#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACBD3	64746	genome.wustl.edu	37	1	226334330	226334330	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:226334330C>G	ENST00000366812.5	-	8	1622	c.1568G>C	c.(1567-1569)aGa>aCa	p.R523T	RP11-275I14.4_ENST00000440540.1_RNA	NM_022735.3	NP_073572.2	Q9H3P7	GCP60_HUMAN	acyl-CoA binding domain containing 3	523	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				steroid biosynthetic process (GO:0006694)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)			breast(2)|endometrium(3)|large_intestine(5)|lung(7)|skin(1)|urinary_tract(2)	20	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.121)		ATAATAGACTCTGTAGTAGAC	0.398																																						dbGAP											0													70.0	71.0	70.0					1																	226334330		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB043587	CCDS1551.1	1q41	2013-10-16	2010-04-30	2003-11-12	ENSG00000182827	ENSG00000182827		"""A-kinase anchor proteins"""	15453	protein-coding gene	gene with protein product	"""PBR- and PKA-associated protein 7"""	606809	"""golgi complex associated protein 1, 60kDa"", ""acyl-Coenzyme A binding domain containing 3"""	GOLPH1, GOCAP1		12692076, 20150326	Standard	NM_022735		Approved	GCP60, PAP7	uc001hpy.3	Q9H3P7	OTTHUMG00000037560	ENST00000366812.5:c.1568G>C	1.37:g.226334330C>G	ENSP00000355777:p.Arg523Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB29|Q5VTJ0|Q6P9F1|Q8IZC5|Q8N4D6|Q9H6U3	Missense_Mutation	SNP	pfam_Acyl-CoA-binding_protein,superfamily_GOLD,superfamily_Acyl-CoA-binding_protein,pfscan_GOLD	p.R523T	ENST00000366812.5	37	c.1568	CCDS1551.1	1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397459	0.83120	.	.	ENSG00000182827	ENST00000366812	T	0.39787	1.06	5.74	5.74	0.90152	GOLD (2);	0.000000	0.85682	D	0.000000	T	0.60792	0.2296	L	0.46947	1.48	0.80722	D	1	D	0.67145	0.996	D	0.74348	0.983	T	0.61063	-0.7138	10	0.87932	D	0	-18.4786	19.9144	0.97043	0.0:1.0:0.0:0.0	.	523	Q9H3P7	GCP60_HUMAN	T	523	ENSP00000355777:R523T	ENSP00000355777:R523T	R	-	2	0	ACBD3	224400953	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.426000	0.80270	2.716000	0.92895	0.491000	0.48974	AGA	ACBD3	-	superfamily_GOLD,pfscan_GOLD	ENSG00000182827		0.398	ACBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACBD3	HGNC	protein_coding	OTTHUMT00000091528.1	36	0.00	0	C	NM_022735		226334330	226334330	-1	no_errors	ENST00000366812	ensembl	human	known	69_37n	missense	68	28.42	27	SNP	1.000	G
ACTN4	81	genome.wustl.edu	37	19	39207792	39207792	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:39207792G>A	ENST00000252699.2	+	10	1055	c.979G>A	c.(979-981)Gag>Aag	p.E327K	ACTN4_ENST00000390009.3_Missense_Mutation_p.E108K|ACTN4_ENST00000424234.2_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	327					actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GACTATCCAGGAGATGCAGCA	0.617																																					Colon(168;199 1940 10254 46213 46384)	dbGAP											0													87.0	69.0	75.0					19																	39207792		2203	4300	6503	-	-	-	SO:0001583	missense	0			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.979G>A	19.37:g.39207792G>A	ENSP00000252699:p.Glu327Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4K467|D6PXK4|O76048	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,pfscan_CH-domain,pfscan_EF_HAND_2	p.E327K	ENST00000252699.2	37	c.979	CCDS12518.1	19	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934763	0.73442	.	.	ENSG00000130402	ENST00000252699;ENST00000445727;ENST00000390009	T;T	0.70869	-0.52;-0.52	4.32	4.32	0.51571	.	0.141518	0.46145	D	0.000313	T	0.65811	0.2727	L	0.27053	0.805	0.80722	D	1	B;B	0.18461	0.028;0.008	B;B	0.36030	0.216;0.027	T	0.67122	-0.5750	10	0.66056	D	0.02	.	16.088	0.81070	0.0:0.0:1.0:0.0	.	327;327	E7EV83;O43707	.;ACTN4_HUMAN	K	327;327;108	ENSP00000252699:E327K;ENSP00000439497:E108K	ENSP00000252699:E327K	E	+	1	0	ACTN4	43899632	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.653000	0.83643	2.399000	0.81585	0.561000	0.74099	GAG	ACTN4	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000130402		0.617	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	HGNC	protein_coding	OTTHUMT00000268091.1	22	0.00	0	G			39207792	39207792	+1	no_errors	ENST00000252699	ensembl	human	known	69_37n	missense	43	41.89	31	SNP	1.000	A
ADAM29	11086	genome.wustl.edu	37	4	175899085	175899085	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr4:175899085G>C	ENST00000359240.3	+	5	3079	c.2409G>C	c.(2407-2409)caG>caC	p.Q803H	ADAM29_ENST00000445694.1_Missense_Mutation_p.Q803H|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000514159.1_Missense_Mutation_p.Q803H|ADAM29_ENST00000404450.4_Missense_Mutation_p.Q803H	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	803	9 X 9 AA approximate repeats.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CACCCTCCCAGAGGCAACCTC	0.572																																					Ovarian(140;1727 1835 21805 25838 41440)	dbGAP											0													132.0	124.0	127.0					4																	175899085		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2409G>C	4.37:g.175899085G>C	ENSP00000352177:p.Gln803His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.Q803H	ENST00000359240.3	37	c.2409	CCDS3823.1	4	.	.	.	.	.	.	.	.	.	.	G	8.275	0.814282	0.16537	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.01947	4.54;4.54;4.54;4.54	0.629	0.629	0.17687	.	.	.	.	.	T	0.01092	0.0036	N	0.08118	0	0.20563	N	0.999884	D	0.54964	0.969	B	0.38106	0.265	T	0.51442	-0.8705	8	.	.	.	.	4.5238	0.11971	0.0:0.4212:0.5787:1.0E-4	.	803	Q9UKF5	ADA29_HUMAN	H	803	ENSP00000352177:Q803H;ENSP00000414544:Q803H;ENSP00000384229:Q803H;ENSP00000423517:Q803H	.	Q	+	3	2	ADAM29	176135660	0.067000	0.21026	0.004000	0.12327	0.014000	0.08584	0.173000	0.16724	0.663000	0.31027	0.280000	0.19369	CAG	ADAM29	-	NULL	ENSG00000168594		0.572	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding		59	0.00	0	G			175899085	175899085	+1	no_errors	ENST00000359240	ensembl	human	known	69_37n	missense	83	43.54	64	SNP	0.718	C
ADCY8	114	genome.wustl.edu	37	8	132051878	132051878	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr8:132051878C>T	ENST00000286355.5	-	1	2794	c.702G>A	c.(700-702)aaG>aaA	p.K234K	ADCY8_ENST00000377928.3_Silent_p.K234K	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	234					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			AGGTGGTGTCCTTCCTGACCA	0.657										HNSCC(32;0.087)																												dbGAP											0													63.0	57.0	59.0					8																	132051878		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.702G>A	8.37:g.132051878C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.K234	ENST00000286355.5	37	c.702	CCDS6363.1	8																																																																																			ADCY8	-	NULL	ENSG00000155897		0.657	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	14	0.00	0	C			132051878	132051878	-1	no_errors	ENST00000286355	ensembl	human	known	69_37n	silent	15	51.61	16	SNP	1.000	T
ADCY9	115	genome.wustl.edu	37	16	4015811	4015811	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr16:4015811C>T	ENST00000294016.3	-	11	4565	c.4027G>A	c.(4027-4029)Gaa>Aaa	p.E1343K		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	1343					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TTGGTGAGTTCGTTGGCTTCT	0.512																																						dbGAP											0													196.0	179.0	184.0					16																	4015811		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.4027G>A	16.37:g.4015811C>T	ENSP00000294016:p.Glu1343Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.E1343K	ENST00000294016.3	37	c.4027	CCDS32382.1	16	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455172	0.84209	.	.	ENSG00000162104	ENST00000294016	D	0.84944	-1.92	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.80042	0.4551	L	0.29908	0.895	0.38405	D	0.945765	D	0.56968	0.978	B	0.43103	0.408	D	0.84257	0.0481	10	0.87932	D	0	.	15.789	0.78338	0.0:0.8646:0.1354:0.0	.	1343	O60503	ADCY9_HUMAN	K	1343	ENSP00000294016:E1343K	ENSP00000294016:E1343K	E	-	1	0	ADCY9	3955812	0.998000	0.40836	0.840000	0.33206	0.992000	0.81027	4.308000	0.59129	2.884000	0.98904	0.655000	0.94253	GAA	ADCY9	-	NULL	ENSG00000162104		0.512	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY9	HGNC	protein_coding	OTTHUMT00000438076.1	113	0.00	0	C			4015811	4015811	-1	no_errors	ENST00000294016	ensembl	human	known	69_37n	missense	122	40.20	82	SNP	0.949	T
ALS2CR11	151254	genome.wustl.edu	37	2	202410312	202410312	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr2:202410312C>T	ENST00000286195.3	-	11	1160	c.1116G>A	c.(1114-1116)acG>acA	p.T372T	ALS2CR11_ENST00000439802.1_Silent_p.T372T|ALS2CR11_ENST00000439140.1_Silent_p.T372T|ALS2CR11_ENST00000450242.1_Silent_p.T372T	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	372										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						GATTACTTTTCGTGTTTTCAG	0.239																																						dbGAP											0													59.0	62.0	61.0					2																	202410312		2202	4290	6492	-	-	-	SO:0001819	synonymous_variant	0			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1116G>A	2.37:g.202410312C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Silent	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.T372	ENST00000286195.3	37	c.1116	CCDS2349.1	2																																																																																			ALS2CR11	-	NULL	ENSG00000155754		0.239	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ALS2CR11	HGNC	protein_coding	OTTHUMT00000256296.2	61	0.00	0	C	NM_152525		202410312	202410312	-1	no_errors	ENST00000286195	ensembl	human	known	69_37n	silent	46	38.67	29	SNP	0.000	T
GMPPB	29925	genome.wustl.edu	37	3	49755912	49755912	+	3'UTR	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr3:49755912G>A	ENST00000480687.1	-	0	4472				RNF123_ENST00000433785.1_Intron|AMIGO3_ENST00000535833.1_Silent_p.I329I|RNF123_ENST00000497099.1_3'UTR|RNF123_ENST00000327697.6_Intron|AMIGO3_ENST00000320431.7_Silent_p.I329I			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCAGCACCGCGATGCTGCCAT	0.662																																						dbGAP											0													38.0	41.0	40.0					3																	49755912		2203	4299	6502	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*3273C>T	3.37:g.49755912G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6N5|Q9H7U3	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.I329	ENST00000480687.1	37	c.987	CCDS2803.1	3																																																																																			AMIGO3	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000176020		0.662	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMIGO3	HGNC	protein_coding	OTTHUMT00000350291.1	12	0.00	0	G	NM_013334		49755912	49755912	-1	no_errors	ENST00000320431	ensembl	human	known	69_37n	silent	10	54.55	12	SNP	0.003	A
ANKRD11	29123	genome.wustl.edu	37	16	89341577	89341577	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr16:89341577G>A	ENST00000301030.4	-	10	7953	c.7493C>T	c.(7492-7494)gCg>gTg	p.A2498V	ANKRD11_ENST00000378330.2_Missense_Mutation_p.A2498V	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2498					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CAGGGGCTCCGCCAGGGAGGG	0.637																																						dbGAP											0													15.0	15.0	15.0					16																	89341577		2194	4300	6494	-	-	-	SO:0001583	missense	0			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.7493C>T	16.37:g.89341577G>A	ENSP00000301030:p.Ala2498Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A2498V	ENST00000301030.4	37	c.7493	CCDS32513.1	16	.	.	.	.	.	.	.	.	.	.	G	25.2	4.618184	0.87359	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.38560	1.13;1.13	5.15	5.15	0.70609	.	0.088085	0.47455	D	0.000223	T	0.41858	0.1177	M	0.65975	2.015	0.80722	D	1	D	0.59357	0.985	B	0.40702	0.338	T	0.43798	-0.9369	10	0.40728	T	0.16	.	14.2433	0.65971	0.0:0.1494:0.8506:0.0	.	2498	Q6UB99	ANR11_HUMAN	V	2498	ENSP00000301030:A2498V;ENSP00000367581:A2498V	ENSP00000301030:A2498V	A	-	2	0	ANKRD11	87869078	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	6.247000	0.72411	2.564000	0.86499	0.650000	0.86243	GCG	ANKRD11	-	NULL	ENSG00000167522		0.637	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	HGNC	protein_coding	OTTHUMT00000430462.3	19	0.00	0	G	NM_013275		89341577	89341577	-1	no_errors	ENST00000301030	ensembl	human	known	69_37n	missense	4	78.26	18	SNP	0.993	A
ANKRD24	170961	genome.wustl.edu	37	19	4224161	4224164	+	Frame_Shift_Del	DEL	ACAG	ACAG	-			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	ACAG	ACAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:4224161_4224164delACAG	ENST00000600132.1	+	21	3611_3614	c.3335_3338delACAG	c.(3334-3339)tacagafs	p.YR1112fs	ANKRD24_ENST00000262970.5_Frame_Shift_Del_p.YR1202fs|ANKRD24_ENST00000318934.4_Frame_Shift_Del_p.YR1112fs	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	1112										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GTGGCTTTGTACAGAAGCCACCTC	0.588																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.3335_3338delACAG	19.37:g.4224161_4224164delACAG	ENSP00000471252:p.Tyr1112fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O75268|O95781	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Y1202fs	ENST00000600132.1	37	c.3605_3608	CCDS45925.1	19																																																																																			ANKRD24	-	NULL	ENSG00000089847		0.588	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKRD24	HGNC	protein_coding	OTTHUMT00000458188.1	20	0.00	0	ACAG	XM_114000		4224161	4224164	+1	no_errors	ENST00000262970	ensembl	human	known	69_37n	frame_shift_del	37	24.00	12	DEL	0.985:0.555:0.566:0.613	-
APLP2	334	genome.wustl.edu	37	11	129993538	129993538	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr11:129993538C>T	ENST00000263574.5	+	7	1026	c.954C>T	c.(952-954)ccC>ccT	p.P318P	APLP2_ENST00000338167.5_Silent_p.P318P|APLP2_ENST00000539648.1_Intron|APLP2_ENST00000278756.7_Silent_p.P328P|APLP2_ENST00000345598.5_Intron|APLP2_ENST00000528499.1_Intron|APLP2_ENST00000543137.1_Silent_p.P225P	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	318	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.				cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		TGACGGGGCCCTGCCGGGCCG	0.552																																						dbGAP											0													69.0	68.0	68.0					11																	129993538		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.954C>T	11.37:g.129993538C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Silent	SNP	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,pfam_Prot_inh_Kunz-m,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,superfamily_Prot_inh_Kunz-m,smart_Amyloid_glyco_extra,smart_Prot_inh_Kunz-m,prints_Amyloid_glyco,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.P318	ENST00000263574.5	37	c.954	CCDS8486.1	11																																																																																			APLP2	-	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	ENSG00000084234		0.552	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APLP2	HGNC	protein_coding	OTTHUMT00000386109.1	36	0.00	0	C	NM_001642		129993538	129993538	+1	no_errors	ENST00000263574	ensembl	human	known	69_37n	silent	38	48.65	36	SNP	1.000	T
ARHGAP35	2909	genome.wustl.edu	37	19	47425022	47425022	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:47425022G>C	ENST00000404338.3	+	1	3090	c.3090G>C	c.(3088-3090)gaG>gaC	p.E1030D		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	1030					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										GCAATTTTGAGAGTAAACTGA	0.423																																						dbGAP											0													55.0	53.0	53.0					19																	47425022		1858	4105	5963	-	-	-	SO:0001583	missense	0			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.3090G>C	19.37:g.47425022G>C	ENSP00000385720:p.Glu1030Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.E1030D	ENST00000404338.3	37	c.3090	CCDS46127.1	19	.	.	.	.	.	.	.	.	.	.	G	14.09	2.432509	0.43224	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.08008	3.14	5.76	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.09423	0.0232	L	0.28115	0.83	0.47037	D	0.99929	B	0.22746	0.074	B	0.38842	0.283	T	0.32161	-0.9917	10	0.29301	T	0.29	-38.0024	10.6052	0.45390	0.156:0.0:0.844:0.0	.	1030	Q9NRY4-2	.	D	1030	ENSP00000385720:E1030D	ENSP00000324820:E1030D	E	+	3	2	ARHGAP35	52116862	0.934000	0.31675	1.000000	0.80357	0.998000	0.95712	0.155000	0.16362	1.435000	0.47434	0.655000	0.94253	GAG	ARHGAP35	-	NULL	ENSG00000160007		0.423	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	HGNC	protein_coding	OTTHUMT00000466652.1	16	0.00	0	G	NM_004491		47425022	47425022	+1	no_errors	ENST00000404338	ensembl	human	known	69_37n	missense	18	30.77	8	SNP	1.000	C
ARSK	153642	genome.wustl.edu	37	5	94936613	94936613	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr5:94936613G>C	ENST00000380009.4	+	7	1364	c.1159G>C	c.(1159-1161)Gaa>Caa	p.E387Q		NM_198150.2	NP_937793.1	Q6UWY0	ARSK_HUMAN	arylsulfatase family, member K	387					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(1)	16		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		GTTATCATCAGAAACATTTAA	0.383																																						dbGAP											0													142.0	138.0	139.0					5																	94936613		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4073.1	5q15	2013-02-14	2006-03-07		ENSG00000164291	ENSG00000164291		"""Arylsulfatase family"""	25239	protein-coding gene	gene with protein product		610011	"""arylsulfatase K"""			12975309, 16174644	Standard	NM_198150		Approved	DKFZp313G1735, TSULF	uc003kld.3	Q6UWY0	OTTHUMG00000121166	ENST00000380009.4:c.1159G>C	5.37:g.94936613G>C	ENSP00000369346:p.Glu387Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDE3|B4E1I4|Q3ZCW3|Q8N3Q8	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.E387Q	ENST00000380009.4	37	c.1159	CCDS4073.1	5	.	.	.	.	.	.	.	.	.	.	G	11.59	1.684681	0.29872	.	.	ENSG00000164291	ENST00000380009	D	0.99894	-7.58	5.83	4.95	0.65309	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.463816	0.25319	N	0.031538	D	0.99369	0.9778	L	0.46157	1.445	0.80722	D	1	B	0.21688	0.059	B	0.18263	0.021	D	0.99977	1.2247	10	0.45353	T	0.12	-13.09	11.1795	0.48620	0.1483:0.0:0.8517:0.0	.	387	Q6UWY0	ARSK_HUMAN	Q	387	ENSP00000369346:E387Q	ENSP00000369346:E387Q	E	+	1	0	ARSK	94962369	0.385000	0.25172	0.991000	0.47740	0.985000	0.73830	1.698000	0.37794	1.442000	0.47568	0.650000	0.86243	GAA	ARSK	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000164291		0.383	ARSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSK	HGNC	protein_coding	OTTHUMT00000241652.2	73	0.00	0	G	NM_198150		94936613	94936613	+1	no_errors	ENST00000380009	ensembl	human	known	69_37n	missense	104	32.90	51	SNP	0.951	C
BCKDHA	593	genome.wustl.edu	37	19	41931969	41931969	+	IGR	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:41931969C>T	ENST00000269980.2	+	0	2103				CTC-435M10.6_ENST00000598887.1_RNA|B3GNT8_ENST00000601379.1_5'UTR|B3GNT8_ENST00000321702.2_Missense_Mutation_p.V239M	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						ACAAAACTCACGGTGGGGCAG	0.637																																						dbGAP											0													48.0	52.0	50.0					19																	41931969		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128		19.37:g.41931969C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DP47|E7EW46|Q16034|Q16472	Missense_Mutation	SNP	pfam_Glyco_trans_31	p.V239M	ENST00000269980.2	37	c.715	CCDS12581.1	19	.	.	.	.	.	.	.	.	.	.	C	15.82	2.947540	0.53186	.	.	ENSG00000177191	ENST00000321702	T	0.43688	0.94	4.14	4.14	0.48551	.	0.230375	0.34986	N	0.003538	T	0.65069	0.2656	M	0.76838	2.35	0.58432	D	0.999992	D	0.89917	1.0	D	0.79784	0.993	T	0.71310	-0.4631	10	0.87932	D	0	.	15.6834	0.77391	0.0:1.0:0.0:0.0	.	239	Q7Z7M8	B3GN8_HUMAN	M	239	ENSP00000312700:V239M	ENSP00000312700:V239M	V	-	1	0	B3GNT8	46623809	0.063000	0.20901	0.123000	0.21794	0.153000	0.21895	2.960000	0.49161	2.313000	0.78055	0.561000	0.74099	GTG	B3GNT8	-	pfam_Glyco_trans_31	ENSG00000177191		0.637	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT8	HGNC	protein_coding	OTTHUMT00000398313.3	9	0.00	0	C	NM_000709		41931969	41931969	-1	no_errors	ENST00000321702	ensembl	human	known	69_37n	missense	4	80.95	17	SNP	0.987	T
BANK1	55024	genome.wustl.edu	37	4	102839158	102839158	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr4:102839158T>G	ENST00000322953.4	+	7	1292	c.1018T>G	c.(1018-1020)Ttc>Gtc	p.F340V	BANK1_ENST00000428908.1_Missense_Mutation_p.F207V|BANK1_ENST00000444316.2_Missense_Mutation_p.F310V|BANK1_ENST00000504592.1_Missense_Mutation_p.F325V|BANK1_ENST00000508653.1_Missense_Mutation_p.F207V	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	340					B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		AGATACTCATTTCAAAGAACT	0.358																																						dbGAP											0													89.0	88.0	88.0					4																	102839158		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.1018T>G	4.37:g.102839158T>G	ENSP00000320509:p.Phe340Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.F340V	ENST00000322953.4	37	c.1018	CCDS34038.1	4	.	.	.	.	.	.	.	.	.	.	T	0.400	-0.918650	0.02396	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.16597	3.01;3.01;2.33;2.33;3.01	4.66	0.547	0.17202	.	1.631200	0.03469	N	0.213366	T	0.13798	0.0334	L	0.42245	1.32	0.09310	N	1	B;B;B	0.14012	0.002;0.009;0.009	B;B;B	0.12837	0.005;0.005;0.008	T	0.25745	-1.0123	10	0.27785	T	0.31	.	0.9956	0.01466	0.2404:0.1031:0.1641:0.4925	.	207;340;325	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	V	325;340;207;207;310	ENSP00000421443:F325V;ENSP00000320509:F340V;ENSP00000412748:F207V;ENSP00000422314:F207V;ENSP00000388817:F310V	ENSP00000320509:F340V	F	+	1	0	BANK1	103058181	0.003000	0.15002	0.010000	0.14722	0.447000	0.32167	0.166000	0.16583	-0.050000	0.13356	-0.274000	0.10170	TTC	BANK1	-	NULL	ENSG00000153064		0.358	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BANK1	HGNC	protein_coding	OTTHUMT00000363161.1	68	0.00	0	T	NM_017935		102839158	102839158	+1	no_errors	ENST00000322953	ensembl	human	known	69_37n	missense	49	48.42	46	SNP	0.002	G
BRPF3	27154	genome.wustl.edu	37	6	36181964	36181964	+	Silent	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr6:36181964C>G	ENST00000357641.6	+	8	3043	c.2790C>G	c.(2788-2790)ctC>ctG	p.L930L	BRPF3_ENST00000534694.1_Intron|BRPF3_ENST00000339717.7_Intron|BRPF3_ENST00000443324.2_Intron|BRPF3_ENST00000543502.1_Intron|BRPF3_ENST00000534400.1_Silent_p.L930L	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	930					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						CATCAGTCCTCTTCAAGAAGG	0.587																																						dbGAP											0													82.0	82.0	82.0					6																	36181964		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.2790C>G	6.37:g.36181964C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	NULL	p.L141V	ENST00000357641.6	37	c.421	CCDS34437.1	6																																																																																			BRPF3	-	NULL	ENSG00000096070		0.587	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	BRPF3	HGNC	protein_coding	OTTHUMT00000040335.3	19	0.00	0	C	NM_015695		36181964	36181964	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000441730	ensembl	human	known	69_37n	missense	22	40.54	15	SNP	1.000	G
MRGBP	55257	genome.wustl.edu	37	20	61430926	61430926	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr20:61430926C>T	ENST00000370487.3	+	5	617	c.546C>T	c.(544-546)gtC>gtT	p.V182V	OGFR-AS1_ENST00000431361.1_RNA	NM_018270.4	NP_060740.1	Q9NV56	MRGBP_HUMAN	MRG/MORF4L binding protein	182					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	H4/H2A histone acetyltransferase complex (GO:0043189)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											GCAGCCGGGTCACCGACAAAG	0.587																																						dbGAP											0													100.0	101.0	100.0					20																	61430926		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001776	CCDS13503.1	20q13.33	2012-10-29	2012-10-29	2012-10-29	ENSG00000101189	ENSG00000101189			15866	protein-coding gene	gene with protein product		611157	"""chromosome 20 open reading frame 20"""	C20orf20		12963728	Standard	NM_018270		Approved	FLJ10914, MRG15BP, Eaf7	uc002ydi.3	Q9NV56	OTTHUMG00000032940	ENST00000370487.3:c.546C>T	20.37:g.61430926C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8C4L5	Silent	SNP	pfam_EAF7	p.V182	ENST00000370487.3	37	c.546	CCDS13503.1	20																																																																																			C20orf20	-	NULL	ENSG00000101189		0.587	MRGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf20	HGNC	protein_coding	OTTHUMT00000080080.1	28	0.00	0	C	NM_018270		61430926	61430926	+1	no_errors	ENST00000370487	ensembl	human	known	69_37n	silent	35	39.66	23	SNP	1.000	T
CACNA1I	8911	genome.wustl.edu	37	22	40055477	40055477	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr22:40055477C>T	ENST00000402142.3	+	13	2370	c.2370C>T	c.(2368-2370)ctC>ctT	p.L790L	CACNA1I_ENST00000401624.1_Silent_p.L790L|CACNA1I_ENST00000400164.3_Silent_p.L755L|CACNA1I_ENST00000404898.1_Silent_p.L755L|CACNA1I_ENST00000336649.4_Silent_p.L796L|CACNA1I_ENST00000407673.1_Silent_p.L755L	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	790					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	AGTTCAGCCTCCGCACGGACA	0.567																																						dbGAP											0													56.0	55.0	55.0					22																	40055477		2094	4212	6306	-	-	-	SO:0001819	synonymous_variant	0			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.2370C>T	22.37:g.40055477C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.L796	ENST00000402142.3	37	c.2388	CCDS46710.1	22																																																																																			CACNA1I	-	pfam_Ion_trans_dom	ENSG00000100346		0.567	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	HGNC	protein_coding	OTTHUMT00000321290.1	49	0.00	0	C	NM_001003406		40055477	40055477	+1	no_errors	ENST00000336649	ensembl	human	known	69_37n	silent	18	73.13	49	SNP	0.972	T
CCDC155	147872	genome.wustl.edu	37	19	49912287	49912287	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:49912287G>A	ENST00000447857.3	+	13	1262	c.1057G>A	c.(1057-1059)Gag>Aag	p.E353K		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	353						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						GGGGCCCGATGAGTGAGTGGA	0.617																																						dbGAP											0													47.0	54.0	52.0					19																	49912287		2054	4191	6245	-	-	-	SO:0001630	splice_region_variant	0				CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.1058+1G>A	19.37:g.49912287G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MC3	Missense_Mutation	SNP	NULL	p.E353K	ENST00000447857.3	37	c.1057	CCDS46140.1	19	.	.	.	.	.	.	.	.	.	.	G	17.86	3.492730	0.64074	.	.	ENSG00000161609	ENST00000447857	T	0.33654	1.4	5.25	4.19	0.49359	.	0.657028	0.15383	N	0.265181	T	0.51873	0.1700	M	0.72479	2.2	0.32334	N	0.560695	D;D	0.64830	0.994;0.994	P;P	0.61397	0.888;0.888	T	0.56420	-0.7982	10	0.15499	T	0.54	-10.6854	12.0769	0.53649	0.0:0.1735:0.8265:0.0	.	353;353	C9JGW3;Q8N6L0	.;CC155_HUMAN	K	353	ENSP00000404220:E353K	ENSP00000404220:E353K	E	+	1	0	CCDC155	54604099	0.991000	0.36638	0.871000	0.34182	0.452000	0.32318	2.348000	0.44045	1.323000	0.45263	0.650000	0.86243	GAG	CCDC155	-	NULL	ENSG00000161609		0.617	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC155	HGNC	protein_coding	OTTHUMT00000465436.2	54	0.00	0	G	NM_144688	Missense_Mutation	49912287	49912287	+1	no_errors	ENST00000447857	ensembl	human	known	69_37n	missense	54	43.16	41	SNP	0.914	A
CCDC22	28952	genome.wustl.edu	37	X	49106129	49106129	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chrX:49106129C>G	ENST00000376227.3	+	16	1883	c.1713C>G	c.(1711-1713)atC>atG	p.I571M		NM_014008.3	NP_054727.1	O60826	CCD22_HUMAN	coiled-coil domain containing 22	571										NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	18						GCCAGCTCATCCAGACCATCG	0.672																																						dbGAP											0													49.0	40.0	43.0					X																	49106129		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC000972	CCDS14322.1	Xp11.23	2008-02-05	2005-07-24	2005-07-24	ENSG00000101997	ENSG00000101997			28909	protein-coding gene	gene with protein product		300859	"""chromosome X open reading frame 37"""	CXorf37		12477932	Standard	NM_014008		Approved	JM1	uc004dnd.2	O60826	OTTHUMG00000024141	ENST00000376227.3:c.1713C>G	X.37:g.49106129C>G	ENSP00000365401:p.Ile571Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7G1	Missense_Mutation	SNP	pfam_DUF812	p.I571M	ENST00000376227.3	37	c.1713	CCDS14322.1	X	.	.	.	.	.	.	.	.	.	.	C	16.25	3.068874	0.55539	.	.	ENSG00000101997	ENST00000376227	.	.	.	5.23	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.66066	0.2752	L	0.52126	1.63	0.51482	D	0.999922	D	0.60575	0.988	P	0.60789	0.879	T	0.66909	-0.5804	9	0.59425	D	0.04	-11.1649	11.6988	0.51558	0.0:0.9101:0.0:0.0899	.	571	O60826	CCD22_HUMAN	M	571	.	ENSP00000365401:I571M	I	+	3	3	CCDC22	48993073	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	0.751000	0.26348	0.973000	0.38340	0.429000	0.28392	ATC	CCDC22	-	pfam_DUF812	ENSG00000101997		0.672	CCDC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC22	HGNC	protein_coding	OTTHUMT00000060822.1	21	0.00	0	C	NM_014008		49106129	49106129	+1	no_errors	ENST00000376227	ensembl	human	known	69_37n	missense	16	52.94	18	SNP	1.000	G
CDH1	999	genome.wustl.edu	37	16	68855966	68855967	+	Frame_Shift_Ins	INS	-	-	C	rs35187787	byFrequency	TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr16:68855966_68855967insC	ENST00000261769.5	+	12	1965_1966	c.1774_1775insC	c.(1774-1776)gccfs	p.A592fs	CDH1_ENST00000562836.1_3'UTR|RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000422392.2_Frame_Shift_Ins_p.A531fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	592	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.		A -> T (in a thyroid cancer sample; may play a role in colorectal carcinogenesis; dbSNP:rs35187787). {ECO:0000269|PubMed:11562785, ECO:0000269|PubMed:8985087}.		adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.A592T(4)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		GAATGACAACGCCCCCATACCA	0.46			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	4	Substitution - Missense(4)	breast(2)|thyroid(1)|stomach(1)	GRCh37	CM994192	CDH1	M	rs35187787																																			-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1779dupC	16.37:g.68855971_68855971dupC	ENSP00000261769:p.Ala592fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I594fs	ENST00000261769.5	37	c.1774_1775	CCDS10869.1	16																																																																																			CDH1	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000039068		0.460	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	52	0.00	0	-	NM_004360		68855966	68855967	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_ins	19	69.84	44	INS	0.914:0.763	C
CDH26	60437	genome.wustl.edu	37	20	58560082	58560082	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr20:58560082C>T	ENST00000244047.5	+	7	1046	c.735C>T	c.(733-735)atC>atT	p.I245I	CDH26_ENST00000348616.4_Silent_p.I245I			Q8IXH8	CAD26_HUMAN	cadherin 26	245	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			CACTGCTAATCAGAGCCAGGG	0.463																																						dbGAP											0													65.0	55.0	59.0					20																	58560082		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.735C>T	20.37:g.58560082C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I245	ENST00000244047.5	37	c.735		20																																																																																			CDH26	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000124215		0.463	CDH26-201	KNOWN	basic	protein_coding	CDH26	HGNC	protein_coding		42	0.00	0	C	NM_177980		58560082	58560082	+1	no_errors	ENST00000244047	ensembl	human	known	69_37n	silent	45	53.61	52	SNP	0.000	T
CDK8	1024	genome.wustl.edu	37	13	26967647	26967647	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr13:26967647G>A	ENST00000381527.3	+	7	1293	c.790G>A	c.(790-792)Gat>Aat	p.D264N	CDK8_ENST00000536792.1_3'UTR	NM_001260.1	NP_001251.1	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	264	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	25	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		ATTTCCTGCAGGTACACATTA	0.353																																						dbGAP											0													172.0	165.0	167.0					13																	26967647		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X85753	CCDS9317.1	13q12	2011-11-08			ENSG00000132964	ENSG00000132964		"""Cyclin-dependent kinases"""	1779	protein-coding gene	gene with protein product		603184				7568034	Standard	NM_001260		Approved	K35	uc001uqr.1	P49336	OTTHUMG00000016617	ENST00000381527.3:c.790+1G>A	13.37:g.26967647G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUF3|Q6ISB5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D264N	ENST00000381527.3	37	c.790	CCDS9317.1	13	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656731	0.67586	.	.	ENSG00000132964	ENST00000381527	T	0.64991	-0.13	5.56	5.56	0.83823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.043120	0.85682	D	0.000000	T	0.56307	0.1976	L	0.31804	0.96	0.80722	D	1	B;B	0.18013	0.02;0.025	B;B	0.26770	0.044;0.073	T	0.50303	-0.8844	10	0.44086	T	0.13	-14.2783	19.8807	0.96899	0.0:0.0:1.0:0.0	.	264;264	P49336-2;P49336	.;CDK8_HUMAN	N	264	ENSP00000370938:D264N	ENSP00000370938:D264N	D	+	1	0	CDK8	25865647	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.771000	0.95319	0.650000	0.86243	GAT	CDK8	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000132964		0.353	CDK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK8	HGNC	protein_coding	OTTHUMT00000044250.1	75	0.00	0	G		Missense_Mutation	26967647	26967647	+1	no_errors	ENST00000381527	ensembl	human	known	69_37n	missense	44	51.11	46	SNP	1.000	A
CDKL1	8814	genome.wustl.edu	37	14	50862466	50862466	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr14:50862466C>T	ENST00000216378.2	-	2	768	c.124G>A	c.(124-126)Gac>Aac	p.D42N	CDKL1_ENST00000395834.1_Missense_Mutation_p.D42N|CDKL1_ENST00000356146.1_5'UTR|RP11-247L20.3_ENST00000556713.1_lincRNA	NM_001282236.1	NP_001269165.1	Q00532	CDKL1_HUMAN	cyclin-dependent kinase-like 1 (CDC2-related kinase)	41	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				heart development (GO:0007507)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|stomach(1)	12	all_epithelial(31;0.000746)|Breast(41;0.0102)					ATGACAGGGTCATCTTCTGAT	0.408																																						dbGAP											0													78.0	84.0	82.0					14																	50862466		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF390028	CCDS9699.1, CCDS73637.1	14q21.3	2011-11-04			ENSG00000100490	ENSG00000100490		"""Cyclin-dependent kinases"""	1781	protein-coding gene	gene with protein product		603441				1639063, 7595554	Standard	XM_005268157		Approved	KKIALRE	uc010anu.2	Q00532	OTTHUMG00000140290	ENST00000216378.2:c.124G>A	14.37:g.50862466C>T	ENSP00000216378:p.Asp42Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3A4|Q6QUA0|Q8WXQ5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D42N	ENST00000216378.2	37	c.124		14	.	.	.	.	.	.	.	.	.	.	C	13.24	2.177305	0.38413	.	.	ENSG00000100490	ENST00000395834;ENST00000216378	T;T	0.44083	0.93;0.93	4.34	4.34	0.51931	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.57592	0.2064	L	0.48642	1.525	0.80722	D	1	D;B	0.89917	1.0;0.305	D;B	0.87578	0.998;0.14	T	0.57318	-0.7832	9	0.44086	T	0.13	.	16.5314	0.84361	0.0:1.0:0.0:0.0	.	231;41	Q00532-2;Q00532	.;CDKL1_HUMAN	N	42	ENSP00000379176:D42N;ENSP00000216378:D42N	ENSP00000216378:D42N	D	-	1	0	CDKL1	49932216	1.000000	0.71417	0.998000	0.56505	0.009000	0.06853	5.573000	0.67417	2.364000	0.80123	0.561000	0.74099	GAC	CDKL1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000100490		0.408	CDKL1-003	PUTATIVE	basic|exp_conf	protein_coding	CDKL1	HGNC	protein_coding	OTTHUMT00000382103.1	82	0.00	0	C			50862466	50862466	-1	no_errors	ENST00000395834	ensembl	human	known	69_37n	missense	62	42.06	45	SNP	1.000	T
