#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AKR1B10	57016	genome.wustl.edu	37	7	134221826	134221826	+	Silent	SNP	A	A	G	rs28545160		TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr7:134221826A>G	ENST00000359579.4	+	6	896	c.576A>G	c.(574-576)acA>acG	p.T192T	AKR1B10_ENST00000475559.1_3'UTR	NM_020299.4	NP_064695.3	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10 (aldose reductase)	192					cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aldo-keto reductase (NADP) activity (GO:0004033)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(9)|skin(5)	20						CATACCTCACACAGGAGAAAC	0.537																																						dbGAP											0													29.0	48.0	42.0					7																	134221826		2166	4264	6430	-	-	-	SO:0001819	synonymous_variant	0			AF052577	CCDS5832.1	7q33	2010-04-08			ENSG00000198074	ENSG00000198074		"""Aldo-keto reductases"""	382	protein-coding gene	gene with protein product	"""aldose reductase-like 1"", ""aldo-keto reductase family 1, member B11 (aldose reductase-like)"", ""aldose reductase-like peptide"", ""aldose reductase-related protein"", ""small intestine reductase"""	604707		AKR1B11		9765596, 9565553	Standard	NM_020299		Approved	AKR1B12, ARL-1, HIS, ARL1, HSI, ALDRLn	uc003vrr.3	O60218	OTTHUMG00000155356	ENST00000359579.4:c.576A>G	7.37:g.134221826A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1P1|O75890|Q6FHF3|Q8IWZ1	Silent	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.T192	ENST00000359579.4	37	c.576	CCDS5832.1	7																																																																																			AKR1B10	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	ENSG00000198074		0.537	AKR1B10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1B10	HGNC	protein_coding	OTTHUMT00000339615.1	28	0.00	0	A	NM_020299		134221826	134221826	+1	no_errors	ENST00000359579	ensembl	human	known	69_37n	silent	35	16.67	7	SNP	0.043	G
AMHR2	269	genome.wustl.edu	37	12	53825208	53825208	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr12:53825208G>A	ENST00000257863.4	+	11	1753	c.1673G>A	c.(1672-1674)gGc>gAc	p.G558D	AMHR2_ENST00000379791.3_Missense_Mutation_p.G463D|AMHR2_ENST00000550311.1_3'UTR	NM_001164690.1|NM_020547.2	NP_001158162.1|NP_065434.1	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II	558					Mullerian duct regression (GO:0001880)|negative regulation of anti-Mullerian hormone signaling pathway (GO:1902613)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	integral component of plasma membrane (GO:0005887)	anti-Mullerian hormone receptor activity (GO:1990272)|ATP binding (GO:0005524)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor activity, type II (GO:0005026)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|skin(2)	34					Adenosine triphosphate(DB00171)	GTTCAGCAAGGCCCTTGTTCC	0.512																																						dbGAP											0													139.0	115.0	123.0					12																	53825208		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF172932	CCDS8858.1, CCDS53798.1, CCDS55829.1	12q13	2013-03-14							465	protein-coding gene	gene with protein product	"""Muellerian inhibiting substance type II receptor"""	600956				7493017	Standard	NM_001164690		Approved	MISR2, MISRII	uc001scx.2	Q16671	OTTHUMG00000170048	ENST00000257863.4:c.1673G>A	12.37:g.53825208G>A	ENSP00000257863:p.Gly558Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVE1|B9EGB7|E9PGD2|F8W1D2|Q13762|Q647K2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Anti-muellerian_hrmn_rcpt_II,pfscan_Prot_kinase_cat_dom	p.G558D	ENST00000257863.4	37	c.1673	CCDS8858.1	12	.	.	.	.	.	.	.	.	.	.	G	21.0	4.077672	0.76528	.	.	ENSG00000135409	ENST00000257863;ENST00000379791	D;D	0.96459	-3.2;-4.02	4.86	2.73	0.32206	.	0.000000	0.35805	N	0.002969	D	0.90604	0.7054	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.83025	-0.0165	10	0.87932	D	0	.	4.4686	0.11701	0.1409:0.0:0.6555:0.2036	.	558	Q16671	AMHR2_HUMAN	D	558;463	ENSP00000257863:G558D;ENSP00000369117:G463D	ENSP00000257863:G558D	G	+	2	0	AMHR2	52111475	0.009000	0.17119	0.228000	0.23943	0.720000	0.41350	1.239000	0.32719	0.562000	0.29204	0.563000	0.77884	GGC	AMHR2	-	pirsf_Anti-muellerian_hrmn_rcpt_II	ENSG00000135409		0.512	AMHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMHR2	HGNC	protein_coding	OTTHUMT00000407048.1	28	0.00	0	G	NM_020547		53825208	53825208	+1	no_errors	ENST00000257863	ensembl	human	known	69_37n	missense	30	37.50	18	SNP	0.007	A
ATAD3B	83858	genome.wustl.edu	37	1	1431165	1431165	+	Missense_Mutation	SNP	C	C	T	rs9792879		TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr1:1431165C>T	ENST00000308647.7	+	16	2031	c.1915C>T	c.(1915-1917)Ccg>Tcg	p.P639S		NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	639						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)	p.P639S(1)		endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TGGCGGTCGGCCGTTCTGCCC	0.647																																						dbGAP											1	Substitution - Missense(1)	skin(1)											33.0	33.0	33.0					1																	1431165		2202	4300	6502	-	-	-	SO:0001583	missense	0			AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.1915C>T	1.37:g.1431165C>T	ENSP00000311766:p.Pro639Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Missense_Mutation	SNP	pfam_DUF3523,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.P639S	ENST00000308647.7	37	c.1915	CCDS30.1	1	476	0.21794871794871795	147	0.29878048780487804	60	0.16574585635359115	170	0.2972027972027972	99	0.13060686015831136	c	11.49	1.652810	0.29336	.	.	ENSG00000160072	ENST00000378737;ENST00000308647	D	0.93811	-3.29	1.39	0.415	0.16411	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.58432	P	8.000000000008E-6	B;B	0.22604	0.072;0.024	B;B	0.12156	0.007;0.002	T	0.11324	-1.0592	8	0.87932	D	0	.	3.748	0.08555	0.0:0.7411:0.0:0.2589	rs9792879	593;639	Q5T9A4-3;Q5T9A4	.;ATD3B_HUMAN	S	473;639	ENSP00000311766:P639S	ENSP00000311766:P639S	P	+	1	0	ATAD3B	1421028	0.034000	0.19679	0.001000	0.08648	0.022000	0.10575	0.000000	0.12993	0.145000	0.18977	0.194000	0.17425	CCG	ATAD3B	-	NULL	ENSG00000160072		0.647	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD3B	HGNC	protein_coding	OTTHUMT00000001369.2	10	0.00	0	C	NM_031921		1431165	1431165	+1	no_errors	ENST00000308647	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	0.003	T
