#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
BSN	8927	genome.wustl.edu	37	3	49694289	49694289	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr3:49694289C>T	ENST00000296452.4	+	5	7414	c.7300C>T	c.(7300-7302)Cgc>Tgc	p.R2434C		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	2434					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GCAAGAGGAACGCCAGGCTCA	0.622																																						dbGAP											0													23.0	24.0	24.0					3																	49694289		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.7300C>T	3.37:g.49694289C>T	ENSP00000296452:p.Arg2434Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43161|Q7LGH3	Missense_Mutation	SNP	pfam_Znf_piccolo,superfamily_Znf_FYVE_PHD	p.R2434C	ENST00000296452.4	37	c.7300	CCDS2800.1	3	.	.	.	.	.	.	.	.	.	.	C	10.75	1.438632	0.25900	.	.	ENSG00000164061	ENST00000296452	T	0.29397	1.57	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.58864	0.2152	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58165	-0.7684	10	0.87932	D	0	-14.2473	20.177	0.98182	0.0:1.0:0.0:0.0	.	2434	Q9UPA5	BSN_HUMAN	C	2434	ENSP00000296452:R2434C	ENSP00000296452:R2434C	R	+	1	0	BSN	49669293	0.997000	0.39634	0.992000	0.48379	0.999000	0.98932	3.557000	0.53741	2.854000	0.98071	0.655000	0.94253	CGC	BSN	-	NULL	ENSG00000164061		0.622	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	HGNC	protein_coding	OTTHUMT00000258164.1	26	0.00	0	C	NM_003458		49694289	49694289	+1	no_errors	ENST00000296452	ensembl	human	known	69_37n	missense	15	51.61	16	SNP	0.998	T
C1QTNF5	114902	genome.wustl.edu	37	11	119210189	119210190	+	Frame_Shift_Ins	INS	-	-	C	rs369839371		TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr11:119210189_119210190insC	ENST00000528368.1	-	3	814_815	c.583_584insG	c.(583-585)gccfs	p.A195fs	MFRP_ENST00000530681.1_3'UTR|C1QTNF5_ENST00000445041.2_Frame_Shift_Ins_p.A195fs|C1QTNF5_ENST00000525657.1_5'UTR|RP11-334E6.10_ENST00000501918.2_RNA|MFRP_ENST00000555262.1_3'UTR	NM_001278431.1	NP_001265360.1	Q9BXJ0	C1QT5_HUMAN	C1q and tumor necrosis factor related protein 5	195	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(2)	3		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CCTCACCATGGCCCCCCCCGAG	0.589																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF329841	CCDS8420.1	11q23.3	2013-05-10				ENSG00000223953			14344	protein-coding gene	gene with protein product	"""complement-c1q tumor necrosis factor-related protein 5"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 3"""	608752				12944416	Standard	NM_015645		Approved	CTRP5, DKFZp586B0621, LORD		Q9BXJ0	OTTHUMG00000166198	ENST00000528368.1:c.584dupG	11.37:g.119210197_119210197dupC	ENSP00000431140:p.Ala195fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDD3|B0YJ35|Q335M2|Q8N6P2|Q9UFX4	Frame_Shift_Ins	INS	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like,smart_C1q,prints_C1q,pfscan_C1q	p.A195fs	ENST00000528368.1	37	c.584_583	CCDS8420.1	11																																																																																			C1QTNF5	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,prints_C1q,pfscan_C1q	ENSG00000223953		0.589	C1QTNF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF5	HGNC	protein_coding	OTTHUMT00000388354.1	78	0.00	0	-	NM_015645		119210189	119210190	-1	no_errors	ENST00000445041	ensembl	human	known	69_37n	frame_shift_ins	49	27.94	19	INS	1.000:0.976	C
CACNA1C	775	genome.wustl.edu	37	12	2788732	2788732	+	Silent	SNP	C	C	T	rs199538058	byFrequency	TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr12:2788732C>T	ENST00000347598.4	+	44	5358	c.5358C>T	c.(5356-5358)ggC>ggT	p.G1786G	CACNA1C_ENST00000406454.3_Silent_p.G1738G|CACNA1C_ENST00000399617.1_Silent_p.G1738G|CACNA1C_ENST00000399644.1_Silent_p.G1738G|CACNA1C_ENST00000399621.1_Silent_p.G1757G|CACNA1C_ENST00000402845.3_Silent_p.G1757G|CACNA1C_ENST00000399591.1_Silent_p.G1746G|CACNA1C_ENST00000344100.3_Silent_p.G1779G|CACNA1C_ENST00000399595.1_Silent_p.G1746G|CACNA1C_ENST00000399641.1_Silent_p.G1738G|CACNA1C_ENST00000399655.1_Silent_p.G1738G|CACNA1C_ENST00000399637.1_Silent_p.G1757G|CACNA1C_ENST00000399649.1_Silent_p.G1744G|CACNA1C_ENST00000399634.1_Silent_p.G1738G|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399629.1_Silent_p.G1755G|CACNA1C_ENST00000399597.1_Silent_p.G1738G|CACNA1C_ENST00000335762.5_Silent_p.G1763G|CACNA1C_ENST00000399606.1_Silent_p.G1758G|CACNA1C_ENST00000399603.1_Silent_p.G1738G|CACNA1C_ENST00000399638.1_Silent_p.G1766G|CACNA1C_ENST00000327702.7_Silent_p.G1738G|CACNA1C_ENST00000399601.1_Silent_p.G1738G	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1786					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCAGCCAGGGCGACACTGAGT	0.632																																						dbGAP											0													55.0	67.0	63.0					12																	2788732		2142	4247	6389	-	-	-	SO:0001819	synonymous_variant	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5358C>T	12.37:g.2788732C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.G1738	ENST00000347598.4	37	c.5214	CCDS44788.1	12																																																																																			CACNA1C	-	NULL	ENSG00000151067		0.632	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	96	0.00	0	C	NM_000719		2788732	2788732	+1	no_errors	ENST00000399634	ensembl	human	known	69_37n	silent	31	45.76	27	SNP	0.819	T
