#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AADACL4	343066	genome.wustl.edu	37	1	12711145	12711145	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr1:12711145A>T	ENST00000376221.1	+	2	172	c.172A>T	c.(172-174)Aat>Tat	p.N58Y		NM_001013630.1	NP_001013652.1	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	58						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)	17	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		CCAACAGGGGAATATATTTGA	0.403																																						dbGAP											0													73.0	74.0	74.0					1																	12711145		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30590.1	1p36.21	2010-12-14			ENSG00000204518	ENSG00000204518			32038	protein-coding gene	gene with protein product							Standard	XM_006710608		Approved	OTTHUMG00000001889	uc001auf.3	Q5VUY2	OTTHUMG00000001889	ENST00000376221.1:c.172A>T	1.37:g.12711145A>T	ENSP00000365395:p.Asn58Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_AB_hydrolase_3,pirsf_Arylacetamide_deacetylase	p.N58Y	ENST00000376221.1	37	c.172	CCDS30590.1	1	.	.	.	.	.	.	.	.	.	.	A	4.356	0.065572	0.08388	.	.	ENSG00000204518	ENST00000376221	T	0.04454	3.62	4.88	-2.7	0.06004	.	1.975730	0.02597	N	0.100631	T	0.03520	0.0101	L	0.40543	1.245	0.09310	N	1	B	0.18610	0.029	B	0.14023	0.01	T	0.35450	-0.9788	10	0.05959	T	0.93	-2.6523	1.4242	0.02319	0.3843:0.2696:0.0833:0.2628	.	58	Q5VUY2	ADCL4_HUMAN	Y	58	ENSP00000365395:N58Y	ENSP00000365395:N58Y	N	+	1	0	AADACL4	12633732	0.000000	0.05858	0.003000	0.11579	0.784000	0.44337	-0.028000	0.12350	-0.399000	0.07668	0.459000	0.35465	AAT	AADACL4	-	pirsf_Arylacetamide_deacetylase	ENSG00000204518		0.403	AADACL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AADACL4	HGNC	protein_coding	OTTHUMT00000005328.1	38	0.00	0	A	NM_001013630		12711145	12711145	+1	no_errors	ENST00000376221	ensembl	human	known	69_37n	missense	86	31.50	40	SNP	0.011	T
ANKRD32	84250	genome.wustl.edu	37	5	94005921	94005921	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr5:94005921A>C	ENST00000265140.5	+	13	2017	c.1598A>C	c.(1597-1599)cAc>cCc	p.H533P		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	533						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		AAGGTGCTCCACCTGACGCTA	0.318																																						dbGAP											0													60.0	51.0	54.0					5																	94005921		692	1590	2282	-	-	-	SO:0001583	missense	0			AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.1598A>C	5.37:g.94005921A>C	ENSP00000265140:p.His533Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.H533P	ENST00000265140.5	37	c.1598	CCDS4071.2	5	.	.	.	.	.	.	.	.	.	.	A	12.87	2.067482	0.36470	.	.	ENSG00000133302	ENST00000265140	T	0.46819	0.86	5.72	4.55	0.56014	.	0.613571	0.14661	N	0.305945	T	0.40473	0.1118	L	0.44542	1.39	0.09310	N	1	B	0.28512	0.214	B	0.31812	0.136	T	0.38650	-0.9651	10	0.72032	D	0.01	.	7.3023	0.26428	0.782:0.1433:0.0747:0.0	.	533	Q9BQI6	ANR32_HUMAN	P	533	ENSP00000265140:H533P	ENSP00000265140:H533P	H	+	2	0	ANKRD32	94031677	0.994000	0.37717	0.918000	0.36340	0.835000	0.47333	4.736000	0.62059	2.169000	0.68431	0.482000	0.46254	CAC	ANKRD32	-	NULL	ENSG00000133302		0.318	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD32	HGNC	protein_coding	OTTHUMT00000241610.1	42	0.00	0	A	NM_032290		94005921	94005921	+1	no_errors	ENST00000265140	ensembl	human	known	69_37n	missense	86	18.10	19	SNP	0.019	C
CILP	8483	genome.wustl.edu	37	15	65495782	65495782	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr15:65495782C>A	ENST00000261883.4	-	7	1112	c.946G>T	c.(946-948)Gag>Tag	p.E316*		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	316	Ig-like C2-type.				negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						GCTTTTGTCTCAGGGTTCATC	0.498																																						dbGAP											0													99.0	89.0	92.0					15																	65495782		2201	4299	6500	-	-	-	SO:0001587	stop_gained	0			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.946G>T	15.37:g.65495782C>A	ENSP00000261883:p.Glu316*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8F7|Q6UW99|Q8IYI5	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.E316*	ENST00000261883.4	37	c.946	CCDS10203.1	15	.	.	.	.	.	.	.	.	.	.	C	37	6.083751	0.97267	.	.	ENSG00000138615	ENST00000261883	.	.	.	5.24	-1.81	0.07882	.	0.300723	0.40640	N	0.001057	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-27.3633	5.8318	0.18584	0.0:0.4523:0.2535:0.2942	.	.	.	.	X	316	.	ENSP00000261883:E316X	E	-	1	0	CILP	63282835	0.322000	0.24634	0.013000	0.15412	0.968000	0.65278	1.002000	0.29796	-0.282000	0.09128	0.561000	0.74099	GAG	CILP	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000138615		0.498	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	HGNC	protein_coding	OTTHUMT00000256829.1	62	0.00	0	C	NM_003613		65495782	65495782	-1	no_errors	ENST00000261883	ensembl	human	known	69_37n	nonsense	108	14.96	19	SNP	0.499	A
CROCCP2	84809	genome.wustl.edu	37	1	16950820	16950820	+	lincRNA	SNP	G	G	A	rs41310373		TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr1:16950820G>A	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											TCCGCAGGCCGCCAGCTGCAC	0.706																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950820G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.706	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	22	0.00	0	G	NR_026752.1		16950820	16950820	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	18	33.33	9	SNP	0.999	A