ATXN2L	11273	genome.wustl.edu	37	16	28844531	28844531	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr16:28844531C>T	ENST00000336783.4	+	14	1978	c.1811C>T	c.(1810-1812)tCg>tTg	p.S604L	ATXN2L_ENST00000382686.4_Missense_Mutation_p.S604L|ATXN2L_ENST00000395547.2_Missense_Mutation_p.S604L|ATXN2L_ENST00000340394.8_Missense_Mutation_p.S604L|ATXN2L_ENST00000564304.1_Missense_Mutation_p.S610L|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000325215.6_Missense_Mutation_p.S604L|ATXN2L_ENST00000570200.1_Missense_Mutation_p.S604L|ATXN2L_ENST00000565845.1_3'UTR	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	604					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						GAGTCCGTATCGGATAAGGAG	0.582																																						dbGAP											0													81.0	82.0	82.0					16																	28844531		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.1811C>T	16.37:g.28844531C>T	ENSP00000338718:p.Ser604Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Missense_Mutation	SNP	pfam_LsmAD_domain,pfam_Ataxin-2_C,superfamily_LSM_dom	p.S604L	ENST00000336783.4	37	c.1811	CCDS10641.1	16	.	.	.	.	.	.	.	.	.	.	.	10.57	1.387186	0.25031	.	.	ENSG00000168488	ENST00000340394;ENST00000395547;ENST00000336783;ENST00000382686;ENST00000325215	T;T;T;T;T	0.48836	0.82;0.8;0.81;0.82;0.82	5.67	1.31	0.21738	.	1.046830	0.07488	N	0.905157	T	0.27489	0.0675	N	0.12182	0.205	0.09310	N	1	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.04013	0.001;0.001;0.001;0.0;0.001;0.001;0.001;0.001	T	0.21861	-1.0233	10	0.28530	T	0.3	0.9702	5.7759	0.18279	0.0:0.5446:0.1293:0.3261	.	604;604;604;604;604;604;604;604	Q8WWM7-6;Q8WWM7-5;Q63ZY4;Q8WWM7;Q8WWM7-2;Q8WWM7-4;A8K1R6;Q8WWM7-3	.;.;.;ATX2L_HUMAN;.;.;.;.	L	604	ENSP00000341459:S604L;ENSP00000378917:S604L;ENSP00000338718:S604L;ENSP00000372133:S604L;ENSP00000315650:S604L	ENSP00000315650:S604L	S	+	2	0	ATXN2L	28752032	0.001000	0.12720	0.044000	0.18714	0.722000	0.41435	0.492000	0.22435	0.012000	0.14892	0.563000	0.77884	TCG	ATXN2L	-	NULL	ENSG00000168488		0.582	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATXN2L	HGNC	protein_coding	OTTHUMT00000214139.1	20	0.00	0	C	NM_007245		28844531	28844531	+1	no_errors	ENST00000395547	ensembl	human	known	69_37n	missense	31	27.91	12	SNP	0.011	T
BCO2	83875	genome.wustl.edu	37	11	112064318	112064318	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr11:112064318C>T	ENST00000357685.5	+	3	550	c.415C>T	c.(415-417)Cga>Tga	p.R139*	SDHD_ENST00000525468.1_3'UTR|BCO2_ENST00000361053.4_Nonsense_Mutation_p.R139*|BCO2_ENST00000526088.1_Nonsense_Mutation_p.R105*|AP002884.3_ENST00000532612.1_Nonsense_Mutation_p.R110*|BCO2_ENST00000393032.2_Nonsense_Mutation_p.R105*|BCO2_ENST00000531169.1_Nonsense_Mutation_p.R105*|BCO2_ENST00000532593.1_Nonsense_Mutation_p.R34*|BCO2_ENST00000438022.1_Nonsense_Mutation_p.R105*			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	139					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						TGCTAAAAACCGAATTGTGAT	0.468																																					GBM(177;1916 2099 21049 29541 39946)	dbGAP											0													132.0	111.0	119.0					11																	112064318		2201	4297	6498	-	-	-	SO:0001587	stop_gained	0			AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.415C>T	11.37:g.112064318C>T	ENSP00000350314:p.Arg139*	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Nonsense_Mutation	SNP	pfam_Carotenoid_Oase	p.R139*	ENST00000357685.5	37	c.415	CCDS8358.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.1|27.1	4.798497|4.798497	0.90538|0.90538	.|.	.|.	ENSG00000197580|ENSG00000197580	ENST00000530677|ENST00000357685;ENST00000393032;ENST00000361053;ENST00000438022;ENST00000526088;ENST00000532593;ENST00000531169	.|.	.|.	.|.	5.58|5.58	1.39|1.39	0.22231|0.22231	.|.	.|0.057288	.|0.64402	.|D	.|0.000001	T|.	0.48943|.	0.1528|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.55786|.	-0.8086|.	3|.	.|.	.|.	.|.	-1.3105|-1.3105	9.2161|9.2161	0.37348|0.37348	0.3821:0.552:0.0:0.0659|0.3821:0.552:0.0:0.0659	.|.	.|.	.|.	.|.	L|X	41|139;105;139;105;105;34;105	.|.	.|.	P|R	+|+	2|1	0|2	BCO2|BCO2	111569528|111569528	1.000000|1.000000	0.71417|0.71417	0.221000|0.221000	0.23827|0.23827	0.920000|0.920000	0.55202|0.55202	3.559000|3.559000	0.53756|0.53756	-0.001000|-0.001000	0.14495|0.14495	-0.181000|-0.181000	0.13052|0.13052	CCG|CGA	BCO2	-	pfam_Carotenoid_Oase	ENSG00000197580		0.468	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCO2	HGNC	protein_coding	OTTHUMT00000256570.3	50	0.00	0	C	NM_001037290		112064318	112064318	+1	no_errors	ENST00000357685	ensembl	human	known	69_37n	nonsense	35	44.62	29	SNP	1.000	T
C20orf195	79025	genome.wustl.edu	37	20	62187465	62187465	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr20:62187465G>A	ENST00000370098.3	+	2	541	c.449G>A	c.(448-450)cGg>cAg	p.R150Q	C20orf195_ENST00000370097.1_Missense_Mutation_p.R150Q	NM_024059.2	NP_076964.1	Q9BVV2	CT195_HUMAN	chromosome 20 open reading frame 195	150						extracellular vesicular exosome (GO:0070062)				large_intestine(3)|lung(4)	7	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			CCAGACCCACGGCCCTTCCTG	0.682																																						dbGAP											0													32.0	34.0	33.0					20																	62187465		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS13526.1	20q13.33	2014-02-12			ENSG00000125531	ENSG00000125531			28764	protein-coding gene	gene with protein product						12477932	Standard	NM_024059		Approved	MGC5356	uc002yfj.3	Q9BVV2	OTTHUMG00000032980	ENST00000370098.3:c.449G>A	20.37:g.62187465G>A	ENSP00000359116:p.Arg150Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.R150Q	ENST00000370098.3	37	c.449	CCDS13526.1	20	.	.	.	.	.	.	.	.	.	.	G	12.22	1.873617	0.33069	.	.	ENSG00000125531	ENST00000370098;ENST00000370097	.	.	.	5.47	0.888	0.19206	.	0.627314	0.14128	N	0.339561	T	0.26629	0.0651	L	0.29908	0.895	0.19300	N	0.999978	B	0.16396	0.017	B	0.10450	0.005	T	0.16482	-1.0401	9	0.40728	T	0.16	-38.7797	5.7819	0.18312	0.3201:0.0:0.5014:0.1785	.	150	Q9BVV2	CT195_HUMAN	Q	150	.	ENSP00000359115:R150Q	R	+	2	0	C20orf195	61657909	0.004000	0.15560	0.785000	0.31869	0.418000	0.31294	-0.066000	0.11598	0.284000	0.22305	0.655000	0.94253	CGG	C20orf195	-	NULL	ENSG00000125531		0.682	C20orf195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf195	HGNC	protein_coding	OTTHUMT00000080155.1	14	0.00	0	G	NM_024059		62187465	62187465	+1	no_errors	ENST00000370097	ensembl	human	known	69_37n	missense	7	53.33	8	SNP	0.122	A