CEP120	153241	genome.wustl.edu	37	5	122714068	122714068	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr5:122714068C>A	ENST00000306467.5	-	15	2462	c.2158G>T	c.(2158-2160)Gag>Tag	p.E720*	CEP120_ENST00000328236.5_Nonsense_Mutation_p.E720*|CEP120_ENST00000306481.6_Nonsense_Mutation_p.E694*			Q8N960	CE120_HUMAN	centrosomal protein 120kDa	720					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)|regulation of protein localization (GO:0032880)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	29						TCTCGCTTCTCCAAGTCAATT	0.338																																						dbGAP											0													121.0	131.0	127.0					5																	122714068		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK095646	CCDS4134.2, CCDS54890.1	5q23.2	2014-02-20	2008-08-14	2008-08-14	ENSG00000168944	ENSG00000168944			26690	protein-coding gene	gene with protein product		613446	"""coiled-coil domain containing 100"""	CCDC100		17920017	Standard	NM_153223		Approved	FLJ36090	uc003ktk.3	Q8N960	OTTHUMG00000128922	ENST00000306467.5:c.2158G>T	5.37:g.122714068C>A	ENSP00000303058:p.Glu720*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AI52|Q6AW89|Q8IWB5|Q8N9Y0|Q8NDE8	Nonsense_Mutation	SNP	pfam_DUF3668,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.E720*	ENST00000306467.5	37	c.2158	CCDS4134.2	5	.	.	.	.	.	.	.	.	.	.	C	39	7.850127	0.98525	.	.	ENSG00000168944	ENST00000306467;ENST00000328236;ENST00000306481;ENST00000508442	.	.	.	5.8	5.8	0.92144	.	0.101502	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-23.6367	20.0563	0.97651	0.0:1.0:0.0:0.0	.	.	.	.	X	720;720;694;694	.	ENSP00000303058:E720X	E	-	1	0	CEP120	122741967	0.999000	0.42202	0.986000	0.45419	0.961000	0.63080	4.438000	0.59961	2.746000	0.94184	0.563000	0.77884	GAG	CEP120	-	NULL	ENSG00000168944		0.338	CEP120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP120	HGNC	protein_coding	OTTHUMT00000250899.2	87	0.00	0	C	NM_153223		122714068	122714068	-1	no_errors	ENST00000306467	ensembl	human	known	69_37n	nonsense	77	41.22	54	SNP	1.000	A
CHD4	1108	genome.wustl.edu	37	12	6701207	6701207	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr12:6701207T>A	ENST00000357008.2	-	20	3128	c.2965A>T	c.(2965-2967)Atc>Ttc	p.I989F	CHD4_ENST00000544040.1_Missense_Mutation_p.I982F|CHD4_ENST00000544484.1_Missense_Mutation_p.I986F|CHD4_ENST00000309577.6_Missense_Mutation_p.I989F	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	989					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						CGAGTGAGGATGTACTTGTAG	0.448																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													148.0	146.0	146.0					12																	6701207		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2965A>T	12.37:g.6701207T>A	ENSP00000349508:p.Ile989Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXZ5	Missense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.I989F	ENST00000357008.2	37	c.2965	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	T	24.8	4.574199	0.86542	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06	4.59	4.59	0.56863	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.86083	0.5848	M	0.68952	2.095	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.997	D;D;D	0.78314	0.953;0.979;0.991	D	0.87832	0.2645	10	0.87932	D	0	.	14.1276	0.65233	0.0:0.0:0.0:1.0	.	989;989;982	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	F	986;982;989;989;963	ENSP00000440392:I986F;ENSP00000440542:I982F;ENSP00000312419:I989F;ENSP00000349508:I989F	ENSP00000312419:I989F	I	-	1	0	CHD4	6571468	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.816000	0.86201	1.913000	0.55393	0.460000	0.39030	ATC	CHD4	-	pfam_SNF2_N	ENSG00000111642		0.448	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		65	0.00	0	T	NM_001273		6701207	6701207	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	missense	74	36.21	42	SNP	1.000	A
CHD4	1108	genome.wustl.edu	37	12	6715439	6715439	+	Splice_Site	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr12:6715439C>T	ENST00000357008.2	-	2	264		c.e2+1		CHD4_ENST00000544040.1_Splice_Site|CHD4_ENST00000544484.1_Splice_Site|CHD4_ENST00000309577.6_Splice_Site	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4						ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						GAAGATGTTACCTGGGTGGGG	0.642																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													52.0	52.0	52.0					12																	6715439		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.100+1G>A	12.37:g.6715439C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXZ5	Splice_Site	SNP	-	e1+1	ENST00000357008.2	37	c.100+1	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	C	15.10	2.732402	0.48939	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942;ENST00000545584	.	.	.	2.14	2.14	0.27477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8461	0.41028	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CHD4	6585700	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	3.969000	0.56816	1.511000	0.48818	0.385000	0.25706	.	CHD4	-	-	ENSG00000111642		0.642	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		13	0.00	0	C	NM_001273	Intron	6715439	6715439	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	splice_site	17	37.04	10	SNP	1.000	T
CHM	1121	genome.wustl.edu	37	X	85236772	85236772	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chrX:85236772G>A	ENST00000357749.2	-	3	187	c.158C>T	c.(157-159)tCa>tTa	p.S53L	CHM_ENST00000358786.4_Missense_Mutation_p.S53L|CHM_ENST00000537751.1_Intron|CHM_ENST00000467744.2_Intron	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	53					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				CAATAGTCCTGAAAAGCTAAA	0.318																																						dbGAP											0													47.0	42.0	43.0					X																	85236772		2203	4299	6502	-	-	-	SO:0001583	missense	0			X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.158C>T	X.37:g.85236772G>A	ENSP00000350386:p.Ser53Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4D2|O43732	Missense_Mutation	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.S53L	ENST00000357749.2	37	c.158	CCDS14454.1	X	.	.	.	.	.	.	.	.	.	.	G	21.4	4.143386	0.77888	.	.	ENSG00000188419	ENST00000357749;ENST00000358786	T;T	0.59502	0.26;0.26	4.8	4.8	0.61643	.	0.133554	0.49916	D	0.000125	T	0.69869	0.3159	M	0.68593	2.085	0.80722	D	1	D;P	0.60575	0.988;0.899	P;P	0.59703	0.862;0.473	T	0.73148	-0.4074	10	0.56958	D	0.05	-7.3038	13.8854	0.63706	0.0:0.0:1.0:0.0	.	53;53	A1L4D2;P24386	.;RAE1_HUMAN	L	53	ENSP00000350386:S53L;ENSP00000362228:S53L	ENSP00000350386:S53L	S	-	2	0	CHM	85123428	1.000000	0.71417	0.998000	0.56505	0.872000	0.50106	5.918000	0.69996	1.963000	0.57068	0.513000	0.50165	TCA	CHM	-	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort	ENSG00000188419		0.318	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	HGNC	protein_coding	OTTHUMT00000057396.3	46	0.00	0	G	NM_000390		85236772	85236772	-1	no_errors	ENST00000357749	ensembl	human	known	69_37n	missense	36	51.35	38	SNP	1.000	A
CPAMD8	27151	genome.wustl.edu	37	19	17015307	17015307	+	Silent	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:17015307G>A	ENST00000443236.1	-	31	4255	c.4224C>T	c.(4222-4224)ttC>ttT	p.F1408F	RN7SL835P_ENST00000579920.1_RNA	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1361						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						TGAAGCTCAAGAATGTGCCCT	0.577																																						dbGAP											0													94.0	101.0	99.0					19																	17015307		2008	4175	6183	-	-	-	SO:0001819	synonymous_variant	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.4224C>T	19.37:g.17015307G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Prot_inh_Kazal	p.S1419F	ENST00000443236.1	37	c.4256	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.322282	0.01320	.	.	ENSG00000160111	ENST00000443236	.	.	.	2.72	-1.09	0.09904	.	.	.	.	.	T	0.50463	0.1617	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40553	-0.9557	4	.	.	.	.	5.7282	0.18024	0.1908:0.0:0.6561:0.1532	.	.	.	.	F	1419	.	.	S	-	2	0	CPAMD8	16876307	1.000000	0.71417	0.137000	0.22149	0.002000	0.02628	2.048000	0.41278	-0.083000	0.12618	-1.702000	0.00720	TCT	CPAMD8	-	pfam_A2M_comp,superfamily_Terpenoid_cyclase/PrenylTrfase	ENSG00000160111		0.577	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	37	0.00	0	G	NM_015692		17015307	17015307	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000443236	ensembl	human	known	69_37n	missense	37	32.73	18	SNP	0.999	A
CPSF6	11052	genome.wustl.edu	37	12	69656307	69656307	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr12:69656307C>T	ENST00000435070.2	+	9	1734	c.1624C>T	c.(1624-1626)Cgt>Tgt	p.R542C	CPSF6_ENST00000456847.3_Missense_Mutation_p.R469C|CPSF6_ENST00000551516.1_Silent_p.S44S|CPSF6_ENST00000266679.8_Missense_Mutation_p.R579C	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	542	Arg-rich.|Sufficient for nuclear targeting.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			tgaccgagagcgtgaccgaga	0.478																																						dbGAP											0													214.0	148.0	171.0					12																	69656307		2203	4300	6503	-	-	-	SO:0001583	missense	0			X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.1624C>T	12.37:g.69656307C>T	ENSP00000391774:p.Arg542Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R579C	ENST00000435070.2	37	c.1735	CCDS8988.1	12	.	.	.	.	.	.	.	.	.	.	C	14.99	2.699125	0.48307	.	.	ENSG00000111605	ENST00000435070;ENST00000456847;ENST00000266679	T;T;T	0.62105	0.05;0.05;0.05	5.74	2.77	0.32553	.	0.000000	0.85682	D	0.000000	T	0.55768	0.1941	M	0.68952	2.095	0.80722	D	1	B;B;B	0.17465	0.001;0.022;0.013	B;B;B	0.08055	0.0;0.003;0.001	T	0.51442	-0.8705	9	.	.	.	-7.0161	10.204	0.43101	0.2435:0.6897:0.0:0.0668	.	291;579;542	B4DSU9;Q16630-2;Q16630	.;.;CPSF6_HUMAN	C	542;469;579	ENSP00000391774:R542C;ENSP00000391437:R469C;ENSP00000266679:R579C	.	R	+	1	0	CPSF6	67942574	0.991000	0.36638	0.435000	0.26784	0.957000	0.61999	2.330000	0.43885	0.827000	0.34685	0.650000	0.86243	CGT	CPSF6	-	NULL	ENSG00000111605		0.478	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF6	HGNC	protein_coding	OTTHUMT00000403609.1	62	0.00	0	C	NM_007007		69656307	69656307	+1	no_errors	ENST00000266679	ensembl	human	known	69_37n	missense	57	45.71	48	SNP	0.761	T
CSMD2	114784	genome.wustl.edu	37	1	34006792	34006792	+	Missense_Mutation	SNP	C	C	A	rs377226303	byFrequency	TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:34006792C>A	ENST00000373381.4	-	59	9571	c.9395G>T	c.(9394-9396)aGa>aTa	p.R3132I		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3106	Sushi 25. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CACAGATACTCTATGTGACTC	0.522																																						dbGAP											0													172.0	155.0	160.0					1																	34006792		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.9395G>T	1.37:g.34006792C>A	ENSP00000362479:p.Arg3132Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.R3132I	ENST00000373381.4	37	c.9395		1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951845	0.53293	.	.	ENSG00000121904	ENST00000373381	T	0.24723	1.84	5.58	5.58	0.84498	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.33265	0.0857	M	0.66939	2.045	0.80722	D	1	B;P	0.35383	0.322;0.498	B;B	0.40329	0.326;0.326	T	0.05084	-1.0907	10	0.39692	T	0.17	.	13.5173	0.61547	0.1558:0.8442:0.0:0.0	.	2988;3132	Q7Z408;E7EUA6	CSMD2_HUMAN;.	I	3132	ENSP00000362479:R3132I	ENSP00000241312:R2988I	R	-	2	0	CSMD2	33779379	1.000000	0.71417	0.967000	0.41034	0.848000	0.48234	4.040000	0.57333	2.622000	0.88805	0.462000	0.41574	AGA	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.522	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		54	0.00	0	C	NM_052896		34006792	34006792	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	65	44.44	52	SNP	0.853	A
CSDE1	7812	genome.wustl.edu	37	1	115284280	115284280	+	Intron	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:115284280C>T	ENST00000358528.4	-	3	427				CSDE1_ENST00000534699.1_Intron|CSDE1_ENST00000369530.1_Silent_p.E2E|CSDE1_ENST00000438362.2_Silent_p.E2E|CSDE1_ENST00000261443.5_Intron|CSDE1_ENST00000339438.6_Intron|CSDE1_ENST00000530886.1_Intron	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding						male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TAAAAACGTTCTCCATCTCAA	0.368																																						dbGAP											0													231.0	205.0	213.0					1																	115284280		692	1591	2283	-	-	-	SO:0001627	intron_variant	0				CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.1-1769G>A	1.37:g.115284280C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Silent	SNP	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold-like,smart_Cold_shock_prot	p.E2	ENST00000358528.4	37	c.6	CCDS30812.1	1																																																																																			CSDE1	-	NULL	ENSG00000009307		0.368	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CSDE1	HGNC	protein_coding	OTTHUMT00000033397.1	93	0.00	0	C	NM_007158		115284280	115284280	-1	no_errors	ENST00000369530	ensembl	human	known	69_37n	silent	69	47.73	63	SNP	1.000	T
DBR1	51163	genome.wustl.edu	37	3	137886069	137886069	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr3:137886069G>C	ENST00000260803.4	-	5	721	c.568C>G	c.(568-570)Ctt>Gtt	p.L190V	DBR1_ENST00000505015.2_5'UTR	NM_016216.3	NP_057300.2	Q9UK59	DBR1_HUMAN	debranching RNA lariats 1	190					mRNA splicing, via spliceosome (GO:0000398)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA lariat debranching enzyme activity (GO:0008419)			NS(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						TTAGTCTTAAGAAGTTGCTTC	0.348																																						dbGAP											0													70.0	71.0	71.0					3																	137886069		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF180919	CCDS33863.1	3q22.3	2013-05-01	2013-05-01		ENSG00000138231	ENSG00000138231			15594	protein-coding gene	gene with protein product		607024	"""debranching enzyme (S. Cerevisiae) homolog 1"", ""debranching enzyme homolog 1 (S. cerevisiae)"""			10982890	Standard	NM_016216		Approved		uc003erv.3	Q9UK59	OTTHUMG00000159824	ENST00000260803.4:c.568C>G	3.37:g.137886069G>C	ENSP00000260803:p.Leu190Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96GH0|Q9NXQ6	Missense_Mutation	SNP	pfam_DBR1_C,pfam_Metallo_PEstase_dom	p.L190V	ENST00000260803.4	37	c.568	CCDS33863.1	3	.	.	.	.	.	.	.	.	.	.	G	21.1	4.103455	0.76983	.	.	ENSG00000138231	ENST00000260803	T	0.46819	0.86	5.28	5.28	0.74379	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.67702	0.2921	M	0.79343	2.45	0.80722	D	1	D	0.62365	0.991	D	0.63033	0.91	T	0.70970	-0.4727	10	0.56958	D	0.05	-9.2061	16.4145	0.83729	0.0:0.0:1.0:0.0	.	190	Q9UK59	DBR1_HUMAN	V	190	ENSP00000260803:L190V	ENSP00000260803:L190V	L	-	1	0	DBR1	139368759	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.727000	0.68523	2.467000	0.83353	0.650000	0.86243	CTT	DBR1	-	pfam_Metallo_PEstase_dom	ENSG00000138231		0.348	DBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBR1	HGNC	protein_coding	OTTHUMT00000357585.1	56	0.00	0	G			137886069	137886069	-1	no_errors	ENST00000260803	ensembl	human	known	69_37n	missense	35	41.67	25	SNP	1.000	C
DDX54	79039	genome.wustl.edu	37	12	113599116	113599116	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr12:113599116C>T	ENST00000306014.5	-	19	2399	c.2372G>A	c.(2371-2373)cGa>cAa	p.R791Q	DDX54_ENST00000314045.7_Missense_Mutation_p.R791Q|DDX54_ENST00000549271.1_5'UTR	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	791					ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CTCTGGGCCTCGCCGGTCAGA	0.562																																						dbGAP											0													211.0	157.0	175.0					12																	113599116		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.2372G>A	12.37:g.113599116C>T	ENSP00000304072:p.Arg791Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YT8|Q9BRZ1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DBP10CT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R791Q	ENST00000306014.5	37	c.2372	CCDS31907.1	12	.	.	.	.	.	.	.	.	.	.	C	7.663	0.685320	0.14973	.	.	ENSG00000123064	ENST00000314045;ENST00000306014	T;T	0.09723	3.0;2.95	4.44	2.58	0.30949	DBP10CT (1);	0.501653	0.15921	N	0.238114	T	0.06234	0.0161	N	0.19112	0.55	0.30297	N	0.789812	B;B	0.13145	0.007;0.007	B;B	0.09377	0.004;0.002	T	0.31081	-0.9956	10	0.14656	T	0.56	.	8.7257	0.34467	0.0:0.7397:0.0:0.2603	.	791;791	Q8TDD1-2;Q8TDD1	.;DDX54_HUMAN	Q	791	ENSP00000323858:R791Q;ENSP00000304072:R791Q	ENSP00000304072:R791Q	R	-	2	0	DDX54	112083499	0.823000	0.29233	0.438000	0.26821	0.415000	0.31203	1.887000	0.39698	0.883000	0.36040	0.313000	0.20887	CGA	DDX54	-	NULL	ENSG00000123064		0.562	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DDX54	HGNC	protein_coding	OTTHUMT00000405435.1	52	0.00	0	C	NM_024072		113599116	113599116	-1	no_errors	ENST00000314045	ensembl	human	known	69_37n	missense	90	46.75	79	SNP	0.750	T
DNAJB5	25822	genome.wustl.edu	37	9	34996744	34996744	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr9:34996744G>A	ENST00000541010.1	+	2	3706	c.694G>A	c.(694-696)Gac>Aac	p.D232N	DNAJB5_ENST00000545841.1_Missense_Mutation_p.D232N|DNAJB5_ENST00000335998.3_Missense_Mutation_p.D266N|DNAJB5_ENST00000454002.2_Missense_Mutation_p.D304N|DNAJB5_ENST00000312316.5_Missense_Mutation_p.D232N|DNAJB5_ENST00000453597.3_Missense_Mutation_p.D346N			O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	232					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)			kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(32;0.00575)			CAAAGAAGGCGACGCCACACC	0.567																																						dbGAP											0													83.0	70.0	75.0					9																	34996744		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF088982	CCDS35007.1, CCDS47959.1, CCDS47960.1, CCDS47960.2	9p	2011-09-02			ENSG00000137094	ENSG00000137094		"""Heat shock proteins / DNAJ (HSP40)"""	14887	protein-coding gene	gene with protein product		611328				10570961, 11147971	Standard	NM_001135004		Approved	Hsc40	uc003zvs.4	O75953	OTTHUMG00000019840	ENST00000541010.1:c.694G>A	9.37:g.34996744G>A	ENSP00000443151:p.Asp232Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN14|B4DSA6|J3KQM9|J3KR08|Q5T656|Q8TDR7|Q96EM4	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.D304N	ENST00000541010.1	37	c.910	CCDS35007.1	9	.	.	.	.	.	.	.	.	.	.	G	24.0	4.481273	0.84747	.	.	ENSG00000137094	ENST00000453597;ENST00000335998;ENST00000378751;ENST00000312316;ENST00000541010;ENST00000454002;ENST00000545841	D;D;D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99;-1.99;-1.99	4.97	4.08	0.47627	HSP40/DnaJ peptide-binding (1);	0.044816	0.85682	D	0.000000	D	0.87030	0.6076	L	0.35249	1.045	0.80722	D	1	D;D	0.89917	1.0;0.992	D;P	0.85130	0.997;0.901	D	0.85488	0.1183	10	0.34782	T	0.22	.	12.5875	0.56426	0.0803:0.0:0.9197:0.0	.	304;232	B4DSA6;O75953	.;DNJB5_HUMAN	N	346;266;232;232;232;304;232	ENSP00000404079:D346N;ENSP00000337626:D266N;ENSP00000312517:D232N;ENSP00000443151:D232N;ENSP00000413684:D304N;ENSP00000441999:D232N	ENSP00000312517:D232N	D	+	1	0	DNAJB5	34986744	1.000000	0.71417	0.597000	0.28824	0.925000	0.55904	9.596000	0.98267	1.342000	0.45619	0.555000	0.69702	GAC	DNAJB5	-	superfamily_HSP40/DnaJ_pept-bd	ENSG00000137094		0.567	DNAJB5-008	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	DNAJB5	HGNC	protein_coding	OTTHUMT00000401397.1	18	0.00	0	G			34996744	34996744	+1	no_errors	ENST00000454002	ensembl	human	known	69_37n	missense	18	50.00	18	SNP	0.998	A
DOCK9	23348	genome.wustl.edu	37	13	99460049	99460049	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr13:99460049C>G	ENST00000376460.1	-	51	5502	c.5422G>C	c.(5422-5424)Gat>Cat	p.D1808H	DOCK9_ENST00000339416.2_Missense_Mutation_p.D1795H	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1809	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCATCTTCATCTTCAAAGAAT	0.423																																						dbGAP											0													136.0	126.0	130.0					13																	99460049		1848	4094	5942	-	-	-	SO:0001583	missense	0			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.5422G>C	13.37:g.99460049C>G	ENSP00000365643:p.Asp1808His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D1795H	ENST00000376460.1	37	c.5383	CCDS45062.1	13	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	20.6|20.6|20.6	4.018376|4.018376|4.018376	0.75275|0.75275|0.75275	.|.|.	.|.|.	ENSG00000088387|ENSG00000088387|ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000400220;ENST00000339416;ENST00000376453;ENST00000451563|ENST00000419908|ENST00000400228	T;T|.|.	0.16597|.|.	2.33;2.42|.|.	5.41|5.41|5.41	5.41|5.41|5.41	0.78517|0.78517|0.78517	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.75140|0.75140|0.75140	0.3809|0.3809|0.3809	M|M|M	0.67953|0.67953|0.67953	2.075|2.075|2.075	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D;B;D;D|.|.	0.71674|.|.	0.998;0.975;0.997;0.124;0.958;0.985|.|.	D;P;D;B;P;D|.|.	0.67382|.|.	0.923;0.873;0.951;0.103;0.602;0.94|.|.	T|T|T	0.73591|0.73591|0.73591	-0.3934|-0.3934|-0.3934	10|5|5	0.87932|.|.	D|.|.	0|.|.	.|.|.	19.2114|19.2114|19.2114	0.93757|0.93757|0.93757	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	514;427;1808;1809;464;426|.|.	B7Z6H5;B7Z2J2;Q9BZ29-5;Q9BZ29;B7Z6G9;F5H1Q4|.|.	.;.;.;DOCK9_HUMAN;.;.|.|.	H|N|T	1808;1809;1801;1786;1808;716;1795;426;159|211|370	ENSP00000365643:D1808H;ENSP00000341086:D1795H|.|.	ENSP00000341086:D1795H|.|.	D|K|R	-|-|-	1|3|2	0|2|0	DOCK9|DOCK9|DOCK9	98258050|98258050|98258050	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	7.463000|7.463000|7.463000	0.80869|0.80869|0.80869	2.544000|2.544000|2.544000	0.85801|0.85801|0.85801	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAT|AAG|AGA	DOCK9	-	NULL	ENSG00000088387		0.423	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK9	HGNC	protein_coding	OTTHUMT00000045566.1	121	0.00	0	C	NM_015296		99460049	99460049	-1	no_errors	ENST00000339416	ensembl	human	known	69_37n	missense	128	44.83	104	SNP	1.000	G
DSP	1832	genome.wustl.edu	37	6	7578090	7578090	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr6:7578090C>T	ENST00000379802.3	+	21	3297	c.2956C>T	c.(2956-2958)Cag>Tag	p.Q986*	DSP_ENST00000418664.2_Nonsense_Mutation_p.Q986*	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	986	Globular 1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GACCATGATTCAGTCCCCTTC	0.468																																						dbGAP											0													122.0	116.0	118.0					6																	7578090		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.2956C>T	6.37:g.7578090C>T	ENSP00000369129:p.Gln986*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Nonsense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.Q986*	ENST00000379802.3	37	c.2956	CCDS4501.1	6	.	.	.	.	.	.	.	.	.	.	C	43	10.475944	0.99412	.	.	ENSG00000096696	ENST00000379802;ENST00000418664;ENST00000397483	.	.	.	5.45	5.45	0.79879	.	0.000000	0.56097	D	0.000025	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	19.2837	0.94061	0.0:1.0:0.0:0.0	.	.	.	.	X	986;986;791	.	ENSP00000369129:Q986X	Q	+	1	0	DSP	7523089	1.000000	0.71417	0.998000	0.56505	0.688000	0.40055	4.572000	0.60886	2.553000	0.86117	0.655000	0.94253	CAG	DSP	-	smart_Spectrin/alpha-actinin	ENSG00000096696		0.468	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	43	0.00	0	C	NM_004415		7578090	7578090	+1	no_errors	ENST00000379802	ensembl	human	known	69_37n	nonsense	43	38.57	27	SNP	1.000	T
DUOX2	50506	genome.wustl.edu	37	15	45398520	45398520	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr15:45398520C>T	ENST00000603300.1	-	17	2153	c.1951G>A	c.(1951-1953)Gag>Aag	p.E651K	DUOX2_ENST00000389039.6_Missense_Mutation_p.E651K	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	651					adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CCTGGCCACTCCATCGCTGGG	0.592																																						dbGAP											0													71.0	53.0	59.0					15																	45398520		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.1951G>A	15.37:g.45398520C>T	ENSP00000475084:p.Glu651Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF-hand,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_Ca-bd,prints_Haem_peroxidase_animal_subgr,prints_Recoverin,pfscan_EF_HAND_2,pfscan_Haem_peroxidase_animal	p.E651K	ENST00000603300.1	37	c.1951	CCDS10117.1	15	.	.	.	.	.	.	.	.	.	.	C	33	5.238454	0.95240	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.79009	0.4374	M	0.74881	2.28	0.80722	D	1	P;D	0.89917	0.876;1.0	P;D	0.76071	0.463;0.987	T	0.81210	-0.1036	9	0.87932	D	0	-27.2263	16.503	0.84262	0.0:1.0:0.0:0.0	.	651;213	Q9NRD8;Q59GU9	DUOX2_HUMAN;.	K	651	.	ENSP00000373691:E651K	E	-	1	0	DUOX2	43185812	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.687000	0.74552	2.627000	0.88993	0.563000	0.77884	GAG	DUOX2	-	NULL	ENSG00000140279		0.592	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DUOX2	HGNC	protein_coding		37	0.00	0	C	NM_014080		45398520	45398520	-1	no_errors	ENST00000389039	ensembl	human	known	69_37n	missense	30	48.33	29	SNP	1.000	T
DZANK1	55184	genome.wustl.edu	37	20	18429657	18429657	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr20:18429657C>T	ENST00000358866.6	-	6	622	c.600G>A	c.(598-600)atG>atA	p.M200I	DZANK1_ENST00000329494.5_Missense_Mutation_p.M202I|DZANK1_ENST00000487128.1_5'UTR|DZANK1_ENST00000357236.4_Missense_Mutation_p.M86I|DZANK1_ENST00000262547.5_Missense_Mutation_p.M200I			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	200							zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						TTTGAATTCTCATTATCTCCG	0.368																																						dbGAP											0													140.0	132.0	135.0					20																	18429657		1867	4104	5971	-	-	-	SO:0001583	missense	0			AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.600G>A	20.37:g.18429657C>T	ENSP00000351734:p.Met200Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.M200I	ENST00000358866.6	37	c.600	CCDS46582.1	20	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150251	0.37923	.	.	ENSG00000089091	ENST00000377630;ENST00000262547;ENST00000329494;ENST00000414623;ENST00000377637;ENST00000357236	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.0	2.0	0.26442	.	0.852017	0.11074	N	0.602533	T	0.38241	0.1033	L	0.60455	1.87	0.30101	N	0.807448	B;B;B	0.32573	0.179;0.274;0.376	B;B;B	0.33960	0.057;0.122;0.173	T	0.37079	-0.9721	10	0.41790	T	0.15	-16.8458	8.0631	0.30644	0.0:0.7291:0.0:0.2709	.	219;86;200	B7Z631;Q9NVP4-4;Q9NVP4	.;.;DZAN1_HUMAN	I	27;200;202;26;26;86	ENSP00000366857:M27I;ENSP00000262547:M200I;ENSP00000328866:M202I;ENSP00000349774:M86I	ENSP00000262547:M200I	M	-	3	0	C20orf12	18377657	0.997000	0.39634	0.914000	0.36105	0.893000	0.52053	0.579000	0.23788	0.622000	0.30249	0.650000	0.86243	ATG	DZANK1	-	NULL	ENSG00000089091		0.368	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	DZANK1	HGNC	protein_coding	OTTHUMT00000471926.1	106	0.00	0	C	NM_001099407		18429657	18429657	-1	no_errors	ENST00000262547	ensembl	human	known	69_37n	missense	91	37.67	55	SNP	0.880	T
E2F1	1869	genome.wustl.edu	37	20	32267771	32267772	+	Frame_Shift_Ins	INS	-	-	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr20:32267771_32267772insA	ENST00000343380.5	-	3	500_501	c.361_362insT	c.(361-363)tccfs	p.S121fs		NM_005225.2	NP_005216.1	Q01094	E2F1_HUMAN	E2F transcription factor 1	121	Interaction with BIRC2/c-IAP1.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|DNA damage checkpoint (GO:0000077)|forebrain development (GO:0030900)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|mRNA stabilization (GO:0048255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(2)|breast(1)|endometrium(3)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	16						CTCCCCCGGGGATTTCACACCT	0.629																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS13224.1	20q11	2008-05-14			ENSG00000101412	ENSG00000101412			3113	protein-coding gene	gene with protein product		189971		RBBP3		8964493	Standard	NM_005225		Approved	RBP3	uc002wzu.4	Q01094	OTTHUMG00000032265	ENST00000343380.5:c.362dupT	20.37:g.32267772_32267772dupA	ENSP00000345571:p.Ser121fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13143|Q92768	Frame_Shift_Ins	INS	pfam_E2F_TDP	p.S121fs	ENST00000343380.5	37	c.362_361	CCDS13224.1	20																																																																																			E2F1	-	NULL	ENSG00000101412		0.629	E2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F1	HGNC	protein_coding	OTTHUMT00000078731.2	30	0.00	0	-			32267771	32267772	-1	no_errors	ENST00000343380	ensembl	human	known	69_37n	frame_shift_ins	37	32.73	18	INS	1.000:1.000	A
E2F1	1869	genome.wustl.edu	37	20	32267776	32267776	+	Silent	SNP	C	C	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr20:32267776C>A	ENST00000343380.5	-	3	496	c.357G>T	c.(355-357)gtG>gtT	p.V119V		NM_005225.2	NP_005216.1	Q01094	E2F1_HUMAN	E2F transcription factor 1	119	Interaction with BIRC2/c-IAP1.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|DNA damage checkpoint (GO:0000077)|forebrain development (GO:0030900)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|mRNA stabilization (GO:0048255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(2)|breast(1)|endometrium(3)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	16						CCGGGGATTTCACACCTGTGG	0.627																																						dbGAP											0													43.0	44.0	43.0					20																	32267776		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13224.1	20q11	2008-05-14			ENSG00000101412	ENSG00000101412			3113	protein-coding gene	gene with protein product		189971		RBBP3		8964493	Standard	NM_005225		Approved	RBP3	uc002wzu.4	Q01094	OTTHUMG00000032265	ENST00000343380.5:c.357G>T	20.37:g.32267776C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13143|Q92768	Silent	SNP	pfam_E2F_TDP	p.V119	ENST00000343380.5	37	c.357	CCDS13224.1	20																																																																																			E2F1	-	NULL	ENSG00000101412		0.627	E2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F1	HGNC	protein_coding	OTTHUMT00000078731.2	28	0.00	0	C			32267776	32267776	-1	no_errors	ENST00000343380	ensembl	human	known	69_37n	silent	30	35.29	18	SNP	1.000	A
EFCAB3	146779	genome.wustl.edu	37	17	60447652	60447652	+	Start_Codon_SNP	SNP	G	G	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr17:60447652G>T	ENST00000450662.2	+	1	74	c.3G>T	c.(1-3)atG>atT	p.M1I		NM_001144933.1	NP_001138405.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	0							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			AAGAAGAAATGAAGGAGTTGA	0.388																																						dbGAP											0													373.0	340.0	350.0					17																	60447652		692	1591	2283	-	-	-	SO:0001582	initiator_codon_variant	0			AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000450662.2:c.3G>T	17.37:g.60447652G>T	ENSP00000403932:p.Met1Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KQM8	Missense_Mutation	SNP	pfscan_EF_HAND_2	p.M1I	ENST00000450662.2	37	c.3	CCDS45751.1	17	.	.	.	.	.	.	.	.	.	.	.	13.21	2.168797	0.38315	.	.	ENSG00000172421	ENST00000450662	T	0.57273	0.41	3.98	-1.13	0.09775	.	.	.	.	.	T	0.47116	0.1428	.	.	.	0.36729	D	0.881616	.	.	.	.	.	.	T	0.54159	-0.8335	6	0.66056	D	0.02	.	1.003	0.01481	0.2311:0.1722:0.4208:0.1758	.	.	.	.	I	1	ENSP00000403932:M1I	ENSP00000403932:M1I	M	+	3	0	EFCAB3	57801383	0.946000	0.32159	0.939000	0.37840	0.829000	0.46940	0.543000	0.23237	-0.017000	0.14103	0.491000	0.48974	ATG	EFCAB3	-	NULL	ENSG00000172421		0.388	EFCAB3-002	KNOWN	basic|CCDS	protein_coding	EFCAB3	HGNC	protein_coding	OTTHUMT00000379315.1	111	0.00	0	G	NM_173503	Missense_Mutation	60447652	60447652	+1	no_errors	ENST00000450662	ensembl	human	known	69_37n	missense	30	71.15	74	SNP	0.642	T
EGR2	1959	genome.wustl.edu	37	10	64573125	64573125	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr10:64573125C>T	ENST00000242480.3	-	2	1598	c.1273G>A	c.(1273-1275)Gag>Aag	p.E425K	EGR2_ENST00000439032.1_Missense_Mutation_p.E425K|EGR2_ENST00000493899.2_5'Flank|EGR2_ENST00000411732.1_Missense_Mutation_p.E375K	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	425					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					CTTTTCCGCTCTTTCTGTCTC	0.617																																						dbGAP											0													122.0	112.0	115.0					10																	64573125		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.1273G>A	10.37:g.64573125C>T	ENSP00000242480:p.Glu425Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Missense_Mutation	SNP	pfam_DUF3446,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E425K	ENST00000242480.3	37	c.1273	CCDS7267.1	10	.	.	.	.	.	.	.	.	.	.	C	16.81	3.227141	0.58668	.	.	ENSG00000122877	ENST00000242480;ENST00000439032;ENST00000411732	T;T;T	0.13307	2.6;2.6;2.64	4.85	3.95	0.45737	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.14013	0.0339	N	0.05280	-0.08	0.52099	D	0.999947	D;D	0.64830	0.994;0.99	P;P	0.57846	0.828;0.677	T	0.19353	-1.0308	10	0.87932	D	0	-17.4181	12.3133	0.54940	0.0:0.9163:0.0:0.0837	.	375;425	P11161-2;P11161	.;EGR2_HUMAN	K	425;425;375	ENSP00000242480:E425K;ENSP00000402040:E425K;ENSP00000387634:E375K	ENSP00000242480:E425K	E	-	1	0	EGR2	64243131	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.609000	0.82925	1.266000	0.44231	0.655000	0.94253	GAG	EGR2	-	pfscan_Znf_C2H2	ENSG00000122877		0.617	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGR2	HGNC	protein_coding	OTTHUMT00000048245.2	77	0.00	0	C	NM_000399		64573125	64573125	-1	no_errors	ENST00000242480	ensembl	human	known	69_37n	missense	100	37.89	61	SNP	1.000	T
EMR3	84658	genome.wustl.edu	37	19	14749063	14749063	+	Silent	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:14749063G>C	ENST00000253673.5	-	11	1438	c.1338C>G	c.(1336-1338)ctC>ctG	p.L446L	EMR3_ENST00000443157.2_Silent_p.L320L|EMR3_ENST00000599900.1_Silent_p.L231L|EMR3_ENST00000344373.4_Silent_p.L394L	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	446					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						TCCGTGCAGTGAGGAAGAGGT	0.567																																						dbGAP											0													153.0	115.0	128.0					19																	14749063		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.1338C>G	19.37:g.14749063G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CD97	p.L446	ENST00000253673.5	37	c.1338	CCDS12315.1	19																																																																																			EMR3	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000131355		0.567	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR3	HGNC	protein_coding	OTTHUMT00000466488.1	43	0.00	0	G	NM_032571		14749063	14749063	-1	no_errors	ENST00000253673	ensembl	human	known	69_37n	silent	31	47.46	28	SNP	1.000	C
ERGIC1	57222	genome.wustl.edu	37	5	172324039	172324039	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr5:172324039C>T	ENST00000393784.3	+	3	256	c.117C>T	c.(115-117)ctC>ctT	p.L39L	ERGIC1_ENST00000523291.1_Silent_p.L39L|ERGIC1_ENST00000519860.1_3'UTR	NM_001031711.2	NP_001026881.1	Q969X5	ERGI1_HUMAN	endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1	39					ER to Golgi vesicle-mediated transport (GO:0006888)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)	9	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCCTCTTCCTCTTCCTCTCGG	0.512																																						dbGAP											0													286.0	213.0	238.0					5																	172324039		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF267855	CCDS34292.1	5q35.1	2009-11-06			ENSG00000113719	ENSG00000113719			29205	protein-coding gene	gene with protein product						10574461, 15308636	Standard	NM_001031711		Approved	ERGIC32, ERGIC-32, KIAA1181, NET24	uc003mbw.4	Q969X5	OTTHUMG00000130520	ENST00000393784.3:c.117C>T	5.37:g.172324039C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H0L0|Q9H2J2|Q9ULN9	Silent	SNP	pfam_DUF1692	p.L39	ENST00000393784.3	37	c.117	CCDS34292.1	5																																																																																			ERGIC1	-	NULL	ENSG00000113719		0.512	ERGIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERGIC1	HGNC	protein_coding	OTTHUMT00000252938.3	151	0.66	1	C	NM_020462		172324039	172324039	+1	no_errors	ENST00000393784	ensembl	human	known	69_37n	silent	181	46.61	158	SNP	1.000	T
