#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AARS2	57505	genome.wustl.edu	37	6	44274104	44274104	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr6:44274104C>T	ENST00000244571.4	-	9	1215	c.1213G>A	c.(1213-1215)Gag>Aag	p.E405K	TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AAGGCTGCCTCGTCCTCTGAC	0.587																																						dbGAP											0													119.0	111.0	114.0					6																	44274104		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.1213G>A	6.37:g.44274104C>T	ENSP00000244571:p.Glu405Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ala-tRNA-synth_IIc_N,pfam_tRNA_SAD,superfamily_Ala-tRNA-synth_IIc_anticod-bd,superfamily_Thr/Ala-tRNA-synth_IIc_edit,smart_tRNA_SAD,prints_Ala-tRNA-synth_IIc,pfscan_Ala-tRNA-synth_IIc_core,tigrfam_Ala-tRNA-synth_IIc	p.E405K	ENST00000244571.4	37	c.1213	CCDS34464.1	6	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025046	0.75390	.	.	ENSG00000124608	ENST00000244571	T	0.74947	-0.89	4.41	4.41	0.53225	Alanyl-tRNA synthetase, class IIc, anti-codon-binding domain (1);Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90954	0.7156	H	0.98525	4.255	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94546	0.7749	10	0.87932	D	0	-27.224	17.1894	0.86875	0.0:1.0:0.0:0.0	.	405	Q5JTZ9	SYAM_HUMAN	K	405	ENSP00000244571:E405K	ENSP00000244571:E405K	E	-	1	0	AARS2	44382082	1.000000	0.71417	0.828000	0.32881	0.035000	0.12851	7.026000	0.76455	2.301000	0.77427	0.655000	0.94253	GAG	AARS2	-	pfam_Ala-tRNA-synth_IIc_N,superfamily_Ala-tRNA-synth_IIc_anticod-bd,pfscan_Ala-tRNA-synth_IIc_core,tigrfam_Ala-tRNA-synth_IIc	ENSG00000124608		0.587	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AARS2	HGNC	protein_coding	OTTHUMT00000040741.2	67	0.00	0	C	NM_020745		44274104	44274104	-1	no_errors	ENST00000244571	ensembl	human	known	69_37n	missense	63	11.27	8	SNP	1.000	T
ACSS2	55902	genome.wustl.edu	37	20	33501263	33501264	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr20:33501263_33501264GG>CT	ENST00000360596.2	+	4	745_746	c.534_535GG>CT	c.(532-537)ctGGca>ctCTca	p.A179S	ACSS2_ENST00000253382.5_Missense_Mutation_p.A179S|ACSS2_ENST00000476922.1_Intron|ACSS2_ENST00000336325.4_Missense_Mutation_p.A129S	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	179					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TGGCCATGCTGGCATGTGCCCG	0.569																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	Exception_encountered	20.37:g.33501263_33501264delinsCT	ENSP00000353804:p.Ala179Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Silent|Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_Acyl-CoA_synth_DUF3448,tigrfam_Ac_CoA_lig	p.L178|p.A179S	ENST00000360596.2	37	c.534|c.535	CCDS13243.1	20																																																																																			ACSS2	-	pfam_AMP-dep_Synth/Lig,tigrfam_Ac_CoA_lig	ENSG00000131069		0.569	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS2	HGNC	protein_coding	OTTHUMT00000078823.3	62|63	0.00	0	G	NM_018677		33501263|33501264	33501263|33501264	+1	no_errors	ENST00000360596	ensembl	human	known	69_37n	silent|missense	83	20.19|19.42	21|20	SNP	1.000	C|T
ACTL9	284382	genome.wustl.edu	37	19	8808499	8808499	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr19:8808499C>G	ENST00000324436.3	-	1	673	c.553G>C	c.(553-555)Gtc>Ctc	p.V185L		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	185						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						TGGGCGTAGACAGACAGCACC	0.657																																						dbGAP											0													53.0	48.0	50.0					19																	8808499		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.553G>C	19.37:g.8808499C>G	ENSP00000316674:p.Val185Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K893|Q6X960	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.V185L	ENST00000324436.3	37	c.553	CCDS12207.1	19	.	.	.	.	.	.	.	.	.	.	C	0.719	-0.784112	0.02907	.	.	ENSG00000181786	ENST00000324436	D	0.96136	-3.92	4.24	3.21	0.36854	.	0.542144	0.15135	N	0.278634	T	0.81148	0.4762	N	0.00991	-1.07	0.30673	N	0.753156	B	0.12013	0.005	B	0.18871	0.023	T	0.74794	-0.3544	10	0.02654	T	1	.	7.2955	0.26391	0.0:0.735:0.1706:0.0944	.	185	Q8TC94	ACTL9_HUMAN	L	185	ENSP00000316674:V185L	ENSP00000316674:V185L	V	-	1	0	ACTL9	8669499	0.977000	0.34250	0.036000	0.18154	0.368000	0.29767	1.912000	0.39946	1.153000	0.42468	0.462000	0.41574	GTC	ACTL9	-	pfam_Actin-like,smart_Actin-like,prints_Actin-like	ENSG00000181786		0.657	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL9	HGNC	protein_coding	OTTHUMT00000459953.1	26	0.00	0	C	NM_178525		8808499	8808499	-1	no_errors	ENST00000324436	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.973	G
ADAMTSL1	92949	genome.wustl.edu	37	9	18829873	18829873	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr9:18829873A>T	ENST00000380548.4	+	23	4486	c.4147A>T	c.(4147-4149)Atc>Ttc	p.I1383F	ADAMTSL1_ENST00000380545.5_Missense_Mutation_p.I84F	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1383						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		GTTGGAAGACATCAGGGCCTT	0.577																																						dbGAP											0													96.0	100.0	99.0					9																	18829873		2085	4210	6295	-	-	-	SO:0001583	missense	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.4147A>T	9.37:g.18829873A>T	ENSP00000369921:p.Ile1383Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.I84F	ENST00000380548.4	37	c.250	CCDS47954.1	9	.	.	.	.	.	.	.	.	.	.	A	13.14	2.149045	0.37923	.	.	ENSG00000178031	ENST00000380548;ENST00000380545;ENST00000316239;ENST00000380541	T;T	0.65732	-0.17;0.06	5.81	4.61	0.57282	Immunoglobulin-like fold (1);	0.114414	0.39615	N	0.001301	T	0.47637	0.1456	L	0.40543	1.245	0.35781	D	0.821615	B;B	0.32245	0.231;0.361	B;B	0.25405	0.06;0.036	T	0.60571	-0.7237	10	0.66056	D	0.02	.	7.4364	0.27158	0.7166:0.1358:0.0:0.1476	.	84;1383	Q8N6G6-6;Q8N6G6	.;ATL1_HUMAN	F	1383;84;87;87	ENSP00000369921:I1383F;ENSP00000369918:I84F	ENSP00000325584:I87F	I	+	1	0	ADAMTSL1	18819873	0.788000	0.28762	0.993000	0.49108	0.994000	0.84299	1.091000	0.30915	2.225000	0.72522	0.533000	0.62120	ATC	ADAMTSL1	-	NULL	ENSG00000178031		0.577	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	123	0.00	0	A			18829873	18829873	+1	no_errors	ENST00000388710	ensembl	human	known	69_37n	missense	105	11.02	13	SNP	0.996	T
ETNPPL	64850	genome.wustl.edu	37	4	109672126	109672126	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr4:109672126T>A	ENST00000296486.3	-	7	821	c.667A>T	c.(667-669)Att>Ttt	p.I223F	ETNPPL_ENST00000512646.1_Missense_Mutation_p.I165F|ETNPPL_ENST00000510706.1_Missense_Mutation_p.I183F|ETNPPL_ENST00000411864.2_Missense_Mutation_p.I217F	NM_001146590.1|NM_031279.3	NP_001140062.1|NP_112569.2	Q8TBG4	AT2L1_HUMAN	ethanolamine-phosphate phospho-lyase	223						mitochondrion (GO:0005739)	ethanolamine-phosphate phospho-lyase activity (GO:0050459)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)										GCTGGAGGAATTATTTGTCCG	0.483																																						dbGAP											0													142.0	147.0	145.0					4																	109672126		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ298293	CCDS3682.1, CCDS54792.1, CCDS54793.1	4q25	2013-06-12	2013-06-12	2013-06-12	ENSG00000164089	ENSG00000164089	4.2.3.2		14404	protein-coding gene	gene with protein product		614682	"""alanine-glyoxylate aminotransferase 2-like 1"""	AGXT2L1		7592550, 22241472	Standard	NM_031279		Approved		uc003hzc.3	Q8TBG4	OTTHUMG00000161036	ENST00000296486.3:c.667A>T	4.37:g.109672126T>A	ENSP00000296486:p.Ile223Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1Y0|E9PBY0|Q9H174	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	p.I223F	ENST00000296486.3	37	c.667	CCDS3682.1	4	.	.	.	.	.	.	.	.	.	.	T	19.24	3.788862	0.70337	.	.	ENSG00000164089	ENST00000296486;ENST00000411864;ENST00000512646;ENST00000510706	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	6.07	6.07	0.98685	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.045329	0.85682	D	0.000000	T	0.65739	0.2720	M	0.83774	2.66	0.80722	D	1	B;B;D	0.67145	0.18;0.149;0.996	B;B;D	0.72625	0.178;0.111;0.978	T	0.69480	-0.5134	9	.	.	.	-26.185	12.3943	0.55376	0.0:0.0668:0.0:0.9331	.	165;217;223	E9PBY0;Q8TBG4-2;Q8TBG4	.;.;AT2L1_HUMAN	F	223;217;165;183	ENSP00000296486:I223F;ENSP00000392269:I217F;ENSP00000427065:I165F;ENSP00000423240:I183F	.	I	-	1	0	AGXT2L1	109891575	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	4.209000	0.58493	2.326000	0.78906	0.528000	0.53228	ATT	AGXT2L1	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000164089		0.483	ETNPPL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGXT2L1	HGNC	protein_coding	OTTHUMT00000363508.1	53	0.00	0	T	NM_031279		109672126	109672126	-1	no_errors	ENST00000296486	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	1.000	A
ATG4D	84971	genome.wustl.edu	37	19	10659619	10659619	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr19:10659619A>T	ENST00000309469.4	+	6	1048	c.875A>T	c.(874-876)gAc>gTc	p.D292V	RNU7-140P_ENST00000459546.1_RNA|ATG4D_ENST00000540862.1_Intron	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	292					apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			GCCAGGCCAGACCCCACAGCC	0.637																																						dbGAP											0													101.0	80.0	87.0					19																	10659619		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.875A>T	19.37:g.10659619A>T	ENSP00000311318:p.Asp292Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q969K0	Missense_Mutation	SNP	pfam_Peptidase_C54	p.D292V	ENST00000309469.4	37	c.875	CCDS12241.1	19	.	.	.	.	.	.	.	.	.	.	A	12.30	1.895155	0.33442	.	.	ENSG00000130734	ENST00000309469	T	0.43688	0.94	5.56	5.56	0.83823	.	0.411149	0.28011	N	0.016942	T	0.34135	0.0887	N	0.12471	0.22	0.80722	D	1	P;B	0.51147	0.942;0.137	P;B	0.49953	0.627;0.115	T	0.10543	-1.0625	10	0.21014	T	0.42	-24.5852	14.6739	0.68964	1.0:0.0:0.0:0.0	.	229;292	B4DGM8;Q86TL0	.;ATG4D_HUMAN	V	292	ENSP00000311318:D292V	ENSP00000311318:D292V	D	+	2	0	ATG4D	10520619	1.000000	0.71417	0.978000	0.43139	0.865000	0.49528	3.177000	0.50871	2.121000	0.65114	0.448000	0.29417	GAC	ATG4D	-	pfam_Peptidase_C54	ENSG00000130734		0.637	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG4D	HGNC	protein_coding	OTTHUMT00000452022.1	81	0.00	0	A	NM_032885		10659619	10659619	+1	no_errors	ENST00000309469	ensembl	human	known	69_37n	missense	51	23.19	16	SNP	1.000	T
ATN1	1822	genome.wustl.edu	37	12	7045891	7045892	+	In_Frame_Ins	INS	-	-	CAG	rs199920334|rs377147612|rs150855426|rs60216939	byFrequency	TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr12:7045891_7045892insCAG	ENST00000356654.4	+	5	1698_1699	c.1461_1462insCAG	c.(1462-1464)cag>CAGcag	p.488_488Q>QQ	ATN1_ENST00000396684.2_In_Frame_Ins_p.488_488Q>QQ	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	488	Poly-Gln.		Missing. {ECO:0000269|PubMed:7485154, ECO:0000269|PubMed:7842016, ECO:0000269|PubMed:8965642}.		cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)	p.Q487_Q488insQ(1)|p.Q488delQ(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcaacagcaacagcagcagca	0.634																																						dbGAP											2	Insertion - In frame(1)|Deletion - In frame(1)	breast(2)																																								-	-	-	SO:0001652	inframe_insertion	0			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1504_1506dupCAG	12.37:g.7045898_7045900dupCAG	ENSP00000349076:p.Gln502dup	Somatic		WXS	Illumina GAIIx	Phase_IV	Q99495|Q99621|Q9UEK7	In_Frame_Ins	INS	pfam_Atrophin-like,prints_Atrophin-1	p.491in_frame_insQ	ENST00000356654.4	37	c.1461_1462	CCDS31734.1	12																																																																																			ATN1	-	pfam_Atrophin-like	ENSG00000111676		0.634	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATN1	HGNC	protein_coding	OTTHUMT00000401948.2	26	0.00	0	-	NM_001940		7045891	7045892	+1	no_errors	ENST00000356654	ensembl	human	known	69_37n	in_frame_ins	39	11.36	5	INS	0.002:0.834	CAG
AURKB	9212	genome.wustl.edu	37	17	8110509	8110509	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr17:8110509A>G	ENST00000585124.1	-	5	476	c.383T>C	c.(382-384)aTc>aCc	p.I128T	AURKB_ENST00000534871.1_Missense_Mutation_p.I87T|AURKB_ENST00000535053.1_Missense_Mutation_p.I129T|AURKB_ENST00000316199.6_Missense_Mutation_p.I129T|AURKB_ENST00000578549.1_Intron	NM_004217.3	NP_004208.2	Q96GD4	AURKB_HUMAN	aurora kinase B	128	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				abscission (GO:0009838)|aging (GO:0007568)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|attachment of spindle microtubules to kinetochore (GO:0008608)|cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|cleavage furrow formation (GO:0036089)|cytokinesis checkpoint (GO:0031565)|histone H3-S28 phosphorylation (GO:0043988)|histone modification (GO:0016570)|mitotic cell cycle (GO:0000278)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytokinesis (GO:0032467)|protein autophosphorylation (GO:0046777)|protein localization to kinetochore (GO:0034501)|protein phosphorylation (GO:0006468)|regulation of chromosome segregation (GO:0051983)|spindle checkpoint (GO:0031577)|spindle midzone assembly involved in mitosis (GO:0051256)|spindle stabilization (GO:0043146)	chromocenter (GO:0010369)|chromosome passenger complex (GO:0032133)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(1)|central_nervous_system(1)|lung(2)	4						GTGGGCCTGGATTTCGATCTC	0.577																																					NSCLC(134;1161 2470 43664 51568)	dbGAP											0													62.0	60.0	61.0					17																	8110509		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF004022	CCDS11134.1, CCDS58514.1, CCDS67162.1	17p13.1	2013-01-17	2003-07-21	2003-07-23	ENSG00000178999	ENSG00000178999		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11390	protein-coding gene	gene with protein product	"""aurora-B"", ""aurora-1"", ""protein phosphatase 1, regulatory subunit 48"""	604970	"""serine/threonine kinase 12"""	STK12		9858806	Standard	NM_001256834		Approved	Aik2, IPL1, AurB, AIM-1, ARK2, STK5, PPP1R48	uc002gkm.4	Q96GD4	OTTHUMG00000108189	ENST00000585124.1:c.383T>C	17.37:g.8110509A>G	ENSP00000463999:p.Ile128Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNM4|C7G533|C7G534|C7G535|D3DTR4|J9JID1|O14630|O60446|O95083|Q96DV5|Q9UQ46	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I128T	ENST00000585124.1	37	c.383	CCDS11134.1	17	.	.	.	.	.	.	.	.	.	.	A	14.02	2.411006	0.42817	.	.	ENSG00000178999	ENST00000316199;ENST00000534871;ENST00000535053	T;T	0.69435	-0.4;-0.4	5.19	5.19	0.71726	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.78291	0.4260	M	0.61703	1.905	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.69824	0.966;0.966	T	0.80571	-0.1323	10	0.87932	D	0	-10.4461	13.0514	0.58957	1.0:0.0:0.0:0.0	.	128;128	C7G533;Q96GD4	.;AURKB_HUMAN	T	128;87;129	ENSP00000443869:I87T;ENSP00000445866:I129T	ENSP00000313950:I128T	I	-	2	0	AURKB	8051234	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.936000	0.92931	2.189000	0.69895	0.533000	0.62120	ATC	AURKB	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000178999		0.577	AURKB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AURKB	HGNC	protein_coding	OTTHUMT00000226995.2	71	0.00	0	A	NM_004217		8110509	8110509	-1	no_errors	ENST00000585124	ensembl	human	known	69_37n	missense	34	22.73	10	SNP	1.000	G
BAI3	577	genome.wustl.edu	37	6	69348974	69348974	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr6:69348974C>A	ENST00000370598.1	+	3	1228	c.407C>A	c.(406-408)aCt>aAt	p.T136N		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	136	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GTATTTCCAACTAATTTCCCA	0.338																																						dbGAP											0													41.0	43.0	42.0					6																	69348974		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.407C>A	6.37:g.69348974C>A	ENSP00000359630:p.Thr136Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.T136N	ENST00000370598.1	37	c.407	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	C	5.061	0.196967	0.09599	.	.	ENSG00000135298	ENST00000370598	T	0.19806	2.12	5.47	3.27	0.37495	CUB (1);	0.561038	0.17978	N	0.155635	T	0.02929	0.0087	N	0.08118	0	0.39623	D	0.970053	B	0.10296	0.003	B	0.09377	0.004	T	0.30707	-0.9969	10	0.27785	T	0.31	.	2.8356	0.05513	0.0:0.4682:0.2796:0.2522	.	136	O60242	BAI3_HUMAN	N	136	ENSP00000359630:T136N	ENSP00000359630:T136N	T	+	2	0	BAI3	69405695	0.998000	0.40836	0.925000	0.36789	0.980000	0.70556	3.904000	0.56325	1.417000	0.47077	0.655000	0.94253	ACT	BAI3	-	pfscan_CUB	ENSG00000135298		0.338	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	26	0.00	0	C			69348974	69348974	+1	no_errors	ENST00000370598	ensembl	human	known	69_37n	missense	41	12.50	6	SNP	0.467	A
C10orf71	118461	genome.wustl.edu	37	10	50530920	50530920	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr10:50530920A>C	ENST00000374144.3	+	3	618	c.330A>C	c.(328-330)gaA>gaC	p.E110D	C10orf71_ENST00000323868.4_Missense_Mutation_p.E110D			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	110										endometrium(1)	1						AGGGAGAGGAAAAGTACCCCA	0.567																																						dbGAP											0													107.0	121.0	117.0					10																	50530920		1941	4124	6065	-	-	-	SO:0001583	missense	0			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.330A>C	10.37:g.50530920A>C	ENSP00000363259:p.Glu110Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVL8	Missense_Mutation	SNP	NULL	p.E110D	ENST00000374144.3	37	c.330	CCDS44387.1	10	.	.	.	.	.	.	.	.	.	.	A	17.40	3.378967	0.61735	.	.	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.18502	2.21;3.32	4.94	-9.87	0.00470	.	0.000000	0.48286	D	0.000182	T	0.13543	0.0328	M	0.64997	1.995	0.20638	N	0.99987	B	0.28178	0.202	B	0.25140	0.058	T	0.02411	-1.1163	10	0.59425	D	0.04	.	13.3901	0.60818	0.2043:0.1854:0.6103:0.0	.	110	Q711Q0-3	.	D	110	ENSP00000318713:E110D;ENSP00000363259:E110D	ENSP00000318713:E110D	E	+	3	2	C10orf71	50200926	0.051000	0.20477	0.085000	0.20634	0.914000	0.54420	-0.606000	0.05654	-2.222000	0.00727	-0.648000	0.03929	GAA	C10orf71	-	NULL	ENSG00000177354		0.567	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf71	HGNC	protein_coding	OTTHUMT00000047984.2	70	0.00	0	A	NM_199459		50530920	50530920	+1	no_errors	ENST00000374144	ensembl	human	known	69_37n	missense	65	17.72	14	SNP	0.001	C
C11orf63	79864	genome.wustl.edu	37	11	122756780	122756780	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr11:122756780G>C	ENST00000531316.1	+	1	315	c.223G>C	c.(223-225)Gac>Cac	p.D75H	C11orf63_ENST00000227349.2_Missense_Mutation_p.D75H|C11orf63_ENST00000307257.6_Missense_Mutation_p.D75H			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	75					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)					breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		CGACAGCTTAGACGAGGAGGA	0.527																																						dbGAP											0													109.0	109.0	109.0					11																	122756780		2202	4299	6501	-	-	-	SO:0001583	missense	0			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.223G>C	11.37:g.122756780G>C	ENSP00000431669:p.Asp75His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6G0|Q96GB5|Q9H5D6	Missense_Mutation	SNP	NULL	p.D75H	ENST00000531316.1	37	c.223	CCDS8438.1	11	.	.	.	.	.	.	.	.	.	.	G	16.64	3.179021	0.57692	.	.	ENSG00000109944	ENST00000307257;ENST00000227349;ENST00000531316	T;T	0.50277	0.75;0.75	5.5	5.5	0.81552	.	0.103551	0.41938	D	0.000787	T	0.49029	0.1533	L	0.29908	0.895	0.34304	D	0.684681	D;D	0.53151	0.958;0.958	P;P	0.51135	0.568;0.66	T	0.62343	-0.6874	10	0.62326	D	0.03	-15.1131	17.1537	0.86784	0.0:0.0:1.0:0.0	.	75;75	Q6NUN7;Q6NUN7-2	CK063_HUMAN;.	H	75	ENSP00000227349:D75H;ENSP00000431669:D75H	ENSP00000227349:D75H	D	+	1	0	C11orf63	122261990	1.000000	0.71417	0.997000	0.53966	0.436000	0.31835	5.579000	0.67457	2.564000	0.86499	0.655000	0.94253	GAC	C11orf63	-	NULL	ENSG00000109944		0.527	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf63	HGNC	protein_coding	OTTHUMT00000387511.1	46	0.00	0	G	NM_024806		122756780	122756780	+1	no_errors	ENST00000227349	ensembl	human	known	69_37n	missense	44	13.73	7	SNP	1.000	C
LRRC74A	145497	genome.wustl.edu	37	14	77323744	77323744	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr14:77323744A>G	ENST00000393774.3	+	10	1154	c.1030A>G	c.(1030-1032)Atg>Gtg	p.M344V		NM_194287.2	NP_919263.2														breast(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(1)	18			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		TCCCATAAATATGGATGGGGC	0.453																																					Ovarian(165;1056 1958 32571 36789 48728)	dbGAP											0													64.0	59.0	61.0					14																	77323744		1875	4103	5978	-	-	-	SO:0001583	missense	0																														ENST00000393774.3:c.1030A>G	14.37:g.77323744A>G	ENSP00000377369:p.Met344Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.M344V	ENST00000393774.3	37	c.1030	CCDS9853.2	14	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.498397	0.00157	.	.	ENSG00000100565	ENST00000393774	T	0.51817	0.69	5.17	0.17	0.15021	.	0.363065	0.26297	N	0.025183	T	0.15176	0.0366	N	0.02391	-0.57	0.51233	D	0.99991	B	0.02656	0.0	B	0.04013	0.001	T	0.05733	-1.0867	10	0.12766	T	0.61	.	3.508	0.07698	0.4189:0.0:0.3961:0.185	.	344	Q0VAA2	CN16B_HUMAN	V	344	ENSP00000377369:M344V	ENSP00000377369:M344V	M	+	1	0	C14orf166B	76393497	0.599000	0.26891	0.060000	0.19600	0.065000	0.16274	0.836000	0.27545	0.254000	0.21573	-0.609000	0.04063	ATG	C14orf166B	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000100565		0.453	C14orf166B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf166B	HGNC	protein_coding	OTTHUMT00000316592.1	100	0.00	0	A			77323744	77323744	+1	no_errors	ENST00000393774	ensembl	human	known	69_37n	missense	62	20.25	16	SNP	0.528	G