DOCK8	81704	genome.wustl.edu	37	9	317062	317062	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr9:317062G>A	ENST00000453981.1	+	7	873	c.761G>A	c.(760-762)cGt>cAt	p.R254H	DOCK8_ENST00000469391.1_Missense_Mutation_p.R186H|DOCK8_ENST00000432829.2_Missense_Mutation_p.R186H			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	254					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GTGGAAATACGTCCAGTACCA	0.443																																						dbGAP											0													122.0	103.0	110.0					9																	317062		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.761G>A	9.37:g.317062G>A	ENSP00000408464:p.Arg254His	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,superfamily_ARM-type_fold	p.R254H	ENST00000453981.1	37	c.761	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451527	0.63290	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391	T;T;T	0.17370	2.28;2.28;2.28	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.22085	0.0532	L	0.60067	1.865	0.80722	D	1	B;B	0.30326	0.276;0.13	B;B	0.26693	0.055;0.072	T	0.01899	-1.1251	10	0.51188	T	0.08	.	19.3662	0.94464	0.0:0.0:1.0:0.0	.	186;254	E9PH09;Q8NF50	.;DOCK8_HUMAN	H	254;254;186;186	ENSP00000408464:R254H;ENSP00000394888:R186H;ENSP00000419438:R186H	ENSP00000287364:R254H	R	+	2	0	DOCK8	307062	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.592000	0.82676	2.589000	0.87451	0.591000	0.81541	CGT	DOCK8	-	NULL	ENSG00000107099		0.443	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	36	0.00	0	G	XM_036307		317062	317062	+1	no_errors	ENST00000453981	ensembl	human	known	69_37n	missense	56	35.23	31	SNP	1.000	A
EPC2	26122	genome.wustl.edu	37	2	149501311	149501311	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr2:149501311G>A	ENST00000258484.6	+	3	468	c.434G>A	c.(433-435)aGa>aAa	p.R145K		NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	145					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		ATGATTGACAGACTTGAAAAA	0.333																																						dbGAP											0													61.0	59.0	59.0					2																	149501311		1823	4088	5911	-	-	-	SO:0001583	missense	0			AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.434G>A	2.37:g.149501311G>A	ENSP00000258484:p.Arg145Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Missense_Mutation	SNP	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.R145K	ENST00000258484.6	37	c.434	CCDS46422.1	2	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799722	0.90538	.	.	ENSG00000135999	ENST00000457184;ENST00000258484;ENST00000397424	T;T;T	0.41065	1.01;1.01;1.01	5.17	5.17	0.71159	Enhancer of polycomb-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.60983	0.2311	L	0.52905	1.665	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	T	0.58532	-0.7620	10	0.44086	T	0.13	-4.7456	19.0102	0.92870	0.0:0.0:1.0:0.0	.	145	Q52LR7	EPC2_HUMAN	K	121;145;74	ENSP00000415543:R121K;ENSP00000258484:R145K;ENSP00000380569:R74K	ENSP00000258484:R145K	R	+	2	0	EPC2	149217781	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.378000	0.97191	2.582000	0.87167	0.585000	0.79938	AGA	EPC2	-	pfam_Enhancer_polycomb-like_N	ENSG00000135999		0.333	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPC2	HGNC	protein_coding	OTTHUMT00000332278.1	36	0.00	0	G	NM_015630		149501311	149501311	+1	no_errors	ENST00000258484	ensembl	human	known	69_37n	missense	58	20.55	15	SNP	1.000	A
FBXL14	144699	genome.wustl.edu	37	12	1702880	1702880	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr12:1702880G>A	ENST00000339235.3	-	1	451	c.353C>T	c.(352-354)tCc>tTc	p.S118F	FBXL14_ENST00000543278.1_5'Flank|WNT5B_ENST00000537031.1_Intron	NM_152441.2	NP_689654.1	Q8N1E6	FXL14_HUMAN	F-box and leucine-rich repeat protein 14	118					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	8	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00115)			AGCGCGCAGGGAGCCGATCTC	0.632																																						dbGAP											0													54.0	56.0	55.0					12																	1702880		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028132	CCDS8509.1	12p13.33	2011-06-09			ENSG00000171823	ENSG00000171823		"""F-boxes / Leucine-rich repeats"""	28624	protein-coding gene	gene with protein product		609081				12477932	Standard	NM_152441		Approved	MGC40195, Fbl14	uc001qjh.3	Q8N1E6	OTTHUMG00000090369	ENST00000339235.3:c.353C>T	12.37:g.1702880G>A	ENSP00000344855:p.Ser118Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_F-box_dom_cyclin-like,pfam_Leu-rich_rpt_2,superfamily_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp	p.S118F	ENST00000339235.3	37	c.353	CCDS8509.1	12	.	.	.	.	.	.	.	.	.	.	G	19.02	3.745471	0.69418	.	.	ENSG00000171823	ENST00000339235	T	0.02472	4.28	4.19	4.19	0.49359	.	0.000000	0.85682	D	0.000000	T	0.07052	0.0179	L	0.55990	1.75	0.53005	D	0.999969	D	0.55385	0.971	P	0.49012	0.598	T	0.25328	-1.0135	10	0.54805	T	0.06	.	16.2962	0.82776	0.0:0.0:1.0:0.0	.	118	Q8N1E6	FXL14_HUMAN	F	118	ENSP00000344855:S118F	ENSP00000344855:S118F	S	-	2	0	FBXL14	1573141	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.463000	0.97652	2.146000	0.66826	0.557000	0.71058	TCC	FBXL14	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000171823		0.632	FBXL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL14	HGNC	protein_coding	OTTHUMT00000206741.1	26	0.00	0	G	NM_152441		1702880	1702880	-1	no_errors	ENST00000339235	ensembl	human	known	69_37n	missense	36	30.91	17	SNP	1.000	A