ESPL1	9700	genome.wustl.edu	37	12	53680434	53680434	+	Nonsense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr12:53680434C>G	ENST00000257934.4	+	18	4005	c.3914C>G	c.(3913-3915)tCa>tGa	p.S1305*	ESPL1_ENST00000552462.1_Nonsense_Mutation_p.S1305*	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1305					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GTCCCTGGCTCAGAGCCCTCT	0.537																																					Colon(53;1069 1201 2587 5382)	dbGAP											0													42.0	44.0	43.0					12																	53680434		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.3914C>G	12.37:g.53680434C>G	ENSP00000257934:p.Ser1305*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Peptidase_C50	p.S1305*	ENST00000257934.4	37	c.3914	CCDS8852.1	12	.	.	.	.	.	.	.	.	.	.	C	41	9.046745	0.99048	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	.	.	.	5.26	4.13	0.48395	.	0.852017	0.10609	N	0.654677	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	7.3761	0.26829	0.0:0.8445:0.0:0.1555	.	.	.	.	X	1305;980;1305	.	ENSP00000257934:S1305X	S	+	2	0	ESPL1	51966701	0.648000	0.27313	0.988000	0.46212	0.791000	0.44710	1.718000	0.38001	1.117000	0.41842	0.561000	0.74099	TCA	ESPL1	-	NULL	ENSG00000135476		0.537	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	HGNC	protein_coding	OTTHUMT00000406899.2	35	0.00	0	C	NM_012291		53680434	53680434	+1	no_errors	ENST00000257934	ensembl	human	known	69_37n	nonsense	17	52.78	19	SNP	0.971	G
EVI5L	115704	genome.wustl.edu	37	19	7917980	7917980	+	Silent	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:7917980G>A	ENST00000270530.4	+	9	1192	c.996G>A	c.(994-996)caG>caA	p.Q332Q	EVI5L_ENST00000538904.2_Silent_p.Q332Q	NM_145245.3	NP_660288.1	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like	332					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	12						AGTACTTCCAGAGAGTGATCC	0.632											OREG0025211	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													119.0	119.0	119.0					19																	7917980		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC014111	CCDS12188.1, CCDS54209.1	19p13	2013-07-09				ENSG00000142459			30464	protein-coding gene	gene with protein product						23669355	Standard	NM_001159944		Approved		uc010xjz.2	Q96CN4		ENST00000270530.4:c.996G>A	19.37:g.7917980G>A		Somatic	645	WXS	Illumina GAIIx	Phase_IV	B9A6I9	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.Q332	ENST00000270530.4	37	c.996	CCDS12188.1	19																																																																																			EVI5L	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000142459		0.632	EVI5L-001	KNOWN	basic|CCDS	protein_coding	EVI5L	HGNC	protein_coding	OTTHUMT00000461347.1	29	0.00	0	G	NM_145245		7917980	7917980	+1	no_errors	ENST00000538904	ensembl	human	known	69_37n	silent	22	38.89	14	SNP	1.000	A
AMER1	139285	genome.wustl.edu	37	X	63412446	63412446	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chrX:63412446G>C	ENST00000330258.3	-	2	993	c.721C>G	c.(721-723)Cca>Gca	p.P241A	AMER1_ENST00000374869.3_Missense_Mutation_p.P241A|AMER1_ENST00000403336.1_Missense_Mutation_p.P241A	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	241					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									TCTGGTGTTGGAGAAACTTTT	0.542																																						dbGAP											67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)											96.0	95.0	95.0					X																	63412446		2203	4297	6500	-	-	-	SO:0001583	missense	0			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.721C>G	X.37:g.63412446G>C	ENSP00000329117:p.Pro241Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A2IB86|Q8N885	Missense_Mutation	SNP	pfam_Uncharacterised_FAM123	p.P241A	ENST00000330258.3	37	c.721	CCDS14377.2	X	.	.	.	.	.	.	.	.	.	.	G	3.601	-0.081624	0.07141	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.19105	2.17;2.17;2.17	4.59	2.65	0.31530	.	0.733624	0.12726	N	0.444253	T	0.13798	0.0334	L	0.36672	1.1	0.09310	N	1	P	0.36683	0.565	B	0.37550	0.253	T	0.17471	-1.0368	10	0.07990	T	0.79	0.2795	6.2042	0.20593	0.314:0.0:0.686:0.0	.	241	Q5JTC6	F123B_HUMAN	A	241	ENSP00000364003:P241A;ENSP00000329117:P241A;ENSP00000384722:P241A	ENSP00000329117:P241A	P	-	1	0	FAM123B	63329171	0.002000	0.14202	0.006000	0.13384	0.677000	0.39632	0.387000	0.20718	0.530000	0.28619	0.600000	0.82982	CCA	FAM123B	-	pfam_Uncharacterised_FAM123	ENSG00000184675		0.542	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM123B	HGNC	protein_coding	OTTHUMT00000316584.1	55	0.00	0	G	NM_152424		63412446	63412446	-1	no_errors	ENST00000330258	ensembl	human	known	69_37n	missense	27	48.08	25	SNP	0.054	C
FAM127B	26071	genome.wustl.edu	37	X	134186091	134186091	+	Silent	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chrX:134186091G>C	ENST00000370775.2	-	1	114	c.48C>G	c.(46-48)ctC>ctG	p.L16L	FAM127B_ENST00000520964.1_5'UTR	NM_001078172.1	NP_001071640.1	Q9BWD3	F127B_HUMAN	family with sequence similarity 127, member B	16										breast(3)|endometrium(2)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;0.000127)					CCGCGGGCCGGAGGGGCCCGG	0.687																																						dbGAP											0													53.0	58.0	56.0					X																	134186091		1929	4093	6022	-	-	-	SO:0001819	synonymous_variant	0			AL117556	CCDS43998.1	Xq26.3	2014-05-16			ENSG00000203950	ENSG00000203950			24514	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078172		Approved	DKFZP564B147, MAR8A, CXX1b	uc004eyf.3	Q9BWD3	OTTHUMG00000022466	ENST00000370775.2:c.48C>G	X.37:g.134186091G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2V9|Q8TBU2	Silent	SNP	NULL	p.L16	ENST00000370775.2	37	c.48	CCDS43998.1	X																																																																																			FAM127B	-	NULL	ENSG00000203950		0.687	FAM127B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM127B	HGNC	protein_coding	OTTHUMT00000058393.2	23	0.00	0	G	NM_001078172		134186091	134186091	-1	no_errors	ENST00000370775	ensembl	human	known	69_37n	silent	25	40.48	17	SNP	0.000	C
FAM162A	26355	genome.wustl.edu	37	3	122121674	122121674	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr3:122121674G>C	ENST00000477892.1	+	2	186	c.102G>C	c.(100-102)ttG>ttC	p.L34F	FAM162A_ENST00000232125.5_Missense_Mutation_p.L24F|FAM162A_ENST00000469967.1_Missense_Mutation_p.L34F	NM_014367.3	NP_055182.3	Q96A26	F162A_HUMAN	family with sequence similarity 162, member A	34					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to hypoxia (GO:0071456)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|transformed cell apoptotic process (GO:0006927)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6						GCTCTGATTTGAAGAGAATAA	0.373																																						dbGAP											0													80.0	75.0	77.0					3																	122121674		1827	4074	5901	-	-	-	SO:0001583	missense	0			AF191020	CCDS43139.1	3q21.1	2008-06-05	2008-06-05	2008-06-05	ENSG00000114023	ENSG00000114023			17865	protein-coding gene	gene with protein product		608017	"""chromosome 3 open reading frame 28"""	C3orf28		11085516	Standard	NM_014367		Approved	E2IG5	uc003eez.3	Q96A26	OTTHUMG00000159494	ENST00000477892.1:c.102G>C	3.37:g.122121674G>C	ENSP00000419088:p.Leu34Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NRN6|Q9UJX8	Missense_Mutation	SNP	pfam_DUF1075	p.L34F	ENST00000477892.1	37	c.102	CCDS43139.1	3	.	.	.	.	.	.	.	.	.	.	G	10.97	1.502410	0.26949	.	.	ENSG00000114023	ENST00000232125;ENST00000477892;ENST00000469967;ENST00000440333	T;T;T	0.34275	1.37;1.37;1.37	4.98	-0.131	0.13494	.	0.601209	0.14764	N	0.299835	T	0.33265	0.0857	M	0.80616	2.505	0.09310	N	0.999999	B;B	0.21688	0.059;0.018	B;B	0.24541	0.054;0.037	T	0.40021	-0.9585	10	0.48119	T	0.1	.	1.1846	0.01852	0.2623:0.1505:0.4324:0.1548	.	34;34	E9PH05;Q96A26	.;F162A_HUMAN	F	24;34;34;34	ENSP00000232125:L24F;ENSP00000419088:L34F;ENSP00000419491:L34F	ENSP00000232125:L24F	L	+	3	2	FAM162A	123604364	0.999000	0.42202	0.023000	0.16930	0.814000	0.46013	0.622000	0.24433	-0.218000	0.10018	0.650000	0.86243	TTG	FAM162A	-	pfam_DUF1075	ENSG00000114023		0.373	FAM162A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM162A	HGNC	protein_coding	OTTHUMT00000355766.1	81	0.00	0	G	NM_014367		122121674	122121674	+1	no_errors	ENST00000477892	ensembl	human	known	69_37n	missense	77	40.31	52	SNP	0.074	C
FAM175B	23172	genome.wustl.edu	37	10	126523424	126523424	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr10:126523424G>A	ENST00000298492.5	+	9	1177	c.1132G>A	c.(1132-1134)Gaa>Aaa	p.E378K		NM_032182.3	NP_115558.3	Q15018	F175B_HUMAN	family with sequence similarity 175, member B	378					cellular response to freezing (GO:0071497)	BRISC complex (GO:0070552)|cytoplasm (GO:0005737)	polyubiquitin binding (GO:0031593)			NS(1)	1						CAGTGATTATGAAAATTTGAT	0.507																																						dbGAP											0													62.0	61.0	61.0					10																	126523424		2203	4300	6503	-	-	-	SO:0001583	missense	0			D63877	CCDS31308.2	10q26.2	2013-01-24	2008-07-02	2008-07-02	ENSG00000165660	ENSG00000165660			28975	protein-coding gene	gene with protein product	"""Abraxas brother"""	611144	"""KIAA0157"""	KIAA0157		8590280	Standard	NM_032182		Approved	Em:AC068896.4, ABRO1	uc001lib.4	Q15018	OTTHUMG00000019218	ENST00000298492.5:c.1132G>A	10.37:g.126523424G>A	ENSP00000298492:p.Glu378Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKR2|Q96H11	Missense_Mutation	SNP	prints_FAM175_BRISC_cplx_Abro1_su,prints_FAM175	p.E378K	ENST00000298492.5	37	c.1132	CCDS31308.2	10	.	.	.	.	.	.	.	.	.	.	G	20.0	3.931142	0.73327	.	.	ENSG00000165660	ENST00000298492	T	0.59906	0.23	5.25	5.25	0.73442	.	0.114911	0.56097	D	0.000025	T	0.41880	0.1178	N	0.19112	0.55	0.58432	D	0.999992	B	0.26602	0.154	B	0.23716	0.048	T	0.26950	-1.0088	10	0.34782	T	0.22	-44.3116	13.0384	0.58885	0.0749:0.0:0.9251:0.0	.	378	Q15018	F175B_HUMAN	K	378	ENSP00000298492:E378K	ENSP00000298492:E378K	E	+	1	0	FAM175B	126513414	1.000000	0.71417	0.998000	0.56505	0.900000	0.52787	4.781000	0.62389	2.836000	0.97738	0.655000	0.94253	GAA	FAM175B	-	NULL	ENSG00000165660		0.507	FAM175B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM175B	HGNC	protein_coding	OTTHUMT00000050891.2	30	0.00	0	G	NM_032182		126523424	126523424	+1	no_errors	ENST00000298492	ensembl	human	known	69_37n	missense	24	33.33	12	SNP	1.000	A
FASTK	10922	genome.wustl.edu	37	7	150774051	150774051	+	Silent	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr7:150774051C>G	ENST00000297532.6	-	9	1568	c.1491G>C	c.(1489-1491)tcG>tcC	p.S497S	RP11-148K1.12_ENST00000485974.1_RNA|FASTK_ENST00000489884.1_5'UTR|FASTK_ENST00000482571.1_Silent_p.S470S|FASTK_ENST00000540185.1_3'UTR|FASTK_ENST00000353841.2_Silent_p.S356S	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	497	RAP. {ECO:0000255|PROSITE- ProRule:PRU00619}.				apoptotic signaling pathway (GO:0097190)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|Fas-activated serine/threonine kinase activity (GO:0033867)|protein serine/threonine kinase activity (GO:0004674)			lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		TCAGGGCCCTCGAGCCCAGCA	0.721																																						dbGAP											0													19.0	23.0	22.0					7																	150774051		2198	4297	6495	-	-	-	SO:0001819	synonymous_variant	0				CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896			24676	protein-coding gene	gene with protein product		606965				7544399, 15572676	Standard	NM_006712		Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.1491G>C	7.37:g.150774051C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K867|F8VTW9|Q59EM8|Q8IVA0	Silent	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.S497	ENST00000297532.6	37	c.1491	CCDS5918.1	7																																																																																			FASTK	-	pfam_RAP,smart_RAP	ENSG00000164896		0.721	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTK	HGNC	protein_coding	OTTHUMT00000351832.2	11	0.00	0	C	NM_006712		150774051	150774051	-1	no_errors	ENST00000297532	ensembl	human	known	69_37n	silent	12	51.85	14	SNP	0.008	G
FN1	2335	genome.wustl.edu	37	2	216284067	216284067	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr2:216284067C>T	ENST00000359671.1	-	12	1982	c.1717G>A	c.(1717-1719)Gga>Aga	p.G573R	FN1_ENST00000323926.6_Missense_Mutation_p.G573R|FN1_ENST00000426059.1_Missense_Mutation_p.G573R|FN1_ENST00000432072.2_Missense_Mutation_p.G573R|FN1_ENST00000336916.4_Missense_Mutation_p.G573R|FN1_ENST00000346544.3_Missense_Mutation_p.G573R|FN1_ENST00000357009.2_Missense_Mutation_p.G573R|FN1_ENST00000421182.1_Missense_Mutation_p.G573R|FN1_ENST00000354785.4_Missense_Mutation_p.G573R|FN1_ENST00000345488.5_Missense_Mutation_p.G573R|FN1_ENST00000357867.4_Missense_Mutation_p.G573R|FN1_ENST00000446046.1_Missense_Mutation_p.G573R|FN1_ENST00000443816.1_Missense_Mutation_p.G573R|FN1_ENST00000356005.4_Missense_Mutation_p.G573R			P02751	FINC_HUMAN	fibronectin 1	573	Collagen-binding.|Fibronectin type-I 9. {ECO:0000255|PROSITE-ProRule:PRU00478}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CATGAATCTCCAATTTGATAA	0.428																																						dbGAP											0													124.0	111.0	115.0					2																	216284067		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.1717G>A	2.37:g.216284067C>T	ENSP00000352696:p.Gly573Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.G573R	ENST00000359671.1	37	c.1717		2	.	.	.	.	.	.	.	.	.	.	C	36	5.670194	0.96754	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000426059	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.60171	0.21;0.21;0.21;0.21;0.21;0.21;0.21;0.21;0.21;0.21;0.21;0.21;0.21;0.21	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000003	T	0.77611	0.4156	M	0.72894	2.215	0.80722	D	1	D;D;D;P;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.953;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;B;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.408;1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.77571	-0.2538	10	0.87932	D	0	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	573;573;573;573;573;573;573;573;573;573;573	E9PG29;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.	R	573	ENSP00000394423:G573R;ENSP00000323534:G573R;ENSP00000338200:G573R;ENSP00000350534:G573R;ENSP00000346839:G573R;ENSP00000352696:G573R;ENSP00000265312:G573R;ENSP00000273049:G573R;ENSP00000349509:G573R;ENSP00000410422:G573R;ENSP00000415018:G573R;ENSP00000399538:G573R;ENSP00000348285:G573R;ENSP00000398907:G573R	ENSP00000265313:G573R	G	-	1	0	FN1	215992312	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	GGA	FN1	-	pfam_Fibronectin_type1,smart_Fibronectin_type1,pfscan_Fibronectin_type1	ENSG00000115414		0.428	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding		74	0.00	0	C	NM_212476		216284067	216284067	-1	no_errors	ENST00000354785	ensembl	human	known	69_37n	missense	71	42.74	53	SNP	1.000	T
FOXA1	3169	genome.wustl.edu	37	14	38061347	38061347	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr14:38061347C>A	ENST00000250448.2	-	2	703	c.642G>T	c.(640-642)tgG>tgT	p.W214C	FOXA1_ENST00000540786.1_Missense_Mutation_p.W181C|FOXA1_ENST00000545425.2_5'UTR	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	214					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		TGGAGTTCTGCCAGCGCTGCT	0.617																																						dbGAP											0													51.0	50.0	51.0					14																	38061347		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.642G>T	14.37:g.38061347C>A	ENSP00000250448:p.Trp214Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.W214C	ENST00000250448.2	37	c.642	CCDS9665.1	14	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969261	0.74246	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	D;D	0.99252	-5.63;-5.63	4.0	4.0	0.46444	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);Transcription factor, fork head, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99694	0.9884	H	0.99336	4.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96965	0.9704	10	0.87932	D	0	.	15.0053	0.71507	0.0:1.0:0.0:0.0	.	214	P55317	FOXA1_HUMAN	C	214;181	ENSP00000250448:W214C;ENSP00000440178:W181C	ENSP00000250448:W214C	W	-	3	0	FOXA1	37131098	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.551000	0.82182	2.057000	0.61298	0.400000	0.26472	TGG	FOXA1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000129514		0.617	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	23	0.00	0	C			38061347	38061347	-1	no_errors	ENST00000250448	ensembl	human	known	69_37n	missense	22	43.59	17	SNP	1.000	A
FREM2	341640	genome.wustl.edu	37	13	39438637	39438637	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr13:39438637T>A	ENST00000280481.7	+	16	8093	c.7877T>A	c.(7876-7878)tTc>tAc	p.F2626Y		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2626					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ACCTTGCGCTTCTACCGGAAC	0.453																																						dbGAP											0													146.0	136.0	139.0					13																	39438637		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.7877T>A	13.37:g.39438637T>A	ENSP00000280481:p.Phe2626Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.F2626Y	ENST00000280481.7	37	c.7877	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	T	24.7	4.560504	0.86335	.	.	ENSG00000150893	ENST00000280481	T	0.23552	1.9	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.57095	0.2030	M	0.87328	2.875	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.998	T	0.65084	-0.6254	10	0.66056	D	0.02	.	15.5494	0.76137	0.0:0.0:0.0:1.0	.	2626;2626	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	Y	2626	ENSP00000280481:F2626Y	ENSP00000280481:F2626Y	F	+	2	0	FREM2	38336637	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	7.972000	0.88022	2.141000	0.66446	0.528000	0.53228	TTC	FREM2	-	NULL	ENSG00000150893		0.453	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	68	0.00	0	T	NM_207361		39438637	39438637	+1	no_errors	ENST00000280481	ensembl	human	known	69_37n	missense	79	10.23	9	SNP	1.000	A
FSCB	84075	genome.wustl.edu	37	14	44975125	44975125	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr14:44975125C>T	ENST00000340446.4	-	1	1357	c.1066G>A	c.(1066-1068)Gaa>Aaa	p.E356K	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	356	Pro-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		GGGGACTCTTCAGCTGATGGA	0.507																																						dbGAP											0													78.0	91.0	87.0					14																	44975125		2200	4300	6500	-	-	-	SO:0001583	missense	0			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1066G>A	14.37:g.44975125C>T	ENSP00000344579:p.Glu356Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	NULL	p.E356K	ENST00000340446.4	37	c.1066	CCDS9679.1	14	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425198	0.62733	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.13538	2.58	4.76	0.398	0.16319	.	.	.	.	.	T	0.11836	0.0288	L	0.52126	1.63	0.09310	N	1	P	0.40332	0.713	B	0.39562	0.303	T	0.24693	-1.0153	9	0.23891	T	0.37	-6.3219	6.6975	0.23207	0.0:0.4085:0.4194:0.1721	.	356	Q5H9T9	FSCB_HUMAN	K	356	ENSP00000344579:E356K	ENSP00000344579:E356K	E	-	1	0	FSCB	44044875	.	.	0.001000	0.08648	0.063000	0.16089	.	.	0.168000	0.19655	0.505000	0.49811	GAA	FSCB	-	NULL	ENSG00000189139		0.507	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1	69	0.00	0	C	NM_032135		44975125	44975125	-1	no_errors	ENST00000340446	ensembl	human	known	69_37n	missense	55	33.73	28	SNP	0.007	T
GANAB	23193	genome.wustl.edu	37	11	62398569	62398569	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr11:62398569G>C	ENST00000356638.3	-	10	1099	c.1083C>G	c.(1081-1083)atC>atG	p.I361M	GANAB_ENST00000534422.1_5'Flank|GANAB_ENST00000540933.1_Missense_Mutation_p.I264M|GANAB_ENST00000346178.4_Missense_Mutation_p.I383M|GANAB_ENST00000534779.1_Missense_Mutation_p.I269M	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	361					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	AGACGTCAATGATGCCAGTCT	0.532																																					Melanoma(23;1005 1074 15747 18937)	dbGAP											0													278.0	257.0	264.0					11																	62398569		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.1083C>G	11.37:g.62398569G>C	ENSP00000349053:p.Ile361Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd	p.I383M	ENST00000356638.3	37	c.1149	CCDS8026.1	11	.	.	.	.	.	.	.	.	.	.	G	13.85	2.359063	0.41801	.	.	ENSG00000089597	ENST00000346178;ENST00000356638;ENST00000534779;ENST00000540933	D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02	5.27	-1.63	0.08345	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.85522	0.5716	M	0.71036	2.16	0.47584	D	0.999464	P;P;P;B	0.38922	0.458;0.458;0.651;0.354	B;B;B;P	0.47981	0.313;0.313;0.165;0.563	T	0.83041	-0.0157	10	0.72032	D	0.01	-22.511	9.9744	0.41774	0.585:0.0:0.415:0.0	.	247;269;361;383	B4DIW2;E9PKU7;Q14697;Q14697-2	.;.;GANAB_HUMAN;.	M	383;361;269;264	ENSP00000340466:I383M;ENSP00000349053:I361M;ENSP00000435306:I269M;ENSP00000442962:I264M	ENSP00000340466:I383M	I	-	3	3	GANAB	62155145	1.000000	0.71417	0.620000	0.29132	0.730000	0.41778	1.755000	0.38379	-0.144000	0.11314	-0.253000	0.11424	ATC	GANAB	-	superfamily_Glyco_hydro-type_carb-bd	ENSG00000089597		0.532	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GANAB	HGNC	protein_coding	OTTHUMT00000395689.1	62	0.00	0	G	NM_198334		62398569	62398569	-1	no_errors	ENST00000346178	ensembl	human	known	69_37n	missense	68	35.85	38	SNP	0.999	C
GRIK3	2899	genome.wustl.edu	37	1	37267521	37267521	+	Silent	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:37267521G>A	ENST00000373091.3	-	16	2707	c.2691C>T	c.(2689-2691)ttC>ttT	p.F897F		NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	897					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GGCGGTCATTGAATGTGTGCA	0.597																																						dbGAP											0													114.0	92.0	99.0					1																	37267521		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2691C>T	1.37:g.37267521G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1Z8|B1AMS6|Q13004|Q16136	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.F897	ENST00000373091.3	37	c.2691	CCDS416.1	1																																																																																			GRIK3	-	NULL	ENSG00000163873		0.597	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	53	0.00	0	G	NM_000831		37267521	37267521	-1	no_errors	ENST00000373091	ensembl	human	known	69_37n	silent	39	38.10	24	SNP	1.000	A
GORAB	92344	genome.wustl.edu	37	1	170508363	170508363	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:170508363C>T	ENST00000367763.3	+	2	169	c.149C>T	c.(148-150)cCa>cTa	p.P50L	GORAB_ENST00000367762.1_Missense_Mutation_p.P50L|GORAB_ENST00000465717.1_3'UTR	NM_152281.2	NP_689494.2	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting	50						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|liver(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	17						CCATTTGAACCACAGCGACGT	0.378																																						dbGAP											0													49.0	51.0	50.0					1																	170508363		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK021814	CCDS1289.1, CCDS53428.1	1q24.2	2009-02-13	2009-02-13	2009-02-13	ENSG00000120370	ENSG00000120370			25676	protein-coding gene	gene with protein product	"""gerodermia osteodysplastica"""	607983	"""SCY1-like 1 binding protein 1"""	SCYL1BP1		12783284, 15781263, 18997784	Standard	NM_152281		Approved	FLJ11752, NTKL-BP1, GO	uc001gha.2	Q5T7V8	OTTHUMG00000035228	ENST00000367763.3:c.149C>T	1.37:g.170508363C>T	ENSP00000356737:p.Pro50Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49A22|Q6P1P9|Q9HAE6|Q9Y350	Missense_Mutation	SNP	pfam_Golgin_RAB6-interacting	p.P50L	ENST00000367763.3	37	c.149	CCDS1289.1	1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679709	0.68042	.	.	ENSG00000120370	ENST00000367763;ENST00000367762	T;T	0.62232	0.04;0.04	5.34	5.34	0.76211	.	0.243854	0.45606	D	0.000351	T	0.73321	0.3572	M	0.68952	2.095	0.51767	D	0.999934	D	0.71674	0.998	D	0.66351	0.943	T	0.74948	-0.3490	10	0.62326	D	0.03	-8.0341	19.0059	0.92851	0.0:1.0:0.0:0.0	.	50	Q5T7V8	GORAB_HUMAN	L	50	ENSP00000356737:P50L;ENSP00000356736:P50L	ENSP00000356736:P50L	P	+	2	0	GORAB	168774987	0.936000	0.31750	0.998000	0.56505	0.439000	0.31926	0.936000	0.28938	2.642000	0.89623	0.650000	0.86243	CCA	GORAB	-	NULL	ENSG00000120370		0.378	GORAB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GORAB	HGNC	protein_coding	OTTHUMT00000085226.1	32	0.00	0	C	NM_152281		170508363	170508363	+1	no_errors	ENST00000367763	ensembl	human	known	69_37n	missense	50	25.37	17	SNP	1.000	T
GRM3	2913	genome.wustl.edu	37	7	86468257	86468257	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr7:86468257G>T	ENST00000361669.2	+	4	2526	c.1427G>T	c.(1426-1428)gGa>gTa	p.G476V	GRM3_ENST00000536043.1_Missense_Mutation_p.G348V|GRM3_ENST00000394720.2_Intron|GRM3_ENST00000439827.1_Intron|GRM3_ENST00000546348.1_Missense_Mutation_p.G68V	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	476					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					AATGTAGGTGGAAAGTATTCC	0.448																																					GBM(52;969 1098 3139 52280)	dbGAP											0													78.0	73.0	75.0					7																	86468257		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1427G>T	7.37:g.86468257G>T	ENSP00000355316:p.Gly476Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B,pfscan_GPCR_3_C	p.G476V	ENST00000361669.2	37	c.1427	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	G	15.31	2.796308	0.50208	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	D;D;D	0.92545	-3.06;-3.06;-3.06	5.91	5.03	0.67393	.	0.187059	0.56097	D	0.000024	D	0.91456	0.7303	L	0.40543	1.245	0.80722	D	1	P;P;P	0.48589	0.912;0.905;0.794	P;P;P	0.53809	0.735;0.534;0.585	D	0.91479	0.5203	10	0.66056	D	0.02	.	10.4642	0.44598	0.1619:0.0:0.8381:0.0	.	68;348;476	B7Z204;F5GYZ2;Q14832	.;.;GRM3_HUMAN	V	476;68;348	ENSP00000355316:G476V;ENSP00000444064:G68V;ENSP00000441407:G348V	ENSP00000355316:G476V	G	+	2	0	GRM3	86306193	0.999000	0.42202	1.000000	0.80357	0.977000	0.68977	2.413000	0.44618	1.500000	0.48636	0.655000	0.94253	GGA	GRM3	-	NULL	ENSG00000198822		0.448	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	29	0.00	0	G			86468257	86468257	+1	no_errors	ENST00000361669	ensembl	human	known	69_37n	missense	20	60.00	30	SNP	1.000	T
HERC1	8925	genome.wustl.edu	37	15	64010840	64010840	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr15:64010840C>T	ENST00000443617.2	-	21	3998	c.3911G>A	c.(3910-3912)cGa>cAa	p.R1304Q		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1304					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TAAACGACTTCGAACTTTGTA	0.333																																						dbGAP											0													78.0	69.0	72.0					15																	64010840		1841	4096	5937	-	-	-	SO:0001583	missense	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.3911G>A	15.37:g.64010840C>T	ENSP00000390158:p.Arg1304Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW65	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.R1304Q	ENST00000443617.2	37	c.3911	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	C	36	5.920112	0.97105	.	.	ENSG00000103657	ENST00000443617	T	0.03272	3.99	5.5	5.5	0.81552	.	0.000000	0.64402	U	0.000009	T	0.16514	0.0397	L	0.58101	1.795	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	T	0.00058	-1.2169	10	0.87932	D	0	.	19.4004	0.94627	0.0:1.0:0.0:0.0	.	1304	Q15751	HERC1_HUMAN	Q	1304	ENSP00000390158:R1304Q	ENSP00000390158:R1304Q	R	-	2	0	HERC1	61797893	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.591000	0.82666	2.577000	0.86979	0.655000	0.94253	CGA	HERC1	-	NULL	ENSG00000103657		0.333	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	109	0.00	0	C	NM_003922		64010840	64010840	-1	no_errors	ENST00000443617	ensembl	human	known	69_37n	missense	89	39.74	60	SNP	1.000	T
HS6ST1	9394	genome.wustl.edu	37	2	129075961	129075961	+	Silent	SNP	T	T	C	rs61732881	byFrequency	TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr2:129075961T>C	ENST00000259241.6	-	1	190	c.177A>G	c.(175-177)acA>acG	p.T59T	HS6ST1_ENST00000494089.1_5'UTR	NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	59					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		GGGGGTCGGGTGTGGGGAACA	0.667													C|||	3623	0.723442	0.8971	0.7839	5008	,	,		8563	0.8304		0.6044	False		,,,				2504	0.4581					dbGAP											0													7.0	15.0	12.0					2																	129075961		1621	3941	5562	-	-	-	SO:0001819	synonymous_variant	0			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.177A>G	2.37:g.129075961T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Silent	SNP	pfam_Sulfotransferase	p.T59	ENST00000259241.6	37	c.177	CCDS42748.1	2																																																																																			HS6ST1	-	NULL	ENSG00000136720		0.667	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST1	HGNC	protein_coding	OTTHUMT00000331572.1	9	0.00	0	T	NM_004807		129075961	129075961	-1	no_errors	ENST00000259241	ensembl	human	known	69_37n	silent	2	77.78	7	SNP	1.000	C
IFT122	55764	genome.wustl.edu	37	3	129183529	129183529	+	Silent	SNP	C	C	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr3:129183529C>A	ENST00000348417.2	+	7	545	c.468C>A	c.(466-468)atC>atA	p.I156I	IFT122_ENST00000504021.1_Silent_p.I109I|IFT122_ENST00000347300.2_Silent_p.I156I|IFT122_ENST00000296266.3_Silent_p.I207I|IFT122_ENST00000431818.2_Silent_p.I6I|IFT122_ENST00000349441.2_Silent_p.I104I|IFT122_ENST00000507564.1_Silent_p.I207I|IFT122_ENST00000440957.2_Silent_p.I6I	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	156					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						ATGGGATCATCAGCATACGGA	0.532																																						dbGAP											0													144.0	141.0	142.0					3																	129183529		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.468C>A	3.37:g.129183529C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Missense_Mutation	SNP	pfam_WD40_repeat	p.Q108K	ENST00000348417.2	37	c.322	CCDS3061.1	3	.	.	.	.	.	.	.	.	.	.	C	6.192	0.403674	0.11754	.	.	ENSG00000163913	ENST00000508826	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	T	0.70876	0.3274	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69335	-0.5172	4	.	.	.	-18.2871	14.8244	0.70101	0.0:0.8564:0.1436:0.0	.	.	.	.	K	108	.	.	Q	+	1	0	IFT122	130666219	1.000000	0.71417	1.000000	0.80357	0.430000	0.31655	3.099000	0.50267	2.544000	0.85801	0.467000	0.42956	CAG	IFT122	-	pfam_WD40_repeat	ENSG00000163913		0.532	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFT122	HGNC	protein_coding	OTTHUMT00000355852.1	63	0.00	0	C	NM_018262		129183529	129183529	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000508826	ensembl	human	putative	69_37n	missense	70	39.13	45	SNP	1.000	A
IGHD	3495	genome.wustl.edu	37	14	106308334	106308334	+	RNA	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr14:106308334C>T	ENST00000390556.2	-	0	439							P01880	IGHD_HUMAN	immunoglobulin heavy constant delta						immune response (GO:0006955)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										GTTCctctttctccttctcct	0.373																																						dbGAP											0													287.0	293.0	291.0					14																	106308334		961	2090	3051	-	-	-			0			K02875		14q32.33	2012-03-09			ENSG00000211898	ENSG00000211898		"""Immunoglobulins / IGH locus"""	5480	other	immunoglobulin gene	"""immunoglobulin delta"", ""constant region of heavy chain of IgD"""	147170				3922054	Standard	NG_001019		Approved	FLJ00382, FLJ46727, MGC29633	uc001ysj.3	P01880	OTTHUMG00000152538		14.37:g.106308334C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P4I8|Q8WU38	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_Immunoglobulin,smart_Ig_C1-set,pfscan_Ig-like	p.R147K	ENST00000390556.2	37	c.440		14																																																																																			IGHD	-	NULL	ENSG00000211898		0.373	IGHD-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHD	HGNC	IG_C_gene	OTTHUMT00000326652.1	142	0.00	0	C	NG_001019		106308334	106308334	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390556	ensembl	human	known	69_37n	missense	122	46.96	108	SNP	0.004	T
IGKV1D-12	28903	genome.wustl.edu	37	2	90199046	90199046	+	RNA	SNP	G	G	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr2:90199046G>T	ENST00000390276.2	+	0	388									immunoglobulin kappa variable 1D-12																		CTAAGCTCCTGATCTATGCTG	0.537																																						dbGAP											0													20.0	25.0	24.0					2																	90199046		1291	3891	5182	-	-	-			0			X17263		2p11.2	2014-05-06			ENSG00000240834	ENSG00000278857		"""Immunoglobulins / IGK locus"""	5746	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000188272		2.37:g.90199046G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L69	ENST00000390276.2	37	c.207		2																																																																																			IGKV1D-12	-	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000240834		0.537	IGKV1D-12-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1D-12	HGNC	IG_V_gene	OTTHUMT00000323139.2	96	0.00	0	G	NG_000833		90199046	90199046	+1	no_stop_codon	ENST00000390276	ensembl	human	known	69_37n	silent	111	44.22	88	SNP	0.994	T
INCENP	3619	genome.wustl.edu	37	11	61897585	61897585	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr11:61897585C>T	ENST00000394818.3	+	4	788	c.586C>T	c.(586-588)Ctg>Ttg	p.L196L	INCENP_ENST00000278849.4_Silent_p.L196L	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	196					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GCCCCGCACTCTGTCCCCGAC	0.597																																						dbGAP											0													65.0	59.0	61.0					11																	61897585		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.586C>T	11.37:g.61897585C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQD2|Q5Y192	Silent	SNP	pfam_INCENP_N,pfam_Inner_centromere_prot_ARK-bd	p.L196	ENST00000394818.3	37	c.586	CCDS44624.1	11																																																																																			INCENP	-	NULL	ENSG00000149503		0.597	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INCENP	HGNC	protein_coding	OTTHUMT00000394723.2	19	0.00	0	C	NM_020238		61897585	61897585	+1	no_errors	ENST00000394818	ensembl	human	known	69_37n	silent	14	48.15	13	SNP	0.001	T
INCENP	3619	genome.wustl.edu	37	11	61897900	61897900	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr11:61897900C>G	ENST00000394818.3	+	4	1103	c.901C>G	c.(901-903)Caa>Gaa	p.Q301E	INCENP_ENST00000278849.4_Missense_Mutation_p.Q301E	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	301					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						CACGGACTCTCAATCGGTGCG	0.627																																						dbGAP											0													69.0	72.0	71.0					11																	61897900		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.901C>G	11.37:g.61897900C>G	ENSP00000378295:p.Gln301Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQD2|Q5Y192	Missense_Mutation	SNP	pfam_INCENP_N,pfam_Inner_centromere_prot_ARK-bd	p.Q301E	ENST00000394818.3	37	c.901	CCDS44624.1	11	.	.	.	.	.	.	.	.	.	.	C	7.543	0.661018	0.14645	.	.	ENSG00000149503	ENST00000394818;ENST00000278849	T;T	0.15372	2.43;2.43	5.04	2.01	0.26516	.	1.007080	0.07994	N	0.987578	T	0.16854	0.0405	L	0.47716	1.5	0.09310	N	1	B;B;B	0.23185	0.081;0.029;0.017	B;B;B	0.19391	0.021;0.025;0.011	T	0.35919	-0.9769	10	0.24483	T	0.36	.	10.8905	0.46992	0.497:0.503:0.0:0.0	.	301;301;301	B3KPD3;Q9NQS7-2;Q9NQS7	.;.;INCE_HUMAN	E	301	ENSP00000378295:Q301E;ENSP00000278849:Q301E	ENSP00000278849:Q301E	Q	+	1	0	INCENP	61654476	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.140000	0.16056	0.129000	0.18514	0.407000	0.27541	CAA	INCENP	-	NULL	ENSG00000149503		0.627	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INCENP	HGNC	protein_coding	OTTHUMT00000394723.2	15	0.00	0	C	NM_020238		61897900	61897900	+1	no_errors	ENST00000394818	ensembl	human	known	69_37n	missense	9	55.00	11	SNP	0.000	G