C2orf71	388939	genome.wustl.edu	37	2	29294367	29294367	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr2:29294367C>A	ENST00000331664.5	-	1	2760	c.2761G>T	c.(2761-2763)Gcc>Tcc	p.A921S		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	921					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						AGGTCCAGGGCTGGCTTCCTG	0.672																																						dbGAP											0													15.0	18.0	17.0					2																	29294367		2012	4148	6160	-	-	-	SO:0001583	missense	0				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.2761G>T	2.37:g.29294367C>A	ENSP00000332809:p.Ala921Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A921S	ENST00000331664.5	37	c.2761	CCDS42669.1	2	.	.	.	.	.	.	.	.	.	.	C	7.138	0.581329	0.13686	.	.	ENSG00000179270	ENST00000331664	T	0.19532	2.14	5.71	-5.15	0.02866	.	1.375250	0.04451	N	0.372553	T	0.08313	0.0207	N	0.16368	0.405	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.27571	-1.0070	10	0.06625	T	0.88	-0.2493	1.7523	0.02974	0.339:0.1484:0.0868:0.4258	.	921	A6NGG8	CB071_HUMAN	S	921	ENSP00000332809:A921S	ENSP00000332809:A921S	A	-	1	0	C2orf71	29147871	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.448000	0.06820	-0.522000	0.06417	-0.282000	0.10007	GCC	C2orf71	-	NULL	ENSG00000179270		0.672	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf71	HGNC	protein_coding	OTTHUMT00000324924.3	12	0.00	0	C	NM_001029883		29294367	29294367	-1	no_errors	ENST00000331664	ensembl	human	novel	69_37n	missense	28	20.00	7	SNP	0.000	A
CFAP69	79846	genome.wustl.edu	37	7	89939392	89939392	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr7:89939392G>A	ENST00000389297.4	+	23	2917	c.2666G>A	c.(2665-2667)gGt>gAt	p.G889D	AC002064.5_ENST00000445784.1_lincRNA|C7orf63_ENST00000497910.1_Missense_Mutation_p.G871D|C7orf63_ENST00000316089.8_Missense_Mutation_p.G843D	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		889										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						GTGCCCTCTGGTGGAGTAGTA	0.413																																						dbGAP											0													130.0	119.0	123.0					7																	89939392		1871	4101	5972	-	-	-	SO:0001583	missense	0																														ENST00000389297.4:c.2666G>A	7.37:g.89939392G>A	ENSP00000373948:p.Gly889Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Nonsense_Mutation	SNP	NULL	p.W117*	ENST00000389297.4	37	c.351	CCDS43613.2	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.29|16.29	3.081388|3.081388	0.55753|0.55753	.|.	.|.	ENSG00000105792|ENSG00000105792	ENST00000389297;ENST00000316089;ENST00000497910;ENST00000449577|ENST00000412839;ENST00000445156	T;T;T;T|.	0.31769|.	2.07;1.99;2.09;1.48|.	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	0.077125|.	0.53938|.	D|.	0.000050|.	T|.	0.78375|.	0.4273|.	M|M	0.77103|0.77103	2.36|2.36	0.52501|0.52501	D|D	0.999953|0.999953	D;D|.	0.76494|.	0.999;0.998|.	D;D|.	0.70935|.	0.971;0.939|.	T|.	0.77731|.	-0.2478|.	10|.	0.87932|.	D|.	0|.	-16.9192|-16.9192	19.6476|19.6476	0.95789|0.95789	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	871;889|.	A5D8W1-5;A5D8W1|.	.;CG063_HUMAN|.	D|X	889;843;871;426|117;40	ENSP00000373948:G889D;ENSP00000321753:G843D;ENSP00000419549:G871D;ENSP00000391571:G426D|.	ENSP00000321753:G843D|.	G|W	+|+	2|3	0|0	C7orf63|C7orf63	89777328|89777328	1.000000|1.000000	0.71417|0.71417	0.372000|0.372000	0.25991|0.25991	0.173000|0.173000	0.22820|0.22820	7.443000|7.443000	0.80521|0.80521	2.653000|2.653000	0.90120|0.90120	0.655000|0.655000	0.94253|0.94253	GGT|TGG	C7orf63	-	NULL	ENSG00000105792		0.413	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf63	HGNC	protein_coding	OTTHUMT00000139891.4	106	0.00	0	G			89939392	89939392	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000412839	ensembl	human	novel	69_37n	nonsense	82	13.68	13	SNP	0.955	A
CCDC88C	440193	genome.wustl.edu	37	14	91810002	91810002	+	Splice_Site	SNP	C	C	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr14:91810002C>G	ENST00000389857.6	-	5	427		c.e5-1			NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C						protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				ATGCTCTTCCCTAGATCAAGA	0.473																																						dbGAP											0													60.0	64.0	63.0					14																	91810002		2081	4222	6303	-	-	-	SO:0001630	splice_region_variant	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.341-1G>C	14.37:g.91810002C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Splice_Site	SNP	-	e5-1	ENST00000389857.6	37	c.341-1	CCDS45151.1	14	.	.	.	.	.	.	.	.	.	.	C	19.58	3.853663	0.71719	.	.	ENSG00000015133	ENST00000389857;ENST00000541408	.	.	.	4.66	4.66	0.58398	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9718	0.86302	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCDC88C	90879755	1.000000	0.71417	0.992000	0.48379	0.792000	0.44763	7.038000	0.76537	2.312000	0.78011	0.555000	0.69702	.	CCDC88C	-	-	ENSG00000015133		0.473	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1	63	0.00	0	C	XM_029353	Intron	91810002	91810002	-1	no_errors	ENST00000389857	ensembl	human	known	69_37n	splice_site	49	27.94	19	SNP	1.000	G
CD163L1	283316	genome.wustl.edu	37	12	7548822	7548822	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr12:7548822G>C	ENST00000313599.3	-	8	1976	c.1919C>G	c.(1918-1920)aCa>aGa	p.T640R	CD163L1_ENST00000416109.2_Missense_Mutation_p.T650R|CD163L1_ENST00000396630.1_Missense_Mutation_p.T640R			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	640	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						TCCATATCCTGTAGAAGCGTT	0.493																																						dbGAP											0													122.0	104.0	110.0					12																	7548822		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.1919C>G	12.37:g.7548822G>C	ENSP00000315945:p.Thr640Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Srcr_rcpt	p.T640R	ENST00000313599.3	37	c.1919	CCDS8577.1	12	.	.	.	.	.	.	.	.	.	.	G	2.451	-0.326448	0.05350	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630;ENST00000545926	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	2.23	-4.28	0.03732	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	6.075730	0.00447	N	0.000099	T	0.15609	0.0376	N	0.04805	-0.155	0.09310	N	1	B;P	0.47034	0.003;0.889	B;B	0.41466	0.004;0.358	T	0.05209	-1.0899	10	0.35671	T	0.21	.	0.1984	0.00142	0.3519:0.146:0.2245:0.2776	.	650;640	E7EVK4;Q9NR16	.;C163B_HUMAN	R	640;650;640;179	ENSP00000315945:T640R;ENSP00000393474:T650R;ENSP00000379871:T640R;ENSP00000439921:T179R	ENSP00000315945:T640R	T	-	2	0	CD163L1	7440089	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.398000	0.07259	-1.001000	0.03434	-0.262000	0.10625	ACA	CD163L1	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000177675		0.493	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	HGNC	protein_coding	OTTHUMT00000399329.1	101	0.00	0	G	NM_174941		7548822	7548822	-1	no_errors	ENST00000313599	ensembl	human	known	69_37n	missense	54	20.59	14	SNP	0.002	C
CDC14A	8556	genome.wustl.edu	37	1	100961587	100961587	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr1:100961587C>A	ENST00000336454.3	+	13	1635	c.1280C>A	c.(1279-1281)gCa>gAa	p.A427E	CDC14A_ENST00000542213.1_Missense_Mutation_p.A369E|CDC14A_ENST00000370125.2_3'UTR|CDC14A_ENST00000544534.1_Missense_Mutation_p.A427E|CDC14A_ENST00000361544.6_Missense_Mutation_p.A427E	NM_003672.3	NP_003663.2	Q9UNH5	CC14A_HUMAN	cell division cycle 14A	427					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(6)|large_intestine(6)|lung(10)|skin(2)|urinary_tract(1)	31		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		CATCCAAGAGCAGTGTCCCAG	0.448																																						dbGAP											0													160.0	145.0	150.0					1																	100961587		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF000367	CCDS769.1, CCDS770.1, CCDS771.1	1p21	2013-01-17	2013-01-17		ENSG00000079335	ENSG00000079335		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1718	protein-coding gene	gene with protein product		603504	"""CDC10 (cell division cycle 10, S. cerevisiae, homolog)"", ""CDC14 cell division cycle 14 homolog A (S. cerevisiae)"""			9367992, 10409437	Standard	NM_033312		Approved	Cdc14A1, Cdc14A2, cdc14	uc001dtf.2	Q9UNH5	OTTHUMG00000010987	ENST00000336454.3:c.1280C>A	1.37:g.100961587C>A	ENSP00000336739:p.Ala427Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6MA65|B1AQ14|B1AQ15|O43171|O60727|O60728|Q52LH9|Q8IXX0	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.A427E	ENST00000336454.3	37	c.1280	CCDS769.1	1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064990	0.55432	.	.	ENSG00000079335	ENST00000542213;ENST00000361544;ENST00000336454;ENST00000544534	T;T;T;T	0.10288	2.89;2.89;3.08;2.89	5.05	5.05	0.67936	.	0.283282	0.34411	N	0.003998	T	0.08223	0.0205	L	0.44542	1.39	0.39263	D	0.964254	B;B;B;B	0.26935	0.015;0.164;0.031;0.118	B;B;B;B	0.32980	0.06;0.075;0.034;0.156	T	0.09143	-1.0688	10	0.62326	D	0.03	-4.5984	18.7732	0.91900	0.0:1.0:0.0:0.0	.	369;427;427;427	F5H7B3;A6MA65;Q9UNH5;Q9UNH5-2	.;.;CC14A_HUMAN;.	E	369;427;427;427	ENSP00000442640:A369E;ENSP00000354916:A427E;ENSP00000336739:A427E;ENSP00000442543:A427E	ENSP00000336739:A427E	A	+	2	0	CDC14A	100734175	1.000000	0.71417	0.993000	0.49108	0.707000	0.40811	5.409000	0.66374	2.493000	0.84123	0.655000	0.94253	GCA	CDC14A	-	NULL	ENSG00000079335		0.448	CDC14A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDC14A	HGNC	protein_coding	OTTHUMT00000030220.1	128	0.00	0	C	NM_033312		100961587	100961587	+1	no_errors	ENST00000361544	ensembl	human	known	69_37n	missense	79	31.30	36	SNP	1.000	A
CDC42BPA	8476	genome.wustl.edu	37	1	227288919	227288919	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr1:227288919G>T	ENST00000366769.3	-	15	3314	c.2023C>A	c.(2023-2025)Cca>Aca	p.P675T	CDC42BPA_ENST00000366765.3_Missense_Mutation_p.P675T|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.P675T|CDC42BPA_ENST00000366766.2_Missense_Mutation_p.P675T|CDC42BPA_ENST00000366767.3_Missense_Mutation_p.P594T|CDC42BPA_ENST00000366764.2_Missense_Mutation_p.P675T|CDC42BPA_ENST00000535525.1_Missense_Mutation_p.P675T	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)									p.P675T(2)|p.P594T(1)		NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CATACTCCTGGTGAGTAACTA	0.259																																						dbGAP											3	Substitution - Missense(3)	endometrium(3)											66.0	67.0	66.0					1																	227288919		2199	4293	6492	-	-	-	SO:0001583	missense	0			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.2023C>A	1.37:g.227288919G>T	ENSP00000355731:p.Pro675Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Pkinase_C,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,superfamily_WD40_repeat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.P675T	ENST00000366769.3	37	c.2023	CCDS1558.1	1	.	.	.	.	.	.	.	.	.	.	g	10.09	1.254280	0.22965	.	.	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000535525;ENST00000366765	T;T;T;T;T;T;T	0.64803	-0.1;-0.1;-0.1;-0.11;-0.12;-0.09;-0.08	5.57	5.57	0.84162	.	0.211271	0.49916	D	0.000132	T	0.59321	0.2185	L	0.55481	1.735	0.42055	D	0.991132	B;B;B;B	0.15473	0.01;0.001;0.004;0.013	B;B;B;B	0.15484	0.007;0.003;0.013;0.008	T	0.55464	-0.8137	10	0.16896	T	0.51	.	19.5667	0.95397	0.0:0.0:1.0:0.0	.	675;675;594;675	F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5	.;.;.;.	T	675;594;675;675;675;675;675	ENSP00000355731:P675T;ENSP00000355729:P594T;ENSP00000335341:P675T;ENSP00000355728:P675T;ENSP00000355726:P675T;ENSP00000443275:P675T;ENSP00000355727:P675T	ENSP00000335341:P675T	P	-	1	0	CDC42BPA	225355542	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.439000	0.44846	2.604000	0.88044	0.645000	0.84053	CCA	CDC42BPA	-	NULL	ENSG00000143776		0.259	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPA	HGNC	protein_coding	OTTHUMT00000091696.1	83	0.00	0	G	NM_014826		227288919	227288919	-1	no_errors	ENST00000334218	ensembl	human	known	69_37n	missense	100	12.28	14	SNP	1.000	T
COL14A1	7373	genome.wustl.edu	37	8	121290407	121290407	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr8:121290407delA	ENST00000297848.3	+	27	3541	c.3271delA	c.(3271-3273)aaafs	p.K1091fs	COL14A1_ENST00000309791.4_Frame_Shift_Del_p.K1091fs|COL14A1_ENST00000247781.3_Frame_Shift_Del_p.K996fs	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			AAATGCTTACAAAACCAAAGA	0.368																																						dbGAP											0													91.0	94.0	93.0					8																	121290407		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.3271delA	8.37:g.121290407delA	ENSP00000297848:p.Lys1091fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.T1092fs	ENST00000297848.3	37	c.3271	CCDS34938.1	8																																																																																			COL14A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000187955		0.368	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	85	0.00	0	A	NM_021110		121290407	121290407	+1	no_errors	ENST00000297848	ensembl	human	known	69_37n	frame_shift_del	90	12.62	13	DEL	1.000	-
COL7A1	1294	genome.wustl.edu	37	3	48629805	48629805	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr3:48629805C>A	ENST00000328333.8	-	8	1179	c.1072G>T	c.(1072-1074)Gtg>Ttg	p.V358L	COL7A1_ENST00000454817.1_Missense_Mutation_p.V358L	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	358	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CGCCATGTCACACGGTAGCCA	0.637																																						dbGAP											0													32.0	31.0	32.0					3																	48629805		2203	4297	6500	-	-	-	SO:0001583	missense	0			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.1072G>T	3.37:g.48629805C>A	ENSP00000332371:p.Val358Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14054|Q16507	Missense_Mutation	SNP	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.V358L	ENST00000328333.8	37	c.1072	CCDS2773.1	3	.	.	.	.	.	.	.	.	.	.	C	9.474	1.096365	0.20552	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	T;T	0.63913	-0.07;-0.07	3.55	3.55	0.40652	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.222685	0.23288	N	0.049831	T	0.41259	0.1151	N	0.16833	0.445	0.24058	N	0.996024	B	0.24132	0.098	B	0.24541	0.054	T	0.16630	-1.0396	10	0.20046	T	0.44	.	9.1758	0.37112	0.0:0.7766:0.2234:0.0	.	358	Q02388	CO7A1_HUMAN	L	358	ENSP00000332371:V358L;ENSP00000412569:V358L	ENSP00000332371:V358L	V	-	1	0	COL7A1	48604809	0.914000	0.31030	0.983000	0.44433	0.883000	0.51084	2.620000	0.46410	2.007000	0.58848	0.462000	0.41574	GTG	COL7A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000114270		0.637	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	HGNC	protein_coding	OTTHUMT00000257519.1	10	0.00	0	C	NM_000094		48629805	48629805	-1	no_errors	ENST00000328333	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.595	A
CPAMD8	27151	genome.wustl.edu	37	19	17039931	17039931	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr19:17039931A>T	ENST00000443236.1	-	24	3137	c.3106T>A	c.(3106-3108)Tct>Act	p.S1036T		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	989						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						TGGGGCCCAGAAGACAAGGCC	0.602																																						dbGAP											0													45.0	49.0	48.0					19																	17039931		2089	4214	6303	-	-	-	SO:0001583	missense	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3106T>A	19.37:g.17039931A>T	ENSP00000402505:p.Ser1036Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Prot_inh_Kazal	p.S1036T	ENST00000443236.1	37	c.3106	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	A	9.600	1.128522	0.21041	.	.	ENSG00000160111	ENST00000291440	.	.	.	3.51	-0.256	0.12984	Farnesoic acid O-methyl transferase (1);	0.454520	0.19314	U	0.117329	T	0.26412	0.0645	L	0.41415	1.275	0.46437	D	0.999048	P	0.39717	0.684	B	0.35182	0.197	T	0.20672	-1.0268	9	0.08837	T	0.75	.	4.4623	0.11671	0.6573:0.1888:0.1539:0.0	.	989	Q8IZJ3	CPMD8_HUMAN	T	1036	.	ENSP00000291440:S1036T	S	-	1	0	CPAMD8	16900931	0.992000	0.36948	0.371000	0.25978	0.648000	0.38561	0.610000	0.24253	-0.065000	0.13021	0.533000	0.62120	TCT	CPAMD8	-	pfam_Methyltransf_FA	ENSG00000160111		0.602	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	44	0.00	0	A	NM_015692		17039931	17039931	-1	no_errors	ENST00000291440	ensembl	human	known	69_37n	missense	51	13.56	8	SNP	0.482	T
CROCCP2	84809	genome.wustl.edu	37	1	16950889	16950889	+	lincRNA	SNP	G	G	A	rs12045375	byFrequency	TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr1:16950889G>A	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											TTGCCCCAGCGTCTCCACCTG	0.697													.|||	1177	0.235024	0.0174	0.2738	5008	,	,		56460	0.4712		0.2495	False		,,,				2504	0.2434					dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950889G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.697	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	13	0.00	0	G	NR_026752.1		16950889	16950889	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	36	25.00	12	SNP	0.470	A
CTPS2	56474	genome.wustl.edu	37	X	16711263	16711263	+	Splice_Site	SNP	C	C	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chrX:16711263C>G	ENST00000443824.1	-	6	1383		c.e6+1		CTPS2_ENST00000380241.3_Splice_Site|CTPS2_ENST00000359276.4_Splice_Site	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2						'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					CCTCAACTCACCAGATCTGGA	0.468																																						dbGAP											0													100.0	87.0	91.0					X																	16711263		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.639+1G>C	X.37:g.16711263C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Splice_Site	SNP	-	e5+1	ENST00000443824.1	37	c.639+1	CCDS14175.1	X	.	.	.	.	.	.	.	.	.	.	C	15.59	2.879367	0.51801	.	.	ENSG00000047230	ENST00000443824;ENST00000380241;ENST00000359276	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4379	0.87557	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CTPS2	16621184	1.000000	0.71417	1.000000	0.80357	0.417000	0.31264	7.434000	0.80377	2.130000	0.65690	0.600000	0.82982	.	CTPS2	-	-	ENSG00000047230		0.468	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CTPS2	HGNC	protein_coding	OTTHUMT00000055906.1	91	0.00	0	C	NM_019857	Intron	16711263	16711263	-1	no_errors	ENST00000359276	ensembl	human	known	69_37n	splice_site	51	25.00	17	SNP	1.000	G
DAB1	1600	genome.wustl.edu	37	1	57491653	57491654	+	Splice_Site	INS	-	-	G	rs138352976|rs201318657		TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr1:57491653_57491654insG	ENST00000371231.1	-	11	919_920		c.e11+1		DAB1_ENST00000371236.2_Splice_Site|DAB1_ENST00000414851.2_Splice_Site|DAB1_ENST00000371234.4_Splice_Site|DAB1_ENST00000420954.2_Splice_Site|DAB1_ENST00000485760.1_Splice_Site|DAB1_ENST00000439789.2_Splice_Site			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)						adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						TGCATACTTACGGGGGGAGAGG	0.465																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.885+1->C	1.37:g.57491659_57491659dupG		Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Frame_Shift_Ins	INS	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	p.T295fs	ENST00000371231.1	37	c.886_885		1																																																																																			DAB1	-	NULL	ENSG00000173406		0.465	DAB1-010	KNOWN	basic	protein_coding	DAB1	HGNC	protein_coding	OTTHUMT00000027962.1	51	0.00	0	-	NM_021080	Intron	57491653	57491654	-1	no_errors	ENST00000371231	ensembl	human	known	69_37n	frame_shift_ins	35	22.22	10	INS	0.996:0.070	G
