#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM21P1	145241	genome.wustl.edu	37	14	70714087	70714087	+	RNA	SNP	T	T	G	rs79122905		TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr14:70714087T>G	ENST00000530196.1	-	0	431					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		CCTCCAGGAGTGCACGCTCAT	0.507																																						dbGAP											0																																										-	-	-			0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70714087T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			ADAM21P1	-	-	ENSG00000235812		0.507	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1	57	0.00	0	T	NG_002467		70714087	70714087	-1	no_errors	ENST00000530196	ensembl	human	known	69_37n	rna	72	17.05	15	SNP	0.001	G
AGTPBP1	23287	genome.wustl.edu	37	9	88204545	88204545	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr9:88204545G>A	ENST00000357081.3	-	20	2764	c.2620C>T	c.(2620-2622)Cgg>Tgg	p.R874W	AGTPBP1_ENST00000376109.3_Missense_Mutation_p.R886W|AGTPBP1_ENST00000376083.3_Missense_Mutation_p.R834W|AGTPBP1_ENST00000432218.1_Intron|AGTPBP1_ENST00000337006.4_3'UTR			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	874					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						ACATCTTTCCGAAAATAGATT	0.343																																						dbGAP											0													99.0	94.0	96.0					9																	88204545		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.2620C>T	9.37:g.88204545G>A	ENSP00000349592:p.Arg874Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.R886W	ENST00000357081.3	37	c.2656		9	.	.	.	.	.	.	.	.	.	.	G	21.9	4.219217	0.79464	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109	T;T;T	0.13307	2.6;2.6;2.6	5.96	5.96	0.96718	Peptidase M14, carboxypeptidase A (1);	0.051173	0.85682	D	0.000000	T	0.46560	0.1399	M	0.90082	3.085	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.77004	0.949;0.989;0.986	T	0.52578	-0.8557	10	0.87932	D	0	-12.4568	16.6815	0.85292	0.0:0.0:0.87:0.13	.	886;874;834	Q9UPW5-3;Q9UPW5;Q9UPW5-2	.;CBPC1_HUMAN;.	W	874;834;886	ENSP00000349592:R874W;ENSP00000365251:R834W;ENSP00000365277:R886W	ENSP00000349592:R874W	R	-	1	2	AGTPBP1	87394365	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.802000	0.62539	2.832000	0.97577	0.655000	0.94253	CGG	AGTPBP1	-	pfam_Peptidase_M14	ENSG00000135049		0.343	AGTPBP1-004	KNOWN	basic	protein_coding	AGTPBP1	HGNC	protein_coding	OTTHUMT00000052893.1	93	0.00	0	G	NM_015239		88204545	88204545	-1	no_errors	ENST00000376109	ensembl	human	known	69_37n	missense	71	28.28	28	SNP	1.000	A
AMY1A	276	genome.wustl.edu	37	1	104203222	104203222	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr1:104203222T>A	ENST00000370083.4	+	8	1245	c.1025T>A	c.(1024-1026)tTt>tAt	p.F342Y		NM_001008221.1|NM_004038.3	NP_001008222.1|NP_004029.2	P04745	AMY1_HUMAN	amylase, alpha 1A (salivary)	342					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)						all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)		GCAGTTGGATTTATGCTTGCT	0.308																																					Pancreas(131;743 2392 43382 44986)	dbGAP											0													8.0	8.0	8.0					1																	104203222		1515	3573	5088	-	-	-	SO:0001583	missense	0				CCDS30782.1	1p21	2012-10-02	2007-05-03		ENSG00000237763	ENSG00000237763	3.2.1.1		474	protein-coding gene	gene with protein product		104700	"""amylase, alpha 1A; salivary"""	AMY1			Standard	XM_005270755		Approved		uc001duv.3	P04745	OTTHUMG00000011020	ENST00000370083.4:c.1025T>A	1.37:g.104203222T>A	ENSP00000359100:p.Phe342Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJS5|A8K8H6|Q13763|Q5T083	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.F342Y	ENST00000370083.4	37	c.1025	CCDS30782.1	1	.	.	.	.	.	.	.	.	.	.	t	8.549	0.875170	0.17395	.	.	ENSG00000237763	ENST00000370083	D	0.98512	-4.97	2.38	2.38	0.29361	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.055536	0.64402	D	0.000001	D	0.93893	0.8046	.	.	.	0.53688	D	0.999972	B	0.18166	0.026	B	0.25759	0.063	D	0.92165	0.5739	9	0.49607	T	0.09	.	9.8681	0.41157	0.0:0.0:0.0:1.0	.	342	P04745	AMY1_HUMAN	Y	342	ENSP00000359100:F342Y	ENSP00000359100:F342Y	F	+	2	0	AMY1A	104004745	1.000000	0.71417	0.997000	0.53966	0.394000	0.30568	3.510000	0.53393	0.948000	0.37687	0.155000	0.16302	TTT	AMY1A	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000237763		0.308	AMY1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY1A	HGNC	protein_coding	OTTHUMT00000030304.2	47	0.00	0	T	NM_001008221		104203222	104203222	+1	no_errors	ENST00000370083	ensembl	human	known	69_37n	missense	25	40.48	17	SNP	1.000	A
APBB1IP	54518	genome.wustl.edu	37	10	26825123	26825123	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr10:26825123T>A	ENST00000376236.4	+	10	1476	c.1021T>A	c.(1021-1023)Tat>Aat	p.Y341N		NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	341	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						TGGAATTTATTATGTACCCAA	0.338																																						dbGAP											0													85.0	103.0	97.0					10																	26825123		2200	4297	6497	-	-	-	SO:0001583	missense	0			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.1021T>A	10.37:g.26825123T>A	ENSP00000365411:p.Tyr341Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Ras-assoc	p.Y341N	ENST00000376236.4	37	c.1021	CCDS31167.1	10	.	.	.	.	.	.	.	.	.	.	T	27.5	4.833583	0.91036	.	.	ENSG00000077420	ENST00000445780;ENST00000376236	T	0.26067	1.76	5.93	5.93	0.95920	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.57095	0.2030	M	0.84585	2.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.63528	-0.6617	10	0.72032	D	0.01	.	16.3798	0.83452	0.0:0.0:0.0:1.0	.	341;341	B4E100;Q7Z5R6	.;AB1IP_HUMAN	N	341	ENSP00000365411:Y341N	ENSP00000365411:Y341N	Y	+	1	0	APBB1IP	26865129	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.271000	0.75665	0.533000	0.62120	TAT	APBB1IP	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000077420		0.338	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	APBB1IP	HGNC	protein_coding	OTTHUMT00000047270.1	26	0.00	0	T	NM_019043		26825123	26825123	+1	no_errors	ENST00000376236	ensembl	human	known	69_37n	missense	34	24.44	11	SNP	1.000	A
ATP13A1	57130	genome.wustl.edu	37	19	19766896	19766896	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr19:19766896T>C	ENST00000357324.6	-	8	1206	c.1180A>G	c.(1180-1182)Atc>Gtc	p.I394V	ATP13A1_ENST00000291503.5_Missense_Mutation_p.I276V|ATP13A1_ENST00000496082.1_5'Flank	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	394						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						TGTGGGGGGATGTGCTGCACC	0.642																																					Esophageal Squamous(142;920 1789 9047 14684 24777)	dbGAP											0													73.0	70.0	71.0					19																	19766896		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.1180A>G	19.37:g.19766896T>C	ENSP00000349877:p.Ile394Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.I394V	ENST00000357324.6	37	c.1180	CCDS32970.2	19	.	.	.	.	.	.	.	.	.	.	T	11.28	1.593275	0.28357	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	D;D	0.90261	-2.64;-2.64	4.47	3.45	0.39498	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.091347	0.85682	D	0.000000	D	0.83266	0.5217	L	0.31926	0.97	0.31599	N	0.652974	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.77368	-0.2614	10	0.35671	T	0.21	-14.9313	8.3012	0.32014	0.0:0.0978:0.0:0.9022	.	394;276	Q9HD20;Q9HD20-2	AT131_HUMAN;.	V	276;394	ENSP00000291503:I276V;ENSP00000349877:I394V	ENSP00000291503:I276V	I	-	1	0	ATP13A1	19627896	1.000000	0.71417	0.950000	0.38849	0.269000	0.26545	5.781000	0.68964	0.679000	0.31345	0.402000	0.26972	ATC	ATP13A1	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_unknown-pump-sp	ENSG00000105726		0.642	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A1	HGNC	protein_coding	OTTHUMT00000329005.1	24	0.00	0	T	NM_020410		19766896	19766896	-1	no_errors	ENST00000357324	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	1.000	C
C2CD2	25966	genome.wustl.edu	37	21	43338233	43338233	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr21:43338233G>A	ENST00000380486.3	-	5	942	c.701C>T	c.(700-702)aCg>aTg	p.T234M	C2CD2_ENST00000329623.7_Missense_Mutation_p.T79M	NM_015500.1	NP_056315.1	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2	234						cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|stomach(1)	15						CTTTACAGTCGTGGGCTTGGT	0.527																																						dbGAP											0													123.0	100.0	108.0					21																	43338233		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB047784	CCDS13677.1, CCDS42933.1	21q22.3	2008-11-24	2007-10-17	2007-10-17	ENSG00000157617	ENSG00000157617			1266	protein-coding gene	gene with protein product	"""TMEM24-like"""		"""chromosome 21 open reading frame 25"""	C21orf25		15289880	Standard	NM_015500		Approved	TMEM24L, DKFZP586F0422, C21orf258	uc002yzw.3	Q9Y426	OTTHUMG00000086779	ENST00000380486.3:c.701C>T	21.37:g.43338233G>A	ENSP00000369853:p.Thr234Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R2V7|Q6AHX8|Q9NSE6	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.T234M	ENST00000380486.3	37	c.701	CCDS42933.1	21	.	.	.	.	.	.	.	.	.	.	G	9.971	1.225358	0.22457	.	.	ENSG00000157617	ENST00000329623;ENST00000380486	T;T	0.23147	1.92;1.92	5.19	-4.8	0.03190	.	1.477220	0.04125	N	0.316974	T	0.19208	0.0461	L	0.44542	1.39	0.09310	N	1	P;P	0.39520	0.676;0.676	B;B	0.28465	0.09;0.09	T	0.36962	-0.9726	10	0.46703	T	0.11	-0.7243	12.7657	0.57391	0.6623:0.0:0.3377:0.0	.	79;234	Q6P6D1;Q9Y426	.;CU025_HUMAN	M	79;234	ENSP00000329302:T79M;ENSP00000369853:T234M	ENSP00000329302:T79M	T	-	2	0	C2CD2	42211302	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.598000	0.05706	-0.981000	0.03520	-0.302000	0.09304	ACG	C2CD2	-	NULL	ENSG00000157617		0.527	C2CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD2	HGNC	protein_coding	OTTHUMT00000195228.2	32	0.00	0	G	NM_015500		43338233	43338233	-1	no_errors	ENST00000380486	ensembl	human	known	69_37n	missense	34	32.00	16	SNP	0.000	A