CCDC141	285025	genome.wustl.edu	37	2	179742731	179742731	+	Missense_Mutation	SNP	G	G	A	rs550596462		TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr2:179742731G>A	ENST00000409284.1	-	12	1976	c.1859C>T	c.(1858-1860)aCa>aTa	p.T620I	CCDC141_ENST00000295723.5_Missense_Mutation_p.T45I|CCDC141_ENST00000420890.2_Missense_Mutation_p.T620I			Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	620										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TAGATCTTGTGTTATAAAACT	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		12302	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													94.0	99.0	97.0					2																	179742731		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000409284.1:c.1859C>T	2.37:g.179742731G>A	ENSP00000386503:p.Thr620Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.T620I	ENST00000409284.1	37	c.1859		2	.	.	.	.	.	.	.	.	.	.	G	9.092	1.001855	0.19121	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723;ENST00000443758;ENST00000446116;ENST00000409284	T;T;T;T	0.42131	0.98;1.54;1.53;1.61	5.32	3.51	0.40186	.	0.556484	0.15835	N	0.242320	T	0.31104	0.0786	L	0.32530	0.975	0.20638	N	0.99988	B;P	0.36535	0.008;0.557	B;B	0.39258	0.01;0.295	T	0.11817	-1.0572	10	0.17369	T	0.5	-0.4213	9.0625	0.36442	0.174:0.0:0.826:0.0	.	620;45	B8ZZB3;Q6ZP82	.;CC141_HUMAN	I	620;64;45;620;555;620	ENSP00000395995:T620I;ENSP00000344627:T64I;ENSP00000295723:T45I;ENSP00000390190:T620I	ENSP00000295723:T45I	T	-	2	0	CCDC141	179450976	0.996000	0.38824	0.600000	0.28864	0.453000	0.32348	2.934000	0.48956	0.612000	0.30071	0.585000	0.79938	ACA	CCDC141	-	NULL	ENSG00000163492		0.388	CCDC141-003	PUTATIVE	basic	protein_coding	CCDC141	HGNC	protein_coding	OTTHUMT00000335873.1	51	0.00	0	G	NM_173648		179742731	179742731	-1	no_errors	ENST00000420890	ensembl	human	known	69_37n	missense	24	38.46	15	SNP	0.567	A
CDK13	8621	genome.wustl.edu	37	7	40027851	40027851	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr7:40027851C>T	ENST00000181839.4	+	2	2470	c.1865C>T	c.(1864-1866)gCt>gTt	p.A622V	CDK13_ENST00000340829.5_Missense_Mutation_p.A622V|CDK13_ENST00000484589.1_3'UTR	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	622					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						GATAAAGAAGCTGATAGGTAA	0.428																																						dbGAP											0													64.0	57.0	59.0					7																	40027851		2203	4300	6503	-	-	-	SO:0001583	missense	0			M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.1865C>T	7.37:g.40027851C>T	ENSP00000181839:p.Ala622Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A622V	ENST00000181839.4	37	c.1865	CCDS5461.1	7	.	.	.	.	.	.	.	.	.	.	C	13.71	2.317712	0.40996	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.68765	-0.33;-0.35	6.02	6.02	0.97574	.	.	.	.	.	T	0.59445	0.2194	L	0.36672	1.1	0.29741	N	0.83712	B;B;B	0.22414	0.018;0.069;0.041	B;B;B	0.24701	0.011;0.055;0.025	T	0.52533	-0.8563	8	.	.	.	-2.3327	15.9556	0.79886	0.0:0.866:0.134:0.0	.	8;622;622	Q9BVE2;Q14004-2;Q14004	.;.;CDK13_HUMAN	V	622	ENSP00000181839:A622V;ENSP00000340557:A622V	.	A	+	2	0	CDK13	39994376	0.325000	0.24660	1.000000	0.80357	0.974000	0.67602	2.258000	0.43249	2.857000	0.98124	0.650000	0.86243	GCT	CDK13	-	NULL	ENSG00000065883		0.428	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK13	HGNC	protein_coding	OTTHUMT00000250726.2	10	0.00	0	C	NM_003718		40027851	40027851	+1	no_errors	ENST00000181839	ensembl	human	known	69_37n	missense	11	50.00	11	SNP	0.998	T
CLEC18B	497190	genome.wustl.edu	37	16	74446108	74446108	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr16:74446108C>T	ENST00000339953.5	-	7	942	c.821G>A	c.(820-822)cGg>cAg	p.R274Q		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	274						extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						CTCCTCCTCCCGGAACCGGCC	0.692																																						dbGAP											0													1.0	2.0	2.0					16																	74446108		1134	2669	3803	-	-	-	SO:0001583	missense	0			AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.821G>A	16.37:g.74446108C>T	ENSP00000341051:p.Arg274Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF90	Missense_Mutation	SNP	pfam_CAP_domain,pfam_C-type_lectin,superfamily_CAP_domain,superfamily_C-type_lectin_fold,smart_Allrgn_V5/Tpx1,smart_EGF-like,smart_C-type_lectin,pfscan_EG-like_dom,pfscan_C-type_lectin,prints_Allrgn_V5/Tpx1	p.R274Q	ENST00000339953.5	37	c.821	CCDS32484.1	16	.	.	.	.	.	.	.	.	.	.	-	11.92	1.783679	0.31593	.	.	ENSG00000140839	ENST00000429489;ENST00000339953;ENST00000268492;ENST00000425714	T	0.21543	2.0	3.28	1.21	0.21127	.	0.233240	0.34411	N	0.003998	T	0.10594	0.0259	L	0.36672	1.1	0.29178	N	0.876696	P;P;P	0.45715	0.865;0.47;0.612	B;B;B	0.31390	0.129;0.024;0.113	T	0.18713	-1.0328	10	0.46703	T	0.11	.	5.4009	0.16295	0.0:0.7163:0.0:0.2837	.	222;274;274	Q6UXF7-2;C9JSV1;Q6UXF7	.;.;CL18B_HUMAN	Q	274;274;274;222	ENSP00000341051:R274Q	ENSP00000268492:R274Q	R	-	2	0	CLEC18B	73003609	1.000000	0.71417	0.887000	0.34795	0.545000	0.35147	0.905000	0.28504	0.106000	0.17784	0.425000	0.28330	CGG	CLEC18B	-	smart_EGF-like	ENSG00000140839		0.692	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC18B	HGNC	protein_coding	OTTHUMT00000434697.1	25	0.00	0	C	NM_001011880		74446108	74446108	-1	no_errors	ENST00000339953	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	0.994	T
CRNKL1	51340	genome.wustl.edu	37	20	20036596	20036596	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr20:20036596T>A	ENST00000377340.2	-	1	94	c.63A>T	c.(61-63)aaA>aaT	p.K21N	C20orf26_ENST00000245957.5_Intron|C20orf26_ENST00000389656.3_Intron|C20orf26_ENST00000451767.2_5'Flank|CRNKL1_ENST00000377327.4_Missense_Mutation_p.K21N|C20orf26_ENST00000377309.2_Intron|C20orf26_ENST00000377306.1_Intron	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	21					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						ACCTACTGTTTTTGTCAAcag	0.428																																						dbGAP											0													157.0	145.0	149.0					20																	20036596		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.63A>T	20.37:g.20036596T>A	ENSP00000366557:p.Lys21Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Missense_Mutation	SNP	pfam_HAT,pfam_Suf,smart_HAT,pfscan_TPR-contain_dom	p.K21N	ENST00000377340.2	37	c.63	CCDS33446.1	20	.	.	.	.	.	.	.	.	.	.	T	9.455	1.091624	0.20471	.	.	ENSG00000101343	ENST00000377327;ENST00000377340	T;T	0.33865	1.39;1.39	2.91	-1.24	0.09435	.	2.717440	0.01628	N	0.023367	T	0.19087	0.0458	N	0.08118	0	0.09310	N	1	B;B	0.23058	0.079;0.002	B;B	0.17098	0.017;0.0	T	0.20605	-1.0270	10	0.62326	D	0.03	1.012	3.0933	0.06301	0.0:0.2924:0.2482:0.4594	.	21;21	Q5JY65;Q9BZJ0	.;CRNL1_HUMAN	N	21	ENSP00000366544:K21N;ENSP00000366557:K21N	ENSP00000366544:K21N	K	-	3	2	CRNKL1	19984596	0.025000	0.19082	0.004000	0.12327	0.010000	0.07245	-1.116000	0.03286	-0.199000	0.10317	0.482000	0.46254	AAA	CRNKL1	-	NULL	ENSG00000101343		0.428	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	CRNKL1	HGNC	protein_coding	OTTHUMT00000127787.1	56	0.00	0	T			20036596	20036596	-1	no_errors	ENST00000377340	ensembl	human	known	69_37n	missense	24	45.45	20	SNP	0.006	A