CIT	11113	genome.wustl.edu	37	12	120156107	120156107	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr12:120156107C>T	ENST00000261833.7	-	31	4037	c.3985G>A	c.(3985-3987)Gcc>Acc	p.A1329T	CIT_ENST00000392521.2_Missense_Mutation_p.A1371T|CIT_ENST00000537607.1_5'UTR	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1329					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		AGGCTCATGGCACTGGGCTGG	0.602																																						dbGAP											0													52.0	57.0	55.0					12																	120156107		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.3985G>A	12.37:g.120156107C>T	ENSP00000261833:p.Ala1329Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,pirsf_Citron_Rho-interacting_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.A1329T	ENST00000261833.7	37	c.3985	CCDS9192.1	12	.	.	.	.	.	.	.	.	.	.	C	19.54	3.847353	0.71603	.	.	ENSG00000122966	ENST00000392521;ENST00000261833	T;T	0.64438	-0.07;-0.1	5.74	3.82	0.43975	.	0.130702	0.51477	D	0.000083	T	0.42314	0.1197	N	0.19112	0.55	0.43390	D	0.995509	B;B;B	0.30361	0.058;0.0;0.277	B;B;B	0.23419	0.046;0.001;0.046	T	0.39440	-0.9614	10	0.40728	T	0.16	.	10.067	0.42311	0.0:0.7124:0.2021:0.0855	.	1371;1329;847	Q2M5E1;O14578;O14578-3	.;CTRO_HUMAN;.	T	1371;1329	ENSP00000376306:A1371T;ENSP00000261833:A1329T	ENSP00000261833:A1329T	A	-	1	0	CIT	118640490	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.843000	0.62838	2.707000	0.92482	0.655000	0.94253	GCC	CIT	-	pirsf_Citron_Rho-interacting_kinase	ENSG00000122966		0.602	CIT-001	KNOWN	basic|CCDS	protein_coding	CIT	HGNC	protein_coding	OTTHUMT00000259410.4	74	0.00	0	C	NM_007174		120156107	120156107	-1	no_errors	ENST00000261833	ensembl	human	known	69_37n	missense	35	44.78	30	SNP	1.000	T
CROCCP2	84809	genome.wustl.edu	37	1	16950880	16950880	+	lincRNA	SNP	T	T	C	rs1629127	byFrequency	TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr1:16950880T>C	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CCGGGCCACTTGCCCCAGCGT	0.701																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950880T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.701	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	37	0.00	0	T	NR_026752.1		16950880	16950880	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	31	13.89	5	SNP	0.238	C
CUL4A	8451	genome.wustl.edu	37	13	113897392	113897392	+	Silent	SNP	G	G	A			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr13:113897392G>A	ENST00000375440.4	+	11	1230	c.1146G>A	c.(1144-1146)aaG>aaA	p.K382K	CUL4A_ENST00000326335.4_Silent_p.K282K|CUL4A_ENST00000451881.1_Silent_p.K282K|CUL4A_ENST00000375441.3_Silent_p.K282K	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	382					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			GCTTCCAGAAGAATGAGCGGT	0.463																																						dbGAP											0													164.0	133.0	143.0					13																	113897392		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.1146G>A	13.37:g.113897392G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Silent	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.K382	ENST00000375440.4	37	c.1146	CCDS41908.1	13																																																																																			CUL4A	-	pfam_Cullin_N,superfamily_Cullin_repeat-like_dom	ENSG00000139842		0.463	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL4A	HGNC	protein_coding	OTTHUMT00000045888.3	103	0.00	0	G	NM_003589		113897392	113897392	+1	no_errors	ENST00000375440	ensembl	human	known	69_37n	silent	30	46.43	26	SNP	1.000	A
DENND2D	79961	genome.wustl.edu	37	1	111742312	111742312	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr1:111742312A>G	ENST00000357640.4	-	2	405	c.176T>C	c.(175-177)gTg>gCg	p.V59A	DENND2D_ENST00000369752.5_Missense_Mutation_p.V56A|CHI3L2_ENST00000445067.2_5'Flank|DENND2D_ENST00000473682.1_5'UTR	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	59					positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		GAGAGAAACCACAAGAAGGTA	0.498																																						dbGAP											0													106.0	116.0	113.0					1																	111742312		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.176T>C	1.37:g.111742312A>G	ENSP00000350266:p.Val59Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T5V6|Q9BSU0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.V59A	ENST00000357640.4	37	c.176	CCDS831.1	1	.	.	.	.	.	.	.	.	.	.	A	29.1	4.977293	0.92982	.	.	ENSG00000162777	ENST00000357640;ENST00000369752	T;T	0.27890	1.64;1.65	6.07	6.07	0.98685	uDENN (2);	0.117336	0.56097	D	0.000025	T	0.45816	0.1361	M	0.68593	2.085	0.53005	D	0.999964	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.45731	-0.9241	10	0.56958	D	0.05	-17.5977	14.5809	0.68288	1.0:0.0:0.0:0.0	.	56;59	Q9H6A0-2;Q9H6A0	.;DEN2D_HUMAN	A	59;56	ENSP00000350266:V59A;ENSP00000358767:V56A	ENSP00000350266:V59A	V	-	2	0	DENND2D	111543835	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	8.745000	0.91600	2.326000	0.78906	0.533000	0.62120	GTG	DENND2D	-	pfam_uDENN_dom,smart_uDENN_dom,pfscan_uDENN_dom	ENSG00000162777		0.498	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DENND2D	HGNC	protein_coding	OTTHUMT00000034456.1	48	0.00	0	A	NM_024901		111742312	111742312	-1	no_errors	ENST00000357640	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	1.000	G
