like domain containing E3 ubiquitin protein ligase											kidney(1)|large_intestine(2)|lung(3)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		TTCTTTCTCCCGGCACATTTC	0.542																																						dbGAP											0													86.0	81.0	82.0					17																	33348610		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF434816	CCDS11286.1	17q12	2012-02-23	2012-02-23		ENSG00000092871	ENSG00000092871		"""RING-type (C3HC4) zinc fingers"""	24821	protein-coding gene	gene with protein product		609735	"""ring finger and FYVE-like domain containing"""			15229288	Standard	NR_037713		Approved	rififylin, fring, RNF189, RNF34L	uc002hin.1	Q8WZ73	OTTHUMG00000132933	ENST00000315249.7:c.371G>C	17.37:g.33348610C>G	ENSP00000326170:p.Arg124Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_Znf_RING,pfscan_Znf_RING	p.R124P	ENST00000315249.7	37	c.371	CCDS11286.1	17	.	.	.	.	.	.	.	.	.	.	C	22.8	4.342629	0.82022	.	.	ENSG00000092871	ENST00000315249;ENST00000394597;ENST00000378516;ENST00000268850;ENST00000413582;ENST00000415395;ENST00000414419	T;T;T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88	5.65	3.68	0.42216	.	0.000000	0.85682	D	0.000000	D	0.83599	0.5289	M	0.72894	2.215	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.998;1.0;0.998	D	0.83820	0.0246	10	0.56958	D	0.05	-20.8001	11.5816	0.50894	0.0:0.8577:0.0:0.1423	.	124;124;124;124	C9JN73;Q8WZ73-3;Q8WZ73;Q8WZ73-2	.;.;RFFL_HUMAN;.	P	124	ENSP00000326170:R124P;ENSP00000378096:R124P;ENSP00000367777:R124P;ENSP00000268850:R124P;ENSP00000408513:R124P;ENSP00000412322:R124P;ENSP00000395090:R124P	ENSP00000268850:R124P	R	-	2	0	RFFL	30372723	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	0.953000	0.37825	-0.136000	0.14681	CGG	RFFL	-	NULL	ENSG00000092871		0.542	RFFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFFL	HGNC	protein_coding	OTTHUMT00000256460.2	64	0.00	0	C	NM_057178		33348610	33348610	-1	no_errors	ENST00000315249	ensembl	human	known	69_37n	missense	64	15.79	12	SNP	1.000	G
RHOBTB2	23221	genome.wustl.edu	37	8	22862905	22862905	+	Silent	SNP	C	C	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr8:22862905C>T	ENST00000251822.6	+	3	750	c.213C>T	c.(211-213)gaC>gaT	p.D71D	RHOBTB2_ENST00000519685.1_Silent_p.D93D|RHOBTB2_ENST00000523918.1_3'UTR|RHOBTB2_ENST00000522948.1_Silent_p.D78D|RP11-875O11.1_ENST00000523884.1_RNA|RP11-875O11.1_ENST00000502083.2_RNA	NM_015178.2	NP_055993.2	Q9BYZ6	RHBT2_HUMAN	Rho-related BTB domain containing 2	71	Rho-like.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	31		Prostate(55;0.0513)|Breast(100;0.214)		Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		GCTCCCGAGACGTGGTAGATG	0.607																																						dbGAP											0													95.0	88.0	91.0					8																	22862905		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF315385	CCDS6034.1, CCDS55210.1, CCDS55211.1	8p21.2	2013-01-08			ENSG00000008853	ENSG00000008853		"""BTB/POZ domain containing"""	18756	protein-coding gene	gene with protein product		607352				11222756	Standard	NM_001160036		Approved	KIAA0717, DBC2	uc011kzp.1	Q9BYZ6	OTTHUMG00000097827	ENST00000251822.6:c.213C>T	8.37:g.22862905C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Z8|D3DSR8|E9PBU2|E9PEI7|O94825|Q8N4A8|Q9BZK6	Silent	SNP	pfam_BTB_POZ,pfam_Small_GTPase,pfam_MIRO-like,superfamily_BTB/POZ_fold,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_BTB/POZ-like,pfscan_BTB/POZ-like,prints_Small_GTPase	p.D71	ENST00000251822.6	37	c.213	CCDS6034.1	8																																																																																			RHOBTB2	-	pfam_Small_GTPase,pfam_MIRO-like,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase	ENSG00000008853		0.607	RHOBTB2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RHOBTB2	HGNC	protein_coding	OTTHUMT00000215101.2	72	0.00	0	C			22862905	22862905	+1	no_errors	ENST00000251822	ensembl	human	known	69_37n	silent	53	20.90	14	SNP	0.989	T
RIMBP2	23504	genome.wustl.edu	37	12	130941040	130941040	+	Splice_Site	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr12:130941040C>G	ENST00000261655.4	-	4	471		c.e4+1		RIMBP2_ENST00000536002.1_Splice_Site|RIMBP2_ENST00000535703.1_Splice_Site	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2						negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CAGGCGCTTACCTTTGCCGAG	0.642																																						dbGAP											0													53.0	43.0	46.0					12																	130941040		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.307+1G>C	12.37:g.130941040C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96ID2	Splice_Site	SNP	-	e2+1	ENST00000261655.4	37	c.307+1	CCDS31925.1	12	.	.	.	.	.	.	.	.	.	.	C	17.67	3.446785	0.63178	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	.	.	.	4.06	4.06	0.47325	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2634	0.82562	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RIMBP2	129506993	1.000000	0.71417	0.480000	0.27341	0.698000	0.40448	7.549000	0.82163	1.816000	0.52996	0.655000	0.94253	.	RIMBP2	-	-	ENSG00000060709		0.642	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	23	0.00	0	C	NM_015347	Intron	130941040	130941040	-1	no_errors	ENST00000261655	ensembl	human	known	69_37n	splice_site	4	63.64	7	SNP	1.000	G
RNASE7	84659	genome.wustl.edu	37	14	21511331	21511331	+	Silent	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr14:21511331G>A	ENST00000298690.4	+	2	437	c.180G>A	c.(178-180)aaG>aaA	p.K60K	NDRG2_ENST00000403829.3_Intron	NM_032572.3	NP_115961	Q9H1E1	RNAS7_HUMAN	ribonuclease, RNase A family, 7	60					antibacterial humoral response (GO:0019731)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|membrane disruption in other organism (GO:0051673)|response to bacterium (GO:0009617)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endonuclease activity (GO:0004519)|lipopolysaccharide binding (GO:0001530)|nucleic acid binding (GO:0003676)|peptidoglycan binding (GO:0042834)|ribonuclease activity (GO:0004540)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)	6	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;3.42e-11)|Epithelial(56;5.57e-09)|all cancers(55;2.36e-08)	GBM - Glioblastoma multiforme(265;0.0191)		ACATTAACAAGCACACAAAAC	0.527																																						dbGAP											0													132.0	123.0	126.0					14																	21511331		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ131212	CCDS41914.1	14q11.1	2013-02-15			ENSG00000165799	ENSG00000165799		"""Ribonucleases, RNase A"""	19278	protein-coding gene	gene with protein product		612484				12244054, 12527768	Standard	NM_032572		Approved		uc001vzk.4	Q9H1E1	OTTHUMG00000171358	ENST00000298690.4:c.180G>A	14.37:g.21511331G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P80927|P83685|Q546N3	Silent	SNP	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.K60	ENST00000298690.4	37	c.180	CCDS41914.1	14																																																																																			RNASE7	-	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	ENSG00000165799		0.527	RNASE7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE7	HGNC	protein_coding	OTTHUMT00000313936.1	99	0.00	0	G	NM_032572		21511331	21511331	+1	no_errors	ENST00000298690	ensembl	human	known	69_37n	silent	56	47.22	51	SNP	0.000	A