FCGBP	8857	genome.wustl.edu	37	19	40392802	40392802	+	Missense_Mutation	SNP	C	C	T	rs149844303		TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr19:40392802C>T	ENST00000221347.6	-	16	7709	c.7702G>A	c.(7702-7704)Gcc>Acc	p.A2568T		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2568	VWFD 6. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGGTCGTAGGCCACACGCAGG	0.582																																						dbGAP											0													4.0	4.0	4.0					19																	40392802		1744	3652	5396	-	-	-	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.7702G>A	19.37:g.40392802C>T	ENSP00000221347:p.Ala2568Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.A2568T	ENST00000221347.6	37	c.7702	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	4.458	0.084878	0.08583	.	.	ENSG00000090920	ENST00000221347	T	0.59224	0.28	2.66	1.61	0.23674	von Willebrand factor, type D domain (3);	.	.	.	.	T	0.32255	0.0823	N	0.01197	-0.965	0.21762	N	0.999551	B	0.28880	0.226	P	0.44447	0.45	T	0.50268	-0.8848	9	0.09843	T	0.71	.	5.9813	0.19409	0.0:0.7321:0.0:0.2679	.	2568	Q9Y6R7	FCGBP_HUMAN	T	2568	ENSP00000221347:A2568T	ENSP00000221347:A2568T	A	-	1	0	FCGBP	45084642	0.000000	0.05858	0.998000	0.56505	0.350000	0.29205	-2.239000	0.01198	1.495000	0.48549	0.298000	0.19748	GCC	FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000090920		0.582	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	26	0.00	0	C	NM_003890		40392802	40392802	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	missense	36	25.00	12	SNP	0.999	T
FZD9	8326	genome.wustl.edu	37	7	72849875	72849875	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr7:72849875A>T	ENST00000344575.3	+	1	1767	c.1538A>T	c.(1537-1539)aAa>aTa	p.K513I		NM_003508.2	NP_003499.1	O00144	FZD9_HUMAN	frizzled class receptor 9	513					B cell differentiation (GO:0030183)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuroblast proliferation (GO:0007405)|vasculature development (GO:0001944)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	14		Lung NSC(55;0.0659)|all_lung(88;0.152)				TTCATGCTCAAAATTTTCATG	0.652																																					Pancreas(144;909 1878 36867 38226 39554)	dbGAP											0													39.0	43.0	42.0					7																	72849875		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82169	CCDS5548.1	7q11.23	2014-01-29	2014-01-29		ENSG00000188763	ENSG00000188763		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4047	protein-coding gene	gene with protein product		601766	"""frizzled (Drosophila) homolog 9"", ""frizzled homolog 9 (Drosophila)"", ""frizzled 9, seven transmembrane spanning receptor"", ""frizzled family receptor 9"""			9147651, 10198163	Standard	NM_003508		Approved	FZD3, CD349	uc003tyb.3	O00144	OTTHUMG00000023051	ENST00000344575.3:c.1538A>T	7.37:g.72849875A>T	ENSP00000345785:p.Lys513Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.K513I	ENST00000344575.3	37	c.1538	CCDS5548.1	7	.	.	.	.	.	.	.	.	.	.	A	23.0	4.357030	0.82243	.	.	ENSG00000188763	ENST00000344575	D	0.85013	-1.93	5.12	5.12	0.69794	GPCR, family 2-like (1);	0.000000	0.85682	U	0.000000	D	0.94029	0.8087	H	0.95043	3.615	0.80722	D	1	D	0.65815	0.995	D	0.64595	0.927	D	0.95583	0.8648	10	0.87932	D	0	.	14.0952	0.65016	1.0:0.0:0.0:0.0	.	513	O00144	FZD9_HUMAN	I	513	ENSP00000345785:K513I	ENSP00000345785:K513I	K	+	2	0	FZD9	72487811	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.339000	0.96797	1.927000	0.55829	0.460000	0.39030	AAA	FZD9	-	pfam_Frizzled,pfscan_GPCR_2-like,prints_Frizzled	ENSG00000188763		0.652	FZD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD9	HGNC	protein_coding	OTTHUMT00000252120.1	35	0.00	0	A			72849875	72849875	+1	no_errors	ENST00000344575	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	1.000	T
GLI4	2738	genome.wustl.edu	37	8	144358528	144358528	+	Missense_Mutation	SNP	C	C	G	rs370794277		TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr8:144358528C>G	ENST00000523522.1	+	3	724	c.685C>G	c.(685-687)Cac>Gac	p.H229D	GLI4_ENST00000340042.1_Missense_Mutation_p.H229D|GLI4_ENST00000523812.1_3'UTR|ZFP41_ENST00000522452.1_3'UTR			P10075	GLI4_HUMAN	GLI family zinc finger 4	229					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(1)|lung(5)	9	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			CTTCATCCAGCACCACCGCAT	0.677																																						dbGAP											0													24.0	27.0	26.0					8																	144358528		2201	4293	6494	-	-	-	SO:0001583	missense	0				CCDS6398.1	8q24.3	2013-01-08	2009-03-05		ENSG00000250571	ENSG00000250571		"""Zinc fingers, C2H2-type"""	4320	protein-coding gene	gene with protein product		165280	"""GLI-Kruppel family member GLI4"", ""glioma-associated oncogene family zinc finger 4"""			2850480	Standard	NM_138465		Approved	HKR4, ZNF928	uc003yxx.3	P10075	OTTHUMG00000164952	ENST00000523522.1:c.685C>G	8.37:g.144358528C>G	ENSP00000430987:p.His229Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96CK9	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H229D	ENST00000523522.1	37	c.685	CCDS6398.1	8	.	.	.	.	.	.	.	.	.	.	C	16.36	3.101981	0.56183	.	.	ENSG00000250571	ENST00000340042;ENST00000523522	D;D	0.86769	-2.17;-2.17	3.97	3.07	0.35406	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.95265	0.8464	H	0.96916	3.905	0.27389	N	0.955199	D	0.89917	1.0	D	0.91635	0.999	D	0.88403	0.3016	9	0.87932	D	0	.	10.8501	0.46765	0.189:0.811:0.0:0.0	.	229	P10075	GLI4_HUMAN	D	229	ENSP00000345024:H229D;ENSP00000430987:H229D	ENSP00000345024:H229D	H	+	1	0	GLI4	144429903	0.984000	0.35163	1.000000	0.80357	0.440000	0.31957	5.354000	0.66040	0.841000	0.35020	0.558000	0.71614	CAC	GLI4	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000250571		0.677	GLI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI4	HGNC	protein_coding	OTTHUMT00000381128.2	21	0.00	0	C			144358528	144358528	+1	no_errors	ENST00000340042	ensembl	human	known	69_37n	missense	23	25.81	8	SNP	0.939	G