DCHS1	8642	genome.wustl.edu	37	11	6643297	6643297	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr11:6643297G>C	ENST00000299441.3	-	21	10021	c.9610C>G	c.(9610-9612)Ctc>Gtc	p.L3204V	TPP1_ENST00000528657.1_5'Flank|TPP1_ENST00000534644.1_5'Flank|RP11-732A19.5_ENST00000526456.1_RNA|RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000533371.1_5'Flank|TPP1_ENST00000299427.6_5'Flank	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	3204					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCAGTGATGAGGGGTGGTGGG	0.637																																						dbGAP											0													45.0	49.0	48.0					11																	6643297		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.9610C>G	11.37:g.6643297G>C	ENSP00000299441:p.Leu3204Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O15098	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L3204V	ENST00000299441.3	37	c.9610	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	G	15.13	2.742550	0.49151	.	.	ENSG00000166341	ENST00000299441	T	0.68903	-0.36	4.88	4.88	0.63580	.	0.000000	0.38217	N	0.001767	T	0.81959	0.4933	M	0.77616	2.38	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.84515	0.0624	10	0.87932	D	0	.	16.7719	0.85539	0.0:0.0:1.0:0.0	.	3204	Q96JQ0	PCD16_HUMAN	V	3204	ENSP00000299441:L3204V	ENSP00000299441:L3204V	L	-	1	0	DCHS1	6599873	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.811000	0.86092	2.531000	0.85337	0.313000	0.20887	CTC	DCHS1	-	NULL	ENSG00000166341		0.637	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	59	0.00	0	G	NM_003737		6643297	6643297	-1	no_errors	ENST00000299441	ensembl	human	known	69_37n	missense	49	12.07	7	SNP	1.000	C
DENND3	22898	genome.wustl.edu	37	8	142161849	142161849	+	Silent	SNP	C	C	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr8:142161849C>T	ENST00000262585.2	+	7	1025	c.747C>T	c.(745-747)atC>atT	p.I249I	DENND3_ENST00000519811.1_Silent_p.I329I|DENND3_ENST00000424248.1_Silent_p.I249I	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	249	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			TCGTGCCCATCCTGTCGGACC	0.582																																						dbGAP											0													149.0	123.0	132.0					8																	142161849		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.747C>T	8.37:g.142161849C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_WD40_repeat,pfam_uDENN_dom,superfamily_WD40_repeat_dom,smart_DENN_dom,smart_dDENN_dom,smart_WD40_repeat,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_WD40_repeat_dom	p.P306S	ENST00000262585.2	37	c.916	CCDS34947.1	8	.	.	.	.	.	.	.	.	.	.	C	10.76	1.440920	0.25900	.	.	ENSG00000105339	ENST00000518668	.	.	.	5.38	-1.75	0.08031	.	.	.	.	.	T	0.49830	0.1580	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40496	-0.9560	4	.	.	.	-23.9737	5.4985	0.16815	0.0:0.2776:0.2594:0.463	.	.	.	.	S	306	.	.	P	+	1	0	DENND3	142231031	0.960000	0.32886	0.990000	0.47175	0.941000	0.58515	0.097000	0.15168	-0.242000	0.09667	-0.300000	0.09419	CCT	DENND3	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom	ENSG00000105339		0.582	DENND3-201	KNOWN	basic|CCDS	protein_coding	DENND3	HGNC	protein_coding		63	0.00	0	C	NM_014957		142161849	142161849	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000518668	ensembl	human	novel	69_37n	missense	119	13.77	19	SNP	0.980	T
DNAH10	196385	genome.wustl.edu	37	12	124343746	124343746	+	Missense_Mutation	SNP	C	C	T	rs201520422		TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr12:124343746C>T	ENST00000409039.3	+	37	6351	c.6326C>T	c.(6325-6327)aCg>aTg	p.T2109M		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2109	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CGCCACACGACGATGGTGGTG	0.542													C|||	1	0.000199681	0.0	0.0	5008	,	,		19205	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													31.0	34.0	33.0					12																	124343746		1888	4108	5996	-	-	-	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6326C>T	12.37:g.124343746C>T	ENSP00000386770:p.Thr2109Met	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.T2109M	ENST00000409039.3	37	c.6326	CCDS9255.2	12	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	19.08	3.758817	0.69763	.	.	ENSG00000197653	ENST00000409039	T	0.38722	1.12	5.44	5.44	0.79542	ATPase, AAA+ type, core (1);	0.000000	0.64402	U	0.000005	T	0.64405	0.2595	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.60974	-0.7156	10	0.36615	T	0.2	.	19.2736	0.94021	0.0:1.0:0.0:0.0	.	2109	Q8IVF4	DYH10_HUMAN	M	2109	ENSP00000386770:T2109M	ENSP00000386770:T2109M	T	+	2	0	DNAH10	122909699	1.000000	0.71417	0.222000	0.23844	0.603000	0.37013	7.738000	0.84966	2.546000	0.85860	0.563000	0.77884	ACG	DNAH10	-	smart_AAA+_ATPase	ENSG00000197653		0.542	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	54	0.00	0	C			124343746	124343746	+1	no_errors	ENST00000409039	ensembl	human	known	69_37n	missense	37	30.19	16	SNP	0.998	T
DNAH10	196385	genome.wustl.edu	37	12	124418005	124418005	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr12:124418005C>T	ENST00000409039.3	+	76	13095	c.13070C>T	c.(13069-13071)aCa>aTa	p.T4357I	RP11-380L11.3_ENST00000602292.1_RNA|CCDC92_ENST00000544798.1_Intron|DNAH10OS_ENST00000514254.2_Intron	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4357					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ACCTTGTTCACACAAGTGACC	0.592																																						dbGAP											0													50.0	52.0	51.0					12																	124418005		1998	4162	6160	-	-	-	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.13070C>T	12.37:g.124418005C>T	ENSP00000386770:p.Thr4357Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.T4357I	ENST00000409039.3	37	c.13070	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	33	5.196362	0.94960	.	.	ENSG00000197653	ENST00000409039	T	0.08282	3.11	5.18	5.18	0.71444	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.33962	0.0881	M	0.88775	2.98	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	T	0.25779	-1.0122	10	0.22109	T	0.4	.	18.3051	0.90177	0.0:1.0:0.0:0.0	.	4357	Q8IVF4	DYH10_HUMAN	I	4357	ENSP00000386770:T4357I	ENSP00000386770:T4357I	T	+	2	0	DNAH10	122983958	1.000000	0.71417	0.954000	0.39281	0.992000	0.81027	7.629000	0.83207	2.413000	0.81919	0.561000	0.74099	ACA	DNAH10	-	pfam_Dynein_heavy	ENSG00000197653		0.592	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	13	0.00	0	C			124418005	124418005	+1	no_errors	ENST00000409039	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	1.000	T
EPT1	85465	genome.wustl.edu	37	2	26587746	26587746	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr2:26587746T>C	ENST00000260585.7	+	3	292	c.173T>C	c.(172-174)tTt>tCt	p.F58S		NM_033505.2	NP_277040.1	Q9C0D9	EPT1_HUMAN	ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)	58					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)										TTTTCTGGCTTTCTGCTGGTC	0.323																																						dbGAP											0													102.0	93.0	96.0					2																	26587746		1806	4062	5868	-	-	-	SO:0001583	missense	0				CCDS46240.1	2p23.3	2012-03-01			ENSG00000138018	ENSG00000138018	2.7.8.1		29361	protein-coding gene	gene with protein product	"""selenoprotein I"""	607915				11214970, 17132865	Standard	NM_033505		Approved	KIAA1724, SELI, SEPI	uc021veu.1	Q9C0D9	OTTHUMG00000151931	ENST00000260585.7:c.173T>C	2.37:g.26587746T>C	ENSP00000260585:p.Phe58Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q63ZE3	Missense_Mutation	SNP	pfam_CDP-OH_P_trans	p.F26S	ENST00000260585.7	37	c.77	CCDS46240.1	2	.	.	.	.	.	.	.	.	.	.	T	24.7	4.560293	0.86335	.	.	ENSG00000138018	ENST00000442141;ENST00000260585;ENST00000447170	T;T	0.42900	0.96;0.96	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.72684	0.3491	M	0.92784	3.345	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79614	-0.1730	10	0.66056	D	0.02	-23.6513	15.2725	0.73717	0.0:0.0:0.0:1.0	.	58	Q9C0D9	EPT1_HUMAN	S	26;58;58	ENSP00000415280:F26S;ENSP00000260585:F58S	ENSP00000260585:F58S	F	+	2	0	EPT1	26441250	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	7.272000	0.78516	2.285000	0.76669	0.533000	0.62120	TTT	EPT1	-	pfam_CDP-OH_P_trans	ENSG00000138018		0.323	EPT1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	EPT1	HGNC	protein_coding	OTTHUMT00000324484.3	126	0.00	0	T	NM_033505.2		26587746	26587746	+1	no_stop_codon	ENST00000442141	ensembl	human	known	69_37n	missense	204	15.35	37	SNP	1.000	C
EVI2B	2124	genome.wustl.edu	37	17	29632390	29632390	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr17:29632390G>T	ENST00000330927.4	-	2	392	c.238C>A	c.(238-240)Caa>Aaa	p.Q80K	NF1_ENST00000358273.4_Intron|NF1_ENST00000356175.3_Intron|CTD-2370N5.3_ENST00000578584.1_3'UTR|EVI2B_ENST00000544462.1_Missense_Mutation_p.Q95K|EVI2B_ENST00000577894.1_Missense_Mutation_p.Q80K	NM_006495.3	NP_006486.3	P34910	EVI2B_HUMAN	ecotropic viral integration site 2B	80						integral component of plasma membrane (GO:0005887)		p.0?(8)|p.?(3)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	12		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;6.88e-13)|Epithelial(4;8.95e-12)|OV - Ovarian serous cystadenocarcinoma(4;1.01e-11)|GBM - Glioblastoma multiforme(4;0.184)		GGTGTTGGTTGTCCAGCAGTG	0.438																																						dbGAP											11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											354.0	294.0	315.0					17																	29632390		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11266.1	17q11.2	2011-08-11			ENSG00000185862	ENSG00000185862		"""CD molecules"""	3500	protein-coding gene	gene with protein product		158381				1903357	Standard	NM_006495		Approved	D17S376, EVDB, CD361	uc002hgk.2	P34910	OTTHUMG00000132869	ENST00000330927.4:c.238C>A	17.37:g.29632390G>T	ENSP00000333779:p.Gln80Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4A7	Missense_Mutation	SNP	NULL	p.Q95K	ENST00000330927.4	37	c.283	CCDS11266.1	17	.	.	.	.	.	.	.	.	.	.	G	9.848	1.192884	0.21954	.	.	ENSG00000185862	ENST00000330927;ENST00000544462	T;T	0.42900	0.96;0.96	5.41	2.14	0.27477	.	0.333255	0.21374	N	0.075597	T	0.35038	0.0918	L	0.55103	1.725	0.09310	N	0.999998	B;B	0.13594	0.008;0.008	B;B	0.16289	0.015;0.015	T	0.29027	-1.0025	10	0.52906	T	0.07	-6.7348	7.6745	0.28478	0.0:0.1778:0.5091:0.3131	.	95;80	B7Z4A7;P34910	.;EVI2B_HUMAN	K	80;95	ENSP00000333779:Q80K;ENSP00000439738:Q95K	ENSP00000333779:Q80K	Q	-	1	0	EVI2B	26656516	0.241000	0.23857	0.007000	0.13788	0.179000	0.23085	1.164000	0.31810	0.204000	0.20548	0.561000	0.74099	CAA	EVI2B	-	NULL	ENSG00000185862		0.438	EVI2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVI2B	HGNC	protein_coding	OTTHUMT00000256349.2	402	0.99	4	G	NM_006495		29632390	29632390	-1	no_errors	ENST00000544462	ensembl	human	known	69_37n	missense	198	36.22	113	SNP	0.018	T
FAM157B	100132403	genome.wustl.edu	37	9	141107536	141107537	+	lincRNA	INS	-	-	GCA	rs367832601|rs554298933|rs370981092		TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr9:141107536_141107537insGCA	ENST00000446912.2	+	0	19_20							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		CGgcagcggcggcagcagcagc	0.545																																						dbGAP											0																																										-	-	-			0					9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141107543_141107545dupGCA		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000446912.2	37	NULL		9																																																																																			FAM157B	-	-	ENSG00000233013		0.545	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	FAM157B	HGNC	lincRNA	OTTHUMT00000055378.2	29	0.00	0	-	NM_001145249		141107536	141107537	+1	no_errors	ENST00000446912	ensembl	human	known	69_37n	rna	58	39.58	38	INS	0.033:0.036	GCA
BRINP3	339479	genome.wustl.edu	37	1	190067803	190067803	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr1:190067803A>T	ENST00000367462.3	-	8	1877	c.1646T>A	c.(1645-1647)aTg>aAg	p.M549K	BRINP3_ENST00000534846.1_Missense_Mutation_p.M447K	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	549					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											ACCCAAAATCATATGGACCAG	0.473																																						dbGAP											0													88.0	91.0	90.0					1																	190067803		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1646T>A	1.37:g.190067803A>T	ENSP00000356432:p.Met549Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.M549K	ENST00000367462.3	37	c.1646	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	A	17.59	3.426253	0.62733	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.20738	2.31;2.05	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.42063	0.1186	M	0.64404	1.975	0.80722	D	1	D;P	0.53462	0.96;0.717	D;P	0.64237	0.923;0.599	T	0.29792	-1.0000	10	0.87932	D	0	.	13.7983	0.63184	1.0:0.0:0.0:0.0	.	447;549	B7Z260;Q76B58	.;FAM5C_HUMAN	K	549;447	ENSP00000356432:M549K;ENSP00000438022:M447K	ENSP00000356432:M549K	M	-	2	0	FAM5C	188334426	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	9.237000	0.95368	2.143000	0.66587	0.482000	0.46254	ATG	FAM5C	-	NULL	ENSG00000162670		0.473	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5C	HGNC	protein_coding	OTTHUMT00000086278.1	61	0.00	0	A	NM_199051		190067803	190067803	-1	no_errors	ENST00000367462	ensembl	human	known	69_37n	missense	81	16.49	16	SNP	1.000	T
FGFR2	2263	genome.wustl.edu	37	10	123258034	123258034	+	Missense_Mutation	SNP	A	A	T	rs121913476		TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr10:123258034A>T	ENST00000358487.5	-	12	1919	c.1647T>A	c.(1645-1647)aaT>aaA	p.N549K	FGFR2_ENST00000357555.5_Missense_Mutation_p.N460K|FGFR2_ENST00000360144.3_Missense_Mutation_p.N461K|FGFR2_ENST00000369060.4_Missense_Mutation_p.N433K|FGFR2_ENST00000457416.2_Missense_Mutation_p.N550K|FGFR2_ENST00000351936.6_Missense_Mutation_p.N547K|FGFR2_ENST00000356226.4_Missense_Mutation_p.N432K|FGFR2_ENST00000369059.1_Missense_Mutation_p.N435K|FGFR2_ENST00000478859.1_Missense_Mutation_p.N321K|FGFR2_ENST00000346997.2_Missense_Mutation_p.N547K|FGFR2_ENST00000369056.1_Missense_Mutation_p.N550K|FGFR2_ENST00000369061.4_Missense_Mutation_p.N437K	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	549	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		N -> H (in CS; constitutive kinase activity). {ECO:0000269|PubMed:11781872}.		angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.N549K(21)|p.N547K(4)|p.N460K(4)|p.N550K(4)		breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	CTCCAAGAAGATTTATGATAT	0.423	N549K(AN3CA_ENDOMETRIUM)|N549K(MFE296_ENDOMETRIUM)	5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																													dbGAP		Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	33	Substitution - Missense(33)	endometrium(33)											169.0	151.0	157.0					10																	123258034		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.1647T>A	10.37:g.123258034A>T	ENSP00000351276:p.Asn549Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Missense_Mutation	SNP	pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.N550K	ENST00000358487.5	37	c.1650	CCDS31298.1	10	.	.	.	.	.	.	.	.	.	.	A	18.86	3.713491	0.68730	.	.	ENSG00000066468	ENST00000357555;ENST00000369062;ENST00000369061;ENST00000358487;ENST00000356226;ENST00000369060;ENST00000369059;ENST00000429361;ENST00000346997;ENST00000457416;ENST00000351936;ENST00000360144;ENST00000369056;ENST00000369058;ENST00000336553	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7	5.02	2.67	0.31697	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87382	0.6163	N	0.04880	-0.145	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.997;0.999;1.0;1.0;1.0;0.999;1.0;1.0	D	0.85769	0.1354	10	0.87932	D	0	.	7.515	0.27596	0.7605:0.0:0.2395:0.0	.	566;548;460;432;549;461;550;452	D3DRD5;P21802-18;P21802-21;P21802-20;P21802;P21802-22;P21802-17;D3DRD3	.;.;.;.;FGFR2_HUMAN;.;.;.	K	460;550;437;549;432;433;435;141;547;550;547;461;550;550;458	ENSP00000350166:N460K;ENSP00000358057:N437K;ENSP00000351276:N549K;ENSP00000348559:N432K;ENSP00000358056:N433K;ENSP00000358055:N435K;ENSP00000404219:N141K;ENSP00000263451:N547K;ENSP00000410294:N550K;ENSP00000309878:N547K;ENSP00000353262:N461K;ENSP00000358052:N550K;ENSP00000358054:N550K;ENSP00000337665:N458K	ENSP00000337665:N458K	N	-	3	2	FGFR2	123248024	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.247000	0.32815	0.269000	0.21961	0.482000	0.46254	AAT	FGFR2	-	pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000066468		0.423	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	FGFR2	HGNC	protein_coding	OTTHUMT00000050715.1	193	0.00	0	A	NM_022976, NM_000141		123258034	123258034	-1	no_errors	ENST00000457416	ensembl	human	known	69_37n	missense	130	23.84	41	SNP	1.000	T
FLG	2312	genome.wustl.edu	37	1	152275600	152275600	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr1:152275600T>C	ENST00000368799.1	-	3	11797	c.11762A>G	c.(11761-11763)gAc>gGc	p.D3921G	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3921	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGTACTAGAGTCTGACTGTAC	0.498									Ichthyosis																													dbGAP											0													121.0	117.0	119.0					1																	152275600		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11762A>G	1.37:g.152275600T>C	ENSP00000357789:p.Asp3921Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.D3921G	ENST00000368799.1	37	c.11762	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	T	4.587	0.108981	0.08780	.	.	ENSG00000143631	ENST00000368799	T	0.04551	3.6	2.81	-0.825	0.10809	.	.	.	.	.	T	0.01254	0.0041	L	0.36672	1.1	0.09310	N	1	P	0.48764	0.915	B	0.44108	0.441	T	0.43294	-0.9400	9	0.14656	T	0.56	.	5.5835	0.17262	0.0:0.4962:0.0:0.5037	.	3921	P20930	FILA_HUMAN	G	3921	ENSP00000357789:D3921G	ENSP00000357789:D3921G	D	-	2	0	FLG	150542224	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.450000	0.06803	-0.057000	0.13199	-0.256000	0.11100	GAC	FLG	-	NULL	ENSG00000143631		0.498	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	134	0.00	0	T	NM_002016		152275600	152275600	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	139	14.20	23	SNP	0.000	C
GNL1	2794	genome.wustl.edu	37	6	30513924	30513924	+	Silent	SNP	C	C	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr6:30513924C>T	ENST00000376621.3	-	12	2719	c.1749G>A	c.(1747-1749)gaG>gaA	p.E583E		NM_005275.3	NP_005266.2	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1	583	Asp/Glu-rich (highly acidic).				cellular response to DNA damage stimulus (GO:0006974)|GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)|signal transduction (GO:0007165)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			cervix(2)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						AGGTTGGGGTctcctcatccc	0.637																																						dbGAP											0													109.0	73.0	85.0					6																	30513924		2199	4289	6488	-	-	-	SO:0001819	synonymous_variant	0				CCDS4680.1	6p21.3	2010-02-17			ENSG00000204590	ENSG00000204590			4413	protein-coding gene	gene with protein product		143024				8180467	Standard	NM_005275		Approved	HSR1	uc003nqh.3	P36915	OTTHUMG00000031137	ENST00000376621.3:c.1749G>A	6.37:g.30513924C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0S838|Q96CT5	Silent	SNP	pfam_GTP_binding_domain	p.E583	ENST00000376621.3	37	c.1749	CCDS4680.1	6																																																																																			GNL1	-	NULL	ENSG00000204590		0.637	GNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL1	HGNC	protein_coding	OTTHUMT00000076241.2	62	0.00	0	C			30513924	30513924	-1	no_errors	ENST00000376621	ensembl	human	known	69_37n	silent	92	20.00	23	SNP	1.000	T
HMCN1	83872	genome.wustl.edu	37	1	186122990	186122990	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr1:186122990G>A	ENST00000271588.4	+	97	15356	c.15127G>A	c.(15127-15129)Gtt>Att	p.V5043I	HMCN1_ENST00000367492.2_Missense_Mutation_p.V5043I	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5043	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GAACCACACCGTTTTCTATGA	0.483																																						dbGAP											0													119.0	104.0	109.0					1																	186122990		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.15127G>A	1.37:g.186122990G>A	ENSP00000271588:p.Val5043Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.V5043I	ENST00000271588.4	37	c.15127	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.480539	0.01027	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.12465	2.68;2.68	5.62	-3.41	0.04839	G2 nidogen/fibulin G2F (2);Green fluorescent protein-like (1);	0.259719	0.43110	N	0.000618	T	0.02047	0.0064	N	0.00132	-2.035	0.09310	N	0.999999	B	0.06786	0.001	B	0.09377	0.004	T	0.41342	-0.9514	10	0.02654	T	1	.	14.8236	0.70091	0.8706:0.0:0.1294:0.0	.	5043	Q96RW7	HMCN1_HUMAN	I	5043	ENSP00000271588:V5043I;ENSP00000356462:V5043I	ENSP00000271588:V5043I	V	+	1	0	HMCN1	184389613	0.171000	0.23029	0.003000	0.11579	0.069000	0.16628	0.897000	0.28390	-0.461000	0.06993	-0.982000	0.02568	GTT	HMCN1	-	pfam_G2_nidogen/fibulin_G2F,superfamily_Green_fluorescent_prot-like,smart_G2_nidogen/fibulin_G2F,pfscan_G2_nidogen/fibulin_G2F	ENSG00000143341		0.483	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	104	0.00	0	G	NM_031935		186122990	186122990	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	80	20.00	20	SNP	0.223	A