DIP2A	23181	genome.wustl.edu	37	21	47965866	47965866	+	Missense_Mutation	SNP	A	A	T	rs371918896		TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr21:47965866A>T	ENST00000417564.2	+	20	2407	c.2386A>T	c.(2386-2388)Atc>Ttc	p.I796F	DIP2A_ENST00000457905.3_Missense_Mutation_p.I796F|DIP2A_ENST00000435722.3_Missense_Mutation_p.I796F|DIP2A_ENST00000427143.2_Missense_Mutation_p.I732F|DIP2A_ENST00000318711.7_Missense_Mutation_p.I797F|DIP2A_ENST00000400274.1_Missense_Mutation_p.I792F|DIP2A_ENST00000466639.1_Missense_Mutation_p.I753F			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	796					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GCTGGGCTTCATCGGGCCTGT	0.602																																						dbGAP											0													85.0	92.0	89.0					21																	47965866		2091	4220	6311	-	-	-	SO:0001583	missense	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.2386A>T	21.37:g.47965866A>T	ENSP00000392066:p.Ile796Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.I797F	ENST00000417564.2	37	c.2389	CCDS46655.1	21	.	.	.	.	.	.	.	.	.	.	A	15.42	2.827883	0.50845	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05;1.05	4.84	1.74	0.24563	AMP-dependent synthetase/ligase (1);	0.244686	0.34725	N	0.003738	T	0.47563	0.1452	M	0.72894	2.215	0.51767	D	0.999934	B;B;P;P;P;P;B	0.48089	0.254;0.07;0.905;0.562;0.562;0.537;0.018	B;B;P;P;P;B;B	0.49012	0.371;0.09;0.558;0.598;0.493;0.361;0.031	T	0.44375	-0.9332	10	0.66056	D	0.02	-8.2859	9.1814	0.37143	0.8858:0.0:0.1142:0.0	.	797;732;753;732;796;796;796	E9PER1;E7EMA5;Q14689-3;B4E0F0;Q14689;Q14689-4;Q14689-2	.;.;.;.;DIP2A_HUMAN;.;.	F	792;732;797;753;796;753;796;796	ENSP00000383133:I792F;ENSP00000400528:I732F;ENSP00000323633:I797F;ENSP00000393434:I796F;ENSP00000430249:I753F;ENSP00000415089:I796F;ENSP00000392066:I796F	ENSP00000323633:I797F	I	+	1	0	DIP2A	46790294	0.986000	0.35501	0.961000	0.40146	0.977000	0.68977	0.855000	0.27805	0.033000	0.15463	0.482000	0.46254	ATC	DIP2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000160305		0.602	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	109	0.00	0	A	NM_015151		47965866	47965866	+1	no_errors	ENST00000318711	ensembl	human	known	69_37n	missense	18	51.35	19	SNP	0.980	T
DNER	92737	genome.wustl.edu	37	2	230312186	230312186	+	Silent	SNP	G	G	T	rs200504138	byFrequency	TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr2:230312186G>T	ENST00000341772.4	-	8	1466	c.1332C>A	c.(1330-1332)acC>acA	p.T444T		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	444	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		CCACATAGCAGGTGCCGTTGT	0.547																																						dbGAP											0													53.0	51.0	52.0					2																	230312186		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.1332C>A	2.37:g.230312186G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Silent	SNP	pfam_EGF-like_dom,pfam_EGF_extracell,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.T444	ENST00000341772.4	37	c.1332	CCDS33390.1	2																																																																																			DNER	-	pfam_EGF-like_dom,pfam_EGF_extracell,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000187957		0.547	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNER	HGNC	protein_coding	OTTHUMT00000331902.1	54	0.00	0	G	NM_139072		230312186	230312186	-1	no_errors	ENST00000341772	ensembl	human	known	69_37n	silent	21	16.00	4	SNP	0.893	T
DSCAM	1826	genome.wustl.edu	37	21	41741044	41741044	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr21:41741044C>T	ENST00000400454.1	-	4	1114	c.637G>A	c.(637-639)Gcc>Acc	p.A213T		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	213	Ig-like C2-type 2.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				AAAAGTCTGGCGCTGTTGCTC	0.428																																					Melanoma(134;970 1778 1785 21664 32388)	dbGAP											0													86.0	87.0	87.0					21																	41741044		1926	4138	6064	-	-	-	SO:0001583	missense	0			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.637G>A	21.37:g.41741044C>T	ENSP00000383303:p.Ala213Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O60468	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A213T	ENST00000400454.1	37	c.637	CCDS42929.1	21	.	.	.	.	.	.	.	.	.	.	C	36	5.626471	0.96671	.	.	ENSG00000171587	ENST00000400454	T	0.12255	2.7	6.07	6.07	0.98685	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.40645	0.1125	M	0.74546	2.27	0.53688	D	0.999971	D	0.89917	1.0	D	0.69654	0.965	T	0.02417	-1.1162	10	0.49607	T	0.09	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	213	O60469	DSCAM_HUMAN	T	213	ENSP00000383303:A213T	ENSP00000383303:A213T	A	-	1	0	DSCAM	40662914	1.000000	0.71417	0.769000	0.31535	0.950000	0.60333	7.670000	0.83925	2.885000	0.99019	0.655000	0.94253	GCC	DSCAM	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000171587		0.428	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	96	0.00	0	C	NM_001389		41741044	41741044	-1	no_errors	ENST00000400454	ensembl	human	known	69_37n	missense	39	22.00	11	SNP	1.000	T
EIF4ENIF1	56478	genome.wustl.edu	37	22	31867837	31867838	+	Frame_Shift_Ins	INS	-	-	T			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr22:31867837_31867838insT	ENST00000397525.1	-	3	385_386	c.162_163insA	c.(160-165)aaatatfs	p.Y55fs	EIF4ENIF1_ENST00000397523.1_Frame_Shift_Ins_p.Y55fs|EIF4ENIF1_ENST00000344710.5_Frame_Shift_Ins_p.Y55fs|EIF4ENIF1_ENST00000330125.5_Frame_Shift_Ins_p.Y55fs	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	55						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TACCTGTCATATTTTTCAGAAA	0.322																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.163dupA	22.37:g.31867842_31867842dupT	ENSP00000380659:p.Tyr55fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Frame_Shift_Ins	INS	pfam_eIF4E_transporter	p.Y54fs	ENST00000397525.1	37	c.163_162	CCDS13898.1	22																																																																																			EIF4ENIF1	-	pfam_eIF4E_transporter	ENSG00000184708		0.322	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4ENIF1	HGNC	protein_coding	OTTHUMT00000127926.1	119	0.00	0	-	NM_019843		31867837	31867838	-1	no_errors	ENST00000330125	ensembl	human	known	69_37n	frame_shift_ins	50	35.06	27	INS	1.000:1.000	T