IKBKAP	8518	genome.wustl.edu	37	9	111673326	111673326	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr9:111673326G>C	ENST00000374647.5	-	12	1631	c.1324C>G	c.(1324-1326)Cta>Gta	p.L442V	IKBKAP_ENST00000537196.1_Missense_Mutation_p.L93V	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	442					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CTGGCATCTAGAACAGCAAGG	0.423																																						dbGAP											0													161.0	147.0	152.0					9																	111673326		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.1324C>G	9.37:g.111673326G>C	ENSP00000363779:p.Leu442Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSV2|Q9H327|Q9UG87	Missense_Mutation	SNP	pfam_IKI3,superfamily_ARM-type_fold,superfamily_UBA-like,pirsf_IKI3	p.L442V	ENST00000374647.5	37	c.1324	CCDS6773.1	9	.	.	.	.	.	.	.	.	.	.	G	15.83	2.947728	0.53186	.	.	ENSG00000070061	ENST00000374647;ENST00000537196	T;T	0.32023	1.47;1.47	5.24	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.33731	0.0873	L	0.41906	1.305	0.29346	N	0.865705	P	0.50272	0.933	P	0.51355	0.667	T	0.12344	-1.0551	10	0.27785	T	0.31	-9.3782	11.9996	0.53222	0.0849:0.0:0.9151:0.0	.	442	O95163	ELP1_HUMAN	V	442;93	ENSP00000363779:L442V;ENSP00000439367:L93V	ENSP00000363779:L442V	L	-	1	2	IKBKAP	110713147	1.000000	0.71417	0.989000	0.46669	0.877000	0.50540	1.920000	0.40025	1.366000	0.46076	0.313000	0.20887	CTA	IKBKAP	-	pfam_IKI3,pirsf_IKI3	ENSG00000070061		0.423	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKAP	HGNC	protein_coding	OTTHUMT00000053574.1	65	0.00	0	G			111673326	111673326	-1	no_errors	ENST00000374647	ensembl	human	known	69_37n	missense	134	19.28	32	SNP	0.998	C
KIAA1683	80726	genome.wustl.edu	37	19	18375974	18375974	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr19:18375974G>T	ENST00000600328.3	-	3	2569	c.2376C>A	c.(2374-2376)agC>agA	p.S792R	KIAA1683_ENST00000600359.3_Missense_Mutation_p.S746R|KIAA1683_ENST00000392413.4_Missense_Mutation_p.S792R			Q9H0B3	K1683_HUMAN	KIAA1683	792						mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						AGGGTGGGGCGCTGAGGCCAC	0.682																																						dbGAP											0													86.0	90.0	89.0					19																	18375974		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.2376C>A	19.37:g.18375974G>T	ENSP00000470780:p.Ser792Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.S792R	ENST00000600328.3	37	c.2376	CCDS32958.1	19	.	.	.	.	.	.	.	.	.	.	G	9.751	1.167589	0.21621	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000411671	T;T;T	0.04603	3.65;3.66;3.59	3.29	-2.37	0.06643	.	.	.	.	.	T	0.06600	0.0169	N	0.24115	0.695	0.09310	N	1	D;D	0.71674	0.998;0.996	P;P	0.61201	0.885;0.836	T	0.37314	-0.9711	9	0.21540	T	0.41	-9.9913	6.9778	0.24686	0.1608:0.3647:0.4745:0.0	.	792;792	E9PDE0;Q9H0B3	.;K1683_HUMAN	R	792;792;746;406	ENSP00000376213:S792R;ENSP00000352774:S792R;ENSP00000404501:S746R	ENSP00000352774:S792R	S	-	3	2	KIAA1683	18236974	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.005000	0.13129	-0.392000	0.07751	-1.583000	0.00853	AGC	KIAA1683	-	NULL	ENSG00000130518		0.682	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1683	HGNC	protein_coding	OTTHUMT00000466312.3	30	0.00	0	G			18375974	18375974	-1	no_errors	ENST00000392413	ensembl	human	known	69_37n	missense	33	29.79	14	SNP	0.000	T
LINC00283	100874057	genome.wustl.edu	37	13	103397200	103397200	+	RNA	SNP	G	G	C			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr13:103397200G>C	ENST00000430111.1	+	0	1573									long intergenic non-protein coding RNA 283																		GTAACTCCAGGACAGTTGCTT	0.423																																						dbGAP											0													112.0	84.0	92.0					13																	103397200		692	1590	2282	-	-	-			0					13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103397200G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000430111.1	37	NULL		13																																																																																			LINC00283	-	-	ENSG00000231633		0.423	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	LINC00283	HGNC	antisense	OTTHUMT00000045714.1	53	0.00	0	G			103397200	103397200	+1	no_errors	ENST00000430111	ensembl	human	known	69_37n	rna	98	30.00	42	SNP	0.000	C