CACNA1C	775	genome.wustl.edu	37	12	2795355	2795355	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr12:2795355G>C	ENST00000347598.4	+	47	5848	c.5848G>C	c.(5848-5850)Gaa>Caa	p.E1950Q	CACNA1C_ENST00000399655.1_Missense_Mutation_p.E1902Q|CACNA1C_ENST00000399606.1_Missense_Mutation_p.E1922Q|CACNA1C_ENST00000335762.5_Missense_Mutation_p.E1927Q|CACNA1C_ENST00000399644.1_Missense_Mutation_p.E1902Q|CACNA1C_ENST00000399637.1_Missense_Mutation_p.E1921Q|CACNA1C_ENST00000399595.1_Missense_Mutation_p.E1910Q|CACNA1C_ENST00000399603.1_Missense_Mutation_p.E1902Q|CACNA1C_ENST00000402845.3_Missense_Mutation_p.E1921Q|CACNA1C_ENST00000327702.7_Missense_Mutation_p.E1937Q|CACNA1C_ENST00000406454.3_Missense_Mutation_p.E1973Q|CACNA1C_ENST00000399597.1_Missense_Mutation_p.E1902Q|CACNA1C_ENST00000399621.1_Missense_Mutation_p.E1921Q|CACNA1C_ENST00000399601.1_Missense_Mutation_p.E1902Q|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000344100.3_Missense_Mutation_p.E1943Q|CACNA1C_ENST00000399591.1_Missense_Mutation_p.E1910Q|CACNA1C_ENST00000399649.1_Missense_Mutation_p.E1908Q|CACNA1C_ENST00000399617.1_Missense_Mutation_p.E1937Q|CACNA1C_ENST00000399634.1_Missense_Mutation_p.E1973Q|CACNA1C_ENST00000399638.1_Missense_Mutation_p.E1930Q|CACNA1C_ENST00000399641.1_Missense_Mutation_p.E1902Q|CACNA1C_ENST00000399629.1_Missense_Mutation_p.E1919Q	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1985					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CTTCCACCTGGAATGTCTGAA	0.562																																						dbGAP											0													99.0	103.0	102.0					12																	2795355		1998	4177	6175	-	-	-	SO:0001583	missense	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5848G>C	12.37:g.2795355G>C	ENSP00000266376:p.Glu1950Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.E1973Q	ENST00000347598.4	37	c.5917	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903137	0.72754	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	4.91	4.91	0.64330	.	1.037400	0.07588	N	0.921466	T	0.78817	0.4343	L	0.54323	1.7	0.46774	D	0.999199	P;D;D;P;D;D;D;D;B;P;D;D;D;D;D;D;D;P;D;B;D;D;D;D;D	0.76494	0.949;0.998;0.996;0.791;0.997;0.999;0.999;0.999;0.12;0.545;0.999;0.998;0.998;0.998;0.993;0.995;0.998;0.956;0.998;0.24;0.999;0.999;0.999;0.998;0.996	P;D;D;B;D;D;D;D;B;B;D;D;D;D;D;D;D;P;D;B;D;D;D;D;D	0.85130	0.656;0.993;0.986;0.368;0.993;0.997;0.995;0.997;0.142;0.21;0.997;0.994;0.994;0.997;0.968;0.954;0.994;0.758;0.993;0.142;0.995;0.997;0.997;0.957;0.986	T	0.71163	-0.4673	10	0.48119	T	0.1	.	18.2794	0.90092	0.0:0.0:1.0:0.0	.	593;1943;1899;1985;1937;1921;1902;1919;1930;1902;1922;1902;1933;1950;1902;1937;1973;1910;1908;1910;1891;1921;1921;1902;1902	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	Q	1927;1902;1902;1930;1902;1921;1921;1910;1902;1950;1922;1902;1943;1919;1937;1908;1921;1902;1973;1937;1973;1910;1803	ENSP00000336982:E1927Q;ENSP00000382563:E1902Q;ENSP00000382552:E1902Q;ENSP00000382547:E1930Q;ENSP00000382506:E1902Q;ENSP00000382530:E1921Q;ENSP00000382546:E1921Q;ENSP00000382500:E1910Q;ENSP00000382549:E1902Q;ENSP00000266376:E1950Q;ENSP00000382515:E1922Q;ENSP00000382510:E1902Q;ENSP00000341092:E1943Q;ENSP00000382537:E1919Q;ENSP00000329877:E1937Q;ENSP00000382557:E1908Q;ENSP00000385724:E1921Q;ENSP00000382512:E1902Q;ENSP00000382542:E1973Q;ENSP00000382526:E1937Q;ENSP00000385896:E1973Q;ENSP00000382504:E1910Q	ENSP00000323129:E1803Q	E	+	1	0	CACNA1C	2665616	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.147000	0.94646	2.549000	0.85964	0.650000	0.86243	GAA	CACNA1C	-	NULL	ENSG00000151067		0.562	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	58	0.00	0	G	NM_000719		2795355	2795355	+1	no_errors	ENST00000399634	ensembl	human	known	69_37n	missense	25	50.98	26	SNP	1.000	C
CKB	1152	genome.wustl.edu	37	14	103988690	103988690	+	Silent	SNP	C	C	T			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr14:103988690C>T	ENST00000348956.2	-	2	498	c.141G>A	c.(139-141)acG>acA	p.T47T	RP11-600F24.7_ENST00000568177.1_RNA	NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	47	Phosphagen kinase N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00842}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	AGCCGCTCGGCGTGCTCTTGG	0.726																																					Esophageal Squamous(186;2492 2823 49929 50127)	dbGAP											0													51.0	49.0	49.0					14																	103988690		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.141G>A	14.37:g.103988690C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	pfam_ATP-guanido_PTrfase_cat,pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	p.T47	ENST00000348956.2	37	c.141	CCDS9981.1	14																																																																																			CKB	-	pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	ENSG00000166165		0.726	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKB	HGNC	protein_coding	OTTHUMT00000415111.1	22	0.00	0	C			103988690	103988690	-1	no_errors	ENST00000348956	ensembl	human	known	69_37n	silent	11	45.00	9	SNP	0.990	T
CTSF	8722	genome.wustl.edu	37	11	66335548	66335548	+	Silent	SNP	A	A	G	rs1127894	byFrequency	TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr11:66335548A>G	ENST00000310325.5	-	2	328	c.219T>C	c.(217-219)ggT>ggC	p.G73G	CTSF_ENST00000533168.1_5'Flank	NM_003793.3	NP_003784.2	Q9UBX1	CATF_HUMAN	cathepsin F	73					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|vesicle (GO:0031982)	cysteine-type endopeptidase activity (GO:0004197)			endometrium(1)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	19						GCGACCCCTGACCCGCCTGGA	0.682													G|||	2918	0.582668	0.8767	0.415	5008	,	,		10960	0.5407		0.5378	False		,,,				2504	0.3937					dbGAP											0													14.0	23.0	20.0					11																	66335548		2196	4292	6488	-	-	-	SO:0001819	synonymous_variant	0			AF071749	CCDS8144.1	11q13.2	2012-02-29			ENSG00000174080	ENSG00000174080		"""Cathepsins"""	2531	protein-coding gene	gene with protein product		603539				9822672, 10318784	Standard	NM_003793		Approved	CATSF, CLN13	uc001oip.3	Q9UBX1	OTTHUMG00000167090	ENST00000310325.5:c.219T>C	11.37:g.66335548A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R964|O95240|Q9NSU4|Q9UKQ5	Silent	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.G73	ENST00000310325.5	37	c.219	CCDS8144.1	11																																																																																			CTSF	-	NULL	ENSG00000174080		0.682	CTSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSF	HGNC	protein_coding	OTTHUMT00000393047.1	10	0.00	0	A	NM_003793		66335548	66335548	-1	no_errors	ENST00000310325	ensembl	human	known	69_37n	silent	5	30.00	6	SNP	0.030	G
CUBN	8029	genome.wustl.edu	37	10	16945996	16945996	+	Silent	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr10:16945996G>A	ENST00000377833.4	-	51	8096	c.8031C>T	c.(8029-8031)caC>caT	p.H2677H		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2677	CUB 19. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGAATCCAATGTGTTCTACAC	0.323																																						dbGAP											0													61.0	55.0	57.0					10																	16945996		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.8031C>T	10.37:g.16945996G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.H2677	ENST00000377833.4	37	c.8031	CCDS7113.1	10																																																																																			CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000107611		0.323	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	38	0.00	0	G	NM_001081		16945996	16945996	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	silent	34	22.73	10	SNP	0.000	A
DCHS2	54798	genome.wustl.edu	37	4	155242117	155242117	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr4:155242117T>A	ENST00000357232.4	-	14	3068	c.3069A>T	c.(3067-3069)agA>agT	p.R1023S		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1023	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TAGTAATCACTCTGAAAAGAT	0.408																																						dbGAP											0													136.0	134.0	135.0					4																	155242117		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3069A>T	4.37:g.155242117T>A	ENSP00000349768:p.Arg1023Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R1023S	ENST00000357232.4	37	c.3069	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	T	14.80	2.643656	0.47258	.	.	ENSG00000197410	ENST00000357232	T	0.49432	0.78	5.69	0.394	0.16299	Cadherin (4);Cadherin-like (1);	0.071821	0.56097	D	0.000032	T	0.28863	0.0716	L	0.34521	1.04	0.80722	D	1	P	0.39535	0.677	B	0.39419	0.299	T	0.12372	-1.0550	10	0.09084	T	0.74	.	6.999	0.24799	0.0:0.3413:0.1228:0.536	.	1023	Q6V1P9	PCD23_HUMAN	S	1023	ENSP00000349768:R1023S	ENSP00000349768:R1023S	R	-	3	2	DCHS2	155461567	0.998000	0.40836	0.997000	0.53966	0.971000	0.66376	0.829000	0.27449	0.011000	0.14865	-0.313000	0.08912	AGA	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.408	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	89	0.00	0	T	NM_001142552		155242117	155242117	-1	no_errors	ENST00000357232	ensembl	human	known	69_37n	missense	70	26.32	25	SNP	0.967	A
DOCK8	81704	genome.wustl.edu	37	9	420960	420960	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr9:420960T>A	ENST00000453981.1	+	32	4147	c.4035T>A	c.(4033-4035)agT>agA	p.S1345R	DOCK8_ENST00000432829.2_Missense_Mutation_p.S1277R|DOCK8_ENST00000493666.2_3'UTR|DOCK8_ENST00000469391.1_Missense_Mutation_p.S1245R|DOCK8_ENST00000382329.1_Missense_Mutation_p.S812R			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1345					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GAAAACAGAGTTCTGACAAAG	0.532																																						dbGAP											0													109.0	101.0	104.0					9																	420960		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.4035T>A	9.37:g.420960T>A	ENSP00000408464:p.Ser1345Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,superfamily_ARM-type_fold	p.S1345R	ENST00000453981.1	37	c.4035	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	T	12.36	1.913773	0.33815	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.01548	4.78;4.78;4.78;4.78	5.96	2.42	0.29668	.	1.117470	0.06481	N	0.732808	T	0.01940	0.0061	L	0.28556	0.865	0.46499	D	0.999074	B;B;B	0.12630	0.002;0.006;0.006	B;B;B	0.17098	0.017;0.017;0.01	T	0.44329	-0.9335	10	0.14656	T	0.56	.	8.7228	0.34452	0.0:0.3997:0.0:0.6003	.	1245;812;1345	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	R	1345;1313;1277;1245;812	ENSP00000408464:S1345R;ENSP00000394888:S1277R;ENSP00000419438:S1245R;ENSP00000371766:S812R	ENSP00000287364:S1313R	S	+	3	2	DOCK8	410960	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	1.389000	0.34453	0.175000	0.19841	-0.256000	0.11100	AGT	DOCK8	-	NULL	ENSG00000107099		0.532	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	20	0.00	0	T	XM_036307		420960	420960	+1	no_errors	ENST00000453981	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	1.000	A
DPCD	25911	genome.wustl.edu	37	10	103360972	103360972	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr10:103360972C>T	ENST00000370151.4	+	4	332	c.283C>T	c.(283-285)Cgc>Tgc	p.R95C	DPCD_ENST00000370147.1_Missense_Mutation_p.R95C|MIR3158-1_ENST00000583596.1_RNA|DPCD_ENST00000370148.2_Missense_Mutation_p.R95C	NM_015448.1	NP_056263.1	Q9BVM2	DPCD_HUMAN	deleted in primary ciliary dyskinesia homolog (mouse)	95					determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|lateral ventricle development (GO:0021670)|left/right pattern formation (GO:0060972)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)	nucleus (GO:0005634)				endometrium(1)|large_intestine(1)|lung(2)|skin(1)	5						TATCTTCATGCGCAAGGACAC	0.542																																						dbGAP											0													152.0	117.0	129.0					10																	103360972		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7514.1	10q24.32	2012-05-03			ENSG00000166171	ENSG00000166171			24542	protein-coding gene	gene with protein product						14630615	Standard	NM_015448		Approved	DKFZP566F084, RP11-529I10.4	uc001ktn.3	Q9BVM2	OTTHUMG00000018934	ENST00000370151.4:c.283C>T	10.37:g.103360972C>T	ENSP00000359170:p.Arg95Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K289|Q6QNL3|Q8N5R1|Q9UFY6	Missense_Mutation	SNP	NULL	p.R95C	ENST00000370151.4	37	c.283	CCDS7514.1	10	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933899	0.73442	.	.	ENSG00000166171	ENST00000370151;ENST00000370147;ENST00000370148;ENST00000370149;ENST00000434727	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.64757	0.2627	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.69824	0.966	T	0.70328	-0.4902	10	0.87932	D	0	-11.6691	13.2881	0.60255	0.2601:0.7399:0.0:0.0	.	95	Q9BVM2	DPCD_HUMAN	C	95;95;95;60;59	ENSP00000359170:R95C;ENSP00000359166:R95C;ENSP00000359167:R95C;ENSP00000403505:R59C	ENSP00000359166:R95C	R	+	1	0	DPCD	103350962	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.262000	0.58847	2.821000	0.97095	0.650000	0.86243	CGC	DPCD	-	NULL	ENSG00000166171		0.542	DPCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPCD	HGNC	protein_coding	OTTHUMT00000049958.2	56	0.00	0	C			103360972	103360972	+1	no_errors	ENST00000370151	ensembl	human	known	69_37n	missense	23	58.93	33	SNP	1.000	T