COMMD7	149951	genome.wustl.edu	37	20	31315779	31315779	+	Silent	SNP	G	G	A			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr20:31315779G>A	ENST00000278980.6	-	3	767	c.162C>T	c.(160-162)ctC>ctT	p.L54L	COMMD7_ENST00000446419.2_Silent_p.L53L	NM_001099339.1|NM_053041.2	NP_001092809.1|NP_444269.2	Q86VX2	COMD7_HUMAN	COMM domain containing 7	54					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular vesicular exosome (GO:0070062)	NF-kappaB binding (GO:0051059)			breast(1)|endometrium(1)|lung(3)	5						CAAATTCAGAGAGCTGAGCCA	0.507																																						dbGAP											0													104.0	99.0	100.0					20																	31315779		1893	4126	6019	-	-	-	SO:0001819	synonymous_variant	0			AY542162	CCDS42864.1, CCDS46587.1	20q11	2004-03-02	2004-02-13	2004-02-18	ENSG00000149600	ENSG00000149600			16223	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 92"""	C20orf92		15799966	Standard	NM_001099339		Approved	dJ1085F17.3	uc002wya.4	Q86VX2	OTTHUMG00000032229	ENST00000278980.6:c.162C>T	20.37:g.31315779G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2BHJ2|B3KTZ2|Q5JYB0|Q96SI7|Q9BW53	Silent	SNP	pfam_HCaRG	p.L54	ENST00000278980.6	37	c.162	CCDS42864.1	20																																																																																			COMMD7	-	pfam_HCaRG	ENSG00000149600		0.507	COMMD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COMMD7	HGNC	protein_coding	OTTHUMT00000078648.2	64	0.00	0	G	NM_053041		31315779	31315779	-1	no_errors	ENST00000278980	ensembl	human	known	69_37n	silent	38	28.30	15	SNP	0.975	A
DUSP16	80824	genome.wustl.edu	37	12	12630318	12630318	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr12:12630318G>A	ENST00000228862.2	-	7	2078	c.1447C>T	c.(1447-1449)Cga>Tga	p.R483*	DUSP16_ENST00000545864.1_5'Flank|DUSP16_ENST00000298573.4_3'UTR	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	483					dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R483*(2)		endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		GAATGCAATCGCTTGCTCTGG	0.572																																					Ovarian(158;443 1896 15437 36069 46477)	dbGAP											2	Substitution - Nonsense(2)	large_intestine(1)|endometrium(1)											105.0	102.0	103.0					12																	12630318		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.1447C>T	12.37:g.12630318G>A	ENSP00000228862:p.Arg483*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q547C7|Q96QS2|Q9C0G3	Nonsense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.R483*	ENST00000228862.2	37	c.1447	CCDS8650.1	12	.	.	.	.	.	.	.	.	.	.	G	38	6.899472	0.97920	.	.	ENSG00000111266	ENST00000228862	.	.	.	5.27	2.23	0.28157	.	0.314503	0.22770	N	0.055846	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.796	0.29148	0.1387:0.0:0.6144:0.2469	.	.	.	.	X	483	.	ENSP00000228862:R483X	R	-	1	2	DUSP16	12521585	0.540000	0.26410	0.012000	0.15200	0.306000	0.27790	1.234000	0.32660	0.792000	0.33850	0.655000	0.94253	CGA	DUSP16	-	NULL	ENSG00000111266		0.572	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP16	HGNC	protein_coding	OTTHUMT00000400311.1	35	0.00	0	G	NM_030640		12630318	12630318	-1	no_errors	ENST00000228862	ensembl	human	known	69_37n	nonsense	27	12.90	4	SNP	0.000	A
HMMR	3161	genome.wustl.edu	37	5	162891728	162891728	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr5:162891728G>A	ENST00000358715.3	+	3	181		c.e3-1		HMMR_ENST00000393915.4_Splice_Site|HMMR_ENST00000432118.2_Intron|HMMR_ENST00000353866.3_Splice_Site			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)						carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)			cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	TTTTTCCGCAGAATCTAAACA	0.333																																						dbGAP											0													111.0	109.0	110.0					5																	162891728		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.146-1G>A	5.37:g.162891728G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Splice_Site	SNP	-	e3-1	ENST00000358715.3	37	c.146-1	CCDS4362.1	5	.	.	.	.	.	.	.	.	.	.	G	8.913	0.959143	0.18507	.	.	ENSG00000072571	ENST00000353866;ENST00000434157;ENST00000393915;ENST00000426586;ENST00000358715	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8992	0.63792	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HMMR	162824306	1.000000	0.71417	0.992000	0.48379	0.023000	0.10783	4.198000	0.58419	2.432000	0.82394	0.563000	0.77884	.	HMMR	-	-	ENSG00000072571		0.333	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HMMR	HGNC	protein_coding	OTTHUMT00000252752.1	73	0.00	0	G	NM_012484	Intron	162891728	162891728	+1	no_errors	ENST00000393915	ensembl	human	known	69_37n	splice_site	28	39.13	18	SNP	0.992	A
LOXHD1	125336	genome.wustl.edu	37	18	44057735	44057735	+	Silent	SNP	G	G	A			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr18:44057735G>A	ENST00000398722.4	-	34	5687	c.5688C>T	c.(5686-5688)gtC>gtT	p.V1896V	LOXHD1_ENST00000582408.1_Silent_p.V1001V|LOXHD1_ENST00000300591.6_Silent_p.V1063V|LOXHD1_ENST00000398705.2_Silent_p.V413V|LOXHD1_ENST00000536736.1_Silent_p.V2112V|LOXHD1_ENST00000441551.2_Silent_p.V1968V|LOXHD1_ENST00000579038.1_Silent_p.V967V|LOXHD1_ENST00000441893.2_Silent_p.V1045V|LOXHD1_ENST00000398686.4_Silent_p.V413V			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1896	PLAT 14. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TGGTCACGAAGACGTTGGCAT	0.587																																						dbGAP											0													116.0	110.0	112.0					18																	44057735		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.5688C>T	18.37:g.44057735G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	p.V2112	ENST00000398722.4	37	c.6336		18																																																																																			LOXHD1	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	ENSG00000167210		0.587	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		28	0.00	0	G	NM_144612		44057735	44057735	-1	no_errors	ENST00000536736	ensembl	human	known	69_37n	silent	19	38.71	12	SNP	1.000	A