RPL8	6132	genome.wustl.edu	37	8	146016828	146016829	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr8:146016828_146016829insGG	ENST00000262584.3	-	4	564_565	c.332_333insCC	c.(331-333)acafs	p.T111fs	RPL8_ENST00000529163.1_5'UTR|RPL8_ENST00000528957.1_Frame_Shift_Ins_p.T111fs|RPL8_ENST00000394920.2_Frame_Shift_Ins_p.T111fs|RPL8_ENST00000527914.1_Intron	NM_000973.3	NP_000964.1	P62917	RL8_HUMAN	ribosomal protein L8	111					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			kidney(12)|lung(7)|prostate(1)	20	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.191)		AGCACACGATTGTACCCTCAGG	0.584																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			Z28407	CCDS6433.1	8q24.3	2011-04-06			ENSG00000161016	ENSG00000161016		"""L ribosomal proteins"""	10368	protein-coding gene	gene with protein product		604177				7506540, 9582194	Standard	NM_033301		Approved	L8	uc003zec.3	P62917	OTTHUMG00000165249	ENST00000262584.3:c.332_333insCC	8.37:g.146016828_146016829insGG	ENSP00000262584:p.Thr111fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K094|D3DWN2|P25120|Q567Q7|Q969V7|Q9BWQ9	Frame_Shift_Ins	INS	pfam_Ribosomal_L2_C,pfam_Rbsml_prot_L2_RNA-bd_dom,superfamily_Translation_prot_SH3-like,superfamily_NA-bd_OB-fold-like,pirsf_Ribosomal_L2	p.I112fs	ENST00000262584.3	37	c.333_332	CCDS6433.1	8																																																																																			RPL8	-	pfam_Ribosomal_L2_C,superfamily_Translation_prot_SH3-like,pirsf_Ribosomal_L2	ENSG00000161016		0.584	RPL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL8	HGNC	protein_coding	OTTHUMT00000382948.1	31	0.00	0	-	NM_000973		146016828	146016829	-1	no_errors	ENST00000262584	ensembl	human	known	69_37n	frame_shift_ins	23	20.69	6	INS	0.997:1.000	GG
SCN2A	6326	genome.wustl.edu	37	2	166245597	166245597	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr2:166245597A>T	ENST00000375437.2	+	27	5571	c.5281A>T	c.(5281-5283)Atc>Ttc	p.I1761F	SCN2A_ENST00000375427.2_Missense_Mutation_p.I1761F|SCN2A_ENST00000283256.6_Missense_Mutation_p.I1761F|SCN2A_ENST00000357398.3_Missense_Mutation_p.I1761F	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1761					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAGTTACATCATCATATCCTT	0.468																																						dbGAP											0													121.0	122.0	122.0					2																	166245597		2203	4297	6500	-	-	-	SO:0001583	missense	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5281A>T	2.37:g.166245597A>T	ENSP00000364586:p.Ile1761Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.I1761F	ENST00000375437.2	37	c.5281	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	A	18.23	3.577200	0.65878	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98512	-4.97;-4.97;-4.97;-4.97	5.72	5.72	0.89469	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.98143	0.9387	L	0.39085	1.19	0.80722	D	1	D;P	0.71674	0.998;0.847	D;P	0.77004	0.989;0.846	D	0.99890	1.1132	10	0.87932	D	0	.	16.3507	0.83204	1.0:0.0:0.0:0.0	.	1761;1761	Q99250-2;Q99250	.;SCN2A_HUMAN	F	1761	ENSP00000364586:I1761F;ENSP00000349973:I1761F;ENSP00000283256:I1761F;ENSP00000364576:I1761F	ENSP00000283256:I1761F	I	+	1	0	SCN2A	165953843	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.194000	0.94962	2.319000	0.78375	0.524000	0.50904	ATC	SCN2A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	ENSG00000136531		0.468	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	227	0.00	0	A	NM_021007		166245597	166245597	+1	no_errors	ENST00000283256	ensembl	human	known	69_37n	missense	117	45.83	99	SNP	1.000	T
SHB	6461	genome.wustl.edu	37	9	37948743	37948743	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr9:37948743T>G	ENST00000377707.3	-	5	1800	c.1235A>C	c.(1234-1236)cAc>cCc	p.H412P	RP11-613M10.9_ENST00000540557.1_3'UTR	NM_003028.2	NP_003019.2	Q15464	SHB_HUMAN	Src homology 2 domain containing adaptor protein B	412	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(4)|lung(1)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)	11		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)		GATGGCTCCGTGATACCATCT	0.607																																						dbGAP											0													56.0	62.0	60.0					9																	37948743		2176	4285	6461	-	-	-	SO:0001583	missense	0				CCDS43806.1	9p13.2	2013-09-23	2005-05-24		ENSG00000107338	ENSG00000107338		"""SH2 domain containing"""	10838	protein-coding gene	gene with protein product		600314	"""SHB adaptor protein (a Src homology 2 protein)"", ""SHB (Src homology 2 domain containing) adaptor protein B"""			7713524	Standard	NM_003028		Approved		uc004aax.3	Q15464	OTTHUMG00000019936	ENST00000377707.3:c.1235A>C	9.37:g.37948743T>G	ENSP00000366936:p.His412Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGM0|D3DRQ5|Q504U5|Q5VUM8	Missense_Mutation	SNP	pfam_SH2,smart_SH2,prints_SH2,pfscan_SH2	p.H412P	ENST00000377707.3	37	c.1235	CCDS43806.1	9	.	.	.	.	.	.	.	.	.	.	T	22.1	4.246637	0.80024	.	.	ENSG00000107338	ENST00000377707	T	0.69306	-0.39	5.11	5.11	0.69529	SH2 motif (5);	0.000000	0.64402	D	0.000006	D	0.87192	0.6116	H	0.96576	3.845	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91020	0.4856	10	0.87932	D	0	-21.1573	13.1304	0.59377	0.0:0.0:0.0:1.0	.	412	Q15464	SHB_HUMAN	P	412	ENSP00000366936:H412P	ENSP00000366936:H412P	H	-	2	0	SHB	37938743	1.000000	0.71417	0.993000	0.49108	0.927000	0.56198	7.594000	0.82698	2.049000	0.60858	0.460000	0.39030	CAC	SHB	-	pfam_SH2,smart_SH2,prints_SH2,pfscan_SH2	ENSG00000107338		0.607	SHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHB	HGNC	protein_coding	OTTHUMT00000052490.1	44	0.00	0	T			37948743	37948743	-1	no_errors	ENST00000377707	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	1.000	G
