#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA10	10349	genome.wustl.edu	37	17	67183897	67183897	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:67183897C>T	ENST00000269081.4	-	20	3164	c.2255G>A	c.(2254-2256)tGg>tAg	p.W752*	ABCA10_ENST00000416101.2_3'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	752					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					TTGTCGTCTCCAGAGAGCTGC	0.398																																						dbGAP											0													161.0	150.0	154.0					17																	67183897		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.2255G>A	17.37:g.67183897C>T	ENSP00000269081:p.Trp752*	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.W752*	ENST00000269081.4	37	c.2255	CCDS11684.1	17	.	.	.	.	.	.	.	.	.	.	C	45	12.035733	0.99629	.	.	ENSG00000154263	ENST00000269081	.	.	.	2.76	2.76	0.32466	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5688	0.61834	0.0:1.0:0.0:0.0	.	.	.	.	X	752	.	ENSP00000269081:W752X	W	-	2	0	ABCA10	64695492	1.000000	0.71417	0.113000	0.21522	0.097000	0.18754	5.082000	0.64450	1.388000	0.46506	0.411000	0.27672	TGG	ABCA10	-	NULL	ENSG00000154263		0.398	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA10	HGNC	protein_coding	OTTHUMT00000379881.4	72	0.00	0	C	NM_080282		67183897	67183897	-1	no_errors	ENST00000269081	ensembl	human	known	69_37n	nonsense	88	23.48	27	SNP	1.000	T
ABCB6	10058	genome.wustl.edu	37	2	220081432	220081432	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:220081432delC	ENST00000265316.3	-	3	1126	c.810delG	c.(808-810)gggfs	p.G270fs	ABCB6_ENST00000439002.2_Frame_Shift_Del_p.G224fs	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	270	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AACCCATGAGCCCCAGGCAGA	0.572																																						dbGAP											0													32.0	29.0	30.0					2																	220081432		2201	4296	6497	-	-	-	SO:0001589	frameshift_variant	0			AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.810delG	2.37:g.220081432delC	ENSP00000265316:p.Gly270fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Frame_Shift_Del	DEL	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.L271fs	ENST00000265316.3	37	c.810	CCDS2436.1	2																																																																																			ABCB6	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000115657		0.572	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB6	HGNC	protein_coding	OTTHUMT00000256820.2	23	0.00	0	C	NM_005689		220081432	220081432	-1	no_errors	ENST00000265316	ensembl	human	known	69_37n	frame_shift_del	13	31.58	6	DEL	0.510	-
ABTB1	80325	genome.wustl.edu	37	3	127395142	127395142	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:127395142C>T	ENST00000232744.8	+	5	434	c.348C>T	c.(346-348)gaC>gaT	p.D116D	ABTB1_ENST00000453791.2_5'UTR|ABTB1_ENST00000468137.1_5'UTR|ABTB1_ENST00000393363.3_5'UTR					ankyrin repeat and BTB (POZ) domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10						TCCACAGTGACGTGGTCTTTG	0.587																																						dbGAP											0													144.0	138.0	140.0					3																	127395142		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB053324	CCDS3045.1, CCDS46901.1	3q21	2013-01-10			ENSG00000114626	ENSG00000114626		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	18275	protein-coding gene	gene with protein product		608308				10891360, 11494141	Standard	NM_172027		Approved	BPOZ, EF1ABP, Btb3, BTBD21	uc003ejt.3	Q969K4	OTTHUMG00000159636	ENST00000232744.8:c.348C>T	3.37:g.127395142C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.D116	ENST00000232744.8	37	c.348	CCDS3045.1	3																																																																																			ABTB1	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000114626		0.587	ABTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABTB1	HGNC	protein_coding	OTTHUMT00000356595.1	76	0.00	0	C	NM_172027		127395142	127395142	+1	no_errors	ENST00000232744	ensembl	human	known	69_37n	silent	25	37.50	15	SNP	0.978	T
ABTB1	80325	genome.wustl.edu	37	3	127396605	127396605	+	Frame_Shift_Del	DEL	C	C	-	rs144462743	byFrequency	TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:127396605delC	ENST00000232744.8	+	10	1034	c.948delC	c.(946-948)ggcfs	p.G316fs	ABTB1_ENST00000453791.2_Frame_Shift_Del_p.G174fs|ABTB1_ENST00000468137.1_Frame_Shift_Del_p.G174fs|ABTB1_ENST00000393363.3_Frame_Shift_Del_p.G174fs					ankyrin repeat and BTB (POZ) domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10						CCTCAGGGGGCCCCCCAGCCG	0.642																																						dbGAP											0													29.0	31.0	30.0					3																	127396605		2202	4299	6501	-	-	-	SO:0001589	frameshift_variant	0			AB053324	CCDS3045.1, CCDS46901.1	3q21	2013-01-10			ENSG00000114626	ENSG00000114626		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	18275	protein-coding gene	gene with protein product		608308				10891360, 11494141	Standard	NM_172027		Approved	BPOZ, EF1ABP, Btb3, BTBD21	uc003ejt.3	Q969K4	OTTHUMG00000159636	ENST00000232744.8:c.948delC	3.37:g.127396605delC	ENSP00000232744:p.Gly316fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.P318fs	ENST00000232744.8	37	c.948	CCDS3045.1	3																																																																																			ABTB1	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000114626		0.642	ABTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABTB1	HGNC	protein_coding	OTTHUMT00000356595.1	24	0.00	0	C	NM_172027		127396605	127396605	+1	no_errors	ENST00000232744	ensembl	human	known	69_37n	frame_shift_del	12	14.29	2	DEL	1.000	-
ACE	1636	genome.wustl.edu	37	17	61557230	61557230	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:61557230C>T	ENST00000290866.4	+	4	636	c.612C>T	c.(610-612)taC>taT	p.Y204Y	ACE_ENST00000584529.1_3'UTR|ACE_ENST00000538928.1_Silent_p.Y204Y|ACE_ENST00000428043.1_Silent_p.Y204Y	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	204	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	AACCGCTGTACGAGGATTTCA	0.602																																						dbGAP											0													80.0	60.0	67.0					17																	61557230		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.612C>T	17.37:g.61557230C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Silent	SNP	pfam_Peptidase_M2,prints_Peptidase_M2	p.Y204	ENST00000290866.4	37	c.612	CCDS11637.1	17																																																																																			ACE	-	pfam_Peptidase_M2	ENSG00000159640		0.602	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACE	HGNC	protein_coding	OTTHUMT00000337675.2	33	0.00	0	C			61557230	61557230	+1	no_errors	ENST00000290866	ensembl	human	known	69_37n	silent	16	20.00	4	SNP	0.329	T
ACSM2A	123876	genome.wustl.edu	37	16	20487095	20487095	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr16:20487095G>A	ENST00000573854.1	+	8	1212	c.1098G>A	c.(1096-1098)acG>acA	p.T366T	ACSM2A_ENST00000536134.1_Splice_Site_p.T138T|ACSM2A_ENST00000396104.2_Splice_Site_p.T366T|ACSM2A_ENST00000417235.2_Splice_Site_p.T287T|ACSM2A_ENST00000219054.6_Splice_Site_p.T366T|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000575690.1_Splice_Site_p.T366T	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	366					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						AGACAGAAACGGTACCTGTTC	0.483																																						dbGAP											0													146.0	155.0	152.0					16																	20487095		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1098+1G>A	16.37:g.20487095G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTT9|O75202	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.T366	ENST00000573854.1	37	c.1098	CCDS32401.1	16																																																																																			ACSM2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000183747		0.483	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM2A	HGNC	protein_coding	OTTHUMT00000436764.1	46	0.00	0	G	NM_001010845	Silent	20487095	20487095	+1	no_errors	ENST00000219054	ensembl	human	known	69_37n	silent	64	13.33	10	SNP	1.000	A
ADAMTS13	11093	genome.wustl.edu	37	9	136307529	136307529	+	Missense_Mutation	SNP	C	C	T	rs587693885		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr9:136307529C>T	ENST00000371929.3	+	17	2422	c.1978C>T	c.(1978-1980)Cgg>Tgg	p.R660W	ADAMTS13_ENST00000356589.2_Missense_Mutation_p.R629W|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.R660W|ADAMTS13_ENST00000485925.1_Intron|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000536611.1_Intron	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	660	Spacer.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GGTTTACAGGCGGTATGGCGA	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		20611	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													106.0	86.0	93.0					9																	136307529		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.1978C>T	9.37:g.136307529C>T	ENSP00000360997:p.Arg660Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,superfamily_CUB,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R660W	ENST00000371929.3	37	c.1978	CCDS6970.1	9	.	.	.	.	.	.	.	.	.	.	C	13.31	2.200344	0.38905	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589	T;T;T	0.69685	-0.4;-0.42;-0.4	5.24	3.17	0.36434	.	.	.	.	.	T	0.78534	0.4298	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.976;0.99;0.998	T	0.79778	-0.1660	9	0.72032	D	0.01	.	10.8777	0.46921	0.571:0.429:0.0:0.0	.	660;629;660	Q76LX8;Q76LX8-3;Q76LX8-2	ATS13_HUMAN;.;.	W	660;660;629	ENSP00000360997:R660W;ENSP00000347927:R660W;ENSP00000348997:R629W	ENSP00000347927:R660W	R	+	1	2	ADAMTS13	135297350	1.000000	0.71417	0.954000	0.39281	0.001000	0.01503	3.189000	0.50965	1.180000	0.42898	-0.293000	0.09583	CGG	ADAMTS13	-	NULL	ENSG00000160323		0.602	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAMTS13	HGNC	protein_coding	OTTHUMT00000054920.1	49	0.00	0	C	NM_139025		136307529	136307529	+1	no_errors	ENST00000371929	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	1.000	T
AHCTF1	25909	genome.wustl.edu	37	1	247053342	247053342	+	Silent	SNP	T	T	C			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:247053342T>C	ENST00000391829.2	-	17	2193	c.2070A>G	c.(2068-2070)tcA>tcG	p.S690S	AHCTF1_ENST00000326225.3_Silent_p.S699S|AHCTF1_ENST00000366508.1_Silent_p.S725S|AHCTF1_ENST00000470300.1_5'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	690	Necessary for cytoplasmic localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			AGCATAACCTTGACAACTGCA	0.313																																					Colon(145;197 1800 4745 15099 26333)	dbGAP											0													111.0	118.0	116.0					1																	247053342		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.2070A>G	1.37:g.247053342T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Silent	SNP	superfamily_Quinonprotein_ADH-like	p.S699	ENST00000391829.2	37	c.2097		1																																																																																			AHCTF1	-	NULL	ENSG00000153207		0.313	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		63	0.00	0	T	NM_015446		247053342	247053342	-1	no_errors	ENST00000326225	ensembl	human	known	69_37n	silent	112	12.50	16	SNP	1.000	C
AK9	221264	genome.wustl.edu	37	6	109906406	109906406	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr6:109906406C>G	ENST00000424296.2	-	19	2110	c.2034G>C	c.(2032-2034)aaG>aaC	p.K678N	AK9_ENST00000341338.6_5'UTR|AK9_ENST00000368948.2_Missense_Mutation_p.K678N	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	678					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										TTTCAGATTTCTTCTGTAAAT	0.254																																						dbGAP											0													9.0	8.0	8.0					6																	109906406		640	1398	2038	-	-	-	SO:0001583	missense	0			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.2034G>C	6.37:g.109906406C>G	ENSP00000410186:p.Lys678Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS,smart_AAA+_ATPase	p.K678N	ENST00000424296.2	37	c.2034	CCDS55048.1	6	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.904290	0.00512	.	.	ENSG00000155085	ENST00000424296;ENST00000368948	T;T	0.59224	0.28;1.57	5.52	1.66	0.24008	.	0.597033	0.16703	N	0.203022	T	0.08537	0.0212	N	0.01048	-1.04	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19976	-1.0289	9	.	.	.	-12.9032	7.3279	0.26566	0.6497:0.2737:0.0766:0.0	.	678	Q5TCS8	AKD1_HUMAN	N	678	ENSP00000410186:K678N;ENSP00000357944:K678N	.	K	-	3	2	AKD1	110013099	1.000000	0.71417	0.800000	0.32199	0.233000	0.25261	1.371000	0.34250	0.424000	0.26061	-0.272000	0.10252	AAG	AKD1	-	NULL	ENSG00000155085		0.254	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AKD1	HGNC	protein_coding		27	0.00	0	C	NM_001145128		109906406	109906406	-1	no_errors	ENST00000424296	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	0.944	G
ALX4	60529	genome.wustl.edu	37	11	44289156	44289156	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr11:44289156C>T	ENST00000329255.3	-	3	897	c.794G>A	c.(793-795)cGa>cAa	p.R265Q		NM_021926.3	NP_068745.2	Q9H161	ALX4_HUMAN	ALX homeobox 4	265					anterior/posterior pattern specification (GO:0009952)|digestive tract development (GO:0048565)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|hair follicle development (GO:0001942)|muscle organ development (GO:0007517)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of apoptotic process (GO:0042981)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	16						CTTGGCCCTTCGGTTCTGGAA	0.577																																						dbGAP											0													155.0	133.0	140.0					11																	44289156		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF294629	CCDS31468.1	11p11.2	2011-06-20	2008-11-04		ENSG00000052850	ENSG00000052850		"""Homeoboxes / PRD class"""	450	protein-coding gene	gene with protein product		605420	"""parietal foramina 2"", ""aristaless-like homeobox 4"""	PFM2		11017806, 8644736	Standard	NM_021926		Approved	FPP, PFM, KIAA1788	uc001myb.3	Q9H161	OTTHUMG00000166557	ENST00000329255.3:c.794G>A	11.37:g.44289156C>T	ENSP00000332744:p.Arg265Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96JN7|Q9H198|Q9HAY9	Missense_Mutation	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.R265Q	ENST00000329255.3	37	c.794	CCDS31468.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.410589	0.96072	.	.	ENSG00000052850	ENST00000329255	D	0.97710	-4.5	4.88	4.88	0.63580	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.063176	0.64402	D	0.000004	D	0.98982	0.9653	M	0.91561	3.22	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.99505	1.0954	10	0.87932	D	0	.	18.578	0.91162	0.0:1.0:0.0:0.0	.	265	Q9H161	ALX4_HUMAN	Q	265	ENSP00000332744:R265Q	ENSP00000332744:R265Q	R	-	2	0	ALX4	44245732	1.000000	0.71417	0.999000	0.59377	0.915000	0.54546	7.537000	0.82033	2.700000	0.92200	0.462000	0.41574	CGA	ALX4	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000052850		0.577	ALX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALX4	HGNC	protein_coding	OTTHUMT00000390399.1	58	0.00	0	C			44289156	44289156	-1	no_errors	ENST00000329255	ensembl	human	known	69_37n	missense	39	22.00	11	SNP	1.000	T
ANK2	287	genome.wustl.edu	37	4	114251533	114251533	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr4:114251533G>A	ENST00000357077.4	+	27	3085	c.3032G>A	c.(3031-3033)cGc>cAc	p.R1011H	ANK2_ENST00000509550.1_Missense_Mutation_p.R220H|ANK2_ENST00000394537.3_Missense_Mutation_p.R1011H|ANK2_ENST00000506722.1_Missense_Mutation_p.R1002H|ANK2_ENST00000264366.6_Missense_Mutation_p.R1011H	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1011	Interaction with SPTBN1.|ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R1011L(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTGGTCAAGCGCCACAGACTG	0.562																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											95.0	79.0	85.0					4																	114251533		2203	4300	6503	-	-	-	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.3032G>A	4.37:g.114251533G>A	ENSP00000349588:p.Arg1011His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.R1011H	ENST00000357077.4	37	c.3032	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.479263	0.96307	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550	T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.83	5.83	0.93111	ZU5 (3);	0.104004	0.43110	D	0.000615	T	0.56441	0.1985	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.986	D;D;D;D;D;D;P	0.97110	0.982;1.0;0.996;0.979;0.997;0.972;0.674	T	0.56938	-0.7896	10	0.62326	D	0.03	.	20.1236	0.97970	0.0:0.0:1.0:0.0	.	220;1011;56;1011;1011;1002;1002	E9PCH6;Q01484;Q7Z344;Q01484-2;Q01484-4;Q01484-5;F8WEF9	.;ANK2_HUMAN;.;.;.;.;.	H	990;957;1002;90;1026;1011;1011;1011;1002;220	ENSP00000423799:R990H;ENSP00000421011:R957H;ENSP00000421067:R1002H;ENSP00000424722:R1026H;ENSP00000378044:R1011H;ENSP00000349588:R1011H;ENSP00000264366:R1011H;ENSP00000426944:R220H	ENSP00000264366:R1011H	R	+	2	0	ANK2	114470982	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	9.864000	0.99589	2.746000	0.94184	0.563000	0.77884	CGC	ANK2	-	pfam_ZU5,smart_ZU5,pfscan_ZU5	ENSG00000145362		0.562	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	58	0.00	0	G	NM_001148		114251533	114251533	+1	no_errors	ENST00000357077	ensembl	human	known	69_37n	missense	48	20.00	12	SNP	1.000	A
ANKLE2	23141	genome.wustl.edu	37	12	133324459	133324459	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr12:133324459G>A	ENST00000357997.5	-	5	1278	c.1189C>T	c.(1189-1191)Cgt>Tgt	p.R397C	ANKLE2_ENST00000539605.1_Missense_Mutation_p.R335C|ANKLE2_ENST00000337516.5_Missense_Mutation_p.R397C	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	397					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		ACCACGTAACGGATACGCTTC	0.532																																						dbGAP											0													126.0	134.0	131.0					12																	133324459		2180	4259	6439	-	-	-	SO:0001583	missense	0			AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.1189C>T	12.37:g.133324459G>A	ENSP00000350686:p.Arg397Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Missense_Mutation	SNP	pfam_LEM,superfamily_LEM-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ribosomal_L9/RNase_H1_N,pfscan_LEM	p.R397C	ENST00000357997.5	37	c.1189	CCDS41869.1	12	.	.	.	.	.	.	.	.	.	.	g	5.014	0.188225	0.09547	.	.	ENSG00000176915	ENST00000539605;ENST00000357997;ENST00000337516;ENST00000545623;ENST00000546061	T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77	5.55	-0.189	0.13260	Ankyrin repeat-containing domain (2);	0.748873	0.13827	N	0.359961	T	0.29256	0.0728	N	0.25890	0.77	0.09310	N	0.999999	B;B	0.24576	0.038;0.106	B;B	0.14023	0.009;0.01	T	0.11494	-1.0585	10	0.39692	T	0.17	-9.5245	7.3454	0.26660	0.239:0.0:0.6571:0.1039	.	397;397	Q86XL3-2;Q86XL3	.;ANKL2_HUMAN	C	335;397;397;167;43	ENSP00000446268:R335C;ENSP00000350686:R397C;ENSP00000337651:R397C;ENSP00000438515:R167C;ENSP00000445718:R43C	ENSP00000337651:R397C	R	-	1	0	ANKLE2	131834532	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	0.375000	0.20518	-0.337000	0.08426	-0.140000	0.14226	CGT	ANKLE2	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000176915		0.532	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE2	HGNC	protein_coding	OTTHUMT00000397712.1	89	0.00	0	G			133324459	133324459	-1	no_errors	ENST00000357997	ensembl	human	known	69_37n	missense	51	23.88	16	SNP	0.012	A
AP1B1	162	genome.wustl.edu	37	22	29726657	29726657	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr22:29726657C>T	ENST00000405198.1	-	19	2597	c.2566G>A	c.(2566-2568)Gag>Aag	p.E856K	AP1B1_ENST00000472057.1_5'Flank|AP1B1_ENST00000317368.7_Missense_Mutation_p.E829K|AP1B1_ENST00000356015.2_Missense_Mutation_p.E849K|AP1B1_ENST00000402502.1_Missense_Mutation_p.E849K|AP1B1_ENST00000357586.2_Missense_Mutation_p.E856K|SNORD125_ENST00000459538.1_RNA|AP1B1_ENST00000415447.1_Missense_Mutation_p.E849K|AP1B1_ENST00000432560.2_Missense_Mutation_p.E849K			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	856					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						GCCTCATTCTCATTGGGAATA	0.642																																						dbGAP											0													70.0	60.0	63.0					22																	29726657		2203	4300	6503	-	-	-	SO:0001583	missense	0			L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.2566G>A	22.37:g.29726657C>T	ENSP00000384194:p.Glu856Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_B-adaptin_app_sub_C,pfam_HEAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Armadillo,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP_complex_bsu	p.E856K	ENST00000405198.1	37	c.2566	CCDS13855.1	22	.	.	.	.	.	.	.	.	.	.	C	13.23	2.176370	0.38413	.	.	ENSG00000100280	ENST00000357586;ENST00000356015;ENST00000432560;ENST00000405198;ENST00000317368;ENST00000402502;ENST00000415447	T;T;T;T;T;T;T	0.22743	1.96;1.95;1.95;1.96;1.94;1.95;1.95	4.25	4.25	0.50352	Coatomer/calthrin adaptor appendage, C-terminal subdomain (1);Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (1);Beta2-adaptin/TATA-box binding, C-terminal (1);	0.222744	0.46145	D	0.000317	T	0.23171	0.0560	L	0.50333	1.59	0.80722	D	1	B;B;B;P;B;P	0.35011	0.143;0.034;0.066;0.477;0.269;0.48	B;B;B;B;B;B	0.37239	0.13;0.034;0.034;0.13;0.103;0.244	T	0.04307	-1.0961	10	0.27785	T	0.31	-25.6106	16.4285	0.83832	0.0:1.0:0.0:0.0	.	409;829;849;856;849;53	B4DS79;F8WDL0;Q10567-2;Q10567;Q10567-3;Q7Z3M8	.;.;.;AP1B1_HUMAN;.;.	K	856;849;849;856;829;849;849	ENSP00000350199:E856K;ENSP00000348297:E849K;ENSP00000400065:E849K;ENSP00000384194:E856K;ENSP00000319361:E829K;ENSP00000386071:E849K;ENSP00000387612:E849K	ENSP00000319361:E829K	E	-	1	0	AP1B1	28056657	1.000000	0.71417	1.000000	0.80357	0.097000	0.18754	7.601000	0.82783	2.208000	0.71279	0.467000	0.42956	GAG	AP1B1	-	pfam_B-adaptin_app_sub_C,superfamily_Coatomer/calthrin_app_sub_C	ENSG00000100280		0.642	AP1B1-001	KNOWN	basic|CCDS	protein_coding	AP1B1	HGNC	protein_coding	OTTHUMT00000321374.1	43	0.00	0	C	NM_001127		29726657	29726657	-1	no_errors	ENST00000357586	ensembl	human	known	69_37n	missense	10	64.29	18	SNP	1.000	T
APMAP	57136	genome.wustl.edu	37	20	24949624	24949624	+	Frame_Shift_Del	DEL	C	C	-	rs185208969	byFrequency	TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr20:24949624delC	ENST00000217456.2	-	8	1235	c.945delG	c.(943-945)gggfs	p.G315fs	APMAP_ENST00000447138.1_Intron	NM_020531.2	NP_065392.1	Q9HDC9	APMAP_HUMAN	adipocyte plasma membrane associated protein	315					biosynthetic process (GO:0009058)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	arylesterase activity (GO:0004064)|strictosidine synthase activity (GO:0016844)										CCACCCAGTACCCCCCAGAGC	0.517																																						dbGAP											0													72.0	72.0	72.0					20																	24949624		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474			13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3		10945474, 11583587, 20552250	Standard	NM_020531		Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.945delG	20.37:g.24949624delC	ENSP00000217456:p.Gly315fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	Frame_Shift_Del	DEL	pfam_Strictosidine_synth_cons-reg,pfam_SGL	p.Y316fs	ENST00000217456.2	37	c.945	CCDS13166.1	20																																																																																			APMAP	-	pfam_SGL	ENSG00000101474		0.517	APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APMAP	HGNC	protein_coding	OTTHUMT00000078380.2	30	0.00	0	C	NM_020531		24949624	24949624	-1	no_errors	ENST00000217456	ensembl	human	known	69_37n	frame_shift_del	59	10.61	7	DEL	0.025	-
ARHGEF5	7984	genome.wustl.edu	37	7	144068342	144068342	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr7:144068342G>A	ENST00000056217.5	+	6	3794	c.3620G>A	c.(3619-3621)cGg>cAg	p.R1207Q	ARHGEF5_ENST00000471847.2_Missense_Mutation_p.R129Q	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	1207	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					ACTTCACTCCGGGCCACACTT	0.512																																						dbGAP											0													55.0	54.0	55.0					7																	144068342		2200	4277	6477	-	-	-	SO:0001583	missense	0			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.3620G>A	7.37:g.144068342G>A	ENSP00000056217:p.Arg1207Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.R1207Q	ENST00000056217.5	37	c.3620	CCDS34771.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.47|14.47	2.544195|2.544195	0.45280|0.45280	.|.	.|.	ENSG00000050327|ENSG00000050327	ENST00000474817|ENST00000056217;ENST00000344879;ENST00000471847	.|T;T	.|0.62105	.|0.05;0.05	4.79|4.79	2.97|2.97	0.34412|0.34412	.|Dbl homology (DH) domain (5);	.|0.536026	.|0.20181	.|N	.|0.097509	T|T	0.41096|0.41096	0.1144|0.1144	N|N	0.16567|0.16567	0.415|0.415	0.09310|0.09310	N|N	1|1	.|B;P	.|0.44478	.|0.009;0.836	.|B;B	.|0.39904	.|0.009;0.313	T|T	0.18023|0.18023	-1.0350|-1.0350	5|10	.|0.36615	.|T	.|0.2	-11.8463|-11.8463	7.083|7.083	0.25241|0.25241	0.2861:0.0:0.7139:0.0|0.2861:0.0:0.7139:0.0	.|.	.|62;1207	.|B3KQX6;Q12774	.|.;ARHG5_HUMAN	R|Q	461|1207;62;129	.|ENSP00000056217:R1207Q;ENSP00000418227:R129Q	.|ENSP00000056217:R1207Q	G|R	+|+	1|2	0|0	ARHGEF5|ARHGEF5	143699275|143699275	1.000000|1.000000	0.71417|0.71417	0.129000|0.129000	0.21949|0.21949	0.521000|0.521000	0.34408|0.34408	2.776000|2.776000	0.47709|0.47709	0.555000|0.555000	0.29079|0.29079	0.555000|0.555000	0.69702|0.69702	GGG|CGG	ARHGEF5	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000050327		0.512	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF5	HGNC	protein_coding	OTTHUMT00000349981.1	80	0.00	0	G	NM_005435		144068342	144068342	+1	no_errors	ENST00000056217	ensembl	human	known	69_37n	missense	54	14.29	9	SNP	0.141	A
ATP1A4	480	genome.wustl.edu	37	1	160143454	160143454	+	Silent	SNP	G	G	C	rs374282407	byFrequency	TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:160143454G>C	ENST00000368081.4	+	13	2409	c.1938G>C	c.(1936-1938)acG>acC	p.T646T	ATP1A4_ENST00000418334.1_3'UTR	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	646					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCACTGAGACGGCAGAGGAAG	0.532																																						dbGAP											0													122.0	99.0	107.0					1																	160143454		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.1938G>C	1.37:g.160143454G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.T646	ENST00000368081.4	37	c.1938	CCDS1197.1	1																																																																																			ATP1A4	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_cation-ex_asu_euk	ENSG00000132681		0.532	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	HGNC	protein_coding	OTTHUMT00000077415.1	44	0.00	0	G	NM_144699		160143454	160143454	+1	no_errors	ENST00000368081	ensembl	human	known	69_37n	silent	59	19.18	14	SNP	0.572	C
ATP8B1	5205	genome.wustl.edu	37	18	55355712	55355712	+	Silent	SNP	A	A	G			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr18:55355712A>G	ENST00000283684.4	-	12	1247	c.1248T>C	c.(1246-1248)agT>agC	p.S416S	RP11-35G9.3_ENST00000599199.1_RNA|ATP8B1_ENST00000536015.1_Silent_p.S416S|RP11-35G9.5_ENST00000588925.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	416					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				TGATGAAGTGACTCTGTCCAA	0.458																																						dbGAP											0													195.0	179.0	185.0					18																	55355712		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.1248T>C	18.37:g.55355712A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BTP8	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.S416	ENST00000283684.4	37	c.1248	CCDS11965.1	18																																																																																			ATP8B1	-	tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000081923		0.458	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B1	HGNC	protein_coding	OTTHUMT00000256097.1	109	0.00	0	A	NM_005603		55355712	55355712	-1	no_errors	ENST00000283684	ensembl	human	known	69_37n	silent	106	13.11	16	SNP	0.994	G
AVPR1B	553	genome.wustl.edu	37	1	206224826	206224826	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:206224826C>T	ENST00000367126.4	+	1	851	c.386C>T	c.(385-387)aCg>aTg	p.T129M	RP11-38J22.3_ENST00000425896.1_RNA	NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	129					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)	p.T129M(2)		breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	CTGGCCATGACGCTGGACCGC	0.657																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											61.0	57.0	58.0					1																	206224826		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.386C>T	1.37:g.206224826C>T	ENSP00000356094:p.Thr129Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B0M0J6|Q5TZ00	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_Vprs_rcpt_V1B,prints_Vasoprsn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Vprs_V1A_rcpt	p.T129M	ENST00000367126.4	37	c.386	CCDS30994.1	1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.970759	0.74246	.	.	ENSG00000198049	ENST00000367126	T	0.73152	-0.72	5.21	5.21	0.72293	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	D	0.87849	0.6281	M	0.91038	3.17	0.54753	D	0.999987	D	0.89917	1.0	D	0.87578	0.998	D	0.90204	0.4259	10	0.87932	D	0	-16.4432	18.5451	0.91043	0.0:1.0:0.0:0.0	.	129	P47901	V1BR_HUMAN	M	129	ENSP00000356094:T129M	ENSP00000356094:T129M	T	+	2	0	AVPR1B	204391449	1.000000	0.71417	0.962000	0.40283	0.998000	0.95712	5.885000	0.69736	2.704000	0.92352	0.514000	0.50259	ACG	AVPR1B	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000198049		0.657	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVPR1B	HGNC	protein_coding	OTTHUMT00000087996.1	29	0.00	0	C	NM_000707		206224826	206224826	+1	no_errors	ENST00000367126	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	0.999	T
AXL	558	genome.wustl.edu	37	19	41743932	41743933	+	Frame_Shift_Ins	INS	-	-	C			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:41743932_41743933insC	ENST00000301178.4	+	7	1057_1058	c.867_868insC	c.(868-870)cccfs	p.P290fs	AXL_ENST00000593513.1_Frame_Shift_Ins_p.P22fs|AXL_ENST00000359092.3_Frame_Shift_Ins_p.P290fs	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	290	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						AAGCATCCGTGCCCCCCCATCA	0.649																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.874dupC	19.37:g.41743939_41743939dupC	ENSP00000301178:p.Pro290fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5L2|Q9UD27	Frame_Shift_Ins	INS	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.H291fs	ENST00000301178.4	37	c.867_868	CCDS12575.1	19																																																																																			AXL	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000167601		0.649	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXL	HGNC	protein_coding	OTTHUMT00000463323.2	72	0.00	0	-			41743932	41743933	+1	no_errors	ENST00000301178	ensembl	human	known	69_37n	frame_shift_ins	31	11.43	4	INS	0.982:1.000	C
B3GALTL	145173	genome.wustl.edu	37	13	31803392	31803392	+	Frame_Shift_Del	DEL	A	A	-	rs141154947		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr13:31803392delA	ENST00000343307.4	+	4	380	c.231delA	c.(229-231)ttafs	p.L77fs		NM_194318.3	NP_919299.3	Q6Y288	B3GLT_HUMAN	beta 1,3-galactosyltransferase-like	77					fucose metabolic process (GO:0006004)|protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)		CAGAGCAGTTAAAAAAAAGCA	0.373																																						dbGAP											0													55.0	52.0	53.0					13																	31803392		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB101481	CCDS9341.1	13q12.3	2014-03-24			ENSG00000187676	ENSG00000187676		"""Beta 3-glycosyltransferases"""	20207	protein-coding gene	gene with protein product		610308				12943678, 16899492, 17032646	Standard	NM_194318		Approved	B3GTL, B3Glc-T	uc010aaz.3	Q6Y288	OTTHUMG00000016688	ENST00000343307.4:c.231delA	13.37:g.31803392delA	ENSP00000343002:p.Leu77fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5F8|Q5W0H2|Q6NUI3	Frame_Shift_Del	DEL	pfam_Fringe-like	p.S80fs	ENST00000343307.4	37	c.231	CCDS9341.1	13																																																																																			B3GALTL	-	NULL	ENSG00000187676		0.373	B3GALTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALTL	HGNC	protein_coding	OTTHUMT00000044396.3	28	0.00	0	A	NM_194318		31803392	31803392	+1	no_errors	ENST00000343307	ensembl	human	known	69_37n	frame_shift_del	29	18.92	7	DEL	0.240	-
BBS5	129880	genome.wustl.edu	37	2	170344338	170344338	+	Silent	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:170344338G>A	ENST00000295240.3	+	4	607	c.231G>A	c.(229-231)ttG>ttA	p.L77L	RP11-724O16.1_ENST00000513963.1_Silent_p.L77L|BBS5_ENST00000392663.2_Silent_p.L77L|BBS5_ENST00000554017.1_Silent_p.L77L	NM_152384.2	NP_689597.1	Q8N3I7	BBS5_HUMAN	Bardet-Biedl syndrome 5	77					cilium assembly (GO:0042384)|heart looping (GO:0001947)|melanosome transport (GO:0032402)|motile cilium assembly (GO:0044458)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphate binding (GO:0032266)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						ATTGCATATTGAATATTACAA	0.269									Bardet-Biedl syndrome																													dbGAP											0													47.0	48.0	47.0					2																	170344338		2199	4273	6472	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AY604003	CCDS2233.1	2q31	2011-08-02			ENSG00000163093	ENSG00000163093			970	protein-coding gene	gene with protein product		603650				9888993, 10053027	Standard	NM_152384		Approved	DKFZp762I194		Q8N3I7	OTTHUMG00000132207	ENST00000295240.3:c.231G>A	2.37:g.170344338G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPC3|Q6PKN0	Silent	SNP	pfam_BBL5,pfam_Kelch_1,smart_DM16_repeat,smart_Kelch_1	p.L77	ENST00000295240.3	37	c.231	CCDS2233.1	2																																																																																			BBS5	-	pfam_BBL5,smart_DM16_repeat	ENSG00000163093		0.269	BBS5-001	KNOWN	basic|CCDS	protein_coding	BBS5	HGNC	protein_coding	OTTHUMT00000255265.2	50	0.00	0	G	NM_152384		170344338	170344338	+1	no_errors	ENST00000554017	ensembl	human	known	69_37n	silent	25	56.90	33	SNP	1.000	A
BDP1	55814	genome.wustl.edu	37	5	70858270	70858270	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:70858270C>T	ENST00000358731.4	+	38	7929	c.7666C>T	c.(7666-7668)Cga>Tga	p.R2556*	BDP1_ENST00000380675.2_3'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	2556					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		GGAAAAAAATCGAGAGTCCTC	0.358																																						dbGAP											0													81.0	75.0	77.0					5																	70858270		1821	4087	5908	-	-	-	SO:0001587	stop_gained	0			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.7666C>T	5.37:g.70858270C>T	ENSP00000351575:p.Arg2556*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Nonsense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.R2556*	ENST00000358731.4	37	c.7666	CCDS43328.1	5	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418293	0.83449	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	.	.	.	5.87	1.76	0.24704	.	0.510234	0.18182	N	0.149098	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	9.873	0.41187	0.1499:0.4139:0.4363:0.0	.	.	.	.	X	2556;2104	.	ENSP00000351575:R2556X	R	+	1	2	BDP1	70894026	0.001000	0.12720	0.000000	0.03702	0.409000	0.31022	0.333000	0.19768	0.345000	0.23873	-0.156000	0.13503	CGA	BDP1	-	NULL	ENSG00000145734		0.358	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BDP1	HGNC	protein_coding	OTTHUMT00000374681.2	54	0.00	0	C	NM_018429		70858270	70858270	+1	no_errors	ENST00000358731	ensembl	human	known	69_37n	nonsense	83	15.31	15	SNP	0.000	T
BIRC5	332	genome.wustl.edu	37	17	76219856	76219857	+	Frame_Shift_Del	DEL	TC	TC	-	rs369792774		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:76219856_76219857delTC	ENST00000600484.1	-	4	424_425	c.425_426delGA	c.(424-426)agafs	p.R142fs	BIRC5_ENST00000301633.4_3'UTR|BIRC5_ENST00000350051.3_3'UTR|BIRC5_ENST00000374948.2_3'UTR|BIRC5_ENST00000589892.1_3'UTR																							AGTGGCTGCTTCTCTCTCTCTC	0.49																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0																														ENST00000600484.1:c.425_426delGA	17.37:g.76219866_76219867delTC	ENSP00000473193:p.Arg142fs	Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000600484.1	37	NULL		17																																																																																			BIRC5	-	-	ENSG00000089685		0.490	AC087645.1-201	NOVEL	basic|appris_principal	protein_coding	BIRC5	HGNC	protein_coding		15	0.00	0	TC			76219856	76219857	+1	no_errors	ENST00000589892	ensembl	human	known	69_37n	rna	3	40.00	2	DEL	0.000:0.001	-
BRE	9577	genome.wustl.edu	37	2	28464261	28464261	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:28464261G>A	ENST00000342045.2	+	10	992		c.e10+1		BRE_ENST00000344773.2_Splice_Site|BRE_ENST00000379624.1_Splice_Site|BRE_ENST00000379632.2_Splice_Site|BRE_ENST00000361704.2_Splice_Site	NM_199194.2	NP_954664.1			brain and reproductive organ-expressed (TNFRSF1A modulator)									p.?(9)		NS(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(2)	23	Acute lymphoblastic leukemia(172;0.155)					ACTTTGGCACGTAAGTTCTGC	0.438																																						dbGAP											9	Unknown(9)	lung(6)|endometrium(3)											169.0	137.0	148.0					2																	28464261		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF015767	CCDS1763.1, CCDS1764.1, CCDS1765.1	2p23	2008-02-05			ENSG00000158019	ENSG00000158019			1106	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 4"""	610497				9737713, 7826398	Standard	NM_004899		Approved	BRCC45, BRCC4	uc002rls.3	Q9NXR7	OTTHUMG00000097831	ENST00000342045.2:c.851+1G>A	2.37:g.28464261G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e8+1	ENST00000342045.2	37	c.851+1	CCDS1763.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.274822	0.95459	.	.	ENSG00000158019	ENST00000344773;ENST00000379624;ENST00000342045;ENST00000379632;ENST00000361704;ENST00000379623	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.949	0.97192	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BRE	28317765	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.058000	0.93896	2.826000	0.97356	0.655000	0.94253	.	BRE	-	-	ENSG00000158019		0.438	BRE-004	KNOWN	basic|appris_principal|CCDS	protein_coding	BRE	HGNC	protein_coding	OTTHUMT00000215114.1	104	0.00	0	G		Intron	28464261	28464261	+1	no_errors	ENST00000344773	ensembl	human	known	69_37n	splice_site	72	33.94	37	SNP	1.000	A
CCDC7	79741	genome.wustl.edu	37	10	33018277	33018277	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr10:33018277delA	ENST00000375030.2	+	13	1360	c.742delA	c.(742-744)aaafs	p.K250fs	C10orf68_ENST00000375025.4_Frame_Shift_Del_p.K242fs|C10orf68_ENST00000375028.3_Frame_Shift_Del_p.K218fs			Q9H943	CJ068_HUMAN		242										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						TTTAGAAATCAAAAAAAAGGA	0.323																																						dbGAP											0													49.0	52.0	51.0					10																	33018277		2200	4293	6493	-	-	-	SO:0001589	frameshift_variant	0																														ENST00000375030.2:c.742delA	10.37:g.33018277delA	ENSP00000364170:p.Lys250fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ71|Q08AN7|Q8N7T7	Frame_Shift_Del	DEL	NULL	p.K242fs	ENST00000375030.2	37	c.718		10																																																																																			C10orf68	-	NULL	ENSG00000150076		0.323	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	C10orf68	HGNC	protein_coding	OTTHUMT00000313999.2	36	0.00	0	A			33018277	33018277	+1	no_errors	ENST00000375025	ensembl	human	known	69_37n	frame_shift_del	51	26.09	18	DEL	0.000	-
CDIP1	29965	genome.wustl.edu	37	16	4562821	4562821	+	Silent	SNP	G	G	A	rs547271998	byFrequency	TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr16:4562821G>A	ENST00000399599.3	-	4	1034	c.486C>T	c.(484-486)ttC>ttT	p.F162F	CDIP1_ENST00000563507.1_Silent_p.F123F|CDIP1_ENST00000563332.2_Silent_p.F162F|CDIP1_ENST00000567695.1_Silent_p.F162F|CDIP1_ENST00000562334.1_Silent_p.F83F|CDIP1_ENST00000564828.1_Intron			Q9H305	CDIP1_HUMAN	cell death-inducing p53 target 1	162					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	nucleus (GO:0005634)											AACCCAGCACGAAATTCATCA	0.592													G|||	2	0.000399361	0.0015	0.0	5008	,	,		15946	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													28.0	31.0	30.0					16																	4562821		2056	4200	6256	-	-	-	SO:0001819	synonymous_variant	0			AF131218	CCDS42114.1, CCDS58419.1, CCDS58420.1	16p13.3	2012-11-14	2012-11-14	2012-11-14	ENSG00000089486	ENSG00000089486			13234	protein-coding gene	gene with protein product	"""cell death involved p53-target"", ""lipopolysaccharide-induced TNF factor-like"""	610503	"""chromosome 16 open reading frame 5"""	C16orf5		10570909, 17599062	Standard	NM_013399		Approved	CDIP, LITAFL	uc002cww.3	Q9H305	OTTHUMG00000177172	ENST00000399599.3:c.486C>T	16.37:g.4562821G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7M1|B4DFU1|B4DY75|D3DUD6|Q96ID8|Q9H0Q4|Q9P112	Silent	SNP	pfam_LITAF,smart_LITAF	p.F162	ENST00000399599.3	37	c.486	CCDS42114.1	16																																																																																			C16orf5	-	pfam_LITAF,smart_LITAF	ENSG00000089486		0.592	CDIP1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C16orf5	HGNC	protein_coding	OTTHUMT00000435718.2	37	0.00	0	G	NM_013399		4562821	4562821	-1	no_errors	ENST00000399599	ensembl	human	known	69_37n	silent	39	18.75	9	SNP	0.795	A
C19orf35	374872	genome.wustl.edu	37	19	2280862	2280862	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:2280862C>T	ENST00000342063.3	-	2	162	c.69G>A	c.(67-69)acG>acA	p.T23T		NM_198532.2	NP_940934.1	Q6ZS72	CS035_HUMAN	chromosome 19 open reading frame 35	23										large_intestine(1)|lung(5)|pancreas(1)|prostate(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTTGCTATACGTGGGCTGAG	0.697																																						dbGAP											0													25.0	26.0	25.0					19																	2280862		2199	4298	6497	-	-	-	SO:0001819	synonymous_variant	0			AK127680	CCDS12087.1	19p13.3	2012-10-26			ENSG00000188305	ENSG00000188305			24793	protein-coding gene	gene with protein product							Standard	NM_198532		Approved	FLJ45778	uc002lvn.2	Q6ZS72	OTTHUMG00000178460	ENST00000342063.3:c.69G>A	19.37:g.2280862C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.T23	ENST00000342063.3	37	c.69	CCDS12087.1	19																																																																																			C19orf35	-	NULL	ENSG00000188305		0.697	C19orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf35	HGNC	protein_coding	OTTHUMT00000442080.1	44	0.00	0	C	NM_198532		2280862	2280862	-1	no_errors	ENST00000342063	ensembl	human	known	69_37n	silent	5	54.55	6	SNP	0.003	T
C1QTNF2	114898	genome.wustl.edu	37	5	159776463	159776463	+	Silent	SNP	G	G	A	rs200309696		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:159776463G>A	ENST00000393975.3	-	3	708	c.705C>T	c.(703-705)ggC>ggT	p.G235G		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	190	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCCCAGGCACGCCGCAGACGA	0.587																																						dbGAP											0													88.0	94.0	92.0					5																	159776463		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.705C>T	5.37:g.159776463G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.G235	ENST00000393975.3	37	c.705	CCDS4351.2	5																																																																																			C1QTNF2	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	ENSG00000145861		0.587	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF2	HGNC	protein_coding	OTTHUMT00000252672.2	55	0.00	0	G			159776463	159776463	-1	no_errors	ENST00000393975	ensembl	human	known	69_37n	silent	28	28.57	12	SNP	0.042	A
ERICH3	127254	genome.wustl.edu	37	1	75036916	75036916	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:75036916G>A	ENST00000326665.5	-	14	4696	c.4478C>T	c.(4477-4479)gCg>gTg	p.A1493V	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1493										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TGTTGCCATCGCCTGTAGACT	0.527																																						dbGAP											0													186.0	174.0	178.0					1																	75036916		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000326665.5:c.4478C>T	1.37:g.75036916G>A	ENSP00000322609:p.Ala1493Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.A1493V	ENST00000326665.5	37	c.4478	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.052875	0.36181	.	.	ENSG00000178965	ENST00000326665	T	0.16196	2.36	5.08	-2.33	0.06724	.	.	.	.	.	T	0.02342	0.0072	N	0.14661	0.345	0.09310	N	1	B	0.24882	0.113	B	0.19946	0.027	T	0.43686	-0.9376	9	0.56958	D	0.05	1.3508	3.0794	0.06256	0.0882:0.2205:0.3942:0.2971	.	1493	Q5RHP9	CA173_HUMAN	V	1493	ENSP00000322609:A1493V	ENSP00000322609:A1493V	A	-	2	0	C1orf173	74809504	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.442000	0.06871	-0.421000	0.07416	-0.310000	0.09108	GCG	C1orf173	-	NULL	ENSG00000178965		0.527	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	60	0.00	0	G			75036916	75036916	-1	no_errors	ENST00000326665	ensembl	human	known	69_37n	missense	41	12.50	6	SNP	0.000	A
NOL4L	140688	genome.wustl.edu	37	20	31041163	31041163	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr20:31041163G>A	ENST00000359676.5	-	5	851	c.709C>T	c.(709-711)Cgc>Tgc	p.R237C	C20orf112_ENST00000475781.1_5'UTR|RP5-1184F4.5_ENST00000442179.1_RNA	NM_001256798.1|NM_080616.4	NP_001243727.1|NP_542183.2	Q96MY1	NOL4L_HUMAN		237						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(5)|lung(5)	15						GTGCGGATGCGCTTGCGGGCC	0.627																																						dbGAP											0													65.0	61.0	63.0					20																	31041163		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000359676.5:c.709C>T	20.37:g.31041163G>A	ENSP00000352704:p.Arg237Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYB7|Q6P0Y4|Q9BR34|Q9NQF6	Missense_Mutation	SNP	NULL	p.R237C	ENST00000359676.5	37	c.709	CCDS13202.1	20	.	.	.	.	.	.	.	.	.	.	G	33	5.282420	0.95489	.	.	ENSG00000197183	ENST00000359676;ENST00000397984	D	0.85258	-1.96	4.56	4.56	0.56223	.	0.054916	0.85682	D	0.000000	D	0.91878	0.7429	M	0.74467	2.265	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.93016	0.6436	10	0.87932	D	0	-12.5934	17.0987	0.86642	0.0:0.0:1.0:0.0	.	237	Q96MY1	CT112_HUMAN	C	237	ENSP00000352704:R237C	ENSP00000352704:R237C	R	-	1	0	C20orf112	30504824	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.263000	0.95617	2.370000	0.80446	0.491000	0.48974	CGC	C20orf112	-	NULL	ENSG00000197183		0.627	C20orf112-001	KNOWN	basic|CCDS	protein_coding	C20orf112	HGNC	protein_coding	OTTHUMT00000078628.2	43	0.00	0	G			31041163	31041163	-1	no_errors	ENST00000359676	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	1.000	A