ING1	3621	genome.wustl.edu	37	13	111371874	111371874	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr13:111371874C>T	ENST00000375774.3	+	2	1326	c.864C>T	c.(862-864)ccC>ccT	p.P288P	ING1_ENST00000338450.7_Silent_p.P101P|ING1_ENST00000375775.3_Silent_p.P76P|ING1_ENST00000333219.7_Silent_p.P145P	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	288					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CTGACAAGCCCAACAGCAAGC	0.682																																						dbGAP											0													28.0	27.0	28.0					13																	111371874		2201	4294	6495	-	-	-	SO:0001819	synonymous_variant	0				CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.864C>T	13.37:g.111371874C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.P288	ENST00000375774.3	37	c.864	CCDS9517.1	13																																																																																			ING1	-	NULL	ENSG00000153487		0.682	ING1-004	KNOWN	basic|CCDS	protein_coding	ING1	HGNC	protein_coding	OTTHUMT00000045770.2	11	0.00	0	C	NM_005537		111371874	111371874	+1	no_errors	ENST00000375774	ensembl	human	known	69_37n	silent	10	61.54	16	SNP	0.057	T
INSR	3643	genome.wustl.edu	37	19	7166387	7166387	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:7166387C>T	ENST00000302850.5	-	8	1781	c.1639G>A	c.(1639-1641)Ggg>Agg	p.G547R	INSR_ENST00000341500.5_Missense_Mutation_p.G547R	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	547					activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GCATCCTGCCCGTCGAACTCC	0.547																																						dbGAP											0													87.0	63.0	71.0					19																	7166387		2203	4300	6503	-	-	-	SO:0001583	missense	0			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.1639G>A	19.37:g.7166387C>T	ENSP00000303830:p.Gly547Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom	p.G547R	ENST00000302850.5	37	c.1639	CCDS12176.1	19	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400190	0.62177	.	.	ENSG00000171105	ENST00000302850;ENST00000341500;ENST00000538006	T;T	0.70282	-0.47;-0.47	5.04	5.04	0.67666	Fibronectin, type III (1);	0.000000	0.45126	U	0.000397	D	0.84492	0.5484	M	0.82716	2.605	0.80722	D	1	D;D;D	0.89917	0.995;1.0;1.0	P;D;D	0.69142	0.738;0.938;0.962	D	0.87171	0.2221	10	0.87932	D	0	.	15.9622	0.79939	0.0:1.0:0.0:0.0	.	538;547;547	Q86WY9;P06213-2;P06213	.;.;INSR_HUMAN	R	547;547;10	ENSP00000303830:G547R;ENSP00000342838:G547R	ENSP00000303830:G547R	G	-	1	0	INSR	7117387	1.000000	0.71417	0.981000	0.43875	0.352000	0.29268	7.475000	0.81041	2.345000	0.79718	0.650000	0.86243	GGG	INSR	-	pirsf_Tyr_kinase_insulin-like_rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000171105		0.547	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSR	HGNC	protein_coding	OTTHUMT00000458544.1	37	0.00	0	C			7166387	7166387	-1	no_errors	ENST00000302850	ensembl	human	known	69_37n	missense	28	48.15	26	SNP	1.000	T
IQSEC1	9922	genome.wustl.edu	37	3	12977058	12977058	+	Silent	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr3:12977058G>A	ENST00000273221.4	-	3	1716	c.1500C>T	c.(1498-1500)ctC>ctT	p.L500L	IQSEC1_ENST00000473088.1_5'Flank	NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	500					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCTGCTTGCTGAGCGTCTGCT	0.587																																						dbGAP											0													148.0	130.0	136.0					3																	12977058		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.1500C>T	3.37:g.12977058G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O94863|Q96D85	Nonsense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.Q501*	ENST00000273221.4	37	c.1501	CCDS33703.1	3	.	.	.	.	.	.	.	.	.	.	G	7.668	0.686332	0.14973	.	.	ENSG00000144711	ENST00000450726	.	.	.	4.43	2.55	0.30701	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.3479	0.32284	0.0:0.2253:0.5412:0.2336	.	.	.	.	X	501	.	.	Q	-	1	0	IQSEC1	12952058	0.995000	0.38212	1.000000	0.80357	0.883000	0.51084	0.271000	0.18626	1.091000	0.41335	-0.127000	0.14921	CAG	IQSEC1	-	NULL	ENSG00000144711		0.587	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQSEC1	HGNC	protein_coding	OTTHUMT00000339865.2	43	0.00	0	G	NM_014869		12977058	12977058	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000450726	ensembl	human	known	69_37n	nonsense	46	44.71	38	SNP	1.000	A
IRF3	3661	genome.wustl.edu	37	19	50164064	50164064	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:50164064C>T	ENST00000597198.1	-	7	1385	c.1004G>A	c.(1003-1005)gGa>gAa	p.G335E	IRF3_ENST00000377139.3_Missense_Mutation_p.G335E|IRF3_ENST00000599223.1_Missense_Mutation_p.G208E|IRF3_ENST00000600911.1_Intron|IRF3_ENST00000593922.1_Missense_Mutation_p.G189E|IRF3_ENST00000596822.1_Intron|IRF3_ENST00000600022.1_Missense_Mutation_p.G62E|IRF3_ENST00000309877.7_Missense_Mutation_p.G335E|IRF3_ENST00000599680.1_5'UTR|IRF3_ENST00000599144.1_Missense_Mutation_p.G189E|IRF3_ENST00000601291.1_Silent_p.R340R|IRF3_ENST00000596765.1_Missense_Mutation_p.G62E|IRF3_ENST00000377135.4_Missense_Mutation_p.G208E|IRF3_ENST00000598808.1_Missense_Mutation_p.G189E			Q14653	IRF3_HUMAN	interferon regulatory factor 3	335	Involved in HERC5 binding.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dsRNA (GO:0071359)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage apoptotic process (GO:0071888)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of interferon-beta biosynthetic process (GO:0045358)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|programmed necrotic cell death (GO:0097300)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(2)|lung(4)|ovary(2)|stomach(1)	10		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.02)		GCGTCCGCTTCCTTCCGTGAA	0.592																																						dbGAP											0													41.0	33.0	36.0					19																	50164064		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12775.1, CCDS56099.1, CCDS59407.1, CCDS59408.1, CCDS59409.1	19q13.3-q13.4	2008-07-16				ENSG00000126456			6118	protein-coding gene	gene with protein product		603734				8524823	Standard	NM_001571		Approved		uc002pow.3	Q14653		ENST00000597198.1:c.1004G>A	19.37:g.50164064C>T	ENSP00000469113:p.Gly335Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7L2|B2RAZ3|Q5FBY1|Q5FBY2|Q5FBY4|Q7Z5G6	Missense_Mutation	SNP	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.G335E	ENST00000597198.1	37	c.1004	CCDS12775.1	19	.	.	.	.	.	.	.	.	.	.	C	16.71	3.197880	0.58126	.	.	ENSG00000126456	ENST00000377139;ENST00000309877;ENST00000377135	D;D;D	0.95690	-3.78;-3.78;-3.78	4.54	4.54	0.55810	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	.	.	.	.	D	0.97445	0.9164	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97754	1.0216	8	0.62326	D	0.03	-0.4394	14.2933	0.66295	0.0:1.0:0.0:0.0	.	335;208	Q14653;Q5FBY1	IRF3_HUMAN;.	E	335;335;208	ENSP00000366344:G335E;ENSP00000310127:G335E;ENSP00000366339:G208E	ENSP00000310127:G335E	G	-	2	0	IRF3	54855876	1.000000	0.71417	0.923000	0.36655	0.324000	0.28378	3.689000	0.54706	2.362000	0.80069	0.591000	0.81541	GGA	IRF3	-	pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain	ENSG00000126456		0.592	IRF3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IRF3	HGNC	protein_coding	OTTHUMT00000465962.1	21	0.00	0	C	NM_001571		50164064	50164064	-1	no_errors	ENST00000309877	ensembl	human	known	69_37n	missense	9	57.14	12	SNP	0.916	T
IRS1	3667	genome.wustl.edu	37	2	227661256	227661256	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr2:227661256C>T	ENST00000305123.5	-	1	3219	c.2199G>A	c.(2197-2199)atG>atA	p.M733I	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	733					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GTGACATGTTCATGTAGTCAC	0.592											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													139.0	146.0	144.0					2																	227661256		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.2199G>A	2.37:g.227661256C>T	ENSP00000304895:p.Met733Ile	Somatic	2321	WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,prints_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.M733I	ENST00000305123.5	37	c.2199	CCDS2463.1	2	.	.	.	.	.	.	.	.	.	.	C	9.700	1.154228	0.21371	.	.	ENSG00000169047	ENST00000305123	T	0.59224	0.28	4.85	1.96	0.26148	.	0.059591	0.64402	D	0.000006	T	0.23649	0.0572	N	0.03608	-0.345	0.33273	D	0.561274	B	0.02656	0.0	B	0.04013	0.001	T	0.12243	-1.0555	10	0.11794	T	0.64	-24.1627	2.7232	0.05206	0.3401:0.352:0.2209:0.087	.	733	P35568	IRS1_HUMAN	I	733	ENSP00000304895:M733I	ENSP00000304895:M733I	M	-	3	0	IRS1	227369500	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	0.431000	0.21444	1.272000	0.44329	0.561000	0.74099	ATG	IRS1	-	NULL	ENSG00000169047		0.592	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS1	HGNC	protein_coding	OTTHUMT00000256886.3	27	0.00	0	C	NM_005544		227661256	227661256	-1	no_errors	ENST00000305123	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	1.000	T
ITGAD	3681	genome.wustl.edu	37	16	31408729	31408729	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr16:31408729C>T	ENST00000389202.2	+	3	236	c.187C>T	c.(187-189)Cgg>Tgg	p.R63W		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	63					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CCAGACGGGACGGCTGTATGA	0.657																																						dbGAP											0													40.0	29.0	33.0					16																	31408729		2193	4296	6489	-	-	-	SO:0001583	missense	0			U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.187C>T	16.37:g.31408729C>T	ENSP00000373854:p.Arg63Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15575|Q15576	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.R63W	ENST00000389202.2	37	c.187	CCDS32438.1	16	.	.	.	.	.	.	.	.	.	.	C	15.80	2.939686	0.52972	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.72282	-0.64	4.05	-0.796	0.10912	.	.	.	.	.	T	0.73567	0.3603	L	0.50333	1.59	0.09310	N	1	D;D;D	0.76494	0.999;0.997;0.997	D;P;P	0.64776	0.929;0.676;0.676	T	0.61382	-0.7074	9	0.87932	D	0	.	5.1316	0.14913	0.5291:0.3658:0.0:0.1051	.	63;79;63	B7Z6V7;Q59H14;Q13349	.;.;ITAD_HUMAN	W	79;63	ENSP00000373854:R63W	ENSP00000373854:R63W	R	+	1	2	ITGAD	31316230	0.001000	0.12720	0.117000	0.21633	0.048000	0.14542	-0.071000	0.11505	0.083000	0.17047	0.650000	0.86243	CGG	ITGAD	-	smart_Int_alpha_beta-p	ENSG00000156886		0.657	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAD	HGNC	protein_coding	OTTHUMT00000432836.1	8	0.00	0	C	NM_005353		31408729	31408729	+1	no_errors	ENST00000389202	ensembl	human	known	69_37n	missense	10	50.00	10	SNP	0.054	T
KAZN	23254	genome.wustl.edu	37	1	15441145	15441145	+	3'UTR	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:15441145C>T	ENST00000376030.2	+	0	2636				TMEM51-AS1_ENST00000310916.3_RNA	NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein						keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						ACTGGTGGCTCCACCAGACCC	0.587																																						dbGAP											0													25.0	22.0	23.0					1																	15441145		2202	4295	6497	-	-	-	SO:0001624	3_prime_UTR_variant	0			AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.*14C>T	1.37:g.15441145C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	RNA	SNP	-	NULL	ENST00000376030.2	37	NULL	CCDS152.2	1																																																																																			KAZN	-	-	ENSG00000189337		0.587	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAZN	HGNC	protein_coding	OTTHUMT00000005690.2	21	0.00	0	C	NM_001017999		15441145	15441145	+1	no_errors	ENST00000469734	ensembl	human	known	69_37n	rna	18	51.35	19	SNP	0.000	T
KCTD10	83892	genome.wustl.edu	37	12	109889615	109889615	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr12:109889615C>T	ENST00000228495.6	-	7	1008	c.727G>A	c.(727-729)Gag>Aag	p.E243K	KCTD10_ENST00000424763.2_Missense_Mutation_p.E62K|KCTD10_ENST00000540411.1_Missense_Mutation_p.E217K|KCTD10_ENST00000540089.1_Missense_Mutation_p.E62K|KCTD10_ENST00000538161.1_5'UTR	NM_031954.3	NP_114160.1	Q9H3F6	BACD3_HUMAN	potassium channel tetramerization domain containing 10	243					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)				endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	10						TCGGGAAACTCCACCTGTGTT	0.582																																						dbGAP											0													25.0	28.0	27.0					12																	109889615		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC040062	CCDS9128.1	12q24.12	2013-06-20	2013-06-20		ENSG00000110906	ENSG00000110906		"""BTB/POZ domain containing"""	23236	protein-coding gene	gene with protein product		613421	"""potassium channel tetramerisation domain containing 10"""			12477932	Standard	XM_005253946		Approved	MSTP028, BTBD28	uc001toi.1	Q9H3F6	OTTHUMG00000169253	ENST00000228495.6:c.727G>A	12.37:g.109889615C>T	ENSP00000228495:p.Glu243Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53HN2|Q59FV1|Q6PL47|Q96SU0	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.E243K	ENST00000228495.6	37	c.727	CCDS9128.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.5|25.5	4.646169|4.646169	0.87958|0.87958	.|.	.|.	ENSG00000110906|ENSG00000110906	ENST00000228495;ENST00000540089;ENST00000545759;ENST00000424763;ENST00000540411;ENST00000542954;ENST00000535546;ENST00000540402;ENST00000540355|ENST00000538161	T;T|.	0.57907|.	0.53;0.37|.	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	0.051633|.	0.85682|.	D|.	0.000000|.	T|.	0.79275|.	0.4418|.	M|M	0.83953|0.83953	2.67|2.67	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;1.0;0.997|.	D;D;D|.	0.79108|.	0.976;0.992;0.947|.	T|.	0.80683|.	-0.1273|.	10|.	0.87932|.	D|.	0|.	-31.0378|-31.0378	17.765|17.765	0.88475|0.88475	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	217;220;243|.	F5GWA4;Q9H3F6-2;Q9H3F6|.	.;.;BACD3_HUMAN|.	K|X	243;62;85;62;217;62;62;62;62|208	ENSP00000228495:E243K;ENSP00000441672:E217K|.	ENSP00000228495:E243K|.	E|W	-|-	1|3	0|0	KCTD10|KCTD10	108373998|108373998	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.476000|0.476000	0.33039|0.33039	7.622000|7.622000	0.83099|0.83099	2.757000|2.757000	0.94681|0.94681	0.655000|0.655000	0.94253|0.94253	GAG|TGG	KCTD10	-	NULL	ENSG00000110906		0.582	KCTD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD10	HGNC	protein_coding	OTTHUMT00000403099.1	15	0.00	0	C	NM_031954		109889615	109889615	-1	no_errors	ENST00000228495	ensembl	human	known	69_37n	missense	4	69.23	9	SNP	1.000	T
KIRREL	55243	genome.wustl.edu	37	1	158054238	158054238	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:158054238G>A	ENST00000359209.6	+	4	446	c.379G>A	c.(379-381)Gga>Aga	p.G127R	KIRREL_ENST00000368173.3_Missense_Mutation_p.G127R|KIRREL_ENST00000360089.4_Intron|KIRREL_ENST00000416935.2_Missense_Mutation_p.G27R|KIRREL_ENST00000368172.1_5'Flank|KIRREL_ENST00000392272.2_Intron			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	127	Ig-like C2-type 2.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					CAGGATTGACGGAGGCCCTGT	0.592																																						dbGAP											0													63.0	70.0	68.0					1																	158054238		692	1591	2283	-	-	-	SO:0001583	missense	0			AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.379G>A	1.37:g.158054238G>A	ENSP00000352138:p.Gly127Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.G127R	ENST00000359209.6	37	c.379	CCDS1172.2	1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629630	0.87660	.	.	ENSG00000183853	ENST00000368173;ENST00000359209;ENST00000416935	D;D;D	0.86497	-2.13;-2.13;-2.13	5.34	5.34	0.76211	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.42964	D	0.000628	D	0.93304	0.7866	M	0.84433	2.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.94009	0.7282	10	0.72032	D	0.01	-17.8799	16.5464	0.84448	0.0:0.0:1.0:0.0	.	27;127	B4DN67;Q96J84	.;KIRR1_HUMAN	R	127;127;27	ENSP00000357155:G127R;ENSP00000352138:G127R;ENSP00000389674:G27R	ENSP00000352138:G127R	G	+	1	0	KIRREL	156320862	1.000000	0.71417	0.987000	0.45799	0.993000	0.82548	6.676000	0.74498	2.515000	0.84797	0.650000	0.86243	GGA	KIRREL	-	pfscan_Ig-like	ENSG00000183853		0.592	KIRREL-001	KNOWN	basic|CCDS	protein_coding	KIRREL	HGNC	protein_coding	OTTHUMT00000058342.3	27	0.00	0	G	NM_018240		158054238	158054238	+1	no_errors	ENST00000368173	ensembl	human	known	69_37n	missense	96	25.58	33	SNP	0.990	A
KRT73	319101	genome.wustl.edu	37	12	53012235	53012235	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr12:53012235G>A	ENST00000305748.3	-	1	108	c.74C>T	c.(73-75)tCa>tTa	p.S25L		NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	25	Gly-rich.|Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		GCTGCCCCCTGAGAGCACAGC	0.637																																						dbGAP											0													42.0	49.0	47.0					12																	53012235		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.74C>T	12.37:g.53012235G>A	ENSP00000307014:p.Ser25Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MB2	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.S25L	ENST00000305748.3	37	c.74	CCDS8834.1	12	.	.	.	.	.	.	.	.	.	.	G	12.69	2.015098	0.35511	.	.	ENSG00000186049	ENST00000305748	D	0.91464	-2.85	4.58	3.68	0.42216	.	0.441437	0.19153	N	0.121386	D	0.83783	0.5329	L	0.35341	1.055	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.71659	-0.4526	10	0.33141	T	0.24	.	9.6591	0.39943	0.087:0.1829:0.7301:0.0	.	25	Q86Y46	K2C73_HUMAN	L	25	ENSP00000307014:S25L	ENSP00000307014:S25L	S	-	2	0	KRT73	51298502	0.354000	0.24912	0.014000	0.15608	0.162000	0.22319	1.684000	0.37649	1.217000	0.43442	0.655000	0.94253	TCA	KRT73	-	NULL	ENSG00000186049		0.637	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT73	HGNC	protein_coding	OTTHUMT00000405700.1	14	0.00	0	G	NM_175068		53012235	53012235	-1	no_errors	ENST00000305748	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	0.001	A
KRT73	319101	genome.wustl.edu	37	12	53012283	53012283	+	Missense_Mutation	SNP	G	G	A	rs114162070		TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr12:53012283G>A	ENST00000305748.3	-	1	60	c.26C>T	c.(25-27)tCg>tTg	p.S9L		NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	9	Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGCAGCTCCCGACTTGTAGGT	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16148	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													34.0	40.0	38.0					12																	53012283		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.26C>T	12.37:g.53012283G>A	ENSP00000307014:p.Ser9Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MB2	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.S9L	ENST00000305748.3	37	c.26	CCDS8834.1	12	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	8.978	0.974596	0.18736	.	.	ENSG00000186049	ENST00000305748	D	0.82893	-1.66	4.58	3.66	0.41972	.	0.610688	0.14472	N	0.317486	T	0.76709	0.4025	M	0.70275	2.135	0.09310	N	1	P	0.36438	0.553	B	0.20184	0.028	T	0.69558	-0.5113	10	0.54805	T	0.06	.	7.9469	0.29991	0.0:0.1641:0.5418:0.2941	.	9	Q86Y46	K2C73_HUMAN	L	9	ENSP00000307014:S9L	ENSP00000307014:S9L	S	-	2	0	KRT73	51298550	0.844000	0.29557	0.169000	0.22859	0.547000	0.35210	2.455000	0.44988	1.184000	0.42957	0.655000	0.94253	TCG	KRT73	-	NULL	ENSG00000186049		0.622	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT73	HGNC	protein_coding	OTTHUMT00000405700.1	18	0.00	0	G	NM_175068		53012283	53012283	-1	no_errors	ENST00000305748	ensembl	human	known	69_37n	missense	11	42.11	8	SNP	0.033	A
KRTAP10-1	386677	genome.wustl.edu	37	21	45959542	45959542	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr21:45959542G>C	ENST00000400375.1	-	1	536	c.492C>G	c.(490-492)tgC>tgG	p.C164W	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198691.2	NP_941964.2	P60331	KR101_HUMAN	keratin associated protein 10-1	164	24 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(3)|prostate(4)|skin(1)	11						TAGACTGCTGGCAGCATGAAG	0.617																																						dbGAP											0													113.0	119.0	117.0					21																	45959542		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ566380	CCDS42954.1	21q22.3	2007-10-05			ENSG00000215455	ENSG00000215455		"""Keratin associated proteins"""	22966	protein-coding gene	gene with protein product				KRTAP18-1			Standard	NM_198691		Approved	KAP10.1, KAP18.1	uc002zfh.1	P60331	OTTHUMG00000057627	ENST00000400375.1:c.492C>G	21.37:g.45959542G>C	ENSP00000383226:p.Cys164Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAR0|Q0VAR1	Missense_Mutation	SNP	NULL	p.C164W	ENST00000400375.1	37	c.492	CCDS42954.1	21	.	.	.	.	.	.	.	.	.	.	g	0.032	-1.328404	0.01309	.	.	ENSG00000215455	ENST00000400375;ENST00000545982	T	0.02812	4.15	2.62	1.73	0.24493	.	.	.	.	.	T	0.09949	0.0244	H	0.95504	3.68	0.45567	D	0.99851	P	0.38551	0.636	B	0.41510	0.359	T	0.00847	-1.1542	9	0.87932	D	0	.	7.5479	0.27778	0.1389:0.0:0.8611:0.0	.	164	P60331	KR101_HUMAN	W	164	ENSP00000383226:C164W	ENSP00000383226:C164W	C	-	3	2	KRTAP10-1	44783970	0.815000	0.29118	0.998000	0.56505	0.029000	0.11900	1.737000	0.38197	0.657000	0.30906	-0.339000	0.08088	TGC	KRTAP10-1	-	NULL	ENSG00000215455		0.617	KRTAP10-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-1	HGNC	protein_coding	OTTHUMT00000128030.1	78	0.00	0	G			45959542	45959542	-1	no_errors	ENST00000400375	ensembl	human	known	69_37n	missense	99	40.36	67	SNP	1.000	C
LIFR	3977	genome.wustl.edu	37	5	38490331	38490331	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr5:38490331G>A	ENST00000263409.4	-	15	2290	c.2128C>T	c.(2128-2130)Caa>Taa	p.Q710*	LIFR_ENST00000503088.1_5'Flank|LIFR_ENST00000453190.2_Nonsense_Mutation_p.Q710*	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	710	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					CGTAATAATTGATATCCTTGA	0.308			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)	dbGAP		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	0													98.0	108.0	105.0					5																	38490331		2202	4292	6494	-	-	-	SO:0001587	stop_gained	0			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.2128C>T	5.37:g.38490331G>A	ENSP00000263409:p.Gln710*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6LCD9	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.Q710*	ENST00000263409.4	37	c.2128	CCDS3927.1	5	.	.	.	.	.	.	.	.	.	.	G	41	8.576933	0.98870	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	.	.	.	6.05	6.05	0.98169	.	0.158534	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-20.3768	20.6013	0.99457	0.0:0.0:1.0:0.0	.	.	.	.	X	710	.	ENSP00000263409:Q710X	Q	-	1	0	LIFR	38526088	1.000000	0.71417	0.988000	0.46212	0.987000	0.75469	6.557000	0.73937	2.878000	0.98634	0.650000	0.86243	CAA	LIFR	-	superfamily_Fibronectin_type3	ENSG00000113594		0.308	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR	HGNC	protein_coding	OTTHUMT00000253823.1	111	0.00	0	G	NM_002310		38490331	38490331	-1	no_errors	ENST00000263409	ensembl	human	known	69_37n	nonsense	75	37.19	45	SNP	1.000	A
LRSAM1	90678	genome.wustl.edu	37	9	130249962	130249962	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr9:130249962G>A	ENST00000323301.4	+	17	1871	c.1267G>A	c.(1267-1269)Gaa>Aaa	p.E423K	LRSAM1_ENST00000483302.1_3'UTR|LRSAM1_ENST00000373322.1_Missense_Mutation_p.E423K|LRSAM1_ENST00000373324.4_Missense_Mutation_p.E423K|LRSAM1_ENST00000300417.6_Missense_Mutation_p.E423K	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	423					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						CAGCATGGCCGAAATGGATGA	0.522																																						dbGAP											0													75.0	66.0	69.0					9																	130249962		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.1267G>A	9.37:g.130249962G>A	ENSP00000322937:p.Glu423Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_PTS_PEP_utilis_N,smart_Leu-rich_rpt_typical-subtyp,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.E423K	ENST00000323301.4	37	c.1267	CCDS6873.1	9	.	.	.	.	.	.	.	.	.	.	G	14.03	2.413343	0.42817	.	.	ENSG00000148356	ENST00000300417;ENST00000373324;ENST00000323301;ENST00000373322	T;T;T;T	0.76186	1.35;-1.0;1.35;1.35	5.34	4.39	0.52855	.	0.273141	0.41396	D	0.000894	T	0.65291	0.2677	L	0.54323	1.7	0.47341	D	0.999399	B;P	0.36837	0.097;0.571	B;B	0.23716	0.011;0.048	T	0.68017	-0.5520	10	0.35671	T	0.21	-7.651	15.1886	0.73025	0.0:0.1547:0.8453:0.0	.	423;423	Q6UWE0-2;Q6UWE0	.;LRSM1_HUMAN	K	423	ENSP00000300417:E423K;ENSP00000362421:E423K;ENSP00000322937:E423K;ENSP00000362419:E423K	ENSP00000300417:E423K	E	+	1	0	LRSAM1	129289783	0.995000	0.38212	0.983000	0.44433	0.921000	0.55340	2.734000	0.47368	2.501000	0.84356	0.655000	0.94253	GAA	LRSAM1	-	NULL	ENSG00000148356		0.522	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRSAM1	HGNC	protein_coding	OTTHUMT00000054164.1	48	0.00	0	G	NM_138361		130249962	130249962	+1	no_errors	ENST00000300417	ensembl	human	known	69_37n	missense	44	52.17	48	SNP	0.910	A
LZTR1	8216	genome.wustl.edu	37	22	21345981	21345981	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr22:21345981G>A	ENST00000215739.8	+	9	1215	c.856G>A	c.(856-858)Ggg>Agg	p.G286R	LZTR1_ENST00000389355.3_Missense_Mutation_p.G267R|LZTR1_ENST00000479606.1_3'UTR	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	286					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			GCGGCGCTACGGGCATACCAT	0.622																																						dbGAP											0													36.0	34.0	35.0					22																	21345981		2201	4294	6495	-	-	-	SO:0001583	missense	0			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.856G>A	22.37:g.21345981G>A	ENSP00000215739:p.Gly286Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14776|Q20WK0	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_Kelch_1,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.G286R	ENST00000215739.8	37	c.856	CCDS33606.1	22	.	.	.	.	.	.	.	.	.	.	G	34	5.372427	0.95923	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	T;T	0.79454	-1.27;-1.27	5.24	5.24	0.73138	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.88104	0.6347	M	0.83953	2.67	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.86477	0.1789	10	0.26408	T	0.33	-38.5202	16.3155	0.82918	0.0:0.0:1.0:0.0	.	267;245;286;245	B7Z3T9;Q6ZSY0;Q8N653;F5GXU8	.;.;LZTR1_HUMAN;.	R	245;286;267	ENSP00000215739:G286R;ENSP00000374006:G267R	ENSP00000215739:G286R	G	+	1	0	LZTR1	19675981	1.000000	0.71417	0.983000	0.44433	0.990000	0.78478	9.460000	0.97641	2.444000	0.82710	0.462000	0.41574	GGG	LZTR1	-	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1	ENSG00000099949		0.622	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTR1	HGNC	protein_coding	OTTHUMT00000320387.1	19	0.00	0	G	NM_006767		21345981	21345981	+1	no_errors	ENST00000215739	ensembl	human	known	69_37n	missense	6	50.00	6	SNP	1.000	A
MAGI3	260425	genome.wustl.edu	37	1	114165576	114165576	+	Silent	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:114165576G>A	ENST00000307546.9	+	9	1395	c.1320G>A	c.(1318-1320)ctG>ctA	p.L440L	MAGI3_ENST00000369617.4_Silent_p.L465L|MAGI3_ENST00000369615.1_Silent_p.L440L|MAGI3_ENST00000369611.4_Silent_p.L440L	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	465	Interaction with PTEN.|PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAATGTGCTGAAAGATGGTC	0.358																																						dbGAP											0													74.0	69.0	71.0					1																	114165576		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.1320G>A	1.37:g.114165576G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Silent	SNP	pfam_PDZ,pfam_WW_Rsp5_WWP,pfam_Guanylate_kin,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP,pfscan_Guanylate_kin	p.L440	ENST00000307546.9	37	c.1320	CCDS44196.1	1																																																																																			MAGI3	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000081026		0.358	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	MAGI3	HGNC	protein_coding	OTTHUMT00000032429.1	71	0.00	0	G	NM_152900		114165576	114165576	+1	no_errors	ENST00000369611	ensembl	human	known	69_37n	silent	59	39.80	39	SNP	0.956	A
MCL1	4170	genome.wustl.edu	37	1	150550932	150550932	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:150550932C>T	ENST00000369026.2	-	2	783	c.724G>A	c.(724-726)Gat>Aat	p.D242N	MCL1_ENST00000464132.1_5'UTR|MCL1_ENST00000307940.3_Intron	NM_001197320.1|NM_021960.4	NP_001184249.1|NP_068779.1	Q07820	MCL1_HUMAN	myeloid cell leukemia 1	242					apoptotic mitochondrial changes (GO:0008637)|cell fate determination (GO:0001709)|cellular homeostasis (GO:0019725)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|protein transmembrane transport (GO:0071806)|regulation of response to DNA damage stimulus (GO:2001020)|response to cytokine (GO:0034097)	Bcl-2 family protein complex (GO:0097136)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	BH3 domain binding (GO:0051434)|protein channel activity (GO:0015266)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)	8	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GATTTCACATCGTCTTCGTTT	0.493																																						dbGAP											0													95.0	99.0	98.0					1																	150550932		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017197	CCDS956.1, CCDS957.1, CCDS72909.1	1q21	2014-03-07	2014-03-07		ENSG00000143384	ENSG00000143384			6943	protein-coding gene	gene with protein product		159552	"""myeloid cell leukemia sequence 1 (BCL2-related)"""			7682708, 7835896	Standard	NM_021960		Approved	BCL2L3, Mcl-1	uc001euz.3	Q07820	OTTHUMG00000034867	ENST00000369026.2:c.724G>A	1.37:g.150550932C>T	ENSP00000358022:p.Asp242Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6B2|D3DV03|D3DV04|Q9HD91|Q9NRQ3|Q9NRQ4|Q9UHR7|Q9UHR8|Q9UHR9|Q9UNJ1	Missense_Mutation	SNP	pfam_Bcl2_BH,smart_Bcl2_BH,pfscan_Bcl2-like_apoptosis,prints_Apop_reg_Mc1,prints_Bcl2_BH	p.D242N	ENST00000369026.2	37	c.724	CCDS957.1	1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635316	0.67130	.	.	ENSG00000143384	ENST00000369026;ENST00000439749	T	0.04551	3.6	5.01	4.1	0.47936	Apoptosis regulator, Bcl2-like (1);Apoptosis regulator, Bcl-2, BH (2);	0.162209	0.52532	N	0.000063	T	0.02267	0.0070	L	0.43152	1.355	0.80722	D	1	P	0.40250	0.709	B	0.35859	0.212	T	0.50625	-0.8806	10	0.59425	D	0.04	-11.2981	12.2564	0.54627	0.0:0.9176:0.0:0.0824	.	242	Q07820	MCL1_HUMAN	N	242;171	ENSP00000358022:D242N	ENSP00000358022:D242N	D	-	1	0	MCL1	148817556	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.386000	0.52492	1.337000	0.45525	0.655000	0.94253	GAT	MCL1	-	pfam_Bcl2_BH,smart_Bcl2_BH,pfscan_Bcl2-like_apoptosis,prints_Apop_reg_Mc1	ENSG00000143384		0.493	MCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCL1	HGNC	protein_coding	OTTHUMT00000084402.1	57	0.00	0	C	NM_021960		150550932	150550932	-1	no_errors	ENST00000369026	ensembl	human	known	69_37n	missense	74	30.84	33	SNP	1.000	T
MDGA2	161357	genome.wustl.edu	37	14	47389259	47389259	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr14:47389259C>A	ENST00000399232.2	-	10	2351	c.1987G>T	c.(1987-1989)Gat>Tat	p.D663Y	MDGA2_ENST00000357362.3_Missense_Mutation_p.D434Y|MDGA2_ENST00000426342.1_Missense_Mutation_p.D434Y|MDGA2_ENST00000439988.3_Missense_Mutation_p.D732Y	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	663	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TCCACTGCATCAGGATTCATC	0.443																																						dbGAP											0													135.0	128.0	130.0					14																	47389259		1908	4130	6038	-	-	-	SO:0001583	missense	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1987G>T	14.37:g.47389259C>A	ENSP00000382178:p.Asp663Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like	p.D732Y	ENST00000399232.2	37	c.2194		14	.	.	.	.	.	.	.	.	.	.	C	14.47	2.546153	0.45383	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	5.39	3.49	0.39957	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.231002	0.27526	U	0.018968	T	0.54431	0.1858	L	0.48642	1.525	0.80722	D	1	P;P	0.48640	0.807;0.913	P;P	0.59056	0.851;0.786	T	0.56517	-0.7966	10	0.87932	D	0	.	9.0596	0.36427	0.1506:0.7667:0.0:0.0827	.	434;663	F6W3S7;Q7Z553	.;MDGA2_HUMAN	Y	663;434;732;434	ENSP00000400011:D663Y;ENSP00000405456:D434Y;ENSP00000382178:D732Y;ENSP00000349925:D434Y	ENSP00000349925:D434Y	D	-	1	0	MDGA2	46459009	0.918000	0.31147	0.992000	0.48379	0.902000	0.53008	1.756000	0.38390	1.368000	0.46115	0.591000	0.81541	GAT	MDGA2	-	superfamily_Fibronectin_type3	ENSG00000139915		0.443	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	HGNC	protein_coding	OTTHUMT00000073352.5	72	0.00	0	C	NM_182830		47389259	47389259	-1	no_errors	ENST00000399232	ensembl	human	known	69_37n	missense	94	41.61	67	SNP	0.999	A
MEF2C	4208	genome.wustl.edu	37	5	88056820	88056820	+	Intron	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr5:88056820C>T	ENST00000437473.2	-	4	820				MEF2C_ENST00000514028.1_Intron|MEF2C_ENST00000510942.1_Intron|MEF2C_ENST00000503554.1_Intron|MEF2C_ENST00000539796.1_Intron|MEF2C_ENST00000506554.1_Intron|MEF2C_ENST00000340208.5_Silent_p.K147K|MEF2C_ENST00000504921.2_Intron|MEF2C_ENST00000424173.2_Silent_p.K127K|MEF2C_ENST00000514015.1_Intron|MEF2C_ENST00000508569.1_Intron	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C						apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		TTTTATGACTCTTGATCATAT	0.408										HNSCC(66;0.2)																												dbGAP											0													93.0	88.0	90.0					5																	88056820		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.402+181G>A	5.37:g.88056820C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JMZ0|D7F7N5|F8W7V7	Silent	SNP	pfam_HJURP_C,pfam_TF_MADSbox,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.K127	ENST00000437473.2	37	c.381	CCDS47245.1	5																																																																																			MEF2C	-	pfam_HJURP_C	ENSG00000081189		0.408	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	MEF2C	HGNC	protein_coding	OTTHUMT00000369817.1	112	0.00	0	C	NM_002397		88056820	88056820	-1	no_errors	ENST00000424173	ensembl	human	known	69_37n	silent	115	32.35	55	SNP	1.000	T
MEPCE	56257	genome.wustl.edu	37	7	100030928	100030928	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr7:100030928G>C	ENST00000310512.2	+	3	2321	c.1933G>C	c.(1933-1935)Gag>Cag	p.E645Q	RP11-758P17.2_ENST00000492523.1_RNA|RP11-758P17.3_ENST00000475250.1_RNA|MEPCE_ENST00000414441.1_Missense_Mutation_p.E176Q|PPP1R35_ENST00000476185.1_5'Flank	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	645	Bin3-type SAM. {ECO:0000255|PROSITE- ProRule:PRU00848}.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ATTGAAGCCAGAGCAGTTCAG	0.542																																						dbGAP											0													106.0	101.0	103.0					7																	100030928		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.1933G>C	7.37:g.100030928G>C	ENSP00000308546:p.Glu645Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KP86|D6W5V7|Q9NPD4	Missense_Mutation	SNP	pfam_Bin3	p.E645Q	ENST00000310512.2	37	c.1933	CCDS5693.1	7	.	.	.	.	.	.	.	.	.	.	G	19.16	3.774178	0.69992	.	.	ENSG00000146834	ENST00000414441;ENST00000425355;ENST00000310512	.	.	.	5.29	4.39	0.52855	Bin3-type S-adenosyl-L-methionine binding domain (1);Bicoid-interacting 3 (1);	0.132505	0.49305	D	0.000147	T	0.47637	0.1456	L	0.31476	0.935	0.48395	D	0.999649	P	0.47841	0.901	P	0.51101	0.659	T	0.26467	-1.0102	9	0.33141	T	0.24	-18.7623	10.0743	0.42351	0.0933:0.0:0.9067:0.0	.	645	Q7L2J0	MEPCE_HUMAN	Q	176;176;645	.	ENSP00000308546:E645Q	E	+	1	0	MEPCE	99868864	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	6.340000	0.72973	2.757000	0.94681	0.462000	0.41574	GAG	MEPCE	-	pfam_Bin3	ENSG00000146834		0.542	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEPCE	HGNC	protein_coding	OTTHUMT00000339135.1	36	0.00	0	G			100030928	100030928	+1	no_errors	ENST00000310512	ensembl	human	known	69_37n	missense	36	37.93	22	SNP	1.000	C