MAST1	22983	genome.wustl.edu	37	19	12954345	12954345	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr19:12954345C>T	ENST00000251472.4	+	4	290	c.251C>T	c.(250-252)gCg>gTg	p.A84V	MAST1_ENST00000591495.1_Missense_Mutation_p.A80V	NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						GGTTCCAGGGCGGACGGACGC	0.667																																						dbGAP											0													51.0	48.0	49.0					19																	12954345		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.251C>T	19.37:g.12954345C>T	ENSP00000251472:p.Ala84Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.A84V	ENST00000251472.4	37	c.251	CCDS32921.1	19	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631984	0.87660	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.32988	1.43	4.43	4.43	0.53597	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.000000	0.64402	D	0.000002	T	0.33614	0.0869	M	0.79475	2.455	0.58432	D	0.999994	P;P	0.47106	0.89;0.777	B;B	0.36885	0.235;0.157	T	0.42582	-0.9443	10	0.44086	T	0.13	-30.2836	14.9453	0.71026	0.0:1.0:0.0:0.0	.	84;84	Q9Y2H9;F5H2S9	MAST1_HUMAN;.	V	84	ENSP00000251472:A84V	ENSP00000251472:A84V	A	+	2	0	MAST1	12815345	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.140000	0.77322	2.189000	0.69895	0.655000	0.94253	GCG	MAST1	-	pfam_MA_Ser/Thr_Kinase_dom	ENSG00000105613		0.667	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST1	HGNC	protein_coding	OTTHUMT00000451733.2	32	0.00	0	C	NM_014975		12954345	12954345	+1	no_errors	ENST00000251472	ensembl	human	known	69_37n	missense	28	49.09	27	SNP	1.000	T
MYBPC1	4604	genome.wustl.edu	37	12	102053566	102053566	+	Silent	SNP	C	C	T			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr12:102053566C>T	ENST00000550270.1	+	17	1809	c.1809C>T	c.(1807-1809)aaC>aaT	p.N603N	MYBPC1_ENST00000547509.1_Silent_p.N589N|MYBPC1_ENST00000452455.2_Silent_p.N603N|MYBPC1_ENST00000547405.1_Silent_p.N577N|MYBPC1_ENST00000545503.2_Silent_p.N603N|RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000536007.1_Silent_p.N584N|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000551300.1_Silent_p.N504N|MYBPC1_ENST00000549145.1_Silent_p.N616N|MYBPC1_ENST00000541119.1_Silent_p.N591N|MYBPC1_ENST00000441232.1_Silent_p.N603N|MYBPC1_ENST00000553190.1_Silent_p.N603N|MYBPC1_ENST00000361685.2_Silent_p.N628N|MYBPC1_ENST00000361466.2_Silent_p.N628N|MYBPC1_ENST00000360610.2_Silent_p.N603N|MYBPC1_ENST00000392934.3_Silent_p.N590N			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	603	Ig-like C2-type 5.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						ATCTGAAAAACGAAGCTGGAG	0.443																																						dbGAP											0													107.0	96.0	99.0					12																	102053566		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.1809C>T	12.37:g.102053566C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.N628	ENST00000550270.1	37	c.1884	CCDS9085.1	12																																																																																			MYBPC1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000196091		0.443	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBPC1	HGNC	protein_coding	OTTHUMT00000408806.1	43	0.00	0	C			102053566	102053566	+1	no_errors	ENST00000361466	ensembl	human	known	69_37n	silent	81	39.10	52	SNP	0.991	T
OR4F4	26682	genome.wustl.edu	37	15	102462857	102462857	+	Missense_Mutation	SNP	C	C	T	rs200667206	byFrequency	TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr15:102462857C>T	ENST00000326183.3	-	1	441	c.406G>A	c.(406-408)Ggc>Agc	p.G136S		NM_001004195.2	NP_001004195.2	Q96R69	OR4F4_HUMAN	olfactory receptor, family 4, subfamily F, member 4	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			GCCATAATGCCGACACATGCG	0.493													c|||	154	0.0307508	0.0182	0.0187	5008	,	,		39921	0.006		0.0239	False		,,,				2504	0.089					dbGAP											0													2.0	2.0	2.0					15																	102462857		514	1891	2405	-	-	-	SO:0001583	missense	0				CCDS32343.1	15q26.3	2012-08-09			ENSG00000177693	ENSG00000177693		"""GPCR / Class A : Olfactory receptors"""	8301	protein-coding gene	gene with protein product							Standard	NM_001004195		Approved	OR4F18	uc002cdf.1	Q96R69		ENST00000326183.3:c.406G>A	15.37:g.102462857C>T	ENSP00000317482:p.Gly136Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNI5|Q6IFN9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G136S	ENST00000326183.3	37	c.406	CCDS32343.1	15	.	.	.	.	.	.	.	.	.	.	.	0.556	-0.847333	0.02651	.	.	ENSG00000177693	ENST00000326183	T	0.00063	8.78	2.81	-0.391	0.12446	GPCR, rhodopsin-like superfamily (1);	0.377447	0.19878	N	0.104026	T	0.00073	0.0002	N	0.11341	0.13	0.09310	N	1	B	0.33198	0.401	B	0.25506	0.061	T	0.02721	-1.1119	9	.	.	.	.	4.6638	0.12655	0.3767:0.5061:0.0:0.1172	.	136	Q96R69	OR4F4_HUMAN	S	136	ENSP00000317482:G136S	.	G	-	1	0	OR4F4	100280380	0.000000	0.05858	0.000000	0.03702	0.076000	0.17211	-2.532000	0.00943	-0.069000	0.12931	0.298000	0.19748	GGC	OR4F4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000177693		0.493	OR4F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F4	HGNC	protein_coding	OTTHUMT00000417599.1	12	0.00	0	C	NM_001004195		102462857	102462857	-1	no_errors	ENST00000326183	ensembl	human	known	69_37n	missense	22	33.33	11	SNP	0.000	T