HS6ST2	90161	genome.wustl.edu	37	X	131762777	131762777	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chrX:131762777A>C	ENST00000370836.2	-	4	1707	c.1292T>G	c.(1291-1293)tTc>tGc	p.F431C	HS6ST2_ENST00000406696.3_Missense_Mutation_p.F157C|HS6ST2_ENST00000521489.1_Missense_Mutation_p.F471C|HS6ST2_ENST00000370833.2_Missense_Mutation_p.F325C	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	431					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					AGTGAGGCCGAAGAACGCCAT	0.458																																						dbGAP											0													89.0	86.0	87.0					X																	131762777		1952	4141	6093	-	-	-	SO:0001583	missense	0			AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.1292T>G	X.37:g.131762777A>C	ENSP00000359873:p.Phe431Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Missense_Mutation	SNP	pfam_Sulfotransferase	p.F471C	ENST00000370836.2	37	c.1412	CCDS48169.1	X	.	.	.	.	.	.	.	.	.	.	A	14.60	2.582589	0.46006	.	.	ENSG00000171004	ENST00000370837;ENST00000370836;ENST00000521489;ENST00000406696;ENST00000370833	T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94	6.02	4.85	0.62838	.	0.045491	0.85682	D	0.000000	D	0.87002	0.6069	M	0.88181	2.935	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.979	D	0.87610	0.2503	10	0.87932	D	0	-0.7558	10.4824	0.44702	0.9239:0.0:0.0761:0.0	.	431;471;157	Q96MM7;E9PDY5;B7Z5H6	H6ST2_HUMAN;.;.	C	285;431;471;157;325	ENSP00000359874:F285C;ENSP00000359873:F431C;ENSP00000429473:F471C;ENSP00000384013:F157C;ENSP00000359870:F325C	ENSP00000359870:F325C	F	-	2	0	HS6ST2	131590458	0.999000	0.42202	0.721000	0.30653	0.968000	0.65278	3.991000	0.56973	0.875000	0.35847	0.486000	0.48141	TTC	HS6ST2	-	pfam_Sulfotransferase	ENSG00000171004		0.458	HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HS6ST2	HGNC	protein_coding	OTTHUMT00000058332.3	78	0.00	0	A	NM_147174		131762777	131762777	-1	no_errors	ENST00000521489	ensembl	human	known	69_37n	missense	53	28.38	21	SNP	0.975	C
HSD17B6	8630	genome.wustl.edu	37	12	57167880	57167880	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr12:57167880C>G	ENST00000554643.1	+	3	593	c.244C>G	c.(244-246)Ctg>Gtg	p.L82V	HSD17B6_ENST00000555805.1_Missense_Mutation_p.L82V|HSD17B6_ENST00000554150.1_Missense_Mutation_p.L82V|HSD17B6_ENST00000322165.1_Missense_Mutation_p.L82V|HSD17B6_ENST00000555159.1_Missense_Mutation_p.L82V			O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6	82					androgen biosynthetic process (GO:0006702)|androgen catabolic process (GO:0006710)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|intracellular (GO:0005622)|membrane (GO:0016020)	catalytic activity (GO:0003824)|electron carrier activity (GO:0009055)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|oxidoreductase activity (GO:0016491)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			endometrium(1)|large_intestine(2)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10					Succinic acid(DB00139)	GACGGTGACCCTGGATGTTAC	0.552																																						dbGAP											0													68.0	70.0	69.0					12																	57167880		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF016509	CCDS8925.1	12q13.3	2012-12-07	2012-12-07		ENSG00000025423	ENSG00000025423	1.1.1.62, 1.1.1.63, 1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	23316	protein-coding gene	gene with protein product	"""oxidative 3-alpha-hydroxysteroid-dehydrogenase"", ""3(alpha->beta)-hydroxysteroid epimerasel"", ""retinol dehydrogenase"", ""oxidoreductase"", ""NAD+ -dependent 3 alpha-hydroxysteroid dehydrogenase"", ""3-hydroxysteroid epimerase"", ""short chain dehydrogenase/reductase family 9C, member 6"""	606623	"""hydroxysteroid (17-beta) dehydrogenase 6"", ""hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)"""			11165032, 19027726	Standard	XM_005269207		Approved	HSE, RODH, SDR9C6	uc001smg.1	O14756	OTTHUMG00000170854	ENST00000554643.1:c.244C>G	12.37:g.57167880C>G	ENSP00000451406:p.Leu82Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O43275	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.L82V	ENST00000554643.1	37	c.244	CCDS8925.1	12	.	.	.	.	.	.	.	.	.	.	C	12.91	2.078716	0.36662	.	.	ENSG00000025423	ENST00000555159;ENST00000555805;ENST00000554643;ENST00000554150;ENST00000554155;ENST00000322165	D;D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23;-2.23;-2.23	5.08	5.08	0.68730	NAD(P)-binding domain (1);	0.000000	0.42420	D	0.000712	D	0.88429	0.6434	L	0.46157	1.445	0.39281	D	0.964558	D	0.59357	0.985	D	0.63283	0.913	D	0.88144	0.2846	10	0.59425	D	0.04	.	6.7662	0.23568	0.1774:0.7351:0.0:0.0874	.	82	O14756	H17B6_HUMAN	V	82	ENSP00000450698:L82V;ENSP00000451753:L82V;ENSP00000451406:L82V;ENSP00000452273:L82V;ENSP00000451497:L82V;ENSP00000318631:L82V	ENSP00000318631:L82V	L	+	1	2	HSD17B6	55454147	0.800000	0.28916	1.000000	0.80357	0.009000	0.06853	1.476000	0.35420	2.810000	0.96702	0.655000	0.94253	CTG	HSD17B6	-	pfam_DH_sc/Rdtase_SDR	ENSG00000025423		0.552	HSD17B6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSD17B6	HGNC	protein_coding	OTTHUMT00000410714.1	39	0.00	0	C	NM_003725		57167880	57167880	+1	no_errors	ENST00000322165	ensembl	human	known	69_37n	missense	74	14.94	13	SNP	0.996	G
HTR3B	9177	genome.wustl.edu	37	11	113815320	113815320	+	Silent	SNP	C	C	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr11:113815320C>T	ENST00000260191.2	+	8	1190	c.933C>T	c.(931-933)gcC>gcT	p.A311A	HTR3B_ENST00000537778.1_Silent_p.A300A	NM_006028.4	NP_006019.1	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B, ionotropic	311					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ion channel activity (GO:0005216)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(11)	20		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	Ergoloid mesylate(DB01049)	TCTGCATGGCCTTCTTGGTTC	0.502																																						dbGAP											0													215.0	168.0	184.0					11																	113815320		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF080582	CCDS8364.1	11q23.1	2012-05-22	2012-02-03		ENSG00000149305	ENSG00000149305		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5298	protein-coding gene	gene with protein product		604654	"""5-hydroxytryptamine (serotonin) receptor 3B"""			9950429, 10521471	Standard	NM_006028		Approved	5-HT3B	uc001pok.3	O95264	OTTHUMG00000168210	ENST00000260191.2:c.933C>T	11.37:g.113815320C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ23|Q0VJC3	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_5HT3_rcpt_A,prints_Neur_channel	p.L170F	ENST00000260191.2	37	c.508	CCDS8364.1	11	.	.	.	.	.	.	.	.	.	.	C	9.836	1.189641	0.21954	.	.	ENSG00000149305	ENST00000543092	.	.	.	5.11	4.2	0.49525	.	.	.	.	.	T	0.54775	0.1879	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51725	-0.8669	4	.	.	.	-18.0646	5.4437	0.16523	0.1436:0.6385:0.139:0.0789	.	.	.	.	F	170	.	.	L	+	1	0	HTR3B	113320530	0.989000	0.36119	0.999000	0.59377	0.741000	0.42261	0.355000	0.20163	1.158000	0.42547	0.655000	0.94253	CTT	HTR3B	-	NULL	ENSG00000149305		0.502	HTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR3B	HGNC	protein_coding	OTTHUMT00000398842.1	235	0.00	0	C	NM_006028		113815320	113815320	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000543092	ensembl	human	putative	69_37n	missense	161	16.58	32	SNP	0.995	T
IFT122	55764	genome.wustl.edu	37	3	129195606	129195606	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr3:129195606C>G	ENST00000348417.2	+	11	1186	c.1109C>G	c.(1108-1110)aCt>aGt	p.T370S	IFT122_ENST00000296266.3_Missense_Mutation_p.T421S|IFT122_ENST00000431818.2_Missense_Mutation_p.T220S|IFT122_ENST00000440957.2_Missense_Mutation_p.T161S|IFT122_ENST00000507564.1_Missense_Mutation_p.T362S|IFT122_ENST00000349441.2_Missense_Mutation_p.T259S|IFT122_ENST00000504021.1_Missense_Mutation_p.T264S|IFT122_ENST00000347300.2_Missense_Mutation_p.T311S	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	370					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						GATAGCATGACTGACGTCATT	0.547																																						dbGAP											0													83.0	78.0	79.0					3																	129195606		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.1109C>G	3.37:g.129195606C>G	ENSP00000324005:p.Thr370Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T421S	ENST00000348417.2	37	c.1262	CCDS3061.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.4|27.4	4.826426|4.826426	0.90955|0.90955	.|.	.|.	ENSG00000163913|ENSG00000163913	ENST00000515783|ENST00000347300;ENST00000296266;ENST00000507564;ENST00000454840;ENST00000431818;ENST00000504021;ENST00000349441;ENST00000348417;ENST00000446384;ENST00000440957	.|T;T;T;T;T;T;T;T	.|0.69926	.|3.25;-0.44;-0.23;-0.1;0.39;0.38;0.22;-0.08	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.83885|0.83885	0.5351|0.5351	M|M	0.83384|0.83384	2.64|2.64	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D	.|0.76494	.|0.998;0.982;0.999;0.995;0.995;0.997;0.997;0.998	.|D;D;D;P;P;D;D;D	.|0.76071	.|0.987;0.952;0.922;0.893;0.893;0.95;0.97;0.987	D|D	0.84479|0.84479	0.0604|0.0604	5|10	.|0.52906	.|T	.|0.07	-16.7806|-16.7806	19.7278|19.7278	0.96172|0.96172	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|161;362;264;210;259;311;370;421	.|E9PDG2;E7EQF4;B4DEY9;B4DPW7;Q9BTY4;Q9HBG6-3;Q9HBG6;G3XAB1	.|.;.;.;.;.;.;IF122_HUMAN;.	E|S	196|311;421;362;311;220;264;259;370;210;161	.|ENSP00000323973:T311S;ENSP00000296266:T421S;ENSP00000425536:T362S;ENSP00000410946:T220S;ENSP00000422179:T264S;ENSP00000324165:T259S;ENSP00000324005:T370S;ENSP00000401569:T161S	.|ENSP00000296266:T421S	D|T	+|+	3|2	2|0	IFT122|IFT122	130678296|130678296	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.906000|0.906000	0.53458|0.53458	7.440000|7.440000	0.80464|0.80464	2.656000|2.656000	0.90262|0.90262	0.591000|0.591000	0.81541|0.81541	GAC|ACT	IFT122	-	NULL	ENSG00000163913		0.547	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFT122	HGNC	protein_coding	OTTHUMT00000355852.1	51	0.00	0	C	NM_018262		129195606	129195606	+1	no_errors	ENST00000296266	ensembl	human	known	69_37n	missense	73	10.98	9	SNP	1.000	G
IL13RA2	3598	genome.wustl.edu	37	X	114242525	114242525	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chrX:114242525T>C	ENST00000371936.1	-	9	1216	c.967A>G	c.(967-969)Agt>Ggt	p.S323G	IL13RA2_ENST00000243213.1_Missense_Mutation_p.S323G			Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2	323	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	23						CTCCACTCACTCCAAATTCCG	0.338																																						dbGAP											0													227.0	194.0	205.0					X																	114242525		2203	4300	6503	-	-	-	SO:0001583	missense	0			X95302	CCDS14565.1	Xq23	2014-01-21			ENSG00000123496	ENSG00000123496		"""Interleukins and interleukin receptors"", ""CD molecules"""	5975	protein-coding gene	gene with protein product	"""cancer/testis antigen 19"""	300130				8663118, 9083087	Standard	NM_000640		Approved	IL-13R, IL13BP, CD213a2, CT19	uc004epx.3	Q14627	OTTHUMG00000022229	ENST00000371936.1:c.967A>G	X.37:g.114242525T>C	ENSP00000361004:p.Ser323Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7E2|O00667	Missense_Mutation	SNP	pfam_IL6_recept-bd,superfamily_Fibronectin_type3	p.S323G	ENST00000371936.1	37	c.967	CCDS14565.1	X	.	.	.	.	.	.	.	.	.	.	t	17.39	3.376327	0.61735	.	.	ENSG00000123496	ENST00000371936;ENST00000243213	T;T	0.80393	-1.37;-1.37	3.96	3.96	0.45880	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.300282	0.43260	D	0.000598	D	0.87985	0.6316	M	0.81341	2.54	0.54753	D	0.999984	D	0.89917	1.0	D	0.97110	1.0	D	0.87991	0.2749	10	0.62326	D	0.03	-18.7539	8.3883	0.32514	0.0:0.0:0.0:1.0	.	323	Q14627	I13R2_HUMAN	G	323	ENSP00000361004:S323G;ENSP00000243213:S323G	ENSP00000243213:S323G	S	-	1	0	IL13RA2	114148781	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.364000	0.59479	1.573000	0.49748	0.438000	0.28831	AGT	IL13RA2	-	superfamily_Fibronectin_type3	ENSG00000123496		0.338	IL13RA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL13RA2	HGNC	protein_coding	OTTHUMT00000057966.1	380	0.00	0	T	NM_000640		114242525	114242525	-1	no_errors	ENST00000243213	ensembl	human	known	69_37n	missense	209	23.72	65	SNP	1.000	C
IL18BP	10068	genome.wustl.edu	37	11	71712371	71712371	+	Splice_Site	SNP	G	G	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr11:71712371G>C	ENST00000393703.4	+	4	896		c.e4+1		IL18BP_ENST00000531053.1_Splice_Site|IL18BP_ENST00000393707.4_Intron|IL18BP_ENST00000393705.4_Splice_Site|IL18BP_ENST00000337131.5_Splice_Site|IL18BP_ENST00000404792.1_Splice_Site|IL18BP_ENST00000260049.5_Splice_Site|IL18BP_ENST00000497194.2_Splice_Site	NM_001039660.1	NP_001034749.1	O95998	I18BP_HUMAN	interleukin 18 binding protein						cellular response to hydrogen peroxide (GO:0070301)|cellular response to tumor necrosis factor (GO:0071356)|extracellular negative regulation of signal transduction (GO:1900116)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	interleukin-18 binding (GO:0042007)|receptor antagonist activity (GO:0048019)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						GGAGCACCAGGTGAGGGTCGC	0.637																																						dbGAP											0													39.0	42.0	41.0					11																	71712371		2070	4181	6251	-	-	-	SO:0001630	splice_region_variant	0			AF110798	CCDS8206.2, CCDS44666.1	11q13	2013-01-11			ENSG00000137496	ENSG00000137496		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5987	protein-coding gene	gene with protein product	"""MC51L-53L-54L homolog gene product"""	604113				10023777	Standard	NM_001145055		Approved	IL18BPa	uc001orf.1	O95998	OTTHUMG00000133713	ENST00000393703.4:c.359+1G>C	11.37:g.71712371G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUZ0|B7WPK4|O95993|O96027|Q9NZA9|Q9UBR7	Splice_Site	SNP	-	e3+1	ENST00000393703.4	37	c.359+1	CCDS8206.2	11	.	.	.	.	.	.	.	.	.	.	G	15.12	2.737865	0.49045	.	.	ENSG00000137496	ENST00000393703;ENST00000497194;ENST00000393705;ENST00000337131;ENST00000531053;ENST00000404792;ENST00000260049	.	.	.	4.64	4.64	0.57946	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0566	0.71917	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IL18BP	71390019	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	5.642000	0.67888	2.402000	0.81655	0.561000	0.74099	.	IL18BP	-	-	ENSG00000137496		0.637	IL18BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IL18BP	HGNC	protein_coding	OTTHUMT00000258012.2	46	0.00	0	G	NM_173042	Intron	71712371	71712371	+1	no_errors	ENST00000260049	ensembl	human	known	69_37n	splice_site	46	13.21	7	SNP	1.000	C
ITIH1	3697	genome.wustl.edu	37	3	52822303	52822303	+	Silent	SNP	C	C	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr3:52822303C>T	ENST00000273283.2	+	18	2085	c.2061C>T	c.(2059-2061)tgC>tgT	p.C687C	ITIH1_ENST00000542827.1_Missense_Mutation_p.L642F|ITIH1_ENST00000405128.3_Silent_p.C53C|ITIH1_ENST00000540715.1_Silent_p.C545C|ITIH1_ENST00000537050.1_Silent_p.C399C	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	687	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		ACACCCTGTGCTTCAACATCA	0.567																																						dbGAP											0													123.0	99.0	107.0					3																	52822303		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.2061C>T	3.37:g.52822303C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.L642F	ENST00000273283.2	37	c.1924	CCDS2864.1	3	.	.	.	.	.	.	.	.	.	.	C	15.30	2.792184	0.50102	.	.	ENSG00000055957	ENST00000542827	T	0.02472	4.28	5.39	3.3	0.37823	.	.	.	.	.	T	0.05640	0.0148	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31833	-0.9929	6	0.56958	D	0.05	-24.1301	4.5646	0.12177	0.0:0.6194:0.0:0.3806	.	.	.	.	F	642	ENSP00000442584:L642F	ENSP00000442584:L642F	L	+	1	0	ITIH1	52797343	0.997000	0.39634	1.000000	0.80357	0.942000	0.58702	0.452000	0.21795	1.249000	0.43950	0.655000	0.94253	CTT	ITIH1	-	NULL	ENSG00000055957		0.567	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH1	HGNC	protein_coding	OTTHUMT00000317522.1	127	0.00	0	C	NM_002215		52822303	52822303	+1	no_errors	ENST00000542827	ensembl	human	known	69_37n	missense	72	14.29	12	SNP	1.000	T
KCNJ15	3772	genome.wustl.edu	37	21	39671727	39671727	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr21:39671727C>A	ENST00000328656.4	+	4	847	c.544C>A	c.(544-546)Cac>Aac	p.H182N	KCNJ15_ENST00000398930.1_Missense_Mutation_p.H182N|KCNJ15_ENST00000398932.1_Missense_Mutation_p.H182N|KCNJ15_ENST00000398934.1_Missense_Mutation_p.H182N|KCNJ15_ENST00000398938.2_Missense_Mutation_p.H182N	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	182					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	CAAGTTCAGCCACTGTGCAGT	0.507																																						dbGAP											0													65.0	62.0	63.0					21																	39671727		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.544C>A	21.37:g.39671727C>A	ENSP00000331698:p.His182Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir1.3,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir1.1	p.H182N	ENST00000328656.4	37	c.544	CCDS13656.1	21	.	.	.	.	.	.	.	.	.	.	C	9.845	1.192218	0.21954	.	.	ENSG00000157551	ENST00000328656;ENST00000398938;ENST00000398932;ENST00000438657;ENST00000398930;ENST00000398934	D;D;D;D;D;D	0.91124	-2.79;-2.79;-2.79;-2.79;-2.79;-2.79	5.83	5.83	0.93111	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.363286	0.31734	N	0.007158	T	0.81574	0.4851	N	0.11845	0.185	0.38812	D	0.955434	B	0.09022	0.002	B	0.09377	0.004	T	0.76558	-0.2915	9	.	.	.	.	14.9154	0.70792	0.1431:0.8569:0.0:0.0	.	182	Q99712	IRK15_HUMAN	N	182	ENSP00000331698:H182N;ENSP00000381911:H182N;ENSP00000381905:H182N;ENSP00000414487:H182N;ENSP00000381904:H182N;ENSP00000381907:H182N	.	H	+	1	0	KCNJ15	38593597	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.739000	0.38217	2.770000	0.95276	0.655000	0.94253	CAC	KCNJ15	-	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir1.3	ENSG00000157551		0.507	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ15	HGNC	protein_coding	OTTHUMT00000207181.2	30	0.00	0	C	NM_002243		39671727	39671727	+1	no_errors	ENST00000328656	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	1.000	A
KCNN3	3782	genome.wustl.edu	37	1	154841911	154841911	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr1:154841911G>T	ENST00000271915.4	-	1	845	c.530C>A	c.(529-531)tCc>tAc	p.S177Y	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	182					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	ATACTTGCAGGAGCTCATGGC	0.672																																						dbGAP											0													41.0	43.0	43.0					1																	154841911		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.530C>A	1.37:g.154841911G>T	ENSP00000271915:p.Ser177Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.S177Y	ENST00000271915.4	37	c.530	CCDS30880.1	1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914207	0.52546	.	.	ENSG00000143603	ENST00000271915	D	0.97850	-4.57	4.75	4.75	0.60458	.	0.163585	0.29522	N	0.011920	D	0.95974	0.8689	N	0.14661	0.345	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.80764	0.994;0.979	D	0.96704	0.9520	10	0.87932	D	0	-18.1588	11.0426	0.47840	0.0:0.1879:0.8121:0.0	.	183;182	Q6JXY2;Q9UGI6	.;KCNN3_HUMAN	Y	177	ENSP00000271915:S177Y	ENSP00000271915:S177Y	S	-	2	0	KCNN3	153108535	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.727000	0.47311	2.461000	0.83175	0.563000	0.77884	TCC	KCNN3	-	NULL	ENSG00000143603		0.672	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	25	0.00	0	G	NM_002249		154841911	154841911	-1	no_errors	ENST00000271915	ensembl	human	known	69_37n	missense	72	14.29	12	SNP	1.000	T
KIAA0586	9786	genome.wustl.edu	37	14	58925191	58925191	+	Splice_Site	SNP	A	A	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr14:58925191A>G	ENST00000556134.1	+	13	1813	c.1539A>G	c.(1537-1539)agA>agG	p.R513R	KIAA0586_ENST00000261244.5_Splice_Site_p.R528R|KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000423743.3_Splice_Site_p.R484R|KIAA0586_ENST00000354386.6_Splice_Site_p.R581R	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	513	Required for centrosomal localization. {ECO:0000250}.				cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TCTTTTATAGAGAGATGTCAG	0.338																																						dbGAP											0													29.0	28.0	28.0					14																	58925191		1789	4011	5800	-	-	-	SO:0001630	splice_region_variant	0			AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.1539-1A>G	14.37:g.58925191A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Silent	SNP	NULL	p.R513	ENST00000556134.1	37	c.1539	CCDS58321.1	14																																																																																			KIAA0586	-	NULL	ENSG00000100578		0.338	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0586	HGNC	protein_coding	OTTHUMT00000411887.1	34	0.00	0	A	NM_014749	Silent	58925191	58925191	+1	no_errors	ENST00000556134	ensembl	human	known	69_37n	silent	35	18.60	8	SNP	0.998	G