DUSP16	80824	genome.wustl.edu	37	12	12640024	12640024	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr12:12640024G>A	ENST00000228862.2	-	5	1260	c.629C>T	c.(628-630)cCt>cTt	p.P210L	DUSP16_ENST00000298573.4_3'UTR|RP11-253I19.3_ENST00000544086.1_lincRNA|DUSP16_ENST00000545864.1_5'UTR	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	210					dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		GTCATTCACAGGCACACGCAG	0.438																																					Ovarian(158;443 1896 15437 36069 46477)	dbGAP											0													152.0	138.0	143.0					12																	12640024		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.629C>T	12.37:g.12640024G>A	ENSP00000228862:p.Pro210Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q547C7|Q96QS2|Q9C0G3	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.P210L	ENST00000228862.2	37	c.629	CCDS8650.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.509355	0.96386	.	.	ENSG00000111266	ENST00000228862	D	0.88664	-2.41	5.57	5.57	0.84162	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.120425	0.56097	D	0.000022	D	0.95076	0.8405	M	0.88241	2.94	0.80722	D	1	D;D	0.53462	0.96;0.96	P;P	0.60541	0.876;0.876	D	0.95517	0.8591	10	0.87932	D	0	.	19.5431	0.95282	0.0:0.0:1.0:0.0	.	210;210	Q9BY84;Q96N49	DUS16_HUMAN;.	L	210	ENSP00000228862:P210L	ENSP00000228862:P210L	P	-	2	0	DUSP16	12531291	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.572000	0.98179	2.621000	0.88768	0.561000	0.74099	CCT	DUSP16	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	ENSG00000111266		0.438	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP16	HGNC	protein_coding	OTTHUMT00000400311.1	71	0.00	0	G	NM_030640		12640024	12640024	-1	no_errors	ENST00000228862	ensembl	human	known	69_37n	missense	69	20.69	18	SNP	1.000	A
EIF5B	9669	genome.wustl.edu	37	2	99988165	99988165	+	Silent	SNP	T	T	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr2:99988165T>A	ENST00000289371.6	+	9	1726	c.1524T>A	c.(1522-1524)gcT>gcA	p.A508A		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	508					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ATTGGGAAGCTATGGCCAGTG	0.328																																					Colon(162;2388 2567 2705 3444)	dbGAP											0													100.0	102.0	101.0					2																	99988165		1918	4137	6055	-	-	-	SO:0001819	synonymous_variant	0			AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.1524T>A	2.37:g.99988165T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Silent	SNP	pfam_ProtSyn_GTP-bd,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel,superfamily_TIF_IF2_dom3,prints_ProtSyn_GTP-bd,tigrfam_Small_GTP-bd_dom	p.A508	ENST00000289371.6	37	c.1524	CCDS42721.1	2																																																																																			EIF5B	-	NULL	ENSG00000158417		0.328	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF5B	HGNC	protein_coding	OTTHUMT00000330364.2	86	0.00	0	T	NM_015904		99988165	99988165	+1	no_errors	ENST00000289371	ensembl	human	known	69_37n	silent	67	32.32	32	SNP	0.990	A
ERMP1	79956	genome.wustl.edu	37	9	5830922	5830922	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr9:5830922C>G	ENST00000339450.5	-	2	534	c.445G>C	c.(445-447)Gtg>Ctg	p.V149L	ERMP1_ENST00000381506.3_5'Flank|ERMP1_ENST00000214893.5_5'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	149						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		TTGCTTTGCACTTCAATCAGT	0.413																																						dbGAP											0													130.0	124.0	126.0					9																	5830922		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.445G>C	9.37:g.5830922C>G	ENSP00000340427:p.Val149Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Missense_Mutation	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.V149L	ENST00000339450.5	37	c.445	CCDS34983.1	9	.	.	.	.	.	.	.	.	.	.	C	8.733	0.917180	0.17982	.	.	ENSG00000099219	ENST00000339450	T	0.43294	0.95	5.67	-1.32	0.09201	.	1.303800	0.04895	N	0.450188	T	0.19525	0.0469	N	0.08118	0	0.24958	N	0.991745	B;B	0.17038	0.02;0.008	B;B	0.15484	0.013;0.005	T	0.14172	-1.0482	10	0.29301	T	0.29	0.7219	1.7609	0.02992	0.1222:0.3581:0.2427:0.277	.	149;149	E7ER77;Q7Z2K6	.;ERMP1_HUMAN	L	149	ENSP00000340427:V149L	ENSP00000340427:V149L	V	-	1	0	ERMP1	5820922	0.002000	0.14202	0.124000	0.21820	0.739000	0.42172	0.009000	0.13219	-0.042000	0.13535	-0.176000	0.13171	GTG	ERMP1	-	NULL	ENSG00000099219		0.413	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ERMP1	HGNC	protein_coding	OTTHUMT00000354877.1	97	0.00	0	C	NM_024896		5830922	5830922	-1	no_errors	ENST00000339450	ensembl	human	known	69_37n	missense	59	35.87	33	SNP	0.012	G
FAM8A1	51439	genome.wustl.edu	37	6	17608448	17608448	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr6:17608448A>C	ENST00000259963.3	+	5	1175	c.1120A>C	c.(1120-1122)Aag>Cag	p.K374Q		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	374	RDD.					integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			AGCTTTGATCAAGAATTTTTC	0.348																																						dbGAP											0													158.0	160.0	160.0					6																	17608448		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.1120A>C	6.37:g.17608448A>C	ENSP00000259963:p.Lys374Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R725	Missense_Mutation	SNP	pfam_RDD	p.K374Q	ENST00000259963.3	37	c.1120	CCDS4540.1	6	.	.	.	.	.	.	.	.	.	.	A	25.0	4.589616	0.86851	.	.	ENSG00000137414	ENST00000542476;ENST00000259963	.	.	.	5.63	5.63	0.86233	RDD (1);	0.000000	0.85682	D	0.000000	T	0.76126	0.3944	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78084	-0.2342	9	0.44086	T	0.13	-11.4542	15.837	0.78805	1.0:0.0:0.0:0.0	.	374	Q9UBU6	FA8A1_HUMAN	Q	124;374	.	ENSP00000259963:K374Q	K	+	1	0	FAM8A1	17716427	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.901000	0.92560	2.143000	0.66587	0.455000	0.32223	AAG	FAM8A1	-	pfam_RDD	ENSG00000137414		0.348	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM8A1	HGNC	protein_coding	OTTHUMT00000039950.1	146	0.00	0	A			17608448	17608448	+1	no_errors	ENST00000259963	ensembl	human	known	69_37n	missense	186	20.51	48	SNP	1.000	C
FBXO18	84893	genome.wustl.edu	37	10	5951018	5951018	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr10:5951018G>A	ENST00000362091.4	+	4	999	c.884G>A	c.(883-885)cGa>cAa	p.R295Q	FBXO18_ENST00000379999.5_Splice_Site_p.R346Q|FBXO18_ENST00000397269.3_5'UTR|FBXO18_ENST00000470089.1_3'UTR	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	295					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						AACCTCATACGGTGAGCTTTG	0.478																																						dbGAP											0													212.0	193.0	199.0					10																	5951018		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.884+1G>A	10.37:g.5951018G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	pfam_UvrD-like_ATP-bd,pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.R346Q	ENST00000362091.4	37	c.1037	CCDS7072.1	10	.	.	.	.	.	.	.	.	.	.	G	23.9	4.471890	0.84533	.	.	ENSG00000134452	ENST00000362091;ENST00000544954;ENST00000379999;ENST00000379994	.	.	.	5.29	5.29	0.74685	.	0.199121	0.41294	D	0.000910	T	0.69602	0.3129	L	0.56769	1.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;P;P	0.66847	0.947;0.886;0.886	T	0.71241	-0.4651	9	0.59425	D	0.04	-11.52	11.9854	0.53145	0.0799:0.0:0.9201:0.0	.	346;295;221	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	Q	295;32;346;32	.	ENSP00000355415:R295Q	R	+	2	0	FBXO18	5991024	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.216000	0.51176	2.478000	0.83669	0.561000	0.74099	CGA	FBXO18	-	NULL	ENSG00000134452		0.478	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO18	HGNC	protein_coding	OTTHUMT00000046596.1	74	0.00	0	G	NM_032807	Missense_Mutation	5951018	5951018	+1	no_errors	ENST00000379999	ensembl	human	known	69_37n	missense	58	15.94	11	SNP	1.000	A
FUT4	2526	genome.wustl.edu	37	11	94278445	94278445	+	Silent	SNP	C	C	T			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr11:94278445C>T	ENST00000358752.2	+	1	1429	c.1146C>T	c.(1144-1146)acC>acT	p.T382T	RP11-867G2.8_ENST00000537874.1_RNA|RP11-867G2.8_ENST00000536540.1_RNA	NM_002033.3	NP_002024.1	P22083	FUT4_HUMAN	fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)	382					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	cell periphery (GO:0071944)|cell surface (GO:0009986)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			central_nervous_system(2)|endometrium(2)|lung(1)|skin(2)|upper_aerodigestive_tract(1)	8		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AACATGTGACCGTGGACGTGT	0.652																																						dbGAP											0													17.0	20.0	19.0					11																	94278445		2194	4294	6488	-	-	-	SO:0001819	synonymous_variant	0				CCDS8301.1	11q21	2013-02-26			ENSG00000196371	ENSG00000196371		"""CD molecules"", ""Fucosyltransferases"""	4015	protein-coding gene	gene with protein product	"""ELAM ligand fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	104230		CD15, FCT3A, ELFT		1702034	Standard	NM_002033		Approved	FUC-TIV	uc001pez.3	P22083	OTTHUMG00000167795	ENST00000358752.2:c.1146C>T	11.37:g.94278445C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMS0	Silent	SNP	pfam_Glyco_trans_10	p.T382	ENST00000358752.2	37	c.1146	CCDS8301.1	11																																																																																			FUT4	-	pfam_Glyco_trans_10	ENSG00000196371		0.652	FUT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT4	HGNC	protein_coding	OTTHUMT00000396327.2	9	0.00	0	C	NM_002033		94278445	94278445	+1	no_errors	ENST00000358752	ensembl	human	known	69_37n	silent	20	20.00	5	SNP	0.000	T
GRIA1	2890	genome.wustl.edu	37	5	153026664	153026664	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr5:153026664C>G	ENST00000285900.5	+	3	740	c.397C>G	c.(397-399)Ctc>Gtc	p.L133V	GRIA1_ENST00000518862.1_3'UTR|GRIA1_ENST00000340592.5_Missense_Mutation_p.L133V|GRIA1_ENST00000518783.1_Missense_Mutation_p.L143V|GRIA1_ENST00000518142.1_Intron|GRIA1_ENST00000448073.4_Missense_Mutation_p.L143V|GRIA1_ENST00000521843.2_Missense_Mutation_p.L64V	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	133					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GCAGGATGCCCTCATCAGCAT	0.512																																						dbGAP											0													134.0	125.0	128.0					5																	153026664		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.397C>G	5.37:g.153026664C>G	ENSP00000285900:p.Leu133Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.L143V	ENST00000285900.5	37	c.427	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	C	23.3	4.393846	0.83011	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	D;D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69;-1.69	5.55	5.55	0.83447	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.87398	0.6167	L	0.36672	1.1	0.80722	D	1	D;D;D;D;P	0.71674	0.998;0.998;0.998;0.998;0.759	D;D;D;D;P	0.87578	0.998;0.998;0.998;0.996;0.523	D	0.85876	0.1419	10	0.35671	T	0.21	.	18.489	0.90839	0.0:1.0:0.0:0.0	.	143;143;143;133;133	E7ESV8;B7Z9G9;B7Z2W8;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	V	133;133;87;133;64;64;143;143	ENSP00000285900:L133V;ENSP00000339343:L133V;ENSP00000427864:L64V;ENSP00000442108:L64V;ENSP00000428994:L143V;ENSP00000415569:L143V	ENSP00000285900:L133V	L	+	1	0	GRIA1	153006857	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.545000	0.82128	2.612000	0.88384	0.655000	0.94253	CTC	GRIA1	-	pfam_ANF_lig-bd_rcpt	ENSG00000155511		0.512	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	93	0.00	0	C			153026664	153026664	+1	no_errors	ENST00000448073	ensembl	human	known	69_37n	missense	56	31.71	26	SNP	1.000	G