OTOF	9381	genome.wustl.edu	37	2	26707384	26707384	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr2:26707384G>A	ENST00000272371.2	-	12	1289	c.1163C>T	c.(1162-1164)aCg>aTg	p.T388M	OTOF_ENST00000403946.3_Missense_Mutation_p.T388M	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	388					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTGTGGGGCGTCTTGATGTT	0.612																																					GBM(102;732 1451 20652 24062 31372)	dbGAP											0													176.0	136.0	149.0					2																	26707384		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.1163C>T	2.37:g.26707384G>A	ENSP00000272371:p.Thr388Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.T388M	ENST00000272371.2	37	c.1163	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846493	0.71603	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.80393	-1.37;-1.37	4.84	4.84	0.62591	FerIin domain (1);	0.000000	0.85682	D	0.000000	D	0.85818	0.5785	L	0.47716	1.5	0.54753	D	0.99998	D	0.89917	1.0	D	0.77557	0.99	D	0.84133	0.0413	10	0.30854	T	0.27	-10.1788	16.4955	0.84242	0.0:0.0:1.0:0.0	.	388	Q9HC10	OTOF_HUMAN	M	388	ENSP00000272371:T388M;ENSP00000385255:T388M	ENSP00000272371:T388M	T	-	2	0	OTOF	26560888	1.000000	0.71417	0.960000	0.40013	0.992000	0.81027	6.660000	0.74417	2.243000	0.73865	0.462000	0.41574	ACG	OTOF	-	pfam_FerIin-domain	ENSG00000115155		0.612	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	93	0.00	0	G			26707384	26707384	-1	no_errors	ENST00000272371	ensembl	human	known	69_37n	missense	86	40.69	59	SNP	0.997	A
PCNXL2	80003	genome.wustl.edu	37	1	233344320	233344320	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr1:233344320T>C	ENST00000258229.9	-	13	3041	c.2807A>G	c.(2806-2808)tAt>tGt	p.Y936C	PCNXL2_ENST00000488780.2_Missense_Mutation_p.Y69C|PCNXL2_ENST00000430153.1_Missense_Mutation_p.Y235C	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	936						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				CTTCAGGCCATACACAACGTA	0.458																																						dbGAP											0													111.0	105.0	107.0					1																	233344320		1915	4115	6030	-	-	-	SO:0001583	missense	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.2807A>G	1.37:g.233344320T>C	ENSP00000258229:p.Tyr936Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.Y936C	ENST00000258229.9	37	c.2807	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.079950	0.76528	.	.	ENSG00000135749	ENST00000258229;ENST00000488780;ENST00000518351;ENST00000430153	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.8	4.61	0.57282	.	.	.	.	.	D	0.83092	0.5179	M	0.80332	2.49	0.52099	D	0.99994	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.979	D	0.85347	0.1099	9	0.87932	D	0	.	11.8829	0.52586	0.1305:0.0:0.0:0.8694	.	235;936	A6NKB5-2;A6NKB5	.;PCX2_HUMAN	C	936;69;105;235	ENSP00000258229:Y936C;ENSP00000430820:Y69C;ENSP00000429231:Y105C;ENSP00000394703:Y235C	ENSP00000258229:Y936C	Y	-	2	0	PCNXL2	231410943	1.000000	0.71417	0.992000	0.48379	0.789000	0.44602	5.863000	0.69568	2.209000	0.71365	0.533000	0.62120	TAT	PCNXL2	-	NULL	ENSG00000135749		0.458	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	42	0.00	0	T	NM_014801		233344320	233344320	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	missense	197	18.26	44	SNP	1.000	C
SALL4	57167	genome.wustl.edu	37	20	50408674	50408674	+	Silent	SNP	G	G	A	rs550786061		TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr20:50408674G>A	ENST00000217086.4	-	2	459	c.348C>T	c.(346-348)tcC>tcT	p.S116S	SALL4_ENST00000395997.3_Silent_p.S116S|SALL4_ENST00000483130.1_5'UTR|SALL4_ENST00000371539.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	116					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GTACAGCTCCGGAGAAGTCTT	0.542													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17765	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													79.0	82.0	81.0					20																	50408674		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.348C>T	20.37:g.50408674G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2D8|Q540H3|Q6Y8G6	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S116	ENST00000217086.4	37	c.348	CCDS13438.1	20																																																																																			SALL4	-	NULL	ENSG00000101115		0.542	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL4	HGNC	protein_coding	OTTHUMT00000079738.3	34	0.00	0	G			50408674	50408674	-1	no_errors	ENST00000217086	ensembl	human	known	69_37n	silent	55	32.10	26	SNP	0.050	A
SLC27A4	10999	genome.wustl.edu	37	9	131115797	131115797	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr9:131115797G>A	ENST00000300456.4	+	9	1418	c.1301G>A	c.(1300-1302)gGc>gAc	p.G434D	SLC27A4_ENST00000372870.1_Intron	NM_005094.3	NP_005085.2	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid transporter), member 4	434					fatty acid transport (GO:0015908)|lipid metabolic process (GO:0006629)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|response to nutrient (GO:0007584)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)|very long-chain fatty acid catabolic process (GO:0042760)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)	13						GGGCCCGACGGCGTCTGCATT	0.647																																					Pancreas(107;1554 2241 10946 12953)	dbGAP											0													53.0	54.0	54.0					9																	131115797		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055899	CCDS6899.1	9q34.13	2013-05-22			ENSG00000167114	ENSG00000167114		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10998	protein-coding gene	gene with protein product		604194				9878842	Standard	NM_005094		Approved	FATP4, ACSVL4	uc004but.3	Q6P1M0	OTTHUMG00000020746	ENST00000300456.4:c.1301G>A	9.37:g.131115797G>A	ENSP00000300456:p.Gly434Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2F7|O95186|Q96G53	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.G434D	ENST00000300456.4	37	c.1301	CCDS6899.1	9	.	