CASP9	842	genome.wustl.edu	37	1	15831197	15831197	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:15831197C>T	ENST00000333868.5	-	6	871	c.777G>A	c.(775-777)tcG>tcA	p.S259S	CASP9_ENST00000348549.5_Intron|CASP9_ENST00000375890.4_Silent_p.S176S|CASP9_ENST00000546424.1_Silent_p.S259S	NM_001229.3	NP_001220.2	P55211	CASP9_HUMAN	caspase 9, apoptosis-related cysteine peptidase	259					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell apoptotic process (GO:0034349)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of apoptotic process (GO:0042981)|regulation of response to DNA damage stimulus (GO:2001020)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|signal transduction in response to DNA damage (GO:0042770)	apoptosome (GO:0043293)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|enzyme activator activity (GO:0008047)|peptidase activity (GO:0008233)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|stomach(1)	18		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		TCTTCTCGACCGACACAGGGC	0.562																																						dbGAP											0													70.0	66.0	67.0					1																	15831197		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U60521	CCDS158.1, CCDS159.1, CCDS159.2, CCDS59995.1	1p36.21	2012-04-17	2005-08-17		ENSG00000132906	ENSG00000132906		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 56"""	602234	"""caspase 9, apoptosis-related cysteine protease"""			8663294, 9390557	Standard	NM_001229		Approved	MCH6, ICE-LAP6, APAF-3, PPP1R56	uc001awn.4	P55211	OTTHUMG00000002256	ENST00000333868.5:c.777G>A	1.37:g.15831197C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1A3|O95348|Q53Y70|Q5JRU9|Q5UGI1|Q92852|Q9BQ62|Q9UEQ3|Q9UIJ8	Missense_Mutation	SNP	pfam_Pept_C14_cat,smart_Pept_C14_p45_core,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14_p45_core	p.G101S	ENST00000333868.5	37	c.301	CCDS158.1	1	.	.	.	.	.	.	.	.	.	.	C	0.273	-0.991320	0.02162	.	.	ENSG00000132906	ENST00000424908	.	.	.	5.45	-10.9	0.00192	.	.	.	.	.	T	0.39860	0.1094	.	.	.	0.54753	D	0.99998	.	.	.	.	.	.	T	0.46911	-0.9157	4	.	.	.	.	4.7597	0.13102	0.5617:0.0798:0.1089:0.2497	.	.	.	.	S	101	.	.	G	-	1	0	CASP9	15703784	0.000000	0.05858	0.000000	0.03702	0.131000	0.20780	-0.947000	0.03901	-2.203000	0.00744	-2.557000	0.00176	GGT	CASP9	-	pfam_Pept_C14_cat,smart_Pept_C14_p45_core,pfscan_Pept_C14_ICE_p20	ENSG00000132906		0.562	CASP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP9	HGNC	protein_coding	OTTHUMT00000006438.1	42	0.00	0	C	NM_032996		15831197	15831197	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000424908	ensembl	human	novel	69_37n	missense	14	26.32	5	SNP	0.000	T
CAV3	859	genome.wustl.edu	37	3	8787229	8787229	+	Silent	SNP	G	G	A	rs372754279		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:8787229G>A	ENST00000343849.2	+	2	209	c.132G>A	c.(130-132)gtG>gtA	p.V44V	CAV3_ENST00000397368.2_Silent_p.V44V|SSUH2_ENST00000478513.1_5'Flank|CAV3_ENST00000472766.1_Intron	NM_001234.4|NM_033337.2	NP_001225.1|NP_203123.1	P56539	CAV3_HUMAN	caveolin 3	44			V -> E (in LGMD1C). {ECO:0000269|PubMed:15564037}.		actin filament organization (GO:0007015)|cardiac muscle cell development (GO:0055013)|caveola assembly (GO:0070836)|cell differentiation (GO:0030154)|cell growth (GO:0016049)|cholesterol homeostasis (GO:0042632)|cytoplasmic microtubule organization (GO:0031122)|endocytosis (GO:0006897)|establishment of protein localization to plasma membrane (GO:0090002)|glucose homeostasis (GO:0042593)|heart trabecula formation (GO:0060347)|membrane raft organization (GO:0031579)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of cell size (GO:0045792)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sarcomere organization (GO:0060299)|nucleus localization (GO:0051647)|plasma membrane organization (GO:0007009)|plasma membrane repair (GO:0001778)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein localization (GO:0008104)|protein localization to plasma membrane (GO:0072659)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of calcium ion import (GO:0090279)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart contraction (GO:0008016)|regulation of heart rate (GO:0002027)|regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900825)|regulation of membrane potential (GO:0042391)|regulation of nerve growth factor receptor activity (GO:0051394)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase B signaling (GO:0051896)|regulation of signal transduction by receptor internalization (GO:0038009)|regulation of skeletal muscle contraction (GO:0014819)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|T-tubule organization (GO:0033292)|triglyceride metabolic process (GO:0006641)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|dystrophin-associated glycoprotein complex (GO:0016010)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	calcium channel regulator activity (GO:0005246)|connexin binding (GO:0071253)|ion channel binding (GO:0044325)|potassium channel inhibitor activity (GO:0019870)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein complex scaffold (GO:0032947)|sodium channel regulator activity (GO:0017080)			breast(1)|kidney(2)|large_intestine(4)|lung(3)|prostate(1)	11						TTGAAGACGTGATCGCAGAGC	0.557																																						dbGAP											0													74.0	62.0	66.0					3																	8787229		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF043101	CCDS2569.1	3p25	2014-09-17			ENSG00000182533	ENSG00000182533			1529	protein-coding gene	gene with protein product	"""M-caveolin"""	601253				9536092, 9537420	Standard	NM_033337		Approved	VIP-21, LGMD1C, VIP21, LQT9	uc003brb.3	P56539	OTTHUMG00000090519	ENST00000343849.2:c.132G>A	3.37:g.8787229G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K777|Q3T1A4	Silent	SNP	pfam_Caveolin	p.V44	ENST00000343849.2	37	c.132	CCDS2569.1	3																																																																																			CAV3	-	pfam_Caveolin	ENSG00000182533		0.557	CAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAV3	HGNC	protein_coding	OTTHUMT00000207008.2	31	0.00	0	G	NM_033337		8787229	8787229	+1	no_errors	ENST00000343849	ensembl	human	known	69_37n	silent	9	62.50	15	SNP	1.000	A
CCDC66	285331	genome.wustl.edu	37	3	56650033	56650033	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:56650033A>G	ENST00000394672.3	+	13	1865	c.1795A>G	c.(1795-1797)Aca>Gca	p.T599A	CCDC66_ENST00000436465.2_Missense_Mutation_p.T599A|CCDC66_ENST00000326595.7_Missense_Mutation_p.T565A	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	599					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		TAAAATGAATACATATATGAA	0.299																																						dbGAP											0													86.0	96.0	92.0					3																	56650033		2203	4289	6492	-	-	-	SO:0001583	missense	0			AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.1795A>G	3.37:g.56650033A>G	ENSP00000378167:p.Thr599Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWL8|Q4VC34|Q8N949	Missense_Mutation	SNP	NULL	p.T599A	ENST00000394672.3	37	c.1795	CCDS46852.1	3	.	.	.	.	.	.	.	.	.	.	A	8.069	0.769874	0.15983	.	.	ENSG00000180376	ENST00000422222;ENST00000394672;ENST00000326595;ENST00000436465	T;T;T;T	0.22743	1.94;1.96;1.96;1.95	5.51	-0.394	0.12434	.	0.460874	0.17536	N	0.170689	T	0.11196	0.0273	L	0.41236	1.265	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.34104	-0.9842	10	0.08381	T	0.77	-0.0766	2.9617	0.05895	0.3565:0.426:0.0881:0.1294	.	599	A2RUB6	CCD66_HUMAN	A	555;599;565;599	ENSP00000401451:T555A;ENSP00000378167:T599A;ENSP00000326050:T565A;ENSP00000404320:T599A	ENSP00000326050:T565A	T	+	1	0	CCDC66	56625073	0.000000	0.05858	0.001000	0.08648	0.099000	0.18886	0.346000	0.19997	0.106000	0.17784	-0.468000	0.05107	ACA	CCDC66	-	NULL	ENSG00000180376		0.299	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC66	HGNC	protein_coding	OTTHUMT00000341473.1	61	0.00	0	A	NM_001012506		56650033	56650033	+1	no_errors	ENST00000394672	ensembl	human	known	69_37n	missense	23	58.93	33	SNP	0.001	G
CCDC88C	440193	genome.wustl.edu	37	14	91780360	91780360	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr14:91780360C>T	ENST00000389857.6	-	15	1886	c.1800G>A	c.(1798-1800)acG>acA	p.T600T		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	600					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CATTGGCCTCCGTCACCGTCT	0.622																																						dbGAP											0													80.0	79.0	80.0					14																	91780360		2118	4248	6366	-	-	-	SO:0001819	synonymous_variant	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.1800G>A	14.37:g.91780360C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	pfam_HOOK,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.T600	ENST00000389857.6	37	c.1800	CCDS45151.1	14																																																																																			CCDC88C	-	NULL	ENSG00000015133		0.622	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1	98	0.00	0	C	XM_029353		91780360	91780360	-1	no_errors	ENST00000389857	ensembl	human	known	69_37n	silent	53	24.29	17	SNP	0.000	T
CCDC97	90324	genome.wustl.edu	37	19	41825700	41825700	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:41825700G>C	ENST00000269967.3	+	3	846	c.724G>C	c.(724-726)Gag>Cag	p.E242Q		NM_052848.1	NP_443080.1	Q96F63	CCD97_HUMAN	coiled-coil domain containing 97	242										biliary_tract(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	17						CCAACagcaggaggaggagga	0.632																																						dbGAP											0													24.0	24.0	24.0					19																	41825700		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC011577	CCDS12578.1	19q13.2	2008-02-05							28289	protein-coding gene	gene with protein product						12477932	Standard	NM_052848		Approved	FLJ40267, MGC20255	uc002oqg.3	Q96F63		ENST00000269967.3:c.724G>C	19.37:g.41825700G>C	ENSP00000269967:p.Glu242Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q658N6|Q96IF3	Missense_Mutation	SNP	pfam_DUF2052_coiled-coil	p.E242Q	ENST00000269967.3	37	c.724	CCDS12578.1	19	.	.	.	.	.	.	.	.	.	.	G	26.6	4.757405	0.89843	.	.	ENSG00000142039	ENST00000269967	.	.	.	4.94	4.94	0.65067	.	0.240396	0.32769	N	0.005673	T	0.68026	0.2956	L	0.41027	1.25	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.65278	-0.6207	9	0.31617	T	0.26	-7.8813	16.9228	0.86168	0.0:0.0:1.0:0.0	.	242	Q96F63	CCD97_HUMAN	Q	242	.	ENSP00000269967:E242Q	E	+	1	0	CCDC97	46517540	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.234000	0.89801	2.295000	0.77249	0.462000	0.41574	GAG	CCDC97	-	pfam_DUF2052_coiled-coil	ENSG00000142039		0.632	CCDC97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC97	HGNC	protein_coding	OTTHUMT00000463293.1	24	0.00	0	G	NM_052848		41825700	41825700	+1	no_errors	ENST00000269967	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	1.000	C
CD1E	913	genome.wustl.edu	37	1	158326370	158326370	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:158326370delA	ENST00000368167.3	+	5	1226	c.987delA	c.(985-987)ttafs	p.L329fs	CD1E_ENST00000434258.1_3'UTR|CD1E_ENST00000368155.3_Frame_Shift_Del_p.L184fs|CD1E_ENST00000368156.1_Frame_Shift_Del_p.L239fs|CD1E_ENST00000368161.3_3'UTR|CD1E_ENST00000368154.1_Frame_Shift_Del_p.L85fs|CD1E_ENST00000368165.3_Frame_Shift_Del_p.L239fs|CD1E_ENST00000368157.1_Frame_Shift_Del_p.L85fs|CD1E_ENST00000368166.3_Frame_Shift_Del_p.L140fs|CD1E_ENST00000368160.3_Frame_Shift_Del_p.L329fs|CD1E_ENST00000444681.2_Frame_Shift_Del_p.L230fs|CD1E_ENST00000368164.3_3'UTR|CD1E_ENST00000452291.2_Frame_Shift_Del_p.L140fs|CD1E_ENST00000368163.3_Frame_Shift_Del_p.L274fs	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	329					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					ACTCACGGTTAAAAAAACAGA	0.373																																						dbGAP											0													87.0	79.0	81.0					1																	158326370		1824	4090	5914	-	-	-	SO:0001589	frameshift_variant	0			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.987delA	1.37:g.158326370delA	ENSP00000357149:p.Leu329fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Frame_Shift_Del	DEL	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.K331fs	ENST00000368167.3	37	c.987	CCDS41417.1	1																																																																																			CD1E	-	NULL	ENSG00000158488		0.373	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD1E	HGNC	protein_coding	OTTHUMT00000046353.3	70	0.00	0	A	NM_030893		158326370	158326370	+1	no_errors	ENST00000368167	ensembl	human	known	69_37n	frame_shift_del	130	17.09	27	DEL	0.000	-
CD9	928	genome.wustl.edu	37	12	6344725	6344725	+	Silent	SNP	C	C	G	rs80271009	byFrequency	TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr12:6344725C>G	ENST00000382518.1	+	7	967	c.531C>G	c.(529-531)acC>acG	p.T177T	Y_RNA_ENST00000365448.1_RNA|CD9_ENST00000481267.1_3'UTR|CD9_ENST00000382515.2_Silent_p.T108T|CD9_ENST00000009180.4_Silent_p.T177T			P21926	CD9_HUMAN	CD9 molecule	177					blood coagulation (GO:0007596)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|oligodendrocyte development (GO:0014003)|paranodal junction assembly (GO:0030913)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|response to water deprivation (GO:0009414)|single fertilization (GO:0007338)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|vesicle (GO:0031982)				endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	8						AAACCTTCACCGTGAAGGTAA	0.542																																						dbGAP											0													123.0	105.0	111.0					12																	6344725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M38690	CCDS8540.1	12p13	2013-02-14	2006-03-28		ENSG00000010278	ENSG00000010278		"""CD molecules"", ""Tetraspanins"""	1709	protein-coding gene	gene with protein product	"""motility related protein-1"""	143030	"""CD9 antigen (p24)"""	MIC3		6198179	Standard	NM_001769		Approved	BA2, P24, TSPAN29, MRP-1	uc001qnq.2	P21926	OTTHUMG00000044400	ENST00000382518.1:c.531C>G	12.37:g.6344725C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUQ9|Q5J7W6|Q96ES4	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.T177	ENST00000382518.1	37	c.531	CCDS8540.1	12	.	.	.	.	.	.	.	.	.	.	C	4.495	0.091866	0.08632	.	.	ENSG00000010278	ENST00000425469	.	.	.	5.39	-10.8	0.00216	.	.	.	.	.	T	0.13670	0.0331	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10894	-1.0610	7	0.22109	T	0.4	.	3.0663	0.06215	0.1762:0.4518:0.2142:0.1578	.	227	B4DK09	.	G	177	.	ENSP00000388933:R177G	R	+	1	0	CD9	6214986	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.283000	0.00527	-1.414000	0.02025	-0.182000	0.12963	CGT	CD9	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000010278		0.542	CD9-004	NOVEL	basic|appris_principal|CCDS	protein_coding	CD9	HGNC	protein_coding	OTTHUMT00000103348.1	83	0.00	0	C			6344725	6344725	+1	no_errors	ENST00000009180	ensembl	human	known	69_37n	silent	54	17.91	12	SNP	0.000	G
CDH1	999	genome.wustl.edu	37	16	68856129	68856129	+	Splice_Site	SNP	G	G	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr16:68856129G>T	ENST00000261769.5	+	12	2127		c.e12+1		RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000562836.1_Splice_Site|CDH1_ENST00000422392.2_Splice_Site	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)						adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		AACGACCCAAGTGGGTACCTG	0.488			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0													72.0	60.0	64.0					16																	68856129		2198	4300	6498	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1936+1G>T	16.37:g.68856129G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Splice_Site	SNP	-	e12+1	ENST00000261769.5	37	c.1936+1	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	G	12.53	1.965097	0.34659	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000422392	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4194	0.90584	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDH1	67413630	1.000000	0.71417	0.540000	0.28089	0.048000	0.14542	7.958000	0.87877	2.697000	0.92050	0.632000	0.83419	.	CDH1	-	-	ENSG00000039068		0.488	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	34	0.00	0	G	NM_004360	Intron	68856129	68856129	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	splice_site	12	58.62	17	SNP	0.996	T
CFH	3075	genome.wustl.edu	37	1	196659317	196659317	+	Silent	SNP	A	A	G			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:196659317A>G	ENST00000359637.2	+	8	1154	c.1092A>G	c.(1090-1092)acA>acG	p.T364T	CFH_ENST00000439155.2_Silent_p.T428T|CFH_ENST00000367429.4_Silent_p.T428T			P08603	CFAH_HUMAN	complement factor H	428	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						CGCAGACCACAGTTACATGTA	0.423																																						dbGAP											0													110.0	92.0	98.0					1																	196659317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.1092A>G	1.37:g.196659317A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Silent	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.T428	ENST00000359637.2	37	c.1284		1																																																																																			CFH	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.423	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000087502.1	52	0.00	0	A	NM_000186		196659317	196659317	+1	no_errors	ENST00000367429	ensembl	human	known	69_37n	silent	75	19.15	18	SNP	0.000	G
CKLF	51192	genome.wustl.edu	37	16	66599895	66599895	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr16:66599895delA	ENST00000264001.4	+	4	589	c.440delA	c.(439-441)gaafs	p.E147fs	CMTM1_ENST00000336328.6_5'Flank|CMTM1_ENST00000328020.6_5'Flank|CKLF_ENST00000563092.1_3'UTR|CMTM1_ENST00000535705.1_5'Flank|CMTM1_ENST00000457188.2_5'Flank|CKLF_ENST00000417030.2_Intron|CKLF_ENST00000345436.4_Frame_Shift_Del_p.E115fs|CMTM1_ENST00000528324.1_5'Flank|CMTM1_ENST00000533953.1_5'Flank|CKLF_ENST00000351137.4_Frame_Shift_Del_p.E94fs|CMTM1_ENST00000531885.1_5'Flank|CKLF_ENST00000362093.4_Frame_Shift_Del_p.E62fs|CMTM1_ENST00000379500.2_5'Flank|CMTM1_ENST00000529506.1_5'Flank|CKLF-CMTM1_ENST00000532838.1_Intron|CKLF-CMTM1_ENST00000527729.1_Intron|CMTM1_ENST00000533666.1_5'Flank|CMTM1_ENST00000332695.7_5'Flank	NM_016951.3	NP_058647.1	Q9UBR5	CKLF_HUMAN	chemokine-like factor	147					cell proliferation (GO:0008283)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|neutrophil chemotaxis (GO:0030593)|secretion by cell (GO:0032940)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chemokine activity (GO:0008009)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|upper_aerodigestive_tract(1)	5		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0689)|Epithelial(162;0.217)		CCTGTGCATGAAAAAAAAGAA	0.363																																						dbGAP											0													52.0	53.0	53.0					16																	66599895		2201	4300	6501	-	-	-	SO:0001589	frameshift_variant	0			AF096895	CCDS10806.1, CCDS10807.1, CCDS10808.1, CCDS10809.1, CCDS45502.1	16q22.1-q22.3	2008-02-05	2003-02-28	2003-03-07	ENSG00000217555	ENSG00000217555			13253	protein-coding gene	gene with protein product			"""chemokine-like factor 1"""	CKLF1		11042152, 11415443	Standard	NM_016326		Approved	UCK-1, CKLF3, CKLF4, HSPC224, C32		Q9UBR5	OTTHUMG00000137504	ENST00000264001.4:c.440delA	16.37:g.66599895delA	ENSP00000264001:p.Glu147fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JE38|Q9UHM7|Q9UHN8|Q9UI41	Frame_Shift_Del	DEL	NULL	p.E150fs	ENST00000264001.4	37	c.440	CCDS10807.1	16																																																																																			CKLF	-	NULL	ENSG00000217555		0.363	CKLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKLF	HGNC	protein_coding	OTTHUMT00000268816.2	52	0.00	0	A	NM_016326		66599895	66599895	+1	no_errors	ENST00000264001	ensembl	human	known	69_37n	frame_shift_del	30	32.65	16	DEL	0.164	-
CHST5	23563	genome.wustl.edu	37	16	75563057	75563057	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr16:75563057G>A	ENST00000336257.3	-	3	2620	c.1226C>T	c.(1225-1227)tCg>tTg	p.S409L	CHST5_ENST00000541075.1_Missense_Mutation_p.S415L|RP11-77K12.7_ENST00000460606.1_3'UTR	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	409					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						TCAGTCAGGCGATGCCCAGCT	0.662																																						dbGAP											0													32.0	26.0	28.0					16																	75563057		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.1226C>T	16.37:g.75563057G>A	ENSP00000338783:p.Ser409Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RV23|Q7LCN3|Q9UBY3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	p.S415L	ENST00000336257.3	37	c.1244	CCDS10919.1	16	.	.	.	.	.	.	.	.	.	.	G	15.28	2.788160	0.49997	.	.	ENSG00000135702	ENST00000336257;ENST00000541075	D;D	0.96992	-4.18;-4.2	2.84	2.84	0.33178	.	0.339050	0.25159	N	0.032683	D	0.96562	0.8878	M	0.68317	2.08	0.09310	N	0.999996	D;D	0.71674	0.998;0.996	P;P	0.59115	0.852;0.715	D	0.91143	0.4947	10	0.46703	T	0.11	.	10.7728	0.46332	0.0:0.0:1.0:0.0	.	415;409	Q9GZS9-2;Q9GZS9	.;CHST5_HUMAN	L	409;415	ENSP00000338783:S409L;ENSP00000441220:S415L	ENSP00000338783:S409L	S	-	2	0	CHST5	74120558	0.999000	0.42202	0.016000	0.15963	0.004000	0.04260	4.289000	0.59013	1.583000	0.49898	0.313000	0.20887	TCG	CHST5	-	NULL	ENSG00000135702		0.662	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST5	HGNC	protein_coding	OTTHUMT00000269025.2	10	0.00	0	G	NM_012126		75563057	75563057	-1	no_errors	ENST00000541075	ensembl	human	known	69_37n	missense	2	71.43	5	SNP	0.139	A
CPED1	79974	genome.wustl.edu	37	7	120911387	120911388	+	Frame_Shift_Ins	INS	-	-	A	rs141494536	byFrequency	TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr7:120911387_120911388insA	ENST00000310396.5	+	22	3238_3239	c.2771_2772insA	c.(2770-2775)gcaaaafs	p.AK924fs		NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	924						endoplasmic reticulum (GO:0005783)											CTGGATACTGCAAAAAAACATG	0.351																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2778dupA	7.37:g.120911394_120911394dupA	ENSP00000309772:p.Ala924fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Frame_Shift_Ins	INS	NULL	p.H927fs	ENST00000310396.5	37	c.2771_2772	CCDS34739.1	7																																																																																			CPED1	-	NULL	ENSG00000106034		0.351	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1	72	0.00	0	-	NM_024913		120911387	120911388	+1	no_errors	ENST00000310396	ensembl	human	known	69_37n	frame_shift_ins	110	12.70	16	INS	1.000:1.000	A
CPT1B	1375	genome.wustl.edu	37	22	51015421	51015421	+	Silent	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr22:51015421G>A	ENST00000360719.2	-	4	461	c.324C>T	c.(322-324)agC>agT	p.S108S	CPT1B_ENST00000312108.7_Silent_p.S108S|CPT1B_ENST00000395650.2_Silent_p.S108S|CPT1B_ENST00000405237.3_Silent_p.S108S|CPT1B_ENST00000457250.1_Silent_p.S108S|CHKB-CPT1B_ENST00000452668.1_5'Flank|CPT1B_ENST00000434492.2_5'UTR|CPT1B_ENST00000440709.1_Silent_p.S108S|CHKB-CPT1B_ENST00000453634.1_3'UTR	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	108					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		AGATGGCCATGCTGAGAAGTG	0.622											OREG0026685	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(170;988 1933 25577 30295 48163)	dbGAP											0													86.0	93.0	91.0					22																	51015421		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.324C>T	22.37:g.51015421G>A		Somatic	974	WXS	Illumina GAIIx	Phase_IV	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Silent	SNP	pfam_Carn_acyl_trans	p.S108	ENST00000360719.2	37	c.324	CCDS14098.1	22																																																																																			CPT1B	-	NULL	ENSG00000205560		0.622	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT1B	HGNC	protein_coding	OTTHUMT00000317264.5	60	0.00	0	G	NM_152246		51015421	51015421	-1	no_errors	ENST00000312108	ensembl	human	known	69_37n	silent	22	26.67	8	SNP	1.000	A
CRP	1401	genome.wustl.edu	37	1	159683727	159683727	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:159683727T>C	ENST00000255030.5	-	2	366	c.263A>G	c.(262-264)gAt>gGt	p.D88G	CRP_ENST00000473196.1_5'Flank|CRP_ENST00000368111.1_Intron|CRP_ENST00000368110.1_Intron|CRP_ENST00000368112.1_Intron|CRP_ENST00000343919.2_Intron|CRP_ENST00000437342.1_5'UTR	NM_000567.2	NP_000558.2	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related	88	Pentaxin.			Missing (in Ref. 13; AA sequence). {ECO:0000305}.	acute-phase response (GO:0006953)|aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|complement activation, classical pathway (GO:0006958)|defense response to Gram-positive bacterium (GO:0050830)|inflammatory response (GO:0006954)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|opsonization (GO:0008228)|positive regulation of dendrite development (GO:1900006)|protein polymerization (GO:0051258)|regulation of interleukin-8 secretion (GO:2000482)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lead ion (GO:0010288)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)	calcium ion binding (GO:0005509)|cholesterol binding (GO:0015485)|choline binding (GO:0033265)|complement component C1q binding (GO:0001849)|low-density lipoprotein particle binding (GO:0030169)			breast(1)|endometrium(3)|kidney(1)|lung(15)|ovary(1)|skin(1)	22	all_hematologic(112;0.0429)				inhaled insulin(DB05278)	GTATCCTATATCCTTAGACCA	0.453																																						dbGAP											0													113.0	110.0	111.0					1																	159683727		2203	4300	6503	-	-	-	SO:0001583	missense	0			M11725	CCDS30911.1	1q23.2	2013-05-13			ENSG00000132693	ENSG00000132693			2367	protein-coding gene	gene with protein product	"""pentraxin 1"""	123260				3840479, 6857266	Standard	NM_000567		Approved	PTX1	uc001ftw.3	P02741	OTTHUMG00000035344	ENST00000255030.5:c.263A>G	1.37:g.159683727T>C	ENSP00000255030:p.Asp88Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K078|D3DVD9|D3DVE0|Q08AK3|Q8WW75	Missense_Mutation	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,prints_Pentaxin	p.D88G	ENST00000255030.5	37	c.263	CCDS30911.1	1	.	.	.	.	.	.	.	.	.	.	C	2.892	-0.229421	0.06022	.	.	ENSG00000132693	ENST00000255030	T	0.60040	0.22	4.97	-9.95	0.00446	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	2.426960	0.01766	N	0.030879	T	0.11367	0.0277	N	0.17312	0.475	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.06844	-1.0804	10	0.15066	T	0.55	0.5518	8.1903	0.31363	0.0837:0.516:0.2547:0.1455	.	88	P02741	CRP_HUMAN	G	88	ENSP00000255030:D88G	ENSP00000255030:D88G	D	-	2	0	CRP	157950351	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-2.447000	0.01010	-4.160000	0.00068	-2.173000	0.00322	GAT	CRP	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin	ENSG00000132693		0.453	CRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRP	HGNC	protein_coding	OTTHUMT00000085553.1	64	0.00	0	T	NM_000567		159683727	159683727	-1	no_errors	ENST00000255030	ensembl	human	known	69_37n	missense	105	17.32	22	SNP	0.000	C
CSPP1	79848	genome.wustl.edu	37	8	68089932	68089932	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr8:68089932C>A	ENST00000262210.5	+	25	3143	c.3112C>A	c.(3112-3114)Cca>Aca	p.P1038T	CSPP1_ENST00000412460.1_Missense_Mutation_p.P693T|ARFGEF1_ENST00000520381.1_Intron|CSPP1_ENST00000521168.1_3'UTR	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	1073					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			AGATGCCATCCCAAGTGCTAA	0.308																																						dbGAP											0													125.0	122.0	123.0					8																	68089932		1826	4075	5901	-	-	-	SO:0001583	missense	0			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.3112C>A	8.37:g.68089932C>A	ENSP00000262210:p.Pro1038Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	NULL	p.P1038T	ENST00000262210.5	37	c.3112	CCDS43744.1	8	.	.	.	.	.	.	.	.	.	.	C	8.265	0.812129	0.16537	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.35421	1.31;1.37;1.37	5.14	2.29	0.28610	.	0.410926	0.24476	N	0.038197	T	0.28067	0.0692	L	0.53249	1.67	0.09310	N	0.999999	B;B;B;B	0.31548	0.16;0.328;0.015;0.005	B;B;B;B	0.30495	0.082;0.116;0.014;0.012	T	0.15122	-1.0448	10	0.36615	T	0.2	0.1385	5.0517	0.14513	0.1656:0.6556:0.0:0.1788	.	196;693;1038;1073	Q9H688;Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5	.;.;.;CSPP1_HUMAN	T	1038;1073;693;693	ENSP00000262210:P1038T;ENSP00000415782:P693T;ENSP00000430092:P693T	ENSP00000262210:P1038T	P	+	1	0	CSPP1	68252486	0.000000	0.05858	0.001000	0.08648	0.983000	0.72400	0.157000	0.16402	0.255000	0.21593	0.585000	0.79938	CCA	CSPP1	-	NULL	ENSG00000104218		0.308	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSPP1	HGNC	protein_coding	OTTHUMT00000379254.1	80	0.00	0	C	NM_024790		68089932	68089932	+1	no_errors	ENST00000262210	ensembl	human	known	69_37n	missense	160	15.34	29	SNP	0.003	A
DIMT1	27292	genome.wustl.edu	37	5	61688029	61688029	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:61688029delT	ENST00000199320.4	-	10	921	c.761delA	c.(760-762)aacfs	p.N254fs	DIMT1_ENST00000506390.1_Frame_Shift_Del_p.N254fs|KIF2A_ENST00000509663.2_Intron	NM_014473.2	NP_055288.1	Q9UNQ2	DIM1_HUMAN	DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)	254						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	18S rRNA (adenine(1779)-N(6)/adenine(1780)-N(6))-dimethyltransferase activity (GO:0052909)|poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)										AATTCTGTAGTTTTTTTCCAA	0.299																																						dbGAP											0													111.0	113.0	112.0					5																	61688029		2202	4296	6498	-	-	-	SO:0001589	frameshift_variant	0			AF102147	CCDS3981.1	5q12.1	2011-08-11	2011-08-11	2011-08-11	ENSG00000086189	ENSG00000086189			30217	protein-coding gene	gene with protein product		612499	"""DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)"""	DIMT1L		11124703	Standard	NM_014473		Approved	HSA9761	uc003jta.3	Q9UNQ2	OTTHUMG00000131223	ENST00000199320.4:c.761delA	5.37:g.61688029delT	ENSP00000199320:p.Asn254fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O76025|Q9BU77|Q9UES1	Frame_Shift_Del	DEL	pfam_rRNA_Ade_methylase_transferase,smart_rRNA_Ade_methylase_Trfase_N,tigrfam_rRNA_adenine_dimethylase	p.N254fs	ENST00000199320.4	37	c.761	CCDS3981.1	5																																																																																			DIMT1	-	pfam_rRNA_Ade_methylase_transferase,tigrfam_rRNA_adenine_dimethylase	ENSG00000086189		0.299	DIMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIMT1	HGNC	protein_coding	OTTHUMT00000253967.1	96	0.00	0	T	NM_014473		61688029	61688029	-1	no_errors	ENST00000199320	ensembl	human	known	69_37n	frame_shift_del	88	29.60	37	DEL	1.000	-
DCP2	167227	genome.wustl.edu	37	5	112321590	112321590	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:112321590C>T	ENST00000389063.2	+	2	310	c.112C>T	c.(112-114)Cag>Tag	p.Q38*	DCP2_ENST00000543319.1_Intron|DCP2_ENST00000515408.1_Nonsense_Mutation_p.Q38*	NM_152624.5	NP_689837	Q8IU60	DCP2_HUMAN	decapping mRNA 2	38					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)|RISC complex (GO:0016442)	exoribonuclease activity, producing 5'-phosphomonoesters (GO:0016896)|m7G(5')pppN diphosphatase activity (GO:0050072)|manganese ion binding (GO:0030145)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(6)|lung(1)	10		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		OV - Ovarian serous cystadenocarcinoma(64;6.98e-08)|Epithelial(69;7.87e-08)|all cancers(49;1.06e-05)|COAD - Colon adenocarcinoma(37;0.0123)|Colorectal(14;0.0171)		AGTGTGTTTTCAGATTGAACT	0.378																																						dbGAP											0													255.0	226.0	236.0					5																	112321590		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AY135173	CCDS34210.1, CCDS56377.1	5q22	2013-05-02	2013-05-02		ENSG00000172795	ENSG00000172795	3.6.1.62	"""Nudix motif containing"""	24452	protein-coding gene	gene with protein product	"""nudix (nucleoside diphosphate linked moiety X)-type motif 20"", ""M(7)GpppN-mRNA hydrolase"""	609844	"""DCP2 decapping enzyme homolog (S. cerevisiae)"""			12218187, 12417715	Standard	NM_152624		Approved	NUDT20	uc003kqh.3	Q8IU60	OTTHUMG00000162853	ENST00000389063.2:c.112C>T	5.37:g.112321590C>T	ENSP00000373715:p.Gln38*	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J778|Q6P2D4|Q7Z5W5|Q8NBG5	Nonsense_Mutation	SNP	pfam_mRNA_decapping_BoxA,pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.Q38*	ENST00000389063.2	37	c.112	CCDS34210.1	5	.	.	.	.	.	.	.	.	.	.	C	38	7.168322	0.98111	.	.	ENSG00000172795	ENST00000515408;ENST00000389063	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.1892	0.93658	0.0:1.0:0.0:0.0	.	.	.	.	X	38	.	ENSP00000373715:Q38X	Q	+	1	0	DCP2	112349489	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.409000	0.80053	2.617000	0.88574	0.591000	0.81541	CAG	DCP2	-	pfam_mRNA_decapping_BoxA	ENSG00000172795		0.378	DCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCP2	HGNC	protein_coding	OTTHUMT00000370765.3	113	0.00	0	C	NM_152624		112321590	112321590	+1	no_errors	ENST00000389063	ensembl	human	known	69_37n	nonsense	110	19.12	26	SNP	1.000	T
DLG2	1740	genome.wustl.edu	37	11	83195172	83195172	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr11:83195172G>A	ENST00000398309.2	-	17	2448	c.1978C>T	c.(1978-1980)Cga>Tga	p.R660*	DLG2_ENST00000426717.2_Intron|DLG2_ENST00000531015.1_Splice_Site_p.R627*|DLG2_ENST00000532653.1_Intron|DLG2_ENST00000524982.1_Intron|DLG2_ENST00000376104.2_Splice_Site_p.R765*|DLG2_ENST00000376106.3_Intron|DLG2_ENST00000280241.8_Splice_Site_p.R699*|DLG2_ENST00000398304.1_Intron|DLG2_ENST00000543673.1_Splice_Site_p.R765*|DLG2_ENST00000537455.1_Intron|DLG2_ENST00000418306.2_Intron|DLG2_ENST00000404783.3_Intron|DLG2_ENST00000330014.6_Intron	NM_001364.3	NP_001355.2	Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	359					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				ATCTACTTACGTTCAGGATCA	0.428																																						dbGAP											0													105.0	107.0	106.0					11																	83195172		2194	4298	6492	-	-	-	SO:0001630	splice_region_variant	0			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000398309.2:c.1978+1C>T	11.37:g.83195172G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Nonsense_Mutation	SNP	pfam_PDZ,pfam_Guanylate_kin,pfam_MAGUK_PEST_N,pfam_PDZ_assoc,pfam_L27_1,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.R765*	ENST00000398309.2	37	c.2293	CCDS41696.1	11	.	.	.	.	.	.	.	.	.	.	G	39	7.529436	0.98339	.	.	ENSG00000150672	ENST00000398309;ENST00000376104;ENST00000543673;ENST00000280241;ENST00000546021;ENST00000531015;ENST00000420775	.	.	.	5.38	5.38	0.77491	.	0.000000	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3333	0.94303	0.0:0.0:1.0:0.0	.	.	.	.	X	660;765;765;699;765;627;142	.	.	R	-	1	2	DLG2	82872820	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.263000	0.95617	2.793000	0.96121	0.655000	0.94253	CGA	DLG2	-	superfamily_SH3_domain,pirsf_M-assoc_guanylate_kinase	ENSG00000150672		0.428	DLG2-001	KNOWN	basic|CCDS	protein_coding	DLG2	HGNC	protein_coding	OTTHUMT00000259243.3	59	0.00	0	G	NM_001364	Nonsense_Mutation	83195172	83195172	-1	no_errors	ENST00000376104	ensembl	human	known	69_37n	nonsense	65	13.33	10	SNP	1.000	A
DNA2	1763	genome.wustl.edu	37	10	70182521	70182521	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr10:70182521delA	ENST00000358410.3	-	15	2385	c.2335delT	c.(2335-2337)tcafs	p.S779fs	DNA2_ENST00000399179.2_Intron|DNA2_ENST00000399180.2_Frame_Shift_Del_p.S865fs	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	779	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)	p.S779fs*6(1)|p.S865fs*6(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						AATCTCCGTGAAAAAAAAAGG	0.403																																						dbGAP											2	Deletion - Frameshift(2)	large_intestine(2)								36,47,3383		0,0,36,2,43,1652	30.0	31.0	31.0			5.7	1.0	10		32	74,113,7597		0,0,74,8,97,3713	no	codingComplex	DNA2	NM_001080449.2		0,0,110,10,140,5365	A1A1,A1A2,A1R,A2A2,A2R,RR		2.4024,2.3947,2.4			70182521	110,160,10980	1797	4062	5859	-	-	-	SO:0001589	frameshift_variant	0			D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.2335delT	10.37:g.70182521delA	ENSP00000351185:p.Ser779fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Frame_Shift_Del	DEL	pfam_DNA_replication_fac_Dna2	p.S865fs	ENST00000358410.3	37	c.2593		10																																																																																			DNA2	-	NULL	ENSG00000138346		0.403	DNA2-001	KNOWN	basic|appris_principal	protein_coding	DNA2	HGNC	protein_coding	OTTHUMT00000048334.2	35	0.00	0	A			70182521	70182521	-1	no_errors	ENST00000399180	ensembl	human	known	69_37n	frame_shift_del	32	11.11	4	DEL	1.000	-
DNAH9	1770	genome.wustl.edu	37	17	11783516	11783516	+	Splice_Site	SNP	C	C	T	rs61736773		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:11783516C>T	ENST00000262442.4	+	54	10668	c.10600C>T	c.(10600-10602)Cga>Tga	p.R3534*	DNAH9_ENST00000608377.1_5'Flank|DNAH9_ENST00000454412.2_Splice_Site_p.R3534*	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3534	AAA 5. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TAAAAAAGGACGGTAAGACTC	0.512																																						dbGAP											0													85.0	86.0	86.0					17																	11783516		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.10601+1C>T	17.37:g.11783516C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCQ8|O15064|O95494|Q9NQ28	Nonsense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.R3534*	ENST00000262442.4	37	c.10600	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	49	15.933467	0.99849	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	.	.	.	4.46	2.27	0.28462	.	0.070917	0.52532	D	0.000066	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.6576	0.45684	0.5854:0.4145:0.0:0.0	rs61736773	.	.	.	X	3534;3534;2116	.	ENSP00000262442:R3534X	R	+	1	2	DNAH9	11724241	1.000000	0.71417	1.000000	0.80357	0.347000	0.29111	3.166000	0.50785	1.079000	0.41038	-0.182000	0.12963	CGA	DNAH9	-	NULL	ENSG00000007174		0.512	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	69	0.00	0	C	NM_001372	Nonsense_Mutation	11783516	11783516	+1	no_errors	ENST00000262442	ensembl	human	known	69_37n	nonsense	24	29.41	10	SNP	1.000	T
DNAJC13	23317	genome.wustl.edu	37	3	132153451	132153451	+	Silent	SNP	A	A	G			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:132153451A>G	ENST00000260818.6	+	2	305	c.57A>G	c.(55-57)tcA>tcG	p.S19S	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	19					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						CAAAACATTCATGGAGGGGGA	0.318																																						dbGAP											0													96.0	99.0	98.0					3																	132153451		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.57A>G	3.37:g.132153451A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Silent	SNP	pfam_DnaJ_N,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_N,pfscan_DnaJ_N	p.S19	ENST00000260818.6	37	c.57	CCDS33857.1	3																																																																																			DNAJC13	-	NULL	ENSG00000138246		0.318	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	HGNC	protein_coding	OTTHUMT00000356807.2	82	0.00	0	A	NM_015268		132153451	132153451	+1	no_errors	ENST00000260818	ensembl	human	known	69_37n	silent	67	29.47	28	SNP	0.997	G
DNAJC3	5611	genome.wustl.edu	37	13	96443192	96443192	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr13:96443192G>A	ENST00000602402.1	+	12	1540	c.1423G>A	c.(1423-1425)Ggc>Agc	p.G475S	DNAJC3_ENST00000376795.6_Missense_Mutation_p.G424S	NM_006260.4	NP_006251.1	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3	475					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of protein kinase activity (GO:0006469)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum Sec complex (GO:0031205)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	protein kinase inhibitor activity (GO:0004860)			NS(1)|breast(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)			AGGAGGCGGCGGCAACCCTTT	0.438																																						dbGAP											0													98.0	104.0	102.0					13																	96443192		2203	4300	6503	-	-	-	SO:0001583	missense	0			U28424	CCDS9479.1	13q32	2013-01-10			ENSG00000102580	ENSG00000102580		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	9439	protein-coding gene	gene with protein product		601184		PRKRI		7511204, 8824806	Standard	NM_006260		Approved	P58, P58IPK, HP58	uc001vmq.3	Q13217	OTTHUMG00000017227	ENST00000602402.1:c.1423G>A	13.37:g.96443192G>A	ENSP00000473631:p.Gly475Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86WT9|Q8N4N2	Missense_Mutation	SNP	pfam_TPR-1,pfam_DnaJ_N,smart_TPR_repeat,smart_DnaJ_N,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.G475S	ENST00000602402.1	37	c.1423	CCDS9479.1	13	.	.	.	.	.	.	.	.	.	.	G	15.23	2.770991	0.49680	.	.	ENSG00000102580	ENST00000376795	.	.	.	5.77	4.04	0.47022	.	0.202287	0.52532	N	0.000075	T	0.34048	0.0884	L	0.37697	1.125	0.46167	D	0.998907	P;P	0.42620	0.785;0.785	B;B	0.31101	0.124;0.124	T	0.09335	-1.0679	9	0.14656	T	0.56	-26.8649	11.9681	0.53047	0.1954:0.0:0.8046:0.0	.	475;475	A8KA82;Q13217	.;DNJC3_HUMAN	S	475	.	ENSP00000365991:G475S	G	+	1	0	DNAJC3	95241193	1.000000	0.71417	0.738000	0.30950	0.928000	0.56348	4.585000	0.60977	0.883000	0.36040	0.655000	0.94253	GGC	DNAJC3	-	NULL	ENSG00000102580		0.438	DNAJC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC3	HGNC	protein_coding	OTTHUMT00000045504.3	43	0.00	0	G			96443192	96443192	+1	no_errors	ENST00000376795	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	0.926	A
DNAJC7	7266	genome.wustl.edu	37	17	40134299	40134299	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:40134299C>T	ENST00000457167.4	-	11	1441	c.1205G>A	c.(1204-1206)cGg>cAg	p.R402Q	DNAJC7_ENST00000316603.7_Missense_Mutation_p.R346Q|DNAJC7_ENST00000426588.3_Missense_Mutation_p.R346Q	NM_003315.3	NP_003306.3	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7	402	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				chaperone cofactor-dependent protein refolding (GO:0070389)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				GGCCCGTTTCCGATAAGCTTT	0.527																																					Colon(63;618 1117 8600 10857 19751)	dbGAP											0													107.0	92.0	97.0					17																	40134299		1939	4144	6083	-	-	-	SO:0001583	missense	0			U46571	CCDS45677.1, CCDS45678.1	17q11.2	2013-01-10				ENSG00000168259		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	12392	protein-coding gene	gene with protein product		601964		TTC2		8836031, 11147971	Standard	NR_029431		Approved	TPR2	uc002hyo.3	Q99615		ENST00000457167.4:c.1205G>A	17.37:g.40134299C>T	ENSP00000406463:p.Arg402Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z784	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DnaJ_N,superfamily_DnaJ_N,smart_TPR_repeat,smart_DnaJ_N,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.R402Q	ENST00000457167.4	37	c.1205	CCDS45677.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.361088	0.95877	.	.	ENSG00000168259	ENST00000457167;ENST00000426588;ENST00000316603	T;T;T	0.41065	1.01;1.01;1.01	6.08	5.08	0.68730	Heat shock protein DnaJ, N-terminal (5);	0.048194	0.85682	D	0.000000	T	0.70020	0.3176	M	0.87097	2.86	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.77389	-0.2606	10	0.87932	D	0	-11.187	17.2103	0.86929	0.0:0.874:0.126:0.0	.	346;402	Q7Z784;Q99615	.;DNJC7_HUMAN	Q	402;346;346	ENSP00000406463:R402Q;ENSP00000394327:R346Q;ENSP00000313311:R346Q	ENSP00000313311:R346Q	R	-	2	0	DNAJC7	37387825	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	1.525000	0.49052	0.655000	0.94253	CGG	DNAJC7	-	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	ENSG00000168259		0.527	DNAJC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC7	HGNC	protein_coding	OTTHUMT00000453366.2	75	0.00	0	C			40134299	40134299	-1	no_errors	ENST00000457167	ensembl	human	known	69_37n	missense	64	16.88	13	SNP	1.000	T
DPYD	1806	genome.wustl.edu	37	1	98058912	98058912	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:98058912C>T	ENST00000370192.3	-	10	1090	c.990G>A	c.(988-990)tcG>tcA	p.S330S		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	330					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	CTCCCCGTATCGATGGCAATG	0.478																																						dbGAP											0													127.0	107.0	114.0					1																	98058912		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.990G>A	1.37:g.98058912C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Silent	SNP	pfam_Dihydroorotate_DH_1_2,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_tRNA_hU_synthase,superfamily_Helical_ferredxn,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_Dihydroorotate_DH	p.S330	ENST00000370192.3	37	c.990	CCDS30777.1	1																																																																																			DPYD	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	ENSG00000188641		0.478	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYD	HGNC	protein_coding	OTTHUMT00000095698.3	43	0.00	0	C	NM_000110		98058912	98058912	-1	no_errors	ENST00000370192	ensembl	human	known	69_37n	silent	27	28.95	11	SNP	0.998	T