MRPS30	10884	genome.wustl.edu	37	5	44813385	44813385	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr5:44813385G>A	ENST00000507110.1	+	4	1068		c.e4+1			NM_016640.3	NP_057724.2	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30						apoptotic process (GO:0006915)|translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(11)|prostate(1)	20	Lung NSC(6;8.08e-07)					ATGTATCAAGGTAAAAATTAA	0.303																																						dbGAP											0													40.0	41.0	40.0					5																	44813385		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF146192	CCDS3951.1	5q11	2012-09-13		2001-11-09	ENSG00000112996	ENSG00000112996		"""Mitochondrial ribosomal proteins / small subunits"""	8769	protein-coding gene	gene with protein product		611991		PDCD9		10640817, 11279123	Standard	NM_016640		Approved	PAP	uc003joh.3	Q9NP92	OTTHUMG00000096967	ENST00000507110.1:c.1030+1G>A	5.37:g.44813385G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96I91|Q96Q19|Q9H0P8|Q9NSF9|Q9NZ76	Splice_Site	SNP	-	e4+1	ENST00000507110.1	37	c.1030+1	CCDS3951.1	5	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338058	0.81911	.	.	ENSG00000112996	ENST00000507110	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3668	0.98882	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MRPS30	44849142	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.492000	0.97957	2.894000	0.99253	0.655000	0.94253	.	MRPS30	-	-	ENSG00000112996		0.303	MRPS30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS30	HGNC	protein_coding	OTTHUMT00000214033.2	23	0.00	0	G	NM_016640	Intron	44813385	44813385	+1	no_errors	ENST00000507110	ensembl	human	known	69_37n	splice_site	11	59.26	16	SNP	1.000	A
MST1L	11223	genome.wustl.edu	37	1	17083776	17083776	+	RNA	SNP	C	C	A	rs56318124	byFrequency	TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr1:17083776C>A	ENST00000455405.2	-	0	812							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.R674L(1)									CACAGAGACACGCGTGAAGAC	0.537																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)																																								-	-	-			0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17083776C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPB1|Q13209	Missense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.R674L	ENST00000455405.2	37	c.2021		1	.	.	.	.	.	.	.	.	.	.	.	14.57	2.575742	0.45902	.	.	ENSG00000186715	ENST00000334998;ENST00000442552	.	.	.	.	.	.	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.42172	D	0.000756	T	0.66197	0.2765	.	.	.	.	.	.	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.72117	-0.4387	6	0.87932	D	0	.	6.7402	0.23431	0.0:0.9998:0.0:2.0E-4	rs56318124	674;700	Q2TV78-2;Q2TV78	.;MSTP9_HUMAN	L	674;700	.	ENSP00000439273:R674L	R	-	2	0	MST1P9	16956363	1.000000	0.71417	0.897000	0.35233	0.000000	0.00434	4.748000	0.62148	0.502000	0.28037	0.000000	0.15137	CGT	MST1P9	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000186715		0.537	MST1L-002	KNOWN	basic	processed_transcript	MST1P9	HGNC	pseudogene	OTTHUMT00000400328.1	17	0.00	0	C	NM_001271733		17083776	17083776	-1	no_errors	ENST00000334998	ensembl	human	known	69_37n	missense	11	35.29	6	SNP	1.000	A
MUC16	94025	genome.wustl.edu	37	19	9066614	9066614	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr19:9066614C>A	ENST00000397910.4	-	3	21035	c.20832G>T	c.(20830-20832)gaG>gaT	p.E6944D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6946	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AATATGTTGACTCTCTCTTAA	0.458																																						dbGAP											0													201.0	190.0	194.0					19																	9066614		1941	4151	6092	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.20832G>T	19.37:g.9066614C>A	ENSP00000381008:p.Glu6944Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.E6944D	ENST00000397910.4	37	c.20832	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	5.753	0.323379	0.10900	.	.	ENSG00000181143	ENST00000397910	T	0.02606	4.23	2.77	-0.85	0.10720	.	.	.	.	.	T	0.02494	0.0076	L	0.37630	1.12	.	.	.	B	0.18968	0.032	B	0.16289	0.015	T	0.40194	-0.9576	8	0.87932	D	0	.	3.1699	0.06549	0.0:0.4923:0.2299:0.2779	.	6944	B5ME49	.	D	6944	ENSP00000381008:E6944D	ENSP00000381008:E6944D	E	-	3	2	MUC16	8927614	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.748000	0.01826	-0.082000	0.12640	0.407000	0.27541	GAG	MUC16	-	NULL	ENSG00000181143		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	59	0.00	0	C	NM_024690		9066614	9066614	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	46	33.33	23	SNP	0.000	A
MYO7B	4648	genome.wustl.edu	37	2	128389268	128389268	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr2:128389268C>T	ENST00000409816.2	+	36	5143	c.5111C>T	c.(5110-5112)cCg>cTg	p.P1704L	MYO7B_ENST00000389524.4_Missense_Mutation_p.P1705L|MYO7B_ENST00000428314.1_Missense_Mutation_p.P1704L|MYO7B_ENST00000409090.1_Missense_Mutation_p.P557L			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1704	MyTH4 2. {ECO:0000255|PROSITE- ProRule:PRU00359}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CTGCAGCACCCGGCCCTCCAG	0.672																																						dbGAP											0													39.0	47.0	44.0					2																	128389268		2165	4257	6422	-	-	-	SO:0001583	missense	0				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.5111C>T	2.37:g.128389268C>T	ENSP00000386461:p.Pro1704Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14786|Q8TEE1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.P1705L	ENST00000409816.2	37	c.5114	CCDS46405.1	2	.	.	.	.	.	.	.	.	.	.	c	9.652	1.141895	0.21205	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000272666;ENST00000409816;ENST00000409090	D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99	5.23	-2.03	0.07365	MyTH4 domain (3);	0.769160	0.11569	N	0.550995	D	0.87993	0.6318	M	0.66939	2.045	0.09310	N	1	B	0.27679	0.185	B	0.27887	0.084	T	0.77000	-0.2750	10	0.42905	T	0.14	.	5.4408	0.16507	0.533:0.2026:0.0:0.2644	.	1704	Q6PIF6	MYO7B_HUMAN	L	1705;1704;800;1704;557	ENSP00000374175:P1705L;ENSP00000415090:P1704L;ENSP00000386461:P1704L;ENSP00000386850:P557L	ENSP00000272666:P800L	P	+	2	0	MYO7B	128105738	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	1.132000	0.31418	-0.377000	0.07930	-0.261000	0.10672	CCG	MYO7B	-	pfam_MyTH4_dom,smart_MyTH4_dom,pfscan_MyTH4_dom	ENSG00000169994		0.672	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	16	0.00	0	C	XM_291001		128389268	128389268	+1	no_errors	ENST00000389524	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.000	T
OR4D6	219983	genome.wustl.edu	37	11	59225033	59225033	+	Silent	SNP	C	C	A			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr11:59225033C>A	ENST00000300127.2	+	1	623	c.600C>A	c.(598-600)atC>atA	p.I200I		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						TTTTCATGATCTCTAACAACG	0.547																																						dbGAP											0													192.0	160.0	170.0					11																	59225033		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.600C>A	11.37:g.59225033C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNP7|Q6IFF5|Q96R74	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I200	ENST00000300127.2	37	c.600	CCDS31562.1	11																																																																																			OR4D6	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000166884		0.547	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D6	HGNC	protein_coding	OTTHUMT00000394234.1	70	0.00	0	C	NM_001004708		59225033	59225033	+1	no_errors	ENST00000300127	ensembl	human	known	69_37n	silent	41	41.43	29	SNP	0.998	A