MOV10L1	54456	genome.wustl.edu	37	22	50591632	50591632	+	Silent	SNP	C	C	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr22:50591632C>A	ENST00000262794.5	+	22	3134	c.3051C>A	c.(3049-3051)atC>atA	p.I1017I	MOV10L1_ENST00000354853.2_Silent_p.I60I|MOV10L1_ENST00000395843.1_Silent_p.I60I|MOV10L1_ENST00000395852.1_Silent_p.I144I|MOV10L1_ENST00000545383.1_Silent_p.I1017I|MOV10L1_ENST00000395858.3_Silent_p.I1017I|MOV10L1_ENST00000540615.1_Silent_p.I997I	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	1017					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TCCCTCTCATCTTCCATGGTG	0.577																																						dbGAP											0													246.0	224.0	231.0					22																	50591632		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.3051C>A	22.37:g.50591632C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Silent	SNP	superfamily_NA-bd_OB-fold-like	p.I1017	ENST00000262794.5	37	c.3051	CCDS14084.1	22																																																																																			MOV10L1	-	NULL	ENSG00000073146		0.577	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOV10L1	HGNC	protein_coding	OTTHUMT00000075009.2	98	0.00	0	C	NM_018995		50591632	50591632	+1	no_errors	ENST00000262794	ensembl	human	known	69_37n	silent	25	73.12	68	SNP	0.998	A
MPEG1	219972	genome.wustl.edu	37	11	58980260	58980260	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr11:58980260C>A	ENST00000361050.3	-	1	164	c.79G>T	c.(79-81)Gac>Tac	p.D27Y	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	27						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				CCAACTTCGTCCATCTCTCCC	0.552																																						dbGAP											0													106.0	109.0	108.0					11																	58980260		2011	4164	6175	-	-	-	SO:0001583	missense	0			AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.79G>T	11.37:g.58980260C>A	ENSP00000354335:p.Asp27Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.D27Y	ENST00000361050.3	37	c.79	CCDS41650.1	11	.	.	.	.	.	.	.	.	.	.	C	10.96	1.499327	0.26861	.	.	ENSG00000197629	ENST00000361050;ENST00000545098	T	0.23147	1.92	5.52	-1.25	0.09405	.	0.693986	0.14191	N	0.335326	T	0.13586	0.0329	L	0.36672	1.1	0.09310	N	1	B	0.29716	0.255	B	0.21917	0.037	T	0.15578	-1.0432	10	0.33940	T	0.23	-1.3193	2.9003	0.05703	0.1133:0.4856:0.1111:0.29	.	27	Q2M385	MPEG1_HUMAN	Y	27	ENSP00000354335:D27Y	ENSP00000354335:D27Y	D	-	1	0	MPEG1	58736836	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.496000	0.06436	0.049000	0.15920	0.644000	0.83932	GAC	MPEG1	-	NULL	ENSG00000197629		0.552	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPEG1	HGNC	protein_coding	OTTHUMT00000370027.1	44	0.00	0	C	NM_001039396		58980260	58980260	-1	no_errors	ENST00000361050	ensembl	human	known	69_37n	missense	29	40.82	20	SNP	0.000	A
MTUS2	23281	genome.wustl.edu	37	13	29599120	29599120	+	Silent	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr13:29599120G>A	ENST00000431530.3	+	1	373	c.315G>A	c.(313-315)ctG>ctA	p.L105L		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	95						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CTGCCAGCCTGAAAGATTTTA	0.478																																						dbGAP											0													34.0	34.0	34.0					13																	29599120		1844	4080	5924	-	-	-	SO:0001819	synonymous_variant	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.315G>A	13.37:g.29599120G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	NULL	p.L105	ENST00000431530.3	37	c.315	CCDS45022.1	13																																																																																			MTUS2	-	NULL	ENSG00000132938		0.478	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	32	0.00	0	G	XM_166270		29599120	29599120	+1	no_errors	ENST00000431530	ensembl	human	known	69_37n	silent	15	54.55	18	SNP	0.005	A
MUC16	94025	genome.wustl.edu	37	19	9086981	9086981	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:9086981C>T	ENST00000397910.4	-	1	5037	c.4834G>A	c.(4834-4836)Gac>Aac	p.D1612N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1612	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GACAGTGTGTCTGTAGATGGT	0.512																																						dbGAP											0													245.0	235.0	238.0					19																	9086981		2016	4179	6195	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.4834G>A	19.37:g.9086981C>T	ENSP00000381008:p.Asp1612Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.D1612N	ENST00000397910.4	37	c.4834	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	5.983	0.365278	0.11352	.	.	ENSG00000181143	ENST00000397910	T	0.02944	4.1	1.33	0.241	0.15494	.	.	.	.	.	T	0.01558	0.0050	N	0.08118	0	.	.	.	B	0.23540	0.087	B	0.14023	0.01	T	0.42515	-0.9447	8	0.87932	D	0	.	3.4969	0.07658	0.0:0.7269:0.0:0.2731	.	1612	B5ME49	.	N	1612	ENSP00000381008:D1612N	ENSP00000381008:D1612N	D	-	1	0	MUC16	8947981	0.005000	0.15991	0.001000	0.08648	0.244000	0.25665	0.021000	0.13489	0.105000	0.17753	0.313000	0.20887	GAC	MUC16	-	NULL	ENSG00000181143		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	145	0.00	0	C	NM_024690		9086981	9086981	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	102	44.02	81	SNP	0.001	T
MUC2	4583	genome.wustl.edu	37	11	1101059	1101059	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr11:1101059C>T	ENST00000441003.2	+	41	7485	c.7458C>T	c.(7456-7458)atC>atT	p.I2486I		NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4848					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GTGGCATCATCTGCCAACCCA	0.587																																						dbGAP											0													75.0	84.0	81.0					11																	1101059		2133	4231	6364	-	-	-	SO:0001819	synonymous_variant	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.7458C>T	11.37:g.1101059C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14878	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.I2486	ENST00000441003.2	37	c.7458		11																																																																																			MUC2	-	superfamily_Prot_inh_PMP,smart_VWF_C,pfscan_VWF_C	ENSG00000198788		0.587	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	25	0.00	0	C	NM_002457		1101059	1101059	+1	no_errors	ENST00000441003	ensembl	human	known	69_37n	silent	37	43.08	28	SNP	0.048	T
MX2	4600	genome.wustl.edu	37	21	42754408	42754408	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr21:42754408G>A	ENST00000330714.3	+	5	833	c.649G>A	c.(649-651)Gag>Aag	p.E217K	MX2_ENST00000543692.1_Missense_Mutation_p.E172K	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	217	Dynamin-type G.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				CACCTCCCCTGAGGTTCCAGA	0.612																																						dbGAP											0													83.0	76.0	79.0					21																	42754408		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.649G>A	21.37:g.42754408G>A	ENSP00000333657:p.Glu217Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5D3|D3DSI7	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,superfamily_CH-domain,smart_Dynamin_GTPase,smart_GED,prints_Dynamin	p.E217K	ENST00000330714.3	37	c.649	CCDS13672.1	21	.	.	.	.	.	.	.	.	.	.	G	12.31	1.899369	0.33535	.	.	ENSG00000183486	ENST00000330714;ENST00000543692	D;D	0.96716	-4.1;-3.69	3.54	-1.95	0.07548	Dynamin, GTPase domain (2);	0.322211	0.30989	U	0.008475	D	0.89157	0.6635	N	0.17082	0.46	0.09310	N	1	B	0.19583	0.037	B	0.25405	0.06	T	0.80863	-0.1192	10	0.62326	D	0.03	-9.3973	5.2651	0.15595	0.2688:0.2762:0.455:0.0	.	217	P20592	MX2_HUMAN	K	217;172	ENSP00000333657:E217K;ENSP00000446017:E172K	ENSP00000333657:E217K	E	+	1	0	MX2	41676278	0.000000	0.05858	0.000000	0.03702	0.608000	0.37181	0.108000	0.15396	-0.316000	0.08690	0.561000	0.74099	GAG	MX2	-	pfam_Dynamin_GTPase,smart_Dynamin_GTPase,prints_Dynamin	ENSG00000183486		0.612	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX2	HGNC	protein_coding	OTTHUMT00000195147.1	32	0.00	0	G	NM_002463		42754408	42754408	+1	no_errors	ENST00000330714	ensembl	human	known	69_37n	missense	23	45.24	19	SNP	0.099	A
NF1	4763	genome.wustl.edu	37	17	29527590	29527590	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr17:29527590C>T	ENST00000358273.4	+	9	1422	c.1039C>T	c.(1039-1041)Cag>Tag	p.Q347*	NF1_ENST00000356175.3_Nonsense_Mutation_p.Q347*|NF1_ENST00000431387.4_Nonsense_Mutation_p.Q347*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	347					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(6)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CCTACTTGTTCAGTCCATGGT	0.348			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	14	Whole gene deletion(8)|Unknown(6)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(3)|lung(1)	GRCh37	CS086356	NF1	S							110.0	101.0	104.0					17																	29527590		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1039C>T	17.37:g.29527590C>T	ENSP00000351015:p.Gln347*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.Q347*	ENST00000358273.4	37	c.1039	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.616177	0.96649	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	19.1503	0.93485	0.0:1.0:0.0:0.0	.	.	.	.	X	347;347;347;13	.	ENSP00000348498:Q347X	Q	+	1	0	NF1	26551716	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	7.182000	0.77689	2.542000	0.85734	0.591000	0.81541	CAG	NF1	-	superfamily_ARM-type_fold	ENSG00000196712		0.348	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	70	0.00	0	C	NM_000267		29527590	29527590	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	nonsense	9	85.25	52	SNP	1.000	T
NBR2	10230	genome.wustl.edu	37	17	41283243	41283243	+	RNA	SNP	C	C	T	rs574074926	byFrequency	TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr17:41283243C>T	ENST00000460115.1	+	0	180					NR_003108.1		O15453	NBR2_HUMAN	neighbor of BRCA1 gene 2 (non-protein coding)																		TTCATTTGATCTGAATAGTAT	0.308													C|||	2	0.000399361	0.0	0.0	5008	,	,		15449	0.0		0.0	False		,,,				2504	0.002					dbGAP											0																																										-	-	-			0			U88573		17q21	2012-10-16	2009-08-21		ENSG00000198496	ENSG00000198496		"""Long non-coding RNAs"""	20691	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 192"""		"""neighbor of BRCA1 gene 2"""			9215675, 15777733	Standard	NR_003108		Approved	NCRNA00192	uc002idf.3	O15453	OTTHUMG00000140395		17.37:g.41283243C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3LRJ7	RNA	SNP	-	NULL	ENST00000460115.1	37	NULL		17																																																																																			NBR2	-	-	ENSG00000198496		0.308	NBR2-001	KNOWN	basic	processed_transcript	NBR2	HGNC	pseudogene	OTTHUMT00000277175.1	21	0.00	0	C	NR_003108		41283243	41283243	+1	no_errors	ENST00000356906	ensembl	human	known	69_37n	rna	3	82.35	14	SNP	1.000	T
NOC3L	64318	genome.wustl.edu	37	10	96106314	96106314	+	Splice_Site	SNP	C	C	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr10:96106314C>A	ENST00000371361.3	-	11	1358		c.e11-1		NOC3L_ENST00000543788.1_Splice_Site|NOC3L_ENST00000371350.1_Splice_Site|NOC3L_ENST00000463649.1_Splice_Site	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)						fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				TTTTTAACATCTAATATTGGA	0.254																																						dbGAP											0													40.0	40.0	40.0					10																	96106314		2163	4234	6397	-	-	-	SO:0001630	splice_region_variant	0			AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.1258-1G>T	10.37:g.96106314C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H5M6|Q9H9D8	Splice_Site	SNP	-	e11-1	ENST00000371361.3	37	c.1258-1	CCDS7433.1	10	.	.	.	.	.	.	.	.	.	.	C	21.4	4.147902	0.78001	.	.	ENSG00000173145	ENST00000543788;ENST00000371361;ENST00000371350	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4021	0.94634	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOC3L	96096304	1.000000	0.71417	0.997000	0.53966	0.918000	0.54935	6.776000	0.75023	2.690000	0.91761	0.655000	0.94253	.	NOC3L	-	-	ENSG00000173145		0.254	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOC3L	HGNC	protein_coding	OTTHUMT00000049466.1	111	0.00	0	C	NM_022451	Intron	96106314	96106314	-1	no_errors	ENST00000371350	ensembl	human	known	69_37n	splice_site	106	36.90	62	SNP	1.000	A
CENPP	401541	genome.wustl.edu	37	9	95086375	95086375	+	5'Flank	SNP	G	G	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr9:95086375G>T	ENST00000375587.3	+	0	0				NOL8_ENST00000535387.1_Missense_Mutation_p.D23E|NOL8_ENST00000358855.4_5'UTR|NOL8_ENST00000442668.2_Missense_Mutation_p.D23E|NOL8_ENST00000543985.1_5'UTR|NOL8_ENST00000542053.1_Intron|NOL8_ENST00000545558.1_Missense_Mutation_p.D23E	NM_001012267.1	NP_001012267.1	Q6IPU0	CENPP_HUMAN	centromere protein P						CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(1)	16						GATTTTGTAGGTCTGCCTCAG	0.458																																						dbGAP											0													149.0	142.0	144.0					9																	95086375		1892	4110	6002	-	-	-	SO:0001631	upstream_gene_variant	0			AK091247	CCDS35063.1, CCDS69618.1	9q22.31	2013-11-05			ENSG00000188312	ENSG00000188312			32933	protein-coding gene	gene with protein product		611505				16622419, 16622420	Standard	NM_001286969		Approved	RP11-19J3.3, CENP-P	uc004arz.3	Q6IPU0	OTTHUMG00000020228		9.37:g.95086375G>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRA5|B3KS17|Q5T9F8|Q5T9F9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D23E	ENST00000375587.3	37	c.69	CCDS35063.1	9	.	.	.	.	.	.	.	.	.	.	G	11.56	1.674534	0.29693	.	.	ENSG00000198000	ENST00000442668;ENST00000375594;ENST00000545558;ENST00000535387;ENST00000432670;ENST00000433029;ENST00000421075;ENST00000536624	T;T;T;T;T;T;T	0.10960	2.82;2.82;2.82;2.82;2.82;2.82;2.82	5.04	2.21	0.28008	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.102984	0.64402	D	0.000004	T	0.09818	0.0241	L	0.37561	1.115	0.80722	D	1	P	0.48089	0.905	P	0.49887	0.625	T	0.27673	-1.0067	10	0.42905	T	0.14	-19.9173	0.4296	0.00469	0.2405:0.1951:0.3251:0.2393	.	23	Q76FK4	NOL8_HUMAN	E	23	ENSP00000401177:D23E;ENSP00000441140:D23E;ENSP00000441300:D23E;ENSP00000414112:D23E;ENSP00000412471:D23E;ENSP00000390143:D23E;ENSP00000442037:D23E	ENSP00000354115:D23E	D	-	3	2	NOL8	94126196	0.924000	0.31332	0.974000	0.42286	0.553000	0.35397	-0.120000	0.10660	0.829000	0.34733	0.655000	0.94253	GAC	NOL8	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000198000		0.458	CENPP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL8	HGNC	protein_coding	OTTHUMT00000053098.1	70	0.00	0	G	NM_001012267		95086375	95086375	-1	no_errors	ENST00000442668	ensembl	human	known	69_37n	missense	83	31.15	38	SNP	0.993	T
NONO	4841	genome.wustl.edu	37	X	70516865	70516865	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chrX:70516865G>A	ENST00000276079.8	+	7	1116	c.911G>A	c.(910-912)cGc>cAc	p.R304H	NONO_ENST00000373856.3_Missense_Mutation_p.R304H|NONO_ENST00000535149.1_Missense_Mutation_p.R215H|NONO_ENST00000373841.1_Missense_Mutation_p.R304H|NONO_ENST00000490044.1_3'UTR	NM_007363.4	NP_031389.3	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding	304	DBHS.				circadian rhythm (GO:0007623)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mRNA processing (GO:0006397)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)		NONO/TFE3(2)	endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	19	Renal(35;0.156)					GAAGCTGCACGCCATGAGCAC	0.483			T	TFE3	papillary renal cancer																																	dbGAP		Dom	yes		X	Xq13.1	4841	"""non-POU domain containing, octamer-binding"""		E	0													45.0	28.0	34.0					X																	70516865		2202	4300	6502	-	-	-	SO:0001583	missense	0			L14599	CCDS14410.1, CCDS55445.1	Xq13.1	2014-06-13	2002-01-14		ENSG00000147140	ENSG00000147140		"""RNA binding motif (RRM) containing"""	7871	protein-coding gene	gene with protein product	"""Nuclear RNA-binding protein, 54-kD"", ""non-Pou domain-containing octamer (ATGCAAAT) binding protein"", ""protein phosphatase 1, regulatory subunit 114"""	300084	"""non-POU-domain-containing, octamer-binding"""			8371983, 9360842	Standard	NM_007363		Approved	NRB54, NMT55, P54NRB, P54, PPP1R114	uc004dzp.3	Q15233	OTTHUMG00000021798	ENST00000276079.8:c.911G>A	X.37:g.70516865G>A	ENSP00000276079:p.Arg304His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4C2|D3DVV4|F5GYZ3|O00201|P30807|Q12786|Q9BQC5	Missense_Mutation	SNP	pfam_RRM_dom,pfam_NOPS,smart_RRM_dom,pfscan_RRM_dom	p.R304H	ENST00000276079.8	37	c.911	CCDS14410.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	14.81|14.81	2.647342|2.647342	0.47258|0.47258	.|.	.|.	ENSG00000147140|ENSG00000147140	ENST00000418921|ENST00000535149;ENST00000276079;ENST00000373856;ENST00000373841;ENST00000413858	.|T;T;T;T;T	.|0.42513	.|2.07;2.04;2.04;2.04;0.97	5.13|5.13	5.13|5.13	0.70059|0.70059	.|.	.|0.053390	.|0.64402	.|D	.|0.000001	T|T	0.39489|0.39489	0.1080|0.1080	L|L	0.46819|0.46819	1.47|1.47	0.80722|0.80722	D|D	1|1	.|B	.|0.21071	.|0.051	.|B	.|0.09377	.|0.004	T|T	0.17410|0.17410	-1.0370|-1.0370	5|10	.|0.41790	.|T	.|0.15	-5.5917|-5.5917	17.7249|17.7249	0.88362|0.88362	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|304	.|Q15233	.|NONO_HUMAN	T|H	166|215;304;304;304;212	.|ENSP00000441364:R215H;ENSP00000276079:R304H;ENSP00000362963:R304H;ENSP00000362947:R304H;ENSP00000413350:R212H	.|ENSP00000276079:R304H	A|R	+|+	1|2	0|0	NONO|NONO	70433590|70433590	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.935000|0.935000	0.57460|0.57460	3.667000|3.667000	0.54547|0.54547	2.374000|2.374000	0.81015|0.81015	0.529000|0.529000	0.55759|0.55759	GCC|CGC	NONO	-	NULL	ENSG00000147140		0.483	NONO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NONO	HGNC	protein_coding	OTTHUMT00000057138.1	42	0.00	0	G	NM_007363		70516865	70516865	+1	no_errors	ENST00000276079	ensembl	human	known	69_37n	missense	28	42.00	21	SNP	0.997	A
NUS1	116150	genome.wustl.edu	37	6	117997186	117997186	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr6:117997186C>G	ENST00000368494.3	+	1	522	c.353C>G	c.(352-354)gCg>gGg	p.A118G		NM_138459.3	NP_612468.1	Q96E22	NGBR_HUMAN	nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)	118					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|intracellular cholesterol transport (GO:0032367)|protein glycosylation (GO:0006486)|sterol homeostasis (GO:0055092)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|prostate(2)	8		all_cancers(87;0.0395)|all_epithelial(87;0.0301)		GBM - Glioblastoma multiforme(226;0.02)|OV - Ovarian serous cystadenocarcinoma(136;0.115)|all cancers(137;0.146)		TCGGACATCGCGAGCCTCGTG	0.647																																						dbGAP											0													12.0	10.0	10.0					6																	117997186		2115	4116	6231	-	-	-	SO:0001583	missense	0			BC013026	CCDS5118.1	6q22.1	2012-12-13	2006-11-24	2006-11-24	ENSG00000153989	ENSG00000153989			21042	protein-coding gene	gene with protein product	"""Nogo-B receptor"", ""transport and golgi organization 14 homolog (Drosophila)"""	610463	"""chromosome 6 open reading frame 68"""	C6orf68			Standard	NM_138459		Approved	MGC7199, NgBR, TANGO14	uc003pxw.3	Q96E22	OTTHUMG00000015458	ENST00000368494.3:c.353C>G	6.37:g.117997186C>G	ENSP00000357480:p.Ala118Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWQ4|O00251	Missense_Mutation	SNP	pfam_UPP_synth-like,superfamily_UPP_synth-like	p.A118G	ENST00000368494.3	37	c.353	CCDS5118.1	6	.	.	.	.	.	.	.	.	.	.	C	29.1	4.980265	0.92982	.	.	ENSG00000153989	ENST00000368494	T	0.18657	2.2	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.41558	0.1164	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.32079	-0.9920	10	0.34782	T	0.22	-9.6598	17.2506	0.87041	0.0:1.0:0.0:0.0	.	118	Q96E22	NGBR_HUMAN	G	118	ENSP00000357480:A118G	ENSP00000357480:A118G	A	+	2	0	NUS1	118103879	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	6.761000	0.74945	2.371000	0.80710	0.561000	0.74099	GCG	NUS1	-	superfamily_UPP_synth-like	ENSG00000153989		0.647	NUS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUS1	HGNC	protein_coding	OTTHUMT00000041989.1	15	0.00	0	C	NM_138459		117997186	117997186	+1	no_errors	ENST00000368494	ensembl	human	known	69_37n	missense	18	30.77	8	SNP	1.000	G
TENM1	10178	genome.wustl.edu	37	X	123514646	123514646	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chrX:123514646C>T	ENST00000371130.3	-	31	7981	c.7918G>A	c.(7918-7920)Gaa>Aaa	p.E2640K	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.E2647K	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2640					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TTTTCCTCTTCGACAGTTGTC	0.532																																						dbGAP											0													110.0	97.0	101.0					X																	123514646		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.7918G>A	X.37:g.123514646C>T	ENSP00000360171:p.Glu2640Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.E2647K	ENST00000371130.3	37	c.7939	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867025	0.91511	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86956	-2.19;-2.16	5.82	5.82	0.92795	.	0.049437	0.85682	D	0.000000	D	0.92450	0.7603	L	0.56769	1.78	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.994	D;P;P	0.73708	0.981;0.832;0.664	D	0.92687	0.6163	10	0.66056	D	0.02	.	19.0811	0.93182	0.0:1.0:0.0:0.0	.	2646;2647;2640	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	K	2640;2647	ENSP00000360171:E2640K;ENSP00000403954:E2647K	ENSP00000360171:E2640K	E	-	1	0	ODZ1	123342327	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.818000	0.86416	2.455000	0.83008	0.594000	0.82650	GAA	ODZ1	-	NULL	ENSG00000009694		0.532	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	80	0.00	0	C	NM_014253		123514646	123514646	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	missense	69	45.24	57	SNP	1.000	T
OR10Z1	128368	genome.wustl.edu	37	1	158576979	158576979	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:158576979C>T	ENST00000361284.1	+	1	751	c.751C>T	c.(751-753)Cat>Tat	p.H251Y		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	251						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					GGTCATTATTCATTATGGCTG	0.517																																						dbGAP											0													198.0	202.0	201.0					1																	158576979		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.751C>T	1.37:g.158576979C>T	ENSP00000354707:p.His251Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYL0|Q6IFR7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.H251Y	ENST00000361284.1	37	c.751	CCDS30901.1	1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.289357	0.40494	.	.	ENSG00000198967	ENST00000361284	T	0.00034	8.87	5.05	5.05	0.67936	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40222	N	0.001159	T	0.00039	0.0001	N	0.20766	0.605	0.36941	D	0.892375	B	0.13594	0.008	B	0.15052	0.012	T	0.56056	-0.8042	10	0.41790	T	0.15	.	11.4241	0.50001	0.0:0.9135:0.0:0.0865	.	251	Q8NGY1	O10Z1_HUMAN	Y	251	ENSP00000354707:H251Y	ENSP00000354707:H251Y	H	+	1	0	OR10Z1	156843603	0.704000	0.27836	0.878000	0.34440	0.841000	0.47740	3.206000	0.51098	2.616000	0.88540	0.650000	0.86243	CAT	OR10Z1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000198967		0.517	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Z1	HGNC	protein_coding	OTTHUMT00000051853.1	54	0.00	0	C	NM_001004478		158576979	158576979	+1	no_errors	ENST00000361284	ensembl	human	known	69_37n	missense	105	34.38	55	SNP	0.986	T
OR5B12	390191	genome.wustl.edu	37	11	58207576	58207576	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr11:58207576C>T	ENST00000302572.2	-	1	70	c.49G>A	c.(49-51)Gat>Aat	p.D17N		NM_001004733.2	NP_001004733.1	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B, member 12	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(6)|liver(1)|lung(28)|ovary(1)|prostate(3)|skin(1)	40	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TCTGGGTCATCAGTTAACCCC	0.433																																						dbGAP											0													96.0	107.0	103.0					11																	58207576		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065851	CCDS31551.1	11q12.1	2012-08-09		2004-03-10	ENSG00000172362	ENSG00000172362		"""GPCR / Class A : Olfactory receptors"""	15432	protein-coding gene	gene with protein product				OR5B12P, OR5B16		12213199	Standard	NM_001004733		Approved	OST743	uc010rkh.2	Q96R08	OTTHUMG00000167543	ENST00000302572.2:c.49G>A	11.37:g.58207576C>T	ENSP00000306657:p.Asp17Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNL2|Q6IEV5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.D17N	ENST00000302572.2	37	c.49	CCDS31551.1	11	.	.	.	.	.	.	.	.	.	.	C	4.460	0.085239	0.08583	.	.	ENSG00000172362	ENST00000302572	T	0.00433	7.43	4.87	-3.02	0.05446	.	0.992217	0.08181	N	0.985509	T	0.00271	0.0008	N	0.25789	0.76	0.09310	N	0.999999	B	0.06786	0.001	B	0.10450	0.005	T	0.18903	-1.0322	10	0.31617	T	0.26	-3.8671	10.4743	0.44655	0.0:0.4683:0.0:0.5317	.	17	Q96R08	OR5BC_HUMAN	N	17	ENSP00000306657:D17N	ENSP00000306657:D17N	D	-	1	0	OR5B12	57964152	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.201000	0.09464	-0.725000	0.04901	0.655000	0.94253	GAT	OR5B12	-	NULL	ENSG00000172362		0.433	OR5B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B12	HGNC	protein_coding	OTTHUMT00000394987.1	53	0.00	0	C	NM_001004733		58207576	58207576	-1	no_errors	ENST00000302572	ensembl	human	known	69_37n	missense	24	45.45	20	SNP	0.007	T
OR7C1	26664	genome.wustl.edu	37	19	14910637	14910638	+	Frame_Shift_Ins	INS	-	-	A	rs534928853	byFrequency	TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:14910637_14910638insA	ENST00000248073.2	-	1	385_386	c.311_312insT	c.(310-312)ttcfs	p.F104fs	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	104					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						CAAATGAAGTGAAAAAAAAAAT	0.446																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.312dupT	19.37:g.14910647_14910647dupA	ENSP00000248073:p.Phe104fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15621|Q6IFP2|Q96R94	Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T105fs	ENST00000248073.2	37	c.312_311	CCDS12317.1	19																																																																																			OR7C1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000127530		0.446	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C1	HGNC	protein_coding	OTTHUMT00000466519.1	78	0.00	0	-			14910637	14910638	-1	no_errors	ENST00000248073	ensembl	human	known	69_37n	frame_shift_ins	53	41.76	38	INS	0.001:0.017	A
OR7D4	125958	genome.wustl.edu	37	19	9325094	9325094	+	Silent	SNP	G	G	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:9325094G>T	ENST00000308682.2	-	1	448	c.420C>A	c.(418-420)ctC>ctA	p.L140L		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						GGAGGCCACAGAGGCAGGGGT	0.517																																						dbGAP											0													78.0	76.0	77.0					19																	9325094		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.420C>A	19.37:g.9325094G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L140	ENST00000308682.2	37	c.420	CCDS32901.1	19																																																																																			OR7D4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000174667		0.517	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D4	HGNC	protein_coding	OTTHUMT00000449004.1	63	0.00	0	G			9325094	9325094	-1	no_errors	ENST00000308682	ensembl	human	known	69_37n	silent	63	35.71	35	SNP	0.419	T
PARP4	143	genome.wustl.edu	37	13	25049681	25049681	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr13:25049681C>T	ENST00000381989.3	-	15	1948	c.1843G>A	c.(1843-1845)Gat>Aat	p.D615N		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	615	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CCAGAGGCATCCTGGAGGCCG	0.458																																						dbGAP											0													109.0	110.0	109.0					13																	25049681		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.1843G>A	13.37:g.25049681C>T	ENSP00000371419:p.Asp615Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.D615N	ENST00000381989.3	37	c.1843	CCDS9307.1	13	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506212	0.44558	.	.	ENSG00000102699	ENST00000381989	T	0.02085	4.46	3.9	3.9	0.45041	Vault protein inter-alpha-trypsin (1);Vault protein inter-alpha-trypsin, metazoa (1);	0.133858	0.48767	U	0.000167	T	0.08268	0.0206	M	0.64404	1.975	0.41534	D	0.988472	D	0.89917	1.0	D	0.80764	0.994	T	0.01869	-1.1257	10	0.62326	D	0.03	-20.9387	7.3494	0.26682	0.0:0.882:0.0:0.118	.	615	Q9UKK3	PARP4_HUMAN	N	615	ENSP00000371419:D615N	ENSP00000371419:D615N	D	-	1	0	PARP4	23947681	1.000000	0.71417	0.968000	0.41197	0.056000	0.15407	3.027000	0.49697	2.032000	0.59987	0.551000	0.68910	GAT	PARP4	-	smart_VIT	ENSG00000102699		0.458	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	HGNC	protein_coding	OTTHUMT00000044189.1	68	0.00	0	C	NM_006437		25049681	25049681	-1	no_errors	ENST00000381989	ensembl	human	known	69_37n	missense	55	33.73	28	SNP	1.000	T
PARP6	56965	genome.wustl.edu	37	15	72552860	72552860	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr15:72552860G>A	ENST00000569795.1	-	10	1402	c.715C>T	c.(715-717)Cag>Tag	p.Q239*	PARP6_ENST00000413097.2_Intron|PARP6_ENST00000287196.9_Nonsense_Mutation_p.Q239*|PARP6_ENST00000260376.7_Nonsense_Mutation_p.Q239*			Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	239							NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.Q239*(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	18						CCCACGTGCTGAGGGCACAGG	0.612																																						dbGAP											1	Substitution - Nonsense(1)	endometrium(1)											150.0	155.0	154.0					15																	72552860		1898	4114	6012	-	-	-	SO:0001587	stop_gained	0			AL390093	CCDS10241.2	15q22	2010-02-16			ENSG00000137817	ENSG00000137817		"""Poly (ADP-ribose) polymerases"""	26921	protein-coding gene	gene with protein product						15273990	Standard	XM_005254557		Approved	pART17	uc002auc.3	Q2NL67	OTTHUMG00000133443	ENST00000569795.1:c.715C>T	15.37:g.72552860G>A	ENSP00000456348:p.Gln239*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H7C5|Q9H9X6|Q9HAF3|Q9NPS6|Q9UFG4	Nonsense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.Q239*	ENST00000569795.1	37	c.715	CCDS10241.2	15	.	.	.	.	.	.	.	.	.	.	G	28.7	4.942946	0.92526	.	.	ENSG00000137817	ENST00000419739;ENST00000287196;ENST00000260376;ENST00000336471	.	.	.	4.77	4.77	0.60923	.	0.942197	0.08956	N	0.869361	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-6.7971	14.9686	0.71213	0.0:0.0:1.0:0.0	.	.	.	.	X	239	.	ENSP00000260376:Q239X	Q	-	1	0	PARP6	70339914	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	4.037000	0.57311	2.198000	0.70561	0.471000	0.43371	CAG	PARP6	-	NULL	ENSG00000137817		0.612	PARP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP6	HGNC	protein_coding	OTTHUMT00000257315.2	16	0.00	0	G	NM_020214		72552860	72552860	-1	no_errors	ENST00000287196	ensembl	human	known	69_37n	nonsense	10	54.55	12	SNP	1.000	A
PCSK1	5122	genome.wustl.edu	37	5	95744025	95744025	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr5:95744025C>T	ENST00000311106.3	-	9	1335	c.1098G>A	c.(1096-1098)acG>acA	p.T366T	CTD-2337A12.1_ENST00000502645.2_RNA|PCSK1_ENST00000513085.1_5'UTR|PCSK1_ENST00000508626.1_Silent_p.T319T	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	366	Peptidase S8.				cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GGTCAGCGCTCGTCTGGATGA	0.582																																						dbGAP											0													68.0	51.0	56.0					5																	95744025		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.1098G>A	5.37:g.95744025C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8T7|E9PHA1|P78478|Q92532	Silent	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,pfam_Proho_convert,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.T366	ENST00000311106.3	37	c.1098	CCDS4081.1	5																																																																																			PCSK1	-	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53	ENSG00000175426		0.582	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK1	HGNC	protein_coding	OTTHUMT00000242851.1	44	0.00	0	C	NM_000439		95744025	95744025	-1	no_errors	ENST00000311106	ensembl	human	known	69_37n	silent	46	39.47	30	SNP	0.004	T
PCDHGA2	56113	genome.wustl.edu	37	5	140719585	140719585	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr5:140719585G>A	ENST00000394576.2	+	1	1047	c.1047G>A	c.(1045-1047)atG>atA	p.M349I	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	349	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATTTTACATGACATCTGCTA	0.443																																						dbGAP											0													102.0	105.0	104.0					5																	140719585		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1047G>A	5.37:g.140719585G>A	ENSP00000378077:p.Met349Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.M349I	ENST00000394576.2	37	c.1047	CCDS47289.1	5	.	.	.	.	.	.	.	.	.	.	.	0.001	-2.952256	0.00050	.	.	ENSG00000081853	ENST00000394576	T	0.01685	4.69	5.13	-0.222	0.13122	Cadherin (2);Cadherin-like (1);	0.478549	0.17451	N	0.173791	T	0.00580	0.0019	N	0.00729	-1.24	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.47182	-0.9137	10	0.05959	T	0.93	.	9.2304	0.37432	0.1791:0.2994:0.5215:0.0	.	349;349	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	I	349	ENSP00000378077:M349I	ENSP00000378077:M349I	M	+	3	0	PCDHGA2	140699769	0.000000	0.05858	0.489000	0.27452	0.015000	0.08874	-1.212000	0.02994	0.007000	0.14760	-1.134000	0.01955	ATG	PCDHGA2	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000081853		0.443	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA2	HGNC	protein_coding	OTTHUMT00000374738.1	36	0.00	0	G	NM_018915		140719585	140719585	+1	no_errors	ENST00000394576	ensembl	human	known	69_37n	missense	22	52.17	24	SNP	0.006	A
PCYOX1	51449	genome.wustl.edu	37	2	70486522	70486522	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr2:70486522C>T	ENST00000433351.2	+	2	171	c.143C>T	c.(142-144)tCa>tTa	p.S48L	PCYOX1_ENST00000545138.1_5'UTR|PCYOX1_ENST00000505044.2_5'UTR|PCYOX1_ENST00000264441.5_Missense_Mutation_p.S48L	NM_016297.3	NP_057381.3	Q9UHG3	PCYOX_HUMAN	prenylcysteine oxidase 1	48					prenylated protein catabolic process (GO:0030327)|prenylcysteine catabolic process (GO:0030328)|prenylcysteine metabolic process (GO:0030329)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	chloride-transporting ATPase activity (GO:0008555)|prenylcysteine oxidase activity (GO:0001735)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)	15						GGTGGCACTTCAGCAGCCTAT	0.453																																						dbGAP											0													149.0	168.0	162.0					2																	70486522		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020715	CCDS1902.1	2p13.3	2008-02-05			ENSG00000116005	ENSG00000116005	1.8.3.5		20588	protein-coding gene	gene with protein product		610995				10585463, 12186880	Standard	NM_016297		Approved	KIAA0908, PCL1	uc002sgn.4	Q9UHG3	OTTHUMG00000129671	ENST00000433351.2:c.143C>T	2.37:g.70486522C>T	ENSP00000387654:p.Ser48Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB14|B7Z9P8|O94982|Q8N4N5|Q96QM8	Missense_Mutation	SNP	pfam_Prenylcys_lyase,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Amino_oxidase,pirsf_Prenylcysteine_Oxase	p.S48L	ENST00000433351.2	37	c.143	CCDS1902.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.594896	0.96602	.	.	ENSG00000116005	ENST00000433351;ENST00000264441	T;T	0.81247	-1.47;-1.47	5.39	5.39	0.77823	FAD dependent oxidoreductase (1);	0.175862	0.50627	D	0.000112	D	0.89577	0.6755	M	0.82056	2.57	0.80722	D	1	D;D	0.71674	0.986;0.998	P;D	0.64877	0.877;0.93	D	0.90532	0.4496	10	0.87932	D	0	-12.267	17.8844	0.88849	0.0:1.0:0.0:0.0	.	48;48	B7Z8A2;Q9UHG3	.;PCYOX_HUMAN	L	48	ENSP00000387654:S48L;ENSP00000264441:S48L	ENSP00000264441:S48L	S	+	2	0	PCYOX1	70340026	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	5.571000	0.67404	2.795000	0.96236	0.655000	0.94253	TCA	PCYOX1	-	pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Amino_oxidase,pirsf_Prenylcysteine_Oxase	ENSG00000116005		0.453	PCYOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYOX1	HGNC	protein_coding	OTTHUMT00000251872.3	105	0.94	1	C	NM_016297		70486522	70486522	+1	no_errors	ENST00000433351	ensembl	human	known	69_37n	missense	73	45.52	61	SNP	0.987	T