DYSF	8291	genome.wustl.edu	37	2	71839797	71839797	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:71839797delC	ENST00000258104.3	+	39	4471	c.4194delC	c.(4192-4194)tgcfs	p.C1398fs	DYSF_ENST00000409651.1_Frame_Shift_Del_p.C1430fs|DYSF_ENST00000410020.3_Frame_Shift_Del_p.C1416fs|DYSF_ENST00000410041.1_Frame_Shift_Del_p.C1416fs|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000413539.2_Frame_Shift_Del_p.C1429fs|DYSF_ENST00000409366.1_Frame_Shift_Del_p.C1399fs|DYSF_ENST00000409744.1_Frame_Shift_Del_p.C1385fs|DYSF_ENST00000394120.2_Frame_Shift_Del_p.C1399fs|DYSF_ENST00000409582.3_Frame_Shift_Del_p.C1415fs|DYSF_ENST00000429174.2_Frame_Shift_Del_p.C1398fs|DYSF_ENST00000409762.1_Frame_Shift_Del_p.C1415fs	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1398	C2 5. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						AGCTCTACTGCCCCCCCATCA	0.622																																						dbGAP											0			GRCh37	CM053841	DYSF	M							58.0	54.0	56.0					2																	71839797		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.4194delC	2.37:g.71839797delC	ENSP00000258104:p.Cys1398fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Frame_Shift_Del	DEL	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_MFS_dom_general_subst_transpt,smart_C2_Ca-dep,smart_Peroxin/Ferlin,pfscan_C2_membr_targeting	p.I1432fs	ENST00000258104.3	37	c.4287	CCDS1918.1	2																																																																																			DYSF	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	ENSG00000135636		0.622	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3	33	0.00	0	C	NM_003494		71839797	71839797	+1	no_errors	ENST00000413539	ensembl	human	known	69_37n	frame_shift_del	14	36.36	8	DEL	0.989	-
EEF1A1	1915	genome.wustl.edu	37	6	74227940	74227940	+	Silent	SNP	A	A	C	rs11556677	byFrequency	TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr6:74227940A>C	ENST00000316292.9	-	6	2068	c.1077T>G	c.(1075-1077)ccT>ccG	p.P359P	EEF1A1_ENST00000331523.2_Silent_p.P359P|EEF1A1_ENST00000309268.6_Silent_p.P359P|EEF1A1_ENST00000491404.1_Intron	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	359					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						AATCCAATACAGGGGCATAGC	0.448																																						dbGAP											0													36.0	40.0	38.0					6																	74227940		2195	4298	6493	-	-	-	SO:0001819	synonymous_variant	0			BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1077T>G	6.37:g.74227940A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	P04719|P04720|Q6IQ15	Silent	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_ProtSyn_GTP-bd,tigrfam_Transl_elong_EF1A_euk/arc	p.P359	ENST00000316292.9	37	c.1077	CCDS4980.1	6																																																																																			EEF1A1	-	pfam_Transl_elong_EFTu/EF1A_C,superfamily_Transl_elong_EF1A/Init_IF2_C,tigrfam_Transl_elong_EF1A_euk/arc	ENSG00000156508		0.448	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1A1	HGNC	protein_coding	OTTHUMT00000041210.2	43	0.00	0	A	NM_001402		74227940	74227940	-1	no_errors	ENST00000309268	ensembl	human	known	69_37n	silent	33	13.16	5	SNP	1.000	C
EHD2	30846	genome.wustl.edu	37	19	48229479	48229479	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:48229479C>T	ENST00000263277.3	+	4	1164	c.913C>T	c.(913-915)Cga>Tga	p.R305*	EHD2_ENST00000538399.1_Nonsense_Mutation_p.R169*|CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_014601.3	NP_055416.2	Q9NZN4	EHD2_HUMAN	EH-domain containing 2	305					blood coagulation (GO:0007596)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein localization to plasma membrane (GO:0072659)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	19		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		CCGGCTGGTGCGAGTGAGTAG	0.642																																						dbGAP											0													16.0	18.0	17.0					19																	48229479		2196	4290	6486	-	-	-	SO:0001587	stop_gained	0			AF181263	CCDS12704.1	19q13.3	2014-08-12			ENSG00000024422	ENSG00000024422		"""EF-hand domain containing"""	3243	protein-coding gene	gene with protein product		605890		PAST2		10673336	Standard	NM_014601		Approved		uc002phj.4	Q9NZN4	OTTHUMG00000183266	ENST00000263277.3:c.913C>T	19.37:g.48229479C>T	ENSP00000263277:p.Arg305*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDH9|B4DNU6|Q96CB6	Nonsense_Mutation	SNP	pfam_Dynamin_GTPase,smart_EPS15_homology,pfscan_EF_HAND_2,pfscan_EPS15_homology	p.R305*	ENST00000263277.3	37	c.913	CCDS12704.1	19	.	.	.	.	.	.	.	.	.	.	C	35	5.541678	0.96474	.	.	ENSG00000024422	ENST00000263277;ENST00000539439;ENST00000540364;ENST00000538399	.	.	.	3.66	0.847	0.18961	.	0.060078	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-29.3818	8.6767	0.34183	0.62:0.3799:0.0:0.0	.	.	.	.	X	305;305;295;169	.	ENSP00000263277:R305X	R	+	1	2	EHD2	52921291	0.659000	0.27411	1.000000	0.80357	0.817000	0.46193	1.370000	0.34238	0.634000	0.30469	0.456000	0.33151	CGA	EHD2	-	NULL	ENSG00000024422		0.642	EHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD2	HGNC	protein_coding	OTTHUMT00000465851.1	18	0.00	0	C			48229479	48229479	+1	no_errors	ENST00000263277	ensembl	human	known	69_37n	nonsense	13	23.53	4	SNP	1.000	T
EIF4G3	8672	genome.wustl.edu	37	1	21299568	21299568	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:21299568G>A	ENST00000264211.8	-	5	544	c.350C>T	c.(349-351)cCg>cTg	p.P117L	EIF4G3_ENST00000356916.3_Missense_Mutation_p.P128L|EIF4G3_ENST00000536266.1_5'Flank|EIF4G3_ENST00000374937.3_Missense_Mutation_p.P124L|EIF4G3_ENST00000400422.1_Missense_Mutation_p.P117L|EIF4G3_ENST00000602326.1_Missense_Mutation_p.P124L|EIF4G3_ENST00000374935.3_Missense_Mutation_p.P117L|EIF4G3_ENST00000374927.4_Missense_Mutation_p.P117L	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	117					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		CTGATACACCGGCTGACTTGG	0.393																																						dbGAP											0													56.0	60.0	59.0					1																	21299568		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.350C>T	1.37:g.21299568G>A	ENSP00000264211:p.Pro117Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,pfam_W2_domain,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.P124L	ENST00000264211.8	37	c.371	CCDS214.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.282029	0.95489	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000374937;ENST00000356916;ENST00000374927;ENST00000537059;ENST00000438975;ENST00000411888	T;T;T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99;1.99;1.99	5.92	5.92	0.95590	.	0.233071	0.44902	D	0.000419	T	0.40498	0.1119	L	0.40543	1.245	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;0.998;1.0;0.999;1.0	D;D;P;D;D;P	0.74348	0.983;0.971;0.608;0.982;0.971;0.9	T	0.02282	-1.1183	10	0.46703	T	0.11	-11.0757	19.9118	0.97027	0.0:0.0:1.0:0.0	.	117;313;117;243;124;117	B4DXR2;Q59GJ0;Q504Z1;B1AN89;B9EGQ7;O43432	.;.;.;.;.;IF4G3_HUMAN	L	117;314;117;117;124;243;117;128;117;155	ENSP00000264211:P117L;ENSP00000383274:P117L;ENSP00000364071:P117L;ENSP00000364073:P124L;ENSP00000364062:P117L;ENSP00000395381:P117L;ENSP00000396083:P155L	ENSP00000264211:P117L	P	-	2	0	EIF4G3	21172155	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.753000	0.91637	2.809000	0.96659	0.557000	0.71058	CCG	EIF4G3	-	NULL	ENSG00000075151		0.393	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4G3	HGNC	protein_coding	OTTHUMT00000007467.3	44	0.00	0	G	NM_003760		21299568	21299568	-1	no_errors	ENST00000374937	ensembl	human	known	69_37n	missense	22	45.00	18	SNP	1.000	A
EML2	24139	genome.wustl.edu	37	19	46130077	46130077	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:46130077C>T	ENST00000245925.3	-	8	677	c.627G>A	c.(625-627)ttG>ttA	p.L209L	EML2_ENST00000536630.1_Silent_p.L356L|EML2_ENST00000589876.1_Silent_p.L209L|EML2_ENST00000586902.1_5'UTR|EML2_ENST00000587152.1_Silent_p.L410L	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	209	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		AGGTGGCCACCAATACAGCCT	0.587																																						dbGAP											0													40.0	35.0	36.0					19																	46130077		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.627G>A	19.37:g.46130077C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Nonsense_Mutation	SNP	NULL	p.W116*	ENST00000245925.3	37	c.347	CCDS12670.1	19																																																																																			EML2	-	NULL	ENSG00000125746		0.587	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	EML2	HGNC	protein_coding	OTTHUMT00000459608.1	27	0.00	0	C	NM_012155		46130077	46130077	-1	no_errors	ENST00000586195	ensembl	human	known	69_37n	nonsense	27	20.59	7	SNP	1.000	T
EP400	57634	genome.wustl.edu	37	12	132474593	132474593	+	Missense_Mutation	SNP	C	C	T	rs200268785		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr12:132474593C>T	ENST00000333577.4	+	9	2711	c.2602C>T	c.(2602-2604)Cgg>Tgg	p.R868W	EP400_ENST00000389561.2_Missense_Mutation_p.R832W|EP400_ENST00000330386.6_Missense_Mutation_p.R832W|EP400_ENST00000389562.2_Missense_Mutation_p.R831W|EP400_ENST00000332482.4_Missense_Mutation_p.R795W			Q96L91	EP400_HUMAN	E1A binding protein p400	868	HSA. {ECO:0000255|PROSITE- ProRule:PRU00549}.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CAGACTGAGGCGGATAGCCGC	0.547																																						dbGAP											0													74.0	79.0	77.0					12																	132474593		2203	4300	6503	-	-	-	SO:0001583	missense	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.2602C>T	12.37:g.132474593C>T	ENSP00000333602:p.Arg868Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R868W	ENST00000333577.4	37	c.2602		12	.	.	.	.	.	.	.	.	.	.	C	12.16	1.855620	0.32791	.	.	ENSG00000183495	ENST00000537902;ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000423130;ENST00000541296;ENST00000542457	D;D;D;D;D	0.92048	-2.94;-2.94;-2.94;-2.96;-2.94	5.11	5.11	0.69529	.	0.051385	0.85682	D	0.000000	D	0.95689	0.8598	M	0.79011	2.435	0.45733	D	0.99863	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0	D;D;D;P;D	0.76071	0.987;0.987;0.987;0.889;0.987	D	0.95720	0.8765	10	0.59425	D	0.04	.	15.2898	0.73857	0.1406:0.8594:0.0:0.0	.	832;832;831;868;795	Q96L91-2;Q96L91-4;Q96L91-5;F8WCN8;Q96L91-3	.;.;.;.;.	W	795;868;832;831;795;832;868;832;832	ENSP00000333602:R868W;ENSP00000374212:R832W;ENSP00000374213:R831W;ENSP00000331737:R795W;ENSP00000330620:R832W	ENSP00000330620:R832W	R	+	1	2	EP400	131040546	1.000000	0.71417	0.191000	0.23289	0.304000	0.27724	4.437000	0.59955	2.539000	0.85634	0.603000	0.83216	CGG	EP400	-	pfam_HSA,smart_HAS_subgr,pfscan_Helicase/SANT-assoc_DNA-bd	ENSG00000183495		0.547	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		22	0.00	0	C	NM_015409		132474593	132474593	+1	no_errors	ENST00000333577	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	0.999	T
EPPK1	83481	genome.wustl.edu	37	8	144941901	144941901	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr8:144941901G>A	ENST00000525985.1	-	2	5592	c.5521C>T	c.(5521-5523)Caa>Taa	p.Q1841*				P58107	EPIPL_HUMAN	epiplakin 1	1841						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTTGGTTTTGCGTCTCTGTT	0.547																																						dbGAP											0													243.0	243.0	243.0					8																	144941901		2092	4226	6318	-	-	-	SO:0001587	stop_gained	0			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.5521C>T	8.37:g.144941901G>A	ENSP00000436337:p.Gln1841*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q76E58|Q9NSU9	Nonsense_Mutation	SNP	pfam_Plectin_repeat,smart_Plectin_repeat	p.Q1841*	ENST00000525985.1	37	c.5521		8	.	.	.	.	.	.	.	.	.	.	G	43	10.279982	0.99375	.	.	ENSG00000227184	ENST00000525985	.	.	.	4.86	3.95	0.45737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	9.9841	0.41830	0.0:0.0:0.6318:0.3682	.	.	.	.	X	1841	.	ENSP00000436337:Q1841X	Q	-	1	0	EPPK1	145013889	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	0.419000	0.21247	1.213000	0.43380	0.585000	0.79938	CAA	EPPK1	-	NULL	ENSG00000227184		0.547	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	EPPK1	HGNC	protein_coding	OTTHUMT00000382675.1	139	0.00	0	G	NM_031308		144941901	144941901	-1	no_errors	ENST00000525985	ensembl	human	known	69_37n	nonsense	228	11.28	29	SNP	0.001	A
FAM47C	442444	genome.wustl.edu	37	X	37026807	37026807	+	Silent	SNP	G	G	A	rs370448444		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chrX:37026807G>A	ENST00000358047.3	+	1	376	c.324G>A	c.(322-324)tcG>tcA	p.S108S		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	108										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CCAAGCTCTCGCCAGCACAGC	0.527																																						dbGAP											0													90.0	84.0	86.0					X																	37026807		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.324G>A	X.37:g.37026807G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU46	Silent	SNP	NULL	p.S108	ENST00000358047.3	37	c.324	CCDS35227.1	X																																																																																			FAM47C	-	NULL	ENSG00000198173		0.527	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	74	0.00	0	G	NM_001013736		37026807	37026807	+1	no_errors	ENST00000358047	ensembl	human	known	69_37n	silent	57	10.94	7	SNP	0.002	A
FCRL5	83416	genome.wustl.edu	37	1	157504569	157504569	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:157504569G>C	ENST00000361835.3	-	8	1673	c.1516C>G	c.(1516-1518)Cag>Gag	p.Q506E	FCRL5_ENST00000368191.3_Missense_Mutation_p.Q421E|FCRL5_ENST00000368189.3_Missense_Mutation_p.Q506E|FCRL5_ENST00000368190.3_Missense_Mutation_p.Q506E|FCRL5_ENST00000356953.4_Missense_Mutation_p.Q506E	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	506	Ig-like C2-type 5.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				TGATAAAACTGGTATAGGATT	0.512																																						dbGAP											0													59.0	58.0	59.0					1																	157504569		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1516C>G	1.37:g.157504569G>C	ENSP00000354691:p.Gln506Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q506E	ENST00000361835.3	37	c.1516	CCDS1165.1	1	.	.	.	.	.	.	.	.	.	.	G	9.021	0.984993	0.18889	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191;ENST00000368189	T;T;T;T;T	0.14391	2.51;2.51;2.51;2.51;2.51	3.54	-7.08	0.01558	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.04998	0.0134	M	0.63843	1.955	0.09310	N	1	P;P;P;P;P;P	0.50528	0.803;0.726;0.936;0.822;0.925;0.822	P;P;P;P;P;P	0.51415	0.643;0.501;0.669;0.601;0.57;0.497	T	0.21381	-1.0247	9	0.05959	T	0.93	.	7.4935	0.27475	0.0:0.2573:0.1901:0.5525	.	537;421;506;506;506;506	B4DW39;F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;.;.;FCRL5_HUMAN	E	506;506;506;421;506	ENSP00000354691:Q506E;ENSP00000349434:Q506E;ENSP00000357173:Q506E;ENSP00000357174:Q421E;ENSP00000357172:Q506E	ENSP00000349434:Q506E	Q	-	1	0	FCRL5	155771193	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.800000	0.04555	-1.512000	0.01791	0.313000	0.20887	CAG	FCRL5	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000143297		0.512	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	30	0.00	0	G	NM_031281		157504569	157504569	-1	no_errors	ENST00000356953	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	0.000	C
FNDC9	408263	genome.wustl.edu	37	5	156770205	156770205	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:156770205delA	ENST00000312349.4	-	2	527	c.340delT	c.(340-342)tggfs	p.W114fs	CYFIP2_ENST00000318218.6_Intron|CYFIP2_ENST00000522463.1_Intron|CYFIP2_ENST00000347377.6_Intron|CYFIP2_ENST00000442283.2_Intron|CYFIP2_ENST00000435847.2_Intron|CYFIP2_ENST00000377576.3_Intron|CYFIP2_ENST00000521420.1_Intron|CYFIP2_ENST00000541131.1_Intron	NM_001001343.3	NP_001001343.2	Q8TBE3	FNDC9_HUMAN	fibronectin type III domain containing 9	114						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	9						ATCAGCACCCAAAGGGAGATC	0.587											OREG0016977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													72.0	74.0	73.0					5																	156770205		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC022570	CCDS4337.1	5q33.3	2013-02-11	2011-01-25	2011-01-25	ENSG00000172568	ENSG00000172568		"""Fibronectin type III domain containing"""	33547	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 40"""	C5orf40			Standard	NM_001001343		Approved	MGC27121	uc003lwu.2	Q8TBE3	OTTHUMG00000130248	ENST00000312349.4:c.340delT	5.37:g.156770205delA	ENSP00000310594:p.Trp114fs	Somatic	1781	WXS	Illumina GAIIx	Phase_IV	A8K0Y6	Frame_Shift_Del	DEL	superfamily_Fibronectin_type3	p.W114fs	ENST00000312349.4	37	c.340	CCDS4337.1	5																																																																																			FNDC9	-	NULL	ENSG00000172568		0.587	FNDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC9	HGNC	protein_coding	OTTHUMT00000252573.2	38	0.00	0	A	NM_001001343		156770205	156770205	-1	no_errors	ENST00000312349	ensembl	human	known	69_37n	frame_shift_del	22	26.67	8	DEL	0.979	-
FUBP3	8939	genome.wustl.edu	37	9	133506076	133506076	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr9:133506076delC	ENST00000319725.9	+	13	1254	c.1179delC	c.(1177-1179)aacfs	p.N393fs		NM_003934.1	NP_003925.1	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	393	KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.				positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|urinary_tract(2)	21				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		TTCAGAGGAACCCCCCTCCCA	0.587																																						dbGAP											0													47.0	52.0	50.0					9																	133506076		1986	4158	6144	-	-	-	SO:0001589	frameshift_variant	0			U69127	CCDS43893.1	9q34.11	2008-02-05			ENSG00000107164	ENSG00000107164			4005	protein-coding gene	gene with protein product		603536		FBP3		8940189	Standard	NM_003934		Approved		uc004bzr.1	Q96I24	OTTHUMG00000020809	ENST00000319725.9:c.1179delC	9.37:g.133506076delC	ENSP00000318177:p.Asn393fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFK8|A3KFL0|Q92946|Q9BVB6	Frame_Shift_Del	DEL	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	p.P395fs	ENST00000319725.9	37	c.1179	CCDS43893.1	9																																																																																			FUBP3	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000107164		0.587	FUBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FUBP3	HGNC	protein_coding	OTTHUMT00000054666.1	20	0.00	0	C			133506076	133506076	+1	no_errors	ENST00000319725	ensembl	human	known	69_37n	frame_shift_del	14	28.57	6	DEL	1.000	-
GLB1L2	89944	genome.wustl.edu	37	11	134244521	134244521	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr11:134244521T>C	ENST00000535456.2	+	18	1921	c.1733T>C	c.(1732-1734)aTc>aCc	p.I578T	GLB1L2_ENST00000529077.1_3'UTR|GLB1L2_ENST00000339772.7_Missense_Mutation_p.I578T|GLB1L2_ENST00000389881.3_Missense_Mutation_p.I578T	NM_138342.3	NP_612351.2	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2	578					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		GTTGTATTCATCAATGGCCAG	0.547																																						dbGAP											0													142.0	142.0	142.0					11																	134244521		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS31724.1	11q25	2008-01-29			ENSG00000149328	ENSG00000149328			25129	protein-coding gene	gene with protein product						12975309	Standard	NM_138342		Approved		uc001qhp.3	Q8IW92	OTTHUMG00000167179	ENST00000535456.2:c.1733T>C	11.37:g.134244521T>C	ENSP00000444628:p.Ile578Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCE6|Q6UX60|Q8NC62|Q8NCB3|Q8NCJ1|Q96HP3	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.I578T	ENST00000535456.2	37	c.1733	CCDS31724.1	11	.	.	.	.	.	.	.	.	.	.	T	24.0	4.484026	0.84854	.	.	ENSG00000149328	ENST00000339772;ENST00000535456;ENST00000389881	D;D;D	0.90133	-2.62;-2.62;-2.62	5.61	5.61	0.85477	Galactose-binding domain-like (1);	0.344749	0.31221	N	0.008027	D	0.94159	0.8126	M	0.89715	3.055	0.37816	D	0.92821	P	0.52692	0.955	P	0.49597	0.616	D	0.96359	0.9264	10	0.87932	D	0	-14.9493	15.4684	0.75422	0.0:0.0:0.0:1.0	.	578	Q8IW92	GLBL2_HUMAN	T	578	ENSP00000344659:I578T;ENSP00000444628:I578T;ENSP00000374531:I578T	ENSP00000344659:I578T	I	+	2	0	GLB1L2	133749731	1.000000	0.71417	0.643000	0.29450	0.998000	0.95712	6.910000	0.75741	2.127000	0.65507	0.533000	0.62120	ATC	GLB1L2	-	superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	ENSG00000149328		0.547	GLB1L2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLB1L2	HGNC	protein_coding	OTTHUMT00000393629.2	61	0.00	0	T	NM_138342		134244521	134244521	+1	no_errors	ENST00000339772	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	1.000	C
GMPS	8833	genome.wustl.edu	37	3	155652811	155652811	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:155652811G>C	ENST00000496455.2	+	14	2118	c.1783G>C	c.(1783-1785)Gcc>Ccc	p.A595P	GMPS_ENST00000295920.7_Missense_Mutation_p.A496P	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	595					glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	TGATTTTGAGGCCCATAACAT	0.413			T	MLL	AML																																Ovarian(153;896 1876 4149 15499 28134)	dbGAP		Dom	yes		3	3q24	8833	guanine monphosphate synthetase		L	0													196.0	180.0	185.0					3																	155652811		1850	4095	5945	-	-	-	SO:0001583	missense	0			U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.1783G>C	3.37:g.155652811G>C	ENSP00000419851:p.Ala595Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K639|B4DXV7|F8W720	Missense_Mutation	SNP	pfam_GATASE_1,pfam_GMP_synth_C,pfam_Peptidase_C26,pfam_NAD/GMP_synthase,pfam_QueC,pfam_Asn_synthase,pfam_tRNA-specific_2-thiouridylase,tigrfam_GMP_synth_N	p.A595P	ENST00000496455.2	37	c.1783	CCDS46941.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.356157	0.95854	.	.	ENSG00000163655	ENST00000496455;ENST00000295920;ENST00000537975;ENST00000541628	.	.	.	5.68	5.68	0.88126	GMP synthase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.82825	0.5121	M	0.77616	2.38	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.73708	0.967;0.981	T	0.83186	-0.0086	9	0.54805	T	0.06	-12.1064	19.7926	0.96466	0.0:0.0:1.0:0.0	.	496;595	F8W720;P49915	.;GUAA_HUMAN	P	595;496;544;595	.	ENSP00000295920:A496P	A	+	1	0	GMPS	157135505	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.697000	0.98697	2.670000	0.90874	0.655000	0.94253	GCC	GMPS	-	pfam_GMP_synth_C	ENSG00000163655		0.413	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMPS	HGNC	protein_coding	OTTHUMT00000351260.2	110	0.00	0	G			155652811	155652811	+1	no_errors	ENST00000496455	ensembl	human	known	69_37n	missense	79	27.52	30	SNP	1.000	C
GNA14	9630	genome.wustl.edu	37	9	80040546	80040546	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr9:80040546T>A	ENST00000341700.6	-	6	1322	c.809A>T	c.(808-810)aAc>aTc	p.N270I	GNA14_ENST00000464095.1_5'UTR	NM_004297.3	NP_004288.1	O95837	GNA14_HUMAN	guanine nucleotide binding protein (G protein), alpha 14	270					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	24						ATCCTTCTTGTTCAAGAATAA	0.368																																						dbGAP											0													119.0	123.0	121.0					9																	80040546		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF105201	CCDS6657.1	9q21	2008-05-23			ENSG00000156049	ENSG00000156049			4382	protein-coding gene	gene with protein product		604397				10191087, 17620339	Standard	NM_004297		Approved		uc004aku.3	O95837	OTTHUMG00000020058	ENST00000341700.6:c.809A>T	9.37:g.80040546T>A	ENSP00000365807:p.Asn270Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALW3	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_Q	p.N270I	ENST00000341700.6	37	c.809	CCDS6657.1	9	.	.	.	.	.	.	.	.	.	.	T	27.0	4.789807	0.90367	.	.	ENSG00000156049	ENST00000341700	D	0.94092	-3.35	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.98381	0.9462	H	0.99415	4.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99758	1.1020	10	0.87932	D	0	.	15.8002	0.78447	0.0:0.0:0.0:1.0	.	270	O95837	GNA14_HUMAN	I	270	ENSP00000365807:N270I	ENSP00000365807:N270I	N	-	2	0	GNA14	79230366	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.178000	0.65037	2.205000	0.71048	0.528000	0.53228	AAC	GNA14	-	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su	ENSG00000156049		0.368	GNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNA14	HGNC	protein_coding	OTTHUMT00000052759.1	70	0.00	0	T			80040546	80040546	-1	no_errors	ENST00000341700	ensembl	human	known	69_37n	missense	71	26.04	25	SNP	1.000	A
GRIN2B	2904	genome.wustl.edu	37	12	13724845	13724845	+	Silent	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr12:13724845G>A	ENST00000609686.1	-	10	2273	c.2064C>T	c.(2062-2064)aaC>aaT	p.N688N		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	688					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.N688N(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CTGTGCTGCCGTTGGGCACGG	0.502																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)											155.0	125.0	135.0					12																	13724845		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.2064C>T	12.37:g.13724845G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.N688	ENST00000609686.1	37	c.2064	CCDS8662.1	12																																																																																			GRIN2B	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000150086		0.502	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	HGNC	protein_coding	OTTHUMT00000268014.2	62	0.00	0	G			13724845	13724845	-1	no_errors	ENST00000279593	ensembl	human	known	69_37n	silent	75	24.24	24	SNP	0.992	A
GRIP1	23426	genome.wustl.edu	37	12	66932939	66932939	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr12:66932939G>A	ENST00000398016.3	-	4	405	c.337C>T	c.(337-339)Cgc>Tgc	p.R113C	GRIP1_ENST00000359742.4_Missense_Mutation_p.R113C|GRIP1_ENST00000286445.7_Missense_Mutation_p.R113C	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	158	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.				intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TCGTCATGGCGGAATTTGGCC	0.483																																						dbGAP											0													217.0	207.0	210.0					12																	66932939		1981	4159	6140	-	-	-	SO:0001583	missense	0			AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.337C>T	12.37:g.66932939G>A	ENSP00000381098:p.Arg113Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R113C	ENST00000398016.3	37	c.337	CCDS41807.1	12	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744765	0.69418	.	.	ENSG00000155974	ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433;ENST00000536215;ENST00000545666;ENST00000542309;ENST00000539540;ENST00000541947	T;T;T;T;T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05	4.55	4.55	0.56014	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.63319	0.2501	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.99	T	0.64283	-0.6444	9	.	.	.	-11.7089	17.7295	0.88373	0.0:0.0:1.0:0.0	.	113;113;113	F5H4N6;Q9Y3R0;Q9Y3R0-3	.;GRIP1_HUMAN;.	C	113;113;113;113;57;57;86;57;57;139	ENSP00000381098:R113C;ENSP00000352780:R113C;ENSP00000286445:R113C;ENSP00000446047:R113C;ENSP00000446024:R57C;ENSP00000446011:R57C;ENSP00000439124:R86C;ENSP00000438500:R57C;ENSP00000443392:R57C;ENSP00000438921:R139C	.	R	-	1	0	GRIP1	65219206	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	5.407000	0.66363	2.263000	0.75096	0.467000	0.42956	CGC	GRIP1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000155974		0.483	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIP1	HGNC	protein_coding	OTTHUMT00000401975.2	82	0.00	0	G			66932939	66932939	-1	no_errors	ENST00000359742	ensembl	human	known	69_37n	missense	60	27.71	23	SNP	1.000	A
GUK1	2987	genome.wustl.edu	37	1	228335369	228335369	+	Silent	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:228335369G>A	ENST00000366718.1	+	6	871	c.444G>A	c.(442-444)cgG>cgA	p.R148R	GUK1_ENST00000470040.1_Intron|GUK1_ENST00000366723.1_Silent_p.R169R|GUK1_ENST00000391865.3_Silent_p.R169R|GUK1_ENST00000366730.1_Silent_p.R148R|GUK1_ENST00000366721.1_Silent_p.R150R|GUK1_ENST00000366728.2_Silent_p.R169R|GUK1_ENST00000366722.1_Silent_p.R146R|GUK1_ENST00000312726.4_Silent_p.R148R|GUK1_ENST00000366716.1_Silent_p.R148R|GJC2_ENST00000366714.2_5'Flank|GUK1_ENST00000366726.1_Silent_p.R148R	NM_001159391.1	NP_001152863.1	Q16774	KGUA_HUMAN	guanylate kinase 1	148	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				ATP metabolic process (GO:0046034)|dATP metabolic process (GO:0046060)|dGDP biosynthetic process (GO:0006185)|dGMP metabolic process (GO:0046054)|drug metabolic process (GO:0017144)|GDP biosynthetic process (GO:0046711)|GDP-mannose metabolic process (GO:0019673)|glycoprotein transport (GO:0034436)|GMP metabolic process (GO:0046037)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleotide metabolic process (GO:0006163)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			endometrium(2)|lung(5)|prostate(1)|soft_tissue(1)	9		Prostate(94;0.0405)				TGGTGAAGCGGCTGGCTGCTG	0.647																																						dbGAP											0													34.0	40.0	38.0					1																	228335369		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC006249	CCDS1568.1, CCDS53481.1, CCDS55689.1	1q32-q41	2012-10-02			ENSG00000143774	ENSG00000143774	2.7.4.8		4693	protein-coding gene	gene with protein product		139270				8647247	Standard	NM_000858		Approved		uc021pkf.1	Q16774	OTTHUMG00000039503	ENST00000366718.1:c.444G>A	1.37:g.228335369G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANH1	Silent	SNP	pfam_Guanylate_kin,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_Guanylate_kin,tigrfam_Guanylate_kinase_sub	p.R146	ENST00000366718.1	37	c.438	CCDS1568.1	1																																																																																			GUK1	-	pfam_Guanylate_kin,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_Guanylate_kin,tigrfam_Guanylate_kinase_sub	ENSG00000143774		0.647	GUK1-021	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	GUK1	HGNC	protein_coding	OTTHUMT00000095944.1	31	0.00	0	G	NM_000858		228335369	228335369	+1	no_errors	ENST00000366722	ensembl	human	known	69_37n	silent	15	25.00	5	SNP	0.959	A
HAGH	3029	genome.wustl.edu	37	16	1869958	1869958	+	Silent	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr16:1869958G>A	ENST00000397356.3	-	4	778	c.372C>T	c.(370-372)taC>taT	p.Y124Y	HAGH_ENST00000397353.2_Silent_p.Y76Y|HAGH_ENST00000455446.2_Silent_p.Y124Y|HAGH_ENST00000566709.1_Silent_p.Y76Y	NM_005326.4	NP_005317.2	Q16775	GLO2_HUMAN	hydroxyacylglutathione hydrolase	124					glutathione biosynthetic process (GO:0006750)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacylglutathione hydrolase activity (GO:0004416)|zinc ion binding (GO:0008270)			kidney(2)|lung(1)|ovary(1)|skin(1)	5		Hepatocellular(780;0.00335)			Glutathione(DB00143)	CGTCACCCCCGTACACCTTCA	0.602																																					Pancreas(55;1048 1176 25227 40124 41333)	dbGAP											0													129.0	101.0	110.0					16																	1869958		2199	4300	6499	-	-	-	SO:0001819	synonymous_variant	0			X90999	CCDS32366.1, CCDS10447.2, CCDS66900.1	16p13.3	2012-10-02	2003-11-04		ENSG00000063854	ENSG00000063854	3.1.2.6		4805	protein-coding gene	gene with protein product		138760	"""hydroxyacyl glutathione hydrolase"""			3025077, 7327557	Standard	NM_001286249		Approved	GLO2, GLXII, HAGH1	uc002cna.3	Q16775	OTTHUMG00000128662	ENST00000397356.3:c.372C>T	16.37:g.1869958G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K290|B4DP33|B4DRA7|E7EN93	Missense_Mutation	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like,tigrfam_Hydroxyacylglutathione_Hdrlase	p.R55W	ENST00000397356.3	37	c.163	CCDS10447.2	16																																																																																			HAGH	-	pfam_Beta-lactamas-like,smart_Beta-lactamas-like,tigrfam_Hydroxyacylglutathione_Hdrlase	ENSG00000063854		0.602	HAGH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HAGH	HGNC	protein_coding	OTTHUMT00000250548.2	54	0.00	0	G	NM_005326		1869958	1869958	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000564445	ensembl	human	known	69_37n	missense	38	15.56	7	SNP	0.857	A
HDAC11	79885	genome.wustl.edu	37	3	13546039	13546039	+	Silent	SNP	C	C	A	rs377587104		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:13546039C>A	ENST00000295757.3	+	10	1083	c.900C>A	c.(898-900)acC>acA	p.T300T	HDAC11_ENST00000404548.1_3'UTR|HDAC11_ENST00000437379.2_Silent_p.T272T|HDAC11_ENST00000433119.1_3'UTR|HDAC11_ENST00000402271.1_Silent_p.T221T|HDAC11_ENST00000404040.1_Silent_p.T200T|HDAC11_ENST00000522202.1_Silent_p.T249T|HDAC11_ENST00000405025.1_3'UTR|HDAC11_ENST00000446613.2_Silent_p.T108T|HDAC11_ENST00000402259.1_Silent_p.T134T	NM_024827.3	NP_079103.2	Q96DB2	HDA11_HUMAN	histone deacetylase 11	300	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|oligodendrocyte development (GO:0014003)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(4)|prostate(3)	13						TTATGGTGACCTCAGGCGGGT	0.612																																						dbGAP											0													87.0	76.0	80.0					3																	13546039		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK025426	CCDS2615.1, CCDS46760.1	3p25.1	2008-07-18			ENSG00000163517	ENSG00000163517	3.5.1.98		19086	protein-coding gene	gene with protein product		607226				11948178	Standard	NM_001136041		Approved		uc003bxy.3	Q96DB2	OTTHUMG00000129800	ENST00000295757.3:c.900C>A	3.37:g.13546039C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDK1|Q9H6I7|Q9H6X3|Q9NTC9	Silent	SNP	pfam_His_deacetylse_dom,prints_His_deacetylse	p.T300	ENST00000295757.3	37	c.900	CCDS2615.1	3																																																																																			HDAC11	-	pfam_His_deacetylse_dom	ENSG00000163517		0.612	HDAC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC11	HGNC	protein_coding	OTTHUMT00000252028.5	40	0.00	0	C	NM_024827		13546039	13546039	+1	no_errors	ENST00000295757	ensembl	human	known	69_37n	silent	19	29.63	8	SNP	0.936	A
HMCN1	83872	genome.wustl.edu	37	1	186034377	186034377	+	Silent	SNP	A	A	G			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:186034377A>G	ENST00000271588.4	+	49	7750	c.7521A>G	c.(7519-7521)ccA>ccG	p.P2507P	HMCN1_ENST00000367492.2_Silent_p.P2507P	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2507	Ig-like C2-type 23.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAGGGAATCCAGTGCCAGAAA	0.393																																						dbGAP											0													49.0	50.0	50.0					1																	186034377		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.7521A>G	1.37:g.186034377A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.P2507	ENST00000271588.4	37	c.7521	CCDS30956.1	1																																																																																			HMCN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000143341		0.393	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	42	0.00	0	A	NM_031935		186034377	186034377	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	silent	41	39.71	27	SNP	0.756	G
HRC	3270	genome.wustl.edu	37	19	49656895	49656895	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:49656895C>T	ENST00000252825.4	-	1	1786	c.1600G>A	c.(1600-1602)Gag>Aag	p.E534K	HRC_ENST00000595625.1_Missense_Mutation_p.E534K	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	534					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		tcttcttcctcctcctGGTTC	0.592																																					Melanoma(37;75 1097 24567 25669 30645)	dbGAP											0													64.0	38.0	47.0					19																	49656895		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.1600G>A	19.37:g.49656895C>T	ENSP00000252825:p.Glu534Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q504Y6	Missense_Mutation	SNP	pfam_Hist_rich_Ca-bd	p.E534K	ENST00000252825.4	37	c.1600	CCDS12759.1	19	.	.	.	.	.	.	.	.	.	.	C	13.40	2.225746	0.39300	.	.	ENSG00000130528	ENST00000252825;ENST00000391863	T	0.49139	0.79	3.29	3.29	0.37713	.	.	.	.	.	T	0.45736	0.1357	L	0.46157	1.445	0.25472	N	0.987815	D	0.61697	0.99	P	0.48704	0.587	T	0.23726	-1.0180	9	0.25106	T	0.35	.	10.7552	0.46232	0.0:1.0:0.0:0.0	.	534	P23327	SRCH_HUMAN	K	534;233	ENSP00000252825:E534K	ENSP00000252825:E534K	E	-	1	0	HRC	54348707	0.119000	0.22226	0.994000	0.49952	0.191000	0.23601	0.139000	0.16036	1.799000	0.52666	0.462000	0.41574	GAG	HRC	-	NULL	ENSG00000130528		0.592	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRC	HGNC	protein_coding	OTTHUMT00000465649.1	50	0.00	0	C	NM_002152		49656895	49656895	-1	no_errors	ENST00000252825	ensembl	human	known	69_37n	missense	22	58.49	31	SNP	0.990	T
HSD17B4	3295	genome.wustl.edu	37	5	118835030	118835030	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:118835030A>G	ENST00000256216.6	+	13	1124	c.991A>G	c.(991-993)Aaa>Gaa	p.K331E	HSD17B4_ENST00000509514.1_Missense_Mutation_p.K69E|HSD17B4_ENST00000414835.2_Missense_Mutation_p.K191E|HSD17B4_ENST00000513628.1_Missense_Mutation_p.K194E|HSD17B4_ENST00000510025.1_Missense_Mutation_p.K307E|HSD17B4_ENST00000504811.1_Missense_Mutation_p.K356E|HSD17B4_ENST00000515320.1_Missense_Mutation_p.K313E	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	331	Enoyl-CoA hydratase 2.				alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		TATTGGCCAGAAACTCCCTCC	0.333																																					Colon(35;490 801 34689 41394 43344)	dbGAP											0													72.0	74.0	73.0					5																	118835030		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.991A>G	5.37:g.118835030A>G	ENSP00000256216:p.Lys331Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNV1|B4DVS5|E9PB82|F5HE57	Missense_Mutation	SNP	pfam_MaoC_deHydtase,pfam_DH_sc/Rdtase_SDR,pfam_SCP2_sterol-bd_dom,pfam_PKS_KR,superfamily_SCP2_sterol-bd_dom,smart_PKS/FAS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR,prints_DHB_DH	p.K331E	ENST00000256216.6	37	c.991	CCDS4126.1	5	.	.	.	.	.	.	.	.	.	.	A	5.886	0.347660	0.11126	.	.	ENSG00000133835	ENST00000256216;ENST00000515320;ENST00000510025;ENST00000504811;ENST00000414835;ENST00000513628;ENST00000509514	T;T;T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24	5.49	4.35	0.52113	.	0.405740	0.30940	N	0.008580	T	0.65059	0.2655	L	0.35593	1.075	0.09310	N	1	B;B;B;B;B	0.13145	0.006;0.007;0.002;0.007;0.007	B;B;B;B;B	0.15484	0.009;0.006;0.004;0.004;0.013	T	0.54417	-0.8297	10	0.39692	T	0.17	-6.5186	7.6575	0.28383	0.7635:0.1596:0.077:0.0	.	356;313;307;69;331	F5HE57;E9PB82;E7EWE5;E7EPL9;P51659	.;.;.;.;DHB4_HUMAN	E	331;313;307;356;191;194;69	ENSP00000256216:K331E;ENSP00000424613:K313E;ENSP00000424940:K307E;ENSP00000420914:K356E;ENSP00000411960:K191E;ENSP00000425993:K194E;ENSP00000426272:K69E	ENSP00000256216:K331E	K	+	1	0	HSD17B4	118862929	0.012000	0.17670	0.002000	0.10522	0.063000	0.16089	0.721000	0.25911	0.936000	0.37367	0.455000	0.32223	AAA	HSD17B4	-	NULL	ENSG00000133835		0.333	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B4	HGNC	protein_coding	OTTHUMT00000250863.3	76	0.00	0	A	NM_000414		118835030	118835030	+1	no_errors	ENST00000256216	ensembl	human	known	69_37n	missense	82	21.90	23	SNP	0.010	G
ICAM3	3385	genome.wustl.edu	37	19	10445930	10445930	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:10445930G>A	ENST00000160262.5	-	4	957	c.749C>T	c.(748-750)tCa>tTa	p.S250L	ICAM3_ENST00000589261.1_Missense_Mutation_p.S173L|RAVER1_ENST00000293677.6_5'Flank	NM_002162.3	NP_002153.2	P32942	ICAM3_HUMAN	intercellular adhesion molecule 3	250	Ig-like C2-type 3.				extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	13			OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)			CTGGGCCTCTGAGGCTGGAAA	0.677																																						dbGAP											0													68.0	75.0	73.0					19																	10445930		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12235.1	19p13.3-p13.2	2013-01-11				ENSG00000076662		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5346	protein-coding gene	gene with protein product		146631				1448174	Standard	NM_002162		Approved	CDW50, ICAM-R, CD50	uc002mob.2	P32942		ENST00000160262.5:c.749C>T	19.37:g.10445930G>A	ENSP00000160262:p.Ser250Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PD68	Missense_Mutation	SNP	pfam_ICAM_N,smart_Ig_sub,pfscan_Ig-like,prints_ICAM_VCAM_N,prints_ICAM	p.S250L	ENST00000160262.5	37	c.749	CCDS12235.1	19	.	.	.	.	.	.	.	.	.	.	G	14.71	2.617798	0.46736	.	.	ENSG00000076662	ENST00000160262	T	0.03717	3.83	5.15	-0.762	0.11034	Immunoglobulin-like fold (1);	0.949253	0.08638	N	0.916031	T	0.07503	0.0189	M	0.78456	2.415	0.09310	N	1	B	0.32876	0.388	B	0.36808	0.233	T	0.33445	-0.9868	10	0.62326	D	0.03	-7.5751	7.983	0.30194	0.0:0.4198:0.3652:0.215	.	250	P32942	ICAM3_HUMAN	L	250	ENSP00000160262:S250L	ENSP00000160262:S250L	S	-	2	0	ICAM3	10306930	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	0.340000	0.19892	0.211000	0.20683	0.462000	0.41574	TCA	ICAM3	-	NULL	ENSG00000076662		0.677	ICAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICAM3	HGNC	protein_coding	OTTHUMT00000451234.1	58	0.00	0	G			10445930	10445930	-1	no_errors	ENST00000160262	ensembl	human	known	69_37n	missense	16	36.00	9	SNP	0.000	A
ICAM3	3385	genome.wustl.edu	37	19	10449539	10449539	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:10449539A>T	ENST00000160262.5	-	2	370	c.162T>A	c.(160-162)agT>agA	p.S54R	ICAM3_ENST00000589261.1_5'UTR	NM_002162.3	NP_002153.2	P32942	ICAM3_HUMAN	intercellular adhesion molecule 3	54	Ig-like C2-type 1.				extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	13			OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)			GACAATCAGTACTGCAGTTCA	0.567																																						dbGAP											0													84.0	80.0	81.0					19																	10449539		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12235.1	19p13.3-p13.2	2013-01-11				ENSG00000076662		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5346	protein-coding gene	gene with protein product		146631				1448174	Standard	NM_002162		Approved	CDW50, ICAM-R, CD50	uc002mob.2	P32942		ENST00000160262.5:c.162T>A	19.37:g.10449539A>T	ENSP00000160262:p.Ser54Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PD68	Nonsense_Mutation	SNP	pfam_ICAM_N,prints_ICAM_VCAM_N	p.C43*	ENST00000160262.5	37	c.129	CCDS12235.1	19	.	.	.	.	.	.	.	.	.	.	A	18.67	3.674095	0.67928	.	.	ENSG00000076662	ENST00000160262	T	0.27720	1.65	5.66	-5.57	0.02521	Intercellular adhesion molecule/vascular cell adhesion molecule, N-terminal (1);Intercellular adhesion molecule, N-terminal (1);Immunoglobulin-like fold (1);	0.793638	0.11746	N	0.533559	T	0.56630	0.1998	M	0.87827	2.91	0.22511	N	0.999035	D	0.89917	1.0	D	0.91635	0.999	T	0.59268	-0.7486	10	0.87932	D	0	-14.3629	15.6154	0.76764	0.3:0.0:0.7:0.0	.	54	P32942	ICAM3_HUMAN	R	54	ENSP00000160262:S54R	ENSP00000160262:S54R	S	-	3	2	ICAM3	10310539	0.000000	0.05858	0.001000	0.08648	0.128000	0.20619	-0.751000	0.04803	-1.312000	0.02306	-0.353000	0.07706	AGT	ICAM3	-	pfam_ICAM_N	ENSG00000076662		0.567	ICAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICAM3	HGNC	protein_coding	OTTHUMT00000451234.1	44	0.00	0	A			10449539	10449539	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000590569	ensembl	human	putative	69_37n	nonsense	19	52.50	21	SNP	0.001	T
IGHD	3495	genome.wustl.edu	37	14	106307559	106307560	+	RNA	DEL	CT	CT	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr14:106307559_106307560delCT	ENST00000390556.2	-	0	477_478							P01880	IGHD_HUMAN	immunoglobulin heavy constant delta						immune response (GO:0006955)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										GGCTCGGACACTCTGCAGGGGA	0.658																																						dbGAP											0																																										-	-	-			0			K02875		14q32.33	2012-03-09			ENSG00000211898	ENSG00000211898		"""Immunoglobulins / IGH locus"""	5480	other	immunoglobulin gene	"""immunoglobulin delta"", ""constant region of heavy chain of IgD"""	147170				3922054	Standard	NG_001019		Approved	FLJ00382, FLJ46727, MGC29633	uc001ysj.3	P01880	OTTHUMG00000152538		14.37:g.106307561_106307562delCT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P4I8|Q8WU38	Frame_Shift_Del	DEL	pfam_Ig_C1-set,pfam_Immunoglobulin,smart_Ig_C1-set,pfscan_Ig-like	p.S160fs	ENST00000390556.2	37	c.479_478		14																																																																																			IGHD	-	NULL	ENSG00000211898		0.658	IGHD-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHD	HGNC	IG_C_gene	OTTHUMT00000326652.1	23	0.00	0	CT	NG_001019		106307559	106307560	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390556	ensembl	human	known	69_37n	frame_shift_del	14	41.67	10	DEL	0.001:0.003	-
IL1RAP	3556	genome.wustl.edu	37	3	190373953	190373953	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:190373953C>T	ENST00000317757.3	+	12	1827	c.1621C>T	c.(1621-1623)Cgg>Tgg	p.R541W	IL1RAP_ENST00000443369.2_Missense_Mutation_p.R541W	NM_001167931.1	NP_001161403.1	Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein	543	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-2 biosynthetic process (GO:0042094)|protein complex assembly (GO:0006461)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		GAAAGCTTTGCGGTTGGCTCT	0.507																																						dbGAP											0													46.0	48.0	47.0					3																	190373953		692	1591	2283	-	-	-	SO:0001583	missense	0			AB006537	CCDS3298.1, CCDS46982.1, CCDS54696.1	3q28	2013-01-11			ENSG00000196083	ENSG00000196083		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5995	protein-coding gene	gene with protein product		602626				9479509, 9065432	Standard	NM_002182		Approved	IL-1RAcP, IL1R3, C3orf13	uc003fsq.3	Q9NPH3	OTTHUMG00000156211	ENST00000317757.3:c.1621C>T	3.37:g.190373953C>T	ENSP00000314807:p.Arg541Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B1NLD0|D3DNW0|O14915|Q86WJ7	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_IL1_rcpt_I/II	p.R541W	ENST00000317757.3	37	c.1621	CCDS54696.1	3	.	.	.	.	.	.	.	.	.	.	C	16.27	3.077082	0.55753	.	.	ENSG00000196083	ENST00000443369;ENST00000317757	T;T	0.10763	2.84;2.84	5.51	-4.89	0.03103	.	.	.	.	.	T	0.30541	0.0768	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.34825	-0.9813	9	0.72032	D	0.01	.	21.3611	0.99952	0.8317:0.1683:0.0:0.0	.	541	Q9NPH3-5	.	W	541	ENSP00000408893:R541W;ENSP00000314807:R541W	ENSP00000314807:R541W	R	+	1	2	IL1RAP	191856647	0.956000	0.32656	0.427000	0.26684	0.990000	0.78478	-0.036000	0.12185	-1.002000	0.03429	-0.310000	0.09108	CGG	IL1RAP	-	pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom,prints_IL1_rcpt_1	ENSG00000196083		0.507	IL1RAP-006	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	IL1RAP	HGNC	protein_coding	OTTHUMT00000343502.1	29	0.00	0	C			190373953	190373953	+1	no_errors	ENST00000443369	ensembl	human	known	69_37n	missense	18	47.06	16	SNP	0.745	T