SHISA6	388336	genome.wustl.edu	37	17	11166794	11166794	+	Silent	SNP	G	G	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr17:11166794G>T	ENST00000409168.3	+	2	750	c.750G>T	c.(748-750)tcG>tcT	p.S250S	SHISA6_ENST00000441885.3_Silent_p.S250S|SHISA6_ENST00000432116.3_Silent_p.S250S	NM_001173461.1	NP_001166932.1	Q6ZSJ9	SHSA6_HUMAN	shisa family member 6	250				S -> P (in Ref. 3; AAY68487). {ECO:0000305}.		alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)				breast(1)|endometrium(4)	5						CGGTCAGATCGTCCTCCAAAA	0.502																																						dbGAP											0													189.0	153.0	164.0					17																	11166794		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK127379, AK128003	CCDS45615.1, CCDS54089.1, CCDS54090.1	17p13.1-p12	2013-07-31	2013-07-31		ENSG00000188803	ENSG00000188803		"""Shisa homologs"""	34491	protein-coding gene	gene with protein product			"""shisa homolog 6 (Xenopus laevis)"""				Standard	NM_207386		Approved	FLJ45455	uc002gnc.2	Q6ZSJ9	OTTHUMG00000154121	ENST00000409168.3:c.750G>T	17.37:g.11166794G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXV5|Q4PL63	Silent	SNP	NULL	p.S250	ENST00000409168.3	37	c.750	CCDS54090.1	17																																																																																			SHISA6	-	NULL	ENSG00000188803		0.502	SHISA6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHISA6	HGNC	protein_coding	OTTHUMT00000333970.2	107	0.00	0	G	NM_207386		11166794	11166794	+1	no_errors	ENST00000441885	ensembl	human	known	69_37n	silent	80	33.88	41	SNP	0.163	T
SLC13A2	9058	genome.wustl.edu	37	17	26818766	26818766	+	Silent	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr17:26818766C>A	ENST00000314669.5	+	6	1194	c.774C>A	c.(772-774)ggC>ggA	p.G258G	SLC13A2_ENST00000545060.1_Silent_p.G215G|SLC13A2_ENST00000537681.1_Silent_p.G187G|SLC13A2_ENST00000444914.3_Silent_p.G307G	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	258					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	CCCAAAACGGCAACGTGGTGA	0.592																																						dbGAP											0													161.0	138.0	145.0					17																	26818766		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.774C>A	17.37:g.26818766C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Silent	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.G307	ENST00000314669.5	37	c.921	CCDS11231.1	17																																																																																			SLC13A2	-	pfam_Na/sul_symport	ENSG00000007216		0.592	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A2	HGNC	protein_coding	OTTHUMT00000255722.1	118	0.00	0	C	NM_003984		26818766	26818766	+1	no_errors	ENST00000444914	ensembl	human	known	69_37n	silent	73	24.74	24	SNP	0.000	A
SLC17A8	246213	genome.wustl.edu	37	12	100796149	100796149	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr12:100796149G>A	ENST00000323346.5	+	7	1108	c.795G>A	c.(793-795)tgG>tgA	p.W265*	snoU13_ENST00000459038.1_RNA|SLC17A8_ENST00000392989.3_Nonsense_Mutation_p.W265*	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	265					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						ACATGTTTTGGCTGTTGCAGG	0.413																																						dbGAP											0													96.0	92.0	93.0					12																	100796149		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.795G>A	12.37:g.100796149G>A	ENSP00000316909:p.Trp265*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXZ6|B7ZKV4|Q17RQ8	Nonsense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.W265*	ENST00000323346.5	37	c.795	CCDS9077.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.064099	0.97251	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.6316	0.95708	0.0:0.0:1.0:0.0	.	.	.	.	X	265	.	ENSP00000316909:W265X	W	+	3	0	SLC17A8	99320280	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	9.703000	0.98714	2.642000	0.89623	0.557000	0.71058	TGG	SLC17A8	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000179520		0.413	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A8	HGNC	protein_coding	OTTHUMT00000408673.2	217	0.00	0	G	NM_139319		100796149	100796149	+1	no_errors	ENST00000323346	ensembl	human	known	69_37n	nonsense	133	20.71	35	SNP	1.000	A
SLC2A12	154091	genome.wustl.edu	37	6	134350198	134350198	+	Silent	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr6:134350198G>A	ENST00000275230.5	-	2	920	c.765C>T	c.(763-765)tcC>tcT	p.S255S		NM_145176.2	NP_660159.1	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 12	255					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	17	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		CTTTCAGGGAGGATTTGATCA	0.418																																					Melanoma(122;1663 1672 14489 35294 41228)	dbGAP											0													76.0	75.0	76.0					6																	134350198		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL035699	CCDS5169.1	6q23.2	2013-05-22			ENSG00000146411	ENSG00000146411		"""Solute carriers"""	18067	protein-coding gene	gene with protein product		610372				11780753, 11832379	Standard	XM_006715349		Approved	GLUT12, GLUT8	uc003qem.1	Q8TD20	OTTHUMG00000015611	ENST00000275230.5:c.765C>T	6.37:g.134350198G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV17|Q7Z6U3|Q96MR8	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt	p.S255	ENST00000275230.5	37	c.765	CCDS5169.1	6																																																																																			SLC2A12	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000146411		0.418	SLC2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A12	HGNC	protein_coding	OTTHUMT00000042302.1	88	0.00	0	G			134350198	134350198	-1	no_errors	ENST00000275230	ensembl	human	known	69_37n	silent	55	15.38	10	SNP	0.983	A
SMOC2	64094	genome.wustl.edu	37	6	169053662	169053662	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr6:169053662C>G	ENST00000356284.2	+	11	1259	c.1039C>G	c.(1039-1041)Cta>Gta	p.L347V	SMOC2_ENST00000354536.5_Missense_Mutation_p.L358V	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	347	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CAGCCATACCCTAGAGGAGCG	0.537																																						dbGAP											0													44.0	46.0	45.0					6																	169053662		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.1039C>G	6.37:g.169053662C>G	ENSP00000348630:p.Leu347Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_SPARC/Testican_Ca-bd-dom,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Thyroglobulin_1,smart_Prot_inh_Kazal,smart_Thyroglobulin_1,pfscan_EF_HAND_2,pfscan_Thyroglobulin_1	p.L358V	ENST00000356284.2	37	c.1072	CCDS55076.1	6	.	.	.	.	.	.	.	.	.	.	C	17.34	3.366104	0.61513	.	.	ENSG00000112562	ENST00000356284;ENST00000354536;ENST00000366793;ENST00000392101;ENST00000538593	T;T	0.37235	1.21;1.21	4.53	4.53	0.55603	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.000000	0.56097	D	0.000028	T	0.44030	0.1274	L	0.44542	1.39	0.53688	D	0.999975	D;D	0.76494	0.992;0.999	D;D	0.87578	0.968;0.998	T	0.38845	-0.9642	10	0.49607	T	0.09	-9.2848	16.6314	0.85033	0.0:1.0:0.0:0.0	.	347;358	Q9H3U7;Q9H3U7-2	SMOC2_HUMAN;.	V	347;358;347;24;24	ENSP00000348630:L347V;ENSP00000346537:L358V	ENSP00000346537:L358V	L	+	1	2	SMOC2	168795587	1.000000	0.71417	0.977000	0.42913	0.539000	0.34962	5.470000	0.66756	2.208000	0.71279	0.655000	0.94253	CTA	SMOC2	-	pfam_SPARC/Testican_Ca-bd-dom,pfscan_EF_HAND_2	ENSG00000112562		0.537	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMOC2	HGNC	protein_coding	OTTHUMT00000043201.1	56	0.00	0	C			169053662	169053662	+1	no_errors	ENST00000354536	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	1.000	G