ILF2	3608	genome.wustl.edu	37	1	153636538	153636538	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr1:153636538G>A	ENST00000361891.4	-	10	850	c.725C>T	c.(724-726)cCc>cTc	p.P242L	ILF2_ENST00000480213.1_5'UTR	NM_001267809.1|NM_004515.3	NP_001254738.1|NP_004506.2	Q12905	ILF2_HUMAN	interleukin enhancer binding factor 2	242	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				immune response (GO:0006955)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)			cervix(1)|kidney(1)|lung(4)|skin(1)	7	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAGGATCCAGGGTGTGAGGGG	0.398																																						dbGAP											0													86.0	86.0	86.0					1																	153636538		2203	4300	6503	-	-	-	SO:0001583	missense	0			U10323	CCDS1050.1, CCDS72919.1	1q21.3	2012-12-04	2012-12-04		ENSG00000143621	ENSG00000143621			6037	protein-coding gene	gene with protein product		603181	"""interleukin enhancer binding factor 2, 45kD"", ""interleukin enhancer binding factor 2, 45kDa"""			7519613	Standard	NM_004515		Approved	NF45	uc001fcr.4	Q12905	OTTHUMG00000037087	ENST00000361891.4:c.725C>T	1.37:g.153636538G>A	ENSP00000355011:p.Pro242Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDB0|B2R8G7|Q5SR10|Q5SR11|Q7L7R3|Q9BWD4|Q9P1N0	Missense_Mutation	SNP	pfam_DZF,smart_DZF,pfscan_2-5-oligoadenylate_synth_N	p.P242L	ENST00000361891.4	37	c.725	CCDS1050.1	1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073211	0.76415	.	.	ENSG00000143621	ENST00000361891	T	0.41400	1.0	5.5	5.5	0.81552	DZF (2);	0.051647	0.85682	D	0.000000	T	0.50548	0.1622	M	0.82517	2.595	0.80722	D	1	P;P	0.38473	0.58;0.633	B;P	0.47299	0.407;0.543	T	0.56341	-0.7995	10	0.62326	D	0.03	-8.1498	16.9058	0.86127	0.0:0.0:1.0:0.0	.	242;242	F4ZW62;Q12905	.;ILF2_HUMAN	L	242	ENSP00000355011:P242L	ENSP00000355011:P242L	P	-	2	0	ILF2	151903162	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.839000	0.75364	2.596000	0.87737	0.650000	0.86243	CCC	ILF2	-	pfam_DZF,smart_DZF	ENSG00000143621		0.398	ILF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILF2	HGNC	protein_coding	OTTHUMT00000090040.1	68	0.00	0	G	NM_004515		153636538	153636538	-1	no_errors	ENST00000361891	ensembl	human	known	69_37n	missense	82	22.64	24	SNP	1.000	A
KCNK5	8645	genome.wustl.edu	37	6	39162069	39162069	+	Silent	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr6:39162069G>A	ENST00000359534.3	-	4	848	c.510C>T	c.(508-510)ggC>ggT	p.G170G		NM_003740.3	NP_003731.1	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	170					excretion (GO:0007588)|potassium ion transport (GO:0006813)	integral component of plasma membrane (GO:0005887)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(4)|skin(3)	19						GGACTAGGACGCCCCACACGA	0.552																																						dbGAP											0													157.0	120.0	132.0					6																	39162069		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF084830	CCDS4841.1	6p21	2012-03-07			ENSG00000164626	ENSG00000164626		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6280	protein-coding gene	gene with protein product		603493				9812978, 16382106	Standard	XM_005249456		Approved	K2p5.1, TASK-2	uc003oon.3	O95279	OTTHUMG00000014642	ENST00000359534.3:c.510C>T	6.37:g.39162069G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAQ6|B5TJL2|Q5VV76	Silent	SNP	pfam_Ion_trans_2,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.G170	ENST00000359534.3	37	c.510	CCDS4841.1	6																																																																																			KCNK5	-	NULL	ENSG00000164626		0.552	KCNK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK5	HGNC	protein_coding	OTTHUMT00000040449.1	55	0.00	0	G	NM_003740		39162069	39162069	-1	no_errors	ENST00000359534	ensembl	human	known	69_37n	silent	58	19.48	15	SNP	0.086	A
CIPC	85457	genome.wustl.edu	37	14	77580648	77580648	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr14:77580648A>C	ENST00000361786.2	+	4	1504	c.1187A>C	c.(1186-1188)cAc>cCc	p.H396P	RP11-463C8.4_ENST00000557752.1_Intron	NM_033426.2	NP_219494.2	Q9C0C6	CIPC_HUMAN		396					negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(2)|lung(4)|prostate(3)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0284)		TTCTCTGATCACCCAGCCATA	0.488																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0																														ENST00000361786.2:c.1187A>C	14.37:g.77580648A>C	ENSP00000355319:p.His396Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCI1|Q8N389|Q8NDZ1	Missense_Mutation	SNP	NULL	p.H396P	ENST00000361786.2	37	c.1187	CCDS9855.1	14	.	.	.	.	.	.	.	.	.	.	A	11.90	1.777229	0.31411	.	.	ENSG00000198894	ENST00000361786	T	0.30714	1.52	5.91	3.49	0.39957	.	0.590539	0.17906	N	0.158023	T	0.18215	0.0437	N	0.12182	0.205	0.33175	D	0.548799	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.10064	-1.0646	10	0.44086	T	0.13	-18.2755	11.4371	0.50074	0.7133:0.2867:0.0:0.0	.	396;298	Q9C0C6;B3KU75	K1737_HUMAN;.	P	396	ENSP00000355319:H396P	ENSP00000355319:H396P	H	+	2	0	KIAA1737	76650401	0.950000	0.32346	0.884000	0.34674	0.807000	0.45602	1.647000	0.37260	0.445000	0.26639	0.528000	0.53228	CAC	KIAA1737	-	NULL	ENSG00000198894		0.488	KIAA1737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1737	HGNC	protein_coding	OTTHUMT00000414278.1	18	0.00	0	A			77580648	77580648	+1	no_errors	ENST00000361786	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	0.497	C
KIFC1	3833	genome.wustl.edu	37	6	33372827	33372827	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr6:33372827C>T	ENST00000428849.2	+	7	1405	c.955C>T	c.(955-957)Cct>Tct	p.P319S		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	319	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						CCGGGTCCGCCCTGTCCTGCC	0.652																																						dbGAP											0													79.0	76.0	77.0					6																	33372827		2203	4300	6503	-	-	-	SO:0001583	missense	0			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.955C>T	6.37:g.33372827C>T	ENSP00000393963:p.Pro319Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P319S	ENST00000428849.2	37	c.955	CCDS34430.1	6	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158566	0.78114	.	.	ENSG00000237649	ENST00000428849	T	0.74421	-0.84	5.43	5.43	0.79202	Kinesin, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.91195	0.7226	H	0.98577	4.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93824	0.7121	10	0.87932	D	0	-23.2017	16.7763	0.85551	0.0:1.0:0.0:0.0	.	311;319	B4E063;Q9BW19	.;KIFC1_HUMAN	S	319	ENSP00000393963:P319S	ENSP00000393963:P319S	P	+	1	0	KIFC1	33480805	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.321000	0.59209	2.824000	0.97209	0.655000	0.94253	CCT	KIFC1	-	smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000237649		0.652	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC1	HGNC	protein_coding	OTTHUMT00000076417.1	20	0.00	0	C	NM_002263		33372827	33372827	+1	no_errors	ENST00000428849	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	T
KLHL8	57563	genome.wustl.edu	37	4	88106441	88106441	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr4:88106441G>A	ENST00000273963.5	-	3	1068	c.727C>T	c.(727-729)Cag>Tag	p.Q243*	KLHL8_ENST00000512111.1_Nonsense_Mutation_p.Q243*|KLHL8_ENST00000425278.2_Intron|KLHL8_ENST00000498875.2_Nonsense_Mutation_p.Q167*|KLHL8_ENST00000545252.1_Intron	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	243	BACK.				protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		GAATGATGCTGAGGATTGGCA	0.408																																						dbGAP											0													136.0	130.0	132.0					4																	88106441		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.727C>T	4.37:g.88106441G>A	ENSP00000273963:p.Gln243*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XA3|Q6N018	Nonsense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_Kelch_2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.Q243*	ENST00000273963.5	37	c.727	CCDS3617.1	4	.	.	.	.	.	.	.	.	.	.	G	40	8.001602	0.98605	.	.	ENSG00000145332	ENST00000273963;ENST00000498875;ENST00000512111	.	.	.	5.67	5.67	0.87782	.	0.103079	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	19.7705	0.96361	0.0:0.0:1.0:0.0	.	.	.	.	X	243;167;243	.	ENSP00000273963:Q243X	Q	-	1	0	KLHL8	88325465	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	7.439000	0.80444	2.669000	0.90835	0.655000	0.94253	CAG	KLHL8	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000145332		0.408	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL8	HGNC	protein_coding	OTTHUMT00000253040.1	55	0.00	0	G			88106441	88106441	-1	no_errors	ENST00000273963	ensembl	human	known	69_37n	nonsense	50	41.86	36	SNP	1.000	A
LIPN	643418	genome.wustl.edu	37	10	90524285	90524285	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr10:90524285G>T	ENST00000404459.1	+	3	345	c.345G>T	c.(343-345)tgG>tgT	p.W115C		NM_001102469.1	NP_001095939.1	Q5VXI9	LIPN_HUMAN	lipase, family member N	115					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	9		Colorectal(252;0.0161)		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)		ATGATGTATGGATGGGAAACA	0.423																																						dbGAP											0													89.0	89.0	89.0					10																	90524285		1894	4125	6019	-	-	-	SO:0001583	missense	0				CCDS44456.1	10q23.31	2013-09-20	2007-02-27	2007-02-27	ENSG00000204020	ENSG00000204020			23452	protein-coding gene	gene with protein product		613924	"""lipase-like, ab-hydrolase domain containing 4"""	LIPL4			Standard	NM_001102469		Approved	bA186O14.3	uc010qmw.2	Q5VXI9	OTTHUMG00000018694	ENST00000404459.1:c.345G>T	10.37:g.90524285G>T	ENSP00000383923:p.Trp115Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7KIH9	Missense_Mutation	SNP	pfam_AB_hydrolase_lipase,pfam_AB_hydrolase_1	p.W115C	ENST00000404459.1	37	c.345	CCDS44456.1	10	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939260	0.73557	.	.	ENSG00000204020	ENST00000404459	T	0.61627	0.09	4.52	4.52	0.55395	Alpha/beta hydrolase fold-1 (1);	0.000000	0.64402	D	0.000019	D	0.83876	0.5349	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89610	0.3841	10	0.87932	D	0	-8.3656	16.5128	0.84290	0.0:0.0:1.0:0.0	.	115	Q5VXI9	LIPN_HUMAN	C	115	ENSP00000383923:W115C	ENSP00000383923:W115C	W	+	3	0	LIPN	90514265	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.950000	0.93019	2.487000	0.83934	0.655000	0.94253	TGG	LIPN	-	pfam_AB_hydrolase_1	ENSG00000204020		0.423	LIPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPN	HGNC	protein_coding	OTTHUMT00000049254.2	87	0.00	0	G	XM_926751		90524285	90524285	+1	no_errors	ENST00000404459	ensembl	human	known	69_37n	missense	50	48.98	48	SNP	1.000	T
MGAM	8972	genome.wustl.edu	37	7	141794269	141794269	+	Intron	SNP	G	G	A	rs3087323		TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr7:141794269G>A	ENST00000549489.2	+	39	4713				MGAM_ENST00000475668.2_Silent_p.A2426A	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ACACAGCCGCGTGGGATCAGC	0.617																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4619-151G>A	7.37:g.141794269G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.A2427	ENST00000549489.2	37	c.7281	CCDS47727.1	7																																																																																			MGAM	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000257335		0.617	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	71	0.00	0	G			141794269	141794269	+1	no_errors	ENST00000475668	ensembl	human	putative	69_37n	silent	47	45.98	40	SNP	0.000	A