ETV3L	440695	genome.wustl.edu	37	1	157069272	157069272	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr1:157069272C>T	ENST00000454449.2	-	1	328	c.44G>A	c.(43-45)gGc>gAc	p.G15D		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	15					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				GATCCAGTTGCCGGGGTTGGC	0.647																																						dbGAP											0													32.0	31.0	31.0					1																	157069272		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.44G>A	1.37:g.157069272C>T	ENSP00000430271:p.Gly15Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ets,smart_Ets,prints_Ets,pfscan_Ets	p.G15D	ENST00000454449.2	37	c.44	CCDS30893.1	1	.	.	.	.	.	.	.	.	.	.	C	11.92	1.783918	0.31593	.	.	ENSG00000253831	ENST00000454449	T	0.10192	2.9	5.16	0.616	0.17613	.	2.096290	0.02438	N	0.084251	T	0.01421	0.0046	N	0.08118	0	0.09310	N	1	B	0.32245	0.361	B	0.24006	0.05	T	0.38067	-0.9678	10	0.56958	D	0.05	.	1.6464	0.02763	0.1638:0.362:0.2975:0.1766	.	15	Q6ZN32	ETV3L_HUMAN	D	15	ENSP00000430271:G15D	ENSP00000430271:G15D	G	-	2	0	ETV3L	155335896	0.000000	0.05858	0.033000	0.17914	0.031000	0.12232	0.208000	0.17415	0.217000	0.20800	-0.136000	0.14681	GGC	ETV3L	-	NULL	ENSG00000253831		0.647	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3L	HGNC	protein_coding	OTTHUMT00000099024.2	44	0.00	0	C	NM_001004341		157069272	157069272	-1	no_errors	ENST00000454449	ensembl	human	known	69_37n	missense	40	29.82	17	SNP	0.004	T
FBXO7	25793	genome.wustl.edu	37	22	32889121	32889121	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr22:32889121G>C	ENST00000266087.7	+	7	1324	c.997G>C	c.(997-999)Gtc>Ctc	p.V333L	FBXO7_ENST00000397426.1_Missense_Mutation_p.V219L|FBXO7_ENST00000382058.3_Missense_Mutation_p.V254L	NM_012179.3	NP_036311.3	Q9Y3I1	FBX7_HUMAN	F-box protein 7	333	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cell death (GO:0008219)|mitochondrion degradation (GO:0000422)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of lymphocyte differentiation (GO:0045620)|protein targeting to mitochondrion (GO:0006626)|protein ubiquitination (GO:0016567)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ATTTGGGTTGGTCGTCCTCCC	0.438																																						dbGAP											0													345.0	289.0	308.0					22																	32889121		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF129537	CCDS13907.1, CCDS58806.1	22q12.3	2013-09-19	2004-06-15		ENSG00000100225	ENSG00000100225		"""F-boxes /  ""other"""", ""Parkinson disease"""	13586	protein-coding gene	gene with protein product		605648	"""F-box only protein 7"""			10531035, 10531037, 19038853	Standard	NM_001257990		Approved	FBX7, Fbx, PARK15	uc003amq.3	Q9Y3I1	OTTHUMG00000030674	ENST00000266087.7:c.997G>C	22.37:g.32889121G>C	ENSP00000266087:p.Val333Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNB3|B4DWX5|Q5TGC4|Q5TI86|Q96HM6|Q9UF21|Q9UKT2	Missense_Mutation	SNP	pfam_Inhibitor_PI31,pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.V333L	ENST00000266087.7	37	c.997	CCDS13907.1	22	.	.	.	.	.	.	.	.	.	.	G	8.195	0.796858	0.16327	.	.	ENSG00000100225	ENST00000266087;ENST00000382058;ENST00000397426	T;T;T	0.52526	0.66;0.66;0.66	6.08	-0.453	0.12201	F-box domain, cyclin-like (1);F-box domain, Skp2-like (1);	0.641608	0.16535	N	0.210203	T	0.20373	0.0490	N	0.08118	0	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.002	B;B;B	0.12156	0.007;0.003;0.007	T	0.27971	-1.0058	10	0.07644	T	0.81	-1.3046	7.9463	0.29989	0.0594:0.4998:0.2481:0.1927	.	333;254;333	A8K7F7;Q9Y3I1-2;Q9Y3I1	.;.;FBX7_HUMAN	L	333;254;219	ENSP00000266087:V333L;ENSP00000371490:V254L;ENSP00000380571:V219L	ENSP00000266087:V333L	V	+	1	0	FBXO7	31219121	0.990000	0.36364	0.015000	0.15790	0.616000	0.37450	0.429000	0.21412	-0.178000	0.10672	-0.136000	0.14681	GTC	FBXO7	-	superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	ENSG00000100225		0.438	FBXO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO7	HGNC	protein_coding	OTTHUMT00000129001.1	373	0.00	0	G			32889121	32889121	+1	no_errors	ENST00000266087	ensembl	human	known	69_37n	missense	87	43.14	66	SNP	0.009	C
FAM19A5	25817	genome.wustl.edu	37	22	49042480	49042480	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr22:49042480G>A	ENST00000402357.1	+	2	317	c.184G>A	c.(184-186)Gcc>Acc	p.A62T	FAM19A5_ENST00000358295.5_Missense_Mutation_p.A55T|FAM19A5_ENST00000473898.1_Intron	NM_001082967.1	NP_001076436.1	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A5	62						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(6)	7		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		GAGGACGATCGCCCGGCAGAC	0.687																																						dbGAP											0													23.0	30.0	28.0					22																	49042480		2068	4208	6276	-	-	-	SO:0001583	missense	0			AY325118	CCDS46728.1, CCDS46729.1	22q13.32	2005-09-20			ENSG00000219438	ENSG00000219438			21592	protein-coding gene	gene with protein product						15028294	Standard	NM_015381		Approved	TAFA-5	uc003bim.4	Q7Z5A7	OTTHUMG00000150308	ENST00000402357.1:c.184G>A	22.37:g.49042480G>A	ENSP00000383933:p.Ala62Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NII9|B0QZ13|B0QZ14|B0QZ15|O95902|Q5H9C4|Q6UWC9|Q8IXR8	Missense_Mutation	SNP	pfam_Chemokine-like_FAM19A2	p.A55T	ENST00000402357.1	37	c.163	CCDS46728.1	22	.	.	.	.	.	.	.	.	.	.	G	34	5.341408	0.95783	.	.	ENSG00000219438	ENST00000402357;ENST00000336769;ENST00000358295	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	T	0.77356	0.4118	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.941;0.995	T	0.79771	-0.1663	8	0.87932	D	0	.	17.3357	0.87280	0.0:0.0:1.0:0.0	.	55;62	Q7Z5A7-2;Q7Z5A7	.;F19A5_HUMAN	T	62;62;55	.	ENSP00000336812:A62T	A	+	1	0	FAM19A5	47428916	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	8.827000	0.92041	2.417000	0.82017	0.655000	0.94253	GCC	FAM19A5	-	pfam_Chemokine-like_FAM19A2	ENSG00000219438		0.687	FAM19A5-003	PUTATIVE	basic|CCDS	protein_coding	FAM19A5	HGNC	protein_coding	OTTHUMT00000317504.1	24	0.00	0	G	NM_015381		49042480	49042480	+1	no_errors	ENST00000358295	ensembl	human	known	69_37n	missense	11	42.11	8	SNP	1.000	A