PCDH10	57575	genome.wustl.edu	37	4	134073305	134073305	+	Silent	SNP	C	C	T			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr4:134073305C>T	ENST00000264360.5	+	1	2836	c.2010C>T	c.(2008-2010)tcC>tcT	p.S670S		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	670	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CCCTTTCCTCCACCGCCACCC	0.726																																						dbGAP											0													17.0	21.0	20.0					4																	134073305		2199	4286	6485	-	-	-	SO:0001819	synonymous_variant	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2010C>T	4.37:g.134073305C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5F6|Q96SF0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S670	ENST00000264360.5	37	c.2010	CCDS34063.1	4																																																																																			PCDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000138650		0.726	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	8	0.00	0	C	NM_032961		134073305	134073305	+1	no_errors	ENST00000264360	ensembl	human	known	69_37n	silent	11	38.89	7	SNP	0.998	T
PDE1C	5137	genome.wustl.edu	37	7	31912927	31912927	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr7:31912927T>G	ENST00000396191.1	-	6	1042	c.587A>C	c.(586-588)tAt>tCt	p.Y196S	PDE1C_ENST00000396182.2_Missense_Mutation_p.Y196S|PDE1C_ENST00000396193.1_Missense_Mutation_p.Y256S|PDE1C_ENST00000396184.3_Missense_Mutation_p.Y196S|PDE1C_ENST00000321453.7_Missense_Mutation_p.Y196S	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	196					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	GATCAGATCATAACGTGTGAG	0.388																																						dbGAP											0													90.0	87.0	88.0					7																	31912927		2203	4300	6503	-	-	-	SO:0001583	missense	0			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.587A>C	7.37:g.31912927T>G	ENSP00000379494:p.Tyr196Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.Y196S	ENST00000396191.1	37	c.587	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	T	24.1	4.493675	0.84962	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07	5.14	5.14	0.70334	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.000000	0.85682	D	0.000000	T	0.81602	0.4857	M	0.77712	2.385	0.80722	D	1	P;P;B	0.37824	0.562;0.609;0.349	B;B;B	0.43251	0.413;0.325;0.099	D	0.83942	0.0312	10	0.66056	D	0.02	.	14.6161	0.68549	0.0:0.0:0.0:1.0	.	196;256;196	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	S	256;196;196;196;196	ENSP00000379496:Y256S;ENSP00000379494:Y196S;ENSP00000318105:Y196S;ENSP00000379487:Y196S;ENSP00000379485:Y196S	ENSP00000318105:Y196S	Y	-	2	0	PDE1C	31879452	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	8.007000	0.88571	1.921000	0.55644	0.383000	0.25322	TAT	PDE1C	-	NULL	ENSG00000154678		0.388	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000328458.1	30	0.00	0	T			31912927	31912927	-1	no_errors	ENST00000321453	ensembl	human	known	69_37n	missense	25	43.18	19	SNP	1.000	G
PER3	8863	genome.wustl.edu	37	1	7890055	7890055	+	Silent	SNP	T	T	A	rs11121034	byFrequency	TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr1:7890055T>A	ENST00000361923.2	+	18	3196	c.3021T>A	c.(3019-3021)gcT>gcA	p.A1007A	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Silent_p.A1016A	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	1007	5 X 18 AA tandem repeats of S-[HP]-[AP]- T-[AT]-[GST]-[ATV]-L-S-[MT]-G-[LS]-P-P- [MRS]-[EKR]-[NST]-P.|Ser-rich.		A -> T (in dbSNP:rs1776342).|Missing (associated with eveningness and better cognitive performance during sleep deprivation exepriments; dbSNP:rs57875989).		circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCCAGCGCTCTGTCCACAG	0.587																																						dbGAP											0													90.0	71.0	77.0					1																	7890055		1995	3900	5895	-	-	-	SO:0001819	synonymous_variant	0			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.3021T>A	1.37:g.7890055T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Silent	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.A1007	ENST00000361923.2	37	c.3021	CCDS89.1	1																																																																																			PER3	-	pfam_Period_circadian-like_C	ENSG00000049246		0.587	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PER3	HGNC	protein_coding	OTTHUMT00000003607.1	13	0.00	0	T	NM_016831		7890055	7890055	+1	no_errors	ENST00000361923	ensembl	human	known	69_37n	silent	25	23.53	8	SNP	0.063	A
PEX7	5191	genome.wustl.edu	37	6	137147511	137147511	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr6:137147511T>G	ENST00000318471.4	+	3	324	c.243T>G	c.(241-243)caT>caG	p.H81Q	PEX7_ENST00000541292.1_Missense_Mutation_p.H81Q|PEX7_ENST00000367756.4_Missense_Mutation_p.H81Q	NM_000288.3	NP_000279.1	O00628	PEX7_HUMAN	peroxisomal biogenesis factor 7	81					endochondral ossification (GO:0001958)|ether lipid biosynthetic process (GO:0008611)|fatty acid beta-oxidation (GO:0006635)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-2 binding (GO:0005053)|protein homodimerization activity (GO:0042803)			lung(7)|prostate(1)	8	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000257)|OV - Ovarian serous cystadenocarcinoma(155;0.00492)		ACAACGAACATGTCCTCATCA	0.453																																						dbGAP											0													184.0	160.0	168.0					6																	137147511		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF180814	CCDS5180.1	6q21-q22.2	2013-01-10			ENSG00000112357	ENSG00000112357		"""WD repeat domain containing"""	8860	protein-coding gene	gene with protein product	"""Refsum disease"""	601757				9090381, 10673331	Standard	NM_000288		Approved	PTS2R, RD	uc003qhd.3	O00628	OTTHUMG00000015650	ENST00000318471.4:c.243T>G	6.37:g.137147511T>G	ENSP00000315680:p.His81Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	C0H5X6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.H81Q	ENST00000318471.4	37	c.243	CCDS5180.1	6	.	.	.	.	.	.	.	.	.	.	T	17.99	3.523615	0.64747	.	.	ENSG00000112357	ENST00000367756;ENST00000541292;ENST00000318471	D;T;T	0.92495	-3.05;0.31;0.31	5.52	-1.09	0.09904	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.045098	0.85682	D	0.000000	D	0.87613	0.6221	L	0.45422	1.42	0.43218	D	0.995095	D	0.60575	0.988	P	0.55455	0.776	D	0.85130	0.0974	10	0.42905	T	0.14	-3.7675	11.3749	0.49722	0.0:0.5103:0.0:0.4897	.	81	O00628	PEX7_HUMAN	Q	81	ENSP00000356730:H81Q;ENSP00000441004:H81Q;ENSP00000315680:H81Q	ENSP00000315680:H81Q	H	+	3	2	PEX7	137189204	0.009000	0.17119	0.989000	0.46669	0.938000	0.57974	-1.233000	0.02934	-0.170000	0.10816	-0.261000	0.10672	CAT	PEX7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000112357		0.453	PEX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX7	HGNC	protein_coding	OTTHUMT00000042387.2	51	0.00	0	T	NM_000288		137147511	137147511	+1	no_errors	ENST00000318471	ensembl	human	known	69_37n	missense	41	22.64	12	SNP	0.995	G