SNX32	254122	genome.wustl.edu	37	11	65620233	65620233	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr11:65620233G>A	ENST00000308342.6	+	11	1470	c.1045G>A	c.(1045-1047)Gag>Aag	p.E349K		NM_152760.2	NP_689973.2	Q86XE0	SNX32_HUMAN	sorting nexin 32	349					intracellular protein transport (GO:0006886)	endosome (GO:0005768)	phosphatidylinositol binding (GO:0035091)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				READ - Rectum adenocarcinoma(159;0.171)		CCAACGCTTCGAGCGCCTCTC	0.701																																						dbGAP											0													24.0	28.0	26.0					11																	65620233		2199	4292	6491	-	-	-	SO:0001583	missense	0			AK055496	CCDS8113.2	11q13.1	2008-03-11	2008-03-11	2008-03-11	ENSG00000172803	ENSG00000172803		"""Sorting nexins"""	26423	protein-coding gene	gene with protein product			"""sorting nexin 6B"""	SNX6B		16782399	Standard	XM_005273871		Approved	FLJ30934	uc001ofr.3	Q86XE0	OTTHUMG00000128491	ENST00000308342.6:c.1045G>A	11.37:g.65620233G>A	ENSP00000310620:p.Glu349Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW53|Q96NG4	Missense_Mutation	SNP	pfam_Vps5_C,pfam_Phox,superfamily_Phox,pirsf_Snx5_Snx6,pfscan_Phox	p.E349K	ENST00000308342.6	37	c.1045	CCDS8113.2	11	.	.	.	.	.	.	.	.	.	.	G	18.17	3.565280	0.65651	.	.	ENSG00000172803	ENST00000308342	T	0.23147	1.92	4.84	3.93	0.45458	.	0.460547	0.18453	N	0.140776	T	0.29028	0.0721	M	0.70275	2.135	0.40460	D	0.980237	B	0.21452	0.056	B	0.16722	0.016	T	0.11084	-1.0602	10	0.51188	T	0.08	-8.3305	11.1767	0.48603	0.09:0.0:0.91:0.0	.	349	Q86XE0	SNX32_HUMAN	K	349	ENSP00000310620:E349K	ENSP00000310620:E349K	E	+	1	0	SNX32	65376809	1.000000	0.71417	0.035000	0.18076	0.969000	0.65631	5.821000	0.69257	1.264000	0.44198	0.561000	0.74099	GAG	SNX32	-	pfam_Vps5_C,pirsf_Snx5_Snx6	ENSG00000172803		0.701	SNX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX32	HGNC	protein_coding	OTTHUMT00000250295.3	26	0.00	0	G	NM_152760		65620233	65620233	+1	no_errors	ENST00000308342	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	0.999	A
SPTBN1	6711	genome.wustl.edu	37	2	54870174	54870174	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr2:54870174G>T	ENST00000356805.4	+	19	4194	c.3913G>T	c.(3913-3915)Gaa>Taa	p.E1305*	SPTBN1_ENST00000333896.5_Nonsense_Mutation_p.E1292*	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1305					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GTCTTACGATGAAGCCAGAAA	0.423																																						dbGAP											0													113.0	111.0	112.0					2																	54870174		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.3913G>T	2.37:g.54870174G>T	ENSP00000349259:p.Glu1305*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Nonsense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.E1305*	ENST00000356805.4	37	c.3913	CCDS33198.1	2	.	.	.	.	.	.	.	.	.	.	G	46	12.662291	0.99686	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	.	.	.	5.73	4.83	0.62350	.	0.098967	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	16.6266	0.84972	0.0:0.1301:0.8699:0.0	.	.	.	.	X	1305;1292	.	ENSP00000334156:E1292X	E	+	1	0	SPTBN1	54723678	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.807000	0.99171	1.382000	0.46385	0.655000	0.94253	GAA	SPTBN1	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000115306		0.423	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN1	HGNC	protein_coding	OTTHUMT00000258115.3	51	0.00	0	G			54870174	54870174	+1	no_errors	ENST00000356805	ensembl	human	known	69_37n	nonsense	57	13.64	9	SNP	1.000	T
STT3B	201595	genome.wustl.edu	37	3	31665175	31665175	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr3:31665175G>A	ENST00000295770.2	+	11	1758	c.1549G>A	c.(1549-1551)Gtg>Atg	p.V517M		NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)	517					co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						GGCAGGTAAAGTGAGGAAACA	0.333																																						dbGAP											0													115.0	104.0	108.0					3																	31665175		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.1549G>A	3.37:g.31665175G>A	ENSP00000295770:p.Val517Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96JZ4|Q96KY7	Missense_Mutation	SNP	pfam_Oligo_trans_STT3	p.V517M	ENST00000295770.2	37	c.1549	CCDS2650.1	3	.	.	.	.	.	.	.	.	.	.	G	18.65	3.669618	0.67814	.	.	ENSG00000163527	ENST00000295770	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.53142	0.1778	N	0.21097	0.63	0.80722	D	1	B	0.25563	0.129	B	0.26517	0.07	T	0.45877	-0.9231	9	0.38643	T	0.18	-14.8521	20.1237	0.97972	0.0:0.0:1.0:0.0	.	517	Q8TCJ2	STT3B_HUMAN	M	517	.	ENSP00000295770:V517M	V	+	1	0	STT3B	31640179	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.869000	0.99810	2.759000	0.94783	0.561000	0.74099	GTG	STT3B	-	pfam_Oligo_trans_STT3	ENSG00000163527		0.333	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STT3B	HGNC	protein_coding	OTTHUMT00000253166.2	147	0.00	0	G	NM_178862		31665175	31665175	+1	no_errors	ENST00000295770	ensembl	human	known	69_37n	missense	126	20.25	32	SNP	1.000	A