KCNJ12	3768	genome.wustl.edu	37	17	21319592	21319592	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr17:21319592G>A	ENST00000583088.1	+	3	1833	c.938G>A	c.(937-939)cGc>cAc	p.R313H	KCNJ12_ENST00000331718.5_Missense_Mutation_p.R313H	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	313					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	ACCCAGGCCCGCAGCTCCTAC	0.592										Prostate(3;0.18)																												dbGAP											0													108.0	109.0	108.0					17																	21319592		2203	4300	6503	-	-	-	SO:0001583	missense	0			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.938G>A	17.37:g.21319592G>A	ENSP00000463778:p.Arg313His	Somatic		WXS	Illumina GAIIx	Phase_IV	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir2.2	p.R313H	ENST00000583088.1	37	c.938	CCDS11219.1	17	.	.	.	.	.	.	.	.	.	.	G	27.3	4.814601	0.90790	.	.	ENSG00000184185	ENST00000331718	D	0.94897	-3.55	5.44	5.44	0.79542	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.98523	0.9507	H	0.97806	4.08	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99624	1.0984	10	0.87932	D	0	.	19.2719	0.94013	0.0:0.0:1.0:0.0	.	313	Q14500	IRK12_HUMAN	H	313	ENSP00000328150:R313H	ENSP00000328150:R313H	R	+	2	0	KCNJ12	21260185	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.698000	0.98700	2.561000	0.86390	0.561000	0.74099	CGC	KCNJ12	-	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2	ENSG00000184185		0.592	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	HGNC	protein_coding	OTTHUMT00000255060.2	104	0.00	0	G	NM_021012		21319592	21319592	+1	no_errors	ENST00000331718	ensembl	human	known	69_37n	missense	77	17.20	16	SNP	1.000	A
KIAA1045	23349	genome.wustl.edu	37	9	34977197	34977197	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr9:34977197T>C	ENST00000242315.3	+	6	1049	c.967T>C	c.(967-969)Tgg>Cgg	p.W323R	KIAA1045_ENST00000544237.1_Missense_Mutation_p.W323R|KIAA1045_ENST00000476115.2_3'UTR	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	323							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			CCAGCACTCTTGGTTTTGCAA	0.637																																						dbGAP											0													62.0	68.0	66.0					9																	34977197		1993	4162	6155	-	-	-	SO:0001583	missense	0			AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.967T>C	9.37:g.34977197T>C	ENSP00000242315:p.Trp323Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.W323R	ENST00000242315.3	37	c.967	CCDS43796.1	9	.	.	.	.	.	.	.	.	.	.	T	21.0	4.088754	0.76756	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	.	.	.	4.72	4.72	0.59763	.	0.000000	0.64402	D	0.000001	T	0.65091	0.2658	L	0.34521	1.04	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.68481	-0.5397	9	0.87932	D	0	-13.2766	12.0782	0.53655	0.0:0.0:0.0:1.0	.	323	Q9UPV7	K1045_HUMAN	R	323	.	ENSP00000242315:W323R	W	+	1	0	KIAA1045	34967197	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	6.852000	0.75430	1.988000	0.58038	0.533000	0.62120	TGG	KIAA1045	-	NULL	ENSG00000122733		0.637	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1045	HGNC	protein_coding	OTTHUMT00000052256.2	50	0.00	0	T	XM_048592		34977197	34977197	+1	no_errors	ENST00000242315	ensembl	human	known	69_37n	missense	21	47.50	19	SNP	1.000	C
LEUTX	342900	genome.wustl.edu	37	19	40275187	40275187	+	5'UTR	SNP	C	C	T			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr19:40275187C>T	ENST00000396841.4	+	0	102					NM_001143832.1	NP_001137304.1	A8MZ59	LEUTX_HUMAN	leucine twenty homeobox						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|breast(1)|kidney(1)|skin(2)	5						GCGTTATCGTCGGCCACGCAC	0.453																																						dbGAP											0													56.0	48.0	50.0					19																	40275187		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0					19q13.2	2011-06-20			ENSG00000213921	ENSG00000213921		"""Homeoboxes / PRD class"""	31953	protein-coding gene	gene with protein product							Standard	NM_001143832		Approved		uc010xvg.2	A8MZ59		ENST00000396841.4:c.-63C>T	19.37:g.40275187C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.V34	ENST00000396841.4	37	c.102		19																																																																																			LEUTX	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000213921		0.453	LEUTX-001	NOVEL	basic|appris_principal	protein_coding	LEUTX	HGNC	protein_coding	OTTHUMT00000410828.3	31	0.00	0	C	XM_001129035		40275187	40275187	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000556180	ensembl	human	known	69_37n	silent	13	56.67	17	SNP	0.001	T
MAP2K3	5606	genome.wustl.edu	37	17	21206523	21206523	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr17:21206523G>A	ENST00000342679.4	+	7	794	c.545G>A	c.(544-546)aGc>aAc	p.S182N	MAP2K3_ENST00000316920.6_Missense_Mutation_p.S153N|MAP2K3_ENST00000361818.5_Missense_Mutation_p.S153N	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	182	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CATCTGCACAGCAAGCTGTCG	0.632																																						dbGAP											0													50.0	42.0	45.0					17																	21206523		2203	4300	6503	-	-	-	SO:0001583	missense	0			L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.545G>A	17.37:g.21206523G>A	ENSP00000345083:p.Ser182Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S182N	ENST00000342679.4	37	c.545	CCDS11217.1	17	.	.	.	.	.	.	.	.	.	.	G	17.34	3.363735	0.61513	.	.	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000316920	T;T	0.45276	0.9;0.9	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.45196	0.1330	L	0.60067	1.865	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.36407	-0.9749	10	0.56958	D	0.05	-46.9621	19.2744	0.94026	0.0:0.0:1.0:0.0	.	182	P46734	MP2K3_HUMAN	N	182;153;153;186	ENSP00000345083:S182N;ENSP00000355081:S153N	ENSP00000319139:S186N	S	+	2	0	MAP2K3	21147116	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.557000	0.82243	2.569000	0.86673	0.561000	0.74099	AGC	MAP2K3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000034152		0.632	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K3	HGNC	protein_coding	OTTHUMT00000259374.2	61	0.00	0	G	NM_145109		21206523	21206523	+1	no_errors	ENST00000342679	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	1.000	A