INTS4L2	644619	genome.wustl.edu	37	7	65150713	65150714	+	RNA	INS	-	-	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr7:65150713_65150714insA	ENST00000430126.2	+	0	694_695							Q2T9F4	IN4L2_HUMAN	integrator complex subunit 4-like 2																		CATACCATGAGAAAATCTCTAA	0.436																																						dbGAP											0																																										-	-	-			0			BC111554		7q11.21	2013-03-26			ENSG00000232270	ENSG00000273024			22351	other	unknown							Standard	NR_027392		Approved	MGC133166	uc003tue.2	Q2T9F4	OTTHUMG00000156558		7.37:g.65150717_65150717dupA		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000430126.2	37	NULL		7																																																																																			INTS4L2	-	-	ENSG00000232270		0.436	INTS4L2-002	KNOWN	basic	processed_transcript	INTS4L2	HGNC	pseudogene	OTTHUMT00000345545.2	42	0.00	0	-	NR_027392		65150713	65150714	+1	no_errors	ENST00000430126	ensembl	human	known	69_37n	rna	16	20.00	4	INS	1.000:0.995	A
ITFG2	55846	genome.wustl.edu	37	12	2929346	2929346	+	Silent	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr12:2929346G>A	ENST00000228799.2	+	5	640	c.501G>A	c.(499-501)ctG>ctA	p.L167L	ITFG2_ENST00000542548.1_Silent_p.L55L|ITFG2_ENST00000419778.2_5'UTR	NM_018463.3	NP_060933.3	Q969R8	ITFG2_HUMAN	integrin alpha FG-GAP repeat containing 2	167					germinal center B cell differentiation (GO:0002314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)	19			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			CTGAACATCTGACAGGGCAGC	0.597																																						dbGAP											0													102.0	75.0	84.0					12																	2929346		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF220048	CCDS8513.1	12p13.33	2006-11-29		2006-07-25	ENSG00000111203	ENSG00000111203			30879	protein-coding gene	gene with protein product						12477932	Standard	NM_018463		Approved	MDS028	uc001qlb.2	Q969R8	OTTHUMG00000130617	ENST00000228799.2:c.501G>A	12.37:g.2929346G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Z5|D3DUQ2|Q6PKU5|Q96SX6	Silent	SNP	pfam_FG-GAP,superfamily_WD40_repeat_dom	p.L167	ENST00000228799.2	37	c.501	CCDS8513.1	12																																																																																			ITFG2	-	superfamily_WD40_repeat_dom	ENSG00000111203		0.597	ITFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITFG2	HGNC	protein_coding	OTTHUMT00000253091.1	68	0.00	0	G	NM_018463		2929346	2929346	+1	no_errors	ENST00000228799	ensembl	human	known	69_37n	silent	34	39.29	22	SNP	0.000	A
JAG1	182	genome.wustl.edu	37	20	10644610	10644610	+	Splice_Site	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr20:10644610C>T	ENST00000254958.5	-	3	955		c.e3+1		JAG1_ENST00000423891.2_5'Flank	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1						angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						GCGATACTTACGAACGGTGTC	0.463									Alagille Syndrome																													dbGAP											0			GRCh37	CS003182	JAG1	S							168.0	130.0	143.0					20																	10644610		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.439+1G>A	20.37:g.10644610C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Splice_Site	SNP	-	e3+1	ENST00000254958.5	37	c.439+1	CCDS13112.1	20	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647456	0.87958	.	.	ENSG00000101384	ENST00000254958	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.773	0.96379	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	JAG1	10592610	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	5.580000	0.67464	2.677000	0.91161	0.655000	0.94253	.	JAG1	-	-	ENSG00000101384		0.463	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	JAG1	HGNC	protein_coding		73	0.00	0	C	NM_000214	Intron	10644610	10644610	-1	no_errors	ENST00000254958	ensembl	human	known	69_37n	splice_site	78	17.02	16	SNP	1.000	T
JAK1	3716	genome.wustl.edu	37	1	65306997	65306997	+	Frame_Shift_Del	DEL	T	T	-	rs202179869		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:65306997delT	ENST00000342505.4	-	19	2828	c.2580delA	c.(2578-2580)aaafs	p.K860fs	JAK1_ENST00000465376.1_5'Flank	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	860					cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CAGTTGCTGGTTTTTTTTCTG	0.468			Mis		ALL																																	dbGAP		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	0													93.0	93.0	93.0					1																	65306997		1870	4100	5970	-	-	-	SO:0001589	frameshift_variant	0			M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.2580delA	1.37:g.65306997delT	ENSP00000343204:p.Lys860fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GQ2|Q9UD26	Frame_Shift_Del	DEL	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak1,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_cat_dom	p.K860fs	ENST00000342505.4	37	c.2580	CCDS41346.1	1																																																																																			JAK1	-	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,superfamily_Kinase-like_dom	ENSG00000162434		0.468	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK1	HGNC	protein_coding	OTTHUMT00000025791.1	53	0.00	0	T	NM_002227		65306997	65306997	-1	no_errors	ENST00000342505	ensembl	human	known	69_37n	frame_shift_del	34	30.61	15	DEL	0.055	-
JAK1	3716	genome.wustl.edu	37	1	65325833	65325833	+	Frame_Shift_Del	DEL	G	G	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:65325833delG	ENST00000342505.4	-	9	1537	c.1289delC	c.(1288-1290)ccgfs	p.P430fs		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	430					cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	GACGATCAACGGGGGGGCCAC	0.542			Mis		ALL																																	dbGAP		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	0													95.0	99.0	98.0					1																	65325833		2012	4160	6172	-	-	-	SO:0001589	frameshift_variant	0			M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.1289delC	1.37:g.65325833delG	ENSP00000343204:p.Pro430fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GQ2|Q9UD26	Frame_Shift_Del	DEL	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak1,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_cat_dom	p.P430fs	ENST00000342505.4	37	c.1289	CCDS41346.1	1																																																																																			JAK1	-	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2	ENSG00000162434		0.542	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK1	HGNC	protein_coding	OTTHUMT00000025791.1	59	0.00	0	G	NM_002227		65325833	65325833	-1	no_errors	ENST00000342505	ensembl	human	known	69_37n	frame_shift_del	26	21.21	7	DEL	0.995	-
KBTBD4	55709	genome.wustl.edu	37	11	47599060	47599060	+	Silent	SNP	C	C	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr11:47599060C>A	ENST00000526005.1	-	2	645	c.492G>T	c.(490-492)acG>acT	p.T164T	KBTBD4_ENST00000533290.1_Silent_p.T189T|NDUFS3_ENST00000533507.1_Intron|KBTBD4_ENST00000450908.1_5'Flank|NDUFS3_ENST00000528192.1_5'Flank|RNU5E-10P_ENST00000363506.1_RNA|NDUFS3_ENST00000534716.2_5'Flank|NDUFS3_ENST00000534208.1_5'Flank|KBTBD4_ENST00000430070.2_Silent_p.T180T|NDUFS3_ENST00000529276.1_5'Flank|NDUFS3_ENST00000263774.4_5'Flank|KBTBD4_ENST00000525720.1_Silent_p.T213T|KBTBD4_ENST00000395288.2_Silent_p.T164T			Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	164	BACK.									NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	24						GCTTGGCAGCCGTATAGAGCT	0.547																																						dbGAP											0													137.0	136.0	136.0					11																	47599060		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AF151086	CCDS7940.1, CCDS44594.1	11p11.2	2013-01-08	2003-12-12	2003-12-17	ENSG00000123444	ENSG00000123444		"""BTB/POZ domain containing"""	23761	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 4"""	BKLHD4		11042152	Standard	NM_018095		Approved	FLJ10450, HSPC252	uc001nfz.3	Q9NVX7	OTTHUMG00000166894	ENST00000526005.1:c.492G>T	11.37:g.47599060C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQS1|D3DQS2|Q6IA85|Q9BUC3|Q9NV76	Silent	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.T180	ENST00000526005.1	37	c.540	CCDS7940.1	11	.	.	.	.	.	.	.	.	.	.	C	8.734	0.917391	0.17982	.	.	ENSG00000123444	ENST00000359900	.	.	.	5.5	-4.11	0.03928	.	.	.	.	.	T	0.32164	0.0820	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22906	-1.0203	5	0.10377	T	0.69	-6.5509	7.4376	0.27164	0.2152:0.5823:0.0658:0.1367	.	.	.	.	L	174	.	ENSP00000352971:R174L	R	-	2	0	KBTBD4	47555636	0.054000	0.20591	0.996000	0.52242	0.945000	0.59286	-0.548000	0.06048	-0.209000	0.10156	-0.562000	0.04174	CGG	KBTBD4	-	pfam_BACK,smart_BACK	ENSG00000123444		0.547	KBTBD4-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	KBTBD4	HGNC	protein_coding	OTTHUMT00000391763.1	41	0.00	0	C	NM_016506		47599060	47599060	-1	no_errors	ENST00000430070	ensembl	human	known	69_37n	silent	27	22.86	8	SNP	0.864	A
KCNAB3	9196	genome.wustl.edu	37	17	7828433	7828433	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:7828433G>T	ENST00000303790.2	-	8	606	c.607C>A	c.(607-609)Ccc>Acc	p.P203T		NM_004732.3	NP_004723.2	O43448	KCAB3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 3	203					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	8		Prostate(122;0.157)				GGACAGTTGGGGTCTGAGCGA	0.537																																						dbGAP											0													135.0	108.0	117.0					17																	7828433		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF016411	CCDS11124.1	17p13.1	2006-11-29			ENSG00000170049	ENSG00000170049		"""Potassium channels"", ""Aldo-keto reductases"""	6230	protein-coding gene	gene with protein product		604111				9857044	Standard	NM_004732		Approved	AKR6A9, KCNA3B	uc002gjm.2	O43448	OTTHUMG00000108170	ENST00000303790.2:c.607C>A	17.37:g.7828433G>T	ENSP00000302719:p.Pro203Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAW0	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_K_chnl_volt-dep_bsu_KCNAB-rel,prints_K_chnl_volt-dep_bsu_KCNAB3,prints_K_chnl_volt-dep_bsu_KCNAB1,tigrfam_K_chnl_volt-dep_bsu_KCNAB	p.P203T	ENST00000303790.2	37	c.607	CCDS11124.1	17	.	.	.	.	.	.	.	.	.	.	G	13.89	2.370979	0.42003	.	.	ENSG00000170049	ENST00000303790	T	0.46819	0.86	5.42	5.42	0.78866	NADP-dependent oxidoreductase domain (3);	0.113135	0.64402	D	0.000007	T	0.48995	0.1531	M	0.69185	2.1	0.48236	D	0.999612	B	0.06786	0.001	B	0.16722	0.016	T	0.43877	-0.9364	10	0.42905	T	0.14	.	15.552	0.76161	0.0:0.1382:0.8618:0.0	.	203	O43448	KCAB3_HUMAN	T	203	ENSP00000302719:P203T	ENSP00000302719:P203T	P	-	1	0	KCNAB3	7769158	0.997000	0.39634	1.000000	0.80357	0.991000	0.79684	1.302000	0.33459	2.542000	0.85734	0.511000	0.50034	CCC	KCNAB3	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,tigrfam_K_chnl_volt-dep_bsu_KCNAB	ENSG00000170049		0.537	KCNAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNAB3	HGNC	protein_coding	OTTHUMT00000226974.1	73	0.00	0	G	NM_004732		7828433	7828433	-1	no_errors	ENST00000303790	ensembl	human	known	69_37n	missense	36	20.00	9	SNP	1.000	T
KCNK1	3775	genome.wustl.edu	37	1	233802463	233802463	+	Missense_Mutation	SNP	G	G	A	rs372727640		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:233802463G>A	ENST00000366621.3	+	2	646	c.478G>A	c.(478-480)Gtc>Atc	p.V160I	KCNK1_ENST00000366620.1_Missense_Mutation_p.V44I|KCNK1_ENST00000472190.1_3'UTR	NM_002245.3	NP_002236.1	O00180	KCNK1_HUMAN	potassium channel, subfamily K, member 1	160					potassium ion transport (GO:0006813)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)	p.V160I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)	11		all_cancers(173;0.00217)|all_epithelial(177;0.121)|Prostate(94;0.122)|Acute lymphoblastic leukemia(190;0.175)			Ibutilide(DB00308)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)	CACCGTGCACGTCACCCGCAG	0.597																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											166.0	116.0	133.0					1																	233802463		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33632	CCDS1599.1	1q42-q43	2012-03-07			ENSG00000135750	ENSG00000135750		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6272	protein-coding gene	gene with protein product		601745				8661042, 16382106	Standard	NM_002245		Approved	K2p1.1, DPK, TWIK-1	uc010pxo.1	O00180	OTTHUMG00000037923	ENST00000366621.3:c.478G>A	1.37:g.233802463G>A	ENSP00000355580:p.Val160Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13307|Q5T5E8	Missense_Mutation	SNP	pirsf_2pore_dom_K_chnl_TASK/TWIK,pfam_Ion_trans_2,prints_2pore_dom_K_chnl_TWIK1,prints_2pore_dom_K_chnl_TWIK,prints_2pore_dom_K_chnl	p.V160I	ENST00000366621.3	37	c.478	CCDS1599.1	1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.398740	0.62177	.	.	ENSG00000135750	ENST00000366621;ENST00000366620;ENST00000446915	T;D;D	0.97328	1.91;-4.34;-4.34	5.91	4.05	0.47172	.	0.262524	0.43260	N	0.000596	D	0.94745	0.8304	M	0.63843	1.955	0.38954	D	0.95841	B	0.29037	0.231	B	0.17098	0.017	D	0.92480	0.5992	10	0.36615	T	0.2	.	12.0842	0.53688	0.1366:0.0:0.8634:0.0	.	160	O00180	KCNK1_HUMAN	I	160;44;78	ENSP00000355580:V160I;ENSP00000355579:V44I;ENSP00000409626:V78I	ENSP00000355579:V44I	V	+	1	0	KCNK1	231869086	1.000000	0.71417	0.970000	0.41538	0.934000	0.57294	5.894000	0.69806	0.844000	0.35094	0.655000	0.94253	GTC	KCNK1	-	pirsf_2pore_dom_K_chnl_TASK/TWIK,prints_2pore_dom_K_chnl_TWIK1	ENSG00000135750		0.597	KCNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK1	HGNC	protein_coding	OTTHUMT00000092565.1	87	0.00	0	G	NM_002245		233802463	233802463	+1	no_errors	ENST00000366621	ensembl	human	known	69_37n	missense	111	12.60	16	SNP	0.998	A
C2CD5	9847	genome.wustl.edu	37	12	22677460	22677460	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr12:22677460G>A	ENST00000333957.4	-	6	802	c.547C>T	c.(547-549)Cgc>Tgc	p.R183C	C2CD5_ENST00000544930.1_5'UTR|C2CD5_ENST00000540703.1_5'UTR|C2CD5_ENST00000446597.1_Missense_Mutation_p.R183C|C2CD5_ENST00000536386.1_Missense_Mutation_p.R183C|C2CD5_ENST00000545552.1_Missense_Mutation_p.R183C|C2CD5_ENST00000396028.2_Missense_Mutation_p.R183C|C2CD5_ENST00000542676.1_Missense_Mutation_p.R183C	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	183					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										CTTGGTGTGCGAATTCGATCA	0.363																																						dbGAP											0													133.0	119.0	124.0					12																	22677460		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.547C>T	12.37:g.22677460G>A	ENSP00000334229:p.Arg183Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.R183C	ENST00000333957.4	37	c.547	CCDS31758.1	12	.	.	.	.	.	.	.	.	.	.	G	20.9	4.067890	0.76301	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552	T;T;T;T;T;T	0.79845	-1.31;-1.31;0.71;0.71;-1.31;0.71	4.95	4.05	0.47172	.	0.000000	0.85682	D	0.000000	D	0.89681	0.6785	M	0.84511	2.7	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.80764	0.994;0.932;0.932;0.927;0.932	D	0.91270	0.5043	10	0.87932	D	0	-10.3346	13.6424	0.62260	0.0769:0.0:0.9231:0.0	.	183;183;183;183;183	F5H2A1;B4DRN7;B7ZLL0;Q86YS7-2;Q86YS7	.;.;.;.;K0528_HUMAN	C	183	ENSP00000334229:R183C;ENSP00000388756:R183C;ENSP00000439392:R183C;ENSP00000379345:R183C;ENSP00000441951:R183C;ENSP00000443204:R183C	ENSP00000334229:R183C	R	-	1	0	KIAA0528	22568727	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.120000	0.64685	2.306000	0.77630	0.585000	0.79938	CGC	KIAA0528	-	NULL	ENSG00000111731		0.363	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0528	HGNC	protein_coding	OTTHUMT00000402257.1	68	0.00	0	G	NM_014802		22677460	22677460	-1	no_errors	ENST00000333957	ensembl	human	known	69_37n	missense	78	12.22	11	SNP	1.000	A
KIAA1109	84162	genome.wustl.edu	37	4	123168476	123168476	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr4:123168476C>T	ENST00000264501.4	+	35	5849	c.5476C>T	c.(5476-5478)Cga>Tga	p.R1826*	KIAA1109_ENST00000455637.1_Nonsense_Mutation_p.R1826*|KIAA1109_ENST00000388738.3_Nonsense_Mutation_p.R1826*			Q2LD37	K1109_HUMAN	KIAA1109	1826					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AAACATTCATCGAGTTCATGG	0.383																																						dbGAP											0													118.0	113.0	115.0					4																	123168476		1868	4118	5986	-	-	-	SO:0001587	stop_gained	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.5476C>T	4.37:g.123168476C>T	ENSP00000264501:p.Arg1826*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Nonsense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.R1826*	ENST00000264501.4	37	c.5476	CCDS43267.1	4	.	.	.	.	.	.	.	.	.	.	C	46	12.130736	0.99639	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637	.	.	.	5.47	4.62	0.57501	.	0.000000	0.43579	U	0.000559	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8484	0.78907	0.137:0.863:0.0:0.0	.	.	.	.	X	1826	.	ENSP00000264501:R1826X	R	+	1	2	KIAA1109	123387926	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.925000	0.56484	1.421000	0.47157	-0.302000	0.09304	CGA	KIAA1109	-	NULL	ENSG00000138688		0.383	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	66	0.00	0	C	NM_020797		123168476	123168476	+1	no_errors	ENST00000264501	ensembl	human	known	69_37n	nonsense	84	13.40	13	SNP	1.000	T
KIF5B	3799	genome.wustl.edu	37	10	32311826	32311826	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr10:32311826delT	ENST00000302418.4	-	16	2321	c.1864delA	c.(1864-1866)atgfs	p.M622fs	KIF5B_ENST00000493889.1_5'Flank	NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	622					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				TTTTCTTCCATTTTTTTGTTG	0.348			T	"""RET, ALK"""	NSCLC																																	dbGAP		Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	0													237.0	201.0	214.0					10																	32311826		2202	4299	6501	-	-	-	SO:0001589	frameshift_variant	0			X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.1864delA	10.37:g.32311826delT	ENSP00000307078:p.Met622fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVB2|Q5VZ85	Frame_Shift_Del	DEL	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.M622fs	ENST00000302418.4	37	c.1864	CCDS7171.1	10																																																																																			KIF5B	-	NULL	ENSG00000170759		0.348	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5B	HGNC	protein_coding	OTTHUMT00000047467.1	126	0.00	0	T	NM_004521		32311826	32311826	-1	no_errors	ENST00000302418	ensembl	human	known	69_37n	frame_shift_del	109	20.29	28	DEL	1.000	-
KIRREL2	84063	genome.wustl.edu	37	19	36357343	36357343	+	Silent	SNP	A	A	G			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:36357343A>G	ENST00000360202.5	+	15	2274	c.2076A>G	c.(2074-2076)ccA>ccG	p.P692P	APLP1_ENST00000537454.2_5'Flank|KIRREL2_ENST00000592409.1_Silent_p.P657P|KIRREL2_ENST00000262625.7_Intron|APLP1_ENST00000221891.4_5'Flank|KIRREL2_ENST00000347900.6_Intron|NPHS1_ENST00000591817.1_Intron	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	692	Pro-rich.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCCCCTTCCCATATGCTGCCT	0.577																																						dbGAP											0													101.0	107.0	105.0					19																	36357343		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.2076A>G	19.37:g.36357343A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P692	ENST00000360202.5	37	c.2076	CCDS12481.1	19																																																																																			KIRREL2	-	NULL	ENSG00000126259		0.577	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIRREL2	HGNC	protein_coding	OTTHUMT00000452561.1	51	0.00	0	A	NM_032123		36357343	36357343	+1	no_errors	ENST00000360202	ensembl	human	known	69_37n	silent	37	24.49	12	SNP	0.432	G
KLK1	3816	genome.wustl.edu	37	19	51323226	51323227	+	Frame_Shift_Ins	INS	-	-	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:51323226_51323227insT	ENST00000301420.2	-	4	596_597	c.561_562insA	c.(559-564)aaagccfs	p.A188fs	KLK1_ENST00000448701.2_Frame_Shift_Ins_p.A86fs|CTD-2568A17.5_ENST00000326989.5_lincRNA	NM_002257.2	NP_002248.1	P06870	KLK1_HUMAN	kallikrein 1	188	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.			A -> V (in Ref. 8; AAP35917 and 11; AAH05313). {ECO:0000305}.		extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			breast(1)|large_intestine(4)|lung(7)|urinary_tract(1)	13		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Aprotinin(DB06692)	TGGACGTGGGCTTTTTTGCACT	0.554																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			L10038	CCDS12804.1	19q13.3	2008-02-05	2006-10-27			ENSG00000167748	3.4.21.35	"""Kallikreins"""	6357	protein-coding gene	gene with protein product		147910	"""kallikrein 1, renal/pancreas/salivary"""			1684954, 16800724, 16800723	Standard	NM_002257		Approved	Klk6	uc002ptk.1	P06870		ENST00000301420.2:c.562dupA	19.37:g.51323232_51323232dupT	ENSP00000301420:p.Ala188fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q66US9|Q86U61|Q8TCV8|Q9BS53|Q9NQU4|Q9UD19|Q9UMJ1	Frame_Shift_Ins	INS	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.A187fs	ENST00000301420.2	37	c.562_561	CCDS12804.1	19																																																																																			KLK1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000167748		0.554	KLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK1	HGNC	protein_coding	OTTHUMT00000464135.2	63	0.00	0	-	NM_002257		51323226	51323227	-1	no_errors	ENST00000301420	ensembl	human	known	69_37n	frame_shift_ins	38	25.49	13	INS	0.935:0.000	T
L1CAM	3897	genome.wustl.edu	37	X	153133791	153133791	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chrX:153133791C>T	ENST00000370060.1	-	14	1858	c.1669G>A	c.(1669-1671)Ggt>Agt	p.G557S	L1CAM_ENST00000361981.3_Missense_Mutation_p.G552S|L1CAM_ENST00000361699.4_Missense_Mutation_p.G557S|L1CAM_ENST00000370055.1_Missense_Mutation_p.G552S|L1CAM_ENST00000538883.1_Missense_Mutation_p.G559S|L1CAM_ENST00000543994.1_Missense_Mutation_p.G559S|L1CAM_ENST00000370057.3_Missense_Mutation_p.G557S	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	557	Ig-like C2-type 6.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGGTCTCGACCGTCCCCACGC	0.612													c|||	1	0.000264901	0.0	0.0014	3775	,	,		13473	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													125.0	125.0	125.0					X																	153133791		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.1669G>A	X.37:g.153133791C>T	ENSP00000359077:p.Gly557Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G559S	ENST00000370060.1	37	c.1675	CCDS14733.1	X	.	.	.	.	.	.	.	.	.	.	C	16.49	3.138264	0.56936	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699	D;D;D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;-1.54	5.32	5.32	0.75619	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.201348	0.33290	N	0.005080	D	0.86594	0.5970	M	0.74647	2.275	0.23468	N	0.997619	P;D;D	0.57571	0.952;0.98;0.961	P;P;P	0.55087	0.523;0.768;0.654	T	0.81525	-0.0893	10	0.72032	D	0.01	.	15.6278	0.76874	0.0:1.0:0.0:0.0	.	552;557;557	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	S	557;559;557;559;552;552;557	ENSP00000359077:G557S;ENSP00000438430:G559S;ENSP00000359074:G557S;ENSP00000439645:G559S;ENSP00000354712:G552S;ENSP00000359072:G552S;ENSP00000355380:G557S	ENSP00000355380:G557S	G	-	1	0	L1CAM	152786985	0.019000	0.18553	0.024000	0.17045	0.685000	0.39939	1.791000	0.38744	2.374000	0.81015	0.529000	0.55759	GGT	L1CAM	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000198910		0.612	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	L1CAM	HGNC	protein_coding	OTTHUMT00000061094.2	67	0.00	0	C	NM_024003		153133791	153133791	-1	no_errors	ENST00000543994	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	0.121	T
LCT	3938	genome.wustl.edu	37	2	136564955	136564955	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:136564955C>T	ENST00000264162.2	-	9	3926	c.3916G>A	c.(3916-3918)Gat>Aat	p.D1306N	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1306	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TCTATACCATCGAGCCTGTAG	0.522																																						dbGAP											0													84.0	82.0	83.0					2																	136564955		2203	4300	6503	-	-	-	SO:0001583	missense	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.3916G>A	2.37:g.136564955C>T	ENSP00000264162:p.Asp1306Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG58	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.D1306N	ENST00000264162.2	37	c.3916	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.128372	0.94473	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.57107	0.42	5.87	5.87	0.94306	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.71804	0.3383	L	0.58669	1.825	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72204	-0.4361	10	0.87932	D	0	-29.6672	20.2192	0.98319	0.0:1.0:0.0:0.0	.	1306	P09848	LPH_HUMAN	N	1306;738	ENSP00000264162:D1306N	ENSP00000264162:D1306N	D	-	1	0	LCT	136281425	1.000000	0.71417	0.903000	0.35520	0.705000	0.40729	6.095000	0.71439	2.780000	0.95670	0.655000	0.94253	GAT	LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000115850		0.522	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	44	0.00	0	C	NM_002299		136564955	136564955	-1	no_errors	ENST00000264162	ensembl	human	known	69_37n	missense	18	35.48	11	SNP	1.000	T
LOXHD1	125336	genome.wustl.edu	37	18	44139503	44139503	+	Missense_Mutation	SNP	C	C	T	rs558768319		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr18:44139503C>T	ENST00000398722.4	-	13	2289	c.2290G>A	c.(2290-2292)Gtc>Atc	p.V764I	LOXHD1_ENST00000536736.1_Missense_Mutation_p.V1042I|LOXHD1_ENST00000441893.2_5'Flank|LOXHD1_ENST00000441551.2_Intron|LOXHD1_ENST00000300591.6_5'Flank|LOXHD1_ENST00000579038.1_5'Flank|LOXHD1_ENST00000582408.1_5'Flank			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	764	PLAT 6. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GTTAGGTAGACGTTAGCATCA	0.547																																						dbGAP											0													164.0	141.0	148.0					18																	44139503		692	1591	2283	-	-	-	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2290G>A	18.37:g.44139503C>T	ENSP00000381707:p.Val764Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	p.V1042I	ENST00000398722.4	37	c.3124		18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.106439|5.106439	0.94292|0.94292	.|.	.|.	ENSG00000167210|ENSG00000167210	ENST00000441551|ENST00000398722;ENST00000536736;ENST00000335730	.|T;T	.|0.27402	.|1.67;1.67	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.56108|0.56108	0.1963|0.1963	M|M	0.72624|0.72624	2.21|2.21	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.995	.|D;D	.|0.74348	.|0.961;0.983	T|T	0.54423|0.54423	-0.8296|-0.8296	5|10	.|0.41790	.|T	.|0.15	.|.	18.899|18.899	0.92434|0.92434	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1042;764	.|F5GZB4;Q8IVV2-2	.|.;.	H|I	1022|764;1042;764	.|ENSP00000381707:V764I;ENSP00000444586:V1042I	.|ENSP00000338222:V764I	R|V	-|-	2|1	0|0	LOXHD1|LOXHD1	42393501|42393501	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.876000|0.876000	0.50452|0.50452	7.759000|7.759000	0.85235|0.85235	2.460000|2.460000	0.83146|0.83146	0.448000|0.448000	0.29417|0.29417	CGT|GTC	LOXHD1	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	ENSG00000167210		0.547	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		76	0.00	0	C	NM_144612		44139503	44139503	-1	no_errors	ENST00000536736	ensembl	human	known	69_37n	missense	39	23.08	12	SNP	1.000	T
LPHN3	23284	genome.wustl.edu	37	4	62813942	62813942	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr4:62813942C>T	ENST00000514591.1	+	16	2878	c.2549C>T	c.(2548-2550)tCt>tTt	p.S850F	LPHN3_ENST00000511324.1_Missense_Mutation_p.S918F|LPHN3_ENST00000508946.1_Missense_Mutation_p.S850F|LPHN3_ENST00000507164.1_Missense_Mutation_p.S918F|LPHN3_ENST00000508693.1_Missense_Mutation_p.S918F|LPHN3_ENST00000512091.2_Missense_Mutation_p.S850F|LPHN3_ENST00000506700.1_Missense_Mutation_p.S850F|LPHN3_ENST00000514157.1_Missense_Mutation_p.S850F|LPHN3_ENST00000514996.1_Missense_Mutation_p.S850F|LPHN3_ENST00000506720.1_Missense_Mutation_p.S918F|LPHN3_ENST00000545650.1_Missense_Mutation_p.S850F|LPHN3_ENST00000509896.1_Missense_Mutation_p.S918F|LPHN3_ENST00000506746.1_Missense_Mutation_p.S918F|LPHN3_ENST00000507625.1_Missense_Mutation_p.S918F|LPHN3_ENST00000504896.1_Missense_Mutation_p.S850F			Q9HAR2	LPHN3_HUMAN	latrophilin 3	837	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						ACTACATGCTCTTGTAACCAC	0.373																																						dbGAP											0													112.0	102.0	105.0					4																	62813942		1916	4138	6054	-	-	-	SO:0001583	missense	0			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2549C>T	4.37:g.62813942C>T	ENSP00000422533:p.Ser850Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like	p.S918F	ENST00000514591.1	37	c.2753	CCDS54768.1	4	.	.	.	.	.	.	.	.	.	.	C	28.3	4.905432	0.92107	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	5.79	5.79	0.91817	GPS domain (3);	0.000000	0.85682	D	0.000000	D	0.84106	0.5399	M	0.66506	2.035	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.998;0.998;0.996	D	0.84666	0.0709	10	0.87932	D	0	.	20.0361	0.97558	0.0:1.0:0.0:0.0	.	850;837;850	E9PE04;Q9HAR2;Q9HAR2-2	.;LPHN3_HUMAN;.	F	850;850;918;918;850;850;837;850;918;918;918;850;850;850;918;918;850	ENSP00000423388:S850F;ENSP00000422533:S850F;ENSP00000423787:S918F;ENSP00000425033:S918F;ENSP00000424120:S850F;ENSP00000439831:S850F;ENSP00000421476:S918F;ENSP00000424030:S918F;ENSP00000421372:S918F;ENSP00000425201:S850F;ENSP00000423434:S850F;ENSP00000421627:S850F;ENSP00000420931:S918F;ENSP00000425884:S918F;ENSP00000424258:S850F	ENSP00000280009:S850F	S	+	2	0	LPHN3	62496537	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.818000	0.86416	2.740000	0.93945	0.563000	0.77884	TCT	LPHN3	-	pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom	ENSG00000150471		0.373	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPHN3	HGNC	protein_coding	OTTHUMT00000361765.1	71	0.00	0	C			62813942	62813942	+1	no_errors	ENST00000507625	ensembl	human	known	69_37n	missense	52	32.47	25	SNP	1.000	T
LRRC30	339291	genome.wustl.edu	37	18	7231524	7231524	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr18:7231524A>G	ENST00000383467.2	+	1	402	c.388A>G	c.(388-390)Aca>Gca	p.T130A		NM_001105581.1	NP_001099051.1	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	130										central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						GAACTGCCTGACAGAGGTGCC	0.602																																						dbGAP											0													37.0	43.0	41.0					18																	7231524		2039	4200	6239	-	-	-	SO:0001583	missense	0				CCDS42409.1	18p11.23	2005-01-06				ENSG00000206422			30219	protein-coding gene	gene with protein product							Standard	NM_001105581		Approved		uc010wzk.2	A6NM36		ENST00000383467.2:c.388A>G	18.37:g.7231524A>G	ENSP00000372959:p.Thr130Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.T130A	ENST00000383467.2	37	c.388	CCDS42409.1	18	.	.	.	.	.	.	.	.	.	.	A	11.93	1.785879	0.31593	.	.	ENSG00000206422	ENST00000383467	T	0.27402	1.67	5.65	1.07	0.20283	.	0.510812	0.23600	N	0.046445	T	0.26702	0.0653	M	0.63843	1.955	0.28172	N	0.928529	B	0.02656	0.0	B	0.04013	0.001	T	0.20907	-1.0261	10	0.26408	T	0.33	.	8.9716	0.35910	0.6545:0.0:0.3455:0.0	.	130	A6NM36	LRC30_HUMAN	A	130	ENSP00000372959:T130A	ENSP00000372959:T130A	T	+	1	0	LRRC30	7221524	0.989000	0.36119	0.669000	0.29828	0.943000	0.58893	2.852000	0.48310	0.012000	0.14892	-0.297000	0.09499	ACA	LRRC30	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000206422		0.602	LRRC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC30	HGNC	protein_coding	OTTHUMT00000442140.1	21	0.00	0	A	XM_292678		7231524	7231524	+1	no_errors	ENST00000383467	ensembl	human	known	69_37n	missense	20	33.33	10	SNP	0.856	G
LSM11	134353	genome.wustl.edu	37	5	157182096	157182096	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:157182096C>T	ENST00000286307.5	+	4	963	c.907C>T	c.(907-909)Cgg>Tgg	p.R303W		NM_173491.2	NP_775762.1	P83369	LSM11_HUMAN	LSM11, U7 small nuclear RNA associated	303					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	histone pre-mRNA 3'end processing complex (GO:0071204)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U7 snRNP (GO:0005683)	U7 snRNA binding (GO:0071209)			breast(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	7	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAGGACTACACGGACAGACGG	0.592																																						dbGAP											0													70.0	68.0	69.0					5																	157182096		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095592	CCDS4342.1	5q33.3	2008-02-05	2004-04-28		ENSG00000155858	ENSG00000155858			30860	protein-coding gene	gene with protein product			"""LSM11 homolog, U7 small nuclear RNA associated (S. cerevisiae)"""			12975319	Standard	NM_173491		Approved	FLJ38273	uc003lxe.1	P83369	OTTHUMG00000130255	ENST00000286307.5:c.907C>T	5.37:g.157182096C>T	ENSP00000286307:p.Arg303Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVQ1|Q7Z7P0|Q8N975	Missense_Mutation	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.R303W	ENST00000286307.5	37	c.907	CCDS4342.1	5	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062001	0.76187	.	.	ENSG00000155858	ENST00000286307	.	.	.	5.52	3.69	0.42338	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.466924	0.21227	N	0.078054	T	0.24736	0.0600	N	0.19112	0.55	0.35667	D	0.812978	D	0.56968	0.978	B	0.36504	0.226	T	0.32214	-0.9915	9	0.87932	D	0	-1.0451	10.9975	0.47585	0.1459:0.714:0.1401:0.0	.	303	P83369	LSM11_HUMAN	W	303	.	ENSP00000286307:R303W	R	+	1	2	LSM11	157114674	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	2.920000	0.48844	0.650000	0.30769	0.655000	0.94253	CGG	LSM11	-	superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	ENSG00000155858		0.592	LSM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM11	HGNC	protein_coding	OTTHUMT00000252580.2	35	0.00	0	C	NM_173491		157182096	157182096	+1	no_errors	ENST00000286307	ensembl	human	known	69_37n	missense	26	35.00	14	SNP	0.997	T
MAN2B2	23324	genome.wustl.edu	37	4	6578364	6578364	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr4:6578364C>T	ENST00000285599.3	+	2	234	c.198C>T	c.(196-198)cgC>cgT	p.R66R	MAN2B2_ENST00000504248.1_Silent_p.R66R	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	66					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						AGCTGGCCCGCGGCCAGCAGC	0.627																																						dbGAP											0													59.0	62.0	61.0					4																	6578364		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.198C>T	4.37:g.6578364C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q66MP2|Q86T67	Missense_Mutation	SNP	pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.A65V	ENST00000285599.3	37	c.194	CCDS33951.1	4	.	.	.	.	.	.	.	.	.	.	C	2.107	-0.404625	0.04832	.	.	ENSG00000013288	ENST00000505907	.	.	.	3.89	-7.79	0.01218	.	.	.	.	.	T	0.15089	0.0364	.	.	.	0.24537	N	0.994085	.	.	.	.	.	.	T	0.20840	-1.0263	4	.	.	.	-9.2647	1.1794	0.01842	0.3625:0.1625:0.0955:0.3796	.	.	.	.	V	65	.	.	A	+	2	0	MAN2B2	6629265	0.000000	0.05858	0.000000	0.03702	0.101000	0.19017	0.329000	0.19698	-1.711000	0.01395	-1.056000	0.02311	GCG	MAN2B2	-	pfam_Glyco_hydro_38_core,superfamily_Glyco_hydro/deAcase_b/a-brl	ENSG00000013288		0.627	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2B2	HGNC	protein_coding	OTTHUMT00000359106.2	28	0.00	0	C	NM_015274		6578364	6578364	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000505907	ensembl	human	known	69_37n	missense	8	55.56	10	SNP	0.020	T
MAP2K4	6416	genome.wustl.edu	37	17	12011109	12011109	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:12011109delT	ENST00000353533.5	+	5	579	c.516delT	c.(514-516)ggtfs	p.G172fs	MAP2K4_ENST00000581941.1_3'UTR|MAP2K4_ENST00000415385.3_Frame_Shift_Del_p.G183fs	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	172	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.D173fs*1(1)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		TTTTATAGGGTGACTGTTGGA	0.284			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																	dbGAP		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	12	Whole gene deletion(10)|Insertion - Frameshift(1)|Unknown(1)	breast(5)|ovary(4)|biliary_tract(1)|large_intestine(1)|pancreas(1)											130.0	140.0	137.0					17																	12011109		2203	4297	6500	-	-	-	SO:0001589	frameshift_variant	0			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.516delT	17.37:g.12011109delT	ENSP00000262445:p.Gly172fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D184fs	ENST00000353533.5	37	c.549	CCDS11162.1	17																																																																																			MAP2K4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000065559		0.284	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP2K4	HGNC	protein_coding	OTTHUMT00000441226.1	98	0.00	0	T			12011109	12011109	+1	no_errors	ENST00000415385	ensembl	human	known	69_37n	frame_shift_del	37	48.10	38	DEL	1.000	-
MARCH5	54708	genome.wustl.edu	37	10	94109244	94109244	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr10:94109244C>T	ENST00000358935.2	+	4	840	c.508C>T	c.(508-510)Cgc>Tgc	p.R170C	MARCH5_ENST00000467521.2_3'UTR	NM_017824.4	NP_060294.1	Q9NX47	MARH5_HUMAN	membrane-associated ring finger (C3HC4) 5	170					negative regulation of cell aging (GO:0090344)|positive regulation of mitochondrial fission (GO:0090141)|protein autoubiquitination (GO:0051865)|protein localization to mitochondrion (GO:0070585)|protein polyubiquitination (GO:0000209)|regulation of mitochondrial fission (GO:0090140)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	GTPase binding (GO:0051020)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						TAGACTGTGGCGCAAATACTC	0.373																																						dbGAP											0													141.0	140.0	140.0					10																	94109244		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015480	CCDS7420.1	10q23.32-q23.33	2013-01-09	2005-01-26	2005-01-27	ENSG00000198060	ENSG00000198060		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26025	protein-coding gene	gene with protein product		610637	"""ring finger protein 153"""	RNF153		14722266	Standard	XM_005269923		Approved	FLJ20445, MARCH-V	uc001khx.1	Q9NX47	OTTHUMG00000018757	ENST00000358935.2:c.508C>T	10.37:g.94109244C>T	ENSP00000351813:p.Arg170Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.R170C	ENST00000358935.2	37	c.508	CCDS7420.1	10	.	.	.	.	.	.	.	.	.	.	C	24.8	4.571016	0.86542	.	.	ENSG00000198060	ENST00000358935	T	0.52057	0.68	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.70518	0.3233	M	0.77616	2.38	0.80722	D	1	D	0.76494	0.999	D	0.63488	0.915	T	0.71948	-0.4438	10	0.87932	D	0	-4.7559	20.5407	0.99260	0.0:1.0:0.0:0.0	.	170	Q9NX47	MARH5_HUMAN	C	170	ENSP00000351813:R170C	ENSP00000351813:R170C	R	+	1	0	MARCH5	94099224	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.026000	0.57232	2.865000	0.98341	0.655000	0.94253	CGC	MARCH5	-	NULL	ENSG00000198060		0.373	MARCH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH5	HGNC	protein_coding	OTTHUMT00000049388.1	66	0.00	0	C	NM_017824		94109244	94109244	+1	no_errors	ENST00000358935	ensembl	human	known	69_37n	missense	68	25.27	23	SNP	1.000	T
MC4R	4160	genome.wustl.edu	37	18	58039219	58039219	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr18:58039219C>T	ENST00000299766.3	-	1	782	c.364G>A	c.(364-366)Gat>Aat	p.D122N		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	122					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				ATGACATTATCAATATTCACT	0.423																																						dbGAP											0													101.0	90.0	94.0					18																	58039219		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.364G>A	18.37:g.58039219C>T	ENSP00000299766:p.Asp122Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAC3|Q16317|Q3MIJ6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Melcrt_ACTH_rcpt,prints_Mcort_rcpt_4,prints_7TM_GPCR_Rhodpsn,prints_Melancort_rcpt,prints_Cnbnoid_rcpt	p.D122N	ENST00000299766.3	37	c.364	CCDS11976.1	18	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808007	0.90707	.	.	ENSG00000166603	ENST00000299766	T	0.37058	1.22	5.71	5.71	0.89125	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.69735	0.3144	M	0.92784	3.345	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.77151	-0.2693	10	0.87932	D	0	.	17.3495	0.87320	0.0:1.0:0.0:0.0	.	122	P32245	MC4R_HUMAN	N	122	ENSP00000299766:D122N	ENSP00000299766:D122N	D	-	1	0	MC4R	56190199	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.818000	0.86416	2.707000	0.92482	0.655000	0.94253	GAT	MC4R	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Melcrt_ACTH_rcpt	ENSG00000166603		0.423	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC4R	HGNC	protein_coding	OTTHUMT00000256139.1	24	0.00	0	C	NM_005912		58039219	58039219	-1	no_errors	ENST00000299766	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	1.000	T
MED25	81857	genome.wustl.edu	37	19	50335233	50335233	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:50335233C>T	ENST00000312865.6	+	11	1324	c.1271C>T	c.(1270-1272)aCg>aTg	p.T424M	MED25_ENST00000538643.1_Missense_Mutation_p.T211M	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	424	Interaction with CREBBP.|Interaction with VP16.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		ACCAAGCTGACGCGGTCACTG	0.597																																					GBM(51;894 1657 37868)	dbGAP											0													100.0	84.0	89.0					19																	50335233		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.1271C>T	19.37:g.50335233C>T	ENSP00000326767:p.Thr424Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Missense_Mutation	SNP	pfam_Mediator_Med25_VWA,pfam_Mediator_Med25,pfam_Mediator_Med25_SD1,pfam_Mediator_Med25_NR-box	p.T424M	ENST00000312865.6	37	c.1271	CCDS33075.1	19	.	.	.	.	.	.	.	.	.	.	C	19.06	3.753685	0.69648	.	.	ENSG00000104973	ENST00000355584;ENST00000377077;ENST00000312881;ENST00000312865;ENST00000456294;ENST00000538643;ENST00000377070	T;T	0.80304	-1.35;-1.36	5.08	4.04	0.47022	Mediator complex, subunit Med25, PTOV activation and synapsin 2 (1);	0.050310	0.85682	D	0.000000	D	0.86053	0.5841	L	0.55990	1.75	0.44668	D	0.997659	D;P;P	0.76494	0.999;0.884;0.897	D;B;B	0.74674	0.984;0.372;0.276	D	0.86721	0.1942	10	0.72032	D	0.01	.	12.4485	0.55666	0.0:0.9171:0.0:0.0829	.	211;424;424	B9TX30;B5ME50;Q71SY5	.;.;MED25_HUMAN	M	424;424;424;424;424;211;159	ENSP00000326767:T424M;ENSP00000437496:T211M	ENSP00000326767:T424M	T	+	2	0	MED25	55027045	1.000000	0.71417	0.821000	0.32701	0.993000	0.82548	4.756000	0.62205	1.144000	0.42321	0.561000	0.74099	ACG	MED25	-	pfam_Mediator_Med25	ENSG00000104973		0.597	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED25	HGNC	protein_coding	OTTHUMT00000465316.1	56	0.00	0	C	NM_030973		50335233	50335233	+1	no_errors	ENST00000312865	ensembl	human	known	69_37n	missense	51	16.39	10	SNP	0.997	T
MEF2D	4209	genome.wustl.edu	37	1	156437437	156437437	+	Nonstop_Mutation	SNP	T	T	C			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:156437437T>C	ENST00000348159.4	-	12	2046	c.1566A>G	c.(1564-1566)tgA>tgG	p.*522W	MEF2D_ENST00000340875.5_Nonstop_Mutation_p.*521W|MEF2D_ENST00000360595.3_Nonstop_Mutation_p.*515W|MEF2D_ENST00000368240.2_Nonstop_Mutation_p.*515W|MEF2D_ENST00000353795.3_Nonstop_Mutation_p.*476W|MEF2D_ENST00000464356.2_Nonstop_Mutation_p.*514W	NM_005920.2	NP_005911.1	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	0					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|chondrocyte differentiation (GO:0002062)|endochondral ossification (GO:0001958)|muscle organ development (GO:0007517)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|histone deacetylase binding (GO:0042826)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	15	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTGGGAATCGTCACTTTAATG	0.627																																						dbGAP											0													59.0	56.0	57.0					1																	156437437		2203	4300	6503	-	-	-	SO:0001578	stop_lost	0			BC054520	CCDS1143.1, CCDS60304.1	1q12-q23	2008-02-05	2007-04-24		ENSG00000116604	ENSG00000116604		"""Myocyte enhancer factors"""	6997	protein-coding gene	gene with protein product		600663				8269842	Standard	NM_005920		Approved		uc001fpb.4	Q14814	OTTHUMG00000033095	ENST00000348159.4:c.1566A>G	1.37:g.156437437T>C	ENSP00000271555:p.*522Cysext*11	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVC0|Q14815|Q5T9U5|Q5T9U6	Nonstop_Mutation	SNP	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.*522W	ENST00000348159.4	37	c.1566	CCDS1143.1	1	.	.	.	.	.	.	.	.	.	.	T	13.02	2.111549	0.37242	.	.	ENSG00000116604	ENST00000348159;ENST00000340875;ENST00000368240;ENST00000353795;ENST00000360595	.	.	.	4.08	4.08	0.47627	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.4156	0.38519	0.0:0.0:0.0:1.0	.	.	.	.	W	522;521;515;476;515	.	.	X	-	3	0	MEF2D	154704061	0.999000	0.42202	0.998000	0.56505	0.983000	0.72400	2.533000	0.45667	1.734000	0.51633	0.363000	0.22086	TGA	MEF2D	-	NULL	ENSG00000116604		0.627	MEF2D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MEF2D	HGNC	protein_coding	OTTHUMT00000080562.2	43	0.00	0	T	NM_005920		156437437	156437437	-1	no_errors	ENST00000348159	ensembl	human	known	69_37n	nonstop	40	13.04	6	SNP	0.995	C
MKL2	57496	genome.wustl.edu	37	16	14354864	14354864	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr16:14354864C>T	ENST00000341243.5	+	15	2830	c.2830C>T	c.(2830-2832)Cgg>Tgg	p.R944W	MKL2_ENST00000318282.5_Missense_Mutation_p.R905W|MKL2_ENST00000574045.1_Missense_Mutation_p.R905W|MKL2_ENST00000571589.1_Missense_Mutation_p.R955W			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	944					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						AGTGGTGTCCCGGCCACCACC	0.483																																						dbGAP											0													105.0	111.0	109.0					16																	14354864		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.2830C>T	16.37:g.14354864C>T	ENSP00000345841:p.Arg944Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_DNA-bd,smart_RPEL_repeat,smart_SAP_DNA-bd,pfscan_RPEL_repeat,pfscan_SAP_DNA-bd	p.R944W	ENST00000341243.5	37	c.2830		16	.	.	.	.	.	.	.	.	.	.	C	19.96	3.922748	0.73213	.	.	ENSG00000186260	ENST00000318282;ENST00000341243	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.76849	0.4045	M	0.68952	2.095	0.52099	D	0.999947	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.78585	-0.2147	9	0.87932	D	0	-30.3244	13.6691	0.62414	0.1544:0.8456:0.0:0.0	.	955;905	B4DGT8;Q9ULH7-4	.;.	W	905;944	.	ENSP00000339086:R905W	R	+	1	2	MKL2	14262365	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.557000	0.53741	2.674000	0.91012	0.591000	0.81541	CGG	MKL2	-	NULL	ENSG00000186260		0.483	MKL2-202	KNOWN	basic	protein_coding	MKL2	HGNC	protein_coding		55	0.00	0	C	NM_014048		14354864	14354864	+1	no_errors	ENST00000341243	ensembl	human	known	69_37n	missense	67	18.29	15	SNP	1.000	T