.	.	.	.	.	.	.	.	.	G	33	5.224813	0.95173	.	.	ENSG00000167114	ENST00000300456	T	0.60548	0.18	5.9	5.9	0.94986	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.84197	0.5419	H	0.95114	3.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88122	0.2832	10	0.87932	D	0	-32.5099	19.2671	0.93993	0.0:0.0:1.0:0.0	.	434	Q6P1M0	S27A4_HUMAN	D	434	ENSP00000300456:G434D	ENSP00000300456:G434D	G	+	2	0	SLC27A4	130155618	1.000000	0.71417	0.661000	0.29709	0.942000	0.58702	9.440000	0.97547	2.788000	0.95919	0.650000	0.86243	GGC	SLC27A4	-	pfam_AMP-dep_Synth/Lig	ENSG00000167114		0.647	SLC27A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A4	HGNC	protein_coding	OTTHUMT00000054432.2	20	0.00	0	G			131115797	131115797	+1	no_errors	ENST00000300456	ensembl	human	known	69_37n	missense	24	35.14	13	SNP	0.999	A
SLC9A2	6549	genome.wustl.edu	37	2	103311569	103311569	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr2:103311569A>G	ENST00000233969.2	+	7	1725	c.1583A>G	c.(1582-1584)gAc>gGc	p.D528G	SLC9A2_ENST00000469286.1_3'UTR	NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	528					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						TTTTGGAGAGACAAGTAAGAA	0.373																																						dbGAP											0													205.0	205.0	205.0					2																	103311569		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.1583A>G	2.37:g.103311569A>G	ENSP00000233969:p.Asp528Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMS2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_2,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.D528G	ENST00000233969.2	37	c.1583	CCDS2062.1	2	.	.	.	.	.	.	.	.	.	.	A	25.4	4.636781	0.87760	.	.	ENSG00000115616	ENST00000233969	T	0.59906	0.23	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.73249	0.3563	M	0.84326	2.69	0.58432	D	0.999999	D	0.57899	0.981	P	0.54431	0.752	T	0.78170	-0.2308	10	0.72032	D	0.01	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	528	Q9UBY0	SL9A2_HUMAN	G	528	ENSP00000233969:D528G	ENSP00000233969:D528G	D	+	2	0	SLC9A2	102678001	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.187000	0.77730	2.254000	0.74563	0.533000	0.62120	GAC	SLC9A2	-	tigrfam_NaH_exchanger	ENSG00000115616		0.373	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A2	HGNC	protein_coding	OTTHUMT00000253292.2	93	0.00	0	A			103311569	103311569	+1	no_errors	ENST00000233969	ensembl	human	known	69_37n	missense	148	44.24	119	SNP	1.000	G
STK11IP	114790	genome.wustl.edu	37	2	220476737	220476737	+	Missense_Mutation	SNP	A	A	T	rs375492599		TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr2:220476737A>T	ENST00000456909.1	+	19	2486	c.2396A>T	c.(2395-2397)gAg>gTg	p.E799V	STK11IP_ENST00000295641.10_Missense_Mutation_p.E810V			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	810					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGGATGTTGAGGTGTTCAGC	0.647																																						dbGAP											0													39.0	43.0	41.0					2																	220476737		2157	4249	6406	-	-	-	SO:0001583	missense	0			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.2396A>T	2.37:g.220476737A>T	ENSP00000389383:p.Glu799Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	NULL	p.E799V	ENST00000456909.1	37	c.2396		2	.	.	.	.	.	.	.	.	.	.	A	18.63	3.664291	0.67700	.	.	ENSG00000144589	ENST00000456909;ENST00000295641	T;T	0.07444	3.19;3.19	4.65	3.47	0.39725	.	0.132496	0.48767	D	0.000171	T	0.21761	0.0524	M	0.71581	2.175	0.41265	D	0.9868	D	0.61080	0.989	P	0.61722	0.893	T	0.00609	-1.1646	10	0.87932	D	0	-17.5117	9.2868	0.37762	0.818:0.182:0.0:0.0	.	810	Q8N1F8	S11IP_HUMAN	V	799;810	ENSP00000389383:E799V;ENSP00000295641:E810V	ENSP00000295641:E810V	E	+	2	0	STK11IP	220184981	1.000000	0.71417	0.918000	0.36340	0.980000	0.70556	5.279000	0.65597	0.795000	0.33922	0.528000	0.53228	GAG	STK11IP	-	NULL	ENSG00000144589		0.647	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	STK11IP	HGNC	protein_coding	OTTHUMT00000131432.1	50	0.00	0	A	NM_052902		220476737	220476737	+1	no_errors	ENST00000456909	ensembl	human	novel	69_37n	missense	61	30.68	27	SNP	0.977	T
TMCO4	255104	genome.wustl.edu	37	1	20027295	20027295	+	Missense_Mutation	SNP	C	C	T	rs535945007	byFrequency	TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr1:20027295C>T	ENST00000294543.6	-	14	1589	c.1348G>A	c.(1348-1350)Gtg>Atg	p.V450M	TMCO4_ENST00000375127.1_Missense_Mutation_p.V450M|TMCO4_ENST00000375122.2_Missense_Mutation_p.V410M|TMCO4_ENST00000489814.1_5'UTR	NM_181719.4	NP_859070.3	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	450						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		CCGGACACCACCTTCCGGAAA	0.577																																						dbGAP											0													144.0	123.0	130.0					1																	20027295		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS198.1	1p36.13	2008-02-05			ENSG00000162542	ENSG00000162542			27393	protein-coding gene	gene with protein product							Standard	NM_181719		Approved	DKFZp686C23231	uc001bcn.3	Q5TGY1	OTTHUMG00000002697	ENST00000294543.6:c.1348G>A	1.37:g.20027295C>T	ENSP00000294543:p.Val450Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TGY2|Q6MZN5|Q7Z6K6|Q9UQP4|Q9Y3K1	Missense_Mutation	SNP	pfam_DUF726,pfam_DUF900_hydrolase	p.V450M	ENST00000294543.6	37	c.1348	CCDS198.1	1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676393	0.88445	.	