PDCL	5082	genome.wustl.edu	37	9	125582781	125582781	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr9:125582781C>T	ENST00000259467.4	-	4	654	c.489G>A	c.(487-489)gaG>gaA	p.E163E		NM_005388.4	NP_005379.3	Q13371	PHLP_HUMAN	phosducin-like	163					heterotrimeric G-protein complex assembly (GO:1902605)|intracellular signal transduction (GO:0035556)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10						CACTGGAGATCTCAAAAACCT	0.458																																						dbGAP											0													110.0	107.0	108.0					9																	125582781		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF083325	CCDS6845.1	9q12-q13	2008-07-21			ENSG00000136940	ENSG00000136940			8770	protein-coding gene	gene with protein product		604421				10095058	Standard	NM_005388		Approved	PhLP, DKFZp564M1863	uc004bmz.2	Q13371	OTTHUMG00000020624	ENST00000259467.4:c.489G>A	9.37:g.125582781C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXB6|Q96AF1|Q9UEW7|Q9UFL0|Q9UNX1|Q9UNX2	Silent	SNP	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold,prints_Phosducin	p.E163	ENST00000259467.4	37	c.489	CCDS6845.1	9																																																																																			PDCL	-	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold	ENSG00000136940		0.458	PDCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCL	HGNC	protein_coding	OTTHUMT00000053956.1	44	0.00	0	C	NM_005388		125582781	125582781	-1	no_errors	ENST00000259467	ensembl	human	known	69_37n	silent	48	33.33	24	SNP	0.994	T
PEX1	5189	genome.wustl.edu	37	7	92120666	92120666	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr7:92120666C>A	ENST00000248633.4	-	21	3453	c.3358G>T	c.(3358-3360)Gaa>Taa	p.E1120*	PEX1_ENST00000438045.1_Nonsense_Mutation_p.E798*|AC007566.10_ENST00000427458.1_RNA|AC007566.10_ENST00000441539.1_RNA|PEX1_ENST00000428214.1_Nonsense_Mutation_p.E1063*	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	1120					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			AATTTTGATTCATCTGGAAGG	0.418																																						dbGAP											0													144.0	147.0	146.0					7																	92120666		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.3358G>T	7.37:g.92120666C>A	ENSP00000248633:p.Glu1120*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Nonsense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Peroxisome_synth_fac_1_a/b,pfam_PEX-1N,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_Asp_de-COase-like_fold,smart_AAA+_ATPase	p.E1120*	ENST00000248633.4	37	c.3358	CCDS5627.1	7	.	.	.	.	.	.	.	.	.	.	C	41	8.991414	0.99029	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214	.	.	.	5.4	5.4	0.78164	.	0.325294	0.36932	N	0.002322	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-13.7618	19.5206	0.95183	0.0:1.0:0.0:0.0	.	.	.	.	X	798;1120;1063	.	ENSP00000248633:E1120X	E	-	1	0	PEX1	91958602	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.165000	0.58196	2.702000	0.92279	0.491000	0.48974	GAA	PEX1	-	NULL	ENSG00000127980		0.418	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX1	HGNC	protein_coding	OTTHUMT00000254066.3	99	0.00	0	C	NM_000466		92120666	92120666	-1	no_errors	ENST00000248633	ensembl	human	known	69_37n	nonsense	65	43.97	51	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	76	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	33	50.00	33	SNP	1.000	A
POLR1A	25885	genome.wustl.edu	37	2	86260895	86260895	+	Silent	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr2:86260895C>G	ENST00000263857.6	-	28	4428	c.4050G>C	c.(4048-4050)ctG>ctC	p.L1350L	POLR1A_ENST00000409681.1_Silent_p.L1350L			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1350					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						TGGATTCCATCAGAAGTTTAA	0.463																																						dbGAP											0													62.0	61.0	61.0					2																	86260895		1854	4107	5961	-	-	-	SO:0001819	synonymous_variant	0			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.4050G>C	2.37:g.86260895C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Silent	SNP	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_Rpb1_1,smart_RNA_pol_N	p.L1350	ENST00000263857.6	37	c.4050	CCDS42706.1	2																																																																																			POLR1A	-	pfam_RNA_pol_Rpb1_5	ENSG00000068654		0.463	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	HGNC	protein_coding	OTTHUMT00000329830.2	69	0.00	0	C	NM_015425		86260895	86260895	-1	no_errors	ENST00000263857	ensembl	human	known	69_37n	silent	39	53.57	45	SNP	1.000	G
POLR2J	5439	genome.wustl.edu	37	7	102116688	102116688	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr7:102116688G>T	ENST00000292614.5	-	2	129	c.83C>A	c.(82-84)cCc>cAc	p.P28H	POLR2J_ENST00000393794.3_Missense_Mutation_p.P28H	NM_006234.4	NP_006225.1	P52435	RPB11_HUMAN	polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa	28					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|LRR domain binding (GO:0030275)			pancreas(2)	2						ACAGGCATTGGGTACCTTGGT	0.498																																						dbGAP											0													14.0	10.0	11.0					7																	102116688		1990	3770	5760	-	-	-	SO:0001583	missense	0			X98433	CCDS5724.1	7q11.2	2013-01-21	2002-08-29		ENSG00000005075	ENSG00000005075		"""RNA polymerase subunits"""	9197	protein-coding gene	gene with protein product		604150	"""polymerase (RNA) II (DNA directed) polypeptide J (13.3kD)"""				Standard	XM_005250452		Approved	RPB11, hRPB14, RPB11A, RPB11m, POLR2J1	uc003uzp.1	P52435	OTTHUMG00000150387	ENST00000292614.5:c.83C>A	7.37:g.102116688G>T	ENSP00000292614:p.Pro28His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D6V8|O43375	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_dimersation,superfamily_DNA-dir_RNA_pol_RBP11-like	p.P28H	ENST00000292614.5	37	c.83	CCDS5724.1	7	.	.	.	.	.	.	.	.	.	.	G	24.6	4.553695	0.86231	.	.	ENSG00000005075	ENST00000292614;ENST00000393794	D;D	0.92805	-3.11;-3.11	5.23	5.23	0.72850	DNA-directed RNA polymerase, RBP11-like (1);	0.000000	0.85682	D	0.000000	D	0.95598	0.8569	M	0.87328	2.875	0.80722	D	1	D	0.63046	0.992	P	0.55508	0.777	D	0.96318	0.9234	10	0.87932	D	0	-18.7259	17.4252	0.87525	0.0:0.0:1.0:0.0	.	28	P52435	RPB11_HUMAN	H	28	ENSP00000292614:P28H;ENSP00000377383:P28H	ENSP00000292614:P28H	P	-	2	0	POLR2J	101903693	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	9.306000	0.96204	2.462000	0.83206	0.650000	0.86243	CCC	POLR2J	-	superfamily_DNA-dir_RNA_pol_RBP11-like	ENSG00000005075		0.498	POLR2J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2J	HGNC	protein_coding	OTTHUMT00000317913.1	64	0.00	0	G	NM_006234		102116688	102116688	-1	no_errors	ENST00000393794	ensembl	human	known	69_37n	missense	36	75.68	112	SNP	1.000	T
PPFIA3	8541	genome.wustl.edu	37	19	49637900	49637900	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:49637900C>T	ENST00000334186.4	+	12	1731	c.1382C>T	c.(1381-1383)tCc>tTc	p.S461F	PPFIA3_ENST00000602351.1_Missense_Mutation_p.S461F	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	461					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		CCACAGAACTCCCTGAGCGAG	0.612																																						dbGAP											0													132.0	125.0	128.0					19																	49637900		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.1382C>T	19.37:g.49637900C>T	ENSP00000335614:p.Ser461Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.S461F	ENST00000334186.4	37	c.1382	CCDS12758.1	19	.	.	.	.	.	.	.	.	.	.	C	10.56	1.383646	0.25031	.	.	ENSG00000177380	ENST00000334186;ENST00000421230	T	0.18960	2.18	3.4	3.4	0.38934	.	0.198139	0.21100	U	0.080166	T	0.24005	0.0581	L	0.42245	1.32	0.35137	D	0.76847	P;P;P	0.47409	0.895;0.548;0.731	P;B;B	0.47705	0.555;0.35;0.308	T	0.28004	-1.0057	10	0.25106	T	0.35	-6.1976	14.1033	0.65072	0.0:1.0:0.0:0.0	.	385;461;461	B4DEU8;O75145-2;O75145	.;.;LIPA3_HUMAN	F	461;385	ENSP00000335614:S461F	ENSP00000335614:S461F	S	+	2	0	PPFIA3	54329712	0.996000	0.38824	0.987000	0.45799	0.332000	0.28634	4.076000	0.57591	1.912000	0.55364	0.557000	0.71058	TCC	PPFIA3	-	NULL	ENSG00000177380		0.612	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIA3	HGNC	protein_coding	OTTHUMT00000465688.1	30	0.00	0	C	NM_003660		49637900	49637900	+1	no_errors	ENST00000334186	ensembl	human	known	69_37n	missense	36	40.00	24	SNP	0.991	T
PPP1R12B	4660	genome.wustl.edu	37	1	202418189	202418189	+	Silent	SNP	C	C	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:202418189C>A	ENST00000608999.1	+	13	1893	c.1740C>A	c.(1738-1740)ctC>ctA	p.L580L	PPP1R12B_ENST00000336894.4_Silent_p.L580L	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	580					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			GCACCCCGCTCTGTGTGATCA	0.493																																						dbGAP											0													134.0	117.0	123.0					1																	202418189		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.1740C>A	1.37:g.202418189C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_12A/B/C_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L580	ENST00000608999.1	37	c.1740	CCDS1426.1	1																																																																																			PPP1R12B	-	pirsf_Pase-1_reg_su_12A/B/C_euk	ENSG00000077157		0.493	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R12B	HGNC	protein_coding	OTTHUMT00000099166.3	73	0.00	0	C	NM_032105		202418189	202418189	+1	no_errors	ENST00000336894	ensembl	human	known	69_37n	silent	140	28.21	55	SNP	0.959	A
PRDM14	63978	genome.wustl.edu	37	8	70981503	70981503	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr8:70981503G>A	ENST00000276594.2	-	2	794	c.593C>T	c.(592-594)aCg>aTg	p.T198M		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	198					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			GTCCTCCTCCGTGAACTGGAA	0.602																																					NSCLC(129;99 1813 5906 40656 46114)	dbGAP											0													81.0	83.0	82.0					8																	70981503		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.593C>T	8.37:g.70981503G>A	ENSP00000276594:p.Thr198Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UX9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.T198M	ENST00000276594.2	37	c.593	CCDS6206.1	8	.	.	.	.	.	.	.	.	.	.	G	14.59	2.582046	0.46006	.	.	ENSG00000147596	ENST00000276594	T	0.15487	2.42	5.5	5.5	0.81552	.	0.055620	0.64402	D	0.000002	T	0.45577	0.1349	M	0.78637	2.42	0.58432	D	0.999997	D	0.89917	1.0	D	0.77004	0.989	T	0.44360	-0.9333	10	0.87932	D	0	-25.5951	17.9691	0.89107	0.0:0.0:1.0:0.0	.	198	Q9GZV8	PRD14_HUMAN	M	198	ENSP00000276594:T198M	ENSP00000276594:T198M	T	-	2	0	PRDM14	71144057	0.941000	0.31946	0.959000	0.39883	0.015000	0.08874	0.828000	0.27435	2.582000	0.87167	0.655000	0.94253	ACG	PRDM14	-	NULL	ENSG00000147596		0.602	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM14	HGNC	protein_coding	OTTHUMT00000318505.1	44	0.00	0	G			70981503	70981503	-1	no_errors	ENST00000276594	ensembl	human	known	69_37n	missense	38	46.48	33	SNP	1.000	A
PRKCB	5579	genome.wustl.edu	37	16	24166032	24166032	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr16:24166032G>A	ENST00000321728.7	+	10	1268	c.1093G>A	c.(1093-1095)Gat>Aat	p.D365N	PRKCB_ENST00000303531.7_Missense_Mutation_p.D365N	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	365	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	AAAAGGCACAGATGAGCTCTA	0.527																																						dbGAP											0													142.0	116.0	125.0					16																	24166032		2197	4300	6497	-	-	-	SO:0001583	missense	0			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1093G>A	16.37:g.24166032G>A	ENSP00000318315:p.Asp365Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,prints_DAG/PE-bd,prints_C2_dom,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.D365N	ENST00000321728.7	37	c.1093	CCDS10618.1	16	.	.	.	.	.	.	.	.	.	.	G	21.0	4.077564	0.76528	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	T;T	0.23552	1.9;1.9	5.87	5.87	0.94306	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.052405	0.64402	D	0.000001	T	0.16811	0.0404	N	0.02697	-0.525	0.80722	D	1	B;B	0.17667	0.019;0.023	B;B	0.31390	0.044;0.129	T	0.21314	-1.0249	10	0.34782	T	0.22	.	19.5705	0.95413	0.0:0.0:1.0:0.0	.	365;365	P05771-2;P05771	.;KPCB_HUMAN	N	365	ENSP00000318315:D365N;ENSP00000305355:D365N	ENSP00000305355:D365N	D	+	1	0	PRKCB	24073533	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	8.009000	0.88606	2.941000	0.99782	0.655000	0.94253	GAT	PRKCB	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_cat_dom	ENSG00000166501		0.527	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	60	0.00	0	G	NM_212535		24166032	24166032	+1	no_errors	ENST00000303531	ensembl	human	known	69_37n	missense	56	50.88	58	SNP	0.997	A
PRKDC	5591	genome.wustl.edu	37	8	48694776	48694776	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr8:48694776C>T	ENST00000314191.2	-	81	11489	c.11433G>A	c.(11431-11433)ttG>ttA	p.L3811L	PRKDC_ENST00000338368.3_Intron|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3812	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GAAGGTCCTTCAAGGTAACAG	0.483								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	dbGAP											0													74.0	76.0	76.0					8																	48694776		1939	4129	6068	-	-	-	SO:0001819	synonymous_variant	0				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.11433G>A	8.37:g.48694776C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Silent	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L3811	ENST00000314191.2	37	c.11433		8																																																																																			PRKDC	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000253729		0.483	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		29	0.00	0	C	NM_001081640		48694776	48694776	-1	no_errors	ENST00000314191	ensembl	human	known	69_37n	silent	21	29.03	9	SNP	1.000	T
PRRC2C	23215	genome.wustl.edu	37	1	171527054	171527054	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:171527054C>G	ENST00000338920.4	+	19	6034	c.5797C>G	c.(5797-5799)Cag>Gag	p.Q1933E	PRRC2C_ENST00000426496.2_Missense_Mutation_p.Q1933E|PRRC2C_ENST00000392078.3_Missense_Mutation_p.Q1935E|PRRC2C_ENST00000367742.3_Missense_Mutation_p.Q1935E	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1933	Ala-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										agcccAGACTCAGGCACAGAC	0.582																																						dbGAP											0													95.0	80.0	85.0					1																	171527054		2197	4288	6485	-	-	-	SO:0001583	missense	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.5797C>G	1.37:g.171527054C>G	ENSP00000343629:p.Gln1933Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	pfam_BAT2_N	p.Q1935E	ENST00000338920.4	37	c.5803	CCDS1296.2	1	.	.	.	.	.	.	.	.	.	.	C	7.634	0.679436	0.14907	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	T;T;T;T	0.01963	4.54;4.53;4.54;4.54	5.04	5.04	0.67666	.	0.174574	0.26995	N	0.021457	T	0.00936	0.0031	N	0.19112	0.55	0.25078	N	0.990944	B	0.27732	0.187	B	0.30495	0.116	T	0.50955	-0.8766	10	0.33940	T	0.23	.	15.5375	0.76016	0.0:1.0:0.0:0.0	.	1933	Q9Y520-4	.	E	1935;1887;1933;1935;1933;1690	ENSP00000375928:Q1935E;ENSP00000410219:Q1933E;ENSP00000356716:Q1935E;ENSP00000343629:Q1933E	ENSP00000343629:Q1933E	Q	+	1	0	PRRC2C	169793678	1.000000	0.71417	0.569000	0.28460	0.218000	0.24690	5.066000	0.64351	2.499000	0.84300	0.449000	0.29647	CAG	PRRC2C	-	NULL	ENSG00000117523		0.582	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4	53	0.00	0	C	NM_015172		171527054	171527054	+1	no_errors	ENST00000392078	ensembl	human	known	69_37n	missense	103	30.41	45	SNP	0.618	G
PTK7	5754	genome.wustl.edu	37	6	43112230	43112230	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr6:43112230G>A	ENST00000230419.4	+	15	2514	c.2293G>A	c.(2293-2295)Gaa>Aaa	p.E765K	PTK7_ENST00000481273.1_Missense_Mutation_p.E773K|PTK7_ENST00000345201.2_Missense_Mutation_p.E725K|PTK7_ENST00000349241.2_Missense_Mutation_p.E635K|PTK7_ENST00000352931.2_Missense_Mutation_p.E709K	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	765					actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			AGAGATCCAAGAAGAAGTGGC	0.612																																						dbGAP											0													110.0	98.0	102.0					6																	43112230		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.2293G>A	6.37:g.43112230G>A	ENSP00000230419:p.Glu765Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Immunoglobulin,pfam_Prot_kinase_cat_dom,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E765K	ENST00000230419.4	37	c.2293	CCDS4884.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.710765	0.96821	.	.	ENSG00000112655	ENST00000230419;ENST00000349241;ENST00000352931;ENST00000345201;ENST00000481273;ENST00000473339	T;T;T;T;T;T	0.77229	-0.63;-0.72;-0.56;-0.64;-0.65;-1.08	5.49	5.49	0.81192	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.86264	0.5891	M	0.70595	2.14	0.80722	D	1	B;D;D;D;D	0.89917	0.402;0.995;0.992;1.0;0.997	B;D;D;D;D	0.91635	0.119;0.953;0.912;0.999;0.954	D	0.86667	0.1908	10	0.62326	D	0.03	.	19.3807	0.94532	0.0:0.0:1.0:0.0	.	773;635;725;709;765	E9PFZ5;Q13308-3;Q13308-2;Q13308-4;Q13308	.;.;.;.;PTK7_HUMAN	K	765;635;709;725;773;33	ENSP00000230419:E765K;ENSP00000325462:E635K;ENSP00000326029:E709K;ENSP00000325992:E725K;ENSP00000418754:E773K;ENSP00000420186:E33K	ENSP00000230418:E765K	E	+	1	0	PTK7	43220208	1.000000	0.71417	0.997000	0.53966	0.896000	0.52359	9.024000	0.93689	2.575000	0.86900	0.561000	0.74099	GAA	PTK7	-	superfamily_Kinase-like_dom	ENSG00000112655		0.612	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK7	HGNC	protein_coding	OTTHUMT00000040580.2	46	0.00	0	G			43112230	43112230	+1	no_errors	ENST00000230419	ensembl	human	known	69_37n	missense	32	49.21	31	SNP	1.000	A
PTPRB	5787	genome.wustl.edu	37	12	70989934	70989934	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr12:70989934C>T	ENST00000261266.5	-	3	528	c.499G>A	c.(499-501)Gaa>Aaa	p.E167K	PTPRB_ENST00000334414.6_Missense_Mutation_p.E385K|PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000538708.1_Missense_Mutation_p.E167K|PTPRB_ENST00000551525.1_Missense_Mutation_p.E384K|PTPRB_ENST00000550857.1_Missense_Mutation_p.E167K|PTPRB_ENST00000451516.2_Missense_Mutation_p.E167K|PTPRB_ENST00000550358.1_Missense_Mutation_p.E385K	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	167	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			AAAGTGTATTCATTCCATGAA	0.358																																						dbGAP											0													88.0	87.0	87.0					12																	70989934		1844	4078	5922	-	-	-	SO:0001583	missense	0			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.499G>A	12.37:g.70989934C>T	ENSP00000261266:p.Glu167Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.E385K	ENST00000261266.5	37	c.1153	CCDS44944.1	12	.	.	.	.	.	.	.	.	.	.	C	6.599	0.478861	0.12581	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000544694;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T;T	0.58797	0.31;0.31;0.31;0.31;0.31;0.31;0.31;0.31	5.8	2.95	0.34219	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.434781	0.26769	N	0.022592	T	0.56202	0.1969	M	0.76574	2.34	0.09310	N	1	B;B;B;B;B;B;B;B	0.19935	0.0;0.0;0.04;0.009;0.003;0.002;0.001;0.004	B;B;B;B;B;B;B;B	0.30782	0.007;0.007;0.12;0.036;0.008;0.018;0.011;0.018	T	0.47661	-0.9100	10	0.12766	T	0.61	.	11.5829	0.50902	0.0:0.7653:0.1093:0.1253	.	167;167;264;385;384;385;167;385	P23467-2;F5H3G6;Q6ZR19;Q6ZTX7;F8VSD5;P23467-3;P23467;F8VU56	.;.;.;.;.;.;PTPRB_HUMAN;.	K	385;167;385;385;167;167;167;384;264	ENSP00000334928:E385K;ENSP00000393028:E167K;ENSP00000448058:E385K;ENSP00000438927:E167K;ENSP00000447302:E167K;ENSP00000261266:E167K;ENSP00000448349:E384K;ENSP00000446982:E264K	ENSP00000261266:E167K	E	-	1	0	PTPRB	69276201	0.359000	0.24955	0.004000	0.12327	0.111000	0.19643	1.044000	0.30329	0.091000	0.17302	-0.797000	0.03246	GAA	PTPRB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000127329		0.358	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404439.1	77	0.00	0	C			70989934	70989934	-1	no_errors	ENST00000334414	ensembl	human	known	69_37n	missense	75	35.90	42	SNP	0.055	T
RAB35	11021	genome.wustl.edu	37	12	120541722	120541722	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr12:120541722G>C	ENST00000229340.5	-	3	323	c.135C>G	c.(133-135)ttC>ttG	p.F45L	RAB35_ENST00000534951.1_Missense_Mutation_p.F45L	NM_001167606.1|NM_006861.6	NP_001161078.1|NP_006852.1	Q15286	RAB35_HUMAN	RAB35, member RAS oncogene family	45					antigen processing and presentation (GO:0019882)|cellular response to nerve growth factor stimulus (GO:1990090)|cytokinesis (GO:0000910)|endosomal transport (GO:0016197)|GTP catabolic process (GO:0006184)|neuron projection development (GO:0031175)|plasma membrane to endosome transport (GO:0048227)|protein localization (GO:0008104)|protein localization to endosome (GO:0036010)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cell projection membrane (GO:0031253)|clathrin-coated endocytic vesicle (GO:0045334)|coated pit (GO:0005905)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intercellular bridge (GO:0045171)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.248)		TCCGGATCTTGAAATCCACTC	0.617																																						dbGAP											0													96.0	108.0	104.0					12																	120541722		2201	4300	6501	-	-	-	SO:0001583	missense	0			X79781	CCDS41846.1, CCDS53836.1	12q24	2008-07-28			ENSG00000111737	ENSG00000111737		"""RAB, member RAS oncogene"""	9774	protein-coding gene	gene with protein product		604199					Standard	NM_001167606		Approved	H-ray	uc009zww.2	Q15286	OTTHUMG00000169159	ENST00000229340.5:c.135C>G	12.37:g.120541722G>C	ENSP00000229340:p.Phe45Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6E0|B4E390	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_Gtr1_RagA,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.F45L	ENST00000229340.5	37	c.135	CCDS41846.1	12	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504468	0.85176	.	.	ENSG00000111737	ENST00000229340;ENST00000427416;ENST00000534951;ENST00000538903	T;T;T	0.80994	-1.44;-1.44;-1.44	5.73	4.84	0.62591	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84768	0.5545	M	0.83483	2.645	0.80722	D	1	B;P	0.39326	0.287;0.668	B;P	0.45610	0.089;0.487	D	0.86276	0.1664	10	0.87932	D	0	.	11.8495	0.52403	0.1525:0.0:0.8475:0.0	.	45;45	B4E390;Q15286	.;RAB35_HUMAN	L	45	ENSP00000229340:F45L;ENSP00000441883:F45L;ENSP00000443994:F45L	ENSP00000229340:F45L	F	-	3	2	RAB35	119026105	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.238000	0.51352	1.426000	0.47256	0.650000	0.86243	TTC	RAB35	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_Gtr1_RagA,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000111737		0.617	RAB35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB35	HGNC	protein_coding	OTTHUMT00000402599.2	43	0.00	0	G			120541722	120541722	-1	no_errors	ENST00000229340	ensembl	human	known	69_37n	missense	41	47.50	38	SNP	1.000	C
RBFOX1	54715	genome.wustl.edu	37	16	7568361	7568361	+	Silent	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr16:7568361G>C	ENST00000550418.1	+	5	1228	c.240G>C	c.(238-240)acG>acC	p.T80T	RBFOX1_ENST00000553186.1_Silent_p.T80T|RBFOX1_ENST00000547338.1_Silent_p.T80T|RBFOX1_ENST00000436368.2_Silent_p.T100T|RBFOX1_ENST00000422070.4_Silent_p.T123T|RBFOX1_ENST00000355637.4_Silent_p.T100T|RBFOX1_ENST00000535565.2_Silent_p.T116T|RBFOX1_ENST00000552089.1_Silent_p.T116T|RBFOX1_ENST00000340209.4_Silent_p.T85T|RBFOX1_ENST00000311745.5_Silent_p.T100T|RBFOX1_ENST00000547372.1_Silent_p.T123T	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	80					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						CGGCGGACACGAGCGCTCAGA	0.657																																					Ovarian(157;934 2567 15163 39509)	dbGAP											0													84.0	83.0	83.0					16																	7568361		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.240G>C	16.37:g.7568361G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Silent	SNP	pfam_Fox-1_C_dom,pfam_RRM_dom,smart_RRM_dom,pirsf_RNA-bd_Fox-1,pfscan_RRM_dom	p.T123	ENST00000550418.1	37	c.369	CCDS55983.1	16																																																																																			RBFOX1	-	pirsf_RNA-bd_Fox-1	ENSG00000078328		0.657	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	RBFOX1	HGNC	protein_coding	OTTHUMT00000409492.2	15	0.00	0	G	NM_145891		7568361	7568361	+1	no_errors	ENST00000547372	ensembl	human	known	69_37n	silent	23	42.50	17	SNP	0.995	C
GBA2	57704	genome.wustl.edu	37	9	35749395	35749395	+	5'Flank	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr9:35749395G>A	ENST00000378103.3	-	0	0				RGP1_ENST00000378078.4_5'UTR|GBA2_ENST00000378094.4_5'Flank|RGP1_ENST00000456972.2_Missense_Mutation_p.D31N|GBA2_ENST00000545786.1_Intron	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CCCTAGTGTCGACTATGCGAG	0.692																																						dbGAP											0													45.0	57.0	53.0					9																	35749395		1934	4111	6045	-	-	-	SO:0001631	upstream_gene_variant	0			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		9.37:g.35749395G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	pfam_Rgp1	p.D31N	ENST00000378103.3	37	c.91	CCDS6589.1	9	.	.	.	.	.	.	.	.	.	.	G	13.49	2.252064	0.39797	.	.	ENSG00000107185	ENST00000456972	.	.	.	5.25	0.884	0.19182	.	.	.	.	.	T	0.32071	0.0817	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25710	-1.0124	5	0.18710	T	0.47	.	11.6223	0.51126	0.0:0.5535:0.3182:0.1283	.	.	.	.	N	31	.	ENSP00000409466:D31N	D	+	1	0	RGP1	35739395	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	-0.164000	0.09983	0.171000	0.19730	0.491000	0.48974	GAC	RGP1	-	NULL	ENSG00000107185		0.692	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RGP1	HGNC	protein_coding	OTTHUMT00000055456.1	38	0.00	0	G	NM_020944		35749395	35749395	+1	no_errors	ENST00000456972	ensembl	human	known	69_37n	missense	58	38.95	37	SNP	0.000	A
RNF148	378925	genome.wustl.edu	37	7	122342073	122342073	+	Silent	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr7:122342073G>A	ENST00000434824.1	-	1	948	c.732C>T	c.(730-732)ctC>ctT	p.L244L	RNF133_ENST00000340112.2_5'Flank|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000449022.2_Intron|RNF148_ENST00000447240.1_3'UTR|CADPS2_ENST00000412584.2_Intron	NM_198085.1	NP_932351.1	Q8N7C7	RN148_HUMAN	ring finger protein 148	244						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|lung(7)	16						CCCCTTCTTTGAGAACTCGCA	0.418																																						dbGAP											0													101.0	93.0	96.0					7																	122342073		1901	4125	6026	-	-	-	SO:0001819	synonymous_variant	0			BC029264	CCDS47692.1	7q31.33	2013-01-09			ENSG00000235631	ENSG00000235631		"""RING-type (C3HC4) zinc fingers"""	22411	protein-coding gene	gene with protein product						8744354	Standard	NM_198085		Approved	MGC35222	uc003vkk.1	Q8N7C7	OTTHUMG00000157099	ENST00000434824.1:c.732C>T	7.37:g.122342073G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0X4|Q8N308	Silent	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L244	ENST00000434824.1	37	c.732	CCDS47692.1	7																																																																																			RNF148	-	NULL	ENSG00000235631		0.418	RNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF148	HGNC	protein_coding	OTTHUMT00000347424.1	94	0.00	0	G	NM_198085		122342073	122342073	-1	no_errors	ENST00000434824	ensembl	human	known	69_37n	silent	82	36.43	47	SNP	0.951	A
RNF182	221687	genome.wustl.edu	37	6	13977702	13977702	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr6:13977702C>G	ENST00000488300.1	+	3	875	c.352C>G	c.(352-354)Ctg>Gtg	p.L118V	RNF182_ENST00000544682.1_Missense_Mutation_p.L118V|RNF182_ENST00000537663.1_Missense_Mutation_p.L118V|RNF182_ENST00000537388.1_Missense_Mutation_p.L118V	NM_152737.3	NP_689950.1	Q8N6D2	RN182_HUMAN	ring finger protein 182	118					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|large_intestine(7)|liver(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	Epithelial(50;0.195)			GCTGGCCTCTCTGGTCAGTCC	0.557																																						dbGAP											0													52.0	54.0	54.0					6																	13977702		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090576	CCDS4531.1	6p23	2013-01-09			ENSG00000180537	ENSG00000180537		"""RING-type (C3HC4) zinc fingers"""	28522	protein-coding gene	gene with protein product						12477932	Standard	NM_152737		Approved	MGC33993	uc003nbg.3	Q8N6D2	OTTHUMG00000014280	ENST00000488300.1:c.352C>G	6.37:g.13977702C>G	ENSP00000420465:p.Leu118Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDG2|Q8NBG3	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L118V	ENST00000488300.1	37	c.352	CCDS4531.1	6	.	.	.	.	.	.	.	.	.	.	C	13.84	2.357974	0.41801	.	.	ENSG00000180537	ENST00000537663;ENST00000488300;ENST00000544682;ENST00000420478;ENST00000537388	D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.26;-2.28	5.27	4.4	0.53042	.	0.798245	0.11454	N	0.562480	T	0.71978	0.3404	L	0.36672	1.1	0.42671	D	0.993518	B	0.32031	0.352	B	0.25884	0.064	T	0.66512	-0.5905	9	.	.	.	-21.409	14.2647	0.66110	0.0:0.9269:0.0:0.0731	.	118	Q8N6D2	RN182_HUMAN	V	118	ENSP00000443228:L118V;ENSP00000420465:L118V;ENSP00000442021:L118V;ENSP00000419329:L118V;ENSP00000441271:L118V	.	L	+	1	2	RNF182	14085681	0.996000	0.38824	0.959000	0.39883	0.996000	0.88848	3.477000	0.53151	2.468000	0.83385	0.563000	0.77884	CTG	RNF182	-	NULL	ENSG00000180537		0.557	RNF182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF182	HGNC	protein_coding	OTTHUMT00000039911.2	38	0.00	0	C	NM_152737		13977702	13977702	+1	no_errors	ENST00000488300	ensembl	human	known	69_37n	missense	33	44.07	26	SNP	0.996	G
RPF1	80135	genome.wustl.edu	37	1	84945165	84945165	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:84945165C>T	ENST00000370654.5	+	1	216	c.201C>T	c.(199-201)ttC>ttT	p.F67F	RPF1_ENST00000370656.1_Silent_p.F67F	NM_025065.6	NP_079341.2	Q9H9Y2	RPF1_HUMAN	ribosome production factor 1 homolog (S. cerevisiae)	67					rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			breast(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(2)|prostate(1)	14						ACTTAATGTTCACGCGGTGGA	0.622																																						dbGAP											0													28.0	33.0	31.0					1																	84945165		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF322053	CCDS695.1	1p22.3	2009-09-25	2009-09-25	2009-09-25	ENSG00000117133	ENSG00000117133			30350	protein-coding gene	gene with protein product	"""RNA processing factor 1"", ""ribosome production factor 1"""		"""brix domain containing 5"""	BXDC5		11864606	Standard	NM_025065		Approved		uc001djv.4	Q9H9Y2	OTTHUMG00000009857	ENST00000370654.5:c.201C>T	1.37:g.84945165C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSK7|Q6AHX1|Q8WXZ8	Silent	SNP	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix	p.F67	ENST00000370654.5	37	c.201	CCDS695.1	1																																																																																			RPF1	-	NULL	ENSG00000117133		0.622	RPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPF1	HGNC	protein_coding	OTTHUMT00000027238.1	16	0.00	0	C	NM_025065		84945165	84945165	+1	no_errors	ENST00000370654	ensembl	human	known	69_37n	silent	8	33.33	4	SNP	1.000	T
RPS27L	51065	genome.wustl.edu	37	15	63447802	63447802	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr15:63447802G>A	ENST00000439025.1	-	3	337	c.244C>T	c.(244-246)Ctc>Ttc	p.L82F	RPS27L_ENST00000455271.1_Intron|RPS27L_ENST00000462430.1_Intron|RPS27L_ENST00000411926.1_Intron|RPS27L_ENST00000330964.5_Intron|RPS27L_ENST00000559763.1_Intron					ribosomal protein S27-like											large_intestine(1)	1						CTGGGTTGGAGAATGCCAAAT	0.378																																						dbGAP											0													109.0	100.0	103.0					15																	63447802		1881	4121	6002	-	-	-	SO:0001583	missense	0			BC003667	CCDS42048.1	15q21.3	2008-07-18			ENSG00000185088	ENSG00000185088		"""S ribosomal proteins"""	18476	protein-coding gene	gene with protein product		612055				11042152	Standard	NM_015920		Approved		uc002aly.3	Q71UM5	OTTHUMG00000155301	ENST00000439025.1:c.244C>T	15.37:g.63447802G>A	ENSP00000402423:p.Leu82Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ribosomal_S27e,superfamily_Ribosomal_zn-bd_dom	p.L82F	ENST00000439025.1	37	c.244		15	.	.	.	.	.	.	.	.	.	.	G	1.729	-0.494567	0.04322	.	.	ENSG00000185088	ENST00000439025	.	.	.	4.75	2.24	0.28232	.	4.302380	0.00639	N	0.000512	T	0.43433	0.1247	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37641	-0.9697	6	0.87932	D	0	.	7.6017	0.28079	0.8144:0.0:0.1856:0.0	.	.	.	.	F	82	.	ENSP00000402423:L82F	L	-	1	0	RPS27L	61234855	0.103000	0.21917	0.001000	0.08648	0.207000	0.24258	-0.103000	0.10940	0.275000	0.22094	-0.300000	0.09419	CTC	RPS27L	-	superfamily_Ribosomal_zn-bd_dom	ENSG00000185088		0.378	RPS27L-005	PUTATIVE	basic	protein_coding	RPS27L	HGNC	protein_coding	OTTHUMT00000339351.1	49	0.00	0	G	NM_015920		63447802	63447802	-1	no_errors	ENST00000439025	ensembl	human	putative	69_37n	missense	56	41.67	40	SNP	0.072	A
Unknown	0	genome.wustl.edu	37	16	21823673	21823673	+	IGR	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr16:21823673G>A								RRN3P1 (4615 upstream) : NPIPB4 (22216 downstream)																							GCTGATACAAGATTACCAAGA	0.403																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															16.37:g.21823673G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		16																																																																																			RRN3P1	-	-	ENSG00000248124	0	0.403					RRN3P1	HGNC			20	0.00	0	G			21823673	21823673	-1	no_errors	ENST00000551681	ensembl	human	known	69_37n	rna	22	38.89	14	SNP	1.000	A
SEMA5B	54437	genome.wustl.edu	37	3	122667367	122667367	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr3:122667367G>T	ENST00000357599.3	-	3	700	c.314C>A	c.(313-315)aCc>aAc	p.T105N	SEMA5B_ENST00000195173.4_Missense_Mutation_p.T105N|SEMA5B_ENST00000451055.2_Missense_Mutation_p.T159N|SEMA5B_ENST00000465147.1_5'UTR	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	105	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		AAAGGCCACGGTGGGGTGCTT	0.587																																						dbGAP											0													57.0	46.0	50.0					3																	122667367		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.314C>A	3.37:g.122667367G>T	ENSP00000350215:p.Thr105Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Thrombospondin_1_rpt,superfamily_Semaphorin/CD100_Ag,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Thrombospondin_1_rpt,pfscan_Semaphorin/CD100_Ag,pfscan_Thrombospondin_1_rpt	p.T159N	ENST00000357599.3	37	c.476	CCDS35491.1	3	.	.	.	.	.	.	.	.	.	.	G	11.55	1.672799	0.29693	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583;ENST00000421053	T;T;T;T	0.34859	1.34;1.34;1.4;1.44	4.84	-3.66	0.04489	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.519441	0.19634	N	0.109620	T	0.31040	0.0784	L	0.49778	1.585	0.09310	N	0.999996	B;B;B	0.25809	0.135;0.048;0.048	B;B;B	0.31337	0.128;0.037;0.037	T	0.30794	-0.9966	10	0.51188	T	0.08	.	12.9908	0.58618	0.7573:0.0:0.2427:0.0	.	47;105;105	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	N	105;105;47;159;105;105	ENSP00000350215:T105N;ENSP00000195173:T105N;ENSP00000389588:T159N;ENSP00000377208:T105N	ENSP00000195173:T105N	T	-	2	0	SEMA5B	124150057	0.790000	0.28787	0.239000	0.24122	0.944000	0.59088	0.567000	0.23608	-0.786000	0.04516	-0.136000	0.14681	ACC	SEMA5B	-	superfamily_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000082684		0.587	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	HGNC	protein_coding	OTTHUMT00000277165.1	20	0.00	0	G	NM_001031702		122667367	122667367	-1	no_errors	ENST00000451055	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	0.076	T