MRPL27	51264	genome.wustl.edu	37	17	48447871	48447871	+	Silent	SNP	G	G	A			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr17:48447871G>A	ENST00000225969.4	-	2	160	c.117C>T	c.(115-117)tcC>tcT	p.S39S	MRPL27_ENST00000507088.1_5'UTR|MRPL27_ENST00000503633.1_Silent_p.S39S|EME1_ENST00000338165.4_5'Flank|MRPL27_ENST00000511860.1_5'UTR|EME1_ENST00000393271.2_5'Flank|MRPL27_ENST00000442592.3_Silent_p.S39S	NM_016504.2	NP_057588.1	Q9P0M9	RM27_HUMAN	mitochondrial ribosomal protein L27	39					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(2)|urinary_tract(1)	4	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;1.73e-07)			CGAGGTTTTTGGAGCTACCAC	0.512																																						dbGAP											0													298.0	265.0	276.0					17																	48447871		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB049647	CCDS11564.1	17q21.3-q22	2012-09-13			ENSG00000108826	ENSG00000108826		"""Mitochondrial ribosomal proteins / large subunits"""	14483	protein-coding gene	gene with protein product		611837					Standard	NM_016504		Approved		uc002iqq.3	Q9P0M9	OTTHUMG00000162062	ENST00000225969.4:c.117C>T	17.37:g.48447871G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE14	Nonsense_Mutation	SNP	pfam_Ribosomal_L27,superfamily_Ribosomal_L27,prints_Ribosomal_L27	p.Q22*	ENST00000225969.4	37	c.64	CCDS11564.1	17	.	.	.	.	.	.	.	.	.	.	G	10.42	1.345976	0.24426	.	.	ENSG00000108826	ENST00000508200	.	.	.	6.06	-1.64	0.08318	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.5718	7.7788	0.29054	0.3643:0.0:0.4989:0.1368	.	.	.	.	X	22	.	.	Q	-	1	0	MRPL27	45802870	0.982000	0.34865	0.996000	0.52242	0.820000	0.46376	0.010000	0.13242	-0.058000	0.13177	-0.142000	0.14014	CAA	MRPL27	-	pfam_Ribosomal_L27,prints_Ribosomal_L27	ENSG00000108826		0.512	MRPL27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL27	HGNC	protein_coding	OTTHUMT00000367057.1	182	0.54	1	G			48447871	48447871	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000508200	ensembl	human	novel	69_37n	nonsense	49	41.67	35	SNP	0.964	A
P2RY10	27334	genome.wustl.edu	37	X	78216289	78216289	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chrX:78216289T>A	ENST00000171757.2	+	4	552	c.272T>A	c.(271-273)aTt>aAt	p.I91N	P2RY10_ENST00000544091.1_Missense_Mutation_p.I91N|P2RY10_ENST00000475374.1_3'UTR	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						CCCCTCCGGATTTACTATTAC	0.453																																						dbGAP											0													114.0	103.0	107.0					X																	78216289		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.272T>A	X.37:g.78216289T>A	ENSP00000171757:p.Ile91Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.I91N	ENST00000171757.2	37	c.272	CCDS14442.1	X	.	.	.	.	.	.	.	.	.	.	T	15.96	2.985570	0.53934	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.38240	1.15;1.15	5.01	5.01	0.66863	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.66906	0.2837	M	0.92268	3.29	0.50813	D	0.999894	D	0.76494	0.999	D	0.75020	0.985	T	0.75651	-0.3244	10	0.87932	D	0	.	12.5831	0.56401	0.0:0.0:0.0:1.0	.	91	O00398	P2Y10_HUMAN	N	91	ENSP00000443138:I91N;ENSP00000171757:I91N	ENSP00000171757:I91N	I	+	2	0	P2RY10	78102945	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	5.913000	0.69957	1.853000	0.53794	0.345000	0.21793	ATT	P2RY10	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_P2_purnocptor	ENSG00000078589		0.453	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY10	HGNC	protein_coding	OTTHUMT00000057323.1	124	0.00	0	T			78216289	78216289	+1	no_errors	ENST00000171757	ensembl	human	known	69_37n	missense	42	53.85	49	SNP	1.000	A
PEG3	5178	genome.wustl.edu	37	19	57328905	57328905	+	Missense_Mutation	SNP	C	C	T	rs549894601		TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr19:57328905C>T	ENST00000326441.9	-	10	1268	c.905G>A	c.(904-906)cGg>cAg	p.R302Q	ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.R302Q|PEG3_ENST00000598410.1_Missense_Mutation_p.R178Q|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.R176Q|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	302					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		ACAAATCCCCCGCCGGTGGGT	0.463													C|||	1	0.000199681	0.0	0.0	5008	,	,		18114	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													51.0	59.0	56.0					19																	57328905		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.905G>A	19.37:g.57328905C>T	ENSP00000326581:p.Arg302Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R302Q	ENST00000326441.9	37	c.905	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	C	13.90	2.373906	0.42105	.	.	ENSG00000198300	ENST00000326441;ENST00000423103;ENST00000292074	T;T	0.02197	4.4;4.4	4.27	3.24	0.37175	.	0.000000	0.43919	D	0.000511	T	0.01353	0.0044	L	0.27053	0.805	.	.	.	P;P;P	0.52577	0.89;0.89;0.954	B;B;B	0.37650	0.168;0.255;0.166	T	0.32214	-0.9915	9	0.07813	T	0.8	-23.6433	6.5444	0.22398	0.0:0.7917:0.0:0.2083	.	178;302;237	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	Q	302;302;272	ENSP00000326581:R302Q;ENSP00000403051:R302Q	ENSP00000292074:R272Q	R	-	2	0	ZIM2	62020717	0.007000	0.16637	0.504000	0.27639	0.992000	0.81027	0.061000	0.14366	1.395000	0.46643	0.561000	0.74099	CGG	PEG3	-	NULL	ENSG00000198300		0.463	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	43	0.00	0	C			57328905	57328905	-1	no_errors	ENST00000326441	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	0.770	T