POMT2	29954	genome.wustl.edu	37	14	77767530	77767530	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr14:77767530A>G	ENST00000261534.4	-	6	921	c.719T>C	c.(718-720)tTa>tCa	p.L240S	POMT2_ENST00000556880.1_5'Flank	NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	240						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		CTTGACCCCTAAAGCACCAGC	0.517											OREG0022837	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													111.0	100.0	104.0					14																	77767530		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.719T>C	14.37:g.77767530A>G	ENSP00000261534:p.Leu240Ser	Somatic	1178	WXS	Illumina GAIIx	Phase_IV	Q9NSG6|Q9P1W0|Q9P1W2	Missense_Mutation	SNP	pfam_Glyco_trans_39,pfam_MIR,superfamily_MIR,smart_MIR_motif,pfscan_MIR_motif	p.L240S	ENST00000261534.4	37	c.719	CCDS9857.1	14	.	.	.	.	.	.	.	.	.	.	A	19.21	3.783508	0.70222	.	.	ENSG00000009830	ENST00000261534	D	0.86769	-2.17	5.75	5.75	0.90469	Glycosyl transferase, family 39 (1);	0.170748	0.38111	N	0.001805	D	0.87442	0.6178	L	0.58669	1.825	0.53688	D	0.999976	B	0.26602	0.154	B	0.36186	0.219	D	0.84704	0.0730	10	0.39692	T	0.17	-1.0832	16.0509	0.80763	1.0:0.0:0.0:0.0	.	240	Q9UKY4	POMT2_HUMAN	S	240	ENSP00000261534:L240S	ENSP00000261534:L240S	L	-	2	0	POMT2	76837283	1.000000	0.71417	0.871000	0.34182	0.994000	0.84299	9.203000	0.95033	2.187000	0.69744	0.533000	0.62120	TTA	POMT2	-	pfam_Glyco_trans_39	ENSG00000009830		0.517	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMT2	HGNC	protein_coding	OTTHUMT00000414155.1	33	0.00	0	A	NM_013382		77767530	77767530	-1	no_errors	ENST00000261534	ensembl	human	known	69_37n	missense	17	41.38	12	SNP	0.787	G
SCN3A	6328	genome.wustl.edu	37	2	166012326	166012326	+	Missense_Mutation	SNP	G	G	C	rs147330828		TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr2:166012326G>C	ENST00000360093.3	-	10	1610	c.1119C>G	c.(1117-1119)ttC>ttG	p.F373L	SCN3A_ENST00000409101.3_Missense_Mutation_p.F373L|SCN3A_ENST00000283254.7_Missense_Mutation_p.F373L	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	373					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.F373F(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATAGAGACAGGAAAGCCCAGC	0.423																																						dbGAP											1	Substitution - coding silent(1)	skin(1)											116.0	111.0	113.0					2																	166012326		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1119C>G	2.37:g.166012326G>C	ENSP00000353206:p.Phe373Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.F373L	ENST00000360093.3	37	c.1119		2	.	.	.	.	.	.	.	.	.	.	G	19.05	3.752274	0.69533	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.98493	-4.96;-4.96;-4.96;-4.96	5.41	1.54	0.23209	Ion transport (1);	0.000000	0.64402	D	0.000006	D	0.97548	0.9197	L	0.36672	1.1	0.80722	D	1	D;B;P;P;D	0.57257	0.979;0.203;0.871;0.571;0.974	D;P;P;P;D	0.74023	0.982;0.77;0.794;0.736;0.969	D	0.95785	0.8820	10	0.56958	D	0.05	.	9.6296	0.39772	0.4483:0.0:0.5517:0.0	.	373;373;373;373;373	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	L	373	ENSP00000353206:F373L;ENSP00000283254:F373L;ENSP00000386726:F373L;ENSP00000403348:F373L	ENSP00000283254:F373L	F	-	3	2	SCN3A	165720572	0.988000	0.35896	0.988000	0.46212	0.995000	0.86356	0.217000	0.17603	0.004000	0.14682	0.585000	0.79938	TTC	SCN3A	-	pfam_Ion_trans_dom	ENSG00000153253		0.423	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		45	0.00	0	G	NM_006922		166012326	166012326	-1	no_errors	ENST00000283254	ensembl	human	known	69_37n	missense	65	13.33	10	SNP	0.987	C
SI	6476	genome.wustl.edu	37	3	164755728	164755728	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr3:164755728T>C	ENST00000264382.3	-	21	2448	c.2386A>G	c.(2386-2388)Atc>Gtc	p.I796V		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	796	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ATGGGGATGATATAACCTCCT	0.323										HNSCC(35;0.089)																												dbGAP											0													102.0	96.0	98.0					3																	164755728		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.2386A>G	3.37:g.164755728T>C	ENSP00000264382:p.Ile796Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.I796V	ENST00000264382.3	37	c.2386	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	T	14.86	2.660568	0.47572	.	.	ENSG00000090402	ENST00000264382	D	0.93307	-3.2	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.92221	0.7533	L	0.60957	1.885	0.47407	D	0.999418	B	0.22683	0.073	B	0.34452	0.183	D	0.89732	0.3927	10	0.41790	T	0.15	.	12.6055	0.56521	0.0:0.0:0.0:1.0	.	796	P14410	SUIS_HUMAN	V	796	ENSP00000264382:I796V	ENSP00000264382:I796V	I	-	1	0	SI	166238422	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.067000	0.50010	2.169000	0.68431	0.528000	0.53228	ATC	SI	-	pfam_Glyco_hydro_31	ENSG00000090402		0.323	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	71	0.00	0	T	NM_001041		164755728	164755728	-1	no_errors	ENST00000264382	ensembl	human	known	69_37n	missense	28	54.10	33	SNP	1.000	C
SP4	6671	genome.wustl.edu	37	7	21516732	21516732	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr7:21516732C>A	ENST00000222584.3	+	4	1932	c.1714C>A	c.(1714-1716)Caa>Aaa	p.Q572K		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	572					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						AAAAGTCCAGCAAGCTACTAT	0.393																																						dbGAP											0													77.0	70.0	73.0					7																	21516732		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.1714C>A	7.37:g.21516732C>A	ENSP00000222584:p.Gln572Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O60402|Q32M52	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q572K	ENST00000222584.3	37	c.1714	CCDS5373.1	7	.	.	.	.	.	.	.	.	.	.	C	16.04	3.009916	0.54361	.	.	ENSG00000105866	ENST00000222584;ENST00000432066	T	0.08807	3.05	6.17	6.17	0.99709	.	0.124501	0.56097	D	0.000030	T	0.17916	0.0430	L	0.43923	1.385	0.50171	D	0.999852	P	0.40332	0.713	P	0.51742	0.678	T	0.02161	-1.1203	10	0.15499	T	0.54	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	572	Q02446	SP4_HUMAN	K	572;15	ENSP00000222584:Q572K	ENSP00000222584:Q572K	Q	+	1	0	SP4	21483257	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.913000	0.48790	2.941000	0.99782	0.655000	0.94253	CAA	SP4	-	NULL	ENSG00000105866		0.393	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP4	HGNC	protein_coding	OTTHUMT00000211617.2	27	0.00	0	C	NM_003112		21516732	21516732	+1	no_errors	ENST00000222584	ensembl	human	known	69_37n	missense	13	56.67	17	SNP	1.000	A