KIAA1324L	222223	genome.wustl.edu	37	7	86537782	86537782	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr7:86537782C>A	ENST00000450689.2	-	17	2622	c.2437G>T	c.(2437-2439)Gat>Tat	p.D813Y	KIAA1324L_ENST00000444627.1_Missense_Mutation_p.D742Y|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.D573Y|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.D646Y	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	813						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					AAATGCACATCTGGTATTTGG	0.294																																						dbGAP											0													115.0	121.0	119.0					7																	86537782		2202	4296	6498	-	-	-	SO:0001583	missense	0			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.2437G>T	7.37:g.86537782C>A	ENSP00000413445:p.Asp813Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Growth_fac_rcpt	p.D813Y	ENST00000450689.2	37	c.2437	CCDS47632.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.95|18.95	3.731059|3.731059	0.69074|0.69074	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314|ENST00000423294	T;T;T;T|.	0.04015|.	3.73;3.73;3.73;3.73|.	5.8|5.8	5.8|5.8	0.92144|0.92144	Mannose-6-phosphate receptor, binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82360|0.82360	0.5020|0.5020	M|M	0.83012|0.83012	2.62|2.62	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.85130|.	0.997;0.983;0.971|.	T|T	0.82680|0.82680	-0.0337|-0.0337	10|5	0.72032|.	D|.	0.01|.	.|.	19.0588|19.0588	0.93078|0.93078	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	813;573;646|.	A8MWY0;A8MWY0-2;B4DJV3|.	K132L_HUMAN;.;.|.	Y|I	813;573;742;646|773	ENSP00000413445:D813Y;ENSP00000297222:D573Y;ENSP00000397377:D742Y;ENSP00000402390:D646Y|.	ENSP00000297222:D573Y|.	D|R	-|-	1|2	0|0	KIAA1324L|KIAA1324L	86375718|86375718	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.460000|4.460000	0.60108|0.60108	2.744000|2.744000	0.94065|0.94065	0.655000|0.655000	0.94253|0.94253	GAT|AGA	KIAA1324L	-	superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000164659		0.294	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1324L	HGNC	protein_coding	OTTHUMT00000333372.3	188	0.00	0	C	NM_152748		86537782	86537782	-1	no_errors	ENST00000450689	ensembl	human	known	69_37n	missense	121	24.84	40	SNP	1.000	A
KRT31	3881	genome.wustl.edu	37	17	39550341	39550341	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr17:39550341C>G	ENST00000251645.2	-	7	1230	c.1178G>C	c.(1177-1179)tGt>tCt	p.C393S		NM_002277.2	NP_002268.2	Q15323	K1H1_HUMAN	keratin 31	393	Tail.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	31		Breast(137;0.000496)				AGGAGGGACACAAGAGGTACA	0.612																																						dbGAP											0													117.0	93.0	101.0					17																	39550341		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86570	CCDS11391.1	17q21.2	2014-05-20	2006-07-17	2006-07-17	ENSG00000094796	ENSG00000094796		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6448	protein-coding gene	gene with protein product	"""hard keratin type I 1"""	601077	"""keratin, hair, acidic, 1"""	KRTHA1		7578244, 16831889	Standard	NM_002277		Approved	Ha-1	uc002hwn.3	Q15323	OTTHUMG00000133423	ENST00000251645.2:c.1178G>C	17.37:g.39550341C>G	ENSP00000251645:p.Cys393Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UE12	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.C393S	ENST00000251645.2	37	c.1178	CCDS11391.1	17	.	.	.	.	.	.	.	.	.	.	c	11.02	1.514873	0.27123	.	.	ENSG00000094796	ENST00000251645	T	0.80909	-1.43	5.38	5.38	0.77491	.	0.000000	0.34555	U	0.003877	D	0.82793	0.5114	L	0.36672	1.1	0.32523	N	0.536016	P	0.50156	0.932	P	0.60789	0.879	D	0.83604	0.0130	10	0.30854	T	0.27	.	14.6324	0.68666	0.0:1.0:0.0:0.0	.	393	Q15323	K1H1_HUMAN	S	393	ENSP00000251645:C393S	ENSP00000251645:C393S	C	-	2	0	KRT31	36803867	0.992000	0.36948	0.928000	0.36995	0.005000	0.04900	3.719000	0.54926	2.525000	0.85131	0.655000	0.94253	TGT	KRT31	-	NULL	ENSG00000094796		0.612	KRT31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT31	HGNC	protein_coding	OTTHUMT00000257286.1	94	0.00	0	C	NM_002277		39550341	39550341	-1	no_errors	ENST00000251645	ensembl	human	known	69_37n	missense	91	13.33	14	SNP	0.977	G
KRTAP15-1	254950	genome.wustl.edu	37	21	31812853	31812853	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr21:31812853T>A	ENST00000334067.3	+	1	257	c.208T>A	c.(208-210)Tcc>Acc	p.S70T		NM_181623.1	NP_853654.1	Q3LI76	KR151_HUMAN	keratin associated protein 15-1	70						intermediate filament (GO:0005882)				kidney(1)|large_intestine(3)|lung(6)|skin(1)	11						TTTGGCCAGATCCTATCAGAC	0.517																																						dbGAP											0													125.0	117.0	120.0					21																	31812853		2203	4300	6503	-	-	-	SO:0001583	missense	0			AP001708	CCDS13593.1	21q22.1	2008-05-21			ENSG00000186970	ENSG00000186970		"""Keratin associated proteins"""	18927	protein-coding gene	gene with protein product						12359730	Standard	NM_181623		Approved	KAP15.1	uc002yod.3	Q3LI76	OTTHUMG00000057784	ENST00000334067.3:c.208T>A	21.37:g.31812853T>A	ENSP00000334866:p.Ser70Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3F4	Missense_Mutation	SNP	pfam_PMG	p.S70T	ENST00000334067.3	37	c.208	CCDS13593.1	21	.	.	.	.	.	.	.	.	.	.	T	11.83	1.756429	0.31137	.	.	ENSG00000186970	ENST00000334067	T	0.03181	4.02	4.48	-5.71	0.02413	.	1.840360	0.02922	N	0.138130	T	0.05318	0.0141	M	0.63843	1.955	0.09310	N	1	P	0.34684	0.463	B	0.35859	0.212	T	0.34675	-0.9819	10	0.87932	D	0	-0.0107	4.6427	0.12558	0.4099:0.3787:0.0:0.2114	.	70	Q3LI76	KR151_HUMAN	T	70	ENSP00000334866:S70T	ENSP00000334866:S70T	S	+	1	0	KRTAP15-1	30734724	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.017000	0.01445	-1.147000	0.02851	-1.140000	0.01884	TCC	KRTAP15-1	-	pfam_PMG	ENSG00000186970		0.517	KRTAP15-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP15-1	HGNC	protein_coding	OTTHUMT00000128236.1	62	0.00	0	T			31812853	31812853	+1	no_errors	ENST00000334067	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	0.000	A
KRTAP5-8	57830	genome.wustl.edu	37	11	71249117	71249118	+	In_Frame_Ins	INS	-	-	CCG			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr11:71249117_71249118insCCG	ENST00000398534.3	+	1	47_48	c.16_17insCCG	c.(16-18)tgc>tCCGgc	p.6_6C>SG		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	6						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						CTGCTGTGGCTGCTCTGGAGGC	0.658																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	Exception_encountered	11.37:g.71249117_71249118insCCG	ENSP00000420723:p.Cys6delinsSerGly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6L8G7|Q6UTX6	In_Frame_Ins	INS	NULL	p.C6in_frame_insSG	ENST00000398534.3	37	c.16_17	CCDS41683.1	11																																																																																			KRTAP5-8	-	NULL	ENSG00000241233		0.658	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-8	HGNC	protein_coding	OTTHUMT00000127954.1	53	0.00	0	-	NM_021046		71249117	71249118	+1	no_errors	ENST00000398534	ensembl	human	known	69_37n	in_frame_ins	56	11.11	7	INS	0.913:0.882	CCG
LAMC1	3915	genome.wustl.edu	37	1	182993128	182993128	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr1:182993128G>A	ENST00000258341.4	+	1	534	c.277G>A	c.(277-279)Gac>Aac	p.D93N		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	93	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						TCACCTGTGCGACGCCGGGCA	0.657											OREG0014040	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													34.0	35.0	35.0					1																	182993128		2203	4299	6502	-	-	-	SO:0001583	missense	0			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.277G>A	1.37:g.182993128G>A	ENSP00000258341:p.Asp93Asn	Somatic	1981	WXS	Illumina GAIIx	Phase_IV	Q5VYE7	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.D93N	ENST00000258341.4	37	c.277	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.340517	0.60963	.	.	ENSG00000135862	ENST00000258341	T	0.79352	-1.26	5.06	3.16	0.36331	Laminin, N-terminal (3);	0.191663	0.43110	N	0.000614	T	0.72407	0.3456	L	0.55017	1.72	0.54753	D	0.999987	B;P	0.37466	0.075;0.596	B;B	0.40825	0.018;0.341	T	0.64715	-0.6342	10	0.23891	T	0.37	.	10.3111	0.43710	0.0741:0.1361:0.7898:0.0	.	93;93	P11047;Q6NVY8	LAMC1_HUMAN;.	N	93	ENSP00000258341:D93N	ENSP00000258341:D93N	D	+	1	0	LAMC1	181259751	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	3.623000	0.54224	0.515000	0.28320	0.591000	0.81541	GAC	LAMC1	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N	ENSG00000135862		0.657	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	HGNC	protein_coding	OTTHUMT00000085954.2	8	0.00	0	G	NM_002293		182993128	182993128	+1	no_errors	ENST00000258341	ensembl	human	known	69_37n	missense	15	58.33	21	SNP	1.000	A
LILRB1	10859	genome.wustl.edu	37	19	55147063	55147063	+	Intron	SNP	G	G	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr19:55147063G>A	ENST00000396331.1	+	14	2007				LILRB1_ENST00000396317.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000434867.2_Intron|LILRB1_ENST00000396327.3_Intron|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000396332.4_Intron|LILRB1_ENST00000324602.7_Intron|LILRB1_ENST00000396315.1_Intron|LILRB1_ENST00000427581.2_Intron	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1						cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		ACACTCGGGTGAGACCCCACC	0.607										HNSCC(37;0.09)																												dbGAP											0													96.0	104.0	101.0					19																	55147063		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1650+3G>A	19.37:g.55147063G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	RNA	SNP	-	NULL	ENST00000396331.1	37	NULL	CCDS42617.1	19																																																																																			LILRB1	-	-	ENSG00000104972		0.607	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB1	HGNC	protein_coding	OTTHUMT00000140796.4	50	0.00	0	G			55147063	55147063	+1	no_errors	ENST00000462628	ensembl	human	known	69_37n	rna	51	19.05	12	SNP	0.485	A
LINC00200	399706	genome.wustl.edu	37	10	1208497	1208497	+	lincRNA	SNP	G	G	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr10:1208497G>T	ENST00000425630.1	+	0	319					NR_015376.2				long intergenic non-protein coding RNA 200																		GGAGAAGACTGCACATATAAC	0.512																																						dbGAP											0													104.0	95.0	98.0					10																	1208497		692	1591	2283	-	-	-			0			AK097673		10p15.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000229205	ENSG00000229205		"""Long non-coding RNAs"""	30974	non-coding RNA	RNA, long non-coding			"""chromosome 10 open reading frame 139"", ""non-protein coding RNA 200"""	C10orf139, NCRNA00200			Standard	NR_015376		Approved	FLJ40354	uc010qag.1		OTTHUMG00000017539		10.37:g.1208497G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000425630.1	37	NULL		10																																																																																			LINC00200	-	-	ENSG00000229205		0.512	LINC00200-001	KNOWN	basic	lincRNA	LINC00200	HGNC	lincRNA	OTTHUMT00000046417.2	61	0.00	0	G	NR_015376		1208497	1208497	+1	no_errors	ENST00000425630	ensembl	human	known	69_37n	rna	47	24.19	15	SNP	0.000	T
LLGL2	3993	genome.wustl.edu	37	17	73555430	73555430	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr17:73555430C>G	ENST00000392550.3	+	6	586	c.469C>G	c.(469-471)Cag>Gag	p.Q157E	LLGL2_ENST00000375227.4_Missense_Mutation_p.Q157E|LLGL2_ENST00000578363.1_Missense_Mutation_p.Q157E|LLGL2_ENST00000577200.1_Missense_Mutation_p.Q157E|LLGL2_ENST00000167462.5_Missense_Mutation_p.Q157E	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	157					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			GTTTGTGGTGCAGCTGCCAGC	0.642																																						dbGAP											0													112.0	79.0	90.0					17																	73555430		2203	4300	6503	-	-	-	SO:0001583	missense	0			X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.469C>G	17.37:g.73555430C>G	ENSP00000376333:p.Gln157Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14521|Q9BR62	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,prints_Lethal2_giant	p.Q157E	ENST00000392550.3	37	c.469	CCDS32733.1	17	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380717	0.42207	.	.	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000375227;ENST00000545227	T;T;T	0.62232	1.65;1.65;0.04	5.32	3.21	0.36854	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.262727	0.42420	D	0.000709	T	0.31327	0.0793	N	0.02247	-0.625	0.29427	N	0.860106	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.001;0.002;0.001;0.001;0.001	T	0.14727	-1.0462	10	0.27785	T	0.31	0.0244	8.2196	0.31532	0.1384:0.4793:0.3823:0.0	.	146;146;157;157;157	B3KX47;G3V1I9;Q6P1M3-2;Q6P1M3;Q6P1M3-3	.;.;.;L2GL2_HUMAN;.	E	157;157;157;146	ENSP00000167462:Q157E;ENSP00000376333:Q157E;ENSP00000364375:Q157E	ENSP00000167462:Q157E	Q	+	1	0	LLGL2	71067025	1.000000	0.71417	0.997000	0.53966	0.709000	0.40893	4.473000	0.60196	2.504000	0.84457	0.462000	0.41574	CAG	LLGL2	-	superfamily_WD40_repeat_dom	ENSG00000073350		0.642	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LLGL2	HGNC	protein_coding	OTTHUMT00000447633.1	63	0.00	0	C	NM_004524		73555430	73555430	+1	no_errors	ENST00000392550	ensembl	human	known	69_37n	missense	81	10.00	9	SNP	1.000	G
LNX1	84708	genome.wustl.edu	37	4	54362419	54362419	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr4:54362419C>G	ENST00000263925.7	-	6	1435	c.1121G>C	c.(1120-1122)aGa>aCa	p.R374T	LNX1_ENST00000306888.2_Missense_Mutation_p.R278T|LNX1-AS1_ENST00000502373.1_RNA|FIP1L1_ENST00000507166.1_Intron	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	374					protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			ATCTCGGGGTCTGTAGGCATC	0.567																																						dbGAP											0													76.0	79.0	78.0					4																	54362419		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.1121G>C	4.37:g.54362419C>G	ENSP00000263925:p.Arg374Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.R374T	ENST00000263925.7	37	c.1121	CCDS47057.1	4	.	.	.	.	.	.	.	.	.	.	C	2.389	-0.340192	0.05243	.	.	ENSG00000072201	ENST00000306888;ENST00000538207;ENST00000263925	T;T	0.06933	3.24;4.62	5.29	3.51	0.40186	PDZ/DHR/GLGF (1);	0.637056	0.17358	N	0.177121	T	0.03136	0.0092	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45234	-0.9275	10	0.16420	T	0.52	.	10.4105	0.44289	0.0:0.7926:0.1353:0.0721	.	374;278	Q8TBB1;Q8TBB1-2	LNX1_HUMAN;.	T	278;212;374	ENSP00000302879:R278T;ENSP00000263925:R374T	ENSP00000263925:R374T	R	-	2	0	LNX1	54057176	0.000000	0.05858	0.011000	0.14972	0.004000	0.04260	0.811000	0.27198	0.760000	0.33108	0.561000	0.74099	AGA	LNX1	-	superfamily_PDZ	ENSG00000072201		0.567	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX1	HGNC	protein_coding	OTTHUMT00000219934.2	82	0.00	0	C			54362419	54362419	-1	no_errors	ENST00000263925	ensembl	human	known	69_37n	missense	47	22.95	14	SNP	0.080	G
MDGA2	161357	genome.wustl.edu	37	14	47687332	47687332	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr14:47687332T>A	ENST00000399232.2	-	3	644	c.280A>T	c.(280-282)Act>Tct	p.T94S	MDGA2_ENST00000426342.1_5'UTR|MDGA2_ENST00000439988.3_Missense_Mutation_p.T163S|MDGA2_ENST00000357362.3_5'UTR	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	94	Ig-like 1.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						ATCCTCAAAGTCTCATTGAAG	0.448																																						dbGAP											0													156.0	126.0	135.0					14																	47687332		692	1591	2283	-	-	-	SO:0001583	missense	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.280A>T	14.37:g.47687332T>A	ENSP00000382178:p.Thr94Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like	p.T163S	ENST00000399232.2	37	c.487		14	.	.	.	.	.	.	.	.	.	.	T	27.2	4.811496	0.90707	.	.	ENSG00000139915	ENST00000439988;ENST00000399232;ENST00000486952	T;T;T	0.68765	-0.35;-0.35;-0.35	5.46	5.46	0.80206	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.38005	U	0.001859	T	0.71400	0.3335	L	0.28504	0.86	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.68401	-0.5418	10	0.25751	T	0.34	.	14.6486	0.68780	0.0:0.0:0.0:1.0	.	94	Q7Z553	MDGA2_HUMAN	S	94;163;118	ENSP00000400011:T94S;ENSP00000382178:T163S;ENSP00000452515:T118S	ENSP00000382178:T163S	T	-	1	0	MDGA2	46757082	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.994000	0.88315	2.188000	0.69820	0.533000	0.62120	ACT	MDGA2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000139915		0.448	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	HGNC	protein_coding	OTTHUMT00000073352.5	100	0.00	0	T	NM_182830		47687332	47687332	-1	no_errors	ENST00000399232	ensembl	human	known	69_37n	missense	101	17.74	22	SNP	1.000	A
MDN1	23195	genome.wustl.edu	37	6	90390438	90390438	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr6:90390438delA	ENST00000369393.3	-	74	12250	c.12135delT	c.(12133-12135)gctfs	p.A4045fs	MDN1_ENST00000428876.1_Frame_Shift_Del_p.A4045fs			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4045					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AGCCGGAAGGAGCAGCGCCCT	0.562																																						dbGAP											0													64.0	59.0	61.0					6																	90390438		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.12135delT	6.37:g.90390438delA	ENSP00000358400:p.Ala4045fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O15019|Q5T794	Frame_Shift_Del	DEL	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.P4046fs	ENST00000369393.3	37	c.12135	CCDS5024.1	6																																																																																			MDN1	-	pirsf_Midasin	ENSG00000112159		0.562	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	58	0.00	0	A			90390438	90390438	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	frame_shift_del	24	36.84	14	DEL	0.001	-
MXRA5	25878	genome.wustl.edu	37	X	3228241	3228241	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chrX:3228241C>T	ENST00000217939.6	-	7	8157	c.8003G>A	c.(8002-8004)cGt>cAt	p.R2668H		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2668	Ig-like C2-type 11.					extracellular vesicular exosome (GO:0070062)		p.R2668P(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CCAGGAGAAACGTCCCTGCCC	0.597																																						dbGAP											2	Substitution - Missense(2)	lung(2)											58.0	55.0	56.0					X																	3228241		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.8003G>A	X.37:g.3228241C>T	ENSP00000217939:p.Arg2668His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R2668H	ENST00000217939.6	37	c.8003	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	C	1.824	-0.471539	0.04445	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.13196	2.61	4.47	-0.589	0.11683	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.457234	0.15734	N	0.247241	T	0.09024	0.0223	L	0.29908	0.895	0.09310	N	1	B	0.31227	0.314	B	0.25140	0.058	T	0.17684	-1.0361	10	0.46703	T	0.11	.	10.8533	0.46782	0.0:0.4407:0.0:0.5593	.	2668	Q9NR99	MXRA5_HUMAN	H	2668	ENSP00000217939:R2668H	ENSP00000217939:R2668H	R	-	2	0	MXRA5	3238241	0.017000	0.18338	0.000000	0.03702	0.001000	0.01503	0.543000	0.23237	-0.304000	0.08843	-0.879000	0.02964	CGT	MXRA5	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000101825		0.597	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	25	0.00	0	C	NM_015419		3228241	3228241	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	0.000	T
NEUROD1	4760	genome.wustl.edu	37	2	182542979	182542979	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr2:182542979C>A	ENST00000295108.3	-	2	1066	c.609G>T	c.(607-609)atG>atT	p.M203I	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	203					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			GGTGGGGGGGCATGTCCTGGT	0.617											OREG0005603	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=NEUROD1|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																										dbGAP											0													52.0	60.0	57.0					2																	182542979		2203	4300	6503	-	-	-	SO:0001583	missense	0			U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.609G>T	2.37:g.182542979C>A	ENSP00000295108:p.Met203Ile	Somatic	1977	WXS	Illumina GAIIx	Phase_IV	B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Missense_Mutation	SNP	pfam_Neurogenic_DUF,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pirsf_TF_bHLH_NeuroD,pfscan_HLH_DNA-bd	p.M203I	ENST00000295108.3	37	c.609	CCDS2283.1	2	.	.	.	.	.	.	.	.	.	.	C	4.245	0.044475	0.08196	.	.	ENSG00000162992	ENST00000295108	T	0.62639	0.01	6.02	6.02	0.97574	Neurogenic differentiation factor, domain of unknown function (1);	0.453634	0.26650	N	0.023203	T	0.35508	0.0934	N	0.02011	-0.69	0.36668	D	0.878327	B	0.02656	0.0	B	0.01281	0.0	T	0.40961	-0.9535	10	0.22109	T	0.4	-11.6858	14.0051	0.64459	0.0:0.7549:0.2451:0.0	.	203	Q13562	NDF1_HUMAN	I	203	ENSP00000295108:M203I	ENSP00000295108:M203I	M	-	3	0	NEUROD1	182251224	0.680000	0.27605	1.000000	0.80357	0.998000	0.95712	1.046000	0.30354	2.850000	0.98022	0.650000	0.86243	ATG	NEUROD1	-	pfam_Neurogenic_DUF,pirsf_TF_bHLH_NeuroD	ENSG00000162992		0.617	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD1	HGNC	protein_coding	OTTHUMT00000255792.2	25	0.00	0	C	NM_002500		182542979	182542979	-1	no_errors	ENST00000295108	ensembl	human	known	69_37n	missense	21	36.36	12	SNP	1.000	A