SVOPL	136306	genome.wustl.edu	37	7	138363783	138363783	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr7:138363783G>T	ENST00000419765.3	-	1	41	c.8C>A	c.(7-9)aCc>aAc	p.T3N	SVOPL_ENST00000421622.1_Missense_Mutation_p.T3N	NM_001139456.1	NP_001132928.1	Q8N434	SVOPL_HUMAN	SVOP-like	3						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	19						TGTTGGCTTGGTTGCCATCTT	0.473																																						dbGAP											0													94.0	91.0	92.0					7																	138363783		692	1591	2283	-	-	-	SO:0001583	missense	0			BC036796	CCDS5848.1, CCDS47721.1	7q34	2011-07-12	2007-04-04		ENSG00000157703	ENSG00000157703			27034	protein-coding gene	gene with protein product		611700	"""SV2 related protein homolog (rat)-like"""				Standard	NM_001139456		Approved	MGC46715	uc011kqh.2	Q8N434	OTTHUMG00000155870	ENST00000419765.3:c.8C>A	7.37:g.138363783G>T	ENSP00000405482:p.Thr3Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.T3N	ENST00000419765.3	37	c.8	CCDS47721.1	7	.	.	.	.	.	.	.	.	.	.	G	4.978	0.181569	0.09495	.	.	ENSG00000157703	ENST00000421622;ENST00000419765	T;T	0.73469	-0.02;-0.75	5.28	2.4	0.29515	Major facilitator superfamily domain, general substrate transporter (1);	.	.	.	.	T	0.61702	0.2368	L	0.29908	0.895	0.09310	N	0.999999	B	0.17667	0.023	B	0.20767	0.031	T	0.40478	-0.9561	9	0.14656	T	0.56	-2.8466	13.1541	0.59508	0.0:0.4728:0.5272:0.0	.	3	Q8N434	SVOPL_HUMAN	N	3	ENSP00000412830:T3N;ENSP00000405482:T3N	ENSP00000405482:T3N	T	-	2	0	SVOPL	138014323	0.349000	0.24870	0.010000	0.14722	0.012000	0.07955	0.420000	0.21263	0.329000	0.23460	-0.176000	0.13171	ACC	SVOPL	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000157703		0.473	SVOPL-005	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SVOPL	HGNC	protein_coding	OTTHUMT00000342092.4	129	0.00	0	G	NM_174959		138363783	138363783	-1	no_errors	ENST00000419765	ensembl	human	known	69_37n	missense	97	12.61	14	SNP	0.053	T
TAOK3	51347	genome.wustl.edu	37	12	118615098	118615098	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr12:118615098G>T	ENST00000392533.3	-	16	2093	c.1603C>A	c.(1603-1605)Caa>Aaa	p.Q535K	TAOK3_ENST00000419821.2_Missense_Mutation_p.Q535K|TAOK3_ENST00000537952.1_Missense_Mutation_p.Q75K	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	535					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AAGATCTGTTGCTGGAACTTC	0.348																																						dbGAP											0													148.0	143.0	145.0					12																	118615098		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1603C>A	12.37:g.118615098G>T	ENSP00000376317:p.Gln535Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q535K	ENST00000392533.3	37	c.1603	CCDS9188.1	12	.	.	.	.	.	.	.	.	.	.	G	13.97	2.394882	0.42512	.	.	ENSG00000135090	ENST00000419821;ENST00000392533;ENST00000537952;ENST00000359811	T;T;T	0.48836	0.8;0.8;0.8	5.24	5.24	0.73138	.	0.118165	0.64402	D	0.000013	T	0.41511	0.1162	L	0.33753	1.03	0.80722	D	1	B	0.23650	0.089	B	0.29942	0.109	T	0.18241	-1.0343	10	0.16896	T	0.51	.	19.0614	0.93095	0.0:0.0:1.0:0.0	.	535	Q9H2K8	TAOK3_HUMAN	K	535;535;75;155	ENSP00000416374:Q535K;ENSP00000376317:Q535K;ENSP00000443834:Q75K	ENSP00000352863:Q155K	Q	-	1	0	TAOK3	117099481	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.725000	0.93324	0.555000	0.69702	CAA	TAOK3	-	NULL	ENSG00000135090		0.348	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK3	HGNC	protein_coding	OTTHUMT00000401456.2	228	0.44	1	G	NM_016281		118615098	118615098	-1	no_errors	ENST00000392533	ensembl	human	known	69_37n	missense	162	20.20	41	SNP	1.000	T
TGFB3	7043	genome.wustl.edu	37	14	76446997	76446997	+	Silent	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr14:76446997C>A	ENST00000238682.3	-	1	537	c.240G>T	c.(238-240)ctG>ctT	p.L80L	TGFB3_ENST00000556285.1_Silent_p.L80L|TGFB3_ENST00000556674.1_5'Flank	NM_003239.2	NP_003230.1	P10600	TGFB3_HUMAN	transforming growth factor, beta 3	80					activation of MAPK activity (GO:0000187)|aging (GO:0007568)|blood coagulation (GO:0007596)|cell growth (GO:0016049)|cell-cell junction organization (GO:0045216)|detection of hypoxia (GO:0070483)|digestive tract development (GO:0048565)|embryonic neurocranium morphogenesis (GO:0048702)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|female pregnancy (GO:0007565)|frontal suture morphogenesis (GO:0060364)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|lung alveolus development (GO:0048286)|mammary gland development (GO:0030879)|menstrual cycle phase (GO:0022601)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of macrophage cytokine production (GO:0010936)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|odontogenesis (GO:0042476)|ossification involved in bone remodeling (GO:0043932)|palate development (GO:0060021)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell division (GO:0051781)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to laminar fluid shear stress (GO:0034616)|response to progesterone (GO:0032570)|salivary gland morphogenesis (GO:0007435)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|T-tubule (GO:0030315)	identical protein binding (GO:0042802)|transforming growth factor beta binding (GO:0050431)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			NS(1)|breast(1)|endometrium(4)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11				BRCA - Breast invasive adenocarcinoma(234;0.0169)		GCATCTCCTCCAGCAGCTCCC	0.572																																						dbGAP											0													129.0	126.0	127.0					14																	76446997		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9846.1	14q24	2014-09-17				ENSG00000119699		"""Endogenous ligands"""	11769	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-3"""	190230	"""arrhythmogenic right ventricular dysplasia 1"""	ARVD1, ARVD		16549496, 15639475	Standard	XM_005268028		Approved		uc001xsc.2	P10600		ENST00000238682.3:c.240G>T	14.37:g.76446997C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WV88	Silent	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,pirsf_TGF-beta,prints_Transform_grow_fac_b3,prints_TGF-beta	p.L80	ENST00000238682.3	37	c.240	CCDS9846.1	14																																																																																			TGFB3	-	pfam_TGF-b_N,pirsf_TGF-beta,prints_Transform_grow_fac_b3	ENSG00000119699		0.572	TGFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFB3	HGNC	protein_coding	OTTHUMT00000413685.1	124	0.00	0	C	NM_003239		76446997	76446997	-1	no_errors	ENST00000238682	ensembl	human	known	69_37n	silent	110	20.86	29	SNP	1.000	A