KMT2A	4297	genome.wustl.edu	37	11	118391565	118391565	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr11:118391565delA	ENST00000389506.5	+	34	11469	c.11469delA	c.(11467-11469)ttafs	p.L3823fs	RP11-770J1.3_ENST00000525992.2_RNA|RP11-770J1.3_ENST00000532597.1_RNA|RP11-770J1.3_ENST00000554407.1_RNA|KMT2A_ENST00000534358.1_Frame_Shift_Del_p.L3826fs|KMT2A_ENST00000354520.4_Frame_Shift_Del_p.L3785fs|RP11-770J1.3_ENST00000556583.1_RNA|RP11-770J1.3_ENST00000528578.1_RNA			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3823					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TCCGGCACTTAAAAAAGACTT	0.378																																						dbGAP											0													55.0	56.0	56.0					11																	118391565		2200	4295	6495	-	-	-	SO:0001589	frameshift_variant	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.11469delA	11.37:g.118391565delA	ENSP00000374157:p.Leu3823fs	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Del	DEL	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.K3825fs	ENST00000389506.5	37	c.11469	CCDS31686.1	11																																																																																			MLL	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.378	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	HGNC	protein_coding	OTTHUMT00000399085.2	31	0.00	0	A	NM_005933		118391565	118391565	+1	no_errors	ENST00000389506	ensembl	human	known	69_37n	frame_shift_del	31	20.51	8	DEL	0.996	-
MRPS18B	28973	genome.wustl.edu	37	6	30587733	30587733	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr6:30587733C>T	ENST00000259873.4	+	4	478	c.321C>T	c.(319-321)atC>atT	p.I107I	PPP1R10_ENST00000376511.2_5'Flank|MRPS18B_ENST00000472229.1_3'UTR|PPP1R10_ENST00000484449.1_5'Flank|MRPS18B_ENST00000506373.2_Silent_p.I107I	NM_014046.3	NP_054765.1	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B	107					translation (GO:0006412)	cell junction (GO:0030054)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(2)	13						CCTGCCCCATCTGTCGAGATC	0.443																																						dbGAP											0													195.0	196.0	196.0					6																	30587733		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100761	CCDS4682.1	6p21	2012-09-13			ENSG00000204568	ENSG00000204568		"""Mitochondrial ribosomal proteins / small subunits"""	14516	protein-coding gene	gene with protein product		611982				11279123	Standard	NM_014046		Approved	MRPS18-2, PTD017, C6orf14, HSPC183	uc003nqo.2	Q9Y676	OTTHUMG00000031268	ENST00000259873.4:c.321C>T	6.37:g.30587733C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ0|Q659G4|Q9BS27	Silent	SNP	pfam_Ribosomal_S18,superfamily_Ribosomal_S18	p.I107	ENST00000259873.4	37	c.321	CCDS4682.1	6																																																																																			MRPS18B	-	superfamily_Ribosomal_S18	ENSG00000204568		0.443	MRPS18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS18B	HGNC	protein_coding	OTTHUMT00000076584.2	111	0.00	0	C			30587733	30587733	+1	no_errors	ENST00000259873	ensembl	human	known	69_37n	silent	60	36.84	35	SNP	1.000	T
MRPS18C	51023	genome.wustl.edu	37	4	84377269	84377271	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	GAA	GAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr4:84377269_84377271delGAA	ENST00000295491.4	+	1	152_154	c.39_41delGAA	c.(37-42)aggaag>agg	p.K15del	MRPS18C_ENST00000507349.1_In_Frame_Del_p.K15del|HELQ_ENST00000295488.3_5'Flank|HELQ_ENST00000510985.1_5'Flank|HELQ_ENST00000440639.2_5'Flank|MRPS18C_ENST00000507019.1_In_Frame_Del_p.K15del	NM_016067.2	NP_057151.1	Q9Y3D5	RT18C_HUMAN	mitochondrial ribosomal protein S18C	15					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5		Hepatocellular(203;0.114)				GTCTAGGGAGGAAGAAGTTGACA	0.547																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS3604.1, CCDS75159.1	4q21.21-q21.23	2012-09-13			ENSG00000163319	ENSG00000163319		"""Mitochondrial ribosomal proteins / small subunits"""	16633	protein-coding gene	gene with protein product		611983				11279123, 10810093	Standard	XM_005263043		Approved	MRPS18-1, CGI-134, FLJ11146, FLJ22967	uc003hor.4	Q9Y3D5	OTTHUMG00000130430	ENST00000295491.4:c.39_41delGAA	4.37:g.84377272_84377274delGAA	ENSP00000295491:p.Lys15del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	pfam_Ribosomal_S18,superfamily_Ribosomal_S18,tigrfam_Ribosomal_S18	p.K15in_frame_del	ENST00000295491.4	37	c.39_41	CCDS3604.1	4																																																																																			MRPS18C	-	NULL	ENSG00000163319		0.547	MRPS18C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS18C	HGNC	protein_coding	OTTHUMT00000252820.2	43	0.00	0	GAA			84377269	84377271	+1	no_errors	ENST00000295491	ensembl	human	known	69_37n	in_frame_del	31	27.27	12	DEL	0.196:0.177:0.055	-
MSH2	4436	genome.wustl.edu	37	2	47702265	47702265	+	Nonsense_Mutation	SNP	C	C	T	rs63750508		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:47702265C>T	ENST00000233146.2	+	12	2084	c.1861C>T	c.(1861-1863)Cga>Tga	p.R621*	MSH2_ENST00000406134.1_Nonsense_Mutation_p.R621*|MSH2_ENST00000543555.1_Nonsense_Mutation_p.R555*	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	621	Interaction with EXO1.				ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(2)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TCCATATGTACGACCAGCCAT	0.403			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													dbGAP	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	4	Whole gene deletion(2)|Unknown(2)	haematopoietic_and_lymphoid_tissue(3)|prostate(1)	GRCh37	CM960990	MSH2	M	rs63750508						141.0	128.0	132.0					2																	47702265		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.1861C>T	2.37:g.47702265C>T	ENSP00000233146:p.Arg621*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2Z2|O75488	Nonsense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_connt,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_connt,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_MSH2	p.R621*	ENST00000233146.2	37	c.1861	CCDS1834.1	2	.	.	.	.	.	.	.	.	.	.	C	39	7.486155	0.98312	.	.	ENSG00000095002	ENST00000233146;ENST00000543555;ENST00000406134;ENST00000419559;ENST00000413880	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.0681	19.6426	0.95764	0.0:1.0:0.0:0.0	rs63750508	.	.	.	X	621;555;621;621;407	.	ENSP00000233146:R621X	R	+	1	2	MSH2	47555769	0.998000	0.40836	0.997000	0.53966	0.925000	0.55904	4.088000	0.57678	2.650000	0.89964	0.655000	0.94253	CGA	MSH2	-	pfam_DNA_mismatch_repair_MutS_C,smart_DNA_mismatch_repair_MutS_core,pirsf_DNA_mismatch_repair_MSH2	ENSG00000095002		0.403	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH2	HGNC	protein_coding	OTTHUMT00000250805.3	48	0.00	0	C			47702265	47702265	+1	no_errors	ENST00000233146	ensembl	human	known	69_37n	nonsense	18	60.87	28	SNP	1.000	T
MT1M	4499	genome.wustl.edu	37	16	56667262	56667262	+	Silent	SNP	C	C	T	rs199506795		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr16:56667262C>T	ENST00000379818.3	+	2	538	c.39C>T	c.(37-39)tgC>tgT	p.C13C	MT1JP_ENST00000564564.1_RNA|AC026461.1_ENST00000600389.1_5'Flank	NM_176870.2	NP_789846.1	Q8N339	MT1M_HUMAN	metallothionein 1M	13	Beta.				cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	5						GTGTCTCCTGCGCCTGCACCG	0.562																																						dbGAP											0													105.0	106.0	106.0					16																	56667262		2196	4300	6496	-	-	-	SO:0001819	synonymous_variant	0			AF136177	CCDS42166.1	16q13	2008-02-05				ENSG00000205364		"""Metallothioneins"""	14296	protein-coding gene	gene with protein product		156357	"""metallothionein 1K"""	MT1, MT1K		2286373, 8049263	Standard	NM_176870		Approved		uc002ejn.3	Q8N339		ENST00000379818.3:c.39C>T	16.37:g.56667262C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TDN3	Silent	SNP	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom,prints_Metalthion_vert	p.C13	ENST00000379818.3	37	c.39	CCDS42166.1	16																																																																																			MT1M	-	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom,prints_Metalthion_vert	ENSG00000205364		0.562	MT1M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MT1M	HGNC	protein_coding	OTTHUMT00000434359.1	91	0.00	0	C	NM_176870		56667262	56667262	+1	no_errors	ENST00000379818	ensembl	human	known	69_37n	silent	49	31.51	23	SNP	0.528	T
MTG1	92170	genome.wustl.edu	37	10	135233665	135233665	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr10:135233665C>A	ENST00000317502.6	+	11	1051	c.1001C>A	c.(1000-1002)cCc>cAc	p.P334H	MTG1_ENST00000477902.2_Missense_Mutation_p.P293H|RP11-108K14.8_ENST00000468317.2_Missense_Mutation_p.P339H	NM_138384.2	NP_612393.2	Q9BT17	MTG1_HUMAN	mitochondrial ribosome-associated GTPase 1	334					GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		GAGACTTTGCCCTGAACTTGT	0.662																																						dbGAP											0													50.0	51.0	50.0					10																	135233665		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31320.1	10q26.3	2013-05-24	2013-05-24	2006-01-09	ENSG00000148824	ENSG00000148824			32159	protein-coding gene	gene with protein product			"""GTP-binding protein 7"", ""GTP-binding protein 7 (putative)"", ""mitochondrial GTPase 1 homolog (S. cerevisiae)"""	GTPBP7		12808030, 23396448	Standard	NM_138384		Approved		uc001lnd.3	Q9BT17	OTTHUMG00000166564	ENST00000317502.6:c.1001C>A	10.37:g.135233665C>A	ENSP00000323047:p.Pro334His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWX8|Q6PIY9|Q8IYJ4|Q8NC48|Q9BVU8	Missense_Mutation	SNP	pfam_GTP_binding_domain,pirsf_GTPase_MTG1,tigrfam_GTP-bd_ribosome_bgen_YlqF	p.P334H	ENST00000317502.6	37	c.1001	CCDS31320.1	10	.	.	.	.	.	.	.	.	.	.	C	15.42	2.826850	0.50739	.	.	ENSG00000254536;ENSG00000148824;ENSG00000148824	ENST00000468317;ENST00000317502;ENST00000432508	T;T;T	0.45276	1.35;1.52;0.9	4.25	1.35	0.21983	.	.	.	.	.	T	0.28962	0.0719	N	0.08118	0	0.09310	N	1	D;P	0.58268	0.982;0.855	P;B	0.50378	0.639;0.258	T	0.13072	-1.0523	9	0.87932	D	0	-16.5413	6.6767	0.23098	0.0:0.7197:0.0:0.2803	.	283;334	E7EVK2;Q9BT17	.;MTG1_HUMAN	H	339;334;283	ENSP00000436767:P339H;ENSP00000323047:P334H;ENSP00000393480:P283H	ENSP00000323047:P334H	P	+	2	0	AL360181.1;MTG1	135083655	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.148000	0.16224	0.174000	0.19809	0.579000	0.79373	CCC	MTG1	-	NULL	ENSG00000148824		0.662	MTG1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	MTG1	Clone_based_vega_gene	protein_coding	OTTHUMT00000051166.1	16	0.00	0	C	NM_138384		135233665	135233665	+1	no_errors	ENST00000317502	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.001	A
MUC12	10071	genome.wustl.edu	37	7	100641744	100641744	+	Missense_Mutation	SNP	C	C	T	rs200229903	byFrequency	TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr7:100641744C>T	ENST00000379442.3	+	5	8329	c.8329C>T	c.(8329-8331)Cgc>Tgc	p.R2777C	MUC12_ENST00000536621.1_Missense_Mutation_p.R2634C			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	2777	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TACAACCTCACGCATCAGTCC	0.512																																						dbGAP											0													1.0	1.0	1.0					7																	100641744		260	658	918	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.8329C>T	7.37:g.100641744C>T	ENSP00000368755:p.Arg2777Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.R2777C	ENST00000379442.3	37	c.8329		7	.	.	.	.	.	.	.	.	.	.	c	4.609	0.113111	0.08831	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.13901	2.55;2.55	0.704	-1.11	0.09840	.	.	.	.	.	T	0.06416	0.0165	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.36792	-0.9733	6	0.49607	T	0.09	.	.	.	.	.	.	.	.	C	2777;2634	ENSP00000368755:R2777C;ENSP00000441929:R2634C	ENSP00000368755:R2777C	R	+	1	0	MUC12	100428464	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	1.334000	0.33827	-0.301000	0.08882	0.173000	0.16961	CGC	MUC12	-	NULL	ENSG00000205277		0.512	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	14	0.00	0	C	XM_379904		100641744	100641744	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	0.000	T
MYH3	4621	genome.wustl.edu	37	17	10544483	10544483	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:10544483C>T	ENST00000583535.1	-	19	2171	c.2084G>A	c.(2083-2085)cGg>cAg	p.R695Q	MYH3_ENST00000226209.7_Missense_Mutation_p.R695Q	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	695	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						ACCGTTACACCGCAGCTGGTG	0.483																																						dbGAP											0													91.0	84.0	86.0					17																	10544483		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.2084G>A	17.37:g.10544483C>T	ENSP00000464317:p.Arg695Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15492	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.R695Q	ENST00000583535.1	37	c.2084	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	C	23.0	4.358068	0.82243	.	.	ENSG00000109063	ENST00000226209	D	0.87412	-2.25	5.87	5.87	0.94306	Myosin head, motor domain (2);	.	.	.	.	D	0.90065	0.6897	M	0.90977	3.165	0.46203	D	0.998929	B	0.33299	0.407	B	0.25405	0.06	D	0.89592	0.3828	9	0.59425	D	0.04	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	695	P11055	MYH3_HUMAN	Q	695	ENSP00000226209:R695Q	ENSP00000226209:R695Q	R	-	2	0	MYH3	10485208	0.862000	0.29867	0.851000	0.33527	0.477000	0.33069	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	CGG	MYH3	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000109063		0.483	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	HGNC	protein_coding	OTTHUMT00000252734.2	51	0.00	0	C	NM_002470		10544483	10544483	-1	no_errors	ENST00000226209	ensembl	human	known	69_37n	missense	32	31.91	15	SNP	0.988	T
MYO18A	399687	genome.wustl.edu	37	17	27420379	27420379	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:27420379G>A	ENST00000527372.1	-	32	5068	c.4888C>T	c.(4888-4890)Cgg>Tgg	p.R1630W	MYO18A_ENST00000531253.1_Missense_Mutation_p.R1630W|MYO18A_ENST00000533112.1_Missense_Mutation_p.R1593W|TIAF1_ENST00000408971.2_5'Flank|MYO18A_ENST00000529578.1_5'Flank|MYO18A_ENST00000354329.4_Missense_Mutation_p.R1630W	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1630					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TCCAGCTCCCGCTTCTCTCGC	0.622																																					Esophageal Squamous(182;472 2015 7001 15270 22562)	dbGAP											0													72.0	77.0	75.0					17																	27420379		2117	4220	6337	-	-	-	SO:0001583	missense	0			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.4888C>T	17.37:g.27420379G>A	ENSP00000437073:p.Arg1630Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_PDZ,superfamily_PDZ,superfamily_Regulat_G_prot_signal_superfam,smart_PDZ,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_PDZ,pfscan_RecA_monomer-monomer_interface,prints_Myosin_head_motor_dom	p.R1630W	ENST00000527372.1	37	c.4888	CCDS45642.1	17	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952818	0.73787	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428	T;D;T;T	0.89343	-1.19;-2.5;-1.19;-1.19	4.54	2.35	0.29111	Myosin tail (1);	0.046487	0.85682	D	0.000000	D	0.92841	0.7723	M	0.69823	2.125	0.38489	D	0.947938	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.971;0.992;0.984;0.997	D	0.93522	0.6862	10	0.66056	D	0.02	.	12.1308	0.53942	0.0:0.0:0.5555:0.4444	.	1233;1593;1630;1630	F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;MY18A_HUMAN	W	1630;1593;1593;1630;1630;526;526;1233	ENSP00000346291:R1630W;ENSP00000435932:R1593W;ENSP00000434228:R1630W;ENSP00000437073:R1630W	ENSP00000346291:R1630W	R	-	1	2	MYO18A	24444505	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.972000	0.49256	1.089000	0.41292	0.460000	0.39030	CGG	MYO18A	-	pfam_Myosin_tail	ENSG00000196535		0.622	MYO18A-001	KNOWN	basic|CCDS	protein_coding	MYO18A	HGNC	protein_coding	OTTHUMT00000389396.1	55	0.00	0	G	NM_078471		27420379	27420379	-1	no_errors	ENST00000354329	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	1.000	A
NIT2	56954	genome.wustl.edu	37	3	100058788	100058788	+	Intron	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:100058788C>T	ENST00000394140.4	+	3	338					NM_020202.4	NP_064587.1	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2						asparagine metabolic process (GO:0006528)|glutamine metabolic process (GO:0006541)|oxaloacetate metabolic process (GO:0006107)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	omega-amidase activity (GO:0050152)			breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)	17						AGGTAACTTCCTACCCACAAG	0.428																																						dbGAP											0													68.0	65.0	66.0					3																	100058788		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF284574	CCDS33806.1	3q12.3	2004-07-12			ENSG00000114021	ENSG00000114021			29878	protein-coding gene	gene with protein product						10959838	Standard	NM_020202		Approved		uc003dtv.3	Q9NQR4	OTTHUMG00000159066	ENST00000394140.4:c.247+9C>T	3.37:g.100058788C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9A3|D3DN47|Q8WUF0	Silent	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.L86	ENST00000394140.4	37	c.256	CCDS33806.1	3																																																																																			NIT2	-	pfscan_C-N_Hydrolase	ENSG00000114021		0.428	NIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIT2	HGNC	protein_coding	OTTHUMT00000353142.2	36	0.00	0	C	NM_020202		100058788	100058788	+1	no_errors	ENST00000480073	ensembl	human	known	69_37n	silent	24	33.33	12	SNP	0.826	T
NLRP2	55655	genome.wustl.edu	37	19	55494672	55494672	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:55494672C>T	ENST00000543010.1	+	6	1749	c.1606C>T	c.(1606-1608)Cag>Tag	p.Q536*	NLRP2_ENST00000537859.1_Nonsense_Mutation_p.Q514*|NLRP2_ENST00000339757.7_Nonsense_Mutation_p.Q514*|NLRP2_ENST00000427260.2_Nonsense_Mutation_p.Q513*|NLRP2_ENST00000448584.2_Nonsense_Mutation_p.Q536*|NLRP2_ENST00000263437.6_Nonsense_Mutation_p.Q533*|NLRP2_ENST00000538819.1_Nonsense_Mutation_p.Q512*|NLRP2_ENST00000391721.4_Nonsense_Mutation_p.Q512*	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	536					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TGGGGACGTACAGAAGCTGCT	0.557																																						dbGAP											0													91.0	84.0	86.0					19																	55494672		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.1606C>T	19.37:g.55494672C>T	ENSP00000445135:p.Gln536*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Nonsense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.Q536*	ENST00000543010.1	37	c.1606	CCDS12913.1	19	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622706	0.87460	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	.	.	.	1.79	0.696	0.18075	.	1.052800	0.07637	N	0.929640	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	6.0549	0.19807	0.0:0.6266:0.3734:0.0	.	.	.	.	X	536;512;514;536;514;513;512;533	.	ENSP00000263437:Q533X	Q	+	1	0	NLRP2	60186484	0.001000	0.12720	0.001000	0.08648	0.048000	0.14542	0.624000	0.24462	0.314000	0.23086	0.561000	0.74099	CAG	NLRP2	-	NULL	ENSG00000022556		0.557	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	HGNC	protein_coding	OTTHUMT00000396152.1	34	0.00	0	C	NM_017852		55494672	55494672	+1	no_errors	ENST00000448584	ensembl	human	known	69_37n	nonsense	31	13.89	5	SNP	0.001	T
NOS2	4843	genome.wustl.edu	37	17	26107923	26107923	+	Missense_Mutation	SNP	C	C	T	rs201644791		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:26107923C>T	ENST00000313735.6	-	9	1107	c.874G>A	c.(874-876)Gac>Aac	p.D292N		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	292					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	CAGCCCAGGTCGATGCACAGC	0.642																																						dbGAP											0													49.0	49.0	49.0					17																	26107923		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.874G>A	17.37:g.26107923C>T	ENSP00000327251:p.Asp292Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_met,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.D292N	ENST00000313735.6	37	c.874	CCDS11223.1	17	.	.	.	.	.	.	.	.	.	.	C	21.0	4.077748	0.76528	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.22539	1.95	5.23	5.23	0.72850	Nitric oxide synthase, oxygenase domain (2);	0.213632	0.39834	N	0.001253	T	0.16514	0.0397	N	0.25647	0.755	0.38263	D	0.941923	B;P	0.45240	0.045;0.854	B;B	0.39935	0.006;0.314	T	0.05022	-1.0911	10	0.62326	D	0.03	.	13.5347	0.61641	0.0:0.8439:0.1561:0.0	.	292;292	F8WEM3;P35228	.;NOS2_HUMAN	N	292;267;292	ENSP00000327251:D292N	ENSP00000305638:D292N	D	-	1	0	NOS2	23132050	0.997000	0.39634	1.000000	0.80357	0.986000	0.74619	2.808000	0.47963	2.418000	0.82041	0.655000	0.94253	GAC	NOS2	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_met	ENSG00000007171		0.642	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS2	HGNC	protein_coding	OTTHUMT00000255597.1	23	0.00	0	C	NM_000625		26107923	26107923	-1	no_errors	ENST00000313735	ensembl	human	known	69_37n	missense	14	39.13	9	SNP	0.982	T
NUMA1	4926	genome.wustl.edu	37	11	71729889	71729889	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr11:71729889C>T	ENST00000393695.3	-	10	1053	c.722G>A	c.(721-723)cGc>cAc	p.R241H	RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000358965.6_Missense_Mutation_p.R241H|NUMA1_ENST00000351960.6_Missense_Mutation_p.R241H	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						GAGGAGCTTGCGGTTCTCAGC	0.562			T	RARA	APL																																	dbGAP		Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	0													107.0	99.0	102.0					11																	71729889		2200	4293	6493	-	-	-	SO:0001583	missense	0			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.722G>A	11.37:g.71729889C>T	ENSP00000377298:p.Arg241His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Prefoldin	p.R241H	ENST00000393695.3	37	c.722	CCDS31633.1	11	.	.	.	.	.	.	.	.	.	.	C	23.6	4.437832	0.83885	.	.	ENSG00000137497	ENST00000351960;ENST00000358965;ENST00000393695;ENST00000542977;ENST00000537217	T;T;T;T;T	0.47528	2.17;2.61;2.62;1.41;0.84	5.98	4.08	0.47627	.	0.224674	0.40469	N	0.001097	T	0.38374	0.1038	N	0.12182	0.205	0.21579	N	0.999638	D;B;B;B;D;B	0.71674	0.998;0.116;0.116;0.012;0.989;0.007	P;B;B;B;P;B	0.56278	0.795;0.025;0.025;0.003;0.674;0.003	T	0.15037	-1.0451	10	0.22706	T	0.39	.	7.9414	0.29961	0.1365:0.7229:0.0:0.1406	.	241;241;241;241;241;241	F5H6Y5;F5H4J1;A8K394;Q14980-2;Q14980;Q9BTE9	.;.;.;.;NUMA1_HUMAN;.	H	241	ENSP00000260051:R241H;ENSP00000351851:R241H;ENSP00000377298:R241H;ENSP00000444880:R241H;ENSP00000442936:R241H	ENSP00000260051:R241H	R	-	2	0	NUMA1	71407537	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.695000	0.37763	0.820000	0.34516	0.655000	0.94253	CGC	NUMA1	-	NULL	ENSG00000137497		0.562	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMA1	HGNC	protein_coding	OTTHUMT00000395769.1	48	0.00	0	C			71729889	71729889	-1	no_errors	ENST00000393695	ensembl	human	known	69_37n	missense	33	38.89	21	SNP	1.000	T
OBSCN	84033	genome.wustl.edu	37	1	228497221	228497221	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:228497221G>A	ENST00000422127.1	+	49	13017	c.12973G>A	c.(12973-12975)Gtg>Atg	p.V4325M	OBSCN_ENST00000570156.2_Missense_Mutation_p.V5282M|OBSCN_ENST00000366709.4_Missense_Mutation_p.V1444M|OBSCN_ENST00000284548.11_Missense_Mutation_p.V4325M|OBSCN_ENST00000366707.4_Missense_Mutation_p.V1959M	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4325	Ig-like 44.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGTTTCCACGTGGGCACGTG	0.612																																						dbGAP											0													69.0	73.0	72.0					1																	228497221		2055	4196	6251	-	-	-	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.12973G>A	1.37:g.228497221G>A	ENSP00000409493:p.Val4325Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.V4325M	ENST00000422127.1	37	c.12973	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614092	0.66672	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.05925	3.37;3.37;3.37;3.37	3.95	3.02	0.34903	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.263528	0.30658	N	0.009145	T	0.22044	0.0531	M	0.83012	2.62	0.39299	D	0.964875	D;D	0.89917	1.0;1.0	D;D	0.72982	0.979;0.923	T	0.04203	-1.0969	10	0.31617	T	0.26	.	9.7263	0.40333	0.1025:0.0:0.8975:0.0	.	4325;4325	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	M	4325;4325;1959;1444	ENSP00000284548:V4325M;ENSP00000409493:V4325M;ENSP00000355668:V1959M;ENSP00000355670:V1444M	ENSP00000284548:V4325M	V	+	1	0	OBSCN	226563844	1.000000	0.71417	0.992000	0.48379	0.524000	0.34500	3.759000	0.55227	1.242000	0.43836	0.561000	0.74099	GTG	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000154358		0.612	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		38	0.00	0	G	NM_052843		228497221	228497221	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	0.997	A
OPTN	10133	genome.wustl.edu	37	10	13169759	13169759	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr10:13169759C>T	ENST00000378748.3	+	13	1619	c.1257C>T	c.(1255-1257)gaC>gaT	p.D419D	OPTN_ENST00000263036.5_Silent_p.D419D|OPTN_ENST00000378752.3_Silent_p.D413D|OPTN_ENST00000378764.2_Silent_p.D413D|OPTN_ENST00000378747.3_Silent_p.D419D|OPTN_ENST00000378757.2_Silent_p.D419D	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	419	Interaction with HD.|Interaction with MYO6.				cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						AAAAAGTGGACAGGGCAGTGC	0.358																																						dbGAP											0													58.0	58.0	58.0					10																	13169759		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.1257C>T	10.37:g.13169759C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Silent	SNP	pfam_NEMO_N	p.D419	ENST00000378748.3	37	c.1257	CCDS7094.1	10																																																																																			OPTN	-	NULL	ENSG00000123240		0.358	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPTN	HGNC	protein_coding	OTTHUMT00000046834.1	35	0.00	0	C	NM_021980		13169759	13169759	+1	no_errors	ENST00000263036	ensembl	human	known	69_37n	silent	45	11.76	6	SNP	0.046	T
OR13C4	138804	genome.wustl.edu	37	9	107289169	107289169	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr9:107289169C>A	ENST00000277216.3	-	1	321	c.322G>T	c.(322-324)Ggg>Tgg	p.G108W		NM_001001919.1	NP_001001919.1	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C, member 4	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(2)|lung(14)|skin(1)	18						TCTGTTGACCCCATTGCAAAC	0.448																																						dbGAP											0													195.0	165.0	175.0					9																	107289169		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35088.1	9q31.1	2013-09-24			ENSG00000148136	ENSG00000148136		"""GPCR / Class A : Olfactory receptors"""	14722	protein-coding gene	gene with protein product							Standard	NM_001001919		Approved		uc011lvn.2	Q8NGS5	OTTHUMG00000020407	ENST00000277216.3:c.322G>T	9.37:g.107289169C>A	ENSP00000277216:p.Gly108Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF51|Q96R41	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.G108W	ENST00000277216.3	37	c.322	CCDS35088.1	9	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789922	0.70337	.	.	ENSG00000148136	ENST00000277216;ENST00000545903	T	0.01369	4.97	4.44	4.44	0.53790	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	U	0.000228	T	0.14227	0.0344	H	0.96398	3.815	0.39940	D	0.974405	D	0.89917	1.0	D	0.87578	0.998	T	0.05989	-1.0852	10	0.87932	D	0	.	14.9433	0.71012	0.0:1.0:0.0:0.0	.	108	Q8NGS5	O13C4_HUMAN	W	108;137	ENSP00000277216:G108W	ENSP00000277216:G108W	G	-	1	0	OR13C4	106328990	0.032000	0.19561	1.000000	0.80357	0.932000	0.56968	1.697000	0.37784	2.444000	0.82710	0.585000	0.79938	GGG	OR13C4	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000148136		0.448	OR13C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C4	HGNC	protein_coding	OTTHUMT00000053478.1	49	0.00	0	C			107289169	107289169	-1	no_errors	ENST00000277216	ensembl	human	known	69_37n	missense	44	42.11	32	SNP	1.000	A
OR2V1	26693	genome.wustl.edu	37	5	180551593	180551594	+	Frame_Shift_Ins	INS	-	-	T	rs151251398	byFrequency	TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:180551593_180551594insT	ENST00000329365.2	-	1	710_711	c.711_712insA	c.(709-714)aaagccfs	p.A238fs		NM_001258283.1	NP_001245212.1	Q8NHB1	OR2V1_HUMAN	olfactory receptor, family 2, subfamily V, member 1	238						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(4)	4						GTGGCCAGGGCTTTTTTCCAGG	0.579																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB065465	CCDS58992.1	5q35.3	2012-08-09		2004-03-10	ENSG00000185372	ENSG00000185372		"""GPCR / Class A : Olfactory receptors"""	8280	protein-coding gene	gene with protein product				OR2V1P			Standard	NM_001258283		Approved	OST265	uc031smg.1	Q8NHB1	OTTHUMG00000162118	ENST00000329365.2:c.712dupA	5.37:g.180551599_180551599dupT	ENSP00000404102:p.Ala238fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A237fs	ENST00000329365.2	37	c.712_711	CCDS58992.1	5																																																																																			OR2V1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000185372		0.579	OR2V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2V1	HGNC	protein_coding	OTTHUMT00000367367.1	44	0.00	0	-			180551593	180551594	-1	no_errors	ENST00000329365	ensembl	human	known	69_37n	frame_shift_ins	24	22.58	7	INS	1.000:1.000	T
OR4F6	390648	genome.wustl.edu	37	15	102345983	102345983	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr15:102345983C>T	ENST00000328882.4	+	1	82	c.61C>T	c.(61-63)Cgg>Tgg	p.R21W		NM_001005326.1	NP_001005326.1	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F, member 6	21						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R21W(1)		breast(1)|large_intestine(1)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			CTCTGACTCGCGGAAGATCCA	0.498																																						dbGAP											1	Substitution - Missense(1)	lung(1)											172.0	156.0	161.0					15																	102345983		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC025234	CCDS32341.1	15q26.3	2014-02-19	2002-02-28		ENSG00000184140	ENSG00000184140		"""GPCR / Class A : Olfactory receptors"""	15372	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily F, member 12"""	OR4F12			Standard	NM_001005326		Approved		uc010utr.2	Q8NGB9	OTTHUMG00000172267	ENST00000328882.4:c.61C>T	15.37:g.102345983C>T	ENSP00000327525:p.Arg21Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH28|Q6IF95	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R21W	ENST00000328882.4	37	c.61	CCDS32341.1	15	.	.	.	.	.	.	.	.	.	.	.	0	-2.731197	0.00089	.	.	ENSG00000184140	ENST00000328882	T	0.00012	9.32	4.68	0.821	0.18799	.	0.157021	0.30611	N	0.009242	T	0.00039	0.0001	N	0.05230	-0.09	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.41998	-0.9477	10	0.02654	T	1	.	2.7792	0.05356	0.3219:0.1803:0.0:0.4977	.	21	Q8NGB9	OR4F6_HUMAN	W	21	ENSP00000327525:R21W	ENSP00000327525:R21W	R	+	1	2	OR4F6	100163506	0.000000	0.05858	0.009000	0.14445	0.002000	0.02628	-0.331000	0.07914	0.019000	0.15079	-0.374000	0.07098	CGG	OR4F6	-	NULL	ENSG00000184140		0.498	OR4F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F6	HGNC	protein_coding	OTTHUMT00000417593.1	119	0.00	0	C			102345983	102345983	+1	no_errors	ENST00000328882	ensembl	human	known	69_37n	missense	133	22.22	38	SNP	0.006	T
PAPL	390928	genome.wustl.edu	37	19	39591673	39591673	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:39591673G>A	ENST00000331256.5	+	8	1166	c.892G>A	c.(892-894)Gac>Aac	p.D298N	PAPL_ENST00000594229.1_Silent_p.T256T	NM_001004318.2	NP_001004318.2	Q6ZNF0	PAPL_HUMAN		298						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)|metal ion binding (GO:0046872)										AGATCTGGACGACTGCACACG	0.612																																						dbGAP											0													69.0	70.0	69.0					19																	39591673		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000331256.5:c.892G>A	19.37:g.39591673G>A	ENSP00000327557:p.Asp298Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN68	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,superfamily_Purple_acid_Pase-like_N	p.D298N	ENST00000331256.5	37	c.892	CCDS33018.1	19	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021551	0.75275	.	.	ENSG00000183760	ENST00000331256	D	0.86366	-2.11	5.71	5.71	0.89125	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.93115	0.7808	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.92904	0.6342	10	0.52906	T	0.07	-53.1904	17.3422	0.87299	0.0:0.0:1.0:0.0	.	298	Q6ZNF0	PAPL_HUMAN	N	298	ENSP00000327557:D298N	ENSP00000327557:D298N	D	+	1	0	AC011443.1	44283513	1.000000	0.71417	0.982000	0.44146	0.053000	0.15095	8.754000	0.91642	2.684000	0.91462	0.655000	0.94253	GAC	AC011443.1	-	pfam_Metallo_PEstase_dom	ENSG00000183760		0.612	PAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPL	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000463810.1	26	0.00	0	G			39591673	39591673	+1	no_errors	ENST00000331256	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	1.000	A
PAPPA	5069	genome.wustl.edu	37	9	118950410	118950410	+	Missense_Mutation	SNP	C	C	T	rs570712795		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr9:118950410C>T	ENST00000328252.3	+	2	1762	c.1393C>T	c.(1393-1395)Cgg>Tgg	p.R465W	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	465	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CAACTATGAACGGTTCAACTT	0.567													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20006	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													117.0	84.0	95.0					9																	118950410		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1393C>T	9.37:g.118950410C>T	ENSP00000330658:p.Arg465Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.R465W	ENST00000328252.3	37	c.1393	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	C	12.34	1.908762	0.33721	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.01933	4.55	6.07	2.89	0.33648	Notch domain (1);	0.251817	0.45126	D	0.000393	T	0.02610	0.0079	L	0.54323	1.7	0.80722	D	1	B;B	0.15141	0.007;0.012	B;B	0.06405	0.0;0.002	T	0.46925	-0.9156	10	0.38643	T	0.18	-9.8146	5.5382	0.17023	0.4394:0.3953:0.0:0.1653	.	7;465	E7EMD3;Q13219	.;PAPP1_HUMAN	W	465;7	ENSP00000330658:R465W	ENSP00000330658:R465W	R	+	1	2	PAPPA	117990231	0.989000	0.36119	0.981000	0.43875	0.994000	0.84299	3.036000	0.49767	0.830000	0.34757	0.655000	0.94253	CGG	PAPPA	-	smart_Notch_dom	ENSG00000182752		0.567	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	28	0.00	0	C	NM_002581		118950410	118950410	+1	no_errors	ENST00000328252	ensembl	human	known	69_37n	missense	18	20.83	5	SNP	0.962	T
PCDHA4	56144	genome.wustl.edu	37	5	140188906	140188906	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:140188906G>A	ENST00000530339.1	+	1	2134	c.2134G>A	c.(2134-2136)Gtg>Atg	p.V712M	PCDHA4_ENST00000512229.2_Missense_Mutation_p.V712M|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.V712M|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	712					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V712L(1)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCCTTTTGGTGCTCACGCT	0.667																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											64.0	56.0	59.0					5																	140188906		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.2134G>A	5.37:g.140188906G>A	ENSP00000435300:p.Val712Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O75285|Q2M253	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V712M	ENST00000530339.1	37	c.2134	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	g	15.36	2.810743	0.50421	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	D;D;D	0.81739	-1.53;-1.53;-1.53	3.83	3.83	0.44106	.	0.000000	0.36628	U	0.002496	D	0.91489	0.7313	H	0.94264	3.515	0.23483	N	0.997585	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.968;0.968	D	0.84386	0.0552	10	0.72032	D	0.01	.	11.8452	0.52381	0.0:0.3294:0.6706:0.0	.	712;712;712	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	M	712	ENSP00000423470:V712M;ENSP00000349344:V712M;ENSP00000435300:V712M	ENSP00000349344:V712M	V	+	1	0	PCDHA4	140169090	0.994000	0.37717	0.997000	0.53966	0.694000	0.40290	1.666000	0.37460	1.866000	0.54105	0.484000	0.47621	GTG	PCDHA4	-	NULL	ENSG00000204967		0.667	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	32	0.00	0	G	NM_018907		140188906	140188906	+1	no_errors	ENST00000530339	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	0.736	A
PCDHGA4	56111	genome.wustl.edu	37	5	140735488	140735488	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:140735488G>A	ENST00000571252.1	+	1	721	c.721G>A	c.(721-723)Gtg>Atg	p.V241M	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	241	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAATGCTCCCGTGTTCACTCA	0.532																																						dbGAP											0													30.0	32.0	31.0					5																	140735488		2071	4215	6286	-	-	-	SO:0001583	missense	0			AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.721G>A	5.37:g.140735488G>A	ENSP00000458570:p.Val241Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5D3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V241M	ENST00000571252.1	37	c.721	CCDS58979.1	5																																																																																			PCDHGA4	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000262576		0.532	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	HGNC	protein_coding	OTTHUMT00000437959.1	17	0.00	0	G	NM_018917		140735488	140735488	+1	no_errors	ENST00000571252	ensembl	human	known	69_37n	missense	16	30.43	7	SNP	0.029	A
PCDHGA7	56108	genome.wustl.edu	37	5	140764797	140764797	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:140764797C>T	ENST00000518325.1	+	1	2331	c.2331C>T	c.(2329-2331)gaC>gaT	p.D777D	PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB4_ENST00000519479.1_5'Flank|PCDHGA6_ENST00000517434.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	777					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTATGTAGACATGCTCATCA	0.502																																						dbGAP											0													98.0	105.0	103.0					5																	140764797		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.2331C>T	5.37:g.140764797C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN87|Q9Y5D0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D777	ENST00000518325.1	37	c.2331	CCDS54927.1	5																																																																																			PCDHGA7	-	NULL	ENSG00000253537		0.502	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA7	HGNC	protein_coding	OTTHUMT00000374744.1	53	0.00	0	C	NM_018920		140764797	140764797	+1	no_errors	ENST00000518325	ensembl	human	known	69_37n	silent	41	18.00	9	SNP	0.146	T
PCDHGA10	56106	genome.wustl.edu	37	5	140793061	140793061	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:140793061G>A	ENST00000398610.2	+	1	319	c.319G>A	c.(319-321)Gtg>Atg	p.V107M	PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	107	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGCGGTGCGTGGTGAGTTT	0.512																																						dbGAP											0													69.0	82.0	78.0					5																	140793061		2127	4281	6408	-	-	-	SO:0001583	missense	0				CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.319G>A	5.37:g.140793061G>A	ENSP00000381611:p.Val107Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5E0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V107M	ENST00000398610.2	37	c.319	CCDS47292.1	5	.	.	.	.	.	.	.	.	.	.	c	10.85	1.466448	0.26335	.	.	ENSG00000253846	ENST00000398610	T	0.31510	1.49	5.78	2.89	0.33648	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.27098	0.0664	M	0.67569	2.06	0.09310	N	0.999997	B;B	0.30937	0.256;0.301	B;B	0.23419	0.039;0.046	T	0.24476	-1.0159	9	0.48119	T	0.1	.	4.6784	0.12724	0.2204:0.3514:0.3561:0.072	.	107;107	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	M	107	ENSP00000381611:V107M	ENSP00000381611:V107M	V	+	1	0	PCDHGA10	140773245	0.000000	0.05858	0.963000	0.40424	0.967000	0.64934	-1.794000	0.01753	0.781000	0.33589	-0.234000	0.12200	GTG	PCDHGA10	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253846		0.512	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA10	HGNC	protein_coding	OTTHUMT00000374747.1	48	0.00	0	G	NM_018913		140793061	140793061	+1	no_errors	ENST00000398610	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	0.546	A
PCLO	27445	genome.wustl.edu	37	7	82595175	82595177	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	TCT	TCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr7:82595175_82595177delTCT	ENST00000333891.9	-	4	4264_4266	c.3927_3929delAGA	c.(3925-3930)gaagat>gat	p.E1309del	PCLO_ENST00000423517.2_In_Frame_Del_p.E1309del	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGTCTTATCATCTTCTTTAGGTA	0.429																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.3927_3929delAGA	7.37:g.82595178_82595180delTCT	ENSP00000334319:p.Glu1309del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.E1309in_frame_del	ENST00000333891.9	37	c.3929_3927	CCDS47630.1	7																																																																																			PCLO	-	NULL	ENSG00000186472		0.429	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	165	0.00	0	TCT	NM_014510		82595175	82595177	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	in_frame_del	172	10.42	20	DEL	0.007:0.008:0.002	-
PCNT	5116	genome.wustl.edu	37	21	47786639	47786639	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr21:47786639C>T	ENST00000359568.5	+	15	2857	c.2750C>T	c.(2749-2751)gCg>gTg	p.A917V	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	917					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					TCAGTGACGGCGGAGCTCGAG	0.657																																						dbGAP											0													36.0	39.0	38.0					21																	47786639		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.2750C>T	21.37:g.47786639C>T	ENSP00000352572:p.Ala917Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O43152|Q7Z7C9	Missense_Mutation	SNP	pfam_PACT_domain	p.A917V	ENST00000359568.5	37	c.2750	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	C	10.29	1.308913	0.23821	.	.	ENSG00000160299	ENST00000359568	T	0.22336	1.96	5.62	0.563	0.17296	.	2.186910	0.02473	N	0.087778	T	0.19167	0.0460	L	0.60455	1.87	0.09310	N	1	P;P	0.50710	0.901;0.938	B;B	0.37601	0.254;0.129	T	0.23013	-1.0200	10	0.59425	D	0.04	.	2.0984	0.03674	0.1364:0.5036:0.1323:0.2276	.	799;917	O95613-2;O95613	.;PCNT_HUMAN	V	917	ENSP00000352572:A917V	ENSP00000352572:A917V	A	+	2	0	PCNT	46611067	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.980000	0.29513	-0.172000	0.10779	-1.083000	0.02208	GCG	PCNT	-	NULL	ENSG00000160299		0.657	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	19	0.00	0	C	NM_006031		47786639	47786639	+1	no_errors	ENST00000359568	ensembl	human	known	69_37n	missense	4	55.56	5	SNP	0.000	T
PDZD2	23037	genome.wustl.edu	37	5	32090758	32090758	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:32090758G>A	ENST00000438447.1	+	20	7592	c.7204G>A	c.(7204-7206)Gaa>Aaa	p.E2402K	PDZD2_ENST00000282493.3_Missense_Mutation_p.E2402K			O15018	PDZD2_HUMAN	PDZ domain containing 2	2402					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.E2402K(2)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TTCCTGCAGCGAAAACCAAAG	0.597																																						dbGAP											2	Substitution - Missense(2)	large_intestine(1)|skin(1)											56.0	58.0	58.0					5																	32090758		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.7204G>A	5.37:g.32090758G>A	ENSP00000402033:p.Glu2402Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E2402K	ENST00000438447.1	37	c.7204	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	28.9	4.959099	0.92726	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.12039	2.72;2.72	5.15	5.15	0.70609	.	0.000000	0.52532	D	0.000065	T	0.34629	0.0904	M	0.65975	2.015	0.44469	D	0.997407	D	0.76494	0.999	D	0.70716	0.97	T	0.01966	-1.1238	10	0.35671	T	0.21	.	16.1187	0.81325	0.0:0.0:1.0:0.0	.	2402	O15018	PDZD2_HUMAN	K	2402;2203;2402	ENSP00000402033:E2402K;ENSP00000282493:E2402K	ENSP00000282493:E2402K	E	+	1	0	PDZD2	32126515	1.000000	0.71417	0.990000	0.47175	0.933000	0.57130	6.351000	0.73022	2.381000	0.81170	0.561000	0.74099	GAA	PDZD2	-	NULL	ENSG00000133401		0.597	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	30	0.00	0	G			32090758	32090758	+1	no_errors	ENST00000282493	ensembl	human	known	69_37n	missense	22	33.33	11	SNP	1.000	A
PHTF1	10745	genome.wustl.edu	37	1	114248545	114248546	+	Frame_Shift_Ins	INS	-	-	A	rs201254988		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:114248545_114248546insA	ENST00000369604.1	-	13	2120_2121	c.1637_1638insT	c.(1636-1638)ttcfs	p.F546fs	PHTF1_ENST00000369600.1_Frame_Shift_Ins_p.F493fs|PHTF1_ENST00000357783.2_Frame_Shift_Ins_p.F546fs|PHTF1_ENST00000393357.2_Frame_Shift_Ins_p.F546fs|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000369598.1_Frame_Shift_Ins_p.F501fs|PHTF1_ENST00000369596.2_Frame_Shift_Ins_p.F493fs			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	546					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CACACATCATGAAAAAAAACAT	0.327																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.1638dupT	1.37:g.114248553_114248553dupA	ENSP00000358617:p.Phe546fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Frame_Shift_Ins	INS	pfam_TF_homeodomain_male	p.M547fs	ENST00000369604.1	37	c.1638_1637	CCDS861.1	1																																																																																			PHTF1	-	NULL	ENSG00000116793		0.327	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHTF1	HGNC	protein_coding	OTTHUMT00000032666.1	57	0.00	0	-	NM_006608		114248545	114248546	-1	no_errors	ENST00000369604	ensembl	human	known	69_37n	frame_shift_ins	62	22.50	18	INS	0.997:1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178916823	178916823	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:178916823C>T	ENST00000263967.3	+	2	367	c.210C>T	c.(208-210)ttC>ttT	p.F70F		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	70	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CTTACATTTTCGTAAGTGTTA	0.348		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	0													94.0	90.0	92.0					3																	178916823		1815	4082	5897	-	-	-	SO:0001819	synonymous_variant	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.210C>T	3.37:g.178916823C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Silent	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.F70	ENST00000263967.3	37	c.210	CCDS43171.1	3																																																																																			PIK3CA	-	pfam_PI3K_adapt-bd_dom,smart_PI3K_adapt-bd_dom	ENSG00000121879		0.348	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	34	0.00	0	C			178916823	178916823	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	silent	32	36.00	18	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	57	0.00	0	G			178936082	178936082	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	25	63.77	44	SNP	1.000	A