NHLRC1	378884	genome.wustl.edu	37	6	18122254	18122254	+	Missense_Mutation	SNP	T	T	G	rs367649330		TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr6:18122254T>G	ENST00000340650.3	-	1	597	c.584A>C	c.(583-585)gAt>gCt	p.D195A		NM_198586.2	NP_940988.2	Q6VVB1	NHLC1_HUMAN	NHL repeat containing E3 ubiquitin protein ligase 1	195					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|positive regulation of protein ubiquitination (GO:0031398)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(2)	11	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.165)	all cancers(50;0.0451)|Epithelial(50;0.0493)			GATGGAGCGATCGCCGGCGTC	0.527																																						dbGAP											0													94.0	96.0	95.0					6																	18122254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY324849	CCDS4542.1	6p22.3	2014-01-28	2013-12-12		ENSG00000187566	ENSG00000187566			21576	protein-coding gene	gene with protein product	"""epilepsy, progressive myoclonus type 2B"""	608072	"""NHL repeat containing 1"""			12958597	Standard	NM_198586		Approved	bA204B7.2, EPM2B, malin	uc003ncl.1	Q6VVB1	OTTHUMG00000014315	ENST00000340650.3:c.584A>C	6.37:g.18122254T>G	ENSP00000345464:p.Asp195Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SYB1|Q5VUK7|Q6IMH1	Missense_Mutation	SNP	smart_Znf_RING,pfscan_NHL_repeat_subgr,pfscan_Znf_RING	p.D195A	ENST00000340650.3	37	c.584	CCDS4542.1	6	.	.	.	.	.	.	.	.	.	.	T	14.61	2.586871	0.46110	.	.	ENSG00000187566	ENST00000340650	D	0.91011	-2.77	4.99	3.75	0.43078	Six-bladed beta-propeller, TolB-like (1);	0.054952	0.64402	D	0.000001	T	0.78868	0.4351	L	0.27053	0.805	0.44694	D	0.997686	P	0.50943	0.94	B	0.42495	0.389	T	0.82489	-0.0432	10	0.59425	D	0.04	-24.1867	11.136	0.48375	0.0:0.0:0.1544:0.8456	.	195	Q6VVB1	NHLC1_HUMAN	A	195	ENSP00000345464:D195A	ENSP00000345464:D195A	D	-	2	0	NHLRC1	18230233	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.557000	0.67313	1.866000	0.54105	0.533000	0.62120	GAT	NHLRC1	-	pfscan_NHL_repeat_subgr	ENSG00000187566		0.527	NHLRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC1	HGNC	protein_coding	OTTHUMT00000039958.1	56	0.00	0	T			18122254	18122254	-1	no_errors	ENST00000340650	ensembl	human	known	69_37n	missense	72	10.00	8	SNP	1.000	G
NKRF	55922	genome.wustl.edu	37	X	118724267	118724267	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chrX:118724267C>T	ENST00000371527.1	-	2	1773	c.1121G>A	c.(1120-1122)cGc>cAc	p.R374H	NKRF_ENST00000487600.1_Intron|NKRF_ENST00000542113.1_Missense_Mutation_p.R389H|NKRF_ENST00000304449.5_Missense_Mutation_p.R374H	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor	374					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						ACGCCATGTGCGATTTGGCAT	0.388																																						dbGAP											0													105.0	96.0	99.0					X																	118724267		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.1121G>A	X.37:g.118724267C>T	ENSP00000360582:p.Arg374His	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V1N1|Q4VC41|Q9UJ91	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_R3H_ss-bd,smart_Ds-RNA-bd,smart_G_patch_dom,smart_R3H_ss-bd,pfscan_G_patch_dom,pfscan_R3H_ss-bd	p.R389H	ENST00000371527.1	37	c.1166	CCDS35375.1	X	.	.	.	.	.	.	.	.	.	.	C	15.52	2.856639	0.51376	.	.	ENSG00000186416	ENST00000371527;ENST00000304449;ENST00000542113	D;D;D	0.97831	-4.56;-4.56;-4.56	5.95	5.95	0.96441	Double-stranded RNA-binding (1);Double-stranded RNA-binding-like (1);	0.153517	0.64402	D	0.000009	D	0.96756	0.8941	L	0.41236	1.265	0.41973	D	0.990762	D	0.61697	0.99	P	0.49502	0.613	D	0.96983	0.9716	10	0.51188	T	0.08	-8.6464	18.1818	0.89780	0.0:1.0:0.0:0.0	.	374	O15226	NKRF_HUMAN	H	374;374;389	ENSP00000360582:R374H;ENSP00000304803:R374H;ENSP00000442308:R389H	ENSP00000304803:R374H	R	-	2	0	NKRF	118608295	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.647000	0.46639	2.518000	0.84900	0.600000	0.82982	CGC	NKRF	-	smart_Ds-RNA-bd	ENSG00000186416		0.388	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKRF	HGNC	protein_coding	OTTHUMT00000058044.1	79	0.00	0	C	NM_017544		118724267	118724267	-1	no_errors	ENST00000542113	ensembl	human	known	69_37n	missense	64	22.89	19	SNP	1.000	T
NLRP1	22861	genome.wustl.edu	37	17	5461874	5461874	+	Silent	SNP	G	G	A	rs147100948	byFrequency	TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr17:5461874G>A	ENST00000572272.1	-	4	2141	c.2142C>T	c.(2140-2142)caC>caT	p.H714H	NLRP1_ENST00000345221.3_Silent_p.H714H|NLRP1_ENST00000354411.3_Silent_p.H714H|NLRP1_ENST00000262467.5_Silent_p.H714H|NLRP1_ENST00000269280.4_Silent_p.H714H|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000577119.1_Silent_p.H714H			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	714					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				ACTCCAGAGAGTGTGGCTGCA	0.552																																						dbGAP											0													60.0	62.0	61.0					17																	5461874		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.2142C>T	17.37:g.5461874G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Silent	SNP	pfam_CARD,pfam_DAPIN,pfam_Leu-rich_rpt,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD,pfscan_DAPIN,prints_Disease_R	p.H714	ENST00000572272.1	37	c.2142	CCDS42246.1	17																																																																																			NLRP1	-	NULL	ENSG00000091592		0.552	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP1	HGNC	protein_coding	OTTHUMT00000439517.1	38	0.00	0	G	NM_033004		5461874	5461874	-1	no_errors	ENST00000572272	ensembl	human	known	69_37n	silent	10	64.29	18	SNP	0.000	A
TENM3	55714	genome.wustl.edu	37	4	183714346	183714346	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr4:183714346G>A	ENST00000511685.1	+	26	6644	c.6521G>A	c.(6520-6522)cGc>cAc	p.R2174H	TENM3_ENST00000406950.2_Missense_Mutation_p.R2174H			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	2174					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ACACCCCTTCGCTATGACCTG	0.453																																						dbGAP											0													117.0	115.0	115.0					4																	183714346		2004	4179	6183	-	-	-	SO:0001583	missense	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.6521G>A	4.37:g.183714346G>A	ENSP00000424226:p.Arg2174His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c_dom,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.R2174H	ENST00000511685.1	37	c.6521	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137129	0.56936	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.87103	-2.21;-2.21	4.75	4.75	0.60458	.	.	.	.	.	D	0.93510	0.7929	M	0.80982	2.52	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.94218	0.7465	9	0.66056	D	0.02	.	17.9486	0.89045	0.0:0.0:1.0:0.0	.	2174	Q9P273	TEN3_HUMAN	H	2174	ENSP00000424226:R2174H;ENSP00000385276:R2174H	ENSP00000385276:R2174H	R	+	2	0	ODZ3	183951340	1.000000	0.71417	0.993000	0.49108	0.216000	0.24613	9.623000	0.98386	2.460000	0.83146	0.455000	0.32223	CGC	ODZ3	-	superfamily_Cyt_c_dom	ENSG00000218336		0.453	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ3	HGNC	protein_coding	OTTHUMT00000361734.1	52	0.00	0	G			183714346	183714346	+1	no_errors	ENST00000406950	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	A
OR1S2	219958	genome.wustl.edu	37	11	57970919	57970919	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr11:57970919C>A	ENST00000302592.6	-	1	734	c.735G>T	c.(733-735)caG>caT	p.Q245H		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				TCCACTTTCCCTGTGTGGATG	0.463																																						dbGAP											0													155.0	129.0	138.0					11																	57970919		2201	4296	6497	-	-	-	SO:0001583	missense	0			BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.735G>T	11.37:g.57970919C>A	ENSP00000305469:p.Gln245His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFG5|Q96R85	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Q245H	ENST00000302592.6	37	c.735	CCDS31545.1	11	.	.	.	.	.	.	.	.	.	.	C	11.50	1.658270	0.29425	.	.	ENSG00000197887	ENST00000302592	T	0.00224	8.51	4.75	-0.414	0.12359	GPCR, rhodopsin-like superfamily (1);	0.577523	0.15384	N	0.265171	T	0.00210	0.0006	L	0.56124	1.755	0.09310	N	1	P	0.45634	0.863	P	0.48227	0.571	T	0.44375	-0.9332	10	0.51188	T	0.08	.	5.5024	0.16836	0.1331:0.5478:0.0:0.319	.	245	Q8NGQ3	OR1S2_HUMAN	H	245	ENSP00000305469:Q245H	ENSP00000305469:Q245H	Q	-	3	2	OR1S2	57727495	0.000000	0.05858	0.270000	0.24601	0.691000	0.40173	-0.480000	0.06559	0.037000	0.15575	0.655000	0.94253	CAG	OR1S2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197887		0.463	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1S2	HGNC	protein_coding	OTTHUMT00000394703.2	207	0.00	0	C	NM_001004459		57970919	57970919	-1	no_errors	ENST00000302592	ensembl	human	known	69_37n	missense	118	21.33	32	SNP	0.000	A
OR2B2	81697	genome.wustl.edu	37	6	27879388	27879388	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr6:27879388G>A	ENST00000303324.2	-	1	786	c.710C>T	c.(709-711)gCa>gTa	p.A237V		NM_033057.2	NP_149046.2	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B, member 2	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	22						TGTCCCAAATGCCTTTCGTTG	0.458																																						dbGAP											0													129.0	116.0	121.0					6																	27879388		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z98744	CCDS4641.1	6p22.3-p21.3	2014-02-19	2002-02-28		ENSG00000168131	ENSG00000168131		"""GPCR / Class A : Olfactory receptors"""	13966	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 9"""	OR2B9			Standard	NM_033057		Approved	hs6M1-10, OR6-1, OR2B2Q	uc011dkw.2	Q9GZK3	OTTHUMG00000014495	ENST00000303324.2:c.710C>T	6.37:g.27879388G>A	ENSP00000304419:p.Ala237Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNH2|Q9GZL2|Q9Y299	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A237V	ENST00000303324.2	37	c.710	CCDS4641.1	6	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292303	0.59976	.	.	ENSG00000168131	ENST00000303324	T	0.00342	8.03	4.42	4.42	0.53409	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38959	U	0.001520	T	0.00328	0.0010	L	0.58510	1.815	0.29332	N	0.866592	D	0.89917	1.0	D	0.91635	0.999	T	0.60924	-0.7166	10	0.46703	T	0.11	.	15.3246	0.74150	0.0:0.0:1.0:0.0	.	237	Q9GZK3	OR2B2_HUMAN	V	237	ENSP00000304419:A237V	ENSP00000304419:A237V	A	-	2	0	OR2B2	27987367	1.000000	0.71417	0.998000	0.56505	0.586000	0.36452	4.957000	0.63652	2.371000	0.80710	0.563000	0.77884	GCA	OR2B2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000168131		0.458	OR2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B2	HGNC	protein_coding	OTTHUMT00000040163.1	141	0.00	0	G			27879388	27879388	-1	no_errors	ENST00000303324	ensembl	human	known	69_37n	missense	98	14.78	17	SNP	0.997	A
OR6A2	8590	genome.wustl.edu	37	11	6816236	6816236	+	Missense_Mutation	SNP	G	G	A	rs201451646	byFrequency	TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr11:6816236G>A	ENST00000332601.3	-	1	892	c.704C>T	c.(703-705)tCg>tTg	p.S235L		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	235					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TCCAGCAGCCGAAGGAATGTG	0.488													G|||	2	0.000399361	0.0	0.0014	5008	,	,		21636	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													95.0	96.0	96.0					11																	6816236		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.704C>T	11.37:g.6816236G>A	ENSP00000330384:p.Ser235Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJC7|Q6IF35|Q9H206	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S235L	ENST00000332601.3	37	c.704	CCDS7772.1	11	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	17.85	3.490546	0.64074	.	.	ENSG00000184933	ENST00000332601	T	0.00330	8.08	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.149707	0.31279	N	0.007936	T	0.01029	0.0034	M	0.90483	3.12	0.09310	N	1	D	0.76494	0.999	D	0.68039	0.955	T	0.29852	-0.9998	10	0.87932	D	0	.	16.3566	0.83237	0.0:0.0:1.0:0.0	.	235	O95222	OR6A2_HUMAN	L	235	ENSP00000330384:S235L	ENSP00000330384:S235L	S	-	2	0	OR6A2	6772812	0.028000	0.19301	0.594000	0.28785	0.892000	0.51952	1.991000	0.40727	2.809000	0.96659	0.655000	0.94253	TCG	OR6A2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000184933		0.488	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6A2	HGNC	protein_coding	OTTHUMT00000385981.1	41	0.00	0	G	NM_003696		6816236	6816236	-1	no_errors	ENST00000332601	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	0.125	A
OR5D13	390142	genome.wustl.edu	37	11	55541722	55541722	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr11:55541722G>A	ENST00000361760.1	+	1	809	c.809G>A	c.(808-810)aGc>aAc	p.S270N		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				AAAACTTCTAGCCTCATAGTT	0.418																																						dbGAP											0													103.0	81.0	89.0					11																	55541722		2200	4296	6496	-	-	-	SO:0001583	missense	0			BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.809G>A	11.37:g.55541722G>A	ENSP00000354800:p.Ser270Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF68|Q6IFC9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S270N	ENST00000361760.1	37	c.809	CCDS31507.1	11	.	.	.	.	.	.	.	.	.	.	G	0.114	-1.133921	0.01742	.	.	ENSG00000198877	ENST00000361760	T	0.00145	8.67	3.68	2.73	0.32206	GPCR, rhodopsin-like superfamily (1);	0.530491	0.14268	U	0.330333	T	0.00144	0.0004	L	0.39692	1.235	0.09310	N	1	B	0.06786	0.001	B	0.12837	0.008	T	0.29549	-1.0008	10	0.72032	D	0.01	-0.7271	9.0152	0.36166	0.0:0.0:0.6064:0.3936	.	270	Q8NGL4	OR5DD_HUMAN	N	270	ENSP00000354800:S270N	ENSP00000354800:S270N	S	+	2	0	OR5D13	55298298	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	-0.807000	0.04520	0.642000	0.30620	0.486000	0.48141	AGC	OR5D13	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000198877		0.418	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D13	HGNC	protein_coding	OTTHUMT00000391511.1	68	0.00	0	G	NM_001001967		55541722	55541722	+1	no_errors	ENST00000361760	ensembl	human	known	69_37n	missense	42	25.00	14	SNP	0.004	A
OR5M9	390162	genome.wustl.edu	37	11	56230715	56230715	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr11:56230715T>C	ENST00000279791.1	-	1	162	c.163A>G	c.(163-165)Agt>Ggt	p.S55G		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					TACATGGGACTCTGAAGCTGA	0.418																																						dbGAP											0													76.0	76.0	76.0					11																	56230715		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.163A>G	11.37:g.56230715T>C	ENSP00000279791:p.Ser55Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEW5|Q96RB9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S55G	ENST00000279791.1	37	c.163	CCDS31531.1	11	.	.	.	.	.	.	.	.	.	.	T	12.79	2.042363	0.35989	.	.	ENSG00000150269	ENST00000279791	T	0.00406	7.55	4.85	3.63	0.41609	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000052	T	0.00412	0.0013	M	0.83312	2.635	0.09310	N	0.999999	P	0.37548	0.599	B	0.32465	0.146	T	0.42832	-0.9428	10	0.87932	D	0	-7.1224	5.3037	0.15791	0.1748:0.0:0.1815:0.6437	.	55	Q8NGP3	OR5M9_HUMAN	G	55	ENSP00000279791:S55G	ENSP00000279791:S55G	S	-	1	0	OR5M9	55987291	0.001000	0.12720	0.999000	0.59377	0.932000	0.56968	1.036000	0.30228	1.939000	0.56221	0.448000	0.29417	AGT	OR5M9	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000150269		0.418	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M9	HGNC	protein_coding	OTTHUMT00000391638.1	41	0.00	0	T	NM_001004743		56230715	56230715	-1	no_errors	ENST00000279791	ensembl	human	known	69_37n	missense	36	32.08	17	SNP	0.164	C
OR5B12	390191	genome.wustl.edu	37	11	58207097	58207097	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr11:58207097G>T	ENST00000302572.2	-	1	549	c.528C>A	c.(526-528)ttC>ttA	p.F176L		NM_001004733.2	NP_001004733.1	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B, member 12	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(6)|liver(1)|lung(28)|ovary(1)|prostate(3)|skin(1)	40	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GAGCATCACAGAAAAAGTGTT	0.423																																						dbGAP											0													104.0	95.0	98.0					11																	58207097		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065851	CCDS31551.1	11q12.1	2012-08-09		2004-03-10	ENSG00000172362	ENSG00000172362		"""GPCR / Class A : Olfactory receptors"""	15432	protein-coding gene	gene with protein product				OR5B12P, OR5B16		12213199	Standard	NM_001004733		Approved	OST743	uc010rkh.2	Q96R08	OTTHUMG00000167543	ENST00000302572.2:c.528C>A	11.37:g.58207097G>T	ENSP00000306657:p.Phe176Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNL2|Q6IEV5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F176L	ENST00000302572.2	37	c.528	CCDS31551.1	11	.	.	.	.	.	.	.	.	.	.	G	18.46	3.629090	0.67015	.	.	ENSG00000172362	ENST00000302572	T	0.00220	8.52	4.3	3.38	0.38709	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000065	T	0.00496	0.0016	M	0.77406	2.37	0.35472	D	0.797452	D	0.89917	1.0	D	0.78314	0.991	T	0.70894	-0.4748	10	0.66056	D	0.02	-21.3611	11.5863	0.50920	0.0884:0.0:0.9116:0.0	.	176	Q96R08	OR5BC_HUMAN	L	176	ENSP00000306657:F176L	ENSP00000306657:F176L	F	-	3	2	OR5B12	57963673	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	2.741000	0.47426	1.155000	0.42497	0.462000	0.41574	TTC	OR5B12	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172362		0.423	OR5B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B12	HGNC	protein_coding	OTTHUMT00000394987.1	61	0.00	0	G	NM_001004733		58207097	58207097	-1	no_errors	ENST00000302572	ensembl	human	known	69_37n	missense	68	20.93	18	SNP	1.000	T
PCK2	5106	genome.wustl.edu	37	14	24567421	24567421	+	Silent	SNP	C	C	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr14:24567421C>A	ENST00000216780.4	+	3	553	c.285C>A	c.(283-285)gcC>gcA	p.A95A	PCK2_ENST00000545054.2_5'UTR|PCK2_ENST00000558096.1_5'UTR|PCK2_ENST00000396973.4_Silent_p.A95A|PCK2_ENST00000559250.1_Silent_p.A107A|NRL_ENST00000561028.1_Intron|PCK2_ENST00000561286.1_5'UTR	NM_004563.2	NP_004554.2	Q16822	PCKGM_HUMAN	phosphoenolpyruvate carboxykinase 2 (mitochondrial)	95					carbohydrate metabolic process (GO:0005975)|cellular response to glucose stimulus (GO:0071333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|NADH oxidation (GO:0006116)|oxaloacetate metabolic process (GO:0006107)|positive regulation of insulin secretion (GO:0032024)|pyruvate metabolic process (GO:0006090)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)|phosphoenolpyruvate carboxykinase activity (GO:0004611)			breast(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(265;0.0184)		GCTGGCTGGCCCGCACAGACC	0.587																																						dbGAP											0													43.0	35.0	38.0					14																	24567421		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK129934	CCDS9609.1, CCDS41928.1	14q12	2006-06-09			ENSG00000100889	ENSG00000100889	4.1.1.32		8725	protein-coding gene	gene with protein product		614095				8645161, 9657976	Standard	XM_005267726		Approved	PEPCK, PEPCK2	uc001wlt.3	Q16822	OTTHUMG00000028791	ENST00000216780.4:c.285C>A	14.37:g.24567421C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43253|Q86U01|Q9BV62	Silent	SNP	pfam_PEP_carboxykinase_GTP,superfamily_PEP_carboxykinase_N,pirsf_PEP_carboxykinase_GTP	p.A95	ENST00000216780.4	37	c.285	CCDS9609.1	14																																																																																			PCK2	-	pfam_PEP_carboxykinase_GTP,superfamily_PEP_carboxykinase_N,pirsf_PEP_carboxykinase_GTP	ENSG00000100889		0.587	PCK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCK2	HGNC	protein_coding	OTTHUMT00000071900.3	31	0.00	0	C	NM_001018073		24567421	24567421	+1	no_errors	ENST00000216780	ensembl	human	known	69_37n	silent	35	18.60	8	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178927980	178927980	+	Missense_Mutation	SNP	T	T	C	rs121913272		TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr3:178927980T>C	ENST00000263967.3	+	8	1415	c.1258T>C	c.(1258-1260)Tgt>Cgt	p.C420R		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	420	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.		C -> R (in CLOVE and CRC; shows an increase in lipid kinase activity; may increase the affinity for lipid membranes). {ECO:0000269|PubMed:22658544}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.C420R(40)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TAAGGAACACTGTCCATTGGC	0.328	C420R(CCK81_LARGE_INTESTINE)|C420R(EFM192A_BREAST)|C420R(HEC151_ENDOMETRIUM)|C420R(OVISE_OVARY)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	40	Substitution - Missense(40)	breast(15)|large_intestine(10)|endometrium(7)|central_nervous_system(2)|lung(2)|prostate(2)|stomach(1)|NS(1)											85.0	80.0	82.0					3																	178927980		1822	4078	5900	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1258T>C	3.37:g.178927980T>C	ENSP00000263967:p.Cys420Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.C420R	ENST00000263967.3	37	c.1258	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	T	19.97	3.925687	0.73213	.	.	ENSG00000121879	ENST00000263967	T	0.68903	-0.36	5.51	5.51	0.81932	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.000000	0.85682	D	0.000000	T	0.76856	0.4046	M	0.61703	1.905	0.80722	D	1	D	0.69078	0.997	P	0.62885	0.908	T	0.74284	-0.3715	10	0.25751	T	0.34	-11.2314	15.6207	0.76805	0.0:0.0:0.0:1.0	.	420	P42336	PK3CA_HUMAN	R	420	ENSP00000263967:C420R	ENSP00000263967:C420R	C	+	1	0	PIK3CA	180410674	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	7.698000	0.84413	2.105000	0.64084	0.460000	0.39030	TGT	PIK3CA	-	pfam_PI3K_C2_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom	ENSG00000121879		0.328	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	60	0.00	0	T			178927980	178927980	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	11	87.78	79	SNP	1.000	C