MTCH1	23787	genome.wustl.edu	37	6	36940433	36940433	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr6:36940433A>C	ENST00000373627.5	-	8	1025	c.901T>G	c.(901-903)Tcc>Gcc	p.S301A	MTCH1_ENST00000538808.1_Intron|MTCH1_ENST00000373616.5_Intron|MTCH1_ENST00000471737.1_5'Flank	NM_001271641.1	NP_001258570.1	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier 1	301					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|neuronal ion channel clustering (GO:0045161)|positive regulation of apoptotic process (GO:0043065)|regulation of signal transduction (GO:0009966)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						CCAACCTGGGAACCTGGATTC	0.567																																						dbGAP											0													28.0	23.0	25.0					6																	36940433		2038	3953	5991	-	-	-	SO:0001583	missense	0			AF151822	CCDS4828.1, CCDS64411.1	6p21.2	2013-05-22	2011-05-19		ENSG00000137409	ENSG00000137409		"""Solute carriers"""	17586	protein-coding gene	gene with protein product	"""solute carrier family 25, member 49"""	610449	"""mitochondrial carrier homolog 1 (C. elegans)"""			12377771	Standard	NM_014341		Approved	CGI-64, PSAP, SLC25A49	uc003ond.2	Q9NZJ7	OTTHUMG00000014614	ENST00000373627.5:c.901T>G	6.37:g.36940433A>C	ENSP00000362730:p.Ser301Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAX5|B2RCE3|Q6PK60|Q6UX45|Q7L465|Q9BW23|Q9NZR6|Q9UJZ5	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.S301A	ENST00000373627.5	37	c.901		6	.	.	.	.	.	.	.	.	.	.	A	11.64	1.699132	0.30142	.	.	ENSG00000137409	ENST00000373627	T	0.43294	0.95	5.11	5.11	0.69529	Mitochondrial carrier domain (2);	0.142120	0.32503	N	0.006010	T	0.32406	0.0828	.	.	.	0.80722	D	1	P;P	0.49961	0.93;0.606	P;B	0.48627	0.584;0.18	T	0.34204	-0.9838	9	0.59425	D	0.04	.	7.5045	0.27536	0.9066:0.0:0.0934:0.0	.	283;301	Q8IW90;Q9NZJ7	.;MTCH1_HUMAN	A	301	ENSP00000362730:S301A	ENSP00000362730:S301A	S	-	1	0	MTCH1	37048411	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.007000	0.57093	2.157000	0.67596	0.533000	0.62120	TCC	MTCH1	-	superfamily_Mt_carrier_dom	ENSG00000137409		0.567	MTCH1-008	KNOWN	basic|appris_principal	protein_coding	MTCH1	HGNC	protein_coding	OTTHUMT00000040396.1	34	0.00	0	A	NM_014341		36940433	36940433	-1	no_errors	ENST00000373627	ensembl	human	known	69_37n	missense	30	25.00	10	SNP	1.000	C
MUC12	10071	genome.wustl.edu	37	7	100637521	100637521	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr7:100637521C>G	ENST00000379442.3	+	5	4106	c.4106C>G	c.(4105-4107)aCa>aGa	p.T1369R	MUC12_ENST00000536621.1_Missense_Mutation_p.T1226R			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1369	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TCCACCCAAACAGGGTTACCT	0.577																																						dbGAP											0													5.0	7.0	6.0					7																	100637521		474	1029	1503	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.4106C>G	7.37:g.100637521C>G	ENSP00000368755:p.Thr1369Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.T1369R	ENST00000379442.3	37	c.4106		7	.	.	.	.	.	.	.	.	.	.	-	1.635	-0.518026	0.04171	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12039	2.72;2.72	0.49	0.49	0.16861	.	.	.	.	.	T	0.06462	0.0166	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.42378	-0.9455	7	0.27082	T	0.32	.	6.783	0.23657	0.0:0.9998:0.0:2.0E-4	.	.	.	.	R	1369;1226	ENSP00000368755:T1369R;ENSP00000441929:T1226R	ENSP00000368755:T1369R	T	+	2	0	MUC12	100424241	0.000000	0.05858	0.021000	0.16686	0.023000	0.10783	-0.397000	0.07269	0.513000	0.28278	0.184000	0.17185	ACA	MUC12	-	NULL	ENSG00000205277		0.577	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	56	0.00	0	C	XM_379904		100637521	100637521	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	8	85.19	46	SNP	0.122	G
NADK2	133686	genome.wustl.edu	37	5	36195293	36195293	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr5:36195293T>C	ENST00000381937.4	-	12	1281	c.1282A>G	c.(1282-1284)Atg>Gtg	p.M428V	NADK2_ENST00000514504.1_Missense_Mutation_p.M396V|NADK2_ENST00000282512.3_Missense_Mutation_p.M265V|NADK2_ENST00000511613.1_5'UTR|NADK2_ENST00000397338.1_Missense_Mutation_p.M265V|NADK2_ENST00000506945.1_Missense_Mutation_p.M287V	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial	428					NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)										TTATTGATCATCATCGAAGCA	0.398																																						dbGAP											0													135.0	131.0	133.0					5																	36195293		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.1282A>G	5.37:g.36195293T>C	ENSP00000371362:p.Met428Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MC93|Q6UTX5|Q96NM0	Missense_Mutation	SNP	pirsf_ATP-NAD-like_euk	p.M265V	ENST00000381937.4	37	c.793	CCDS47197.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.40|13.40	2.226178|2.226178	0.39300|0.39300	.|.	.|.	ENSG00000152620|ENSG00000152620	ENST00000397338;ENST00000282512;ENST00000381937;ENST00000506945;ENST00000514504|ENST00000502355	.|.	.|.	.|.	5.91|5.91	4.73|4.73	0.59995|0.59995	.|.	0.338646|.	0.42172|.	D|.	0.000759|.	T|.	0.17534|.	0.0421|.	N|N	0.08118|0.08118	0|0	0.28064|0.28064	N|N	0.932834|0.932834	B;B;B|.	0.06786|.	0.0;0.0;0.001|.	B;B;B|.	0.06405|.	0.002;0.001;0.001|.	T|.	0.18398|.	-1.0338|.	9|.	0.33940|.	T|.	0.23|.	-7.6404|-7.6404	5.3942|5.3942	0.16261|0.16261	0.3753:0.0756:0.0:0.5491|0.3753:0.0756:0.0:0.5491	.|.	287;396;428|.	B7Z8V7;Q4G0N4-2;Q4G0N4|.	.;.;NAKD1_HUMAN|.	V|W	265;265;428;287;396|122	.|.	ENSP00000282512:M265V|.	M|X	-|-	1|3	0|0	NADKD1|NADKD1	36231050|36231050	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.100000|2.100000	0.41777|0.41777	1.016000|1.016000	0.39470|0.39470	0.533000|0.533000	0.62120|0.62120	ATG|TGA	NADKD1	-	pirsf_ATP-NAD-like_euk	ENSG00000152620		0.398	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	NADKD1	HGNC	protein_coding	OTTHUMT00000367541.1	119	0.00	0	T	NM_153013		36195293	36195293	-1	no_errors	ENST00000397338	ensembl	human	known	69_37n	missense	72	51.02	75	SNP	1.000	C
NPR2	4882	genome.wustl.edu	37	9	35794041	35794041	+	Missense_Mutation	SNP	C	C	T	rs61758519		TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr9:35794041C>T	ENST00000342694.2	+	2	1069	c.814C>T	c.(814-816)Cgg>Tgg	p.R272W		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	272					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	TGCTACAGGCCGGCCCTGGCA	0.577																																						dbGAP											0													56.0	57.0	57.0					9																	35794041		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.814C>T	9.37:g.35794041C>T	ENSP00000341083:p.Arg272Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.R272W	ENST00000342694.2	37	c.814	CCDS6590.1	9	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559600	0.45590	.	.	ENSG00000159899	ENST00000342694	T	0.74526	-0.85	4.11	4.11	0.48088	Extracellular ligand-binding receptor (1);	0.000000	0.37437	N	0.002081	T	0.62208	0.2409	L	0.36672	1.1	0.37314	D	0.909252	B;B	0.25105	0.111;0.118	B;B	0.22880	0.03;0.042	T	0.64407	-0.6415	10	0.39692	T	0.17	.	9.8331	0.40954	0.3234:0.6766:0.0:0.0	rs61758519	272;272	P20594-2;P20594	.;ANPRB_HUMAN	W	272	ENSP00000341083:R272W	ENSP00000341083:R272W	R	+	1	2	NPR2	35784041	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.151000	0.50670	2.275000	0.75901	0.655000	0.94253	CGG	NPR2	-	pfam_ANF_lig-bd_rcpt	ENSG00000159899		0.577	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR2	HGNC	protein_coding	OTTHUMT00000052345.1	52	0.00	0	C			35794041	35794041	+1	no_errors	ENST00000342694	ensembl	human	known	69_37n	missense	14	73.08	38	SNP	0.999	T
OR56A4	120793	genome.wustl.edu	37	11	6024337	6024337	+	Silent	SNP	C	C	T			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr11:6024337C>T	ENST00000330728.4	-	1	87	c.42G>A	c.(40-42)caG>caA	p.Q14Q		NM_001005179.2	NP_001005179.2	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A, member 4	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	32		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACTGAGGCCCTGTATCTGTC	0.368																																						dbGAP											0													108.0	121.0	117.0					11																	6024337		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			BK004255	CCDS31404.1	11p15.4	2012-08-09			ENSG00000183389	ENSG00000183389		"""GPCR / Class A : Olfactory receptors"""	14791	protein-coding gene	gene with protein product							Standard	NM_001005179		Approved		uc010qzv.2	Q8NGH8	OTTHUMG00000165376	ENST00000330728.4:c.42G>A	11.37:g.6024337C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH17	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Q14	ENST00000330728.4	37	c.42	CCDS31404.1	11																																																																																			OR56A4	-	NULL	ENSG00000183389		0.368	OR56A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56A4	HGNC	protein_coding	OTTHUMT00000383756.2	78	0.00	0	C	NM_001005179		6024337	6024337	-1	no_errors	ENST00000330728	ensembl	human	known	69_37n	silent	75	21.88	21	SNP	0.000	T
NRXN2	9379	genome.wustl.edu	37	11	64416348	64416348	+	Silent	SNP	A	A	G			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr11:64416348A>G	ENST00000377551.1	-	15	3352	c.3141T>C	c.(3139-3141)aaT>aaC	p.N1047N	NRXN2_ENST00000409571.1_Silent_p.N1040N|NRXN2_ENST00000377559.3_Silent_p.N1007N|NRXN2_ENST00000265459.6_Silent_p.N1047N|AP001092.4_ENST00000433606.1_RNA			Q9P2S2	NRX2A_HUMAN	neurexin 2	1047	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TGCTGAACATATTCTTGCTCA	0.592																																						dbGAP											0													98.0	94.0	96.0					11																	64416348		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.3141T>C	11.37:g.64416348A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C1|Q9Y2D6	Silent	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.N1047	ENST00000377551.1	37	c.3141	CCDS8077.1	11																																																																																			NRXN2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000110076		0.592	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRXN2	HGNC	protein_coding	OTTHUMT00000104967.3	24	0.00	0	A	NM_015080		64416348	64416348	-1	no_errors	ENST00000265459	ensembl	human	known	69_37n	silent	22	37.14	13	SNP	0.891	G
PLD5	200150	genome.wustl.edu	37	1	242253225	242253225	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr1:242253225G>T	ENST00000536534.2	-	10	1783	c.1542C>A	c.(1540-1542)ttC>ttA	p.F514L	PLD5_ENST00000442594.2_Missense_Mutation_p.F422L|PLD5_ENST00000427495.1_Missense_Mutation_p.F452L			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	514						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			GTTTGAGTTTGAACAGGCTTG	0.468																																						dbGAP											0													240.0	229.0	233.0					1																	242253225		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1542C>A	1.37:g.242253225G>T	ENSP00000440896:p.Phe514Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	smart_PLipase_D/transphosphatidylase	p.F514L	ENST00000536534.2	37	c.1542	CCDS1621.2	1	.	.	.	.	.	.	.	.	.	.	G	9.496	1.101929	0.20632	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.40476	1.04;1.03;1.03	4.83	3.91	0.45181	.	1.054610	0.07352	N	0.882638	T	0.21347	0.0514	N	0.03608	-0.345	0.26229	N	0.979043	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.10683	-1.0619	10	0.10902	T	0.67	-2.8074	11.0245	0.47736	0.0868:0.0:0.9132:0.0	.	422;514;452	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	L	452;422;514	ENSP00000401285:F452L;ENSP00000414188:F422L;ENSP00000440896:F514L	ENSP00000401285:F452L	F	-	3	2	PLD5	240319848	1.000000	0.71417	0.922000	0.36590	0.750000	0.42670	1.845000	0.39279	1.389000	0.46526	0.655000	0.94253	TTC	PLD5	-	NULL	ENSG00000180287		0.468	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	HGNC	protein_coding	OTTHUMT00000397213.2	210	0.00	0	G	NM_152666		242253225	242253225	-1	no_errors	ENST00000536534	ensembl	human	known	69_37n	missense	238	12.13	33	SNP	0.994	T