PLCL1	5334	genome.wustl.edu	37	2	198950763	198950763	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:198950763delT	ENST00000428675.1	+	2	2920	c.2522delT	c.(2521-2523)cttfs	p.L841fs	PLCL1_ENST00000437704.2_Frame_Shift_Del_p.L743fs	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	841					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	CACGTAACCCTTTTTGTCCAC	0.448																																						dbGAP											0													158.0	132.0	141.0					2																	198950763		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2522delT	2.37:g.198950763delT	ENSP00000402861:p.Leu841fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJ90|Q53SD3|Q7Z3S3	Frame_Shift_Del	DEL	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,prints_Pinositol_PLipase_C,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.F842fs	ENST00000428675.1	37	c.2522	CCDS2326.2	2																																																																																			PLCL1	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000115896		0.448	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1	85	0.00	0	T	NM_006226		198950763	198950763	+1	no_errors	ENST00000428675	ensembl	human	known	69_37n	frame_shift_del	62	21.52	17	DEL	0.918	-
PLXNA2	5362	genome.wustl.edu	37	1	208227774	208227774	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:208227774T>C	ENST00000367033.3	-	14	3605	c.2848A>G	c.(2848-2850)Acc>Gcc	p.T950A		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	950	IPT/TIG 1.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		ACCACGAAGGTGTACTGCTGA	0.617																																						dbGAP											0													94.0	76.0	82.0					1																	208227774		2203	4300	6503	-	-	-	SO:0001583	missense	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.2848A>G	1.37:g.208227774T>C	ENSP00000356000:p.Thr950Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.T950A	ENST00000367033.3	37	c.2848	CCDS31013.1	1	.	.	.	.	.	.	.	.	.	.	T	15.66	2.900671	0.52227	.	.	ENSG00000076356	ENST00000367033	T	0.79653	-1.29	5.38	5.38	0.77491	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (2);Immunoglobulin-like fold (1);	0.047014	0.85682	D	0.000000	T	0.80924	0.4717	L	0.60012	1.86	0.47065	D	0.999301	B	0.28584	0.216	B	0.39706	0.307	T	0.76008	-0.3116	10	0.17369	T	0.5	.	15.4125	0.74937	0.0:0.0:0.0:1.0	.	950	O75051	PLXA2_HUMAN	A	950	ENSP00000356000:T950A	ENSP00000356000:T950A	T	-	1	0	PLXNA2	206294397	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.096000	0.50243	2.035000	0.60131	0.533000	0.62120	ACC	PLXNA2	-	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	ENSG00000076356		0.617	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6	36	0.00	0	T	NM_025179		208227774	208227774	-1	no_errors	ENST00000367033	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	1.000	C
PNLIPRP1	5407	genome.wustl.edu	37	10	118351338	118351338	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr10:118351338C>T	ENST00000528052.1	+	3	176	c.105C>T	c.(103-105)ggC>ggT	p.G35G	PNLIPRP1_ENST00000358834.4_Silent_p.G35G|PNLIPRP1_ENST00000534537.1_Silent_p.G35G|PNLIPRP1_ENST00000480870.2_3'UTR|PNLIPRP1_ENST00000442761.1_Silent_p.G35G			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	35					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		AGCCCTGGGGCGGGACAGCAA	0.512																																						dbGAP											0													110.0	117.0	115.0					10																	118351338		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.105C>T	10.37:g.118351338C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68D83|Q68DR6|Q8TAU2|Q9BS82	Silent	SNP	pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pirsf_Lipoprotein_lipase_LIPH,pfscan_LipOase_LH2,prints_Lipase_panc,prints_Lipase	p.G35	ENST00000528052.1	37	c.105	CCDS7595.1	10																																																																																			PNLIPRP1	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase_panc	ENSG00000187021		0.512	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PNLIPRP1	HGNC	protein_coding	OTTHUMT00000384633.1	65	0.00	0	C	NM_006229		118351338	118351338	+1	no_errors	ENST00000358834	ensembl	human	known	69_37n	silent	22	53.19	25	SNP	0.564	T
PPP2CB	5516	genome.wustl.edu	37	8	30648767	30648767	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr8:30648767C>T	ENST00000221138.4	-	6	1253	c.803G>A	c.(802-804)cGt>cAt	p.R268H	PPP2CB_ENST00000518564.1_Intron	NM_001009552.1	NP_001009552.1	P62714	PP2AB_HUMAN	protein phosphatase 2, catalytic subunit, beta isozyme	268					apoptotic mitochondrial changes (GO:0008637)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of Ras protein signal transduction (GO:0046580)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|regulation of gene expression (GO:0010468)|response to antibiotic (GO:0046677)|response to endoplasmic reticulum stress (GO:0034976)|response to hydrogen peroxide (GO:0042542)	chromosome, centromeric region (GO:0000775)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	9				KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	Vitamin E(DB00163)	GTTCCCACAACGATAACAGTA	0.328																																						dbGAP											0													81.0	75.0	77.0					8																	30648767		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6079.1	8p12	2011-05-24	2010-03-05		ENSG00000104695	ENSG00000104695	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9300	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, beta isoform"""	176916	"""protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform"""			8383590	Standard	NM_001009552		Approved	PP2Abeta	uc003xik.3	P62714	OTTHUMG00000163949	ENST00000221138.4:c.803G>A	8.37:g.30648767C>T	ENSP00000221138:p.Arg268His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSV4|P11082|Q6FHK5	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.R268H	ENST00000221138.4	37	c.803	CCDS6079.1	8	.	.	.	.	.	.	.	.	.	.	C	27.1	4.798990	0.90538	.	.	ENSG00000104695	ENST00000221138;ENST00000406655;ENST00000520334	T;T	0.54675	0.56;0.56	5.31	4.42	0.53409	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);	0.000000	0.85682	D	0.000000	T	0.77758	0.4178	H	0.96111	3.77	0.80722	D	1	D	0.76494	0.999	P	0.60886	0.88	D	0.84625	0.0686	10	0.87932	D	0	1.2954	13.3829	0.60778	0.0:0.9231:0.0:0.0769	.	268	P62714	PP2AB_HUMAN	H	268;268;106	ENSP00000221138:R268H;ENSP00000430758:R106H	ENSP00000221138:R268H	R	-	2	0	PPP2CB	30768309	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	5.746000	0.68681	2.631000	0.89168	0.655000	0.94253	CGT	PPP2CB	-	smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	ENSG00000104695		0.328	PPP2CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2CB	HGNC	protein_coding	OTTHUMT00000376527.2	51	0.00	0	C	NM_001009552		30648767	30648767	-1	no_errors	ENST00000221138	ensembl	human	known	69_37n	missense	81	12.90	12	SNP	1.000	T
PPP2R3C	55012	genome.wustl.edu	37	14	35568559	35568559	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr14:35568559G>T	ENST00000261475.5	-	7	958	c.605C>A	c.(604-606)cCt>cAt	p.P202H		NM_017917.2	NP_060387.2	Q969Q6	P2R3C_HUMAN	protein phosphatase 2, regulatory subunit B'', gamma	202					activation of protein kinase activity (GO:0032147)|B cell homeostasis (GO:0001782)|positive regulation of B cell differentiation (GO:0045579)|regulation of antimicrobial humoral response (GO:0002759)|regulation of mitochondrial depolarization (GO:0051900)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)	15	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		TGGCAACGTAGGGATAAGTTC	0.299																																						dbGAP											0													53.0	53.0	53.0					14																	35568559		2201	4291	6492	-	-	-	SO:0001583	missense	0			AK000651	CCDS9654.1	14q13.2	2010-06-18	2010-06-18	2007-01-22	ENSG00000092020	ENSG00000092020		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	17485	protein-coding gene	gene with protein product		615902	"""chromosome 14 open reading frame 10"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma"""	C14orf10		12167160, 16129705	Standard	NM_017917		Approved	FLJ20644, G4-1, G5PR	uc001wss.3	Q969Q6	OTTHUMG00000140224	ENST00000261475.5:c.605C>A	14.37:g.35568559G>T	ENSP00000261475:p.Pro202His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEN7|D3DS97|D3DS98|Q5GJ55|Q5GJ56|Q6P4G2|Q86TZ3|Q9NWR9	Missense_Mutation	SNP	NULL	p.P202H	ENST00000261475.5	37	c.605	CCDS9654.1	14	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187077	0.78789	.	.	ENSG00000092020	ENST00000261475;ENST00000554361	T;T	0.28454	1.61;1.61	5.4	4.51	0.55191	.	0.047372	0.85682	D	0.000000	T	0.60932	0.2307	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.87578	0.912;0.998	T	0.67565	-0.5638	10	0.46703	T	0.11	-5.0303	14.418	0.67163	0.0713:0.0:0.9287:0.0	.	174;202	G3V2K1;Q969Q6	.;P2R3C_HUMAN	H	202;174	ENSP00000261475:P202H;ENSP00000450716:P174H	ENSP00000261475:P202H	P	-	2	0	PPP2R3C	34638310	1.000000	0.71417	0.971000	0.41717	0.993000	0.82548	9.083000	0.94067	1.423000	0.47198	0.650000	0.86243	CCT	PPP2R3C	-	NULL	ENSG00000092020		0.299	PPP2R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3C	HGNC	protein_coding	OTTHUMT00000276687.1	37	0.00	0	G	NM_017917		35568559	35568559	-1	no_errors	ENST00000261475	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	1.000	T
PRPF4	9128	genome.wustl.edu	37	9	116053923	116053923	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr9:116053923C>T	ENST00000374198.4	+	14	1654	c.1552C>T	c.(1552-1554)Ctg>Ttg	p.L518L	PRPF4_ENST00000374199.4_Silent_p.L517L	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	518					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)				NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						GACCTTCAAGCTGTGGATGGC	0.468																																						dbGAP											0													72.0	64.0	67.0					9																	116053923		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.1552C>T	9.37:g.116053923C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Silent	SNP	pfam_WD40_repeat,pfam_PRP4,superfamily_WD40_repeat_dom,smart_SFM,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L518	ENST00000374198.4	37	c.1552	CCDS6791.1	9																																																																																			PRPF4	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000136875		0.468	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRPF4	HGNC	protein_coding	OTTHUMT00000053708.2	37	0.00	0	C	NM_004697		116053923	116053923	+1	no_errors	ENST00000374198	ensembl	human	known	69_37n	silent	47	20.34	12	SNP	1.000	T
PRR14	78994	genome.wustl.edu	37	16	30664308	30664308	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr16:30664308C>T	ENST00000542965.2	+	4	844	c.388C>T	c.(388-390)Cga>Tga	p.R130*	PRR14_ENST00000300835.4_Nonsense_Mutation_p.R130*			Q9BWN1	PRR14_HUMAN	proline rich 14	130	Pro-rich.									breast(3)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	18			Colorectal(24;0.103)			CCTGAGGCGGCGATCAAGGAC	0.627																																						dbGAP											0													42.0	47.0	45.0					16																	30664308		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0			AK074783	CCDS10687.1	16p11.2	2008-02-05			ENSG00000156858	ENSG00000156858			28458	protein-coding gene	gene with protein product						12477932	Standard	NM_024031		Approved	MGC3121	uc002dyy.3	Q9BWN1	OTTHUMG00000132414	ENST00000542965.2:c.388C>T	16.37:g.30664308C>T	ENSP00000441641:p.Arg130*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WTX2	Nonsense_Mutation	SNP	NULL	p.R130*	ENST00000542965.2	37	c.388	CCDS10687.1	16	.	.	.	.	.	.	.	.	.	.	C	28.5	4.926108	0.92319	.	.	ENSG00000156858	ENST00000287463;ENST00000300835;ENST00000542965	.	.	.	5.35	0.262	0.15597	.	0.650487	0.13199	N	0.406092	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.8669	8.6325	0.33928	0.4367:0.4398:0.1234:0.0	.	.	.	.	X	103;130;130	.	ENSP00000287463:R103X	R	+	1	2	PRR14	30571809	0.003000	0.15002	0.000000	0.03702	0.049000	0.14656	1.411000	0.34702	0.189000	0.20188	0.585000	0.79938	CGA	PRR14	-	NULL	ENSG00000156858		0.627	PRR14-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRR14	HGNC	protein_coding	OTTHUMT00000434433.1	27	0.00	0	C	NM_024031		30664308	30664308	+1	no_errors	ENST00000300835	ensembl	human	known	69_37n	nonsense	36	18.18	8	SNP	0.000	T
PSPC1	55269	genome.wustl.edu	37	13	20315754	20315754	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr13:20315754C>T	ENST00000338910.4	-	5	1162	c.1003G>A	c.(1003-1005)Gaa>Aaa	p.E335K		NM_001042414.2	NP_001035879.1	Q8WXF1	PSPC1_HUMAN	paraspeckle component 1	335	Sufficient for paraspeckles localization.|Sufficient for perinucleolar caps localization and interaction with NONO.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		CTGAGTTCTTCCAAGCGTCTG	0.303																																						dbGAP											0													132.0	117.0	122.0					13																	20315754		1816	4075	5891	-	-	-	SO:0001583	missense	0			AK001817	CCDS41870.1	13q11	2013-02-12			ENSG00000121390	ENSG00000121390		"""RNA binding motif (RRM) containing"""	20320	protein-coding gene	gene with protein product		612408				11790299	Standard	NM_001042414		Approved	PSP1, FLJ10955	uc021rgx.1	Q8WXF1	OTTHUMG00000016502	ENST00000338910.4:c.1003G>A	13.37:g.20315754C>T	ENSP00000343966:p.Glu335Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTQ3|Q8NCZ9|Q8WXE8|Q9NV36	Missense_Mutation	SNP	pfam_RRM_dom,pfam_NOPS,smart_RRM_dom,pfscan_RRM_dom	p.E335K	ENST00000338910.4	37	c.1003	CCDS41870.1	13	.	.	.	.	.	.	.	.	.	.	C	33	5.286264	0.95517	.	.	ENSG00000121390	ENST00000338910;ENST00000422828	T	0.17691	2.26	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.44932	0.1317	M	0.73430	2.235	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.28332	-1.0047	10	0.48119	T	0.1	-15.9717	18.9836	0.92763	0.0:1.0:0.0:0.0	.	335	Q8WXF1	PSPC1_HUMAN	K	335;275	ENSP00000343966:E335K	ENSP00000343966:E335K	E	-	1	0	PSPC1	19213754	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.721000	0.84768	2.573000	0.86826	0.650000	0.86243	GAA	PSPC1	-	NULL	ENSG00000121390		0.303	PSPC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PSPC1	HGNC	protein_coding	OTTHUMT00000044037.2	133	0.00	0	C			20315754	20315754	-1	no_errors	ENST00000338910	ensembl	human	known	69_37n	missense	46	66.67	92	SNP	1.000	T
PXDN	7837	genome.wustl.edu	37	2	1653368	1653368	+	Silent	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:1653368G>A	ENST00000252804.4	-	17	2234	c.2184C>T	c.(2182-2184)cgC>cgT	p.R728R		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	728					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.R728R(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		AGTTGTTCACGCGCCGGTGGG	0.602																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											86.0	92.0	90.0					2																	1653368		2087	4206	6293	-	-	-	SO:0001819	synonymous_variant	0			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2184C>T	2.37:g.1653368G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like	p.R728	ENST00000252804.4	37	c.2184	CCDS46221.1	2																																																																																			PXDN	-	NULL	ENSG00000130508		0.602	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	HGNC	protein_coding	OTTHUMT00000322505.1	39	0.00	0	G	XM_056455		1653368	1653368	-1	no_errors	ENST00000252804	ensembl	human	known	69_37n	silent	18	33.33	9	SNP	0.575	A
RAB39B	116442	genome.wustl.edu	37	X	154493388	154493388	+	Silent	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chrX:154493388G>A	ENST00000369454.3	-	1	486	c.186C>T	c.(184-186)atC>atT	p.I62I		NM_171998.2	NP_741995.1	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	62					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|synapse organization (GO:0050808)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			breast(1)|central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(12)	19	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CGGTATCCCAGATCTGGAGCT	0.627																																						dbGAP											0													77.0	63.0	68.0					X																	154493388		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY052478	CCDS14766.1	Xq28	2014-01-31			ENSG00000155961	ENSG00000155961		"""RAB, member RAS oncogene"""	16499	protein-coding gene	gene with protein product		300774	"""mental retardation, X-linked 72"""	MRX72		12438742, 20159109	Standard	NM_171998		Approved		uc004fne.3	Q96DA2	OTTHUMG00000022659	ENST00000369454.3:c.186C>T	X.37:g.154493388G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JT79|Q8NEX3	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.I62	ENST00000369454.3	37	c.186	CCDS14766.1	X																																																																																			RAB39B	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000155961		0.627	RAB39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB39B	HGNC	protein_coding	OTTHUMT00000058792.1	47	0.00	0	G	NM_171998		154493388	154493388	-1	no_errors	ENST00000369454	ensembl	human	known	69_37n	silent	15	51.61	16	SNP	1.000	A
RAD21	5885	genome.wustl.edu	37	8	117866515	117866515	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr8:117866515G>C	ENST00000297338.2	-	9	1417	c.1130C>G	c.(1129-1131)gCt>gGt	p.A377G	RAD21_ENST00000523986.1_5'Flank|RAD21_ENST00000518055.1_5'Flank	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	377	Interaction with STAG1.|Interaction with WAPAL and PDS5B.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					CAAAGGCTGAGCAGGTAAAGA	0.348																																						dbGAP											0													72.0	74.0	74.0					8																	117866515		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.1130C>G	8.37:g.117866515G>C	ENSP00000297338:p.Ala377Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu,pfam_ScpA	p.A377G	ENST00000297338.2	37	c.1130	CCDS6321.1	8	.	.	.	.	.	.	.	.	.	.	G	16.08	3.020254	0.54576	.	.	ENSG00000164754	ENST00000297338	T	0.63913	-0.07	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.72003	0.3407	L	0.43152	1.355	0.80722	D	1	D	0.63880	0.993	D	0.72625	0.978	T	0.63563	-0.6609	10	0.12430	T	0.62	-2.2469	19.6983	0.96039	0.0:0.0:1.0:0.0	.	377	O60216	RAD21_HUMAN	G	377	ENSP00000297338:A377G	ENSP00000297338:A377G	A	-	2	0	RAD21	117935696	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.669000	0.90835	0.460000	0.39030	GCT	RAD21	-	NULL	ENSG00000164754		0.348	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21	HGNC	protein_coding	OTTHUMT00000381184.1	64	0.00	0	G	NM_006265		117866515	117866515	-1	no_errors	ENST00000297338	ensembl	human	known	69_37n	missense	106	10.92	13	SNP	1.000	C
RAD50	10111	genome.wustl.edu	37	5	131931452	131931452	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:131931452delA	ENST00000265335.6	+	13	2544	c.2157delA	c.(2155-2157)ctafs	p.L719fs	RAD50_ENST00000378823.3_Frame_Shift_Del_p.L580fs			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	719	Zinc-hook. {ECO:0000255|PROSITE- ProRule:PRU00471}.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.L580L(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AATCAGAGCTAAAAAAAAAGG	0.418								Homologous recombination																														dbGAP											1	Substitution - coding silent(1)	breast(1)											67.0	66.0	66.0					5																	131931452		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.2157delA	5.37:g.131931452delA	ENSP00000265335:p.Leu719fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Frame_Shift_Del	DEL	pfam_Rad50_Zn_hook,superfamily_Prefoldin,pfscan_Zn_hook_Rad50,tigrfam_Rad50	p.K722fs	ENST00000265335.6	37	c.2157	CCDS34233.1	5																																																																																			RAD50	-	superfamily_Prefoldin,pfscan_Zn_hook_Rad50,tigrfam_Rad50	ENSG00000113522		0.418	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD50	HGNC	protein_coding	OTTHUMT00000132566.5	21	0.00	0	A	NM_005732		131931452	131931452	+1	no_errors	ENST00000265335	ensembl	human	known	69_37n	frame_shift_del	36	14.29	6	DEL	0.997	-
RAD54L2	23132	genome.wustl.edu	37	3	51673633	51673633	+	Missense_Mutation	SNP	G	G	A	rs532971546		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:51673633G>A	ENST00000409535.2	+	12	2184	c.2059G>A	c.(2059-2061)Gtt>Att	p.V687I	RAD54L2_ENST00000296477.3_Missense_Mutation_p.V381I	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	687						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		CCTACAGGGCGTTGGCTTCAA	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		22447	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													73.0	62.0	66.0					3																	51673633		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.2059G>A	3.37:g.51673633G>A	ENSP00000386520:p.Val687Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB57|Q9BV54	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V687I	ENST00000409535.2	37	c.2059	CCDS33765.2	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.18|14.18	2.457307|2.457307	0.43634|0.43634	.|.	.|.	ENSG00000164080|ENSG00000164080	ENST00000432863|ENST00000409535;ENST00000296477	.|D;D	.|0.93189	.|-3.07;-3.18	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.138099	.|0.48286	.|D	.|0.000189	D|D	0.86719|0.86719	0.6000|0.6000	N|N	0.17082|0.17082	0.46|0.46	0.31022|0.31022	N|N	0.717966|0.717966	.|B;B	.|0.11235	.|0.004;0.004	.|B;B	.|0.04013	.|0.001;0.001	T|T	0.81846|0.81846	-0.0745|-0.0745	5|10	.|0.37606	.|T	.|0.19	-15.4047|-15.4047	12.3199|12.3199	0.54979|0.54979	0.0767:0.0:0.9233:0.0|0.0767:0.0:0.9233:0.0	.|.	.|687;278	.|Q9Y4B4;B3KV54	.|ARIP4_HUMAN;.	H|I	515|687;381	.|ENSP00000386520:V687I;ENSP00000296477:V381I	.|ENSP00000296477:V381I	R|V	+|+	2|1	0|0	RAD54L2|RAD54L2	51648673|51648673	0.998000|0.998000	0.40836|0.40836	0.988000|0.988000	0.46212|0.46212	0.978000|0.978000	0.69477|0.69477	3.034000|3.034000	0.49751|0.49751	2.719000|2.719000	0.93026|0.93026	0.655000|0.655000	0.94253|0.94253	CGT|GTT	RAD54L2	-	NULL	ENSG00000164080		0.517	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L2	HGNC	protein_coding	OTTHUMT00000328700.2	50	0.00	0	G	NM_015106		51673633	51673633	+1	no_errors	ENST00000409535	ensembl	human	known	69_37n	missense	31	22.50	9	SNP	0.987	A
RAPGEF2	9693	genome.wustl.edu	37	4	160253744	160253744	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr4:160253744delA	ENST00000264431.4	+	11	1966	c.1547delA	c.(1546-1548)gaafs	p.E516fs		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	516					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		ATAGGACTTGAAAAAGTGAAC	0.433																																						dbGAP											0													94.0	88.0	90.0					4																	160253744		1905	4130	6035	-	-	-	SO:0001589	frameshift_variant	0			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.1547delA	4.37:g.160253744delA	ENSP00000264431:p.Glu516fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DP27	Frame_Shift_Del	DEL	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,pfam_PDZ,pfam_cNMP-bd_dom,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.V518fs	ENST00000264431.4	37	c.1547	CCDS43277.1	4																																																																																			RAPGEF2	-	superfamily_Ras_GEF_dom	ENSG00000109756		0.433	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPGEF2	HGNC	protein_coding	OTTHUMT00000364980.2	51	0.00	0	A	NM_014247		160253744	160253744	+1	no_errors	ENST00000264431	ensembl	human	known	69_37n	frame_shift_del	55	17.91	12	DEL	1.000	-
RARS	5917	genome.wustl.edu	37	5	167946113	167946113	+	Missense_Mutation	SNP	G	G	A	rs555837551		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:167946113G>A	ENST00000231572.3	+	15	1955	c.1901G>A	c.(1900-1902)cGt>cAt	p.R634H	RARS_ENST00000538719.1_Missense_Mutation_p.R428H	NM_002887.3	NP_002878.2	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	634					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	arginine binding (GO:0034618)|arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|tRNA binding (GO:0000049)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|stomach(1)	22	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		AACATGTGGCGTATGCTGCTA	0.348													G|||	1	0.000199681	0.0	0.0	5008	,	,		18833	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													90.0	85.0	87.0					5																	167946113		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000528	CCDS4367.1	5q35.1	2011-07-01			ENSG00000113643	ENSG00000113643	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	9870	protein-coding gene	gene with protein product	"""arginine tRNA ligase 1, cytoplasmic"""	107820				7590355	Standard	NM_002887		Approved	DALRD1	uc003lzx.3	P54136	OTTHUMG00000130411	ENST00000231572.3:c.1901G>A	5.37:g.167946113G>A	ENSP00000231572:p.Arg634His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBS9|Q53GY4|Q9BWA1	Missense_Mutation	SNP	pfam_Arg-tRNA-synth_Ia_core,pfam_DALR_anticod-bd,pfam_Arg-tRNA-synth_N,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Arg-tRNA-synth_N,smart_DALR_anticod-bd,prints_Arg-tRNA-synth_Ia_core,tigrfam_Arg-tRNA-synth_Ia	p.R634H	ENST00000231572.3	37	c.1901	CCDS4367.1	5	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074130	0.76415	.	.	ENSG00000113643	ENST00000231572;ENST00000538719	D;D	0.90324	-2.65;-2.65	5.78	3.99	0.46301	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);DALR anticodon binding (2);	0.054331	0.64402	D	0.000002	D	0.96228	0.8770	H	0.95679	3.705	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.95657	0.8712	10	0.87932	D	0	-9.0398	9.9567	0.41671	0.0728:0.0:0.7881:0.1392	.	634	P54136	SYRC_HUMAN	H	634;428	ENSP00000231572:R634H;ENSP00000439108:R428H	ENSP00000231572:R634H	R	+	2	0	RARS	167878691	1.000000	0.71417	0.640000	0.29408	0.775000	0.43874	9.444000	0.97578	0.776000	0.33473	-0.182000	0.12963	CGT	RARS	-	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd,tigrfam_Arg-tRNA-synth_Ia	ENSG00000113643		0.348	RARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARS	HGNC	protein_coding	OTTHUMT00000252794.2	39	0.00	0	G	NM_002887		167946113	167946113	+1	no_errors	ENST00000231572	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	0.999	A
RASGRP4	115727	genome.wustl.edu	37	19	38901798	38901798	+	Frame_Shift_Del	DEL	G	G	-	rs376039220	byFrequency	TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:38901798delG	ENST00000587738.1	-	15	1879	c.1809delC	c.(1807-1809)cccfs	p.P603fs	RASGRP4_ENST00000587753.1_Frame_Shift_Del_p.P534fs|RASGRP4_ENST00000433821.2_Frame_Shift_Del_p.P511fs|RASGRP4_ENST00000426920.2_Frame_Shift_Del_p.P414fs|RASGRP4_ENST00000454404.2_Frame_Shift_Del_p.P569fs|RASGRP4_ENST00000586305.1_Frame_Shift_Del_p.P589fs|RASGRP4_ENST00000293062.9_Frame_Shift_Del_p.P506fs			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	603					activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CAGGAGCTCCGGGGGGTCCTG	0.622																																						dbGAP											0													61.0	67.0	65.0					19																	38901798		2008	4170	6178	-	-	-	SO:0001589	frameshift_variant	0			AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.1809delC	19.37:g.38901798delG	ENSP00000465772:p.Pro603fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Frame_Shift_Del	DEL	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.G604fs	ENST00000587738.1	37	c.1809	CCDS46068.1	19																																																																																			RASGRP4	-	NULL	ENSG00000171777		0.622	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	RASGRP4	HGNC	protein_coding	OTTHUMT00000460540.1	91	0.00	0	G	NM_170604		38901798	38901798	-1	no_errors	ENST00000587738	ensembl	human	known	69_37n	frame_shift_del	57	19.72	14	DEL	0.000	-
RGS16	6004	genome.wustl.edu	37	1	182572462	182572462	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:182572462G>C	ENST00000367558.5	-	2	205	c.57C>G	c.(55-57)ttC>ttG	p.F19L		NM_002928.3	NP_002919.3	O15492	RGS16_HUMAN	regulator of G-protein signaling 16	19					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			NS(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)	11						GACGTGTCTTGAACTCTTTGG	0.483																																						dbGAP											0													129.0	117.0	121.0					1																	182572462		2203	4300	6503	-	-	-	SO:0001583	missense	0			U70426	CCDS1348.1	1q25-q31	2008-02-05	2007-08-14		ENSG00000143333	ENSG00000143333		"""Regulators of G-protein signaling"""	9997	protein-coding gene	gene with protein product		602514	"""regulator of G-protein signalling 16"""			9469939	Standard	NM_002928		Approved	A28-RGS14, RGS-r	uc001gpl.4	O15492	OTTHUMG00000035212	ENST00000367558.5:c.57C>G	1.37:g.182572462G>C	ENSP00000356529:p.Phe19Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4M4|Q5VYN9|Q99701	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.F19L	ENST00000367558.5	37	c.57	CCDS1348.1	1	.	.	.	.	.	.	.	.	.	.	G	7.602	0.672929	0.14776	.	.	ENSG00000143333	ENST00000367558	T	0.52057	0.68	5.25	4.31	0.51392	.	0.388578	0.29684	N	0.011467	T	0.28995	0.0720	N	0.12637	0.245	0.27994	N	0.935533	B;B	0.12013	0.005;0.0	B;B	0.11329	0.006;0.003	T	0.12066	-1.0562	10	0.20046	T	0.44	.	13.1514	0.59492	0.0:0.3075:0.6925:0.0	.	19;19	B4DVW5;O15492	.;RGS16_HUMAN	L	19	ENSP00000356529:F19L	ENSP00000356529:F19L	F	-	3	2	RGS16	180839085	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.166000	0.31834	1.158000	0.42547	0.561000	0.74099	TTC	RGS16	-	NULL	ENSG00000143333		0.483	RGS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS16	HGNC	protein_coding	OTTHUMT00000085188.1	80	0.00	0	G	NM_002928		182572462	182572462	-1	no_errors	ENST00000367558	ensembl	human	known	69_37n	missense	127	13.01	19	SNP	1.000	C
RNF14	9604	genome.wustl.edu	37	5	141359789	141359789	+	Silent	SNP	G	G	A	rs141694109		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:141359789G>A	ENST00000394520.2	+	6	1245	c.936G>A	c.(934-936)ccG>ccA	p.P312P	AC005740.5_ENST00000520882.1_RNA|RNF14_ENST00000394514.2_Silent_p.P186P|RNF14_ENST00000356143.1_Silent_p.P312P|RNF14_ENST00000394515.3_Silent_p.P136P|RNF14_ENST00000394519.1_Silent_p.P312P|RNF14_ENST00000347642.3_Silent_p.P312P|RNF14_ENST00000540015.1_Intron	NM_001201365.1|NM_004290.4	NP_001188294.1|NP_004281.1	Q9UBS8	RNF14_HUMAN	ring finger protein 14	312					androgen receptor signaling pathway (GO:0030521)|positive regulation of transcription, DNA-templated (GO:0045893)|protein ubiquitination (GO:0016567)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|small conjugating protein ligase activity (GO:0019787)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15		all_hematologic(541;0.0536)|Ovarian(839;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		GCCCCCGGCCGTGCTGCCAGC	0.547																																						dbGAP											0													112.0	99.0	103.0					5																	141359789		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF060544	CCDS4270.1, CCDS4271.1	5q23.3-q31.1	2008-02-05			ENSG00000013561	ENSG00000013561		"""RING-type (C3HC4) zinc fingers"""	10058	protein-coding gene	gene with protein product		605675				10085091, 10320776	Standard	NM_183399		Approved	ARA54, HFB30, TRIAD2	uc003lmc.3	Q9UBS8	OTTHUMG00000129660	ENST00000394520.2:c.936G>A	5.37:g.141359789G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV26|A6NMR2|A8MTW5|B3KN72|B7ZLV2|D3DQE4|O94793|Q6IBV0	Silent	SNP	pfam_RWD-domain,pfam_Znf_C6HC,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,smart_Znf_C6HC,pfscan_RWD-domain,pfscan_Znf_RING	p.P312	ENST00000394520.2	37	c.936	CCDS4270.1	5																																																																																			RNF14	-	pfam_Znf_C6HC,smart_Znf_C6HC	ENSG00000013561		0.547	RNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF14	HGNC	protein_coding	OTTHUMT00000251860.2	46	0.00	0	G	NM_004290		141359789	141359789	+1	no_errors	ENST00000347642	ensembl	human	known	69_37n	silent	24	32.43	12	SNP	0.231	A
RPGRIP1	57096	genome.wustl.edu	37	14	21789487	21789487	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr14:21789487G>A	ENST00000400017.2	+	12	1537	c.1537G>A	c.(1537-1539)Gca>Aca	p.A513T	RPGRIP1_ENST00000382933.4_Missense_Mutation_p.A155T|RPGRIP1_ENST00000206660.6_Missense_Mutation_p.A513T|RPGRIP1_ENST00000556336.1_Missense_Mutation_p.A486T|RPGRIP1_ENST00000553500.1_Intron|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.A486T	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	513					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		AGTATCACACGCAGAGACCAC	0.453																																						dbGAP											0													121.0	110.0	114.0					14																	21789487		1929	4138	6067	-	-	-	SO:0001583	missense	0			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.1537G>A	14.37:g.21789487G>A	ENSP00000382895:p.Ala513Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	pfam_DUF3250,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.A513T	ENST00000400017.2	37	c.1537	CCDS45080.1	14	.	.	.	.	.	.	.	.	.	.	G	21.5	4.159487	0.78226	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660;ENST00000382933	T;T;T;T;T	0.80909	-1.16;-1.38;-1.3;-1.43;-1.39	5.12	4.21	0.49690	.	0.054786	0.64402	D	0.000001	D	0.88966	0.6581	M	0.81341	2.54	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.962;0.999;0.998	D	0.89791	0.3968	10	0.59425	D	0.04	-14.1765	12.5368	0.56145	0.0:0.0:0.8327:0.1673	.	155;129;513	Q96KN7-4;Q96KN7-5;Q96KN7	.;.;RPGR1_HUMAN	T	486;486;513;513;155	ENSP00000450445:A486T;ENSP00000451219:A486T;ENSP00000382895:A513T;ENSP00000206660:A513T;ENSP00000372391:A155T	ENSP00000206660:A513T	A	+	1	0	RPGRIP1	20859327	1.000000	0.71417	0.971000	0.41717	0.647000	0.38526	5.789000	0.69029	1.497000	0.48584	0.650000	0.86243	GCA	RPGRIP1	-	NULL	ENSG00000092200		0.453	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPGRIP1	HGNC	protein_coding	OTTHUMT00000410258.1	68	0.00	0	G	NM_020366		21789487	21789487	+1	no_errors	ENST00000206660	ensembl	human	known	69_37n	missense	69	23.33	21	SNP	1.000	A
SAFB2	9667	genome.wustl.edu	37	19	5587282	5587282	+	Frame_Shift_Del	DEL	G	G	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:5587282delG	ENST00000252542.4	-	21	3098	c.2834delC	c.(2833-2835)ccgfs	p.P945fs		NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	945	Interacts with SAFB1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P945fs*>9(1)		endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		gtgggggtacggggggggatg	0.657																																					Ovarian(127;888 1728 23957 44128 52668)	dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)											21.0	21.0	21.0					19																	5587282		2201	4300	6501	-	-	-	SO:0001589	frameshift_variant	0			D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.2834delC	19.37:g.5587282delG	ENSP00000252542:p.Pro945fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKG3|Q8TB13	Frame_Shift_Del	DEL	pfam_RRM_dom,pfam_SAP_DNA-bd,smart_SAP_DNA-bd,smart_RRM_dom,pfscan_SAP_DNA-bd,pfscan_RRM_dom	p.P945fs	ENST00000252542.4	37	c.2834	CCDS32879.1	19																																																																																			SAFB2	-	NULL	ENSG00000130254		0.657	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAFB2	HGNC	protein_coding	OTTHUMT00000451016.1	20	0.00	0	G	NM_014649		5587282	5587282	-1	no_errors	ENST00000252542	ensembl	human	known	69_37n	frame_shift_del	5	28.57	2	DEL	0.100	-
SERPING1	710	genome.wustl.edu	37	11	57373624	57373624	+	Missense_Mutation	SNP	G	G	A	rs548701651		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr11:57373624G>A	ENST00000278407.4	+	5	1054	c.827G>A	c.(826-828)cGg>cAg	p.R276Q	SERPING1_ENST00000403558.1_Missense_Mutation_p.R310Q|SERPING1_ENST00000378324.2_Missense_Mutation_p.R224Q|SERPING1_ENST00000378323.4_Missense_Mutation_p.R281Q|SERPING1_ENST00000340687.6_Missense_Mutation_p.R276Q	NM_000062.2	NP_000053.2	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G (C1 inhibitor), member 1	276					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(1)	27						AAGATCAGCCGGCTGCTAGAC	0.547																																						dbGAP											0													212.0	195.0	201.0					11																	57373624		2201	4296	6497	-	-	-	SO:0001583	missense	0			X54486	CCDS7962.1	11q12.1	2014-09-17	2008-07-31		ENSG00000149131	ENSG00000149131		"""Serine (or cysteine) peptidase inhibitors"""	1228	protein-coding gene	gene with protein product	"""plasma protease C1 inhibitor"", ""angioedema, hereditary"""	606860	"""serine (or cysteine) proteinase inhibitor, clade G (C1 inhibitor), member 1, (angioedema, hereditary)"""	C1NH		2026152, 24172014	Standard	NM_000062		Approved	C1IN, C1-INH, HAE1, HAE2	uc001nkp.1	P05155	OTTHUMG00000150304	ENST00000278407.4:c.827G>A	11.37:g.57373624G>A	ENSP00000278407:p.Arg276Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMU0|A8KAI9|B2R6L5|B4E1F0|B4E1H2|Q16304|Q547W3|Q59EI5|Q7Z455|Q96FE0|Q9UC49|Q9UCF9	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.R276Q	ENST00000278407.4	37	c.827	CCDS7962.1	11	.	.	.	.	.	.	.	.	.	.	G	4.290	0.053090	0.08291	.	.	ENSG00000149131	ENST00000278407;ENST00000340687;ENST00000378323;ENST00000378324;ENST00000403558	D;D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24;-2.24	4.99	-2.2	0.06994	Serpin domain (3);	1.649940	0.03232	N	0.179123	T	0.71178	0.3309	N	0.04297	-0.235	0.09310	N	1	B;B;B;B	0.18013	0.025;0.008;0.025;0.025	B;B;B;B	0.06405	0.002;0.002;0.001;0.001	T	0.59413	-0.7459	10	0.38643	T	0.18	.	5.3919	0.16249	0.5229:0.1445:0.3326:0.0	.	281;310;276;276	B4E1F0;E9PGN7;E9KL26;P05155	.;.;.;IC1_HUMAN	Q	276;276;281;224;310	ENSP00000278407:R276Q;ENSP00000341861:R276Q;ENSP00000367574:R281Q;ENSP00000367575:R224Q;ENSP00000384420:R310Q	ENSP00000278407:R276Q	R	+	2	0	SERPING1	57130200	0.000000	0.05858	0.000000	0.03702	0.216000	0.24613	0.110000	0.15437	-0.648000	0.05437	-0.459000	0.05422	CGG	SERPING1	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000149131		0.547	SERPING1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SERPING1	HGNC	protein_coding	OTTHUMT00000317465.1	77	0.00	0	G	NM_000062		57373624	57373624	+1	no_errors	ENST00000278407	ensembl	human	known	69_37n	missense	39	31.58	18	SNP	0.000	A
SFMBT2	57713	genome.wustl.edu	37	10	7218087	7218087	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr10:7218087G>A	ENST00000361972.4	-	17	1939	c.1849C>T	c.(1849-1851)Cgg>Tgg	p.R617W	SFMBT2_ENST00000397167.1_Missense_Mutation_p.R617W	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	617					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.R617G(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TCAGATGTCCGTACGATTTTG	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											108.0	107.0	107.0					10																	7218087		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1849C>T	10.37:g.7218087G>A	ENSP00000355109:p.Arg617Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD09|Q9HCF5	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.R617W	ENST00000361972.4	37	c.1849	CCDS31138.1	10	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648095	0.67358	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.47528	0.84;0.84	5.96	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.68522	0.3010	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72868	-0.4162	10	0.72032	D	0.01	.	16.3303	0.83006	0.0:0.0:0.8669:0.1331	.	617	Q5VUG0	SMBT2_HUMAN	W	617	ENSP00000355109:R617W;ENSP00000380353:R617W	ENSP00000355109:R617W	R	-	1	2	SFMBT2	7258093	1.000000	0.71417	0.041000	0.18516	0.283000	0.27025	5.140000	0.64807	1.468000	0.48064	0.655000	0.94253	CGG	SFMBT2	-	pfam_DUF3588	ENSG00000198879		0.468	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1	68	0.00	0	G	NM_001029880		7218087	7218087	-1	no_errors	ENST00000361972	ensembl	human	known	69_37n	missense	67	22.99	20	SNP	0.998	A
POMK	84197	genome.wustl.edu	37	8	42977594	42977594	+	Silent	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr8:42977594G>A	ENST00000331373.5	+	5	882	c.627G>A	c.(625-627)ccG>ccA	p.P209P		NM_001277971.1|NM_032237.3	NP_001264900.1|NP_115613.1	Q9H5K3	SG196_HUMAN	protein-O-mannose kinase	209	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|carbohydrate phosphorylation (GO:0046835)|learning or memory (GO:0007611)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|protein O-linked glycosylation (GO:0006493)|sensory perception of pain (GO:0019233)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|carbohydrate kinase activity (GO:0019200)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)|protein kinase activity (GO:0004672)										ACGACCTGCCGAAGACACTGT	0.547																																						dbGAP											0													65.0	51.0	56.0					8																	42977594		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6141.1	8p11.21	2013-08-22			ENSG00000185900	ENSG00000185900			26267	protein-coding gene	gene with protein product		615247				16879967, 23519211	Standard	NM_001277971		Approved	FLJ23356, SgK196		Q9H5K3	OTTHUMG00000164100	ENST00000331373.5:c.627G>A	8.37:g.42977594G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,pfscan_Prot_kinase_cat_dom	p.P209	ENST00000331373.5	37	c.627	CCDS6141.1	8																																																																																			SGK196	-	superfamily_Kinase-like_dom,pfscan_Prot_kinase_cat_dom	ENSG00000185900		0.547	POMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK196	Clone_based_vega_gene	protein_coding	OTTHUMT00000377291.2	42	0.00	0	G	NM_032237		42977594	42977594	+1	no_errors	ENST00000331373	ensembl	human	known	69_37n	silent	55	15.38	10	SNP	1.000	A
SLC35G6	643664	genome.wustl.edu	37	17	7385307	7385307	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:7385307G>A	ENST00000412468.2	+	2	119	c.4G>A	c.(4-6)Gct>Act	p.A2T	ZBTB4_ENST00000380599.4_5'Flank|POLR2A_ENST00000322644.6_5'Flank|POLR2A_ENST00000572844.1_5'Flank|ZBTB4_ENST00000311403.4_Intron	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	2						integral component of membrane (GO:0016021)											TCCCTAACAGGCTGGCAGTCA	0.667																																						dbGAP											0													43.0	45.0	44.0					17																	7385307		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.4-1G>A	17.37:g.7385307G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DMT	p.A2T	ENST00000412468.2	37	c.4	CCDS45603.1	17	.	.	.	.	.	.	.	.	.	.	G	16.80	3.221854	0.58560	.	.	ENSG00000181222	ENST00000412468	T	0.34275	1.37	4.21	3.23	0.37069	.	.	.	.	.	T	0.41650	0.1168	N	0.24115	0.695	0.27189	N	0.960452	D	0.63880	0.993	D	0.70935	0.971	T	0.18777	-1.0326	8	.	.	.	-4.3124	9.7157	0.40274	0.0:0.0:0.6256:0.3744	.	2	P0C7Q6	S35G6_HUMAN	T	2	ENSP00000396523:A2T	.	A	+	1	0	SLC35G6	7326031	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	2.889000	0.48601	0.890000	0.36211	-0.475000	0.04921	GCT	SLC35G6	-	NULL	ENSG00000259224		0.667	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35G6	HGNC	protein_coding		62	0.00	0	G	NM_001102614	Missense_Mutation	7385307	7385307	+1	no_errors	ENST00000412468	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	1.000	A
SLC5A7	60482	genome.wustl.edu	37	2	108614339	108614341	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	TCA	TCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:108614339_108614341delTCA	ENST00000264047.2	+	5	770_772	c.494_496delTCA	c.(493-498)gtcatc>gtc	p.I167del	SLC5A7_ENST00000540517.1_In_Frame_Del_p.I62del|SLC5A7_ENST00000409059.1_In_Frame_Del_p.I167del	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	167					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	CACATTTCTGTCATCATCTCTGC	0.478																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.494_496delTCA	2.37:g.108614342_108614344delTCA	ENSP00000264047:p.Ile167del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TF2	In_Frame_Del	DEL	pfam_Na/solute_symporter,pfscan_Na/solute_symporter	p.I167in_frame_del	ENST00000264047.2	37	c.494_496	CCDS2074.1	2																																																																																			SLC5A7	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter	ENSG00000115665		0.478	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A7	HGNC	protein_coding	OTTHUMT00000253562.1	80	0.00	0	TCA			108614339	108614341	+1	no_errors	ENST00000264047	ensembl	human	known	69_37n	in_frame_del	48	23.81	15	DEL	1.000:0.999:1.000	-
SMARCC2	6601	genome.wustl.edu	37	12	56559113	56559113	+	Frame_Shift_Del	DEL	G	G	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr12:56559113delG	ENST00000267064.4	-	26	3214	c.3128delC	c.(3127-3129)cctfs	p.P1043fs	SMARCC2_ENST00000347471.4_Frame_Shift_Del_p.P1074fs|SMARCC2_ENST00000394023.3_Frame_Shift_Del_p.P1074fs|SMARCC2_ENST00000550164.1_Frame_Shift_Del_p.P1074fs|RP11-977G19.5_ENST00000553176.1_RNA	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	1043	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			ATGGGGTCCAGGGGGGGGAAC	0.577																																						dbGAP											0									,,	47,38,3933		0,0,47,2,34,1926	35.0	41.0	39.0		,,	4.5	1.0	12		38	49,80,7671		2,0,45,9,62,3782	no	codingComplex,codingComplex,codingComplex	SMARCC2	NM_139067.2,NM_003075.3,NM_001130420.1	,,	2,0,92,11,96,5708	A1A1,A1A2,A1R,A2A2,A2R,RR		1.6538,2.1155,1.8108	,,	,,	56559113	96,118,11604	2116	4167	6283	-	-	-	SO:0001589	frameshift_variant	0			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.3128delC	12.37:g.56559113delG	ENSP00000267064:p.Pro1043fs	Somatic		WXS	Illumina GAIIx	Phase_IV	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Frame_Shift_Del	DEL	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.P1043fs	ENST00000267064.4	37	c.3128	CCDS8907.1	12																																																																																			SMARCC2	-	NULL	ENSG00000139613		0.577	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	HGNC	protein_coding	OTTHUMT00000408370.1	10	0.00	0	G			56559113	56559113	-1	no_errors	ENST00000267064	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	1.000	-