PLA2G3	50487	genome.wustl.edu	37	22	31532946	31532946	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr22:31532946G>T	ENST00000215885.3	-	5	1399	c.1147C>A	c.(1147-1149)Cag>Aag	p.Q383K		NM_015715.3	NP_056530.2	Q9NZ20	PA2G3_HUMAN	phospholipase A2, group III	383					acrosome assembly (GO:0001675)|cilium morphogenesis (GO:0060271)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|lipoxygenase pathway (GO:0019372)|mast cell degranulation (GO:0043303)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|sperm axoneme assembly (GO:0007288)	centriole (GO:0005814)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)			large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	18						TTGAGCAGCTGGAACTCGATT	0.672																																						dbGAP											0													38.0	38.0	38.0					22																	31532946		2200	4300	6500	-	-	-	SO:0001583	missense	0			AF220490	CCDS13889.1	22q12.2	2008-09-19			ENSG00000100078	ENSG00000100078	3.1.1.4		17934	protein-coding gene	gene with protein product		611651				10713052	Standard	NM_015715		Approved	GIII-SPLA2	uc003aka.3	Q9NZ20	OTTHUMG00000151255	ENST00000215885.3:c.1147C>A	22.37:g.31532946G>T	ENSP00000215885:p.Gln383Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95768	Missense_Mutation	SNP	pfam_PLipase_A2_euk,superfamily_PLipase_A2	p.Q383K	ENST00000215885.3	37	c.1147	CCDS13889.1	22	.	.	.	.	.	.	.	.	.	.	G	15.56	2.870572	0.51588	.	.	ENSG00000100078	ENST00000215885	T	0.28454	1.61	5.62	4.59	0.56863	Phospholipase A2 (2);	0.641060	0.16578	N	0.208331	T	0.34745	0.0908	L	0.60455	1.87	0.24795	N	0.992739	P	0.39352	0.669	B	0.41374	0.355	T	0.13150	-1.0520	10	0.30078	T	0.28	-7.1209	14.5317	0.67931	0.0:0.1464:0.8536:0.0	.	383	Q9NZ20	PA2G3_HUMAN	K	383	ENSP00000215885:Q383K	ENSP00000215885:Q383K	Q	-	1	0	PLA2G3	29862946	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	3.259000	0.51515	1.364000	0.46038	0.655000	0.94253	CAG	PLA2G3	-	pfam_PLipase_A2_euk,superfamily_PLipase_A2	ENSG00000100078		0.672	PLA2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G3	HGNC	protein_coding	OTTHUMT00000321938.1	52	0.00	0	G	NM_015715		31532946	31532946	-1	no_errors	ENST00000215885	ensembl	human	known	69_37n	missense	97	11.82	13	SNP	1.000	T
POLA1	5422	genome.wustl.edu	37	X	24717586	24717587	+	Frame_Shift_Ins	INS	-	-	A	rs146733808		TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chrX:24717586_24717587insA	ENST00000379059.3	+	2	85_86	c.70_71insA	c.(70-72)gaafs	p.E24fs	AC004655.1_ENST00000577230.1_RNA|POLA1_ENST00000379068.3_Frame_Shift_Ins_p.E30fs	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	24					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	AGCCCGGCGAGAAAAAAAATCA	0.381																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.78dupA	X.37:g.24717594_24717594dupA	ENSP00000368349:p.Glu24fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UQ7	Frame_Shift_Ins	INS	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_Znf_DNA-dir_DNA_pol_B_alpha,pfam_DNA_pol_a_cat_su_N,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.S33fs	ENST00000379059.3	37	c.88_89	CCDS14214.1	X																																																																																			POLA1	-	NULL	ENSG00000101868		0.381	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POLA1	HGNC	protein_coding	OTTHUMT00000056111.1	16	0.00	0	-	NM_016937		24717586	24717587	+1	no_errors	ENST00000379068	ensembl	human	known	69_37n	frame_shift_ins	37	13.95	6	INS	1.000:1.000	A
POPDC2	64091	genome.wustl.edu	37	3	119378865	119378865	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr3:119378865G>T	ENST00000264231.3	-	1	572	c.406C>A	c.(406-408)Cag>Aag	p.Q136K	POPDC2_ENST00000493094.1_Missense_Mutation_p.Q136K|POPDC2_ENST00000474523.1_5'UTR|POPDC2_ENST00000468801.1_Missense_Mutation_p.Q136K|POPDC2_ENST00000538678.1_Missense_Mutation_p.Q136K	NM_022135.2	NP_071418.2	Q9HBU9	POPD2_HUMAN	popeye domain containing 2	136					regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sinoatrial node cell development (GO:0060931)	integral component of membrane (GO:0016021)	cAMP binding (GO:0030552)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.242)		GTTAAGACCTGCTCCTCGCAG	0.567																																						dbGAP											0													154.0	148.0	150.0					3																	119378865		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF204173	CCDS2992.1	3q13.33	2004-01-15			ENSG00000121577	ENSG00000121577			17648	protein-coding gene	gene with protein product		605823				10882522	Standard	NM_022135		Approved	POP2	uc031sbc.1	Q9HBU9	OTTHUMG00000159438	ENST00000264231.3:c.406C>A	3.37:g.119378865G>T	ENSP00000264231:p.Gln136Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UE7	Missense_Mutation	SNP	pfam_Popeye_prot,superfamily_cNMP-bd-like	p.Q136K	ENST00000264231.3	37	c.406	CCDS2992.1	3	.	.	.	.	.	.	.	.	.	.	G	12.70	2.015554	0.35511	.	.	ENSG00000121577	ENST00000264231;ENST00000493094;ENST00000468801;ENST00000538678	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	5.79	3.93	0.45458	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.210069	0.49916	D	0.000140	T	0.14700	0.0355	N	0.04508	-0.205	0.80722	D	1	B;B	0.19073	0.021;0.033	B;B	0.23574	0.019;0.047	T	0.07908	-1.0748	10	0.25106	T	0.35	.	10.8936	0.47010	0.0:0.1265:0.611:0.2625	.	136;136	Q9HBU9-2;Q9HBU9	.;POPD2_HUMAN	K	136	ENSP00000264231:Q136K;ENSP00000417250:Q136K;ENSP00000420715:Q136K;ENSP00000438271:Q136K	ENSP00000264231:Q136K	Q	-	1	0	POPDC2	120861555	0.969000	0.33509	0.984000	0.44739	0.794000	0.44872	2.199000	0.42715	1.436000	0.47453	0.655000	0.94253	CAG	POPDC2	-	pfam_Popeye_prot,superfamily_cNMP-bd-like	ENSG00000121577		0.567	POPDC2-002	KNOWN	basic|CCDS	protein_coding	POPDC2	HGNC	protein_coding	OTTHUMT00000355378.1	82	0.00	0	G	NM_022135		119378865	119378865	-1	no_errors	ENST00000341124	ensembl	human	known	69_37n	missense	82	22.64	24	SNP	1.000	T
POLQ	10721	genome.wustl.edu	37	3	121217489	121217489	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr3:121217489G>C	ENST00000264233.5	-	13	2116	c.1988C>G	c.(1987-1989)aCt>aGt	p.T663S		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	663					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		CCAATCAATAGTAGTCCAATC	0.358								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)	dbGAP											0													83.0	77.0	79.0					3																	121217489		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.1988C>G	3.37:g.121217489G>C	ENSP00000264233:p.Thr663Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O95160|Q6VMB5	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_A_palm_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_RNaseH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_DNA-dir_DNA_pol_A_palm_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_DNA_polymerase_A	p.T663S	ENST00000264233.5	37	c.1988	CCDS33833.1	3	.	.	.	.	.	.	.	.	.	.	G	11.01	1.512903	0.27123	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.47528	0.84	5.83	4.01	0.46588	.	0.220312	0.46145	N	0.000311	T	0.30665	0.0772	L	0.29908	0.895	0.29307	N	0.86832	B	0.14438	0.01	B	0.10450	0.005	T	0.20009	-1.0288	10	0.17832	T	0.49	.	7.0878	0.25267	0.0685:0.1293:0.6754:0.1268	.	663	O75417	DPOLQ_HUMAN	S	286;663;799	ENSP00000264233:T663S	ENSP00000264233:T663S	T	-	2	0	POLQ	122700179	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.627000	0.54252	0.771000	0.33359	-0.140000	0.14226	ACT	POLQ	-	NULL	ENSG00000051341		0.358	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	HGNC	protein_coding	OTTHUMT00000355097.1	100	0.00	0	G	NM_199420		121217489	121217489	-1	no_errors	ENST00000264233	ensembl	human	known	69_37n	missense	84	18.45	19	SNP	1.000	C
POTEB	100996331	genome.wustl.edu	37	15	22077588	22077588	+	Silent	SNP	A	A	G	rs201906481		TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr15:22077588A>G	ENST00000439682.1	-	3	693	c.642T>C	c.(640-642)gaT>gaC	p.D214D	POTEB_ENST00000553662.2_5'UTR	NM_001277304.1	NP_001264233.1	Q6S5H4	POTEB_HUMAN	POTE ankyrin domain family, member B	251										endometrium(2)|kidney(8)|lung(4)	14						CCATTAATTTATCTTCATTGT	0.338																																						dbGAP											0													1.0	1.0	1.0					15																	22077588		199	303	502	-	-	-	SO:0001819	synonymous_variant	0			AY465170	CCDS59250.1	15q11.2	2014-01-10	2008-11-26	2008-11-26	ENSG00000233917	ENSG00000233917		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33734	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 5"""	608912	"""ANKRD26-like family B, member 1"""	A26B1			Standard	NM_001277304		Approved	POTE15, POTE-15, CT104.5	uc031qqz.1	Q6S5H4		ENST00000439682.1:c.642T>C	15.37:g.22077588A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NXN7|Q6S5H7	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D214	ENST00000439682.1	37	c.642	CCDS59250.1	15																																																																																			POTEB	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000233917		0.338	POTEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEB	HGNC	protein_coding	OTTHUMT00000414911.2	9	0.00	0	A	NM_207355		22077588	22077588	-1	no_errors	ENST00000439682	ensembl	human	known	69_37n	silent	4	42.86	3	SNP	0.003	G
PRDM5	11107	genome.wustl.edu	37	4	121739572	121739572	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr4:121739572C>A	ENST00000264808.3	-	5	826	c.586G>T	c.(586-588)Gag>Tag	p.E196*	PRDM5_ENST00000428209.2_Nonsense_Mutation_p.E196*|PRDM5_ENST00000515109.1_Nonsense_Mutation_p.E196*	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	196					histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						AATTCTTTCTCCTCTGTGGGT	0.388																																						dbGAP											0													89.0	86.0	87.0					4																	121739572		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.586G>T	4.37:g.121739572C>A	ENSP00000264808:p.Glu196*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAI9|Q0VAJ0|Q6NXQ7	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM5,pfscan_SET_dom,pfscan_Znf_C2H2	p.E196*	ENST00000264808.3	37	c.586	CCDS3716.1	4	.	.	.	.	.	.	.	.	.	.	C	38	7.274322	0.98179	.	.	ENSG00000138738	ENST00000264808;ENST00000515109;ENST00000428209	.	.	.	5.32	5.32	0.75619	.	0.048942	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-34.1283	19.0126	0.92879	0.0:1.0:0.0:0.0	.	.	.	.	X	196	.	ENSP00000264808:E196X	E	-	1	0	PRDM5	121959022	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.412000	0.80091	2.498000	0.84270	0.555000	0.69702	GAG	PRDM5	-	pirsf_Znf_PRDM5	ENSG00000138738		0.388	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM5	HGNC	protein_coding	OTTHUMT00000256528.2	152	0.65	1	C			121739572	121739572	-1	no_errors	ENST00000264808	ensembl	human	known	69_37n	nonsense	89	19.82	22	SNP	1.000	A
PRPF4	9128	genome.wustl.edu	37	9	116053913	116053913	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr9:116053913G>C	ENST00000374198.4	+	14	1644	c.1542G>C	c.(1540-1542)agG>agC	p.R514S	PRPF4_ENST00000374199.4_Missense_Mutation_p.R513S	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	514					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)				NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						CATATGACAGGACCTTCAAGC	0.493																																						dbGAP											0													77.0	70.0	73.0					9																	116053913		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.1542G>C	9.37:g.116053913G>C	ENSP00000363313:p.Arg514Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_PRP4,superfamily_WD40_repeat_dom,smart_SFM,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R514S	ENST00000374198.4	37	c.1542	CCDS6791.1	9	.	.	.	.	.	.	.	.	.	.	G	17.51	3.406882	0.62399	.	.	ENSG00000136875	ENST00000374199;ENST00000374198	T;T	0.60548	0.18;0.18	5.71	2.8	0.32819	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.144841	0.64402	D	0.000013	T	0.68016	0.2955	L	0.58428	1.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.67677	-0.5609	10	0.87932	D	0	.	8.0414	0.30523	0.4109:0.0:0.5891:0.0	.	529;514	Q59EL4;O43172	.;PRP4_HUMAN	S	513;514	ENSP00000363315:R513S;ENSP00000363313:R514S	ENSP00000363313:R514S	R	+	3	2	PRPF4	115093734	0.963000	0.33076	1.000000	0.80357	0.965000	0.64279	0.269000	0.18589	0.726000	0.32339	0.591000	0.81541	AGG	PRPF4	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000136875		0.493	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRPF4	HGNC	protein_coding	OTTHUMT00000053708.2	38	0.00	0	G	NM_004697		116053913	116053913	+1	no_errors	ENST00000374198	ensembl	human	known	69_37n	missense	43	25.86	15	SNP	0.999	C
PTPRB	5787	genome.wustl.edu	37	12	70964942	70964942	+	Silent	SNP	T	T	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr12:70964942T>G	ENST00000261266.5	-	11	2609	c.2580A>C	c.(2578-2580)gtA>gtC	p.V860V	PTPRB_ENST00000551525.1_Silent_p.V1077V|PTPRB_ENST00000334414.6_Silent_p.V1078V|PTPRB_ENST00000451516.2_Silent_p.V770V|PTPRB_ENST00000538708.1_Silent_p.V860V|PTPRB_ENST00000550857.1_Silent_p.V770V|PTPRB_ENST00000550358.1_Silent_p.V990V	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	860	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			AAGGAGGAAATACTTTCATGT	0.468																																						dbGAP											0													107.0	101.0	103.0					12																	70964942		1975	4155	6130	-	-	-	SO:0001819	synonymous_variant	0			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.2580A>C	12.37:g.70964942T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.V1078	ENST00000261266.5	37	c.3234	CCDS44944.1	12																																																																																			PTPRB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000127329		0.468	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404439.1	84	0.00	0	T			70964942	70964942	-1	no_errors	ENST00000334414	ensembl	human	known	69_37n	silent	60	28.57	24	SNP	0.515	G
RSL1D1	26156	genome.wustl.edu	37	16	11940658	11940658	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr16:11940658C>T	ENST00000571133.1	-	4	499	c.427G>A	c.(427-429)Gaa>Aaa	p.E143K	RSL1D1_ENST00000542106.1_5'UTR	NM_015659.2	NP_056474.2	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	143					osteoblast differentiation (GO:0001649)|regulation of apoptotic process (GO:0042981)|regulation of cellular senescence (GO:2000772)|regulation of protein localization (GO:0032880)	membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	15						AGCTTGGCTTCATAGGATTTA	0.388																																						dbGAP											0													142.0	152.0	149.0					16																	11940658		2197	4300	6497	-	-	-	SO:0001583	missense	0			AY154473	CCDS10551.1	16p13.13	2011-08-12			ENSG00000171490	ENSG00000171490			24534	protein-coding gene	gene with protein product		615874				15334068, 9859858	Standard	NM_015659		Approved	PBK1, L12, DKFZP564M182, CSIG, UTP30	uc002dbp.1	O76021	OTTHUMG00000129824	ENST00000571133.1:c.427G>A	16.37:g.11940658C>T	ENSP00000460871:p.Glu143Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJ58|D3DUG7|Q2M1T7|Q6PL22|Q8IWS7|Q8WUZ1|Q9HDA9|Q9Y3Z9	Missense_Mutation	SNP	pfam_Ribosomal_L1,superfamily_Ribosomal_L1_SF	p.E143K	ENST00000571133.1	37	c.427	CCDS10551.1	16	.	.	.	.	.	.	.	.	.	.	C	32	5.138468	0.94560	.	.	ENSG00000171490	ENST00000355674;ENST00000396503	T	0.43294	0.95	5.23	5.23	0.72850	Ribosomal protein L1, 3-layer alpha/beta-sandwich (1);Ribosomal protein L1, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.69033	0.3066	M	0.86343	2.81	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.71656	0.974;0.974	T	0.73642	-0.3918	10	0.51188	T	0.08	-37.5649	17.3795	0.87401	0.0:1.0:0.0:0.0	.	143;143	Q32Q62;O76021	.;RL1D1_HUMAN	K	143	ENSP00000347897:E143K	ENSP00000347897:E143K	E	-	1	0	RSL1D1	11848159	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	6.527000	0.73803	2.444000	0.82710	0.555000	0.69702	GAA	RSL1D1	-	pfam_Ribosomal_L1,superfamily_Ribosomal_L1_SF	ENSG00000171490		0.388	RSL1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSL1D1	HGNC	protein_coding	OTTHUMT00000252059.2	77	0.00	0	C	NM_015659		11940658	11940658	-1	no_errors	ENST00000571133	ensembl	human	known	69_37n	missense	46	40.26	31	SNP	1.000	T
RUSC2	9853	genome.wustl.edu	37	9	35558279	35558279	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr9:35558279A>G	ENST00000455600.1	+	7	3715	c.3146A>G	c.(3145-3147)gAg>gGg	p.E1049G		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1049	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			GCCGTGCTGGAGGATGGGCTC	0.577																																						dbGAP											0													99.0	85.0	90.0					9																	35558279		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.3146A>G	9.37:g.35558279A>G	ENSP00000393922:p.Glu1049Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	pfam_Run,pfam_SH3_2,superfamily_SH3_domain,smart_Run,smart_SH3_domain,pfscan_Run,pfscan_SH3_domain	p.E1049G	ENST00000455600.1	37	c.3146	CCDS35008.1	9	.	.	.	.	.	.	.	.	.	.	A	14.76	2.631501	0.46944	.	.	ENSG00000198853	ENST00000361226;ENST00000455600	T;T	0.30981	1.51;1.51	5.72	4.59	0.56863	RUN (2);	0.352981	0.31188	N	0.008090	T	0.14056	0.0340	N	0.12182	0.205	0.33924	D	0.641201	B	0.09022	0.002	B	0.08055	0.003	T	0.12167	-1.0558	10	0.30078	T	0.28	-19.5276	3.637	0.08153	0.7113:0.0:0.2887:0.0	.	1049	Q8N2Y8	RUSC2_HUMAN	G	1049	ENSP00000355177:E1049G;ENSP00000393922:E1049G	ENSP00000355177:E1049G	E	+	2	0	RUSC2	35548279	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.878000	0.69682	2.183000	0.69458	0.533000	0.62120	GAG	RUSC2	-	pfam_Run,pfscan_Run	ENSG00000198853		0.577	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RUSC2	HGNC	protein_coding	OTTHUMT00000052309.1	71	0.00	0	A	XM_048462		35558279	35558279	+1	no_errors	ENST00000361226	ensembl	human	known	69_37n	missense	70	14.63	12	SNP	1.000	G
SELPLG	6404	genome.wustl.edu	37	12	109017662	109017662	+	Missense_Mutation	SNP	G	G	A	rs63748999|rs372173288	byFrequency	TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr12:109017662G>A	ENST00000550948.1	-	2	646	c.422C>T	c.(421-423)gCa>gTa	p.A141V	SELPLG_ENST00000228463.6_Missense_Mutation_p.A157V|SELPLG_ENST00000388962.3_Splice_Site_p.A131V			Q14242	SELPL_HUMAN	selectin P ligand	141	12 X 10 AA tandem repeats.		Missing (in short form; not an alternative splicing; dbSNP:rs63748999). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7505206}.		blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interleukin-6 (GO:0071354)|leukocyte adhesive activation (GO:0050902)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(3)|skin(1)	12						AGTGGTCTGTGCCTCCGTGGG	0.602																																						dbGAP											0													172.0	132.0	145.0					12																	109017662		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31895.1, CCDS31895.2, CCDS55881.1	12q24	2014-01-30						"""CD molecules"", ""Endogenous ligands"""	10722	protein-coding gene	gene with protein product		600738				7505206	Standard	NM_003006		Approved	PSGL-1, CD162	uc010sxe.2	Q14242		ENST00000550948.1:c.422C>T	12.37:g.109017662G>A	ENSP00000447752:p.Ala141Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Y0|B4DQC3|B7Z5C7|J3KMX6|Q12775|Q6GTW7|Q8N7J7	Missense_Mutation	SNP	NULL	p.A141V	ENST00000550948.1	37	c.422	CCDS31895.2	12	.	.	.	.	.	.	.	.	.	.	G	7.104	0.574738	0.13623	.	.	ENSG00000110876	ENST00000388962;ENST00000550948;ENST00000228463	T;T;T	0.13538	2.58;2.58;2.58	3.66	-1.93	0.07594	.	.	.	.	.	T	0.07818	0.0196	L	0.40543	1.245	0.09310	N	1	B;B	0.29432	0.244;0.138	B;B	0.25506	0.061;0.033	T	0.37820	-0.9689	9	0.22109	T	0.4	-6.07	1.4128	0.02295	0.2338:0.1245:0.4158:0.2259	.	157;141	B7Z5C7;Q14242	.;SELPL_HUMAN	V	131;141;157	ENSP00000373614:A131V;ENSP00000447752:A141V;ENSP00000228463:A157V	ENSP00000228463:A157V	A	-	2	0	SELPLG	107541791	0.017000	0.18338	0.000000	0.03702	0.001000	0.01503	1.623000	0.37008	-0.381000	0.07882	-0.500000	0.04577	GCA	SELPLG	-	NULL	ENSG00000110876		0.602	SELPLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELPLG	HGNC	protein_coding	OTTHUMT00000403904.1	862	0.00	0	G			109017662	109017662	-1	no_errors	ENST00000550948	ensembl	human	known	69_37n	missense	422	20.00	106	SNP	0.000	A