SHMT2	6472	genome.wustl.edu	37	12	57626352	57626352	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr12:57626352G>A	ENST00000328923.3	+	6	1163	c.711G>A	c.(709-711)atG>atA	p.M237I	SHMT2_ENST00000393827.4_Missense_Mutation_p.M141I|SHMT2_ENST00000449049.3_Missense_Mutation_p.M216I|SHMT2_ENST00000554600.1_3'UTR|SHMT2_ENST00000553474.1_Missense_Mutation_p.M216I|SHMT2_ENST00000414700.3_Missense_Mutation_p.M216I|SHMT2_ENST00000557487.1_Missense_Mutation_p.M227I	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	237					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	ACGCCCGCATGAGAGAGGTTG	0.652																																					Esophageal Squamous(150;1369 2416 49071 49364)	dbGAP											0													62.0	70.0	67.0					12																	57626352		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.711G>A	12.37:g.57626352G>A	ENSP00000333667:p.Met237Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	pfam_Ser_HO-MeTrfase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Ser_HO-MeTrfase	p.M237I	ENST00000328923.3	37	c.711	CCDS8934.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.92|13.92	2.380745|2.380745	0.42207|0.42207	.|.	.|.	ENSG00000182199|ENSG00000182199	ENST00000557529|ENST00000328923;ENST00000557487;ENST00000555634;ENST00000414700;ENST00000553474;ENST00000449049;ENST00000393827	.|T;T;T;T;T;T;T	.|0.42131	.|1.76;0.98;0.98;1.76;1.76;1.76;0.98	5.09|5.09	5.09|5.09	0.68999|0.68999	.|Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|0.090425	.|0.85682	.|D	.|0.000000	T|T	0.32376|0.32376	0.0827|0.0827	L|L	0.28115|0.28115	0.83|0.83	0.45097|0.45097	D|D	0.998118|0.998118	.|B;B;B;B;B	.|0.13145	.|0.007;0.0;0.006;0.004;0.001	.|B;B;B;B;B	.|0.24269	.|0.01;0.006;0.052;0.015;0.005	T|T	0.05716|0.05716	-1.0868|-1.0868	5|10	.|0.33940	.|T	.|0.23	-1.8564|-1.8564	14.0465|14.0465	0.64708|0.64708	0.0:0.1523:0.8477:0.0|0.0:0.1523:0.8477:0.0	.|.	.|246;227;141;168;237	.|B4DWA7;Q8N1A5;B4DLV4;B4DP88;P34897	.|.;.;.;.;GLYM_HUMAN	K|I	37|237;227;76;216;216;216;141	.|ENSP00000333667:M237I;ENSP00000452315:M227I;ENSP00000450930:M76I;ENSP00000406881:M216I;ENSP00000452419:M216I;ENSP00000413770:M216I;ENSP00000377413:M141I	.|ENSP00000333667:M237I	E|M	+|+	1|3	0|0	SHMT2|SHMT2	55912619|55912619	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.882000|0.882000	0.50991|0.50991	1.931000|1.931000	0.40134|0.40134	2.816000|2.816000	0.96949|0.96949	0.563000|0.563000	0.77884|0.77884	GAG|ATG	SHMT2	-	pfam_Ser_HO-MeTrfase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Ser_HO-MeTrfase	ENSG00000182199		0.652	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHMT2	HGNC	protein_coding	OTTHUMT00000412525.2	25	0.00	0	G	NM_005412		57626352	57626352	+1	no_errors	ENST00000328923	ensembl	human	known	69_37n	missense	18	50.00	18	SNP	1.000	A
SLC15A1	6564	genome.wustl.edu	37	13	99338507	99338507	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr13:99338507C>T	ENST00000376503.5	-	22	1927	c.1872G>A	c.(1870-1872)ctG>ctA	p.L624L		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	624					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CAGCCACGGTCAGCAGCCATC	0.567																																						dbGAP											0													139.0	92.0	108.0					13																	99338507		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.1872G>A	13.37:g.99338507C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VW82	Silent	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_Pep_H_symport	p.L624	ENST00000376503.5	37	c.1872	CCDS9489.1	13																																																																																			SLC15A1	-	superfamily_MFS_dom_general_subst_transpt,tigrfam_Pep_H_symport	ENSG00000088386		0.567	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC15A1	HGNC	protein_coding	OTTHUMT00000045560.3	48	0.00	0	C	NM_005073		99338507	99338507	-1	no_errors	ENST00000376503	ensembl	human	known	69_37n	silent	47	50.00	47	SNP	1.000	T
SLC22A25	387601	genome.wustl.edu	37	11	62996883	62996883	+	Nonsense_Mutation	SNP	G	G	C	rs553765175		TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr11:62996883G>C	ENST00000306494.6	-	1	241	c.242C>G	c.(241-243)tCa>tGa	p.S81*	SLC22A10_ENST00000525620.1_Intron|SLC22A25_ENST00000403374.2_5'Flank|SLC22A10_ENST00000535888.1_Intron	NM_199352.3	NP_955384.3			solute carrier family 22, member 25									p.S81*(1)		NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						CCTCAGATTTGAGTCGAATGG	0.532																																						dbGAP											1	Substitution - Nonsense(1)	NS(1)											130.0	117.0	121.0					11																	62996883		2201	4298	6499	-	-	-	SO:0001587	stop_gained	0			AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.242C>G	11.37:g.62996883G>C	ENSP00000307443:p.Ser81*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S81*	ENST00000306494.6	37	c.242	CCDS31592.1	11	.	.	.	.	.	.	.	.	.	.	G	17.02	3.280766	0.59758	.	.	ENSG00000196600	ENST00000306494;ENST00000451441	.	.	.	3.64	3.64	0.41730	.	0.653399	0.14558	N	0.312253	.	.	.	.	.	.	0.22479	N	0.999065	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	11.3378	0.49513	0.0:0.0:1.0:0.0	.	.	.	.	X	81	.	ENSP00000307443:S81X	S	-	2	0	SLC22A25	62753459	0.000000	0.05858	0.556000	0.28293	0.308000	0.27856	0.267000	0.18552	1.760000	0.52011	0.289000	0.19496	TCA	SLC22A25	-	pfscan_MFS_dom	ENSG00000196600		0.532	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A25	HGNC	protein_coding	OTTHUMT00000383519.3	83	0.00	0	G	NM_199352		62996883	62996883	-1	no_errors	ENST00000306494	ensembl	human	known	69_37n	nonsense	81	46.00	69	SNP	0.125	C
SLC24A1	9187	genome.wustl.edu	37	15	65946274	65946274	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr15:65946274C>T	ENST00000261892.6	+	10	3444	c.3157C>T	c.(3157-3159)Ctg>Ttg	p.L1053L	SLC24A1_ENST00000546330.1_Silent_p.L1035L|SLC24A1_ENST00000339868.6_Silent_p.L1035L|SLC24A1_ENST00000449142.2_3'UTR|SLC24A1_ENST00000399033.4_Silent_p.L1023L|SLC24A1_ENST00000537259.1_Intron|SLC24A1_ENST00000544319.2_Silent_p.L939L	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	1053					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						TCTCATGCTTCTGTTTGTGAT	0.393																																						dbGAP											0													309.0	284.0	292.0					15																	65946274		1954	4134	6088	-	-	-	SO:0001819	synonymous_variant	0			AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.3157C>T	15.37:g.65946274C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43485|O75184|Q17RM9	Silent	SNP	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger,tigrfam_K-dep_Na/Ca-exchanger-like	p.L1053	ENST00000261892.6	37	c.3157	CCDS45284.1	15																																																																																			SLC24A1	-	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger-like	ENSG00000074621		0.393	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A1	HGNC	protein_coding	OTTHUMT00000397304.1	193	0.00	0	C	NM_004727		65946274	65946274	+1	no_errors	ENST00000261892	ensembl	human	known	69_37n	silent	219	45.00	180	SNP	1.000	T
SLC26A3	1811	genome.wustl.edu	37	7	107408026	107408026	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr7:107408026C>A	ENST00000340010.5	-	20	2453	c.2269G>T	c.(2269-2271)Gag>Tag	p.E757*	SLC26A3_ENST00000422236.2_Nonsense_Mutation_p.E644*	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	757					anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						AATCTTACCTCATATACCCGA	0.378																																						dbGAP											0													108.0	110.0	109.0					7																	107408026		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.2269G>T	7.37:g.107408026C>A	ENSP00000345873:p.Glu757*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.E757*	ENST00000340010.5	37	c.2269	CCDS5748.1	7	.	.	.	.	.	.	.	.	.	.	c	26.4	4.733528	0.89482	.	.	ENSG00000091138	ENST00000422236;ENST00000340010	.	.	.	3.82	2.95	0.34219	.	0.875392	0.10170	N	0.707217	.	.	.	.	.	.	0.29967	N	0.818896	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.9374	0.35708	0.0:0.1622:0.6718:0.166	.	.	.	.	X	644;757	.	ENSP00000345873:E757X	E	-	1	0	SLC26A3	107195262	0.779000	0.28652	0.943000	0.38184	0.178000	0.23041	1.147000	0.31602	1.190000	0.43042	-0.134000	0.14843	GAG	SLC26A3	-	NULL	ENSG00000091138		0.378	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A3	HGNC	protein_coding	OTTHUMT00000337190.1	111	0.00	0	C	NM_000111		107408026	107408026	-1	no_errors	ENST00000340010	ensembl	human	known	69_37n	nonsense	84	36.84	49	SNP	0.794	A
SLC34A2	10568	genome.wustl.edu	37	4	25671395	25671395	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr4:25671395C>T	ENST00000382051.3	+	7	812	c.762C>T	c.(760-762)ttC>ttT	p.F254F	SLC34A2_ENST00000503434.1_Silent_p.F253F|SLC34A2_ENST00000504570.1_Silent_p.F253F	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	254					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				GCTTCCACTTCAAGAATGGAG	0.493			T	ROS1	NSCLC																																	dbGAP		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	0													201.0	197.0	198.0					4																	25671395		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.762C>T	4.37:g.25671395C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Silent	SNP	pfam_Na/Pi_transpt,superfamily_ABC_transptrTM_dom_typ1,tigrfam_Na/Pi_transpt	p.F254	ENST00000382051.3	37	c.762	CCDS3435.1	4																																																																																			SLC34A2	-	tigrfam_Na/Pi_transpt	ENSG00000157765		0.493	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC34A2	HGNC	protein_coding	OTTHUMT00000214990.1	60	0.00	0	C	NM_006424		25671395	25671395	+1	no_errors	ENST00000382051	ensembl	human	known	69_37n	silent	60	39.39	39	SNP	0.937	T
SLC43A1	8501	genome.wustl.edu	37	11	57263539	57263539	+	Silent	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr11:57263539G>A	ENST00000278426.3	-	7	1012	c.657C>T	c.(655-657)atC>atT	p.I219I	SLC43A1_ENST00000528450.1_Silent_p.I219I|SLC43A1_ENST00000533515.1_5'UTR	NM_003627.5	NP_003618.1			solute carrier family 43 (amino acid system L transporter), member 1											breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						GAAAGGCTTCGATGGGCCAGT	0.567																																						dbGAP											0													75.0	60.0	65.0					11																	57263539		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF045584	CCDS7958.1	11q12.1	2013-07-17	2013-07-17	2003-09-12	ENSG00000149150	ENSG00000149150		"""Solute carriers"""	9225	protein-coding gene	gene with protein product		603733	"""prostate cancer overexpressed gene 1"""	POV1		9255310, 9722952	Standard	NM_003627		Approved	R00504, PB39	uc001nkk.3	O75387	OTTHUMG00000167030	ENST00000278426.3:c.657C>T	11.37:g.57263539G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.I219	ENST00000278426.3	37	c.657	CCDS7958.1	11																																																																																			SLC43A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000149150		0.567	SLC43A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC43A1	HGNC	protein_coding	OTTHUMT00000392541.1	38	0.00	0	G	NM_003627		57263539	57263539	-1	no_errors	ENST00000278426	ensembl	human	known	69_37n	silent	29	53.97	34	SNP	0.000	A
SLC7A1	6541	genome.wustl.edu	37	13	30091323	30091323	+	Silent	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr13:30091323G>A	ENST00000380752.5	-	11	2021	c.1635C>T	c.(1633-1635)gtC>gtT	p.V545V	SLC7A1_ENST00000473577.1_5'UTR	NM_003045.4	NP_003036.1	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 1	545					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|stomach(1)|urinary_tract(2)	24		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GCCTCCAGATGACGCCCGTGA	0.617																																						dbGAP											0													37.0	36.0	36.0					13																	30091323		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF078107	CCDS9333.1	13q12.3	2013-05-22			ENSG00000139514	ENSG00000139514		"""Solute carriers"""	11057	protein-coding gene	gene with protein product	"""ecotropic retroviral receptor"", ""amino acid transporter, cationic 1"""	104615		ERR, ATRC1		1348489	Standard	NM_003045		Approved	CAT-1, HCAT1, REC1L	uc001uso.3	P30825	OTTHUMG00000016658	ENST00000380752.5:c.1635C>T	13.37:g.30091323G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JR50	Silent	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	p.V545	ENST00000380752.5	37	c.1635	CCDS9333.1	13																																																																																			SLC7A1	-	pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	ENSG00000139514		0.617	SLC7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A1	HGNC	protein_coding	OTTHUMT00000044337.2	11	0.00	0	G	NM_003045		30091323	30091323	-1	no_errors	ENST00000380752	ensembl	human	known	69_37n	silent	21	32.26	10	SNP	1.000	A
SMTN	6525	genome.wustl.edu	37	22	31485771	31485771	+	Silent	SNP	A	A	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr22:31485771A>G	ENST00000347557.2	+	7	776	c.558A>G	c.(556-558)acA>acG	p.T186T	SMTN_ENST00000358743.1_Silent_p.T186T|SMTN_ENST00000333137.7_Silent_p.T186T	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	186					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						ATGTGACCACAGTGACACTCC	0.622																																						dbGAP											0													80.0	67.0	72.0					22																	31485771		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.558A>G	22.37:g.31485771A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Silent	SNP	pfam_Smoothelin,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.T186	ENST00000347557.2	37	c.558	CCDS13886.1	22																																																																																			SMTN	-	NULL	ENSG00000183963		0.622	SMTN-001	KNOWN	basic|CCDS	protein_coding	SMTN	HGNC	protein_coding	OTTHUMT00000321766.1	8	0.00	0	A	NM_134270		31485771	31485771	+1	no_errors	ENST00000347557	ensembl	human	known	69_37n	silent	3	75.00	9	SNP	1.000	G
SNX27	81609	genome.wustl.edu	37	1	151630881	151630881	+	Silent	SNP	A	A	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:151630881A>T	ENST00000458013.2	+	3	834	c.714A>T	c.(712-714)ggA>ggT	p.G238G	SNX27_ENST00000368838.1_Silent_p.G145G|SNX27_ENST00000368843.3_Silent_p.G238G			Q96L92	SNX27_HUMAN	sorting nexin family member 27	238	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GACGTCGGGGATTGGAAGAAT	0.403																																					Colon(46;291 966 40145 41237 41888)	dbGAP											0													82.0	82.0	82.0					1																	151630881		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.714A>T	1.37:g.151630881A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Silent	SNP	pfam_Phox,pfam_PDZ,pfam_Ras-assoc,superfamily_Phox,superfamily_PDZ,smart_PDZ,smart_Phox,pfscan_PDZ,pfscan_Phox,pfscan_Ras-assoc	p.G238	ENST00000458013.2	37	c.714		1																																																																																			SNX27	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000143376		0.403	SNX27-003	NOVEL	basic	protein_coding	SNX27	HGNC	protein_coding	OTTHUMT00000036624.3	48	0.00	0	A	NM_030918		151630881	151630881	+1	no_errors	ENST00000368843	ensembl	human	known	69_37n	silent	57	38.95	37	SNP	0.368	T
SPG20	23111	genome.wustl.edu	37	13	36886556	36886556	+	Silent	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr13:36886556C>T	ENST00000451493.1	-	7	1759	c.1542G>A	c.(1540-1542)aaG>aaA	p.K514K	SPG20_ENST00000438666.2_Silent_p.K514K|SPG20_ENST00000494062.2_Silent_p.K514K|SPG20_ENST00000355182.4_Silent_p.K514K	NM_001142295.1	NP_001135767.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)	514					abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		TTCCATGCTTCTTGACATGTG	0.368																																						dbGAP											0													140.0	137.0	138.0					13																	36886556		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000451493.1:c.1542G>A	13.37:g.36886556C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60349|Q86Y67|Q9H1T2|Q9H1T3	Silent	SNP	pfam_Senescence/spartin,pfam_MIT,smart_MIT	p.K514	ENST00000451493.1	37	c.1542	CCDS9356.1	13																																																																																			SPG20	-	pfam_Senescence/spartin	ENSG00000133104		0.368	SPG20-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG20	HGNC	protein_coding	OTTHUMT00000044494.2	83	0.00	0	C			36886556	36886556	-1	no_errors	ENST00000355182	ensembl	human	known	69_37n	silent	56	47.66	51	SNP	1.000	T
SPTA1	6708	genome.wustl.edu	37	1	158615335	158615335	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:158615335C>T	ENST00000368147.4	-	28	4126	c.3946G>A	c.(3946-3948)Gag>Aag	p.E1316K		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1316					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCGGCCAGCTCCTGTGATGAT	0.448																																						dbGAP											0													161.0	158.0	159.0					1																	158615335		2024	4170	6194	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3946G>A	1.37:g.158615335C>T	ENSP00000357129:p.Glu1316Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.E1316K	ENST00000368147.4	37	c.3946	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.187517	0.94923	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.37411	1.2;1.2	5.07	5.07	0.68467	.	.	.	.	.	T	0.59797	0.2220	M	0.87381	2.88	0.58432	D	0.999998	D	0.89917	1.0	D	0.81914	0.995	T	0.64909	-0.6296	9	0.54805	T	0.06	.	17.2029	0.86910	0.0:1.0:0.0:0.0	.	1316	P02549	SPTA1_HUMAN	K	1316	ENSP00000357130:E1316K;ENSP00000357129:E1316K	ENSP00000357129:E1316K	E	-	1	0	SPTA1	156881959	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	6.910000	0.75741	2.635000	0.89317	0.655000	0.94253	GAG	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.448	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	68	0.00	0	C	NM_003126		158615335	158615335	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	100	31.97	47	SNP	1.000	T
SSPO	23145	genome.wustl.edu	37	7	149514749	149514749	+	RNA	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr7:149514749G>A	ENST00000378016.2	+	0	11291							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CAGGAGCTGGGAGCCACCATA	0.652																																						dbGAP											0													16.0	19.0	18.0					7																	149514749		2129	4258	6387	-	-	-			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149514749G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.652	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		17	0.00	0	G			149514749	149514749	+1	no_errors	ENST00000378016	ensembl	human	known	69_37n	rna	9	62.50	15	SNP	0.536	A
STX3	6809	genome.wustl.edu	37	11	59559682	59559682	+	Missense_Mutation	SNP	G	G	A	rs201661485		TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr11:59559682G>A	ENST00000337979.4	+	6	1007	c.460G>A	c.(460-462)Gaa>Aaa	p.E154K	STX3_ENST00000535361.1_Missense_Mutation_p.E154K|STX3_ENST00000300150.7_Missense_Mutation_p.E123K|STX3_ENST00000529177.1_Missense_Mutation_p.E154K|STX3_ENST00000437946.2_Missense_Mutation_p.E57K	NM_001178040.1|NM_004177.4	NP_001171511.1|NP_004168.1	Q13277	STX3_HUMAN	syntaxin 3	154					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|long-term synaptic potentiation (GO:0060291)|membrane fusion (GO:0061025)|neuron projection development (GO:0031175)|neurotransmitter transport (GO:0006836)	apical plasma membrane (GO:0016324)|azurophil granule (GO:0042582)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|vacuole (GO:0005773)	arachidonic acid binding (GO:0050544)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|skin(1)	13						GCGGCAGCTCGAAATTAGTAT	0.527																																						dbGAP											0													111.0	93.0	99.0					11																	59559682		2201	4295	6496	-	-	-	SO:0001583	missense	0			AJ002076	CCDS7975.1, CCDS53637.1	11q12.1	2008-02-05	2006-04-25	2006-04-25	ENSG00000166900	ENSG00000166900			11438	protein-coding gene	gene with protein product		600876	"""syntaxin 3A"""	STX3A		16598260, 16339081	Standard	NM_004177		Approved		uc001nog.3	Q13277	OTTHUMG00000167353	ENST00000337979.4:c.460G>A	11.37:g.59559682G>A	ENSP00000338562:p.Glu154Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DME0|O43750|O43751|Q15360	Missense_Mutation	SNP	pfam_Syntaxin_N,pfam_T_SNARE_dom,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.E154K	ENST00000337979.4	37	c.460	CCDS7975.1	11	.	.	.	.	.	.	.	.	.	.	G	28.0	4.879203	0.91740	.	.	ENSG00000166900	ENST00000300150;ENST00000337979;ENST00000535361;ENST00000437946;ENST00000529177;ENST00000528805	T;T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05;2.05	5.3	5.3	0.74995	t-SNARE (1);	0.000000	0.85682	D	0.000000	T	0.44477	0.1295	M	0.64260	1.97	0.80722	D	1	B;D;D;D	0.89917	0.267;1.0;1.0;1.0	B;D;D;D	0.91635	0.128;0.95;0.999;0.997	T	0.12889	-1.0530	10	0.32370	T	0.25	-36.4414	17.5317	0.87816	0.0:0.0:1.0:0.0	.	57;154;154;154	E7ET77;B4DME0;Q13277-2;Q13277	.;.;.;STX3_HUMAN	K	123;154;154;57;154;106	ENSP00000300150:E123K;ENSP00000338562:E154K;ENSP00000441649:E154K;ENSP00000393536:E57K;ENSP00000433248:E154K;ENSP00000431386:E106K	ENSP00000300150:E123K	E	+	1	0	STX3	59316258	1.000000	0.71417	0.984000	0.44739	0.813000	0.45954	9.415000	0.97375	2.478000	0.83669	0.650000	0.86243	GAA	STX3	-	superfamily_t-SNARE	ENSG00000166900		0.527	STX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX3	HGNC	protein_coding	OTTHUMT00000394264.1	40	0.00	0	G	NM_004177		59559682	59559682	+1	no_errors	ENST00000337979	ensembl	human	known	69_37n	missense	28	52.54	31	SNP	1.000	A
SV2A	9900	genome.wustl.edu	37	1	149885119	149885119	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:149885119C>T	ENST00000369146.3	-	2	764	c.274G>A	c.(274-276)Gag>Aag	p.E92K	SV2A_ENST00000369145.1_Missense_Mutation_p.E92K	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	92					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.I93_E95delIYE(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	TCATAGATCTCATCATCCTCG	0.602																																						dbGAP											1	Deletion - In frame(1)	prostate(1)											147.0	129.0	135.0					1																	149885119		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.274G>A	1.37:g.149885119C>T	ENSP00000358142:p.Glu92Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2_chordata	p.E92K	ENST00000369146.3	37	c.274	CCDS940.1	1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.016052	0.93404	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.31247	1.5;1.5	5.32	5.32	0.75619	.	0.151580	0.47093	D	0.000245	T	0.47210	0.1433	M	0.72118	2.19	0.80722	D	1	D	0.61080	0.989	D	0.63192	0.912	T	0.46105	-0.9215	10	0.72032	D	0.01	-29.6006	18.1693	0.89740	0.0:1.0:0.0:0.0	.	92	Q7L0J3	SV2A_HUMAN	K	92	ENSP00000358142:E92K;ENSP00000358141:E92K	ENSP00000358141:E92K	E	-	1	0	SV2A	148151743	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	5.894000	0.69806	2.767000	0.95098	0.655000	0.94253	GAG	SV2A	-	tigrfam_SV2_chordata	ENSG00000159164		0.602	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2A	HGNC	protein_coding	OTTHUMT00000033754.1	16	0.00	0	C			149885119	149885119	-1	no_errors	ENST00000369146	ensembl	human	known	69_37n	missense	65	28.57	26	SNP	1.000	T
SYTL2	54843	genome.wustl.edu	37	11	85435306	85435306	+	Intron	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr11:85435306G>A	ENST00000528231.1	-	8	1737				SYTL2_ENST00000359152.5_Nonsense_Mutation_p.Q1256*|SYTL2_ENST00000524452.1_Intron|SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000389960.4_Intron|SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000354566.3_Nonsense_Mutation_p.Q732*|SYTL2_ENST00000525423.1_Nonsense_Mutation_p.Q732*	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CCAGGTTCCTGAAGAGTCCCT	0.468																																						dbGAP											0													82.0	80.0	81.0					11																	85435306		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1460-3304C>T	11.37:g.85435306G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Nonsense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.Q1256*	ENST00000528231.1	37	c.3766	CCDS53688.1	11	.	.	.	.	.	.	.	.	.	.	G	11.06	1.527386	0.27299	.	.	ENSG00000137501	ENST00000359152;ENST00000354566;ENST00000525423;ENST00000530351	.	.	.	5.4	4.48	0.54585	.	1.542250	0.03453	N	0.210927	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	0.5528	11.0543	0.47909	0.0:0.0:0.6618:0.3382	.	.	.	.	X	1256;732;732;151	.	.	Q	-	1	0	SYTL2	85112954	0.055000	0.20627	0.012000	0.15200	0.001000	0.01503	2.246000	0.43142	1.498000	0.48600	-0.181000	0.13052	CAG	SYTL2	-	NULL	ENSG00000137501		0.468	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	HGNC	protein_coding	OTTHUMT00000392192.1	80	0.00	0	G	NM_206927		85435306	85435306	-1	no_errors	ENST00000359152	ensembl	human	known	69_37n	nonsense	43	48.24	41	SNP	0.002	A
SZT2	23334	genome.wustl.edu	37	1	43892848	43892848	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:43892848C>T	ENST00000562955.1	+	23	3260	c.3260C>T	c.(3259-3261)tCa>tTa	p.S1087L	SZT2_ENST00000372442.1_Missense_Mutation_p.S245L	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	1144					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						GCTACCTTCTCAGGTGCCAGC	0.567																																						dbGAP											0													117.0	127.0	124.0					1																	43892848		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.3260C>T	1.37:g.43892848C>T	ENSP00000457168:p.Ser1087Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	NULL	p.S1087L	ENST00000562955.1	37	c.3260	CCDS30694.2	1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466987	0.63625	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.19	5.19	0.71726	.	0.667620	0.14671	N	0.305379	T	0.49915	0.1585	L	0.54323	1.7	0.31871	N	0.619776	B	0.02656	0.0	B	0.06405	0.002	T	0.55952	-0.8059	9	0.56958	D	0.05	.	13.4089	0.60931	0.0:0.9242:0.0:0.0758	.	1087	Q5T011-5	.	L	245	.	ENSP00000361519:S245L	S	+	2	0	SZT2	43665435	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.251000	0.65438	2.577000	0.86979	0.655000	0.94253	TCA	SZT2	-	NULL	ENSG00000198198		0.567	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	HGNC	protein_coding	OTTHUMT00000019517.3	57	0.00	0	C	NM_015284		43892848	43892848	+1	no_errors	ENST00000562955	ensembl	human	known	69_37n	missense	60	40.00	40	SNP	1.000	T
TAF5L	27097	genome.wustl.edu	37	1	229738611	229738611	+	Silent	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:229738611G>A	ENST00000366676.1	-	3	302	c.303C>T	c.(301-303)gtC>gtT	p.V101V	TAF5L_ENST00000366675.3_Silent_p.V101V|TAF5L_ENST00000258281.2_Silent_p.V101V			O75529	TAF5L_HUMAN	TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	101					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)	11	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				GATGGAGGTAGACAAAGAGAG	0.433																																						dbGAP											0													57.0	56.0	56.0					1																	229738611		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF069736	CCDS1581.1, CCDS31051.1	1q42.11-q42.3	2013-01-10	2002-08-29		ENSG00000135801	ENSG00000135801		"""WD repeat domain containing"""	17304	protein-coding gene	gene with protein product	"""PCAF associated factor 65 beta"""		"""TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425, 11124703	Standard	XM_005273100		Approved	PAF65B	uc001htq.3	O75529	OTTHUMG00000039463	ENST00000366676.1:c.303C>T	1.37:g.229738611G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDI5|Q5TDI6|Q8IW31	Silent	SNP	pfam_WD40_repeat,pfam_TFIID-su_WD40-assoc_reg,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.V101	ENST00000366676.1	37	c.303	CCDS1581.1	1																																																																																			TAF5L	-	pfam_TFIID-su_WD40-assoc_reg	ENSG00000135801		0.433	TAF5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF5L	HGNC	protein_coding	OTTHUMT00000095229.1	18	0.00	0	G	NM_014409		229738611	229738611	-1	no_errors	ENST00000258281	ensembl	human	known	69_37n	silent	25	28.57	10	SNP	1.000	A
TAT	6898	genome.wustl.edu	37	16	71602632	71602632	+	Silent	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr16:71602632G>A	ENST00000355962.4	-	11	1339	c.1206C>T	c.(1204-1206)gtC>gtT	p.V402V	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	402					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	GGAGGCAGTGGACAGACTGCT	0.507																																					Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)	dbGAP											0													72.0	60.0	64.0					16																	71602632		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0				CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.1206C>T	16.37:g.71602632G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8I1|D3DWS2	Silent	SNP	pfam_Aminotransferase_I/II,pfam_Tyr_aminoTrfase_ubiquitination,pfam_ArAA_b-elim_lyase/Thr_aldolase,pfam_Aminotrans_V/Cys_dSase,pfam_DegT/StrS_aminotransferase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Tyrosine_transaminase,prints_ACC_synthase,tigrfam_Tyrosine_aminoTrfase,tigrfam_TyrNic_aminoTrfase	p.V402	ENST00000355962.4	37	c.1206	CCDS10903.1	16																																																																																			TAT	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Tyrosine_transaminase,tigrfam_Tyrosine_aminoTrfase,tigrfam_TyrNic_aminoTrfase	ENSG00000198650		0.507	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAT	HGNC	protein_coding	OTTHUMT00000268989.1	41	0.00	0	G			71602632	71602632	-1	no_errors	ENST00000355962	ensembl	human	known	69_37n	silent	5	80.77	21	SNP	1.000	A
TBC1D23	55773	genome.wustl.edu	37	3	99979901	99979901	+	Silent	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr3:99979901G>C	ENST00000394144.4	+	1	46	c.39G>C	c.(37-39)tcG>tcC	p.S13S	TBC1D23_ENST00000344949.5_Silent_p.S13S	NM_001199198.2	NP_001186127.1	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	13					positive regulation of interleukin-6 production (GO:0032755)|regulation of inflammatory response (GO:0050727)|regulation of tumor necrosis factor production (GO:0032680)		Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(10)|ovary(1)|prostate(2)|skin(2)	25						TGCCAACGTCGAGCGGCGACG	0.597																																						dbGAP											0													67.0	71.0	69.0					3																	99979901		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001908	CCDS2936.1, CCDS56265.1	3q12.2	2013-07-10			ENSG00000036054	ENSG00000036054			25622	protein-coding gene	gene with protein product						22312129	Standard	NM_001199198		Approved	FLJ11046	uc003dtt.4	Q9NUY8	OTTHUMG00000159067	ENST00000394144.4:c.39G>C	3.37:g.99979901G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B9A6M5|Q8TCN8|Q8WUB7|Q96D90|Q9NV75	Silent	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Rhodanese-like_dom,superfamily_Rab-GTPase-TBC_dom,superfamily_Rhodanese-like_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Rhodanese-like_dom	p.S13	ENST00000394144.4	37	c.39	CCDS56265.1	3																																																																																			TBC1D23	-	NULL	ENSG00000036054		0.597	TBC1D23-002	KNOWN	basic|CCDS	protein_coding	TBC1D23	HGNC	protein_coding	OTTHUMT00000353150.1	17	0.00	0	G	NM_018309		99979901	99979901	+1	no_errors	ENST00000394144	ensembl	human	known	69_37n	silent	22	29.03	9	SNP	0.022	C
TESK2	10420	genome.wustl.edu	37	1	45821062	45821062	+	Silent	SNP	A	A	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:45821062A>T	ENST00000372086.3	-	5	853	c.453T>A	c.(451-453)acT>acA	p.T151T	TESK2_ENST00000372084.1_Silent_p.T151T|TESK2_ENST00000538496.1_Silent_p.T68T|TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000341771.6_Silent_p.T151T	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2	151	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					TTACCCTCACAGTCCAAGGCA	0.453																																						dbGAP											0													135.0	127.0	129.0					1																	45821062		1921	4127	6048	-	-	-	SO:0001819	synonymous_variant	0			AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.453T>A	1.37:g.45821062A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T422|Q5T423|Q8N520|Q9Y3Q6	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T151	ENST00000372086.3	37	c.453	CCDS41323.1	1																																																																																			TESK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000070759		0.453	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK2	HGNC	protein_coding	OTTHUMT00000020523.1	74	0.00	0	A	NM_007170		45821062	45821062	-1	no_errors	ENST00000372086	ensembl	human	known	69_37n	silent	59	55.64	74	SNP	0.998	T
THSD7B	80731	genome.wustl.edu	37	2	138000073	138000073	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr2:138000073C>T	ENST00000409968.1	+	10	2375	c.2197C>T	c.(2197-2199)Cca>Tca	p.P733S	THSD7B_ENST00000272643.3_Missense_Mutation_p.P733S|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000413152.2_Missense_Mutation_p.P702S			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	733	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CTGTTTTCTCCCATGCAAAAA	0.468																																						dbGAP											0													144.0	138.0	140.0					2																	138000073		1978	4155	6133	-	-	-	SO:0001583	missense	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.2197C>T	2.37:g.138000073C>T	ENSP00000387145:p.Pro733Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.P733S	ENST00000409968.1	37	c.2197		2	.	.	.	.	.	.	.	.	.	.	C	16.69	3.194145	0.58017	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.24151	2.36;2.23;1.87	5.78	4.91	0.64330	.	0.098358	0.64402	N	0.000001	T	0.38348	0.1037	M	0.64170	1.965	0.80722	D	1	D;D	0.61080	0.989;0.989	P;P	0.53401	0.725;0.725	T	0.13124	-1.0521	10	0.27082	T	0.32	.	14.7861	0.69806	0.0:0.9312:0.0:0.0688	.	733;702	Q9C0I4;C9JKN6	THS7B_HUMAN;.	S	733;733;702	ENSP00000387145:P733S;ENSP00000272643:P733S;ENSP00000413841:P702S	ENSP00000272643:P733S	P	+	1	0	THSD7B	137716543	0.997000	0.39634	0.986000	0.45419	0.139000	0.21198	5.602000	0.67612	1.471000	0.48121	0.655000	0.94253	CCA	THSD7B	-	smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000144229		0.468	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	79	0.00	0	C	XM_046570.9		138000073	138000073	+1	no_errors	ENST00000272643	ensembl	human	known	69_37n	missense	114	46.23	98	SNP	1.000	T
TLR5	7100	genome.wustl.edu	37	1	223284238	223284238	+	Silent	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:223284238G>C	ENST00000540964.1	-	4	2597	c.2136C>G	c.(2134-2136)ctC>ctG	p.L712L	TLR5_ENST00000342210.6_Silent_p.L712L			O60602	TLR5_HUMAN	toll-like receptor 5	712	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.		Missing (in 10% of the population; abolishes flagellin signaling; associated with resistance to SLEB1). {ECO:0000269|PubMed:14623910}.		cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		CCAGGTGTTTGAGCAAAGCAT	0.453																																						dbGAP											0													64.0	59.0	61.0					1																	223284238		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.2136C>G	1.37:g.223284238G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Silent	SNP	pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L712	ENST00000540964.1	37	c.2136	CCDS31033.1	1																																																																																			TLR5	-	pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom	ENSG00000187554		0.453	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR5	HGNC	protein_coding		26	0.00	0	G	NM_003268		223284238	223284238	-1	no_errors	ENST00000342210	ensembl	human	known	69_37n	silent	44	18.52	10	SNP	0.525	C