TMEM245	23731	genome.wustl.edu	37	9	111812873	111812873	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr9:111812873G>T	ENST00000374586.3	-	13	1985	c.1954C>A	c.(1954-1956)Ctt>Att	p.L652I		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	652						integral component of membrane (GO:0016021)											AAATTGAGAAGGGCTGTCCCG	0.453																																						dbGAP											0													131.0	128.0	129.0					9																	111812873		1981	4178	6159	-	-	-	SO:0001583	missense	0			AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.1954C>A	9.37:g.111812873G>T	ENSP00000363714:p.Leu652Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Missense_Mutation	SNP	pfam_UPF0118	p.L652I	ENST00000374586.3	37	c.1954	CCDS43858.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.6|23.6	4.435925|4.435925	0.83885|0.83885	.|.	.|.	ENSG00000106771|ENSG00000106771	ENST00000374586;ENST00000223608|ENST00000413712	T|.	0.43294|.	0.95|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.45316|0.45316	0.1336|0.1336	N|N	0.04090|0.04090	-0.28|-0.28	0.48762|0.48762	D|D	0.999706|0.999706	P;D|.	0.76494|.	0.884;0.999|.	P;D|.	0.87578|.	0.636;0.998|.	T|T	0.41484|0.41484	-0.9506|-0.9506	10|5	0.22109|.	T|.	0.4|.	-15.072|-15.072	20.1356|20.1356	0.98028|0.98028	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	652;652|.	Q9H330-2;Q9H330|.	.;CI005_HUMAN|.	I|H	652|244	ENSP00000363714:L652I|.	ENSP00000223608:L652I|.	L|P	-|-	1|2	0|0	C9orf5|C9orf5	110852694|110852694	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	7.840000|7.840000	0.86819|0.86819	2.755000|2.755000	0.94549|0.94549	0.650000|0.650000	0.86243|0.86243	CTT|CCT	TMEM245	-	pfam_UPF0118	ENSG00000106771		0.453	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM245	HGNC	protein_coding	OTTHUMT00000053587.2	112	0.00	0	G	NM_032012		111812873	111812873	-1	no_errors	ENST00000374586	ensembl	human	known	69_37n	missense	73	17.05	15	SNP	1.000	T
TMPRSS15	5651	genome.wustl.edu	37	21	19666941	19666941	+	Silent	SNP	G	G	T	rs140721787		TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr21:19666941G>T	ENST00000284885.3	-	20	2323	c.2290C>A	c.(2290-2292)Cgg>Agg	p.R764R		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	764	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						CACTGTAACCGAATCAAGGAA	0.284																																						dbGAP											0													83.0	86.0	85.0					21																	19666941		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2290C>A	21.37:g.19666941G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKL7	Silent	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_MAM_dom,pfam_SEA,pfam_LDrepeatLR_classA_rpt,pfam_Peptidase_S1A_nudel,pfam_Srcr_rcpt,superfamily_Pept_cys/ser_Trypsin-like,superfamily_ConA-like_lec_gl,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_SEA,smart_LDrepeatLR_classA_rpt,smart_CUB,smart_MAM_dom,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,pfscan_SEA,pfscan_Srcr_rcpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.R764	ENST00000284885.3	37	c.2290	CCDS13571.1	21																																																																																			TMPRSS15	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000154646		0.284	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS15	HGNC	protein_coding	OTTHUMT00000158231.2	120	0.00	0	G	NM_002772		19666941	19666941	-1	no_errors	ENST00000284885	ensembl	human	known	69_37n	silent	50	35.06	27	SNP	0.701	T
TP53	7157	genome.wustl.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr17:7578271T>A	ENST00000269305.4	-	6	767	c.578A>T	c.(577-579)cAt>cTt	p.H193L	TP53_ENST00000445888.2_Missense_Mutation_p.H193L|TP53_ENST00000359597.4_Missense_Mutation_p.H193L|TP53_ENST00000413465.2_Missense_Mutation_p.H193L|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.H193L|TP53_ENST00000455263.2_Missense_Mutation_p.H193L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	GRCh37	CM083194|CM951225	TP53	M							97.0	87.0	90.0					17																	7578271		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>T	17.37:g.7578271T>A	ENSP00000269305:p.His193Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.H193L	ENST00000269305.4	37	c.578	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	15.17	2.752987	0.49362	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99851	-7.17;-7.17;-7.17;-7.17;-7.17;-7.17;-7.17;-7.17	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99864	0.9936	M	0.92738	3.34	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97204	0.9866	10	0.87932	D	0	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193L;ENSP00000352610:H193L;ENSP00000269305:H193L;ENSP00000398846:H193L;ENSP00000391127:H193L;ENSP00000391478:H193L;ENSP00000425104:H61L;ENSP00000423862:H100L	ENSP00000269305:H193L	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	111	0.00	0	T	NM_000546		7578271	7578271	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	63	43.24	48	SNP	0.998	A
TWF1	5756	genome.wustl.edu	37	12	44191587	44191587	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr12:44191587A>G	ENST00000395510.2	-	6	662	c.533T>C	c.(532-534)gTa>gCa	p.V178A	TWF1_ENST00000325127.4_Missense_Mutation_p.V212A|TWF1_ENST00000552521.1_Missense_Mutation_p.V80A|TWF1_ENST00000548315.1_Missense_Mutation_p.V185A	NM_001242397.1|NM_002822.4	NP_001229326.1|NP_002813.3	Q12792	TWF1_HUMAN	twinfilin actin-binding protein 1	178	ADF-H 2. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|negative regulation of actin filament polymerization (GO:0030837)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of actin phosphorylation (GO:0043538)|sequestering of actin monomers (GO:0042989)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|ruffle membrane (GO:0032587)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|stomach(1)	14	all_cancers(12;0.00125)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.0474)		GGGAAATGCTACTCCTTGTAG	0.373																																						dbGAP											0													112.0	108.0	109.0					12																	44191587		2203	4297	6500	-	-	-	SO:0001583	missense	0			U02680	CCDS31780.1, CCDS31780.2, CCDS55818.1	12q12	2013-04-25	2013-04-25	2006-11-13					9620	protein-coding gene	gene with protein product		610932	"""protein tyrosine kinase 9"", ""PTK9 protein tyrosine kinase 9"", ""twinfilin, actin-binding protein, homolog 1 (Drosophila)"""	PTK9		7507208	Standard	NM_002822		Approved	A6	uc001rob.3	Q12792		ENST00000395510.2:c.533T>C	12.37:g.44191587A>G	ENSP00000378886:p.Val178Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5A8|B3KXS6|B4DLX9|Q59G07|Q5U0B1|Q6FHJ1|Q6FHL6|Q6NUK9|Q86XL6|Q8TCD3	Missense_Mutation	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.V212A	ENST00000395510.2	37	c.635	CCDS31780.2	12	.	.	.	.	.	.	.	.	.	.	A	22.8	4.334951	0.81801	.	.	ENSG00000151239	ENST00000552521;ENST00000395510;ENST00000325127;ENST00000548315;ENST00000546662	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.49	5.76	5.76	0.90799	Actin-binding, cofilin/tropomyosin type (1);	0.211021	0.49916	N	0.000140	T	0.50973	0.1647	M	0.86097	2.795	0.58432	D	0.999997	B;B	0.17667	0.023;0.02	B;B	0.31812	0.054;0.136	T	0.54463	-0.8290	10	0.87932	D	0	-17.6721	16.1113	0.81266	1.0:0.0:0.0:0.0	.	185;178	Q12792-3;Q12792	.;TWF1_HUMAN	A	80;178;212;185;216	ENSP00000448750:V80A;ENSP00000378886:V178A;ENSP00000321058:V212A;ENSP00000449428:V185A;ENSP00000448221:V216A	ENSP00000321058:V212A	V	-	2	0	TWF1	42477854	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.339000	0.96797	2.216000	0.71823	0.397000	0.26171	GTA	TWF1	-	NULL	ENSG00000151239		0.373	TWF1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TWF1	HGNC	protein_coding	OTTHUMT00000403956.1	115	0.00	0	A	NM_002822		44191587	44191587	-1	no_errors	ENST00000325127	ensembl	human	known	69_37n	missense	68	21.84	19	SNP	1.000	G