TAF1	6872	genome.wustl.edu	37	X	70627446	70627446	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chrX:70627446G>A	ENST00000373790.4	+	27	4178	c.4127G>A	c.(4126-4128)cGg>cAg	p.R1376Q	TAF1_ENST00000276072.3_Missense_Mutation_p.R1397Q|TAF1_ENST00000449580.1_Missense_Mutation_p.R1376Q|TAF1_ENST00000423759.1_Missense_Mutation_p.R1397Q	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1376	Interaction with ASF1A and ASF1B.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				TCCATCCACCGGCGCCGCACA	0.458																																						dbGAP											0													102.0	92.0	95.0					X																	70627446		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.4127G>A	X.37:g.70627446G>A	ENSP00000362895:p.Arg1376Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R1376Q	ENST00000373790.4	37	c.4127	CCDS35325.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	27.0|27.0	4.794649|4.794649	0.90453|0.90453	.|.	.|.	ENSG00000147133|ENSG00000147133	ENST00000463163;ENST00000437147|ENST00000373790;ENST00000449580;ENST00000423759;ENST00000395779;ENST00000538124;ENST00000276072	.|T;T;T;T	.|0.19938	.|2.11;2.11;2.11;2.11	4.95|4.95	4.08|4.08	0.47627|0.47627	.|Bromodomain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.45518|0.45518	0.1346|0.1346	M|M	0.73598|0.73598	2.24|2.24	0.80722|0.80722	D|D	1|1	.|P;D;P	.|0.76494	.|0.837;0.999;0.955	.|P;D;B	.|0.71414	.|0.465;0.973;0.22	T|T	0.49826|0.49826	-0.8898|-0.8898	5|10	.|0.87932	.|D	.|0	.|.	14.0972|14.0972	0.65029|0.65029	0.0:0.0:0.8489:0.1511|0.0:0.0:0.8489:0.1511	.|.	.|1376;1376;1397	.|P21675-4;P21675;P21675-2	.|.;TAF1_HUMAN;.	S|Q	42;31|1376;1376;1397;82;82;1397	.|ENSP00000362895:R1376Q;ENSP00000389000:R1376Q;ENSP00000406549:R1397Q;ENSP00000276072:R1397Q	.|ENSP00000276072:R1397Q	G|R	+|+	1|2	0|0	TAF1|TAF1	70544171|70544171	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.841000|0.841000	0.47740|0.47740	7.433000|7.433000	0.80362|0.80362	1.085000|1.085000	0.41206|0.41206	0.462000|0.462000	0.41574|0.41574	GGC|CGG	TAF1	-	pirsf_TAF1_animal,superfamily_Bromodomain	ENSG00000147133		0.458	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	HGNC	protein_coding	OTTHUMT00000058995.2	42	0.00	0	G	NM_004606		70627446	70627446	+1	no_errors	ENST00000449580	ensembl	human	known	69_37n	missense	35	27.08	13	SNP	1.000	A
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000230354.6_Silent_p.Q76Q|TBP_ENST00000540980.1_Silent_p.Q56Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																						dbGAP											4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	8	0.00	0	G	NM_003194		170871052	170871052	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	25	16.67	5	SNP	0.994	A
TLK2	11011	genome.wustl.edu	37	17	60678053	60678053	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr17:60678053A>G	ENST00000326270.9	+	19	1926	c.1658A>G	c.(1657-1659)gAc>gGc	p.D553G	TLK2_ENST00000346027.5_Missense_Mutation_p.D531G|TLK2_ENST00000343388.7_Missense_Mutation_p.D499G|TLK2_ENST00000542523.1_Missense_Mutation_p.D499G|TLK2_ENST00000582809.1_Missense_Mutation_p.D382G	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	553	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						AATGATCTGGACTTCTACCTG	0.353																																						dbGAP											0													80.0	74.0	76.0					17																	60678053		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.1658A>G	17.37:g.60678053A>G	ENSP00000316512:p.Asp553Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D553G	ENST00000326270.9	37	c.1658		17	.	.	.	.	.	.	.	.	.	.	A	14.58	2.577437	0.45902	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	5.3	5.3	0.74995	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.68007	0.2954	L	0.36672	1.1	0.80722	D	1	P;D;B;B	0.57257	0.873;0.979;0.36;0.27	P;P;B;P	0.59357	0.685;0.856;0.287;0.493	T	0.71800	-0.4483	10	0.87932	D	0	.	14.7139	0.69254	1.0:0.0:0.0:0.0	.	553;499;531;531	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	G	531;499;553;499	ENSP00000275780:D531G;ENSP00000340800:D499G;ENSP00000316512:D553G;ENSP00000442311:D499G	ENSP00000316512:D553G	D	+	2	0	TLK2	58031785	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.287000	0.95975	2.129000	0.65627	0.383000	0.25322	GAC	TLK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000146872		0.353	TLK2-004	KNOWN	basic	protein_coding	TLK2	HGNC	protein_coding	OTTHUMT00000445140.1	63	0.00	0	A	NM_006852		60678053	60678053	+1	no_errors	ENST00000326270	ensembl	human	known	69_37n	missense	38	39.68	25	SNP	1.000	G
TOR3A	64222	genome.wustl.edu	37	1	179063271	179063271	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XC-01A-11D-A14G-09	TCGA-D8-A1XC-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	68fd3045-073d-4242-8a41-41b707fca625	fea77f35-8b5b-404e-a9e1-5b2d3d02fd4c	g.chr1:179063271C>T	ENST00000367627.3	+	5	1614	c.862C>T	c.(862-864)Ctc>Ttc	p.L288F	TOR3A_ENST00000352445.6_Missense_Mutation_p.L288F	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	288					ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						CCTAAAGTTGCTCAAGGCTGG	0.448																																						dbGAP											0													99.0	99.0	99.0					1																	179063271		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.862C>T	1.37:g.179063271C>T	ENSP00000356599:p.Leu288Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	pfam_Torsin	p.L288F	ENST00000367627.3	37	c.862	CCDS1329.1	1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802927	0.90623	.	.	ENSG00000186283	ENST00000367627;ENST00000352445	T;T	0.31510	1.49;1.49	5.55	5.55	0.83447	.	0.063246	0.64402	D	0.000003	T	0.47655	0.1457	M	0.78916	2.43	0.38074	D	0.93645	D	0.63880	0.993	P	0.56216	0.794	T	0.55412	-0.8145	10	0.56958	D	0.05	-15.5521	9.856	0.41086	0.0:0.9031:0.0:0.0969	.	288	Q9H497	TOR3A_HUMAN	F	288	ENSP00000356599:L288F;ENSP00000335351:L288F	ENSP00000335351:L288F	L	+	1	0	TOR3A	177329894	1.000000	0.71417	0.835000	0.33067	0.948000	0.59901	5.426000	0.66476	2.607000	0.88179	0.561000	0.74099	CTC	TOR3A	-	NULL	ENSG00000186283		0.448	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOR3A	HGNC	protein_coding	OTTHUMT00000084927.1	45	0.00	0	C	NM_022371		179063271	179063271	+1	no_errors	ENST00000367627	ensembl	human	known	69_37n	missense	43	27.12	16	SNP	1.000	T