JADE3	9767	genome.wustl.edu	37	X	46913561	46913561	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chrX:46913561G>A	ENST00000218343.4	+	9	1272	c.974G>A	c.(973-975)tGc>tAc	p.C325Y	PHF16_ENST00000397189.1_Splice_Site_p.C325Y	NM_014735.3	NP_055550.1														NS(2)|endometrium(8)|kidney(4)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(2)	33						TTCCTACAGTGCTCTATAAAA	0.458																																						dbGAP											0													41.0	37.0	38.0					X																	46913561		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0																														ENST00000218343.4:c.973-1G>A	X.37:g.46913561G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.C325Y	ENST00000218343.4	37	c.974	CCDS14271.1	X	.	.	.	.	.	.	.	.	.	.	G	15.64	2.892811	0.52121	.	.	ENSG00000102221	ENST00000397189;ENST00000218343	T;T	0.53206	0.63;0.63	5.14	5.14	0.70334	Zinc finger, PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.82688	0.5091	H	0.99104	4.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90720	0.4634	10	0.87932	D	0	.	17.9754	0.89126	0.0:0.0:1.0:0.0	.	325	Q92613	JADE3_HUMAN	Y	325	ENSP00000380373:C325Y;ENSP00000218343:C325Y	ENSP00000218343:C325Y	C	+	2	0	PHF16	46798505	1.000000	0.71417	0.999000	0.59377	0.084000	0.17831	9.367000	0.97148	2.265000	0.75225	0.600000	0.82982	TGC	PHF16	-	smart_Znf_PHD	ENSG00000102221		0.458	PHF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF16	HGNC	protein_coding	OTTHUMT00000056376.1	46	0.00	0	G		Missense_Mutation	46913561	46913561	+1	no_errors	ENST00000218343	ensembl	human	known	69_37n	missense	7	50.00	7	SNP	1.000	A
QSER1	79832	genome.wustl.edu	37	11	32954399	32954399	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr11:32954399C>T	ENST00000399302.2	+	4	1543	c.1208C>T	c.(1207-1209)tCt>tTt	p.S403F	QSER1_ENST00000527788.1_Intron	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	403	Ser-rich.									breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					GAGGTATTGTCTTCAGTTACA	0.388																																						dbGAP											0													79.0	73.0	75.0					11																	32954399		1860	4090	5950	-	-	-	SO:0001583	missense	0			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.1208C>T	11.37:g.32954399C>T	ENSP00000382241:p.Ser403Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	NULL	p.S403F	ENST00000399302.2	37	c.1208	CCDS41631.1	11	.	.	.	.	.	.	.	.	.	.	C	13.78	2.339170	0.41398	.	.	ENSG00000060749	ENST00000399302	T	0.49720	0.77	4.73	3.74	0.42951	.	0.781113	0.09889	U	0.742587	T	0.55986	0.1955	L	0.54323	1.7	0.80722	D	1	P	0.52316	0.952	P	0.52267	0.694	T	0.53258	-0.8464	10	0.40728	T	0.16	.	14.1605	0.65443	0.0:0.7342:0.2657:0.0	.	403	Q2KHR3	QSER1_HUMAN	F	403	ENSP00000382241:S403F	ENSP00000382241:S403F	S	+	2	0	QSER1	32910975	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	1.915000	0.39976	2.348000	0.79779	0.467000	0.42956	TCT	QSER1	-	NULL	ENSG00000060749		0.388	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	HGNC	protein_coding	OTTHUMT00000388448.1	83	0.00	0	C	NM_024774		32954399	32954399	+1	no_errors	ENST00000399302	ensembl	human	known	69_37n	missense	25	46.81	22	SNP	0.976	T
SH3KBP1	30011	genome.wustl.edu	37	X	19560229	19560229	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chrX:19560229G>A	ENST00000397821.3	-	16	1996	c.1706C>T	c.(1705-1707)gCg>gTg	p.A569V	SH3KBP1_ENST00000379716.1_Missense_Mutation_p.A331V|SH3KBP1_ENST00000379698.4_Missense_Mutation_p.A532V|SH3KBP1_ENST00000541422.1_Missense_Mutation_p.A308V	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1	569					apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.A569V(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						GGAGGGCGCCGCTGAGGACAG	0.637																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											41.0	42.0	42.0					X																	19560229		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.1706C>T	X.37:g.19560229G>A	ENSP00000380921:p.Ala569Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_p67phox,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.A569V	ENST00000397821.3	37	c.1706	CCDS14193.1	X	.	.	.	.	.	.	.	.	.	.	G	0.669	-0.802514	0.02841	.	.	ENSG00000147010	ENST00000379702;ENST00000397821;ENST00000379716;ENST00000379698;ENST00000541422;ENST00000379726	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	5.54	3.67	0.42095	.	1.927100	0.01829	N	0.034593	T	0.11153	0.0272	N	0.00926	-1.1	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.36744	-0.9735	10	0.09843	T	0.71	-2.8184	4.6927	0.12788	0.2116:0.1752:0.6132:0.0	.	331;569;532	Q5JPT4;Q96B97;Q5JPT5	.;SH3K1_HUMAN;.	V	554;569;331;532;308;549	ENSP00000380921:A569V;ENSP00000369039:A331V;ENSP00000369020:A532V;ENSP00000442499:A308V;ENSP00000369049:A549V	ENSP00000369020:A532V	A	-	2	0	SH3KBP1	19470150	0.300000	0.24435	0.005000	0.12908	0.036000	0.12997	2.538000	0.45710	0.461000	0.27071	0.529000	0.55759	GCG	SH3KBP1	-	NULL	ENSG00000147010		0.637	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3KBP1	HGNC	protein_coding	OTTHUMT00000055992.1	87	0.00	0	G	NM_031892		19560229	19560229	-1	no_errors	ENST00000397821	ensembl	human	known	69_37n	missense	29	54.69	35	SNP	0.002	A