PPM1D	8493	genome.wustl.edu	37	17	58725291	58725291	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr17:58725291G>A	ENST00000305921.3	+	4	1097	c.865G>A	c.(865-867)Gtg>Atg	p.V289M		NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	289	PP2C-like.				G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			TGGTGAATTTGTGGTGTCACC	0.433																																						dbGAP											0													141.0	123.0	129.0					17																	58725291		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.865G>A	17.37:g.58725291G>A	ENSP00000306682:p.Val289Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XP4|Q6P991|Q8IVR6	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.V289M	ENST00000305921.3	37	c.865	CCDS11625.1	17	.	.	.	.	.	.	.	.	.	.	G	20.8	4.042801	0.75732	.	.	ENSG00000170836	ENST00000305921;ENST00000544712;ENST00000392995	T;T	0.09817	2.94;2.94	5.02	5.02	0.67125	Protein phosphatase 2C-like (4);	0.000000	0.85682	D	0.000000	T	0.24005	0.0581	L	0.56396	1.775	0.80722	D	1	D	0.64830	0.994	P	0.59056	0.851	T	0.00280	-1.1852	10	0.52906	T	0.07	-12.65	12.7359	0.57222	0.0795:0.0:0.9205:0.0	.	289	O15297	PPM1D_HUMAN	M	289;137;289	ENSP00000306682:V289M;ENSP00000376720:V289M	ENSP00000306682:V289M	V	+	1	0	PPM1D	56080073	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.335000	0.72949	2.343000	0.79666	0.484000	0.47621	GTG	PPM1D	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000170836		0.433	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1D	HGNC	protein_coding	OTTHUMT00000449474.1	83	0.00	0	G	NM_003620		58725291	58725291	+1	no_errors	ENST00000305921	ensembl	human	known	69_37n	missense	111	20.71	29	SNP	1.000	A
PTPRB	5787	genome.wustl.edu	37	12	70974895	70974895	+	Silent	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr12:70974895G>A	ENST00000261266.5	-	8	1874	c.1845C>T	c.(1843-1845)tcC>tcT	p.S615S	PTPRB_ENST00000538708.1_Silent_p.S615S|PTPRB_ENST00000334414.6_Silent_p.S833S|PTPRB_ENST00000451516.2_Silent_p.S525S|PTPRB_ENST00000551525.1_Silent_p.S832S|PTPRB_ENST00000550857.1_Silent_p.S525S|PTPRB_ENST00000550358.1_Silent_p.S833S	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	615	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ACAGGCTGCCGGACTTGAGAG	0.453																																						dbGAP											0													120.0	124.0	123.0					12																	70974895		1950	4144	6094	-	-	-	SO:0001819	synonymous_variant	0			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.1845C>T	12.37:g.70974895G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.S833	ENST00000261266.5	37	c.2499	CCDS44944.1	12																																																																																			PTPRB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000127329		0.453	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404439.1	77	0.00	0	G			70974895	70974895	-1	no_errors	ENST00000334414	ensembl	human	known	69_37n	silent	42	53.85	49	SNP	0.001	A
RAB14	51552	genome.wustl.edu	37	9	123943767	123943767	+	Silent	SNP	A	A	G			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr9:123943767A>G	ENST00000373840.4	-	8	792	c.555T>C	c.(553-555)gcT>gcC	p.A185A		NM_016322.3	NP_057406.2	P61106	RAB14_HUMAN	RAB14, member RAS oncogene family	185					embryo development (GO:0009790)|endocytic recycling (GO:0032456)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi to endosome transport (GO:0006895)|GTP catabolic process (GO:0006184)|intracellular transport (GO:0046907)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|rough endoplasmic reticulum (GO:0005791)|trans-Golgi network transport vesicle (GO:0030140)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CAGACTCAGCAGCATTCAGAT	0.517																																						dbGAP											0													98.0	94.0	95.0					9																	123943767		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152463	CCDS6827.1	9q32-q34.11	2008-07-21			ENSG00000119396	ENSG00000119396		"""RAB, member RAS oncogene"""	16524	protein-coding gene	gene with protein product	"""F protein-binding protein 1"", ""bA165P4.3 (member RAS oncogene family)"", ""small GTP binding protein RAB14"""	612673				9792283, 15004230	Standard	NM_016322		Approved	FBP, RAB-14	uc004blc.3	P61106	OTTHUMG00000020582	ENST00000373840.4:c.555T>C	9.37:g.123943767A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR31|P35287|Q5JVD4|Q6Q7K5|Q969L0|Q9UI11	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.A185	ENST00000373840.4	37	c.555	CCDS6827.1	9																																																																																			RAB14	-	smart_Ran_GTPase	ENSG00000119396		0.517	RAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB14	HGNC	protein_coding	OTTHUMT00000053857.1	46	0.00	0	A	NM_016322		123943767	123943767	-1	no_errors	ENST00000373840	ensembl	human	known	69_37n	silent	14	75.86	44	SNP	0.945	G
SCN11A	11280	genome.wustl.edu	37	3	38892206	38892206	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr3:38892206T>C	ENST00000302328.3	-	25	4291	c.4093A>G	c.(4093-4095)Agc>Ggc	p.S1365G	SCN11A_ENST00000444237.2_Missense_Mutation_p.S1365G|SCN11A_ENST00000456224.3_Missense_Mutation_p.S1327G|SCN11A_ENST00000450244.1_Missense_Mutation_p.S1365G	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1365					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAGATCTGGCTTGTGACTATG	0.328																																						dbGAP											0													147.0	134.0	138.0					3																	38892206		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.4093A>G	3.37:g.38892206T>C	ENSP00000307599:p.Ser1365Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.S1365G	ENST00000302328.3	37	c.4093	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	T	9.358	1.067368	0.20067	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.97620	-4.46;-4.46;-4.46;-4.46	4.98	2.47	0.30058	.	0.472531	0.24907	N	0.034643	D	0.95671	0.8592	M	0.70903	2.155	0.09310	N	1	B	0.23442	0.085	B	0.19666	0.026	D	0.89623	0.3850	10	0.66056	D	0.02	.	13.9533	0.64131	0.0:0.0:0.5551:0.4449	.	1365	Q9UI33	SCNBA_HUMAN	G	1365;1365;1327;1365	ENSP00000307599:S1365G;ENSP00000400945:S1365G;ENSP00000416757:S1327G;ENSP00000408028:S1365G	ENSP00000307599:S1365G	S	-	1	0	SCN11A	38867210	0.000000	0.05858	0.571000	0.28486	0.366000	0.29705	0.493000	0.22451	0.285000	0.22329	0.533000	0.62120	AGC	SCN11A	-	NULL	ENSG00000168356		0.328	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	88	0.00	0	T	NM_014139		38892206	38892206	-1	no_errors	ENST00000302328	ensembl	human	known	69_37n	missense	52	54.39	62	SNP	0.006	C
SIRT2	22933	genome.wustl.edu	37	19	39369929	39369929	+	Missense_Mutation	SNP	G	G	A	rs199855116		TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr19:39369929G>A	ENST00000249396.7	-	16	1337	c.1036C>T	c.(1036-1038)Cgg>Tgg	p.R346W	SIRT2_ENST00000392081.2_Missense_Mutation_p.R309W|SIRT2_ENST00000358931.5_3'UTR|RINL_ENST00000591812.1_5'Flank|RINL_ENST00000340740.3_5'Flank|RINL_ENST00000598904.1_5'Flank	NM_012237.3	NP_036369.2	Q8IXJ6	SIR2_HUMAN	sirtuin 2	346					autophagy (GO:0006914)|cellular lipid catabolic process (GO:0044242)|cellular response to caloric restriction (GO:0061433)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to hypoxia (GO:0071456)|cellular response to molecule of bacterial origin (GO:0071219)|cellular response to oxidative stress (GO:0034599)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|chromatin silencing at telomere (GO:0006348)|gene silencing (GO:0016458)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|innate immune response (GO:0045087)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|myelination in peripheral nervous system (GO:0022011)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)|negative regulation of defense response to bacterium (GO:1900425)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of oligodendrocyte progenitor proliferation (GO:0070446)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of cell division (GO:0051781)|positive regulation of DNA binding (GO:0043388)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of meiosis (GO:0045836)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)|protein kinase B signaling (GO:0043491)|regulation of cell cycle (GO:0051726)|regulation of exit from mitosis (GO:0007096)|regulation of myelination (GO:0031641)|regulation of phosphorylation (GO:0042325)|response to redox state (GO:0051775)|ripoptosome assembly involved in necroptotic process (GO:1901026)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)	centriole (GO:0005814)|centrosome (GO:0005813)|chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|glial cell projection (GO:0097386)|juxtaparanode region of axon (GO:0044224)|lateral loop (GO:0043219)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|myelin sheath (GO:0043209)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|spindle (GO:0005819)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|NAD-dependent protein deacetylase activity (GO:0034979)|protein deacetylase activity (GO:0033558)|transcription factor binding (GO:0008134)|tubulin deacetylase activity (GO:0042903)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)	9	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)			TGCTCCCTCCGGACAAGGTCC	0.632																																						dbGAP											0													32.0	34.0	34.0					19																	39369929		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF083107	CCDS12523.1, CCDS46069.1, CCDS74361.1	19q13	2010-06-25	2010-06-25		ENSG00000068903	ENSG00000068903			10886	protein-coding gene	gene with protein product		604480	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 2"", ""sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae)"""	SIR2L		10393250, 10381378	Standard	NM_012237		Approved		uc002ojt.2	Q8IXJ6	OTTHUMG00000150480	ENST00000249396.7:c.1036C>T	19.37:g.39369929G>A	ENSP00000249396:p.Arg346Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3V1|B2RB45|O95889|Q924Y7|Q9P0G8|Q9UNT0|Q9Y6E9|U5TP13	Missense_Mutation	SNP	pfam_NAD-dep_deAcase_sirtuin,pirsf_NAD-dep_deAcase_SIR2_euk,pfscan_NAD-dep_deAcase_sirtuin	p.R346W	ENST00000249396.7	37	c.1036	CCDS12523.1	19	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564588	0.65651	.	.	ENSG00000068903	ENST00000249396;ENST00000392081;ENST00000456703	T;T	0.18174	2.23;2.23	4.88	2.59	0.31030	.	0.677315	0.13565	N	0.378491	T	0.23572	0.0570	L	0.58583	1.82	0.80722	D	1	D;D;D	0.69078	0.959;0.963;0.997	P;B;P	0.50570	0.559;0.356;0.644	T	0.05484	-1.0882	10	0.72032	D	0.01	-5.5654	7.4288	0.27115	0.0913:0.0:0.6425:0.2662	.	309;346;326	Q8IXJ6-2;Q8IXJ6;Q8IXJ6-3	.;SIRT2_HUMAN;.	W	346;309;331	ENSP00000249396:R346W;ENSP00000375931:R309W	ENSP00000249396:R346W	R	-	1	2	SIRT2	44061769	0.996000	0.38824	0.968000	0.41197	0.994000	0.84299	1.701000	0.37825	1.189000	0.43028	0.467000	0.42956	CGG	SIRT2	-	pirsf_NAD-dep_deAcase_SIR2_euk	ENSG00000068903		0.632	SIRT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIRT2	HGNC	protein_coding	OTTHUMT00000318278.1	41	0.00	0	G			39369929	39369929	-1	no_errors	ENST00000249396	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	0.998	A