SLC17A1	6568	genome.wustl.edu	37	6	25801134	25801134	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr6:25801134C>G	ENST00000244527.4	-	11	1368	c.1253G>C	c.(1252-1254)gGa>gCa	p.G418A	SLC17A1_ENST00000476801.1_Missense_Mutation_p.G418A|SLC17A1_ENST00000427328.1_Missense_Mutation_p.G364A|SLC17A1_ENST00000468082.1_Missense_Mutation_p.G364A	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	418					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						AAGGATCAATCCAGTCAAAGT	0.299																																						dbGAP											0													103.0	103.0	103.0					6																	25801134		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.1253G>C	6.37:g.25801134C>G	ENSP00000244527:p.Gly418Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Pi_cotranspt	p.G418A	ENST00000244527.4	37	c.1253	CCDS4565.1	6	.	.	.	.	.	.	.	.	.	.	C	19.96	3.922960	0.73213	.	.	ENSG00000124568	ENST00000244527;ENST00000427328;ENST00000476801;ENST00000468082	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	3.67	3.67	0.42095	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.800542	0.10517	N	0.665383	T	0.77644	0.4161	M	0.86864	2.845	0.30008	N	0.815387	D;D	0.76494	0.999;0.998	D;D	0.69654	0.965;0.948	T	0.68379	-0.5424	10	0.87932	D	0	.	11.2287	0.48899	0.0:1.0:0.0:0.0	.	364;418	Q14916-2;Q14916	.;NPT1_HUMAN	A	418;364;418;364	ENSP00000244527:G418A;ENSP00000410549:G364A;ENSP00000420614:G418A;ENSP00000420546:G364A	ENSP00000244527:G418A	G	-	2	0	SLC17A1	25909113	0.276000	0.24211	0.443000	0.26883	0.735000	0.41995	2.730000	0.47335	2.353000	0.79882	0.655000	0.94253	GGA	SLC17A1	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Pi_cotranspt	ENSG00000124568		0.299	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A1	HGNC	protein_coding	OTTHUMT00000043647.2	60	0.00	0	C			25801134	25801134	-1	no_errors	ENST00000244527	ensembl	human	known	69_37n	missense	62	19.48	15	SNP	0.512	G
SLC22A25	387601	genome.wustl.edu	37	11	62948206	62948206	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr11:62948206delC	ENST00000306494.6	-	6	995	c.996delG	c.(994-996)cagfs	p.Q332fs	SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000535888.1_Intron|SLC22A25_ENST00000403374.2_Frame_Shift_Del_p.Q166fs	NM_199352.3	NP_955384.3			solute carrier family 22, member 25											NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						AATGCTTTTTCTGTGCTGCCT	0.398																																						dbGAP											0													150.0	139.0	143.0					11																	62948206		2201	4298	6499	-	-	-	SO:0001589	frameshift_variant	0			AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.996delG	11.37:g.62948206delC	ENSP00000307443:p.Gln332fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.K334fs	ENST00000306494.6	37	c.996	CCDS31592.1	11																																																																																			SLC22A25	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000196600		0.398	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A25	HGNC	protein_coding	OTTHUMT00000383519.3	141	0.00	0	C	NM_199352		62948206	62948206	-1	no_errors	ENST00000306494	ensembl	human	known	69_37n	frame_shift_del	91	13.76	15	DEL	0.018	-
STAC	6769	genome.wustl.edu	37	3	36485094	36485094	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr3:36485094A>G	ENST00000273183.3	+	2	650	c.350A>G	c.(349-351)aAg>aGg	p.K117R	STAC_ENST00000457375.2_Missense_Mutation_p.K117R|STAC_ENST00000476388.1_3'UTR	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	117					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						ATCTTCAAGAAGCCCACTTTC	0.577																																						dbGAP											0													122.0	114.0	117.0					3																	36485094		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.350A>G	3.37:g.36485094A>G	ENSP00000273183:p.Lys117Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8S8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_SH3_domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.K117R	ENST00000273183.3	37	c.350	CCDS2662.1	3	.	.	.	.	.	.	.	.	.	.	A	14.44	2.536162	0.45176	.	.	ENSG00000144681	ENST00000273183;ENST00000457375;ENST00000544687;ENST00000434649	D;D;D	0.92911	-3.13;-1.79;-1.79	5.03	5.03	0.67393	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.91623	0.7353	N	0.25094	0.71	0.28623	N	0.908083	D;D	0.69078	0.997;0.996	D;D	0.75020	0.985;0.916	D	0.84828	0.0800	10	0.14252	T	0.57	.	14.733	0.69397	1.0:0.0:0.0:0.0	.	117;117	E9PEA7;Q99469	.;STAC_HUMAN	R	117;117;49;106	ENSP00000273183:K117R;ENSP00000393713:K117R;ENSP00000398403:K106R	ENSP00000273183:K117R	K	+	2	0	STAC	36460098	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.238000	0.95380	2.026000	0.59711	0.455000	0.32223	AAG	STAC	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000144681		0.577	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAC	HGNC	protein_coding	OTTHUMT00000253338.2	29	0.00	0	A	NM_003149		36485094	36485094	+1	no_errors	ENST00000273183	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	1.000	G
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000540980.1_Silent_p.Q56Q|TBP_ENST00000230354.6_Silent_p.Q76Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																						dbGAP											4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	12	0.00	0	G	NM_003194		170871052	170871052	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	33	35.29	18	SNP	0.994	A
TP53	7157	genome.wustl.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	GRCh37	CM010465|CM900211	TP53	M	rs121912651						151.0	112.0	125.0					17																	7577539		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248W	ENST00000269305.4	37	c.742	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	75	0.00	0	G	NM_000546		7577539	7577539	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	24	42.86	18	SNP	1.000	A
TTC39A	22996	genome.wustl.edu	37	1	51761833	51761833	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr1:51761833T>C	ENST00000447632.2	-	13	1219	c.1171A>G	c.(1171-1173)Att>Gtt	p.I391V	TTC39A_ENST00000530004.1_5'UTR|TTC39A_ENST00000534098.1_Intron|TTC39A_ENST00000371750.5_Missense_Mutation_p.I356V|TTC39A_ENST00000371747.3_Missense_Mutation_p.I390V|TTC39A_ENST00000262675.7_Missense_Mutation_p.I328V|TTC39A_ENST00000413473.2_Missense_Mutation_p.I359V|TTC39A_ENST00000451380.1_Missense_Mutation_p.I355V			Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A	391								p.0?(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(2)|prostate(2)|skin(3)|urinary_tract(1)	17						TTCATGTAAATGTAGGTGGCC	0.607											OREG0013486	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)											42.0	48.0	46.0					1																	51761833		2058	4178	6236	-	-	-	SO:0001583	missense	0			AB007921	CCDS44143.1, CCDS44144.1, CCDS72789.1, CCDS72790.1	1p32.3	2013-01-11	2008-06-23	2008-06-23	ENSG00000085831	ENSG00000085831		"""Tetratricopeptide (TTC) repeat domain containing"""	18657	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 34"""	C1orf34		9455484, 9461476	Standard	XM_005270643		Approved	KIAA0452, DEME-6	uc010onf.2	Q5SRH9	OTTHUMG00000008193	ENST00000447632.2:c.1171A>G	1.37:g.51761833T>C	ENSP00000393952:p.Ile391Val	Somatic	979	WXS	Illumina GAIIx	Phase_IV	B7Z782|E7EQY9|G3XAF8|O43417|O75040|Q5SRH5|Q5SRH6|Q5SRH7|Q5SRH8|Q5SRI0|Q5SRI1|Q5SRI2|Q5T7S1|Q6PIU8|Q9BT24	Missense_Mutation	SNP	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.I391V	ENST00000447632.2	37	c.1171		1	.	.	.	.	.	.	.	.	.	.	T	4.027	0.002522	0.07819	.	.	ENSG00000085831	ENST00000447632;ENST00000413473;ENST00000262675;ENST00000451380;ENST00000371750;ENST00000371747	T;T;T;T;T;T	0.62105	0.72;0.72;0.72;0.72;0.72;0.05	5.23	1.33	0.21861	.	0.539015	0.21501	N	0.073530	T	0.22898	0.0553	N	0.00788	-1.185	0.25635	N	0.986261	B;B;B;B;B;B	0.09022	0.0;0.0;0.001;0.002;0.0;0.001	B;B;B;B;B;B	0.11329	0.002;0.004;0.002;0.002;0.006;0.001	T	0.20140	-1.0284	10	0.15952	T	0.53	-10.5005	3.6107	0.08060	0.1328:0.0733:0.1385:0.6554	.	359;355;328;355;391;356	Q5SRH9-4;E7EQY9;D3DQ30;B7Z782;Q5SRH9;G3XAF8	.;.;.;.;TT39A_HUMAN;.	V	391;359;328;355;356;390	ENSP00000393952:I391V;ENSP00000406144:I359V;ENSP00000262675:I328V;ENSP00000397207:I355V;ENSP00000360815:I356V;ENSP00000360812:I390V	ENSP00000262675:I328V	I	-	1	0	TTC39A	51534421	0.990000	0.36364	1.000000	0.80357	0.992000	0.81027	1.104000	0.31074	0.292000	0.22492	0.460000	0.39030	ATT	TTC39A	-	pfam_OMP_IML2_mit/TPR_39	ENSG00000085831		0.607	TTC39A-004	KNOWN	basic	protein_coding	TTC39A	HGNC	protein_coding	OTTHUMT00000022434.2	31	0.00	0	T			51761833	51761833	-1	no_errors	ENST00000447632	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	1.000	C
TRIM67	440730	genome.wustl.edu	37	1	231344976	231344976	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr1:231344976C>A	ENST00000366653.5	+	8	2103	c.2103C>A	c.(2101-2103)caC>caA	p.H701Q	TRIM67_ENST00000444294.3_Missense_Mutation_p.H699Q|TRIM67_ENST00000366652.2_Missense_Mutation_p.H701Q|TRIM67_ENST00000449018.3_Missense_Mutation_p.H639Q			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	701	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GGTTCATGCACTGCAACTCCC	0.597																																						dbGAP											0													79.0	84.0	82.0					1																	231344976		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.2103C>A	1.37:g.231344976C>A	ENSP00000355613:p.His701Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.H701Q	ENST00000366653.5	37	c.2103	CCDS44333.1	1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.246581	0.80024	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29	5.73	2.85	0.33270	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	D	0.89863	0.6838	M	0.88105	2.93	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.90341	0.4359	10	0.59425	D	0.04	.	11.8829	0.52586	0.0:0.802:0.0:0.198	.	701	Q6ZTA4	TRI67_HUMAN	Q	699;701;639;701	ENSP00000412124:H699Q;ENSP00000355612:H701Q;ENSP00000400163:H639Q;ENSP00000355613:H701Q	ENSP00000355612:H701Q	H	+	3	2	TRIM67	229411599	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.268000	0.33062	0.899000	0.36444	-0.119000	0.15052	CAC	TRIM67	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000119283		0.597	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	TRIM67	HGNC	protein_coding	OTTHUMT00000092649.3	100	0.00	0	C	NM_001004342		231344976	231344976	+1	no_errors	ENST00000366652	ensembl	human	known	69_37n	missense	80	30.43	35	SNP	1.000	A
UBR2	23304	genome.wustl.edu	37	6	42585064	42585064	+	Silent	SNP	C	C	T			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr6:42585064C>T	ENST00000372899.1	+	11	1527	c.1269C>T	c.(1267-1269)acC>acT	p.T423T	UBR2_ENST00000372901.1_Intron|UBR2_ENST00000372903.2_Intron|UBR2_ENST00000372883.3_Intron	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	423					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			AGTTCTTCACCGCACCTACTC	0.458																																						dbGAP											0													137.0	121.0	127.0					6																	42585064		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.1269C>T	6.37:g.42585064C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Silent	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.T423	ENST00000372899.1	37	c.1269	CCDS4870.1	6																																																																																			UBR2	-	NULL	ENSG00000024048		0.458	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBR2	HGNC	protein_coding	OTTHUMT00000040558.2	106	0.00	0	C	NM_015255		42585064	42585064	+1	no_errors	ENST00000372899	ensembl	human	known	69_37n	silent	74	20.43	19	SNP	0.980	T
USP41	373856	genome.wustl.edu	37	22	20720878	20720878	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr22:20720878C>A	ENST00000454608.2	-	10	869	c.870G>T	c.(868-870)gaG>gaT	p.E290D	USP41_ENST00000486536.2_5'UTR			Q3LFD5	UBP41_HUMAN	ubiquitin specific peptidase 41	290	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			endometrium(1)|kidney(1)|lung(2)|skin(1)	5						CATCACAAGACTCTCGCTTCA	0.537																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AJ586979		22q11.22	2011-01-31	2005-08-08		ENSG00000161133	ENSG00000161133		"""Ubiquitin-specific peptidases"""	20070	protein-coding gene	gene with protein product			"""ubiquitin specific protease 41"""			12838346	Standard	XM_006710116		Approved		uc011ahq.1	Q3LFD5	OTTHUMG00000151317	ENST00000454608.2:c.870G>T	22.37:g.20720878C>A	ENSP00000414922:p.Glu290Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXD0|Q70BM7	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.E290D	ENST00000454608.2	37	c.870		22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	0.004|0.004	-2.368686|-2.368686	0.00209|0.00209	.|.	.|.	ENSG00000161133|ENSG00000161133	ENST00000454608|ENST00000292729	T|.	0.32272|.	1.46|.	0.311|0.311	-0.622|-0.622	0.11560|0.11560	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);|.	0.786334|.	0.12483|.	N|.	0.465003|.	T|T	0.21347|0.21347	0.0514|0.0514	N|N	0.13371|0.13371	0.34|0.34	.|.	.|.	.|.	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.06405|.	0.002;0.002|.	T|T	0.30090|0.30090	-0.9990|-0.9990	8|3	0.13108|.	T|.	0.6|.	.|.	.|.	.|.	.|.	.|.	290;122|.	Q3LFD5;F5H844|.	UBP41_HUMAN;.|.	D|I	290|238	ENSP00000414922:E290D|.	ENSP00000414922:E290D|.	E|S	-|-	3|2	2|0	USP41|USP41	19050878|19050878	0.001000|0.001000	0.12720|0.12720	0.001000|0.001000	0.08648|0.08648	0.001000|0.001000	0.01503|0.01503	0.123000|0.123000	0.15708|0.15708	-0.608000|-0.608000	0.05731|0.05731	-0.608000|-0.608000	0.04076|0.04076	GAG|AGT	USP41	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000161133		0.537	USP41-201	KNOWN	basic|appris_candidate_longest	protein_coding	USP41	HGNC	protein_coding		18	0.00	0	C	XM_036729		20720878	20720878	-1	no_stop_codon	ENST00000454608	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.002	A
VWCE	220001	genome.wustl.edu	37	11	61026440	61026440	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr11:61026440G>C	ENST00000335613.5	-	20	2961	c.2575C>G	c.(2575-2577)Cta>Gta	p.L859V	VWCE_ENST00000535710.1_Missense_Mutation_p.L324V	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	859	Pro-rich.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GGGGAAGCTAGAGGTAGAGTG	0.662																																						dbGAP											0													25.0	30.0	28.0					11																	61026440		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.2575C>G	11.37:g.61026440G>C	ENSP00000334186:p.Leu859Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	pfam_VWF_C,pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd,smart_VWF_C,smart_VWC_out,pfscan_EG-like_dom,pfscan_VWF_C	p.L859V	ENST00000335613.5	37	c.2575	CCDS8002.1	11	.	.	.	.	.	.	.	.	.	.	G	7.345	0.621718	0.14193	.	.	ENSG00000167992	ENST00000335613;ENST00000535710	T;T	0.68331	-0.32;3.55	4.64	4.64	0.57946	.	0.192225	0.25925	N	0.027413	T	0.51736	0.1692	N	0.22421	0.69	0.26935	N	0.966375	B	0.23316	0.083	B	0.21360	0.034	T	0.44498	-0.9324	10	0.33940	T	0.23	.	13.3742	0.60728	0.0:0.0:1.0:0.0	.	859	Q96DN2	VWCE_HUMAN	V	859;324	ENSP00000334186:L859V;ENSP00000442570:L324V	ENSP00000334186:L859V	L	-	1	2	VWCE	60783016	1.000000	0.71417	0.990000	0.47175	0.036000	0.12997	3.283000	0.51701	2.268000	0.75426	0.655000	0.94253	CTA	VWCE	-	NULL	ENSG00000167992		0.662	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWCE	HGNC	protein_coding	OTTHUMT00000398811.1	27	0.00	0	G	NM_152718		61026440	61026440	-1	no_errors	ENST00000335613	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	0.997	C
ZNF177	7730	genome.wustl.edu	37	19	9492136	9492136	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr19:9492136T>G	ENST00000589262.1	+	6	1195	c.1129T>G	c.(1129-1131)Ttc>Gtc	p.F377V	ZNF177_ENST00000434737.2_Missense_Mutation_p.F377V|ZNF177_ENST00000343499.4_Missense_Mutation_p.F217V|ZNF177_ENST00000602738.1_Missense_Mutation_p.F217V|ZNF177_ENST00000590616.1_Intron|ZNF177_ENST00000541595.2_Missense_Mutation_p.F217V|ZNF177_ENST00000446085.4_3'UTR|ZNF177_ENST00000602856.1_3'UTR	NM_001172651.1	NP_001166122.1	Q13360	ZN177_HUMAN	zinc finger protein 177	377					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|stomach(2)	13						TGGAAAAGCCTTCATCGATCA	0.473																																						dbGAP											0													168.0	168.0	168.0					19																	9492136		2203	4300	6503	-	-	-	SO:0001583	missense	0			U37263, BC012012	CCDS12212.1, CCDS54214.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	12966	protein-coding gene	gene with protein product		601276					Standard	NM_003451		Approved		uc021uon.1	Q13360		ENST00000589262.1:c.1129T>G	19.37:g.9492136T>G	ENSP00000468531:p.Phe377Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DY57|E9PDG0|I3L0I4|Q96ER2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F377V	ENST00000589262.1	37	c.1129	CCDS54214.1	19	.	.	.	.	.	.	.	.	.	.	T	18.66	3.670979	0.67814	.	.	ENSG00000188629	ENST00000541595;ENST00000343499;ENST00000434737	T;T;T	0.47528	0.84;0.84;0.84	2.64	2.64	0.31445	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.71978	0.3404	M	0.92122	3.275	0.26722	N	0.970756	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80955	-0.1151	8	0.87932	D	0	.	9.1073	0.36705	0.0:0.0:0.0:1.0	.	377;217	B4DY57;Q13360	.;ZN177_HUMAN	V	217;217;377	ENSP00000445323:F217V;ENSP00000341497:F217V;ENSP00000415070:F377V	ENSP00000341497:F217V	F	+	1	0	ZNF177	9353136	1.000000	0.71417	0.956000	0.39512	0.891000	0.51852	4.788000	0.62439	1.472000	0.48140	0.460000	0.39030	TTC	ZNF177	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000188629		0.473	ZNF177-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF177	HGNC	protein_coding	OTTHUMT00000449028.1	118	0.00	0	T	NM_003451		9492136	9492136	+1	no_errors	ENST00000434737	ensembl	human	known	69_37n	missense	58	33.33	29	SNP	0.999	G
ZNF716	441234	genome.wustl.edu	37	7	57528859	57528859	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr7:57528859A>G	ENST00000420713.1	+	4	804	c.692A>G	c.(691-693)cAt>cGt	p.H231R		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	231					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						CTTACTAGACATAAAAGAATT	0.378																																						dbGAP											0													30.0	27.0	28.0					7																	57528859		692	1591	2283	-	-	-	SO:0001583	missense	0			AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.692A>G	7.37:g.57528859A>G	ENSP00000394248:p.His231Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H231R	ENST00000420713.1	37	c.692	CCDS55112.1	7	.	.	.	.	.	.	.	.	.	.	A	8.316	0.823106	0.16678	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	D	0.86865	-2.18	0.195	0.195	0.15151	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.86965	0.6060	M	0.91140	3.18	0.31271	N	0.691719	B	0.23185	0.081	B	0.17433	0.018	T	0.82896	-0.0230	9	0.66056	D	0.02	.	4.8229	0.13400	0.9998:0.0:2.0E-4:0.0	.	219	A6NP11	ZN716_HUMAN	R	231;219	ENSP00000394248:H231R	ENSP00000387687:H219R	H	+	2	0	ZNF716	57532801	0.997000	0.39634	0.041000	0.18516	0.040000	0.13550	6.146000	0.71777	0.257000	0.21650	0.254000	0.18369	CAT	ZNF716	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000182111		0.378	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF716	HGNC	protein_coding	OTTHUMT00000345309.1	61	0.00	0	A	NM_001159279		57528859	57528859	+1	no_errors	ENST00000420713	ensembl	human	known	69_37n	missense	37	43.08	28	SNP	0.995	G
ZRANB1	54764	genome.wustl.edu	37	10	126673532	126673532	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XL-01A-11D-A14K-09	TCGA-D8-A1XL-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	28d44e6e-c73f-4788-8ad4-2bd6572f643d	a64ed39f-0699-4997-b8f4-011090174b75	g.chr10:126673532G>C	ENST00000359653.4	+	9	2469	c.2098G>C	c.(2098-2100)Gag>Cag	p.E700Q		NM_017580.2	NP_060050.2	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	700					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|positive regulation of Wnt signaling pathway (GO:0030177)|protein deubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0071947)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell morphogenesis (GO:0022604)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	23		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		GTCTGATGGAGAGGAAGATGA	0.478																																						dbGAP											0													43.0	40.0	41.0					10																	126673532		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ252060	CCDS7642.1	10q26.12	2014-02-24			ENSG00000019995	ENSG00000019995		"""Zinc fingers, RAN-binding domain containing"", ""OTU domain containing"""	18224	protein-coding gene	gene with protein product		611749				11463333	Standard	NM_017580		Approved	TRABID	uc001lic.3	Q9UGI0	OTTHUMG00000019223	ENST00000359653.4:c.2098G>C	10.37:g.126673532G>C	ENSP00000352676:p.Glu700Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ98|D3DRF4|Q5SQP6|Q69YK3	Missense_Mutation	SNP	pfam_OTU,pfam_Znf_RanBP2,smart_Znf_RanBP2,pfscan_OTU,pfscan_Znf_RanBP2	p.E700Q	ENST00000359653.4	37	c.2098	CCDS7642.1	10	.	.	.	.	.	.	.	.	.	.	G	14.24	2.474997	0.43942	.	.	ENSG00000019995	ENST00000359653	T	0.19394	2.15	5.27	5.27	0.74061	.	0.050354	0.85682	D	0.000000	T	0.21550	0.0519	L	0.44542	1.39	0.80722	D	1	B	0.27823	0.19	B	0.24701	0.055	T	0.02484	-1.1152	10	0.27785	T	0.31	-19.3383	19.0693	0.93126	0.0:0.0:1.0:0.0	.	700	Q9UGI0	ZRAN1_HUMAN	Q	700	ENSP00000352676:E700Q	ENSP00000352676:E700Q	E	+	1	0	ZRANB1	126663522	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.346000	0.79347	2.733000	0.93635	0.650000	0.86243	GAG	ZRANB1	-	NULL	ENSG00000019995		0.478	ZRANB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZRANB1	HGNC	protein_coding	OTTHUMT00000050898.1	34	0.00	0	G	NM_017580		126673532	126673532	+1	no_errors	ENST00000359653	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	1.000	C