SNAPC1	6617	genome.wustl.edu	37	14	62242911	62242911	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr14:62242911delT	ENST00000216294.4	+	5	737	c.633delT	c.(631-633)gatfs	p.D211fs	RP11-618G20.1_ENST00000555937.1_RNA	NM_003082.3	NP_003073.1	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex, polypeptide 1, 43kDa	211	SNAPC4-binding.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)	p.D214fs*1(2)		endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		TAAAGGATGATTTTTTTGACA	0.358																																					NSCLC(27;223 907 37180 39193 46568)	dbGAP											2	Insertion - Frameshift(2)	large_intestine(1)|ovary(1)											114.0	108.0	110.0					14																	62242911		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			Z47542	CCDS9755.1	14q22	2008-08-11	2002-08-29		ENSG00000023608	ENSG00000023608			11134	protein-coding gene	gene with protein product		600591	"""small nuclear RNA activating complex, polypeptide 1, 43kD"""			9644240	Standard	NM_003082		Approved	SNAP43, PTFgamma	uc001xft.3	Q16533	OTTHUMG00000140343	ENST00000216294.4:c.633delT	14.37:g.62242911delT	ENSP00000216294:p.Asp211fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_SNAPc_SNAP43	p.F213fs	ENST00000216294.4	37	c.633	CCDS9755.1	14																																																																																			SNAPC1	-	NULL	ENSG00000023608		0.358	SNAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPC1	HGNC	protein_coding	OTTHUMT00000276976.2	48	0.00	0	T	NM_003082		62242911	62242911	+1	no_errors	ENST00000216294	ensembl	human	known	69_37n	frame_shift_del	56	21.13	15	DEL	0.961	-
SPACA1	81833	genome.wustl.edu	37	6	88773880	88773880	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr6:88773880T>C	ENST00000237201.1	+	6	791	c.674T>C	c.(673-675)aTa>aCa	p.I225T	SPACA1_ENST00000462690.1_Intron	NM_030960.2	NP_112222.1	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	225					acrosome assembly (GO:0001675)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	20		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		GTGCTGACCATAGGAGTCATT	0.368																																						dbGAP											0													156.0	150.0	152.0					6																	88773880		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF203447	CCDS5014.1	6q15	2012-09-20			ENSG00000118434	ENSG00000118434			14967	protein-coding gene	gene with protein product		612739					Standard	NM_030960		Approved	SAMP32	uc003pmn.3	Q9HBV2	OTTHUMG00000015183	ENST00000237201.1:c.674T>C	6.37:g.88773880T>C	ENSP00000237201:p.Ile225Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.I225T	ENST00000237201.1	37	c.674	CCDS5014.1	6	.	.	.	.	.	.	.	.	.	.	T	1.859	-0.463231	0.04476	.	.	ENSG00000118434	ENST00000237201	T	0.28454	1.61	5.68	2.03	0.26663	.	0.449199	0.22488	N	0.059407	T	0.07773	0.0195	L	0.41079	1.255	0.09310	N	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.32771	-0.9894	10	0.27082	T	0.32	-2.2654	5.9711	0.19353	0.0:0.4932:0.0:0.5068	.	225	Q9HBV2	SACA1_HUMAN	T	225	ENSP00000237201:I225T	ENSP00000237201:I225T	I	+	2	0	SPACA1	88830599	0.973000	0.33851	0.520000	0.27837	0.122000	0.20287	1.037000	0.30241	0.442000	0.26555	0.477000	0.44152	ATA	SPACA1	-	NULL	ENSG00000118434		0.368	SPACA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPACA1	HGNC	protein_coding	OTTHUMT00000041459.1	75	0.00	0	T			88773880	88773880	+1	no_errors	ENST00000237201	ensembl	human	known	69_37n	missense	61	25.61	21	SNP	0.542	C
SPEN	23013	genome.wustl.edu	37	1	16260214	16260214	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:16260214delC	ENST00000375759.3	+	11	7683	c.7479delC	c.(7477-7479)agcfs	p.S2493fs		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2493	Pro-rich.|RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CACACCAGAGCCCCCCTACTA	0.597																																						dbGAP											0													81.0	77.0	78.0					1																	16260214		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.7479delC	1.37:g.16260214delC	ENSP00000364912:p.Ser2493fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Frame_Shift_Del	DEL	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.P2495fs	ENST00000375759.3	37	c.7479	CCDS164.1	1																																																																																			SPEN	-	NULL	ENSG00000065526		0.597	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	32	0.00	0	C	NM_015001		16260214	16260214	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	frame_shift_del	20	20.00	5	DEL	0.001	-
SRSF11	9295	genome.wustl.edu	37	1	70701196	70701196	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:70701196G>A	ENST00000370950.3	+	6	635	c.553G>A	c.(553-555)Gat>Aat	p.D185N	SRSF11_ENST00000370951.1_Missense_Mutation_p.D185N|SRSF11_ENST00000370949.1_Missense_Mutation_p.D125N|SRSF11_ENST00000405432.1_Missense_Mutation_p.D185N|SRSF11_ENST00000484162.1_3'UTR|SRSF11_ENST00000436161.2_3'UTR			Q05519	SRS11_HUMAN	serine/arginine-rich splicing factor 11	185					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|ovary(2)|skin(1)	6						TCTTGCTGCAGATCAGTTGCT	0.328																																						dbGAP											0													197.0	182.0	187.0					1																	70701196		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74002	CCDS647.1, CCDS53332.1	1p31.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000116754	ENSG00000116754		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10782	protein-coding gene	gene with protein product	"""SR splicing factor 11"""	602010	"""splicing factor, arginine/serine-rich 11"""	SFRS11		1896467, 20516191	Standard	NM_004768		Approved	p54, NET2	uc001des.3	Q05519	OTTHUMG00000009342	ENST00000370950.3:c.553G>A	1.37:g.70701196G>A	ENSP00000359988:p.Asp185Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T758|Q8IWE6	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D185N	ENST00000370950.3	37	c.553	CCDS647.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.674475	0.96764	.	.	ENSG00000116754	ENST00000370951;ENST00000370950;ENST00000405432;ENST00000395136;ENST00000370949	T	0.27104	1.69	5.77	5.77	0.91146	.	0.043831	0.85682	D	0.000000	T	0.40423	0.1116	M	0.74647	2.275	0.80722	D	1	D;D;D;D	0.58268	0.982;0.97;0.97;0.97	P;P;P;P	0.54965	0.765;0.681;0.681;0.681	T	0.33599	-0.9862	10	0.87932	D	0	.	19.9923	0.97371	0.0:0.0:1.0:0.0	.	125;185;185;185	Q5T757;Q6PJB9;Q8IWE6;Q05519	.;.;.;SRS11_HUMAN	N	185;185;185;185;125	ENSP00000378568:D185N	ENSP00000359987:D125N	D	+	1	0	SRSF11	70473784	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.823000	0.92018	2.729000	0.93468	0.585000	0.79938	GAT	SRSF11	-	NULL	ENSG00000116754		0.328	SRSF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRSF11	HGNC	protein_coding	OTTHUMT00000025889.1	151	0.00	0	G	NM_004768		70701196	70701196	+1	no_errors	ENST00000370950	ensembl	human	known	69_37n	missense	109	29.22	45	SNP	1.000	A
ST6GAL2	84620	genome.wustl.edu	37	2	107460277	107460277	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:107460277G>A	ENST00000409382.3	-	2	767	c.157C>T	c.(157-159)Ccg>Tcg	p.P53S	ST6GAL2_ENST00000409087.3_Missense_Mutation_p.P53S|AC016994.2_ENST00000425419.1_RNA|ST6GAL2_ENST00000361686.4_Missense_Mutation_p.P53S	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	53					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						CCCTGCACCGGCAGGAGCCTC	0.682																																						dbGAP											0													15.0	19.0	18.0					2																	107460277		2196	4291	6487	-	-	-	SO:0001583	missense	0			AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.157C>T	2.37:g.107460277G>A	ENSP00000386942:p.Pro53Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	pfam_Glyco_trans_29,superfamily_Glyco_hydro/deAcase_b/a-brl	p.P53S	ENST00000409382.3	37	c.157	CCDS2073.1	2	.	.	.	.	.	.	.	.	.	.	G	18.74	3.689224	0.68271	.	.	ENSG00000144057	ENST00000361686;ENST00000409382;ENST00000409087	T;T;T	0.26518	2.8;2.8;1.73	5.74	5.74	0.90152	.	0.049989	0.85682	D	0.000000	T	0.32526	0.0832	L	0.28458	0.855	0.54753	D	0.999984	P;P	0.51537	0.946;0.911	P;P	0.52758	0.708;0.514	T	0.00814	-1.1555	10	0.31617	T	0.26	-34.5678	18.8932	0.92413	0.0:0.0:1.0:0.0	.	53;53	Q96JF0-2;Q96JF0	.;SIAT2_HUMAN	S	53	ENSP00000355273:P53S;ENSP00000386942:P53S;ENSP00000387332:P53S	ENSP00000355273:P53S	P	-	1	0	ST6GAL2	106826709	1.000000	0.71417	0.999000	0.59377	0.798000	0.45092	5.556000	0.67307	2.701000	0.92244	0.655000	0.94253	CCG	ST6GAL2	-	NULL	ENSG00000144057		0.682	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ST6GAL2	HGNC	protein_coding	OTTHUMT00000330065.1	20	0.00	0	G	NM_032528		107460277	107460277	-1	no_errors	ENST00000361686	ensembl	human	known	69_37n	missense	6	53.85	7	SNP	1.000	A
SULF2	55959	genome.wustl.edu	37	20	46318931	46318931	+	Frame_Shift_Del	DEL	G	G	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr20:46318931delG	ENST00000359930.4	-	5	1527	c.676delC	c.(676-678)cacfs	p.H226fs	SULF2_ENST00000361612.4_Frame_Shift_Del_p.H226fs|SULF2_ENST00000467815.1_Frame_Shift_Del_p.H226fs|SULF2_ENST00000484875.1_Frame_Shift_Del_p.H226fs	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	226					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						TCAGGGCCGTGGGGGGCTGCA	0.572																																						dbGAP											0													146.0	119.0	128.0					20																	46318931		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.676delC	20.37:g.46318931delG	ENSP00000353007:p.His226fs	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Frame_Shift_Del	DEL	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.H226fs	ENST00000359930.4	37	c.676	CCDS13408.1	20																																																																																			SULF2	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	ENSG00000196562		0.572	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SULF2	HGNC	protein_coding	OTTHUMT00000079606.1	115	0.00	0	G	NM_018837		46318931	46318931	-1	no_errors	ENST00000359930	ensembl	human	known	69_37n	frame_shift_del	65	39.66	46	DEL	1.000	-
SVOP	55530	genome.wustl.edu	37	12	109311864	109311864	+	Missense_Mutation	SNP	C	C	T	rs575951583		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr12:109311864C>T	ENST00000299134.5	-	12	1108	c.1109G>A	c.(1108-1110)cGt>cAt	p.R370H		NM_018711.2	NP_061181.1	Q8N4V2	SVOP_HUMAN	SV2 related protein homolog (rat)	0						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	ion transmembrane transporter activity (GO:0015075)			breast(2)|lung(4)	6						CAGAAATAAACGCTCTTGCAA	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		18937	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													119.0	113.0	115.0					12																	109311864		1910	4103	6013	-	-	-	SO:0001583	missense	0			BC033587	CCDS73520.1	12q24.11	2011-07-12				ENSG00000166111			25417	protein-coding gene	gene with protein product		611699					Standard	NM_018711		Approved	DKFZp761H039	uc010sxh.1	Q8N4V2		ENST00000299134.5:c.1109G>A	12.37:g.109311864C>T	ENSP00000299134:p.Arg370His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NPW5	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R370H	ENST00000299134.5	37	c.1109		12	.	.	.	.	.	.	.	.	.	.	C	10.39	1.336885	0.24253	.	.	ENSG00000166111	ENST00000299134	.	.	.	5.35	0.871	0.19107	.	.	.	.	.	T	0.26448	0.0646	.	.	.	.	.	.	.	.	.	.	.	.	T	0.26916	-1.0089	3	.	.	.	-24.5176	1.432	0.02336	0.389:0.3205:0.1128:0.1777	.	.	.	.	H	370	.	.	R	-	2	0	SVOP	107835993	0.001000	0.12720	1.000000	0.80357	0.998000	0.95712	-1.682000	0.01935	0.222000	0.20900	0.557000	0.71058	CGT	SVOP	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000166111		0.498	SVOP-001	KNOWN	mRNA_start_NF|cds_start_NF|basic	protein_coding	SVOP	HGNC	protein_coding	OTTHUMT00000403982.1	104	0.00	0	C	NM_018711		109311864	109311864	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000299134	ensembl	human	known	69_37n	missense	103	11.21	13	SNP	0.996	T
SYCP2	10388	genome.wustl.edu	37	20	58452519	58452519	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr20:58452519delT	ENST00000357552.3	-	33	3296	c.3071delA	c.(3070-3072)aacfs	p.N1024fs	SYCP2_ENST00000371001.2_Frame_Shift_Del_p.N1024fs			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1024					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			ATCTTTATAGTTTTTTTTTGT	0.328																																						dbGAP											0													58.0	61.0	60.0					20																	58452519		2200	4295	6495	-	-	-	SO:0001589	frameshift_variant	0			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.3071delA	20.37:g.58452519delT	ENSP00000350162:p.Asn1024fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Frame_Shift_Del	DEL	NULL	p.N1024fs	ENST00000357552.3	37	c.3071	CCDS13482.1	20																																																																																			SYCP2	-	NULL	ENSG00000196074		0.328	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	77	0.00	0	T	NM_014258		58452519	58452519	-1	no_errors	ENST00000357552	ensembl	human	known	69_37n	frame_shift_del	104	17.46	22	DEL	1.000	-
SYT8	90019	genome.wustl.edu	37	11	1857151	1857151	+	Frame_Shift_Del	DEL	G	G	-	rs370047832		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr11:1857151delG	ENST00000381968.3	+	4	464	c.336delG	c.(334-336)ccgfs	p.P112fs	SYT8_ENST00000341958.3_Frame_Shift_Del_p.P98fs|SYT8_ENST00000483280.1_3'UTR|SYT8_ENST00000535046.1_Frame_Shift_Del_p.P250fs|SYT8_ENST00000436964.2_Frame_Shift_Del_p.P98fs	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	112					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AGTCCAGCCCGGGGGATGCTC	0.642																																						dbGAP											0													47.0	48.0	47.0					11																	1857151		2200	4299	6499	-	-	-	SO:0001589	frameshift_variant	0			AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.336delG	11.37:g.1857151delG	ENSP00000371394:p.Pro112fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFJ4|Q9NSV9	Frame_Shift_Del	DEL	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_Synaptotagmin,pfscan_C2_membr_targeting	p.D114fs	ENST00000381968.3	37	c.336	CCDS7726.2	11																																																																																			SYT8	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000149043		0.642	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT8	HGNC	protein_coding	OTTHUMT00000025013.4	26	0.00	0	G			1857151	1857151	+1	no_errors	ENST00000381968	ensembl	human	known	69_37n	frame_shift_del	13	31.58	6	DEL	0.000	-
TACC2	10579	genome.wustl.edu	37	10	123844356	123844356	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr10:123844356delC	ENST00000369005.1	+	4	2681	c.2341delC	c.(2341-2343)cccfs	p.P782fs	TACC2_ENST00000515273.1_Frame_Shift_Del_p.P782fs|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000453444.2_Frame_Shift_Del_p.P782fs|TACC2_ENST00000334433.3_Frame_Shift_Del_p.P782fs|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000515603.1_Frame_Shift_Del_p.P782fs	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	782					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				GGTGCCACATCCCCCCCAGGG	0.642																																						dbGAP											0													51.0	57.0	55.0					10																	123844356		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.2341delC	10.37:g.123844356delC	ENSP00000358001:p.Pro782fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Frame_Shift_Del	DEL	pfam_TACC	p.Q783fs	ENST00000369005.1	37	c.2341	CCDS7626.1	10																																																																																			TACC2	-	NULL	ENSG00000138162		0.642	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	HGNC	protein_coding	OTTHUMT00000090004.1	30	0.00	0	C			123844356	123844356	+1	no_errors	ENST00000334433	ensembl	human	known	69_37n	frame_shift_del	21	22.22	6	DEL	0.000	-
TAF2	6873	genome.wustl.edu	37	8	120774729	120774729	+	Silent	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr8:120774729G>A	ENST00000378164.2	-	19	2782	c.2484C>T	c.(2482-2484)ctC>ctT	p.L828L	TAF2_ENST00000519355.1_5'UTR	NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	828					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CTTCAAGAATGAGTCGCACAT	0.378																																						dbGAP											0													74.0	72.0	73.0					8																	120774729		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.2484C>T	8.37:g.120774729G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	NULL	p.H16Y	ENST00000378164.2	37	c.46	CCDS34937.1	8																																																																																			TAF2	-	NULL	ENSG00000064313		0.378	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF2	HGNC	protein_coding	OTTHUMT00000381436.1	59	0.00	0	G	NM_003184		120774729	120774729	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000523098	ensembl	human	known	69_37n	missense	74	28.85	30	SNP	0.398	A
TANC2	26115	genome.wustl.edu	37	17	61396410	61396410	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:61396410C>T	ENST00000424789.2	+	9	1316	c.1312C>T	c.(1312-1314)Cgc>Tgc	p.R438C	TANC2_ENST00000389520.4_Missense_Mutation_p.R438C|AC037445.1_ENST00000581421.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	438					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						TCCGGAAATGCGCAGGCGGCA	0.517																																						dbGAP											0													34.0	37.0	36.0					17																	61396410		2083	4221	6304	-	-	-	SO:0001583	missense	0			AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.1312C>T	17.37:g.61396410C>T	ENSP00000387593:p.Arg438Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.R438C	ENST00000424789.2	37	c.1312	CCDS45754.1	17	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516683	0.85495	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.68331	-0.32;-0.32	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.79263	0.4416	L	0.56769	1.78	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.66351	0.94;0.943	T	0.81019	-0.1122	10	0.72032	D	0.01	.	18.8852	0.92375	0.0:1.0:0.0:0.0	.	438;438	Q9HCD6-2;Q9HCD6	.;TANC2_HUMAN	C	438	ENSP00000374171:R438C;ENSP00000387593:R438C	ENSP00000374171:R438C	R	+	1	0	TANC2	58750142	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.698000	0.61789	2.472000	0.83506	0.585000	0.79938	CGC	TANC2	-	NULL	ENSG00000170921		0.517	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TANC2	HGNC	protein_coding	OTTHUMT00000444765.1	32	0.00	0	C			61396410	61396410	+1	no_errors	ENST00000424789	ensembl	human	known	69_37n	missense	25	30.56	11	SNP	1.000	T
TAS2R3	50831	genome.wustl.edu	37	7	141464156	141464156	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr7:141464156delT	ENST00000247879.2	+	1	260	c.198delT	c.(196-198)agtfs	p.S66fs	SSBP1_ENST00000465582.1_Intron	NM_016943.2	NP_058639.1	Q9NYW6	TA2R3_HUMAN	taste receptor, type 2, member 3	66					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)	14	Melanoma(164;0.0171)					TGACTGATAGTTTTTTAATAG	0.393																																						dbGAP											0										1,4259		0,1,2129	207.0	204.0	205.0			1.0	0.0	7		206	0,8252		0,0,4126	no	frameshift	TAS2R3	NM_016943.2		0,1,6255	A1A1,A1R,RR		0.0,0.0235,0.0080			141464156	1,12511	2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF227130	CCDS5867.1	7q31.3-q32	2012-08-22			ENSG00000127362	ENSG00000127362		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14910	protein-coding gene	gene with protein product		604868					Standard	NM_016943		Approved	T2R3	uc003vwp.1	Q9NYW6	OTTHUMG00000157637	ENST00000247879.2:c.198delT	7.37:g.141464156delT	ENSP00000247879:p.Ser66fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1U2|Q645W2|Q75MV6	Frame_Shift_Del	DEL	pfam_TAS2_rcpt	p.L68fs	ENST00000247879.2	37	c.198	CCDS5867.1	7																																																																																			TAS2R3	-	pfam_TAS2_rcpt	ENSG00000127362		0.393	TAS2R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R3	HGNC	protein_coding	OTTHUMT00000349288.1	83	0.00	0	T			141464156	141464156	+1	no_errors	ENST00000247879	ensembl	human	known	69_37n	frame_shift_del	145	14.71	25	DEL	0.000	-
TBC1D23	55773	genome.wustl.edu	37	3	100039736	100039736	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:100039736delA	ENST00000394144.4	+	18	1946	c.1939delA	c.(1939-1941)aaafs	p.K649fs	TBC1D23_ENST00000486274.1_3'UTR|TBC1D23_ENST00000344949.5_Frame_Shift_Del_p.K634fs|TBC1D23_ENST00000475134.1_Frame_Shift_Del_p.K512fs	NM_001199198.2	NP_001186127.1	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	649					positive regulation of interleukin-6 production (GO:0032755)|regulation of inflammatory response (GO:0050727)|regulation of tumor necrosis factor production (GO:0032680)		Rab GTPase activator activity (GO:0005097)	p.?(2)|p.H650fs*3(1)|p.H635fs*3(1)		breast(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(10)|ovary(1)|prostate(2)|skin(2)	25						AATTACATCCAAAAAAAAACA	0.353																																						dbGAP											4	Unknown(2)|Insertion - Frameshift(2)	large_intestine(2)|skin(2)											72.0	73.0	73.0					3																	100039736		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK001908	CCDS2936.1, CCDS56265.1	3q12.2	2013-07-10			ENSG00000036054	ENSG00000036054			25622	protein-coding gene	gene with protein product						22312129	Standard	NM_001199198		Approved	FLJ11046	uc003dtt.4	Q9NUY8	OTTHUMG00000159067	ENST00000394144.4:c.1939delA	3.37:g.100039736delA	ENSP00000377700:p.Lys649fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A6M5|Q8TCN8|Q8WUB7|Q96D90|Q9NV75	Frame_Shift_Del	DEL	pfam_Rab-GTPase-TBC_dom,pfam_Rhodanese-like_dom,superfamily_Rab-GTPase-TBC_dom,superfamily_Rhodanese-like_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Rhodanese-like_dom	p.K649fs	ENST00000394144.4	37	c.1939	CCDS56265.1	3																																																																																			TBC1D23	-	NULL	ENSG00000036054		0.353	TBC1D23-002	KNOWN	basic|CCDS	protein_coding	TBC1D23	HGNC	protein_coding	OTTHUMT00000353150.1	63	0.00	0	A	NM_018309		100039736	100039736	+1	no_errors	ENST00000394144	ensembl	human	known	69_37n	frame_shift_del	42	25.42	15	DEL	1.000	-
TCEAL6	158931	genome.wustl.edu	37	X	101396134	101396134	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chrX:101396134T>G	ENST00000372774.3	-	3	419	c.170A>C	c.(169-171)gAg>gCg	p.E57A	TCEAL6_ENST00000372773.1_Missense_Mutation_p.E57A	NM_001006938.2	NP_001006939.2	Q6IPX3	TCAL6_HUMAN	transcription elongation factor A (SII)-like 6	57	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	14						CAGTTGtccctcatcacctgg	0.572																																						dbGAP											0													153.0	124.0	134.0					X																	101396134		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC071675	CCDS43978.1	Xq22.1	2014-03-21			ENSG00000204071	ENSG00000204071			24553	protein-coding gene	gene with protein product						16221301	Standard	NM_001006938		Approved	WEX2	uc004eiq.3	Q6IPX3	OTTHUMG00000022050	ENST00000372774.3:c.170A>C	X.37:g.101396134T>G	ENSP00000361860:p.Glu57Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9J8	Missense_Mutation	SNP	pfam_TF_A-like/BEX-like	p.E57A	ENST00000372774.3	37	c.170	CCDS43978.1	X	.	.	.	.	.	.	.	.	.	.	T	13.58	2.278910	0.40294	.	.	ENSG00000204071	ENST00000372774;ENST00000372773;ENST00000536102	T;T	0.26067	1.76;1.76	2.24	2.24	0.28232	.	0.934806	0.08723	N	0.903114	T	0.25865	0.0630	L	0.60845	1.875	0.09310	N	1	P	0.44139	0.827	B	0.41510	0.359	T	0.14200	-1.0481	10	0.29301	T	0.29	.	7.6183	0.28171	0.0:0.0:0.0:1.0	.	57	Q6IPX3-2	.	A	57	ENSP00000361860:E57A;ENSP00000361859:E57A	ENSP00000361859:E57A	E	-	2	0	TCEAL6	101282790	0.001000	0.12720	0.020000	0.16555	0.227000	0.25037	0.132000	0.15891	1.122000	0.41944	0.381000	0.24937	GAG	TCEAL6	-	pfam_TF_A-like/BEX-like	ENSG00000204071		0.572	TCEAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEAL6	HGNC	protein_coding	OTTHUMT00000057609.1	135	0.00	0	T	NM_001006938		101396134	101396134	-1	no_errors	ENST00000372773	ensembl	human	known	69_37n	missense	83	12.63	12	SNP	0.101	G
TCERG1	10915	genome.wustl.edu	37	5	145886723	145886723	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:145886723delA	ENST00000296702.5	+	19	2901	c.2863delA	c.(2863-2865)aaafs	p.K957fs	TCERG1_ENST00000394421.2_Frame_Shift_Del_p.K936fs	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	957	FF 5.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGCACTTACCAAAAAAAAGAG	0.373																																						dbGAP											0													84.0	88.0	87.0					5																	145886723		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.2863delA	5.37:g.145886723delA	ENSP00000296702:p.Lys957fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKN2|Q59EA1	Frame_Shift_Del	DEL	pfam_FF_domain,pfam_WW_Rsp5_WWP,superfamily_FF_domain,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_FF_domain,pfscan_WW_Rsp5_WWP	p.K957fs	ENST00000296702.5	37	c.2863	CCDS4282.1	5																																																																																			TCERG1	-	pfam_FF_domain,superfamily_FF_domain,smart_FF_domain	ENSG00000113649		0.373	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCERG1	HGNC	protein_coding	OTTHUMT00000251886.1	49	0.00	0	A	NM_001040006		145886723	145886723	+1	no_errors	ENST00000296702	ensembl	human	known	69_37n	frame_shift_del	51	26.09	18	DEL	1.000	-
TDRD10	126668	genome.wustl.edu	37	1	154516982	154516982	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:154516982C>T	ENST00000368480.3	+	10	871	c.786C>T	c.(784-786)caC>caT	p.H262H	TDRD10_ENST00000368482.4_Silent_p.H262H|TDRD10_ENST00000479937.1_3'UTR			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	262	Tudor.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			ATTATGGACACGCCTGGAACA	0.607																																						dbGAP											0													28.0	31.0	30.0					1																	154516982		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.786C>T	1.37:g.154516982C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Silent	SNP	pfam_Tudor,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.H262	ENST00000368480.3	37	c.786	CCDS41406.1	1																																																																																			TDRD10	-	pfam_Tudor	ENSG00000163239		0.607	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD10	HGNC	protein_coding	OTTHUMT00000090700.2	17	0.00	0	C	NM_182499		154516982	154516982	+1	no_errors	ENST00000368480	ensembl	human	known	69_37n	silent	21	22.22	6	SNP	0.018	T
TFPI	7035	genome.wustl.edu	37	2	188332651	188332651	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:188332651C>T	ENST00000233156.3	-	7	931	c.637G>A	c.(637-639)Ggt>Agt	p.G213S	AC007319.1_ENST00000453517.1_RNA|TFPI_ENST00000392365.1_Missense_Mutation_p.G213S|AC007319.1_ENST00000412276.1_RNA	NM_006287.4	NP_006278.1	P10646	TFPI1_HUMAN	tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)	213					blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0554)		Coagulation factor VIIa(DB00036)|Dalteparin(DB06779)	CATGAGGGACCGTGAAATTCT	0.388																																						dbGAP											0													78.0	74.0	75.0					2																	188332651		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2294.1, CCDS33349.1	2q32	2008-06-02			ENSG00000003436	ENSG00000003436			11760	protein-coding gene	gene with protein product	"""extrinsic pathway inhibitor"""	152310		LACI		1993173	Standard	XM_005246818		Approved	EPI, TFI, TFPI1	uc002upy.3	P10646	OTTHUMG00000132634	ENST00000233156.3:c.637G>A	2.37:g.188332651C>T	ENSP00000233156:p.Gly213Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O95103|Q53TS4	Missense_Mutation	SNP	pirsf_Prot_inhib_I2_TFPI,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.G213S	ENST00000233156.3	37	c.637	CCDS2294.1	2	.	.	.	.	.	.	.	.	.	.	C	9.822	1.186125	0.21870	.	.	ENSG00000003436	ENST00000392365;ENST00000233156;ENST00000426055;ENST00000435414	T;T;T;T	0.62941	0.47;0.47;0.47;-0.01	5.59	1.78	0.24846	Proteinase inhibitor I2, Kunitz metazoa (2);	0.354079	0.30800	N	0.008858	T	0.47266	0.1436	L	0.52364	1.645	0.09310	N	1	D	0.63046	0.992	B	0.44085	0.44	T	0.43261	-0.9402	10	0.09590	T	0.72	.	4.3358	0.11085	0.0:0.5637:0.1677:0.2686	.	213	P10646	TFPI1_HUMAN	S	213;213;213;200	ENSP00000376172:G213S;ENSP00000233156:G213S;ENSP00000397248:G213S;ENSP00000409177:G200S	ENSP00000233156:G213S	G	-	1	0	TFPI	188040896	0.000000	0.05858	0.005000	0.12908	0.112000	0.19704	-0.134000	0.10436	0.306000	0.22856	-0.259000	0.10710	GGT	TFPI	-	pirsf_Prot_inhib_I2_TFPI,superfamily_Prot_inh_Kunz-m	ENSG00000003436		0.388	TFPI-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TFPI	HGNC	protein_coding	OTTHUMT00000255881.1	43	0.00	0	C	NM_006287		188332651	188332651	-1	no_errors	ENST00000233156	ensembl	human	known	69_37n	missense	54	22.86	16	SNP	0.003	T
TLR7	51284	genome.wustl.edu	37	X	12906029	12906029	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chrX:12906029C>T	ENST00000380659.3	+	3	2541	c.2402C>T	c.(2401-2403)aCg>aTg	p.T801M		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	801					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	GTTAACCATACGGAGGTGACT	0.493																																						dbGAP											0													124.0	109.0	114.0					X																	12906029		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.2402C>T	X.37:g.12906029C>T	ENSP00000370034:p.Thr801Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D1CS69|Q9NR98	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_TIR_dom,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.T801M	ENST00000380659.3	37	c.2402	CCDS14151.1	X	.	.	.	.	.	.	.	.	.	.	C	19.25	3.791675	0.70452	.	.	ENSG00000196664	ENST00000380659	T	0.37915	1.17	5.66	5.66	0.87406	Cysteine-rich flanking region, C-terminal (1);	0.061093	0.64402	D	0.000005	T	0.60689	0.2288	M	0.85041	2.73	0.80722	D	1	D	0.63880	0.993	P	0.55667	0.781	T	0.68002	-0.5524	10	0.72032	D	0.01	.	18.782	0.91937	0.0:1.0:0.0:0.0	.	801	Q9NYK1	TLR7_HUMAN	M	801	ENSP00000370034:T801M	ENSP00000370034:T801M	T	+	2	0	TLR7	12815950	1.000000	0.71417	0.578000	0.28575	0.981000	0.71138	6.027000	0.70881	2.381000	0.81170	0.529000	0.55759	ACG	TLR7	-	smart_Cys-rich_flank_reg_C	ENSG00000196664		0.493	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR7	HGNC	protein_coding	OTTHUMT00000055769.1	98	0.00	0	C	NM_016562		12906029	12906029	+1	no_errors	ENST00000380659	ensembl	human	known	69_37n	missense	40	28.57	16	SNP	0.998	T
TMBIM4	51643	genome.wustl.edu	37	12	66531937	66531937	+	Frame_Shift_Del	DEL	A	A	-	rs199863727	byFrequency	TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr12:66531937delA	ENST00000358230.3	-	7	640	c.520delT	c.(520-522)tatfs	p.Y174fs	TMBIM4_ENST00000544599.1_5'UTR|TMBIM4_ENST00000556010.1_Intron|TMBIM4_ENST00000542724.1_Frame_Shift_Del_p.Y143fs|TMBIM4_ENST00000539652.1_Intron|TMBIM4_ENST00000286424.7_Frame_Shift_Del_p.Y221fs|TMBIM4_ENST00000398033.4_Frame_Shift_Del_p.F158fs	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	174					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		ATCTCACTATAAAAAAAAAAC	0.353																																						dbGAP											0										30,27,3421		0,0,30,0,27,1682	40.0	38.0	38.0			6.2	0.1	12		41	61,77,7666		0,0,61,0,77,3764	no	codingComplex	TMBIM4	NM_016056.2		0,0,91,0,104,5446	A1A1,A1A2,A1R,A2A2,A2R,RR		1.7683,1.6389,1.7284			66531937	91,104,11087	1806	4076	5882	-	-	-	SO:0001589	frameshift_variant	0			AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.520delT	12.37:g.66531937delA	ENSP00000350965:p.Tyr174fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q542Z6|Q9UHY5|Q9Y3C2	Frame_Shift_Del	DEL	pfam_Bax_inhibitor_1-related	p.Y174fs	ENST00000358230.3	37	c.520	CCDS41805.1	12																																																																																			TMBIM4	-	pfam_Bax_inhibitor_1-related	ENSG00000155957		0.353	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMBIM4	HGNC	protein_coding	OTTHUMT00000401832.2	22	0.00	0	A	NM_016056		66531937	66531937	-1	no_errors	ENST00000358230	ensembl	human	known	69_37n	frame_shift_del	35	12.50	5	DEL	0.028	-
TMEM132C	92293	genome.wustl.edu	37	12	128899747	128899747	+	Missense_Mutation	SNP	C	C	T	rs557263376		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr12:128899747C>T	ENST00000435159.2	+	2	556	c.556C>T	c.(556-558)Cgg>Tgg	p.R186W		NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	186						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						GGGCAGCTGCCGGCTGAAGGG	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		15002	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													11.0	15.0	14.0					12																	128899747		692	1589	2281	-	-	-	SO:0001583	missense	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.556C>T	12.37:g.128899747C>T	ENSP00000410852:p.Arg186Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YX8	Missense_Mutation	SNP	NULL	p.R186W	ENST00000435159.2	37	c.556		12	.	.	.	.	.	.	.	.	.	.	C	19.21	3.783675	0.70222	.	.	ENSG00000181234	ENST00000435159	T	0.13657	2.57	5.09	4.14	0.48551	.	.	.	.	.	T	0.40015	0.1100	M	0.84683	2.71	0.39283	D	0.9646	D	0.89917	1.0	D	0.73708	0.981	T	0.47837	-0.9086	9	0.87932	D	0	.	13.4672	0.61260	0.2811:0.7189:0.0:0.0	.	186	Q8N3T6	T132C_HUMAN	W	186	ENSP00000410852:R186W	ENSP00000410852:R186W	R	+	1	2	TMEM132C	127465700	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	0.929000	0.28844	2.519000	0.84933	0.655000	0.94253	CGG	TMEM132C	-	NULL	ENSG00000181234		0.647	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		23	0.00	0	C	XM_044062		128899747	128899747	+1	no_errors	ENST00000435159	ensembl	human	known	69_37n	missense	17	25.00	6	SNP	1.000	T
TMEM139	135932	genome.wustl.edu	37	7	142983891	142983891	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr7:142983891delT	ENST00000359333.3	+	3	1133	c.620delT	c.(619-621)gttfs	p.V207fs	CASP2_ENST00000310447.5_5'Flank|AC073342.12_ENST00000446192.1_RNA|TMEM139_ENST00000409102.1_Frame_Shift_Del_p.V207fs|AC073342.12_ENST00000427392.1_RNA|TMEM139_ENST00000410004.1_Frame_Shift_Del_p.V207fs|TMEM139_ENST00000409244.1_Frame_Shift_Del_p.V207fs|CASP2_ENST00000392925.2_5'Flank|TMEM139_ENST00000471161.1_3'UTR|TMEM139_ENST00000409541.1_Frame_Shift_Del_p.V207fs	NM_001242775.2|NM_001282876.1|NM_001282877.1	NP_001229704.1|NP_001269805.1|NP_001269806.1	Q8IV31	TM139_HUMAN	transmembrane protein 139	207						integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|ovary(1)|prostate(1)	7	Melanoma(164;0.059)					GATGATAGTGTTTTTTATGAG	0.507																																						dbGAP											0									,,,,,	0,4264		0,0,2132	150.0	142.0	145.0		,,,,,	5.3	1.0	7		145	1,8253		0,1,4126	no	frameshift,frameshift,frameshift,frameshift,frameshift,frameshift	TMEM139	NM_153345.2,NM_001242777.1,NM_001242776.1,NM_001242775.1,NM_001242774.1,NM_001242773.1	,,,,,	0,1,6258	A1A1,A1R,RR		0.0121,0.0,0.0080	,,,,,	,,,,,	142983891	1,12517	2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK075067	CCDS5878.1	7q34	2006-03-17			ENSG00000178826	ENSG00000178826			22058	protein-coding gene	gene with protein product							Standard	NM_153345		Approved	FLJ90586	uc003wck.4	Q8IV31	OTTHUMG00000152652	ENST00000359333.3:c.620delT	7.37:g.142983891delT	ENSP00000352284:p.Val207fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCL5|D3DXD4|Q6ZME2|Q8NC22|Q96AU8	Frame_Shift_Del	DEL	NULL	p.Y209fs	ENST00000359333.3	37	c.620	CCDS5878.1	7																																																																																			TMEM139	-	NULL	ENSG00000178826		0.507	TMEM139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM139	HGNC	protein_coding	OTTHUMT00000327145.1	79	0.00	0	T	NM_153345		142983891	142983891	+1	no_errors	ENST00000359333	ensembl	human	known	69_37n	frame_shift_del	69	21.11	19	DEL	1.000	-
TMEM63A	9725	genome.wustl.edu	37	1	226041376	226041376	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:226041376C>T	ENST00000366835.3	-	19	2021	c.1751G>A	c.(1750-1752)cGc>cAc	p.R584H		NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	584					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)			breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					CATGATCATGCGGAAGGTATA	0.602																																						dbGAP											0													53.0	38.0	43.0					1																	226041376		2199	4299	6498	-	-	-	SO:0001583	missense	0				CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.1751G>A	1.37:g.226041376C>T	ENSP00000355800:p.Arg584His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53GI7|Q5TE96|Q8N2U2	Missense_Mutation	SNP	pfam_DUF221	p.R584H	ENST00000366835.3	37	c.1751	CCDS31042.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.555443	0.96514	.	.	ENSG00000196187	ENST00000366835	T	0.33216	1.42	5.45	5.45	0.79879	Domain of unknown function DUF221 (1);	0.000000	0.85682	D	0.000000	T	0.60689	0.2288	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.63866	-0.6540	10	0.59425	D	0.04	-32.9894	19.2875	0.94084	0.0:1.0:0.0:0.0	.	584	O94886	TM63A_HUMAN	H	584	ENSP00000355800:R584H	ENSP00000355800:R584H	R	-	2	0	TMEM63A	224107999	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.708000	0.84633	2.562000	0.86427	0.563000	0.77884	CGC	TMEM63A	-	pfam_DUF221	ENSG00000196187		0.602	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63A	HGNC	protein_coding	OTTHUMT00000091154.2	45	0.00	0	C	NM_014698		226041376	226041376	-1	no_errors	ENST00000366835	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	T
TMEM97	27346	genome.wustl.edu	37	17	26653807	26653807	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:26653807delA	ENST00000226230.6	+	3	664	c.519delA	c.(517-519)agafs	p.R173fs	TMEM97_ENST00000583381.1_Frame_Shift_Del_p.R66fs|TMEM97_ENST00000336687.6_Frame_Shift_Del_p.R66fs	NM_014573.2	NP_055388.2	Q5BJF2	TMM97_HUMAN	transmembrane protein 97	173					cholesterol homeostasis (GO:0042632)|regulation of cell growth (GO:0001558)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)		p.K176fs?(1)		endometrium(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	6	all_lung(13;0.000238)|Lung NSC(42;0.000789)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		AAGAGAAAAGAAAAAAAAAAT	0.438																																						dbGAP											1	Deletion - Frameshift(1)	lung(1)								25,25,4214		0,0,25,0,25,2082	59.0	56.0	57.0			2.6	1.0	17		58	45,41,8168		0,0,45,0,41,4041	no	codingComplex	TMEM97	NM_014573.2		0,0,70,0,66,6123	A1A1,A1A2,A1R,A2A2,A2R,RR		1.0419,1.1726,1.0864			26653807	70,66,12382	2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC091504	CCDS11226.2	17q11.2	2014-01-28			ENSG00000109084	ENSG00000109084			28106	protein-coding gene	gene with protein product		612912				7694637, 15375745	Standard	NM_014573		Approved	MAC30	uc002hat.3	Q5BJF2	OTTHUMG00000132497	ENST00000226230.6:c.519delA	17.37:g.26653807delA	ENSP00000226230:p.Arg173fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DS02|Q07823	Frame_Shift_Del	DEL	pfam_Transmembrane_6/97,pirsf_Transmembrane_6/97	p.K176fs	ENST00000226230.6	37	c.519	CCDS11226.2	17																																																																																			TMEM97	-	pirsf_Transmembrane_6/97	ENSG00000109084		0.438	TMEM97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM97	HGNC	protein_coding	OTTHUMT00000255675.2	55	0.00	0	A	NM_014573		26653807	26653807	+1	no_errors	ENST00000226230	ensembl	human	known	69_37n	frame_shift_del	53	23.94	17	DEL	1.000	-
TMIGD1	388364	genome.wustl.edu	37	17	28645921	28645922	+	Frame_Shift_Del	DEL	CA	CA	-	rs183978584		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:28645921_28645922delCA	ENST00000328886.4	-	5	722_723	c.650_651delTG	c.(649-651)gtgfs	p.V217fs	TMIGD1_ENST00000538566.2_Intron	NM_206832.1	NP_996663.1	Q6UXZ0	TMIG1_HUMAN	transmembrane and immunoglobulin domain containing 1	217						integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	12						TTGGTACACCCACAGTTTTATC	0.376																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY358153	CCDS32605.1	17q11.2	2013-01-29	2006-07-05	2006-07-05		ENSG00000182271		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32431	protein-coding gene	gene with protein product				TMIGD		12975309	Standard	NM_206832		Approved	UNQ9372	uc002hfa.1	Q6UXZ0		ENST00000328886.4:c.650_651delTG	17.37:g.28645923_28645924delCA	ENSP00000332404:p.Val217fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2K1|Q6ZMC6	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V217fs	ENST00000328886.4	37	c.651_650	CCDS32605.1	17																																																																																			TMIGD1	-	NULL	ENSG00000182271		0.376	TMIGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMIGD1	HGNC	protein_coding	OTTHUMT00000447955.1	91	0.00	0	CA	NM_206832		28645921	28645922	-1	no_errors	ENST00000328886	ensembl	human	known	69_37n	frame_shift_del	86	17.31	18	DEL	0.000:0.000	-
TNS1	7145	genome.wustl.edu	37	2	218682600	218682600	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:218682600G>T	ENST00000171887.4	-	24	4595	c.4143C>A	c.(4141-4143)agC>agA	p.S1381R	TNS1_ENST00000430930.1_Missense_Mutation_p.S1360R|TNS1_ENST00000419504.1_Missense_Mutation_p.S1368R	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	1381					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CTGGTGTTGGGCTCCCTTGCC	0.642																																						dbGAP											0													71.0	62.0	65.0					2																	218682600		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.4143C>A	2.37:g.218682600G>T	ENSP00000171887:p.Ser1381Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.S1381R	ENST00000171887.4	37	c.4143	CCDS2407.1	2	.	.	.	.	.	.	.	.	.	.	G	18.86	3.714122	0.68730	.	.	ENSG00000079308	ENST00000171887;ENST00000446688;ENST00000419504;ENST00000430930	D;T;D;D	0.91945	-2.94;2.07;-2.94;-2.94	5.21	2.42	0.29668	.	0.291803	0.35179	N	0.003399	D	0.94032	0.8088	L	0.56769	1.78	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.995	D;D;P	0.83275	0.996;0.99;0.9	D	0.93089	0.6498	10	0.72032	D	0.01	.	10.5336	0.44992	0.2132:0.0:0.7868:0.0	.	1381;1360;1368	Q9HBL0;E9PGF5;E9PF55	TENS1_HUMAN;.;.	R	1381;519;1368;1360	ENSP00000171887:S1381R;ENSP00000394171:S519R;ENSP00000408724:S1368R;ENSP00000406016:S1360R	ENSP00000171887:S1381R	S	-	3	2	TNS1	218390845	0.991000	0.36638	0.997000	0.53966	0.912000	0.54170	0.180000	0.16860	0.599000	0.29845	0.650000	0.86243	AGC	TNS1	-	NULL	ENSG00000079308		0.642	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNS1	HGNC	protein_coding	OTTHUMT00000256672.2	49	0.00	0	G	NM_022648		218682600	218682600	-1	no_errors	ENST00000171887	ensembl	human	known	69_37n	missense	13	40.91	9	SNP	1.000	T
TOX3	27324	genome.wustl.edu	37	16	52484428	52484428	+	Missense_Mutation	SNP	G	G	A	rs573103587		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr16:52484428G>A	ENST00000219746.9	-	4	723	c.439C>T	c.(439-441)Cgg>Tgg	p.R147W	TOX3_ENST00000407228.3_Missense_Mutation_p.R142W	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	147					apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						GGATCCTGCCGGTACTGGGAC	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		18287	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													79.0	83.0	82.0					16																	52484428		2046	4189	6235	-	-	-	SO:0001583	missense	0			U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.439C>T	16.37:g.52484428G>A	ENSP00000219746:p.Arg147Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRD0|B5MCW4	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.R147W	ENST00000219746.9	37	c.439	CCDS54009.1	16	.	.	.	.	.	.	.	.	.	.	G	15.84	2.951015	0.53186	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.42900	0.96;0.96	5.85	4.89	0.63831	.	0.381500	0.26460	N	0.024246	T	0.38692	0.1050	L	0.44542	1.39	0.41055	D	0.985334	D;D	0.62365	0.991;0.991	B;B	0.44315	0.425;0.446	T	0.37103	-0.9720	10	0.72032	D	0.01	.	11.8758	0.52546	0.0:0.1327:0.7293:0.138	.	142;147	B4DRD0;O15405	.;TOX3_HUMAN	W	147;142	ENSP00000219746:R147W;ENSP00000385705:R142W	ENSP00000219746:R147W	R	-	1	2	TOX3	51041929	1.000000	0.71417	0.654000	0.29608	0.001000	0.01503	7.412000	0.80091	1.464000	0.47987	-0.300000	0.09419	CGG	TOX3	-	NULL	ENSG00000103460		0.532	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TOX3	HGNC	protein_coding	OTTHUMT00000422534.1	45	0.00	0	G	XM_049037		52484428	52484428	-1	no_errors	ENST00000219746	ensembl	human	known	69_37n	missense	29	27.50	11	SNP	0.998	A
TPH2	121278	genome.wustl.edu	37	12	72335393	72335393	+	Silent	SNP	C	C	T	rs74510566		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr12:72335393C>T	ENST00000333850.3	+	2	276	c.135C>T	c.(133-135)gaC>gaT	p.D45D	TPH2_ENST00000546576.1_3'UTR	NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	45					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)	p.D45D(2)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	GCAAAAATGACGACAAAGGCA	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		6803	0.0		0.001	False		,,,				2504	0.0					dbGAP											2	Substitution - coding silent(2)	ovary(1)|lung(1)											82.0	76.0	78.0					12																	72335393		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.135C>T	12.37:g.72335393C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGA4|Q14CB0	Silent	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Trp_5_mOase	p.D45	ENST00000333850.3	37	c.135	CCDS31859.1	12																																																																																			TPH2	-	pirsf_Tyrosine_3-monooxygenase-like	ENSG00000139287		0.393	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPH2	HGNC	protein_coding	OTTHUMT00000405234.1	43	0.00	0	C	NM_173353		72335393	72335393	+1	no_errors	ENST00000333850	ensembl	human	known	69_37n	silent	50	19.35	12	SNP	0.918	T