.	ENSG00000162542	ENST00000294543;ENST00000375127;ENST00000375122	T;T;T	0.64991	-0.13;-0.13;-0.13	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000003	T	0.78375	0.4273	M	0.68952	2.095	0.53688	D	0.999978	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.996	T	0.79514	-0.1772	10	0.87932	D	0	-11.2303	17.4392	0.87561	0.0:1.0:0.0:0.0	.	34;450;410	Q6ZSC6;Q5TGY1;Q5TGY1-2	.;TMCO4_HUMAN;.	M	450;450;410	ENSP00000294543:V450M;ENSP00000364269:V450M;ENSP00000364264:V410M	ENSP00000294543:V450M	V	-	1	0	TMCO4	19899882	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.915000	0.69973	2.806000	0.96561	0.655000	0.94253	GTG	TMCO4	-	pfam_DUF726,pfam_DUF900_hydrolase	ENSG00000162542		0.577	TMCO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO4	HGNC	protein_coding	OTTHUMT00000007658.1	38	0.00	0	C	NM_181719		20027295	20027295	-1	no_errors	ENST00000294543	ensembl	human	known	69_37n	missense	51	36.25	29	SNP	1.000	T
USP34	9736	genome.wustl.edu	37	2	61468772	61468772	+	Silent	SNP	G	G	A			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr2:61468772G>A	ENST00000398571.2	-	53	6776	c.6700C>T	c.(6700-6702)Ctg>Ttg	p.L2234L		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2234	USP.				positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TTGTAAAACAGCATATATGCA	0.313																																						dbGAP											0													146.0	123.0	130.0					2																	61468772		1815	4082	5897	-	-	-	SO:0001819	synonymous_variant	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.6700C>T	2.37:g.61468772G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.L2234	ENST00000398571.2	37	c.6700	CCDS42686.1	2																																																																																			USP34	-	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	ENSG00000115464		0.313	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	99	0.00	0	G			61468772	61468772	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	silent	193	39.38	126	SNP	1.000	A
USP9X	8239	genome.wustl.edu	37	X	41025387	41025387	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chrX:41025387C>T	ENST00000324545.8	+	16	2881	c.2248C>T	c.(2248-2250)Cga>Tga	p.R750*	USP9X_ENST00000378308.2_Nonsense_Mutation_p.R750*	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	750					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						TGTGAATTGTCGAGAAGGAAA	0.373																																					Ovarian(172;1807 2695 35459 49286)	dbGAP											0													82.0	78.0	80.0					X																	41025387		2185	4289	6474	-	-	-	SO:0001587	stop_gained	0			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.2248C>T	X.37:g.41025387C>T	ENSP00000316357:p.Arg750*	Somatic		WXS	Illumina GAIIx	Phase_IV	O75550|Q8WWT3|Q8WX12	Nonsense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.R750*	ENST00000324545.8	37	c.2248	CCDS43930.1	X	.	.	.	.	.	.	.	.	.	.	C	40	7.999739	0.98602	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	.	.	.	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	17.7657	0.88477	0.0:1.0:0.0:0.0	.	.	.	.	X	750	.	ENSP00000316357:R750X	R	+	1	2	USP9X	40910331	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.862000	0.56009	2.213000	0.71641	0.600000	0.82982	CGA	USP9X	-	superfamily_ARM-type_fold	ENSG00000124486		0.373	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	HGNC	protein_coding	OTTHUMT00000056250.4	41	0.00	0	C	NM_004652		41025387	41025387	+1	no_errors	ENST00000324545	ensembl	human	known	69_37n	nonsense	78	35.00	42	SNP	1.000	T
ZNF286B	729288	genome.wustl.edu	37	17	18565506	18565506	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1X7-01A-11D-A14K-09	TCGA-D8-A1X7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7acb4232-db95-4889-942e-f1be897b4f2a	94d5eab1-0c42-45c7-8bb4-a3eccefd205b	g.chr17:18565506G>C	ENST00000545289.1	-	5	1563	c.1313C>G	c.(1312-1314)cCc>cGc	p.P438R	ZNF286B_ENST00000285274.5_3'UTR	NM_001145045.1	NP_001138517.1	P0CG31	Z286B_HUMAN	zinc finger protein 286B	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(1)	2						ACACTCATAGGGTTTCTCTCC	0.388																																						dbGAP											0													99.0	102.0	101.0					17																	18565506		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS58523.1	17p11.2	2013-01-08			ENSG00000249459	ENSG00000249459		"""Zinc fingers, C2H2-type"""	33241	protein-coding gene	gene with protein product	"""zinc finger protein 590"""		"""zinc finger protein 286-like"", ""zinc finger 286C pseudogene"""	ZNF286L, ZNF286C			Standard	NM_001145045		Approved	ZNF590	uc010vyd.1	P0CG31	OTTHUMG00000178136	ENST00000545289.1:c.1313C>G	17.37:g.18565506G>C	ENSP00000461413:p.Pro438Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P438R	ENST00000545289.1	37	c.1313	CCDS58523.1	17																																																																																			ZNF286B	-	pfscan_Znf_C2H2	ENSG00000249459		0.388	ZNF286B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF286B	HGNC	protein_coding		82	0.00	0	G	XM_001723047		18565506	18565506	-1	no_errors	ENST00000545289	ensembl	human	known	69_37n	missense	28	72.82	75	SNP	1.000	C