SLC7A11	23657	genome.wustl.edu	37	4	139144461	139144461	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr4:139144461T>G	ENST00000280612.5	-	4	817	c.538A>C	c.(538-540)Aat>Cat	p.N180H		NM_014331.3	NP_055146.1	Q9UPY5	XCT_HUMAN	solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11	180					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|brain development (GO:0007420)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|lens fiber cell differentiation (GO:0070306)|leukocyte migration (GO:0050900)|platelet aggregation (GO:0070527)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	cystine:glutamate antiporter activity (GO:0015327)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)	18	all_hematologic(180;0.166)				Acetylcysteine(DB06151)|L-Cystine(DB00138)|Riluzole(DB00740)|Rosuvastatin(DB01098)|Sulfasalazine(DB00795)|Tauroursodeoxycholic acid(DB08834)	CTCATGCTATTTAGGACCATC	0.423																																						dbGAP											0													73.0	76.0	75.0					4																	139144461		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB026891	CCDS3742.1	4q28-q32	2013-05-22	2011-07-12		ENSG00000151012	ENSG00000151012		"""Solute carriers"""	11059	protein-coding gene	gene with protein product		607933				10206947, 12763038	Standard	XM_005262875		Approved	xCT	uc021xrw.1	Q9UPY5	OTTHUMG00000133396	ENST00000280612.5:c.538A>C	4.37:g.139144461T>G	ENSP00000280612:p.Asn180His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2U4	Missense_Mutation	SNP	pfam_AA-permease_dom,pfam_AA_transpt_TM,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	p.N180H	ENST00000280612.5	37	c.538	CCDS3742.1	4	.	.	.	.	.	.	.	.	.	.	T	19.37	3.814374	0.70912	.	.	ENSG00000151012	ENST00000280612	D	0.91068	-2.78	5.48	4.3	0.51218	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.94896	0.8350	M	0.83774	2.66	0.58432	D	0.999996	D	0.76494	0.999	D	0.83275	0.996	D	0.94509	0.7717	10	0.66056	D	0.02	.	11.2354	0.48938	0.0:0.0721:0.0:0.9279	.	180	Q9UPY5	XCT_HUMAN	H	180	ENSP00000280612:N180H	ENSP00000280612:N180H	N	-	1	0	SLC7A11	139363911	1.000000	0.71417	0.992000	0.48379	0.992000	0.81027	7.101000	0.76997	0.917000	0.36895	0.482000	0.46254	AAT	SLC7A11	-	pfam_AA-permease_dom,pfam_AA_transpt_TM,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	ENSG00000151012		0.423	SLC7A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A11	HGNC	protein_coding	OTTHUMT00000257251.2	81	0.00	0	T			139144461	139144461	-1	no_errors	ENST00000280612	ensembl	human	known	69_37n	missense	86	21.10	23	SNP	1.000	G
SPRY2	10253	genome.wustl.edu	37	13	80910967	80910967	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr13:80910967G>A	ENST00000377102.1	-	2	1851	c.874C>T	c.(874-876)Cgc>Tgc	p.R292C	SPRY2_ENST00000540649.1_Missense_Mutation_p.R292C|SPRY2_ENST00000377104.3_Missense_Mutation_p.R292C			O43597	SPY2_HUMAN	sprouty homolog 2 (Drosophila)	292	Cys-rich.				bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of mitotic spindle orientation (GO:0000132)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inner ear morphogenesis (GO:0042472)|lung growth (GO:0060437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|sensory perception of sound (GO:0007605)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase inhibitor activity (GO:0030291)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		TTTTTACAGCGGCAACCAGGC	0.448																																						dbGAP											0													61.0	63.0	63.0					13																	80910967		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039843	CCDS9463.1	13q31.1	2008-05-14	2001-11-28		ENSG00000136158	ENSG00000136158			11270	protein-coding gene	gene with protein product		602466	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005842		Approved	hSPRY2	uc001vlj.3	O43597	OTTHUMG00000017140	ENST00000377102.1:c.874C>T	13.37:g.80910967G>A	ENSP00000366306:p.Arg292Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9J9|Q5T6Z7	Missense_Mutation	SNP	pfam_Sprouty	p.R292C	ENST00000377102.1	37	c.874	CCDS9463.1	13	.	.	.	.	.	.	.	.	.	.	G	17.56	3.419650	0.62622	.	.	ENSG00000136158	ENST00000377104;ENST00000377102;ENST00000541655;ENST00000540649	T;T;T	0.68765	-0.35;-0.35;-0.35	5.21	4.34	0.51931	.	0.000000	0.85682	D	0.000000	T	0.81394	0.4813	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.67725	0.953	D	0.84683	0.0718	10	0.87932	D	0	-13.4884	15.1896	0.73032	0.0:0.0:0.8578:0.1422	.	292	O43597	SPY2_HUMAN	C	292	ENSP00000366308:R292C;ENSP00000366306:R292C;ENSP00000439027:R292C	ENSP00000366306:R292C	R	-	1	0	SPRY2	79808968	1.000000	0.71417	0.681000	0.30009	0.982000	0.71751	7.455000	0.80726	1.290000	0.44636	0.561000	0.74099	CGC	SPRY2	-	pfam_Sprouty	ENSG00000136158		0.448	SPRY2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPRY2	HGNC	protein_coding	OTTHUMT00000045387.1	52	0.00	0	G			80910967	80910967	-1	no_errors	ENST00000377102	ensembl	human	known	69_37n	missense	10	60.00	15	SNP	1.000	A
SRRM4	84530	genome.wustl.edu	37	12	119591417	119591417	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr12:119591417C>T	ENST00000267260.4	+	11	1742	c.1354C>T	c.(1354-1356)Cgc>Tgc	p.R452C		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	452	Arg-rich.|Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						CTCTAGGTCCCGCCGCAGCCC	0.652																																						dbGAP											0													17.0	24.0	22.0					12																	119591417		1863	4070	5933	-	-	-	SO:0001583	missense	0			AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.1354C>T	12.37:g.119591417C>T	ENSP00000267260:p.Arg452Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	NULL	p.R452C	ENST00000267260.4	37	c.1354	CCDS44994.1	12	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048836	0.75846	.	.	ENSG00000139767	ENST00000267260	T	0.26223	1.75	5.72	5.72	0.89469	.	0.060635	0.64402	D	0.000002	T	0.30823	0.0777	L	0.44542	1.39	0.58432	D	0.999994	D	0.55800	0.973	P	0.46110	0.504	T	0.00920	-1.1514	9	.	.	.	-16.1686	19.8721	0.96854	0.0:1.0:0.0:0.0	.	452	A7MD48	SRRM4_HUMAN	C	452	ENSP00000267260:R452C	.	R	+	1	0	SRRM4	118075800	0.992000	0.36948	0.996000	0.52242	0.589000	0.36550	3.101000	0.50283	2.700000	0.92200	0.561000	0.74099	CGC	SRRM4	-	NULL	ENSG00000139767		0.652	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM4	HGNC	protein_coding	OTTHUMT00000401640.2	29	0.00	0	C	NM_194286		119591417	119591417	+1	no_errors	ENST00000267260	ensembl	human	known	69_37n	missense	9	43.75	7	SNP	0.987	T
TAF4	6874	genome.wustl.edu	37	20	60578311	60578311	+	Silent	SNP	G	G	C	rs561993913		TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr20:60578311G>C	ENST00000252996.4	-	9	2390	c.2391C>G	c.(2389-2391)gcC>gcG	p.A797A		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	797					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.A797A(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CAGGTAACACGGCGGGTTTCA	0.488																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											99.0	91.0	94.0					20																	60578311		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.2391C>G	20.37:g.60578311G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Silent	SNP	pfam_TAF4,pfam_TAFH_NHR1,superfamily_Histone-fold,smart_TAFH_NHR1,pfscan_TAFH_NHR1	p.A797	ENST00000252996.4	37	c.2391	CCDS33500.1	20																																																																																			TAF4	-	NULL	ENSG00000130699		0.488	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF4	HGNC	protein_coding	OTTHUMT00000079968.2	75	0.00	0	G	NM_003185		60578311	60578311	-1	no_errors	ENST00000252996	ensembl	human	known	69_37n	silent	63	26.74	23	SNP	0.026	C
TCF7L2	6934	genome.wustl.edu	37	10	114925317	114925317	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr10:114925317delA	ENST00000355995.4	+	15	1953	c.1446delA	c.(1444-1446)agafs	p.R482fs	TCF7L2_ENST00000352065.5_3'UTR|TCF7L2_ENST00000538897.1_Frame_Shift_Del_p.E458fs|TCF7L2_ENST00000466338.1_3'UTR|TCF7L2_ENST00000543371.1_Frame_Shift_Del_p.R465fs|TCF7L2_ENST00000355717.4_Frame_Shift_Del_p.E465fs|TCF7L2_ENST00000545257.1_Frame_Shift_Del_p.R482fs|TCF7L2_ENST00000369389.1_Frame_Shift_Del_p.E152fs|TCF7L2_ENST00000542695.1_Frame_Shift_Del_p.R198fs|TCF7L2_ENST00000369397.4_Frame_Shift_Del_p.R459fs|TCF7L2_ENST00000369386.1_3'UTR|TCF7L2_ENST00000536810.1_Frame_Shift_Del_p.R465fs			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	482	Promoter-specific activation domain.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		TTTCTAGGAGAAAAAAAAAGT	0.522			T	VTI1A	colorectal																																	dbGAP		Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	0													94.0	102.0	99.0					10																	114925317		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1446delA	10.37:g.114925317delA	ENSP00000348274:p.Arg482fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Frame_Shift_Del	DEL	pfam_CTNNB1-bd_N,pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.K485fs	ENST00000355995.4	37	c.1446		10																																																																																			TCF7L2	-	NULL	ENSG00000148737		0.522	TCF7L2-203	KNOWN	basic	protein_coding	TCF7L2	HGNC	protein_coding		9	0.00	0	A	NM_030756		114925317	114925317	+1	no_errors	ENST00000355995	ensembl	human	known	69_37n	frame_shift_del	7	22.22	2	DEL	1.000	-
THBS1	7057	genome.wustl.edu	37	15	39874617	39874619	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	GAA	GAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr15:39874617_39874619delGAA	ENST00000260356.5	+	3	456_458	c.291_293delGAA	c.(289-294)atgaag>atg	p.K99del		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	99	Laminin G-like.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		TGAGGCAGATGAAGAAGACCCGG	0.616																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.291_293delGAA	15.37:g.39874620_39874622delGAA	ENSP00000260356:p.Lys99del	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	In_Frame_Del	DEL	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.K99in_frame_del	ENST00000260356.5	37	c.291_293	CCDS32194.1	15																																																																																			THBS1	-	superfamily_ConA-like_lec_gl,smart_Laminin_G	ENSG00000137801		0.616	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS1	HGNC	protein_coding	OTTHUMT00000257831.2	47	0.00	0	GAA	NM_003246		39874617	39874619	+1	no_errors	ENST00000260356	ensembl	human	known	69_37n	in_frame_del	34	24.44	11	DEL	1.000:1.000:1.000	-
TICRR	90381	genome.wustl.edu	37	15	90167690	90167690	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr15:90167690A>C	ENST00000268138.7	+	20	4254	c.4149A>C	c.(4147-4149)aaA>aaC	p.K1383N	KIF7_ENST00000558928.1_Intron|TICRR_ENST00000560985.1_Missense_Mutation_p.K1382N			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1383					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										AAGTTGGGAAACGGTGTAGAA	0.582																																						dbGAP											0													130.0	128.0	129.0					15																	90167690		2200	4299	6499	-	-	-	SO:0001583	missense	0			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.4149A>C	15.37:g.90167690A>C	ENSP00000268138:p.Lys1383Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	NULL	p.K1383N	ENST00000268138.7	37	c.4149	CCDS10352.2	15	.	.	.	.	.	.	.	.	.	.	A	10.47	1.358504	0.24598	.	.	ENSG00000140534	ENST00000268138	T	0.10860	2.83	4.86	1.26	0.21427	.	0.720518	0.13041	N	0.418555	T	0.15305	0.0369	L	0.56769	1.78	0.09310	N	1	P	0.48016	0.904	P	0.48227	0.571	T	0.10870	-1.0611	10	0.49607	T	0.09	-4.1103	7.5429	0.27748	0.7496:0.0:0.2504:0.0	.	1383	Q7Z2Z1	TICRR_HUMAN	N	1383	ENSP00000268138:K1383N	ENSP00000268138:K1383N	K	+	3	2	C15orf42	87968694	0.016000	0.18221	0.000000	0.03702	0.001000	0.01503	0.435000	0.21510	0.020000	0.15106	-0.899000	0.02877	AAA	TICRR	-	NULL	ENSG00000140534		0.582	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TICRR	HGNC	protein_coding	OTTHUMT00000312856.1	49	0.00	0	A	NM_152259		90167690	90167690	+1	no_errors	ENST00000268138	ensembl	human	known	69_37n	missense	41	24.07	13	SNP	0.001	C
TP53	7157	genome.wustl.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	GRCh37	CM951226	TP53	M							132.0	118.0	123.0					17																	7578212		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R213*	ENST00000269305.4	37	c.637	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	141	0.00	0	G	NM_000546		7578212	7578212	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	28	53.33	32	SNP	0.893	A