SMC3	9126	genome.wustl.edu	37	10	112361451	112361451	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr10:112361451A>G	ENST00000361804.4	+	24	2827	c.2701A>G	c.(2701-2703)Atg>Gtg	p.M901V		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	901					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TCAGAAGAGTATGGAGCGCTG	0.358																																						dbGAP											0													97.0	105.0	102.0					10																	112361451		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.2701A>G	10.37:g.112361451A>G	ENSP00000354720:p.Met901Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K156|O60464|Q5T482	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge	p.M901V	ENST00000361804.4	37	c.2701	CCDS31285.1	10	.	.	.	.	.	.	.	.	.	.	A	9.770	1.172529	0.21704	.	.	ENSG00000108055	ENST00000361804	T	0.74632	-0.86	5.71	4.55	0.56014	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.46600	0.1401	N	0.01352	-0.895	0.80722	D	1	B	0.13145	0.007	B	0.11329	0.006	T	0.35525	-0.9785	10	0.33141	T	0.24	.	12.0489	0.53495	0.8707:0.0:0.0:0.1293	.	901	Q9UQE7	SMC3_HUMAN	V	901	ENSP00000354720:M901V	ENSP00000354720:M901V	M	+	1	0	SMC3	112351441	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.618000	0.90932	0.950000	0.37743	0.477000	0.44152	ATG	SMC3	-	pfam_RecF/RecN/SMC	ENSG00000108055		0.358	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SMC3	HGNC	protein_coding	OTTHUMT00000050337.1	79	0.00	0	A	NM_005445		112361451	112361451	+1	no_errors	ENST00000361804	ensembl	human	known	69_37n	missense	27	47.06	24	SNP	1.000	G
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000230354.6_Silent_p.Q76Q|TBP_ENST00000540980.1_Silent_p.Q56Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																						dbGAP											4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	27	0.00	0	G	NM_003194		170871052	170871052	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	35	31.37	16	SNP	0.994	A
TPM3	7170	genome.wustl.edu	37	1	154163748	154163748	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr1:154163748C>A	ENST00000368530.2	-	2	349	c.157G>T	c.(157-159)Ggg>Tgg	p.G53W	TPM3_ENST00000271850.7_Missense_Mutation_p.G53W|MIR190B_ENST00000401119.1_RNA	NM_152263.2	NP_689476.2	P06753	TPM3_HUMAN	tropomyosin 3	53					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle thin filament tropomyosin (GO:0005862)|stress fiber (GO:0001725)			TPM3/NTRK1_ENST00000392302(70)|TPM3/ALK(33)	breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					TCCTCTGTCCCTTTCAGCTTC	0.498			T	"""NTRK1, ALK, ROS1"""	"""papillary thyroid, ALCL, NSCLC"""																																	dbGAP		Dom	yes		1	1q22-q23	7170	tropomyosin 3		"""E, L"""	0													115.0	116.0	116.0					1																	154163748		2181	4292	6473	-	-	-	SO:0001583	missense	0			BC008425	CCDS1060.1, CCDS41400.1, CCDS41401.1, CCDS41402.1, CCDS41403.1, CCDS60274.1, CCDS60275.1, CCDS72922.1	1q21.2	2014-09-17			ENSG00000143549	ENSG00000143549		"""Tropomyosins"""	12012	protein-coding gene	gene with protein product		191030		NEM1		1829807	Standard	NM_153649		Approved	TRK	uc001fec.2	P06753	OTTHUMG00000035853	ENST00000368530.2:c.157G>T	1.37:g.154163748C>A	ENSP00000357516:p.Gly53Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV71|P12324|Q2QD06|Q5VU58|Q5VU63|Q5VU66|Q5VU71|Q5VU72|Q8TCG3|Q969Q2|Q9NQH8	Missense_Mutation	SNP	pfam_Tropomyosin,prints_Tropomyosin	p.G53W	ENST00000368530.2	37	c.157	CCDS41403.1	1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005877	0.74932	.	.	ENSG00000143549	ENST00000271850;ENST00000368530;ENST00000515609	D;D;D	0.88046	-2.33;-2.33;-2.33	6.02	5.08	0.68730	.	0.218259	0.47093	D	0.000259	D	0.91690	0.7373	M	0.88842	2.985	0.38937	D	0.958079	D	0.53151	0.958	P	0.59487	0.858	D	0.91816	0.5463	10	0.38643	T	0.18	-4.1114	15.5239	0.75887	0.139:0.861:0.0:0.0	.	52	P06753	TPM3_HUMAN	W	53	ENSP00000271850:G53W;ENSP00000357516:G53W;ENSP00000426306:G53W	ENSP00000271850:G53W	G	-	1	0	TPM3	152430372	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.908000	0.69916	1.489000	0.48450	0.650000	0.86243	GGG	TPM3	-	pfam_Tropomyosin	ENSG00000143549		0.498	TPM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPM3	HGNC	protein_coding	OTTHUMT00000087271.2	230	0.00	0	C	NM_152263		154163748	154163748	-1	no_errors	ENST00000368530	ensembl	human	known	69_37n	missense	168	16.83	34	SNP	1.000	A
ZNF714	148206	genome.wustl.edu	37	19	21299748	21299748	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XR-01A-11D-A14K-09	TCGA-D8-A1XR-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5913c8ff-26ce-4f26-909e-3ed292d3c538	596c1603-ee4c-4f54-9641-27a67edf30a4	g.chr19:21299748T>A	ENST00000596143.1	+	5	603	c.278T>A	c.(277-279)gTt>gAt	p.V93D	ZNF714_ENST00000291770.7_3'UTR|ZNF714_ENST00000601416.1_3'UTR|ZNF714_ENST00000596053.1_Intron	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	93					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						GCAAATGTGGTTGAGTGTAAG	0.338																																						dbGAP											0													55.0	57.0	56.0					19																	21299748		2194	4298	6492	-	-	-	SO:0001583	missense	0			AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.278T>A	19.37:g.21299748T>A	ENSP00000472368:p.Val93Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AI1|Q86W65|Q8ND40	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V93D	ENST00000596143.1	37	c.278	CCDS54239.1	19	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.654196	0.00006	.	.	ENSG00000160352	ENST00000343332;ENST00000291770	.	.	.	0.601	-1.2	0.09554	.	.	.	.	.	T	0.03871	0.0109	N	0.00303	-1.675	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.13019	-1.0525	7	0.02654	T	1	.	.	.	.	.	93;93	Q96N38-2;A6NEM4	.;.	D	93	.	ENSP00000291770:V93D	V	+	2	0	ZNF714	21091588	0.015000	0.18098	0.000000	0.03702	0.003000	0.03518	-0.897000	0.04110	-2.435000	0.00554	-2.151000	0.00333	GTT	ZNF714	-	NULL	ENSG00000160352		0.338	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF714	HGNC	protein_coding	OTTHUMT00000463930.1	98	0.00	0	T	NM_182515		21299748	21299748	+1	no_errors	ENST00000291770	ensembl	human	known	69_37n	missense	34	56.96	45	SNP	0.000	A