UBR3	130507	genome.wustl.edu	37	2	170751798	170751798	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr2:170751798A>G	ENST00000272793.5	+	7	1263	c.1213A>G	c.(1213-1215)Atg>Gtg	p.M405V	UBR3_ENST00000418381.1_Missense_Mutation_p.M405V			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	405					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						CTTACTCAACATGCTTCCAGA	0.289																																						dbGAP											0													48.0	43.0	45.0					2																	170751798		692	1579	2271	-	-	-	SO:0001583	missense	0			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.1213A>G	2.37:g.170751798A>G	ENSP00000272793:p.Met405Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	pfam_Znf_N-recognin,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.M405V	ENST00000272793.5	37	c.1213		2	.	.	.	.	.	.	.	.	.	.	A	15.42	2.829504	0.50845	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381	T;T	0.57595	0.39;0.39	5.02	5.02	0.67125	.	.	.	.	.	T	0.62429	0.2427	L	0.50333	1.59	0.80722	D	1	P	0.40332	0.713	P	0.54815	0.761	T	0.59085	-0.7520	9	0.31617	T	0.26	.	15.0498	0.71858	1.0:0.0:0.0:0.0	.	405	Q6ZT12	UBR3_HUMAN	V	405	ENSP00000272793:M405V;ENSP00000396068:M405V	ENSP00000272793:M405V	M	+	1	0	UBR3	170460044	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.194000	0.94962	2.013000	0.59113	0.533000	0.62120	ATG	UBR3	-	NULL	ENSG00000144357		0.289	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	HGNC	protein_coding	OTTHUMT00000255290.2	36	0.00	0	A	NM_172070		170751798	170751798	+1	no_errors	ENST00000272793	ensembl	human	known	69_37n	missense	14	56.25	18	SNP	1.000	G
UBR4	23352	genome.wustl.edu	37	1	19494604	19494604	+	Silent	SNP	A	A	C			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:19494604A>C	ENST00000375254.3	-	28	3843	c.3816T>G	c.(3814-3816)acT>acG	p.T1272T	UBR4_ENST00000375217.2_Silent_p.T1272T|UBR4_ENST00000375226.2_Silent_p.T1272T|UBR4_ENST00000375267.2_Silent_p.T1272T	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1272					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GGCTACAGAGAGTCCCCAGGT	0.498																																						dbGAP											0													101.0	96.0	98.0					1																	19494604		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.3816T>G	1.37:g.19494604A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.T1272	ENST00000375254.3	37	c.3816	CCDS189.1	1																																																																																			UBR4	-	superfamily_ARM-type_fold	ENSG00000127481		0.498	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	41	0.00	0	A	NM_020765		19494604	19494604	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	silent	16	42.86	12	SNP	0.849	C
UNC79	57578	genome.wustl.edu	37	14	94088952	94088952	+	Silent	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr14:94088952C>A	ENST00000393151.2	+	30	5373	c.5373C>A	c.(5371-5373)ccC>ccA	p.P1791P	UNC79_ENST00000256339.4_Silent_p.P1614P|UNC79_ENST00000555664.1_Silent_p.P1791P|UNC79_ENST00000553484.1_Silent_p.P1813P			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1791					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TCAAAGTTCCCGAAGATGCAG	0.537																																						dbGAP											0													66.0	60.0	62.0					14																	94088952		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.5373C>A	14.37:g.94088952C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDL6|Q6ZUT7	Silent	SNP	superfamily_ARM-type_fold	p.P1813	ENST00000393151.2	37	c.5439		14																																																																																			UNC79	-	superfamily_ARM-type_fold	ENSG00000133958		0.537	UNC79-006	KNOWN	basic	protein_coding	UNC79	HGNC	protein_coding	OTTHUMT00000412766.1	50	0.00	0	C	XM_028395		94088952	94088952	+1	no_errors	ENST00000553484	ensembl	human	known	69_37n	silent	25	19.35	6	SNP	0.102	A
VCAM1	7412	genome.wustl.edu	37	1	101190442	101190442	+	Silent	SNP	T	T	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:101190442T>A	ENST00000294728.2	+	4	1025	c.924T>A	c.(922-924)gtT>gtA	p.V308V	VCAM1_ENST00000370115.1_Silent_p.V308V|VCAM1_ENST00000370119.4_Silent_p.V246V|VCAM1_ENST00000347652.2_Silent_p.V308V	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	308	Ig-like C2-type 3.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	AATTAATTGTTCAAGGTGAGT	0.373																																						dbGAP											0													82.0	82.0	82.0					1																	101190442		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.924T>A	1.37:g.101190442T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Silent	SNP	pfam_Ig_I-set,pfam_Ig_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like,prints_VCAM-1,prints_ICAM_VCAM_N	p.V308	ENST00000294728.2	37	c.924	CCDS773.1	1																																																																																			VCAM1	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000162692		0.373	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCAM1	HGNC	protein_coding	OTTHUMT00000030213.1	161	0.00	0	T	NM_001078		101190442	101190442	+1	no_errors	ENST00000294728	ensembl	human	known	69_37n	silent	80	35.48	44	SNP	1.000	A
URB2	9816	genome.wustl.edu	37	1	229771028	229771028	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:229771028G>A	ENST00000258243.2	+	4	804	c.668G>A	c.(667-669)gGc>gAc	p.G223D		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	223						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						GCTGGCCAGGGCCAGCTGAGG	0.602																																						dbGAP											0													45.0	49.0	47.0					1																	229771028		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.668G>A	1.37:g.229771028G>A	ENSP00000258243:p.Gly223Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYC9	Missense_Mutation	SNP	pfam_Urb2/Npa2_C	p.G223D	ENST00000258243.2	37	c.668	CCDS31052.1	1	.	.	.	.	.	.	.	.	.	.	G	8.260	0.810873	0.16537	.	.	ENSG00000135763	ENST00000258243	T	0.09911	2.93	5.46	1.49	0.22878	.	0.476681	0.22460	N	0.059769	T	0.10165	0.0249	L	0.57536	1.79	0.09310	N	1	B	0.18310	0.027	B	0.17433	0.018	T	0.29150	-1.0021	9	.	.	.	-4.1258	6.789	0.23689	0.2834:0.1178:0.5988:0.0	.	223	Q14146	URB2_HUMAN	D	223	ENSP00000258243:G223D	.	G	+	2	0	URB2	227837651	0.370000	0.25047	0.937000	0.37676	0.008000	0.06430	0.711000	0.25764	0.095000	0.17434	-0.894000	0.02916	GGC	URB2	-	NULL	ENSG00000135763		0.602	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	46	0.00	0	G	NM_014777		229771028	229771028	+1	no_errors	ENST00000258243	ensembl	human	known	69_37n	missense	21	52.17	24	SNP	0.115	A