TRIM35	23087	genome.wustl.edu	37	8	27151640	27151640	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr8:27151640C>T	ENST00000305364.4	-	3	802	c.719G>A	c.(718-720)cGg>cAg	p.R240Q	TRIM35_ENST00000521253.1_Missense_Mutation_p.R208Q	NM_171982.3	NP_741983.2	Q9UPQ4	TRI35_HUMAN	tripartite motif containing 35	240					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	14		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|Epithelial(17;9.34e-10)|Colorectal(74;0.141)		CATCTGCAGCCGCTCGATCTC	0.562																																						dbGAP											0													112.0	93.0	99.0					8																	27151640		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029021	CCDS6056.2	8p21.2	2013-01-09	2011-01-25		ENSG00000104228	ENSG00000104228		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16285	protein-coding gene	gene with protein product			"""tripartite motif-containing 35"""			11331580, 14662771, 12692137	Standard	XM_005273451		Approved	KIAA1098, MAIR, HLS5	uc003xfl.1	Q9UPQ4	OTTHUMG00000102047	ENST00000305364.4:c.719G>A	8.37:g.27151640C>T	ENSP00000301924:p.Arg240Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XQ0|Q8WVA4	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R240Q	ENST00000305364.4	37	c.719	CCDS6056.2	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.177|9.177	1.022548|1.022548	0.19433|0.19433	.|.	.|.	ENSG00000104228|ENSG00000104228	ENST00000521283|ENST00000305364;ENST00000380544;ENST00000521253	.|T;T	.|0.65732	.|0.04;-0.17	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	.|0.204084	.|0.35040	.|N	.|0.003486	T|T	0.60508|0.60508	0.2274|0.2274	L|L	0.39397|0.39397	1.21|1.21	0.31368|0.31368	N|N	0.680525|0.680525	.|D;P	.|0.71674	.|0.998;0.835	.|P;B	.|0.49361	.|0.608;0.073	T|T	0.61888|0.61888	-0.6970|-0.6970	5|10	.|0.23891	.|T	.|0.37	.|.	15.5931|15.5931	0.76554|0.76554	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|208;240	.|E5RGB3;Q9UPQ4	.|.;TRI35_HUMAN	S|Q	5|240;240;208	.|ENSP00000301924:R240Q;ENSP00000428770:R208Q	.|ENSP00000301924:R240Q	G|R	-|-	1|2	0|0	TRIM35|TRIM35	27207557|27207557	0.064000|0.064000	0.20934|0.20934	0.998000|0.998000	0.56505|0.56505	0.567000|0.567000	0.35839|0.35839	0.764000|0.764000	0.26532|0.26532	2.756000|2.756000	0.94617|0.94617	0.561000|0.561000	0.74099|0.74099	GGC|CGG	TRIM35	-	NULL	ENSG00000104228		0.562	TRIM35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM35	HGNC	protein_coding	OTTHUMT00000219848.2	54	0.00	0	C	NM_171982		27151640	27151640	-1	no_errors	ENST00000305364	ensembl	human	known	69_37n	missense	51	22.73	15	SNP	0.995	T
TRIM38	10475	genome.wustl.edu	37	6	25983774	25983774	+	Silent	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr6:25983774G>A	ENST00000357085.3	+	8	1733	c.1257G>A	c.(1255-1257)gaG>gaA	p.E419E	TRIM38_ENST00000349458.3_Silent_p.E419E|U91328.21_ENST00000608931.1_RNA	NM_006355.3	NP_006346.1	O00635	TRI38_HUMAN	tripartite motif containing 38	419	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of defense response to virus (GO:0050687)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of viral entry into host cell (GO:0046598)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of interferon-beta production (GO:0032648)|signal transduction (GO:0007165)	intracellular (GO:0005622)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	23						TGGACTATGAGGCCGGAGTTG	0.483																																						dbGAP											0													89.0	87.0	87.0					6																	25983774		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U90547	CCDS4568.1	6p21.3	2011-04-20	2011-01-25	2002-06-07	ENSG00000112343	ENSG00000112343		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10059	protein-coding gene	gene with protein product			"""ring finger protein 15"", ""tripartite motif-containing 38"""	RNF15			Standard	XR_241880		Approved	RORET	uc003nfm.4	O00635	OTTHUMG00000014414	ENST00000357085.3:c.1257G>A	6.37:g.25983774G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R862	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.E419	ENST00000357085.3	37	c.1257	CCDS4568.1	6																																																																																			TRIM38	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000112343		0.483	TRIM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM38	HGNC	protein_coding	OTTHUMT00000040076.2	82	0.00	0	G			25983774	25983774	+1	no_errors	ENST00000349458	ensembl	human	known	69_37n	silent	38	24.00	12	SNP	0.929	A
TRIM56	81844	genome.wustl.edu	37	7	100732127	100732127	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr7:100732127G>A	ENST00000306085.6	+	3	1831	c.1534G>A	c.(1534-1536)Ggg>Agg	p.G512R		NM_030961.1	NP_112223.1	Q9BRZ2	TRI56_HUMAN	tripartite motif containing 56	512					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of type I interferon production (GO:0032481)|protein K63-linked ubiquitination (GO:0070534)|regulation of type I interferon production (GO:0032479)|response to type I interferon (GO:0034340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	Lung NSC(181;0.136)|all_lung(186;0.182)					CCGGATCACCGGGCTCTGTCC	0.652																																					Ovarian(89;1092 1379 22756 38989 39611)	dbGAP											0													56.0	65.0	62.0					7																	100732127		2018	4166	6184	-	-	-	SO:0001583	missense	0			BK000511	CCDS43625.1	7q11.2	2013-01-09	2011-01-25		ENSG00000169871	ENSG00000169871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19028	protein-coding gene	gene with protein product			"""tripartite motif-containing 56"""				Standard	NM_030961		Approved	RNF109	uc003uxq.3	Q9BRZ2	OTTHUMG00000157032	ENST00000306085.6:c.1534G>A	7.37:g.100732127G>A	ENSP00000305161:p.Gly512Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJS5|Q86VT6|Q8N2H8|Q8NAC0|Q9H031	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_CheY-like_superfamily,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.G512R	ENST00000306085.6	37	c.1534	CCDS43625.1	7	.	.	.	.	.	.	.	.	.	.	G	11.02	1.515507	0.27123	.	.	ENSG00000169871	ENST00000306085	T	0.50277	0.75	3.88	2.96	0.34315	Six-bladed beta-propeller, TolB-like (1);	.	.	.	.	T	0.49813	0.1579	N	0.19112	0.55	0.26535	N	0.974184	D	0.89917	1.0	D	0.73708	0.981	T	0.32903	-0.9889	9	0.56958	D	0.05	.	8.662	0.34099	0.0:0.0:0.7726:0.2274	.	512	Q9BRZ2	TRI56_HUMAN	R	512	ENSP00000305161:G512R	ENSP00000305161:G512R	G	+	1	0	TRIM56	100518847	0.979000	0.34478	0.260000	0.24451	0.047000	0.14425	3.480000	0.53172	1.143000	0.42306	0.591000	0.81541	GGG	TRIM56	-	NULL	ENSG00000169871		0.652	TRIM56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM56	HGNC	protein_coding	OTTHUMT00000347185.1	13	0.00	0	G	NM_030961		100732127	100732127	+1	no_errors	ENST00000306085	ensembl	human	known	69_37n	missense	4	75.00	12	SNP	0.469	A
TRIM64DP	727828	genome.wustl.edu	37	11	89515104	89515104	+	IGR	SNP	G	G	A	rs201326892	byFrequency	TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr11:89515104G>A								RP11-313I2.11 (26983 upstream) : TRIM49 (15718 downstream)																							GCCTTTCTGAGGATGTGAGAT	0.448																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															11.37:g.89515104G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		11																																																																																			TRIM64DP	-	-	ENSG00000254751	0	0.448					TRIM64DP	HGNC			11	0.00	0	G			89515104	89515104	+1	no_errors	ENST00000532821	ensembl	human	known	69_37n	rna	17	32.00	8	SNP	0.461	A
TRMT13	54482	genome.wustl.edu	37	1	100606429	100606429	+	Missense_Mutation	SNP	G	G	A	rs34001526		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr1:100606429G>A	ENST00000370141.2	+	7	529	c.523G>A	c.(523-525)Gaa>Aaa	p.E175K		NM_019083.2	NP_061956.2	Q9NUP7	TRM13_HUMAN	tRNA methyltransferase 13 homolog (S. cerevisiae)	175					tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										AGGTAACATTGAAAATTTAAA	0.338																																						dbGAP											0													94.0	94.0	94.0					1																	100606429		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC075811	CCDS765.1	1p21.2	2012-06-07	2012-06-07	2012-06-07	ENSG00000122435	ENSG00000122435			25502	protein-coding gene	gene with protein product			"""coiled-coil domain containing 76"""	CCDC76		11799066	Standard	NM_019083		Approved	FLJ10287, FLJ11219	uc001dsv.3	Q9NUP7	OTTHUMG00000010841	ENST00000370141.2:c.523G>A	1.37:g.100606429G>A	ENSP00000359160:p.Glu175Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVL0|Q9NW65	Missense_Mutation	SNP	pfam_Methyltransferase_TRM13,pfam_Znf_CCCH-type_TRM13,pfam_TRM13/UPF0224_CHHC_Znf_dom	p.E175K	ENST00000370141.2	37	c.523	CCDS765.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.291316	0.95546	.	.	ENSG00000122435	ENST00000370141	T	0.49432	0.78	5.78	5.78	0.91487	Methyltransferase TRM13 (1);	0.133806	0.64402	D	0.000002	T	0.60599	0.2281	L	0.60012	1.86	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.72982	0.938;0.979	T	0.56220	-0.8015	10	0.44086	T	0.13	-27.0914	20.0136	0.97470	0.0:0.0:1.0:0.0	.	161;175	B4DQS9;Q9NUP7	.;TRM13_HUMAN	K	175	ENSP00000359160:E175K	ENSP00000359160:E175K	E	+	1	0	CCDC76	100379017	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.756000	0.91651	2.735000	0.93741	0.563000	0.77884	GAA	TRMT13	-	pfam_Methyltransferase_TRM13	ENSG00000122435		0.338	TRMT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT13	HGNC	protein_coding	OTTHUMT00000029919.1	94	0.00	0	G	NM_019083		100606429	100606429	+1	no_errors	ENST00000370141	ensembl	human	known	69_37n	missense	52	20.00	13	SNP	1.000	A
TTC23L	153657	genome.wustl.edu	37	5	34867123	34867123	+	Silent	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:34867123G>A	ENST00000505624.1	+	7	892	c.789G>A	c.(787-789)caG>caA	p.Q263Q	TTC23L_ENST00000514080.1_3'UTR	NM_144725.3	NP_653326.3	Q6PF05	TT23L_HUMAN	tetratricopeptide repeat domain 23-like	263								p.Q263Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(9)|prostate(2)|stomach(1)|urinary_tract(1)	22						AAGCTGCTCAGATAGAGCAGC	0.547																																						dbGAP											1	Substitution - coding silent(1)	urinary_tract(1)											43.0	46.0	45.0					5																	34867123		1980	4159	6139	-	-	-	SO:0001819	synonymous_variant	0				CCDS54840.1	5p13.2	2008-07-14			ENSG00000205838	ENSG00000205838			26355	protein-coding gene	gene with protein product						12477932	Standard	NM_144725		Approved	FLJ25439	uc003jiu.3	Q6PF05	OTTHUMG00000162020	ENST00000505624.1:c.789G>A	5.37:g.34867123G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6RGS4|Q8N7R3|Q96LJ2	Silent	SNP	NULL	p.Q263	ENST00000505624.1	37	c.789	CCDS54840.1	5																																																																																			TTC23L	-	NULL	ENSG00000205838		0.547	TTC23L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC23L	HGNC	protein_coding	OTTHUMT00000366819.1	41	0.00	0	G	NM_144725		34867123	34867123	+1	no_errors	ENST00000505624	ensembl	human	known	69_37n	silent	21	25.00	7	SNP	0.998	A
TXNDC11	51061	genome.wustl.edu	37	16	11773171	11773172	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr16:11773171_11773172delCT	ENST00000356957.3	-	13	2944_2945	c.2837_2838delAG	c.(2836-2838)gagfs	p.E946fs	TXNDC11_ENST00000570917.1_5'UTR|TXNDC11_ENST00000283033.5_Frame_Shift_Del_p.E919fs			Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	946					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						TGGGGTGGACCTCTCTCTGGGC	0.619																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC013727	CCDS32387.1	16p13.13	2008-09-29				ENSG00000153066			28030	protein-coding gene	gene with protein product	"""EF-hand binding protein 1"""					8619474, 9110174	Standard	XM_005255346		Approved	EFP1	uc002dbg.1	Q6PKC3		ENST00000356957.3:c.2837_2838delAG	16.37:g.11773177_11773178delCT	ENSP00000349439:p.Glu946fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O95887|Q6PJA6|Q8N2Q4|Q96K45|Q96K53	Frame_Shift_Del	DEL	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.E946fs	ENST00000356957.3	37	c.2838_2837		16																																																																																			TXNDC11	-	NULL	ENSG00000153066		0.619	TXNDC11-002	KNOWN	basic|appris_candidate_longest	protein_coding	TXNDC11	HGNC	protein_coding	OTTHUMT00000437057.1	22	0.00	0	CT	NM_015914		11773171	11773172	-1	no_errors	ENST00000356957	ensembl	human	known	69_37n	frame_shift_del	31	13.89	5	DEL	0.012:0.006	-
UBTD2	92181	genome.wustl.edu	37	5	171638974	171638974	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:171638974G>A	ENST00000393792.2	-	3	970	c.565C>T	c.(565-567)Cca>Tca	p.P189S		NM_152277.2	NP_689490.2	Q8WUN7	UBTD2_HUMAN	ubiquitin domain containing 2	189	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.					cytoplasm (GO:0005737)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)|skin(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00976)|all_lung(126;0.0156)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGACTACCTGGTTCCACTCCC	0.483																																						dbGAP											0													132.0	120.0	124.0					5																	171638974		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251700	CCDS4379.2	5q35.1	2008-10-30			ENSG00000168246	ENSG00000168246			24463	protein-coding gene	gene with protein product	"""dendritic cell derived ubiquitin like protein"""	610174				12507522	Standard	NM_152277		Approved	DC-UbP, MGC30022	uc003mbp.1	Q8WUN7	OTTHUMG00000130519	ENST00000393792.2:c.565C>T	5.37:g.171638974G>A	ENSP00000377381:p.Pro189Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TDQ3	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_SUMO,pfscan_Ubiquitin_supergroup	p.P189S	ENST00000393792.2	37	c.565	CCDS4379.2	5	.	.	.	.	.	.	.	.	.	.	G	10.04	1.241560	0.22711	.	.	ENSG00000168246	ENST00000393792	T	0.74842	-0.88	5.96	5.96	0.96718	Ubiquitin supergroup (1);Ubiquitin (2);	0.045182	0.85682	D	0.000000	T	0.71804	0.3383	L	0.48174	1.505	0.54753	D	0.999982	B	0.23650	0.089	B	0.29077	0.098	T	0.65768	-0.6088	10	0.37606	T	0.19	-8.0598	17.9158	0.88950	0.0:0.0:1.0:0.0	.	189	Q8WUN7	UBTD2_HUMAN	S	189	ENSP00000377381:P189S	ENSP00000377381:P189S	P	-	1	0	UBTD2	171571579	1.000000	0.71417	0.724000	0.30704	0.077000	0.17291	6.168000	0.71908	2.832000	0.97577	0.655000	0.94253	CCA	UBTD2	-	pfam_Ubiquitin,pfam_SUMO,pfscan_Ubiquitin_supergroup	ENSG00000168246		0.483	UBTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBTD2	HGNC	protein_coding	OTTHUMT00000252936.1	40	0.00	0	G	NM_152277		171638974	171638974	-1	no_errors	ENST00000393792	ensembl	human	known	69_37n	missense	46	28.12	18	SNP	0.996	A
UBTF	7343	genome.wustl.edu	37	17	42287046	42287046	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr17:42287046A>G	ENST00000302904.4	-	16	2174	c.1682T>C	c.(1681-1683)aTg>aCg	p.M561T	UBTF_ENST00000527034.1_Missense_Mutation_p.M524T|UBTF_ENST00000436088.1_Missense_Mutation_p.M561T|UBTF_ENST00000343638.5_Missense_Mutation_p.M524T|UBTF_ENST00000533177.1_Missense_Mutation_p.M524T|UBTF_ENST00000393606.3_Missense_Mutation_p.M524T|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000526094.1_Missense_Mutation_p.M524T|UBTF_ENST00000529383.1_Missense_Mutation_p.M561T			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	561					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CTGGAATTTCATCTTCTTGGA	0.587																																						dbGAP											0													65.0	64.0	64.0					17																	42287046		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.1682T>C	17.37:g.42287046A>G	ENSP00000302640:p.Met561Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6R8	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,superfamily_ARM-type_fold,smart_HMG_superfamily,pfscan_HMG_superfamily	p.M561T	ENST00000302904.4	37	c.1682	CCDS11480.1	17	.	.	.	.	.	.	.	.	.	.	A	15.18	2.758314	0.49468	.	.	ENSG00000108312	ENST00000343638;ENST00000302904;ENST00000527034;ENST00000533177;ENST00000436088;ENST00000393606;ENST00000526094;ENST00000529383;ENST00000529373	T;T;T;T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03	5.43	5.43	0.79202	High mobility group, superfamily (2);High mobility group, HMG1/HMG2 (1);	0.043887	0.85682	D	0.000000	T	0.28134	0.0694	N	0.19112	0.55	0.53688	D	0.99997	P;B;B	0.38020	0.615;0.302;0.329	B;B;B	0.34873	0.099;0.105;0.191	T	0.07102	-1.0790	10	0.21540	T	0.41	-25.5689	15.1579	0.72759	1.0:0.0:0.0:0.0	.	524;524;561	E9PKP7;P17480-2;P17480	.;.;UBF1_HUMAN	T	524;561;524;524;561;524;524;561;148	ENSP00000345297:M524T;ENSP00000302640:M561T;ENSP00000431539:M524T;ENSP00000437180:M524T;ENSP00000390669:M561T;ENSP00000377231:M524T;ENSP00000432925:M524T;ENSP00000435708:M561T;ENSP00000431295:M148T	ENSP00000302640:M561T	M	-	2	0	UBTF	39642572	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.976000	0.93442	2.060000	0.61445	0.375000	0.23000	ATG	UBTF	-	superfamily_HMG_superfamily,superfamily_ARM-type_fold	ENSG00000108312		0.587	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBTF	HGNC	protein_coding	OTTHUMT00000395205.1	75	0.00	0	A	NM_014233		42287046	42287046	-1	no_errors	ENST00000302904	ensembl	human	known	69_37n	missense	59	20.27	15	SNP	1.000	G
UGT2A1	10941	genome.wustl.edu	37	4	70462045	70462045	+	Silent	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr4:70462045G>A	ENST00000503640.1	-	3	974	c.919C>T	c.(919-921)Ctg>Ttg	p.L307L	UGT2A1_ENST00000512704.1_Intron|UGT2A1_ENST00000514019.1_Intron|UGT2A2_ENST00000457664.2_Silent_p.L316L|UGT2A1_ENST00000286604.4_Intron|UGT2A1_ENST00000502343.1_Intron	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus	307					cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						ATTGATCCCAGAGAAAACACC	0.408																																						dbGAP											0													115.0	108.0	110.0					4																	70462045		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.919C>T	4.37:g.70462045G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.L316	ENST00000503640.1	37	c.946	CCDS3529.1	4																																																																																			UGT2A1	-	pfam_UDP_glucos_trans	ENSG00000173610		0.408	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2A1	HGNC	protein_coding	OTTHUMT00000251554.3	78	0.00	0	G	NM_006798		70462045	70462045	-1	no_errors	ENST00000457664	ensembl	human	known	69_37n	silent	62	46.09	53	SNP	0.997	A
VAX2	25806	genome.wustl.edu	37	2	71160174	71160174	+	Frame_Shift_Del	DEL	C	C	-	rs555134830	byFrequency	TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:71160174delC	ENST00000234392.2	+	3	745	c.713delC	c.(712-714)tccfs	p.S238fs	ATP6V1B1_ENST00000234396.4_5'Flank|ATP6V1B1_ENST00000412314.1_5'Flank|snoU13_ENST00000459218.1_RNA	NM_012476.2	NP_036608.1	Q9UIW0	VAX2_HUMAN	ventral anterior homeobox 2	238					axonogenesis (GO:0007409)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic eye morphogenesis (GO:0048048)|forebrain development (GO:0030900)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	7						GCCTCAGCGTCCCCCCCACTG	0.687																																						dbGAP											0													23.0	26.0	25.0					2																	71160174		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			Y17791	CCDS1911.1	2p13.3	2011-06-20			ENSG00000116035	ENSG00000116035		"""Homeoboxes / ANTP class : NKL subclass"""	12661	protein-coding gene	gene with protein product		604295				10485894	Standard	NM_012476		Approved	DRES93	uc002shh.3	Q9UIW0	OTTHUMG00000129714	ENST00000234392.2:c.713delC	2.37:g.71160174delC	ENSP00000234392:p.Ser238fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53Y33	Frame_Shift_Del	DEL	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa,pfscan_Homeodomain	p.P240fs	ENST00000234392.2	37	c.713	CCDS1911.1	2																																																																																			VAX2	-	NULL	ENSG00000116035		0.687	VAX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAX2	HGNC	protein_coding	OTTHUMT00000251923.1	21	0.00	0	C			71160174	71160174	+1	no_errors	ENST00000234392	ensembl	human	known	69_37n	frame_shift_del	3	50.00	3	DEL	0.296	-
VRK3	51231	genome.wustl.edu	37	19	50519394	50519394	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:50519394C>T	ENST00000599538.1	-	3	690	c.26G>A	c.(25-27)gGc>gAc	p.G9D	VRK3_ENST00000601341.1_Missense_Mutation_p.G9D|VRK3_ENST00000601912.1_Missense_Mutation_p.G9D|VRK3_ENST00000593919.1_Missense_Mutation_p.G9D|VRK3_ENST00000443401.2_5'UTR|VRK3_ENST00000594948.1_Missense_Mutation_p.G9D|VRK3_ENST00000594092.1_Missense_Mutation_p.G9D|VRK3_ENST00000377011.2_Missense_Mutation_p.G9D|VRK3_ENST00000316763.3_Missense_Mutation_p.G9D|VRK3_ENST00000424804.2_5'UTR			Q8IV63	VRK3_HUMAN	vaccinia related kinase 3	9					negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)|stomach(2)|urinary_tract(1)	23		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		GATACTTTTGCCACAGTCTGG	0.463																																					Pancreas(6;90 181 4352 12603 17050 34726 35237 44094)	dbGAP											0													93.0	89.0	90.0					19																	50519394		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB031052	CCDS12791.1, CCDS33076.1	19q13.33	2011-01-14			ENSG00000105053	ENSG00000105053			18996	protein-coding gene	gene with protein product							Standard	XM_005258971		Approved		uc002prh.1	Q8IV63		ENST00000599538.1:c.26G>A	19.37:g.50519394C>T	ENSP00000469880:p.Gly9Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEG5|A8KA53|Q502Y2|Q9P2V8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.G9D	ENST00000599538.1	37	c.26	CCDS12791.1	19	.	.	.	.	.	.	.	.	.	.	C	20.4	3.988602	0.74589	.	.	ENSG00000105053	ENST00000316763;ENST00000377011;ENST00000424804	T;T	0.54479	0.91;0.57	4.52	4.52	0.55395	.	0.104827	0.64402	D	0.000005	T	0.79879	0.4522	H	0.96015	3.755	0.43724	D	0.996209	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.991;0.997;0.991;0.998;0.998	D	0.84785	0.0775	10	0.66056	D	0.02	-27.0638	13.0397	0.58891	0.0:1.0:0.0:0.0	.	9;9;9;9;9	E7EMG6;Q8IV63-2;B4E0U5;A6NEG5;Q8IV63	.;.;.;.;VRK3_HUMAN	D	9	ENSP00000324636:G9D;ENSP00000366210:G9D	ENSP00000324636:G9D	G	-	2	0	VRK3	55211206	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	2.812000	0.47994	2.792000	0.96026	0.650000	0.86243	GGC	VRK3	-	NULL	ENSG00000105053		0.463	VRK3-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	VRK3	HGNC	protein_coding	OTTHUMT00000464815.1	56	0.00	0	C	NM_016440		50519394	50519394	-1	no_errors	ENST00000316763	ensembl	human	known	69_37n	missense	61	11.59	8	SNP	1.000	T
WDR55	54853	genome.wustl.edu	37	5	140049102	140049102	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr5:140049102delA	ENST00000358337.5	+	7	1252	c.1015delA	c.(1015-1017)aaafs	p.K341fs	WDR55_ENST00000520764.1_3'UTR	NM_017706.4	NP_060176	Q9H6Y2	WDR55_HUMAN	WD repeat domain 55	341					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)		p.K341fs*8(1)		NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGTCGGCGCAAAAAAAAGGG	0.592																																						dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)											43.0	45.0	45.0					5																	140049102		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK000202	CCDS4235.1	5q31.3	2013-01-09			ENSG00000120314	ENSG00000120314		"""WD repeat domain containing"""	25971	protein-coding gene	gene with protein product						12477932	Standard	NM_017706		Approved	FLJ20195, FLJ21702	uc003lgr.4	Q9H6Y2	OTTHUMG00000129506	ENST00000358337.5:c.1015delA	5.37:g.140049102delA	ENSP00000351100:p.Lys341fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NXK4	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_WD_repeat_p55,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K341fs	ENST00000358337.5	37	c.1015	CCDS4235.1	5																																																																																			WDR55	-	pirsf_WD_repeat_p55	ENSG00000120314		0.592	WDR55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR55	HGNC	protein_coding	OTTHUMT00000251680.3	52	0.00	0	A	NM_017706		140049102	140049102	+1	no_errors	ENST00000358337	ensembl	human	known	69_37n	frame_shift_del	31	13.51	5	DEL	1.000	-
WDR66	144406	genome.wustl.edu	37	12	122413586	122413586	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr12:122413586G>A	ENST00000288912.4	+	19	3855	c.3001G>A	c.(3001-3003)Gag>Aag	p.E1001K		NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	1001							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CCCATCTGAAGAGAAGGTAGG	0.423																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0													116.0	105.0	108.0					12																	122413586		1896	4138	6034	-	-	-	SO:0001583	missense	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.3001G>A	12.37:g.122413586G>A	ENSP00000288912:p.Glu1001Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.E1001K	ENST00000288912.4	37	c.3001	CCDS41853.1	12	.	.	.	.	.	.	.	.	.	.	G	15.00	2.704031	0.48412	.	.	ENSG00000158023	ENST00000288912	T	0.80304	-1.36	5.05	5.05	0.67936	EF-hand-like domain (1);	0.263950	0.37669	N	0.001997	T	0.72922	0.3521	L	0.38175	1.15	0.80722	D	1	B	0.15473	0.013	B	0.14023	0.01	T	0.68973	-0.5268	10	0.41790	T	0.15	.	14.0761	0.64891	0.0:0.1507:0.8493:0.0	.	1001	Q8TBY9	WDR66_HUMAN	K	1001	ENSP00000288912:E1001K	ENSP00000288912:E1001K	E	+	1	0	WDR66	120897969	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	3.703000	0.54808	2.341000	0.79615	0.561000	0.74099	GAG	WDR66	-	NULL	ENSG00000158023		0.423	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	48	0.00	0	G	NM_144668		122413586	122413586	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	missense	24	52.94	27	SNP	1.000	A
WRN	7486	genome.wustl.edu	37	8	31001132	31001132	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr8:31001132delA	ENST00000298139.5	+	28	3625	c.3376delA	c.(3376-3378)aaafs	p.K1127fs		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	1127					aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		TAACATTTCTAAAAAAAGGTA	0.289			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	dbGAP	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0													54.0	62.0	59.0					8																	31001132		2195	4271	6466	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.3376delA	8.37:g.31001132delA	ENSP00000298139:p.Lys1127fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A1KYY9	Frame_Shift_Del	DEL	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/RNaseD_C,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_Helicase/RNaseD_C,pfscan_Helicase/RNaseD_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.S1128fs	ENST00000298139.5	37	c.3376	CCDS6082.1	8																																																																																			WRN	-	NULL	ENSG00000165392		0.289	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1	38	0.00	0	A			31001132	31001132	+1	no_errors	ENST00000298139	ensembl	human	known	69_37n	frame_shift_del	100	14.29	17	DEL	0.872	-
TBC1D31	93594	genome.wustl.edu	37	8	124105925	124105925	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr8:124105925A>G	ENST00000287380.1	+	5	704	c.614A>G	c.(613-615)cAa>cGa	p.Q205R	TBC1D31_ENST00000327098.5_Missense_Mutation_p.Q205R|TBC1D31_ENST00000522420.1_Missense_Mutation_p.Q100R|TBC1D31_ENST00000378080.2_Missense_Mutation_p.Q100R|TBC1D31_ENST00000521676.1_Missense_Mutation_p.Q100R|TBC1D31_ENST00000309336.3_Missense_Mutation_p.Q205R	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	205						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										TGCAAATATCAATTGCCAGCT	0.333																																						dbGAP											0													95.0	93.0	94.0					8																	124105925		2203	4298	6501	-	-	-	SO:0001583	missense	0			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.614A>G	8.37:g.124105925A>G	ENSP00000287380:p.Gln205Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Rab-GTPase-TBC_dom,smart_WD40_repeat,pfscan_Rab-GTPase-TBC_dom,pfscan_WD40_repeat_dom	p.Q205R	ENST00000287380.1	37	c.614	CCDS6338.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.4|24.4	4.531657|4.531657	0.85706|0.85706	.|.	.|.	ENSG00000156787|ENSG00000156787	ENST00000521914|ENST00000287380;ENST00000309336;ENST00000543408;ENST00000327098;ENST00000522420;ENST00000521676;ENST00000378080;ENST00000522276	.|T;T;T;T;T;T;T	.|0.70164	.|-0.12;1.62;1.62;1.63;1.63;1.63;-0.46	5.73|5.73	5.73|5.73	0.89815|0.89815	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78489|0.78489	0.4291|0.4291	M|M	0.73598|0.73598	2.24|2.24	0.58432|0.58432	D|D	0.999998|0.999998	.|P;D;P	.|0.62365	.|0.584;0.991;0.936	.|B;P;P	.|0.59221	.|0.267;0.854;0.605	T|T	0.77840|0.77840	-0.2438|-0.2438	5|10	.|0.34782	.|T	.|0.22	-19.6208|-19.6208	16.0107|16.0107	0.80402|0.80402	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|205;205;205	.|B7ZL19;Q96DN5;Q3KRB0	.|.;WDR67_HUMAN;.	D|R	9|205;205;84;205;100;100;100;195	.|ENSP00000287380:Q205R;ENSP00000308358:Q205R;ENSP00000312701:Q205R;ENSP00000429334:Q100R;ENSP00000430628:Q100R;ENSP00000367320:Q100R;ENSP00000428891:Q195R	.|ENSP00000287380:Q205R	N|Q	+|+	1|2	0|0	WDR67|WDR67	124175106|124175106	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.937000|0.937000	0.57800|0.57800	5.773000|5.773000	0.68898|0.68898	2.187000|2.187000	0.69744|0.69744	0.402000|0.402000	0.26972|0.26972	AAT|CAA	WDR67	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000156787		0.333	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR67	HGNC	protein_coding	OTTHUMT00000381721.1	83	0.00	0	A	NM_145647		124105925	124105925	+1	no_errors	ENST00000287380	ensembl	human	known	69_37n	missense	162	11.96	22	SNP	1.000	G
XIRP1	165904	genome.wustl.edu	37	3	39227618	39227618	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:39227618C>A	ENST00000340369.3	-	2	3547	c.3319G>T	c.(3319-3321)Ggt>Tgt	p.G1107C	XIRP1_ENST00000396251.1_Missense_Mutation_p.G1107C|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1107					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TCACTTCCACCCCCAGGCCTT	0.607																																						dbGAP											0													63.0	66.0	65.0					3																	39227618		2203	4300	6503	-	-	-	SO:0001583	missense	0			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.3319G>T	3.37:g.39227618C>A	ENSP00000343140:p.Gly1107Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.G1107C	ENST00000340369.3	37	c.3319	CCDS2683.1	3	.	.	.	.	.	.	.	.	.	.	C	7.242	0.601435	0.13939	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.05649	3.41;3.87	4.69	1.92	0.25849	.	0.805091	0.11119	U	0.597638	T	0.03871	0.0109	N	0.08118	0	0.20196	N	0.99992	P;B	0.37864	0.61;0.32	B;B	0.37091	0.241;0.176	T	0.43147	-0.9409	10	0.66056	D	0.02	.	8.3742	0.32434	0.0:0.7351:0.0:0.2649	.	1107;1107	Q702N8;Q702N8-2	XIRP1_HUMAN;.	C	1107	ENSP00000379550:G1107C;ENSP00000343140:G1107C	ENSP00000343140:G1107C	G	-	1	0	XIRP1	39202622	0.000000	0.05858	0.259000	0.24435	0.542000	0.35054	0.118000	0.15605	0.308000	0.22923	-0.137000	0.14449	GGT	XIRP1	-	NULL	ENSG00000168334		0.607	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XIRP1	HGNC	protein_coding	OTTHUMT00000254065.1	31	0.00	0	C	XM_093522		39227618	39227618	-1	no_errors	ENST00000340369	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	0.157	A
ZAR1	326340	genome.wustl.edu	37	4	48496158	48496158	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr4:48496158G>A	ENST00000327939.4	+	4	1212	c.1172G>A	c.(1171-1173)cGc>cAc	p.R391H		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	391					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						GTAAAACTTCGCCACGTGGAC	0.468																																						dbGAP											0													86.0	84.0	84.0					4																	48496158		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.1172G>A	4.37:g.48496158G>A	ENSP00000329803:p.Arg391His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.R391H	ENST00000327939.4	37	c.1172	CCDS3483.1	4	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481550	0.63849	.	.	ENSG00000182223	ENST00000327939	T	0.21031	2.03	5.64	4.78	0.61160	.	0.064956	0.64402	D	0.000007	T	0.49389	0.1554	M	0.81802	2.56	0.52099	D	0.999942	D	0.89917	1.0	D	0.76575	0.988	T	0.56601	-0.7952	10	0.72032	D	0.01	-20.84	15.6875	0.77424	0.0:0.0:0.862:0.138	.	391	Q86SH2	ZAR1_HUMAN	H	391	ENSP00000329803:R391H	ENSP00000329803:R391H	R	+	2	0	ZAR1	48190915	1.000000	0.71417	0.946000	0.38457	0.002000	0.02628	9.441000	0.97557	1.317000	0.45149	0.655000	0.94253	CGC	ZAR1	-	superfamily_Znf_FYVE_PHD	ENSG00000182223		0.468	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAR1	HGNC	protein_coding	OTTHUMT00000219927.3	59	0.00	0	G			48496158	48496158	+1	no_errors	ENST00000327939	ensembl	human	known	69_37n	missense	41	26.79	15	SNP	1.000	A
ZBTB16	7704	genome.wustl.edu	37	11	113935219	113935219	+	Silent	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr11:113935219C>T	ENST00000335953.4	+	2	1577	c.1197C>T	c.(1195-1197)agC>agT	p.S399S	ZBTB16_ENST00000392996.2_Silent_p.S399S	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	399					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		AGTCAGAGAGCCGGACCATCG	0.637																																						dbGAP											0													83.0	81.0	82.0					11																	113935219		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1197C>T	11.37:g.113935219C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TAL4	Missense_Mutation	SNP	NULL	p.A29V	ENST00000335953.4	37	c.86	CCDS8367.1	11																																																																																			ZBTB16	-	NULL	ENSG00000109906		0.637	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB16	HGNC	protein_coding	OTTHUMT00000398940.1	50	0.00	0	C	NM_006006		113935219	113935219	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000539918	ensembl	human	known	69_37n	missense	19	39.39	13	SNP	1.000	T
ZBTB20	26137	genome.wustl.edu	37	3	114057923	114057923	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:114057923C>T	ENST00000474710.1	-	5	2333	c.2155G>A	c.(2155-2157)Gtc>Atc	p.V719I	ZBTB20_ENST00000481632.1_Missense_Mutation_p.V646I|ZBTB20_ENST00000357258.3_Missense_Mutation_p.V646I|ZBTB20_ENST00000471418.1_Missense_Mutation_p.V646I|ZBTB20_ENST00000393785.2_Missense_Mutation_p.V646I|ZBTB20_ENST00000464560.1_Missense_Mutation_p.V646I|ZBTB20_ENST00000462705.1_Missense_Mutation_p.V646I	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	719						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GCTGGGCAGACGGAGCAGACG	0.582																																					NSCLC(69;748 1344 9802 11203 30933)	dbGAP											0													74.0	71.0	72.0					3																	114057923		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.2155G>A	3.37:g.114057923C>T	ENSP00000419153:p.Val719Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.V719I	ENST00000474710.1	37	c.2155	CCDS54626.1	3	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719251	0.68844	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.11495	2.79;2.79;2.79;2.79;2.77;2.79;2.79	5.87	5.87	0.94306	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.127904	0.52532	D	0.000067	T	0.27098	0.0664	L	0.37850	1.14	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.00128	-1.2017	10	0.62326	D	0.03	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	719	Q9HC78	ZBT20_HUMAN	I	646;646;646;646;719;646;646	ENSP00000420324:V646I;ENSP00000377375:V646I;ENSP00000418092:V646I;ENSP00000419902:V646I;ENSP00000419153:V719I;ENSP00000349803:V646I;ENSP00000417307:V646I	ENSP00000349803:V646I	V	-	1	0	ZBTB20	115540613	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.746000	0.68681	2.941000	0.99782	0.655000	0.94253	GTC	ZBTB20	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181722		0.582	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	ZBTB20	HGNC	protein_coding	OTTHUMT00000354951.1	45	0.00	0	C	NM_015642		114057923	114057923	-1	no_errors	ENST00000474710	ensembl	human	known	69_37n	missense	28	21.62	8	SNP	1.000	T
ZEB2	9839	genome.wustl.edu	37	2	145147249	145147251	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:145147249_145147251delCTT	ENST00000558170.2	-	10	4596_4598	c.3412_3414delAAG	c.(3412-3414)aagdel	p.K1138del	ZEB2_ENST00000303660.4_In_Frame_Del_p.K1138del|ZEB2_ENST00000409487.3_In_Frame_Del_p.K1138del|ZEB2_ENST00000539609.3_In_Frame_Del_p.K1114del	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	1138	Glu-rich (acidic).				cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		TCTCGTGCTCCTTCTCGCTCTCG	0.557																																					Melanoma(33;1235 1264 5755 16332)	dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.3412_3414delAAG	2.37:g.145147249_145147251delCTT	ENSP00000454157:p.Lys1138del	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP09|B7Z2P2|F5H814|Q9UED1	In_Frame_Del	DEL	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.K1138in_frame_del	ENST00000558170.2	37	c.3414_3412	CCDS2186.1	2																																																																																			ZEB2	-	NULL	ENSG00000169554		0.557	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	HGNC	protein_coding	OTTHUMT00000254778.5	80	0.00	0	CTT	NM_014795		145147249	145147251	-1	no_errors	ENST00000303660	ensembl	human	known	69_37n	in_frame_del	58	23.68	18	DEL	1.000:1.000:1.000	-
ZFHX3	463	genome.wustl.edu	37	16	72830903	72830904	+	Frame_Shift_Del	DEL	CT	CT	-	rs534501327		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr16:72830903_72830904delCT	ENST00000268489.5	-	9	6349_6350	c.5677_5678delAG	c.(5677-5679)aggfs	p.R1893fs	ZFHX3_ENST00000397992.5_Frame_Shift_Del_p.R979fs	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1893					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GGCGCTGTCCCTCTCTCTCTGG	0.54																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.5677_5678delAG	16.37:g.72830911_72830912delCT	ENSP00000268489:p.Arg1893fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWS8|O15101|Q13719	Frame_Shift_Del	DEL	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.R1893fs	ENST00000268489.5	37	c.5678_5677	CCDS10908.1	16																																																																																			ZFHX3	-	NULL	ENSG00000140836		0.540	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	90	0.00	0	CT	NM_006885		72830903	72830904	-1	no_errors	ENST00000268489	ensembl	human	known	69_37n	frame_shift_del	40	52.38	44	DEL	0.999:0.991	-
ZNF223	7766	genome.wustl.edu	37	19	44570961	44570961	+	Missense_Mutation	SNP	G	G	A	rs76427641		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr19:44570961G>A	ENST00000434772.3	+	5	1235	c.980G>A	c.(979-981)cGt>cAt	p.R327H	ZNF223_ENST00000591793.1_Missense_Mutation_p.R437H	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	327				R -> D (in Ref. 1; AAF04105). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				GGCTTCATTCGTAGGCTGGAT	0.443													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21876	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													111.0	107.0	108.0					19																	44570961		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.980G>A	19.37:g.44570961G>A	ENSP00000401947:p.Arg327His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15736|Q8TBJ3|Q9HCA9	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R437H	ENST00000434772.3	37	c.1310	CCDS12635.1	19	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	2.701	-0.271053	0.05716	.	.	ENSG00000178386	ENST00000434772	T	0.15718	2.4	2.46	-0.362	0.12560	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07279	0.0184	N	0.12961	0.28	0.09310	N	1	B	0.21309	0.054	B	0.04013	0.001	T	0.41270	-0.9518	9	0.15066	T	0.55	.	4.2443	0.10663	0.1346:0.0:0.4654:0.4	.	327	Q9UK11	ZN223_HUMAN	H	327	ENSP00000401947:R327H	ENSP00000401947:R327H	R	+	2	0	ZNF223	49262801	0.000000	0.05858	0.001000	0.08648	0.096000	0.18686	-0.579000	0.05834	0.282000	0.22254	0.313000	0.20887	CGT	AC084219.2	-	pfscan_Znf_C2H2	ENSG00000267022		0.443	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF223	Clone_based_vega_gene	protein_coding	OTTHUMT00000460469.2	31	0.00	0	G			44570961	44570961	+1	no_errors	ENST00000591793	ensembl	human	known	69_37n	missense	44	24.14	14	SNP	0.000	A
ZNF469	84627	genome.wustl.edu	37	16	88501554	88501556	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	AGG	AGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr16:88501554_88501556delAGG	ENST00000437464.1	+	2	7592_7594	c.7592_7594delAGG	c.(7591-7596)aaggag>aag	p.E2532del	ZNF469_ENST00000565624.1_In_Frame_Del_p.E2560del	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2532					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CAGGGCTCAAAGGAGGTTCTCAG	0.626																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.7592_7594delAGG	16.37:g.88501557_88501559delAGG	ENSP00000402343:p.Glu2532del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E2532in_frame_del	ENST00000437464.1	37	c.7592_7594	CCDS45544.1	16																																																																																			ZNF469	-	NULL	ENSG00000225614		0.626	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		29	0.00	0	AGG	NG_012236		88501554	88501556	+1	no_errors	ENST00000437464	ensembl	human	known	69_37n	in_frame_del	15	23.81	5	DEL	0.000:0.000:0.001	-
ZNF512	84450	genome.wustl.edu	37	2	27838044	27838044	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr2:27838044A>G	ENST00000355467.4	+	11	1224	c.1141A>G	c.(1141-1143)Act>Gct	p.T381A	RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000416005.2_Missense_Mutation_p.T352A|ZNF512_ENST00000556601.1_Missense_Mutation_p.T250A|ZNF512_ENST00000379717.1_Missense_Mutation_p.T380A|ZNF512_ENST00000413371.2_Missense_Mutation_p.T304A	NM_001271287.1|NM_001271288.1|NM_001271289.1|NM_001271318.1|NM_032434.3	NP_001258216.1|NP_001258217.1|NP_001258218.1|NP_001258247.1|NP_115810.2	Q96ME7	ZN512_HUMAN	zinc finger protein 512	381					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)					GTTAAAATATACTCGTCCAGG	0.378																																						dbGAP											0													159.0	151.0	154.0					2																	27838044		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833748	CCDS1758.1, CCDS59428.1, CCDS59429.1	2p23	2008-02-05			ENSG00000243943	ENSG00000243943		"""Zinc fingers, C2H2-type"""	29380	protein-coding gene	gene with protein product						11347906	Standard	NM_032434		Approved	KIAA1805	uc002rla.4	Q96ME7	OTTHUMG00000097786	ENST00000355467.4:c.1141A>G	2.37:g.27838044A>G	ENSP00000347648:p.Thr381Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSM5|Q53RZ7|Q86XK6|Q96JM0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T381A	ENST00000355467.4	37	c.1141	CCDS1758.1	2	.	.	.	.	.	.	.	.	.	.	A	15.39	2.818103	0.50633	.	.	ENSG00000243943	ENST00000379717;ENST00000355467;ENST00000556601;ENST00000416005;ENST00000413371	.	.	.	5.85	4.7	0.59300	.	0.156512	0.64402	N	0.000018	T	0.29976	0.0750	L	0.44542	1.39	0.35680	D	0.81397	B;P;P	0.38020	0.128;0.615;0.615	B;B;B	0.29267	0.039;0.1;0.1	T	0.32079	-0.9920	9	0.06494	T	0.89	-7.6813	9.295	0.37811	0.9186:0.0:0.0814:0.0	.	276;352;381	B4DES6;B4DSM5;Q96ME7	.;.;ZN512_HUMAN	A	380;381;250;352;304	.	ENSP00000347648:T381A	T	+	1	0	ZNF512	27691548	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	3.763000	0.55257	1.038000	0.40049	0.533000	0.62120	ACT	ZNF512	-	NULL	ENSG00000243943		0.378	ZNF512-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF512	HGNC	protein_coding	OTTHUMT00000215029.2	82	0.00	0	A	NM_032434		27838044	27838044	+1	no_errors	ENST00000355467	ensembl	human	known	69_37n	missense	67	28.72	27	SNP	1.000	G
ZNF572	137209	genome.wustl.edu	37	8	125987892	125987893	+	Frame_Shift_Ins	INS	-	-	A			TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr8:125987892_125987893insA	ENST00000319286.5	+	2	164_165	c.10_11insA	c.(10-12)gaafs	p.E4fs		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	4					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E4Q(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			GATGGAGCAAGAAAAAAAACTG	0.396										HNSCC(60;0.17)																												dbGAP											1	Substitution - Missense(1)	lung(1)																																								-	-	-	SO:0001589	frameshift_variant	0			BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.18dupA	8.37:g.125987900_125987900dupA	ENSP00000319305:p.Glu4fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4F1|Q8N1Q0	Frame_Shift_Ins	INS	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L7fs	ENST00000319286.5	37	c.10_11	CCDS6354.1	8																																																																																			ZNF572	-	NULL	ENSG00000180938		0.396	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF572	HGNC	protein_coding	OTTHUMT00000381359.1	87	0.00	0	-	NM_152412		125987892	125987893	+1	no_errors	ENST00000319286	ensembl	human	known	69_37n	frame_shift_ins	176	11.56	23	INS	0.001:0.002	A
ZPLD1	131368	genome.wustl.edu	37	3	102187833	102187833	+	Missense_Mutation	SNP	G	G	A	rs186547877		TCGA-D8-A1Y1-01A-21D-A14K-09	TCGA-D8-A1Y1-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2ea6e540-6e2f-48a5-99e3-27a0107d07b7	0400d779-78d9-4645-add6-2a9f94d55e1c	g.chr3:102187833G>A	ENST00000491959.1	+	15	1669	c.787G>A	c.(787-789)Gtc>Atc	p.V263I	ZPLD1_ENST00000466937.1_Missense_Mutation_p.V263I|ZPLD1_ENST00000306176.1_Missense_Mutation_p.V279I			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	263	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						TCAGACCACCGTCATTGAGAA	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		17711	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													68.0	68.0	68.0					3																	102187833		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.787G>A	3.37:g.102187833G>A	ENSP00000420265:p.Val263Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AS1|Q8WU36	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	p.V279I	ENST00000491959.1	37	c.835		3	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	13.06	2.124271	0.37533	.	.	ENSG00000170044	ENST00000491959;ENST00000306176;ENST00000466937	D;D;D	0.82255	-1.59;-1.59;-1.59	5.47	4.59	0.56863	Zona pellucida sperm-binding protein (3);	0.182172	0.49916	D	0.000136	T	0.66406	0.2786	N	0.25957	0.775	0.42493	D	0.9929	B;B	0.18310	0.027;0.021	B;B	0.18263	0.011;0.021	T	0.57969	-0.7719	10	0.08599	T	0.76	-0.0899	5.206	0.15291	0.284:0.0:0.716:0.0	.	279;263	Q8TCW7-2;Q8TCW7	.;ZPLD1_HUMAN	I	263;279;263	ENSP00000420265:V263I;ENSP00000307801:V279I;ENSP00000418253:V263I	ENSP00000307801:V279I	V	+	1	0	ZPLD1	103670523	0.989000	0.36119	0.991000	0.47740	0.976000	0.68499	2.221000	0.42917	2.571000	0.86741	0.462000	0.41574	GTC	ZPLD1	-	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	ENSG00000170044		0.443	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	ZPLD1	HGNC	protein_coding	OTTHUMT00000353984.1	37	0.00	0	G	NM_175056		102187833	102187833	+1	no_errors	ENST00000306176	ensembl	human	known	69_37n	missense	15	64.29	27	SNP	0.953	A