TMC5	79838	genome.wustl.edu	37	16	19477531	19477531	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr16:19477531C>G	ENST00000396229.2	+	9	2362	c.1613C>G	c.(1612-1614)aCc>aGc	p.T538S	TMC5_ENST00000542583.2_Missense_Mutation_p.T538S|TMC5_ENST00000564959.1_Missense_Mutation_p.T221S|TMC5_ENST00000381414.4_Missense_Mutation_p.T538S|TMC5_ENST00000541464.1_Missense_Mutation_p.T538S|TMC5_ENST00000219821.5_Missense_Mutation_p.T292S|TMC5_ENST00000561503.1_Missense_Mutation_p.T179S	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	538					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TGCTTGACCACCTGCTTCTTC	0.443																																						dbGAP											0													172.0	131.0	145.0					16																	19477531		2197	4300	6497	-	-	-	SO:0001583	missense	0			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.1613C>G	16.37:g.19477531C>G	ENSP00000379531:p.Thr538Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	pfam_TMC	p.T538S	ENST00000396229.2	37	c.1613	CCDS45431.1	16	.	.	.	.	.	.	.	.	.	.	C	6.813	0.519116	0.13005	.	.	ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583;ENST00000219821;ENST00000440743	T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66	5.3	1.79	0.24919	.	0.715314	0.14521	N	0.314461	T	0.26557	0.0649	N	0.11560	0.145	0.20489	N	0.999895	B;B;B;B;B;B	0.25486	0.127;0.003;0.127;0.078;0.078;0.127	B;B;B;B;B;B	0.27076	0.076;0.011;0.076;0.035;0.035;0.076	T	0.19353	-1.0308	10	0.32370	T	0.25	-2.1777	8.0468	0.30553	0.0:0.3211:0.0:0.6789	.	538;221;292;292;538;538	F5GYU8;E7EU57;Q6UXY8-3;B3KUQ8;Q6UXY8;Q6UXY8-2	.;.;.;.;TMC5_HUMAN;.	S	538;538;538;538;292;221	ENSP00000441227:T538S;ENSP00000370822:T538S;ENSP00000379531:T538S;ENSP00000446274:T538S;ENSP00000219821:T292S	ENSP00000219821:T292S	T	+	2	0	TMC5	19385032	0.660000	0.27420	0.205000	0.23548	0.070000	0.16714	0.931000	0.28871	0.039000	0.15632	-0.378000	0.06908	ACC	TMC5	-	NULL	ENSG00000103534		0.443	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC5	HGNC	protein_coding	OTTHUMT00000435888.1	101	0.00	0	C	NM_024780		19477531	19477531	+1	no_errors	ENST00000396229	ensembl	human	known	69_37n	missense	111	40.00	74	SNP	0.745	G
TMCC3	57458	genome.wustl.edu	37	12	94972209	94972209	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr12:94972209C>G	ENST00000261226.4	-	3	1223	c.1092G>C	c.(1090-1092)aaG>aaC	p.K364N	TMCC3_ENST00000551457.1_Missense_Mutation_p.K333N	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	364						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						GGTAGGCCACCTTCTCCTCAA	0.557																																						dbGAP											0													97.0	85.0	89.0					12																	94972209		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.1092G>C	12.37:g.94972209C>G	ENSP00000261226:p.Lys364Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWB2	Missense_Mutation	SNP	pfam_Predicted_TM_coiled-coil_2	p.K364N	ENST00000261226.4	37	c.1092	CCDS31877.1	12	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375023	0.82573	.	.	ENSG00000057704	ENST00000261226;ENST00000551457	T;T	0.58797	0.31;0.31	5.7	4.81	0.61882	.	0.041017	0.85682	D	0.000000	T	0.75561	0.3866	M	0.82823	2.61	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.78666	-0.2115	10	0.87932	D	0	-45.0385	12.0167	0.53317	0.0:0.8337:0.0:0.1663	.	364	Q9ULS5	TMCC3_HUMAN	N	364;333	ENSP00000261226:K364N;ENSP00000449888:K333N	ENSP00000261226:K364N	K	-	3	2	TMCC3	93496340	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.914000	0.28624	2.698000	0.92095	0.491000	0.48974	AAG	TMCC3	-	pfam_Predicted_TM_coiled-coil_2	ENSG00000057704		0.557	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCC3	HGNC	protein_coding	OTTHUMT00000408113.1	53	0.00	0	C	NM_020698		94972209	94972209	-1	no_errors	ENST00000261226	ensembl	human	known	69_37n	missense	35	48.57	34	SNP	1.000	G
TMEM245	23731	genome.wustl.edu	37	9	111849507	111849507	+	Silent	SNP	G	G	A	rs369574982		TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr9:111849507G>A	ENST00000374586.3	-	6	1297	c.1266C>T	c.(1264-1266)ctC>ctT	p.L422L		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	422						integral component of membrane (GO:0016021)											GCCAAGGCGCGAGAGCTCCCT	0.443																																						dbGAP											0													87.0	86.0	87.0					9																	111849507		1835	4090	5925	-	-	-	SO:0001819	synonymous_variant	0			AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.1266C>T	9.37:g.111849507G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Missense_Mutation	SNP	pfam_UPF0118	p.R23C	ENST00000374586.3	37	c.67	CCDS43858.1	9	.	.	.	.	.	.	.	.	.	.	G	6.390	0.440076	0.12104	.	.	ENSG00000106771	ENST00000413712	.	.	.	5.83	-11.7	0.00046	.	.	.	.	.	T	0.32734	0.0839	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50651	-0.8803	4	.	.	.	-9.9942	2.7868	0.05376	0.2671:0.4837:0.1628:0.0865	.	.	.	.	C	23	.	.	R	-	1	0	C9orf5	110889328	0.000000	0.05858	0.002000	0.10522	0.762000	0.43233	-2.977000	0.00664	-3.926000	0.00090	-0.251000	0.11542	CGC	TMEM245	-	NULL	ENSG00000106771		0.443	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM245	HGNC	protein_coding	OTTHUMT00000053587.2	45	0.00	0	G	NM_032012		111849507	111849507	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000413712	ensembl	human	novel	69_37n	missense	42	40.00	28	SNP	0.001	A
TPP1	1200	genome.wustl.edu	37	11	6637688	6637688	+	Silent	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr11:6637688G>A	ENST00000299427.6	-	8	993	c.933C>T	c.(931-933)ctC>ctT	p.L311L	TPP1_ENST00000533371.1_Silent_p.L68L|TPP1_ENST00000534644.1_5'Flank|RP11-732A19.9_ENST00000545572.1_RNA	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I	0					embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	ACTCATTACTGAGCAGCATGA	0.517																																						dbGAP											0													46.0	42.0	43.0					11																	6637688		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.933C>T	11.37:g.6637688G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q71V64	Missense_Mutation	SNP	pfam_Peptidase_S53_propep,superfamily_Prot_inh_propept,smart_Peptidase_S53_propep	p.S166L	ENST00000299427.6	37	c.497	CCDS7770.1	11	.	.	.	.	.	.	.	.	.	.	G	9.434	1.086265	0.20390	.	.	ENSG00000166340	ENST00000436873	T	0.73152	-0.72	5.27	3.37	0.38596	.	.	.	.	.	T	0.70263	0.3204	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.64769	-0.6329	5	.	.	.	-14.6081	8.5336	0.33349	0.1802:0.0:0.8198:0.0	.	.	.	.	L	166	ENSP00000398136:S166L	.	S	-	2	0	TPP1	6594264	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	2.036000	0.41165	0.596000	0.29794	0.555000	0.69702	TCA	TPP1	-	NULL	ENSG00000166340		0.517	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP1	HGNC	protein_coding	OTTHUMT00000257261.2	18	0.00	0	G			6637688	6637688	-1	no_stop_codon	ENST00000436873	ensembl	human	putative	69_37n	missense	22	45.00	18	SNP	1.000	A
TMPRSS5	80975	genome.wustl.edu	37	11	113563803	113563803	+	Silent	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr11:113563803G>C	ENST00000299882.5	-	9	1102	c.954C>G	c.(952-954)ctC>ctG	p.L318L	TMPRSS5_ENST00000544634.1_Silent_p.L249L|TMPRSS5_ENST00000545265.1_5'UTR|TMPRSS5_ENST00000544476.1_Silent_p.L205L|TMPRSS5_ENST00000545579.1_Silent_p.L309L|TMPRSS5_ENST00000540540.1_Silent_p.L59L|TMPRSS5_ENST00000538955.1_Silent_p.L274L|TMPRSS5_ENST00000536856.1_Silent_p.L59L	NM_030770.2	NP_110397.2	Q9H3S3	TMPS5_HUMAN	transmembrane protease, serine 5	318	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	peptidase activity (GO:0008233)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10		all_cancers(61;2.71e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.75e-06)|Epithelial(105;6.34e-05)|all cancers(92;0.000502)		CTGAGAAGTTGAGAGCGGTCT	0.617																																						dbGAP											0													20.0	25.0	24.0					11																	113563803		1939	4136	6075	-	-	-	SO:0001819	synonymous_variant	0			AB028140	CCDS44735.1, CCDS73390.1, CCDS73391.1, CCDS73392.1, CCDS73393.1	11q	2010-04-13	2008-07-31		ENSG00000166682	ENSG00000166682		"""Serine peptidases / Transmembrane"""	14908	protein-coding gene	gene with protein product	"""spinesin"""	606751					Standard	NM_030770		Approved	MGC141886, MGC148044	uc001poc.4	Q9H3S3	OTTHUMG00000168186	ENST00000299882.5:c.954C>G	11.37:g.113563803G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Srcr_rcpt-rel,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	p.L318	ENST00000299882.5	37	c.954	CCDS44735.1	11																																																																																			TMPRSS5	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	ENSG00000166682		0.617	TMPRSS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS5	HGNC	protein_coding	OTTHUMT00000398652.1	10	0.00	0	G	NM_030770		113563803	113563803	-1	no_errors	ENST00000299882	ensembl	human	known	69_37n	silent	20	28.57	8	SNP	0.996	C
TTN	7273	genome.wustl.edu	37	2	179499240	179499240	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr2:179499240C>G	ENST00000591111.1	-	180	37569	c.37345G>C	c.(37345-37347)Gat>Cat	p.D12449H	TTN_ENST00000359218.5_Missense_Mutation_p.D5150H|TTN_ENST00000460472.2_Missense_Mutation_p.D5025H|TTN_ENST00000342992.6_Missense_Mutation_p.D11522H|TTN_ENST00000342175.6_Missense_Mutation_p.D5217H|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D14090H|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000418062.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12449					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTAATTATATCAGGTCCTTTG	0.408																																						dbGAP											0													85.0	87.0	87.0					2																	179499240		1867	4114	5981	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.37345G>C	2.37:g.179499240C>G	ENSP00000465570:p.Asp12449His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.D11522H	ENST00000591111.1	37	c.34564		2	.	.	.	.	.	.	.	.	.	.	C	13.65	2.299692	0.40694	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	6.17	5.3	0.74995	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.72574	0.3477	L	0.39898	1.24	0.53688	D	0.999975	D;D;D;D	0.63046	0.972;0.972;0.972;0.992	P;P;P;P	0.59221	0.854;0.854;0.854;0.854	T	0.76024	-0.3110	9	0.87932	D	0	.	15.4435	0.75208	0.0:0.9342:0.0:0.0658	.	5025;5150;5217;12449	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	11522;5025;5217;5150;5025	ENSP00000343764:D11522H;ENSP00000434586:D5025H;ENSP00000340554:D5217H;ENSP00000352154:D5150H	ENSP00000340554:D5217H	D	-	1	0	TTN	179207485	1.000000	0.71417	0.984000	0.44739	0.921000	0.55340	6.044000	0.71012	1.633000	0.50488	0.655000	0.94253	GAT	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	29	0.00	0	C	NM_133378		179499240	179499240	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	30	49.15	29	SNP	0.998	G
TTN	7273	genome.wustl.edu	37	2	179649010	179649010	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr2:179649010C>G	ENST00000591111.1	-	16	2786	c.2562G>C	c.(2560-2562)aaG>aaC	p.K854N	TTN_ENST00000359218.5_Missense_Mutation_p.K808N|TTN_ENST00000460472.2_Missense_Mutation_p.K808N|TTN_ENST00000342992.6_Missense_Mutation_p.K854N|TTN_ENST00000360870.5_Missense_Mutation_p.K854N|TTN_ENST00000342175.6_Missense_Mutation_p.K808N|TTN_ENST00000589042.1_Missense_Mutation_p.K854N			Q8WZ42	TITIN_HUMAN	titin	33684					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTGGTGATCTTCTGAGCAG	0.488																																						dbGAP											0													88.0	77.0	81.0					2																	179649010		2203	4300	6503	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2562G>C	2.37:g.179649010C>G	ENSP00000465570:p.Lys854Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.K854N	ENST00000591111.1	37	c.2562		2	.	.	.	.	.	.	.	.	.	.	C	15.04	2.713838	0.48622	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.68624	-0.34;-0.11;-0.12;-0.13;-0.0	5.52	4.64	0.57946	Ribonuclease H-like (1);	.	.	.	.	T	0.74543	0.3730	L	0.36672	1.1	0.32071	N	0.594466	D;D;D;D;D	0.89917	0.998;0.998;0.998;0.999;1.0	P;P;P;D;D	0.79784	0.82;0.82;0.82;0.922;0.993	T	0.79487	-0.1783	9	0.87932	D	0	.	14.5195	0.67842	0.0:0.9293:0.0:0.0707	.	808;808;808;854;854	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	N	854;808;808;808;808;854	ENSP00000343764:K854N;ENSP00000434586:K808N;ENSP00000340554:K808N;ENSP00000352154:K808N;ENSP00000354117:K854N	ENSP00000340554:K808N	K	-	3	2	TTN	179357255	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.739000	0.68622	1.467000	0.48044	0.655000	0.94253	AAG	TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.488	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	30	0.00	0	C	NM_133378		179649010	179649010	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	24	52.00	26	SNP	1.000	G
UBA1	7317	genome.wustl.edu	37	X	47074208	47074208	+	Silent	SNP	G	G	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chrX:47074208G>T	ENST00000335972.6	+	26	3240	c.3057G>T	c.(3055-3057)gtG>gtT	p.V1019V	UBA1_ENST00000377351.4_Silent_p.V1019V|UBA1_ENST00000377269.3_Silent_p.V467V	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	1019					cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CAGAGATTGTGAGCCGTGTGT	0.602																																						dbGAP											0													76.0	56.0	63.0					X																	47074208		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.3057G>T	X.37:g.47074208G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRR8|Q96E13	Silent	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.V1019	ENST00000335972.6	37	c.3057	CCDS14275.1	X																																																																																			UBA1	-	pfam_Ub-activating_enz_e1_C,tigrfam_UBQ-activ_enz_E1	ENSG00000130985		0.602	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	HGNC	protein_coding	OTTHUMT00000056389.1	29	0.00	0	G	NM_003334		47074208	47074208	+1	no_errors	ENST00000335972	ensembl	human	known	69_37n	silent	34	45.16	28	SNP	0.986	T
UBIAD1	29914	genome.wustl.edu	37	1	11345847	11345847	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr1:11345847G>A	ENST00000376810.5	+	2	1002	c.676G>A	c.(676-678)Gag>Aag	p.E226K	UBIAD1_ENST00000376804.2_Intron	NM_013319.2	NP_037451.1	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	226					menaquinone biosynthetic process (GO:0009234)|ubiquinone biosynthetic process (GO:0006744)|vitamin K biosynthetic process (GO:0042371)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)|prenyltransferase activity (GO:0004659)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(3)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		CCTCAGCACCGAGGCCATTCT	0.617																																						dbGAP											0													160.0	125.0	137.0					1																	11345847		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS129.1	1p36.22	2012-05-02			ENSG00000120942	ENSG00000120942			30791	protein-coding gene	gene with protein product	"""transitional epithelia response protein"""	611632	"""Schnyder crystalline corneal dystrophy"""	SCCD		20953171, 12497587, 11314041, 17668063, 17962451, 8894705	Standard	NM_013319		Approved	TERE1	uc001asg.3	Q9Y5Z9	OTTHUMG00000002075	ENST00000376810.5:c.676G>A	1.37:g.11345847G>A	ENSP00000366006:p.Glu226Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQG3|Q53GX3|Q5THD4	Missense_Mutation	SNP	pfam_UbiA_prenyltransferase	p.E226K	ENST00000376810.5	37	c.676	CCDS129.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.173600	0.94807	.	.	ENSG00000120942	ENST00000376810	D	0.92299	-3.01	5.94	5.94	0.96194	.	0.165319	0.53938	D	0.000056	D	0.94624	0.8267	M	0.82323	2.585	0.80722	D	1	D	0.53151	0.958	P	0.53518	0.728	D	0.92643	0.6126	10	0.19590	T	0.45	0.3995	17.5153	0.87771	0.0:0.0:1.0:0.0	.	226	Q9Y5Z9	UBIA1_HUMAN	K	226	ENSP00000366006:E226K	ENSP00000366006:E226K	E	+	1	0	UBIAD1	11268434	1.000000	0.71417	0.994000	0.49952	0.949000	0.60115	9.434000	0.97515	2.807000	0.96579	0.591000	0.81541	GAG	UBIAD1	-	pfam_UbiA_prenyltransferase	ENSG00000120942		0.617	UBIAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBIAD1	HGNC	protein_coding	OTTHUMT00000005773.1	44	0.00	0	G	NM_013319		11345847	11345847	+1	no_errors	ENST00000376810	ensembl	human	known	69_37n	missense	47	47.19	42	SNP	1.000	A
USP7	7874	genome.wustl.edu	37	16	8988916	8988916	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr16:8988916C>T	ENST00000344836.4	-	28	3209	c.3011G>A	c.(3010-3012)gGa>gAa	p.G1004E	USP7_ENST00000535863.1_Missense_Mutation_p.G905E|USP7_ENST00000381886.4_Missense_Mutation_p.G988E	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	1004					maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						AAACGGGATTCCGAACGTTCC	0.522																																						dbGAP											0													234.0	214.0	221.0					16																	8988916		2197	4300	6497	-	-	-	SO:0001583	missense	0			Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.3011G>A	16.37:g.8988916C>T	ENSP00000343535:p.Gly1004Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_MATH,pfam_Pept_C19_dom,superfamily_TRAF-like,smart_MATH,pfscan_MATH,pfscan_Peptidase_C19	p.G1004E	ENST00000344836.4	37	c.3011	CCDS32385.1	16	.	.	.	.	.	.	.	.	.	.	C	32	5.129565	0.94473	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863	T;T	0.17213	2.29;2.37	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.53610	0.1807	M	0.91768	3.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.64089	-0.6489	10	0.87932	D	0	.	19.4254	0.94740	0.0:1.0:0.0:0.0	.	1004;988	Q93009;B7Z815	UBP7_HUMAN;.	E	1004;1012;905	ENSP00000343535:G1004E;ENSP00000443646:G905E	ENSP00000343535:G1004E	G	-	2	0	USP7	8896417	1.000000	0.71417	0.663000	0.29738	0.917000	0.54804	7.700000	0.84556	2.598000	0.87819	0.484000	0.47621	GGA	USP7	-	NULL	ENSG00000187555		0.522	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP7	HGNC	protein_coding	OTTHUMT00000434268.2	53	0.00	0	C			8988916	8988916	-1	no_errors	ENST00000344836	ensembl	human	known	69_37n	missense	48	43.53	37	SNP	1.000	T
ZC3H6	376940	genome.wustl.edu	37	2	113089006	113089006	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr2:113089006C>G	ENST00000409871.1	+	12	2912	c.2511C>G	c.(2509-2511)ttC>ttG	p.F837L	ZC3H6_ENST00000343936.4_Missense_Mutation_p.F837L|AC115115.2_ENST00000607612.1_RNA	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	837							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						AAAAAGCTTTCTTAATACCTT	0.393																																						dbGAP											0													92.0	88.0	89.0					2																	113089006		1912	4144	6056	-	-	-	SO:0001583	missense	0			AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.2511C>G	2.37:g.113089006C>G	ENSP00000386764:p.Phe837Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A9JR71|Q6ZW96	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.F837L	ENST00000409871.1	37	c.2511	CCDS46393.1	2	.	.	.	.	.	.	.	.	.	.	C	14.38	2.518905	0.44763	.	.	ENSG00000188177	ENST00000409871;ENST00000343936;ENST00000542974	T;T	0.13307	2.6;2.6	5.6	4.72	0.59763	.	0.178441	0.50627	D	0.000108	T	0.12178	0.0296	L	0.51422	1.61	0.32771	N	0.503794	B	0.30406	0.278	B	0.21360	0.034	T	0.10064	-1.0646	10	0.48119	T	0.1	-0.5679	8.9237	0.35628	0.0:0.7261:0.0:0.2739	.	837	P61129	ZC3H6_HUMAN	L	837;837;814	ENSP00000386764:F837L;ENSP00000340298:F837L	ENSP00000340298:F837L	F	+	3	2	ZC3H6	112805477	0.195000	0.23338	0.917000	0.36280	0.975000	0.68041	0.206000	0.17375	1.367000	0.46095	-0.140000	0.14226	TTC	ZC3H6	-	NULL	ENSG00000188177		0.393	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H6	HGNC	protein_coding	OTTHUMT00000330551.1	31	0.00	0	C	NM_198581		113089006	113089006	+1	no_errors	ENST00000343936	ensembl	human	known	69_37n	missense	4	81.82	18	SNP	0.960	G
ZNF106	64397	genome.wustl.edu	37	15	42743279	42743279	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr15:42743279C>G	ENST00000263805.4	-	2	1448	c.1122G>C	c.(1120-1122)atG>atC	p.M374I	ZNF106_ENST00000565611.1_Intron|ZNF106_ENST00000565380.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	374					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GTTTCTCTATCATTTCTGACT	0.438																																						dbGAP											0													174.0	168.0	170.0					15																	42743279		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.1122G>C	15.37:g.42743279C>G	ENSP00000263805:p.Met374Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_Znf_C2H2-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M374I	ENST00000263805.4	37	c.1122	CCDS32208.1	15	.	.	.	.	.	.	.	.	.	.	C	1.122	-0.655133	0.03480	.	.	ENSG00000103994	ENST00000263805	T	0.54279	0.58	5.34	-0.885	0.10593	.	1.611820	0.02903	N	0.135704	T	0.37705	0.1013	L	0.36672	1.1	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09975	-1.0650	10	0.07644	T	0.81	9.4963	5.364	0.16103	0.144:0.3299:0.0:0.5262	.	157;374	B4DGC7;Q9H2Y7	.;ZF106_HUMAN	I	374	ENSP00000263805:M374I	ENSP00000263805:M374I	M	-	3	0	ZFP106	40530571	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	-0.253000	0.08794	-0.310000	0.08766	-0.793000	0.03317	ATG	ZFP106	-	NULL	ENSG00000103994		0.438	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP106	HGNC	protein_coding	OTTHUMT00000422587.1	132	0.00	0	C	NM_022473		42743279	42743279	-1	no_errors	ENST00000263805	ensembl	human	known	69_37n	missense	95	38.31	59	SNP	0.000	G
ZNF266	10781	genome.wustl.edu	37	19	9524224	9524224	+	Silent	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:9524224G>A	ENST00000592904.1	-	5	3453	c.1377C>T	c.(1375-1377)agC>agT	p.S459S	ZNF266_ENST00000588933.1_Silent_p.S459S|ZNF266_ENST00000361151.1_Silent_p.S459S|ZNF266_ENST00000361451.2_Silent_p.S459S|ZNF266_ENST00000588221.1_Silent_p.S459S|ZNF266_ENST00000592292.1_Silent_p.S459S|ZNF266_ENST00000590306.1_Silent_p.S459S			Q14584	ZN266_HUMAN	zinc finger protein 266	459					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						GTTTTTTGGCGCTGTGGGTCC	0.448																																						dbGAP											0													60.0	53.0	55.0					19																	9524224		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.1377C>T	19.37:g.9524224G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S459	ENST00000592904.1	37	c.1377	CCDS12213.1	19																																																																																			ZNF266	-	smart_Znf_BED_prd,pfscan_Znf_C2H2	ENSG00000174652		0.448	ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF266	HGNC	protein_coding	OTTHUMT00000449033.1	39	0.00	0	G			9524224	9524224	-1	no_errors	ENST00000361151	ensembl	human	known	69_37n	silent	32	43.86	25	SNP	0.501	A
ZNF121	7675	genome.wustl.edu	37	19	9677557	9677557	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:9677557G>A	ENST00000586602.1	-	6	648	c.232C>T	c.(232-234)Cac>Tac	p.H78Y	ZNF121_ENST00000320451.6_Missense_Mutation_p.H78Y			P58317	ZN121_HUMAN	zinc finger protein 121	78					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|kidney(4)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	24						GTTCTCTGGTGAACATTTGGT	0.448																																						dbGAP											0													110.0	97.0	102.0					19																	9677557		2203	4300	6503	-	-	-	SO:0001583	missense	0			M99593	CCDS32902.1	19p13.2	2013-01-08	2006-08-22			ENSG00000197961		"""Zinc fingers, C2H2-type"""	12904	protein-coding gene	gene with protein product		194628	"""zinc finger protein 121 (clone ZHC32)"""	D19S204		8468057	Standard	NM_001008727		Approved	ZHC32, ZNF20	uc010xkp.1	P58317		ENST00000586602.1:c.232C>T	19.37:g.9677557G>A	ENSP00000468643:p.His78Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H78Y	ENST00000586602.1	37	c.232		19	.	.	.	.	.	.	.	.	.	.	G	0.022	-1.412881	0.01145	.	.	ENSG00000197961	ENST00000538300;ENST00000320451	T	0.28454	1.61	1.27	-2.33	0.06724	.	.	.	.	.	T	0.33731	0.0873	M	0.84773	2.715	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.41928	-0.9481	9	0.87932	D	0	.	6.4286	0.21784	0.3961:0.0:0.6039:0.0	.	78	P58317	ZN121_HUMAN	Y	78	ENSP00000326967:H78Y	ENSP00000326967:H78Y	H	-	1	0	ZNF121	9538557	0.000000	0.05858	0.000000	0.03702	0.570000	0.35934	-0.322000	0.08007	-0.733000	0.04850	0.485000	0.47835	CAC	ZNF121	-	NULL	ENSG00000197961		0.448	ZNF121-003	KNOWN	basic|appris_principal	protein_coding	ZNF121	HGNC	protein_coding	OTTHUMT00000449910.1	72	0.00	0	G	NM_001008727		9677557	9677557	-1	no_errors	ENST00000320451	ensembl	human	known	69_37n	missense	72	42.06	53	SNP	0.011	A
ZNF114	163071	genome.wustl.edu	37	19	48789311	48789311	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:48789311G>C	ENST00000595607.1	+	6	924	c.430G>C	c.(430-432)Gat>Cat	p.D144H	ZNF114_ENST00000315849.1_Missense_Mutation_p.D144H|ZNF114_ENST00000597695.1_Missense_Mutation_p.D110H|ZNF114_ENST00000600687.1_Missense_Mutation_p.D144H			Q8NC26	ZN114_HUMAN	zinc finger protein 114	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(6)|lung(11)	18		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)		TTCACAGGGAGATTCCATAAG	0.398																																						dbGAP											0													78.0	71.0	73.0					19																	48789311		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014935	CCDS12713.1, CCDS74412.1	19q13.32	2013-01-08			ENSG00000178150	ENSG00000178150		"""Zinc fingers, C2H2-type"", ""-"""	12894	protein-coding gene	gene with protein product		603996					Standard	XM_005258580		Approved	MGC17986	uc002pim.1	Q8NC26		ENST00000595607.1:c.430G>C	19.37:g.48789311G>C	ENSP00000469998:p.Asp144His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6B0|Q08AQ6	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D144H	ENST00000595607.1	37	c.430	CCDS12713.1	19	.	.	.	.	.	.	.	.	.	.	G	11.21	1.570488	0.28003	.	.	ENSG00000178150	ENST00000315849	T	0.04970	3.52	2.65	-1.33	0.09172	.	.	.	.	.	T	0.07188	0.0182	N	0.24115	0.695	0.09310	N	1	D	0.54772	0.968	P	0.53102	0.718	T	0.35251	-0.9796	9	0.44086	T	0.13	.	6.5073	0.22202	0.57:0.0:0.43:0.0	.	144	Q8NC26	ZN114_HUMAN	H	144	ENSP00000318898:D144H	ENSP00000318898:D144H	D	+	1	0	ZNF114	53481123	0.025000	0.19082	0.004000	0.12327	0.079000	0.17450	0.574000	0.23714	-0.271000	0.09272	0.411000	0.27672	GAT	ZNF114	-	NULL	ENSG00000178150		0.398	ZNF114-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF114	HGNC	protein_coding	OTTHUMT00000465601.1	31	0.00	0	G	NM_153608		48789311	48789311	+1	no_errors	ENST00000315849	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	0.003	C
ZNF41	7592	genome.wustl.edu	37	X	47307019	47307019	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chrX:47307019C>G	ENST00000377065.4	-	5	2789	c.2150G>C	c.(2149-2151)aGa>aCa	p.R717T	ZNF41_ENST00000313116.7_Missense_Mutation_p.R717T|ZNF41_ENST00000465311.1_5'Flank|ZNF41_ENST00000397050.2_Missense_Mutation_p.R727T	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	759					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				TTCATAGTGTCTTTCTCCAGT	0.413																																						dbGAP											0													136.0	119.0	124.0					X																	47307019		2203	4300	6503	-	-	-	SO:0001583	missense	0			X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.2150G>C	X.37:g.47307019C>G	ENSP00000366265:p.Arg717Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R727T	ENST00000377065.4	37	c.2180	CCDS14279.1	X	.	.	.	.	.	.	.	.	.	.	C	14.62	2.588323	0.46110	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	T;T;T	0.17854	2.25;2.25;3.21	3.58	3.58	0.41010	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38436	N	0.001686	T	0.34890	0.0913	M	0.73217	2.22	0.25762	N	0.984932	D;D;D;D;D	0.89917	0.995;0.995;1.0;0.995;0.996	D;D;D;D;D	0.83275	0.919;0.919;0.996;0.919;0.951	T	0.06844	-1.0804	10	0.87932	D	0	.	6.1502	0.20308	0.0:0.8622:0.0:0.1378	.	717;719;727;751;759	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	T	717;717;727	ENSP00000315173:R717T;ENSP00000366265:R717T;ENSP00000380243:R727T	ENSP00000315173:R717T	R	-	2	0	ZNF41	47191963	0.018000	0.18449	0.994000	0.49952	0.936000	0.57629	0.286000	0.18902	2.061000	0.61500	0.600000	0.82982	AGA	ZNF41	-	pfscan_Znf_C2H2	ENSG00000147124		0.413	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF41	HGNC	protein_coding	OTTHUMT00000056429.1	95	0.00	0	C	NM_153380		47307019	47307019	-1	no_errors	ENST00000397050	ensembl	human	known	69_37n	missense	87	39.16	56	SNP	0.997	G
ZNF425	155054	genome.wustl.edu	37	7	148823258	148823258	+	Intron	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr7:148823258G>A	ENST00000378061.2	-	1	151				ZNF398_ENST00000426851.2_5'Flank|RN7SL521P_ENST00000488398.2_RNA	NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			AGTTTCGACAGAGCCTGCATC	0.726																																						dbGAP											0													56.0	45.0	49.0					7																	148823258		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.18+29C>T	7.37:g.148823258G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPM1|Q08AG3	Silent	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.L16	ENST00000378061.2	37	c.48	CCDS34773.1	7																																																																																			ZNF425	-	NULL	ENSG00000204947		0.726	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF425	HGNC	protein_coding	OTTHUMT00000352726.1	8	0.00	0	G	XM_088140		148823258	148823258	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000483014	ensembl	human	putative	69_37n	silent	19	32.14	9	SNP	0.000	A
ZNF629	23361	genome.wustl.edu	37	16	30795272	30795272	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr16:30795272G>A	ENST00000262525.4	-	3	584	c.377C>T	c.(376-378)cCa>cTa	p.P126L		NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	126					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			GGGGACGACTGGGGGGCTGTT	0.701																																						dbGAP											0													7.0	8.0	8.0					16																	30795272		1978	4134	6112	-	-	-	SO:0001583	missense	0			AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.377C>T	16.37:g.30795272G>A	ENSP00000262525:p.Pro126Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15938	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P126L	ENST00000262525.4	37	c.377	CCDS45463.1	16	.	.	.	.	.	.	.	.	.	.	G	6.446	0.450450	0.12223	.	.	ENSG00000102870	ENST00000262525	T	0.10573	2.86	4.88	4.88	0.63580	.	0.155021	0.30419	N	0.009664	T	0.06872	0.0175	N	0.19112	0.55	0.42234	D	0.991909	B	0.12013	0.005	B	0.15484	0.013	T	0.20571	-1.0271	10	0.08381	T	0.77	-16.3727	12.8973	0.58106	0.0:0.0:0.8367:0.1633	.	126	Q9UEG4	ZN629_HUMAN	L	126	ENSP00000262525:P126L	ENSP00000262525:P126L	P	-	2	0	ZNF629	30702773	0.000000	0.05858	0.624000	0.29186	0.023000	0.10783	0.021000	0.13489	2.415000	0.81967	0.655000	0.94253	CCA	ZNF629	-	NULL	ENSG00000102870		0.701	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF629	HGNC	protein_coding	OTTHUMT00000434291.1	12	0.00	0	G	NM_015309		30795272	30795272	-1	no_errors	ENST00000262525	ensembl	human	known	69_37n	missense	5	61.54	8	SNP	0.662	A
KRBOX4	55634	genome.wustl.edu	37	X	46322764	46322764	+	Intron	SNP	G	G	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chrX:46322764G>T	ENST00000344302.4	+	5	884				KRBOX4_ENST00000377919.2_Intron|KRBOX4_ENST00000487081.1_Intron|KRBOX4_ENST00000360017.5_Intron|KRBOX4_ENST00000478600.1_Intron|KRBOX4_ENST00000298190.6_Intron	NM_001129898.1|NM_017776.2	NP_001123370.1|NP_060246.2	Q5JUW0	KRBX4_HUMAN	KRAB box domain containing 4						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)										CCGGGGAAAGGAGACCAGGTT	0.612																																						dbGAP											0													47.0	47.0	47.0					X																	46322764		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS14267.1, CCDS48097.1, CCDS48098.1	Xp11.3	2013-01-08	2013-01-08	2013-01-08	ENSG00000147121	ENSG00000147121		"""-"""	26007	protein-coding gene	gene with protein product	"""hypothetical protein FLJ20344"""	300585	"""zinc finger protein 673"", ""zinc finger family member 673"""	ZNF673		11944989	Standard	NM_001129898		Approved	FLJ20344	uc004dgn.4	Q5JUW0	OTTHUMG00000021421	ENST00000344302.4:c.253+21G>T	X.37:g.46322764G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0Y8|B3KU22|Q96EA3|Q9NXB1	Nonsense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.E92*	ENST00000344302.4	37	c.274	CCDS48097.1	X	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974170	0.34848	.	.	ENSG00000147121	ENST00000476762	.	.	.	3.0	1.11	0.20524	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.9662	0.14091	0.4937:0.0:0.5063:0.0	.	.	.	.	X	92	.	.	E	+	1	0	ZNF673	46207708	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.216000	0.09266	0.151000	0.19162	0.513000	0.50165	GAG	ZNF673	-	NULL	ENSG00000147121		0.612	KRBOX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF673	HGNC	protein_coding	OTTHUMT00000056359.2	29	0.00	0	G	NM_017776		46322764	46322764	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000476762	ensembl	human	putative	69_37n	nonsense	55	45.00	45	SNP	0.001	T
ZNF681	148213	genome.wustl.edu	37	19	23928047	23928047	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:23928047C>T	ENST00000402377.3	-	4	446	c.305G>A	c.(304-306)aGa>aAa	p.R102K	ZNF681_ENST00000395385.3_Missense_Mutation_p.R33K	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	102					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTTTCCATATCTTCTTGGTGT	0.328																																						dbGAP											0													45.0	43.0	43.0					19																	23928047		2203	4297	6500	-	-	-	SO:0001583	missense	0			AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.305G>A	19.37:g.23928047C>T	ENSP00000384000:p.Arg102Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVF7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R102K	ENST00000402377.3	37	c.305	CCDS12414.2	19	.	.	.	.	.	.	.	.	.	.	.	5.085	0.201394	0.09652	.	.	ENSG00000196172	ENST00000402377;ENST00000395385;ENST00000528059;ENST00000531570	T;T;T;T	0.08984	3.3;3.03;6.15;6.44	1.19	-0.0726	0.13739	.	.	.	.	.	T	0.04861	0.0131	L	0.31664	0.95	0.09310	N	1	B	0.14012	0.009	B	0.24848	0.056	T	0.47674	-0.9099	9	0.02654	T	1	.	4.9339	0.13930	0.0:0.6103:0.3897:0.0	.	102	Q96N22	ZN681_HUMAN	K	102;33;33;33	ENSP00000384000:R102K;ENSP00000378783:R33K;ENSP00000433806:R33K;ENSP00000435824:R33K	ENSP00000378783:R33K	R	-	2	0	ZNF681	23719887	0.000000	0.05858	0.011000	0.14972	0.010000	0.07245	0.068000	0.14531	-0.712000	0.04988	-0.702000	0.03669	AGA	ZNF681	-	NULL	ENSG00000196172		0.328	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF681	HGNC	protein_coding	OTTHUMT00000320248.2	57	0.00	0	C	NM_138286		23928047	23928047	-1	no_errors	ENST00000402377	ensembl	human	known	69_37n	missense	70	41.18	49	SNP	0.001	T
ZNF780B	163131	genome.wustl.edu	37	19	40540443	40540443	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JN-01A-11D-A13L-09	TCGA-D8-A1JN-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c83c7d48-8671-4f27-b3dd-05411fa2f784	c14cac2a-e308-44fa-b1af-ee51511ee0ee	g.chr19:40540443G>A	ENST00000434248.1	-	5	2388	c.2323C>T	c.(2323-2325)Cat>Tat	p.H775Y	ZNF780B_ENST00000221355.6_Missense_Mutation_p.H627Y	NM_001005851.2	NP_001005851.1	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	775					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TCACCAGTATGAATACTCTGA	0.418																																						dbGAP											0													82.0	88.0	86.0					19																	40540443		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK127063	CCDS46077.1	19q13.2	2013-01-08	2006-08-15	2006-08-15	ENSG00000128000	ENSG00000128000		"""Zinc fingers, C2H2-type"", ""-"""	33109	protein-coding gene	gene with protein product			"""zinc finger protein 779"""	ZNF779			Standard	NM_001005851		Approved		uc002omu.3	Q9Y6R6	OTTHUMG00000155118	ENST00000434248.1:c.2323C>T	19.37:g.40540443G>A	ENSP00000391641:p.His775Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH00	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H775Y	ENST00000434248.1	37	c.2323	CCDS46077.1	19	.	.	.	.	.	.	.	.	.	.	G	9.126	1.010249	0.19277	.	.	ENSG00000128000	ENST00000434248;ENST00000221355	T;T	0.67523	-0.27;-0.27	2.46	1.38	0.22167	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.75034	0.3795	M	0.91612	3.225	0.26644	N	0.972235	B	0.15473	0.013	B	0.34093	0.175	T	0.70019	-0.4987	9	0.72032	D	0.01	.	9.7729	0.40601	0.1319:0.0:0.8681:0.0	.	775	Q9Y6R6	Z780B_HUMAN	Y	775;627	ENSP00000391641:H775Y;ENSP00000221355:H627Y	ENSP00000221355:H627Y	H	-	1	0	ZNF780B	45232283	1.000000	0.71417	0.002000	0.10522	0.001000	0.01503	4.021000	0.57196	-0.128000	0.11641	-1.644000	0.00765	CAT	ZNF780B	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000128000		0.418	ZNF780B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF780B	HGNC	protein_coding	OTTHUMT00000338466.1	65	0.00	0	G	NM_001005851		40540443	40540443	-1	no_errors	ENST00000434248	ensembl	human	known	69_37n	missense	49	53.33	56	SNP	0.907	A