WNT2	7472	genome.wustl.edu	37	7	116955248	116955248	+	Silent	SNP	A	A	G			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr7:116955248A>G	ENST00000265441.3	-	3	764	c.465T>C	c.(463-465)ggT>ggC	p.G155G	AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	155					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CACTGCAGCCACCCCAATCAA	0.483																																						dbGAP											0													167.0	150.0	156.0					7																	116955248		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.465T>C	7.37:g.116955248A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0V1|Q75N05|Q9UDP9	Silent	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt2	p.G155	ENST00000265441.3	37	c.465	CCDS5771.1	7																																																																																			WNT2	-	pfam_Wnt,smart_Wnt,prints_Wnt	ENSG00000105989		0.483	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT2	HGNC	protein_coding	OTTHUMT00000059749.3	166	0.00	0	A	NM_003391		116955248	116955248	-1	no_errors	ENST00000265441	ensembl	human	known	69_37n	silent	148	28.16	58	SNP	0.995	G
ZNF644	84146	genome.wustl.edu	37	1	91383613	91383613	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr1:91383613A>T	ENST00000370440.1	-	5	4004	c.3787T>A	c.(3787-3789)Tgc>Agc	p.C1263S	ZNF644_ENST00000347275.5_Missense_Mutation_p.C41S|ZNF644_ENST00000337393.5_Missense_Mutation_p.C1263S|ZNF644_ENST00000361321.5_Missense_Mutation_p.C41S|ZNF644_ENST00000467231.1_5'UTR			Q9H582	ZN644_HUMAN	zinc finger protein 644	1263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		ATATACCTGCATCGGAGAATG	0.363																																						dbGAP											0													226.0	200.0	209.0					1																	91383613		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.3787T>A	1.37:g.91383613A>T	ENSP00000359469:p.Cys1263Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C1263S	ENST00000370440.1	37	c.3787	CCDS731.1	1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.775502	0.90195	.	.	ENSG00000122482	ENST00000370440;ENST00000347275;ENST00000337393;ENST00000361321	T;T	0.03242	4.0;4.0	5.77	5.77	0.91146	Zinc finger, C2H2-like (1);	0.136731	0.64402	D	0.000003	T	0.06872	0.0175	L	0.34521	1.04	0.80722	D	1	D;D	0.76494	0.999;0.989	D;D	0.78314	0.991;0.978	T	0.30534	-0.9975	10	0.87932	D	0	.	16.0828	0.81017	1.0:0.0:0.0:0.0	.	1263;41	Q9H582;Q9H582-3	ZN644_HUMAN;.	S	1263;41;1263;41	ENSP00000359469:C1263S;ENSP00000337008:C1263S	ENSP00000337008:C1263S	C	-	1	0	ZNF644	91156201	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.380000	0.90149	2.199000	0.70637	0.528000	0.53228	TGC	ZNF644	-	smart_Znf_C2H2-like	ENSG00000122482		0.363	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2	284	0.00	0	A	NM_032186		91383613	91383613	-1	no_errors	ENST00000337393	ensembl	human	known	69_37n	missense	253	19.68	62	SNP	1.000	T
ZNF682	91120	genome.wustl.edu	37	19	20117638	20117638	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr19:20117638C>A	ENST00000397165.2	-	4	833	c.673G>T	c.(673-675)Gga>Tga	p.G225*	ZNF682_ENST00000358523.5_Nonsense_Mutation_p.G193*|ZNF682_ENST00000595736.1_Nonsense_Mutation_p.G149*|ZNF682_ENST00000597972.1_Nonsense_Mutation_p.G231*|ZNF682_ENST00000397162.1_Nonsense_Mutation_p.G193*|ZNF682_ENST00000596019.1_Intron	NM_033196.2	NP_149973.1	O95780	ZN682_HUMAN	zinc finger protein 682	225					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	14						GGTTTCTCTCCAGTGTGAATT	0.373																																						dbGAP											0													47.0	50.0	49.0					19																	20117638		2109	4254	6363	-	-	-	SO:0001587	stop_gained	0			AC006539	CCDS42533.1, CCDS42534.1	19p12	2014-02-13			ENSG00000197124	ENSG00000197124		"""Zinc fingers, C2H2-type"", ""-"""	28857	protein-coding gene	gene with protein product							Standard	NM_033196		Approved	BC39498_3	uc002noq.3	O95780	OTTHUMG00000182650	ENST00000397165.2:c.673G>T	19.37:g.20117638C>A	ENSP00000380351:p.Gly225*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU64|E9PFJ5|Q96JV9	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G225*	ENST00000397165.2	37	c.673	CCDS42533.1	19	.	.	.	.	.	.	.	.	.	.	C	34	5.324490	0.95708	.	.	ENSG00000197124	ENST00000397165;ENST00000397162;ENST00000358523	.	.	.	1.08	1.08	0.20341	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	7.5572	0.27831	0.0:1.0:0.0:0.0	.	.	.	.	X	225;193;193	.	ENSP00000351324:G193X	G	-	1	0	ZNF682	19978638	0.004000	0.15560	0.525000	0.27900	0.508000	0.34012	1.988000	0.40697	0.482000	0.27582	0.484000	0.47621	GGA	ZNF682	-	pfscan_Znf_C2H2	ENSG00000197124		0.373	ZNF682-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF682	HGNC	protein_coding	OTTHUMT00000462888.1	92	0.00	0	C	NM_033196		20117638	20117638	-1	no_errors	ENST00000397165	ensembl	human	known	69_37n	nonsense	121	18.12	27	SNP	1.000	A
ZNF705G	100131980	genome.wustl.edu	37	8	7217781	7217781	+	Silent	SNP	T	T	A			TCGA-D8-A1JL-01A-11D-A13L-09	TCGA-D8-A1JL-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	425dbc9f-6bee-412a-b77a-22a2724ea4c6	7929b553-0e4b-4bd4-ad98-5256d9aca6b8	g.chr8:7217781T>A	ENST00000400156.4	-	5	494	c.213A>T	c.(211-213)gtA>gtT	p.V71V	ZNF705G_ENST00000400078.2_Silent_p.V71V			A8MUZ8	Z705G_HUMAN	zinc finger protein 705G	71	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(9)	9						CTTGAAGAAATACTCTTCCTT	0.393																																						dbGAP											0													73.0	99.0	91.0					8																	7217781		671	1590	2261	-	-	-	SO:0001819	synonymous_variant	0				CCDS47773.1	8p23.1	2013-01-08			ENSG00000215372	ENSG00000215372		"""Zinc fingers, C2H2-type"", ""-"""	37134	protein-coding gene	gene with protein product							Standard	NM_001164457		Approved		uc022are.1	A8MUZ8	OTTHUMG00000165384	ENST00000400156.4:c.213A>T	8.37:g.7217781T>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V71	ENST00000400156.4	37	c.213		8																																																																																			ZNF705G	-	pfscan_Krueppel-associated_box	ENSG00000215372		0.393	ZNF705G-001	KNOWN	basic|appris_principal	protein_coding	ZNF705G	HGNC	protein_coding	OTTHUMT00000383776.1	248	0.00	0	T	XM_001720517		7217781	7217781	-1	no_errors	ENST00000400078	ensembl	human	known	69_37n	silent	274	10.46	32	SNP	0.270	A