TREML1	340205	genome.wustl.edu	37	6	41122014	41122014	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr6:41122014G>C	ENST00000426005.2	-	1	56	c.13C>G	c.(13-15)Ctg>Gtg	p.L5V	TREML1_ENST00000437044.2_Missense_Mutation_p.L5V|TREML1_ENST00000373127.4_Missense_Mutation_p.L5V	NM_178174.2	NP_835468.1	Q86YW5	TRML1_HUMAN	triggering receptor expressed on myeloid cells-like 1	5					calcium-mediated signaling (GO:0019722)|innate immune response (GO:0045087)|platelet activation (GO:0030168)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGCAAGAGCAGGGTGAGGCCC	0.572																																						dbGAP											0													57.0	55.0	56.0					6																	41122014		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF534822	CCDS4851.1, CCDS64420.1, CCDS64421.1	6p21.1	2013-01-11			ENSG00000161911	ENSG00000161911		"""Immunoglobulin superfamily / V-set domain containing"""	20434	protein-coding gene	gene with protein product	"""TREM-like transcript 1"""	609714				12393607, 12645956	Standard	NM_178174		Approved	TLT1, dJ238O23.3	uc011duc.3	Q86YW5	OTTHUMG00000016231	ENST00000426005.2:c.13C>G	6.37:g.41122014G>C	ENSP00000402855:p.Leu5Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q496B3|Q8IWY1|Q8IWY2	Missense_Mutation	SNP	pfam_Ig_V-set	p.L5V	ENST00000426005.2	37	c.13	CCDS4851.1	6	.	.	.	.	.	.	.	.	.	.	G	12.44	1.937612	0.34189	.	.	ENSG00000161911	ENST00000373127;ENST00000437044;ENST00000426005	T;T;T	0.48522	1.24;0.81;1.31	5.72	4.63	0.57726	.	0.151580	0.31051	N	0.008360	T	0.37461	0.1004	L	0.34521	1.04	0.09310	N	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.71870	0.975;0.943;0.963	T	0.20140	-1.0284	10	0.27785	T	0.31	.	10.1237	0.42637	0.1113:0.0:0.8887:0.0	.	5;5;5	Q86YW5-3;Q86YW5;Q86YW5-2	.;TRML1_HUMAN;.	V	5	ENSP00000362219:L5V;ENSP00000400405:L5V;ENSP00000402855:L5V	ENSP00000362219:L5V	L	-	1	2	TREML1	41229992	0.959000	0.32827	0.783000	0.31826	0.533000	0.34776	1.936000	0.40183	1.276000	0.44395	0.655000	0.94253	CTG	TREML1	-	NULL	ENSG00000161911		0.572	TREML1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TREML1	HGNC	protein_coding	OTTHUMT00000043538.2	30	0.00	0	G	NM_178174		41122014	41122014	-1	no_errors	ENST00000426005	ensembl	human	known	69_37n	missense	51	13.56	8	SNP	0.429	C
TRIM61	391712	genome.wustl.edu	37	4	165890903	165890903	+	Silent	SNP	T	T	C			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr4:165890903T>C	ENST00000329314.5	-	3	864	c.252A>G	c.(250-252)agA>agG	p.R84R		NM_001012414.2	NP_001012414.1	Q5EBN2	TRI61_HUMAN	tripartite motif containing 61	84						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|kidney(1)|liver(1)|skin(1)|upper_aerodigestive_tract(1)	5	all_hematologic(180;0.221)	Prostate(90;0.109)		GBM - Glioblastoma multiforme(119;0.155)		TCTTCTTGCTTCTTATCTGGA	0.428																																						dbGAP											0													6.0	7.0	7.0					4																	165890903		1593	3042	4635	-	-	-	SO:0001819	synonymous_variant	0				CCDS34093.1	4q32.3	2013-01-09	2011-01-25			ENSG00000183439		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24339	protein-coding gene	gene with protein product			"""ring finger protein 35"", ""tripartite motif-containing 61"""	RNF35			Standard	NM_001012414		Approved		uc003iqw.3	Q5EBN2		ENST00000329314.5:c.252A>G	4.37:g.165890903T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,smart_Znf_RING,pfscan_Znf_B-box,pfscan_Znf_RING	p.R84	ENST00000329314.5	37	c.252	CCDS34093.1	4																																																																																			TRIM61	-	NULL	ENSG00000183439		0.428	TRIM61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM61	HGNC	protein_coding	OTTHUMT00000364331.1	58	0.00	0	T	XM_373038		165890903	165890903	-1	no_errors	ENST00000329314	ensembl	human	known	69_37n	silent	63	26.74	23	SNP	0.015	C
ULK4	54986	genome.wustl.edu	37	3	41938435	41938435	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr3:41938435G>A	ENST00000301831.4	-	15	1871	c.1409C>T	c.(1408-1410)tCg>tTg	p.S470L	ULK4_ENST00000420927.1_Missense_Mutation_p.S470L|U8_ENST00000390843.2_RNA	NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	470					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		GTCGATCTGCGAGCACACTTG	0.458																																						dbGAP											0													88.0	90.0	89.0					3																	41938435		1938	4126	6064	-	-	-	SO:0001583	missense	0			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.1409C>T	3.37:g.41938435G>A	ENSP00000301831:p.Ser470Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S470L	ENST00000301831.4	37	c.1409	CCDS43071.1	3	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417603	0.42918	.	.	ENSG00000168038	ENST00000301831;ENST00000420927	T;T	0.55760	0.5;0.63	4.68	3.79	0.43588	Armadillo-like helical (1);	0.299147	0.33916	N	0.004424	T	0.38532	0.1044	L	0.38838	1.175	0.48632	D	0.999683	B;B	0.20887	0.049;0.049	B;B	0.11329	0.006;0.006	T	0.36915	-0.9728	10	0.54805	T	0.06	.	6.9562	0.24572	0.0938:0.0:0.7308:0.1755	.	470;470	B4E2M4;Q96C45	.;ULK4_HUMAN	L	470	ENSP00000301831:S470L;ENSP00000412187:S470L	ENSP00000301831:S470L	S	-	2	0	ULK4	41913439	0.992000	0.36948	0.940000	0.37924	0.937000	0.57800	2.101000	0.41787	2.150000	0.67090	0.585000	0.79938	TCG	ULK4	-	NULL	ENSG00000168038		0.458	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK4	HGNC	protein_coding	OTTHUMT00000343490.1	21	0.00	0	G	XM_929989		41938435	41938435	-1	no_errors	ENST00000301831	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	0.685	A
USP32	84669	genome.wustl.edu	37	17	58275761	58275761	+	Silent	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr17:58275761G>A	ENST00000300896.4	-	27	3488	c.3294C>T	c.(3292-3294)ccC>ccT	p.P1098P	USP32_ENST00000592339.1_Silent_p.P768P	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	1098	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			CAAAGAGGCTGGGGCGATTCT	0.463																																						dbGAP											0													156.0	142.0	147.0					17																	58275761		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.3294C>T	17.37:g.58275761G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5T3|Q9BX85|Q9Y591	Silent	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_EF_hand_Ca-bd,smart_Pept_C19_DUSP,pfscan_EF_HAND_2,pfscan_Peptidase_C19,prints_Recoverin	p.P1098	ENST00000300896.4	37	c.3294	CCDS32697.1	17																																																																																			USP32	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000170832		0.463	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP32	HGNC	protein_coding	OTTHUMT00000449235.2	150	0.00	0	G	NM_032582		58275761	58275761	-1	no_errors	ENST00000300896	ensembl	human	known	69_37n	silent	79	52.69	88	SNP	1.000	A
VPS33A	65082	genome.wustl.edu	37	12	122720362	122720362	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr12:122720362G>A	ENST00000267199.4	-	11	1523	c.1411C>T	c.(1411-1413)Cgc>Tgc	p.R471C	RP11-512M8.5_ENST00000535844.1_Missense_Mutation_p.R432C	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	471					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		ATCCAGAGGCGTAATGTTTTC	0.498																																						dbGAP											0													290.0	248.0	263.0					12																	122720362		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.1411C>T	12.37:g.122720362G>A	ENSP00000267199:p.Arg471Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q547V4|Q9H5Q0	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.R471C	ENST00000267199.4	37	c.1411	CCDS9231.1	12	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477195	0.84640	.	.	ENSG00000139719	ENST00000267199	T	0.32023	1.47	5.54	5.54	0.83059	.	0.057768	0.64402	D	0.000002	T	0.60470	0.2271	M	0.83774	2.66	0.80722	D	1	D	0.76494	0.999	D	0.65987	0.94	T	0.64867	-0.6306	10	0.87932	D	0	-25.9706	19.8585	0.96775	0.0:0.0:1.0:0.0	.	471	Q96AX1	VP33A_HUMAN	C	471	ENSP00000267199:R471C	ENSP00000446319:R432C	R	-	1	0	VPS33A	121286315	1.000000	0.71417	0.961000	0.40146	0.884000	0.51177	5.795000	0.69074	2.760000	0.94817	0.655000	0.94253	CGC	VPS33A	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000139719		0.498	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS33A	HGNC	protein_coding	OTTHUMT00000401607.2	96	0.00	0	G			122720362	122720362	-1	no_errors	ENST00000267199	ensembl	human	known	69_37n	missense	101	24.06	32	SNP	0.998	A
WRN	7486	genome.wustl.edu	37	8	30958371	30958371	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr8:30958371C>T	ENST00000298139.5	+	18	2237	c.1988C>T	c.(1987-1989)aCg>aTg	p.T663M		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	663	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		ACAGGTATCACGCTCATTGCT	0.388			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	dbGAP	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0													79.0	74.0	76.0					8																	30958371		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.1988C>T	8.37:g.30958371C>T	ENSP00000298139:p.Thr663Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A1KYY9	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/RNaseD_C,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_Helicase/RNaseD_C,pfscan_Helicase/RNaseD_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.T663M	ENST00000298139.5	37	c.1988	CCDS6082.1	8	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958834	0.92726	.	.	ENSG00000165392	ENST00000298139	T	0.15487	2.42	5.74	5.74	0.90152	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.131279	0.52532	D	0.000078	T	0.34542	0.0901	L	0.39514	1.22	0.38757	D	0.954244	D;D	0.76494	0.984;0.999	D;D	0.65140	0.932;0.912	T	0.04885	-1.0920	10	0.72032	D	0.01	-10.3912	19.5086	0.95132	0.0:1.0:0.0:0.0	.	73;663	Q59F09;Q14191	.;WRN_HUMAN	M	663	ENSP00000298139:T663M	ENSP00000298139:T663M	T	+	2	0	WRN	31077913	0.660000	0.27420	0.805000	0.32314	0.494000	0.33585	5.836000	0.69375	2.711000	0.92665	0.591000	0.81541	ACG	WRN	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000165392		0.388	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1	107	0.00	0	C			30958371	30958371	+1	no_errors	ENST00000298139	ensembl	human	known	69_37n	missense	19	58.70	27	SNP	0.849	T
ZNF414	84330	genome.wustl.edu	37	19	8577364	8577364	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr19:8577364C>T	ENST00000255616.8	-	4	538	c.437G>A	c.(436-438)cGc>cAc	p.R146H	ZNF414_ENST00000393927.4_Missense_Mutation_p.R146H	NM_032370.2	NP_115746.2	Q96IQ9	ZN414_HUMAN	zinc finger protein 414	146					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(2)	2						GGCTGAGCAGCGGAAGAGCTT	0.597																																						dbGAP											0													132.0	120.0	124.0					19																	8577364		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074191	CCDS12205.1, CCDS54211.1	19p13.2	2008-02-05				ENSG00000133250		"""Zinc fingers, C2H2-type"""	20630	protein-coding gene	gene with protein product							Standard	NM_032370		Approved	MGC15716, Zfp414	uc002mke.4	Q96IQ9		ENST00000255616.8:c.437G>A	19.37:g.8577364C>T	ENSP00000255616:p.Arg146His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY94	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R146H	ENST00000255616.8	37	c.437	CCDS12205.1	19	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783286	0.49891	.	.	ENSG00000133250	ENST00000393927;ENST00000255616	T;T	0.09073	3.02;3.02	4.92	2.4	0.29515	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.289101	0.29814	N	0.011126	T	0.14227	0.0344	L	0.37750	1.13	0.31759	N	0.633534	B;D	0.76494	0.229;0.999	B;D	0.77004	0.105;0.989	T	0.04635	-1.0937	10	0.48119	T	0.1	-18.2944	4.817	0.13372	0.0:0.6522:0.0:0.3478	.	146;146	Q96IQ9;A8MY94	ZN414_HUMAN;.	H	146	ENSP00000377504:R146H;ENSP00000255616:R146H	ENSP00000255616:R146H	R	-	2	0	ZNF414	8483364	0.989000	0.36119	1.000000	0.80357	0.996000	0.88848	0.490000	0.22403	1.194000	0.43101	0.561000	0.74099	CGC	ZNF414	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000133250		0.597	ZNF414-002	KNOWN	basic|CCDS	protein_coding	ZNF414	HGNC	protein_coding	OTTHUMT00000460199.2	69	0.00	0	C	NM_032370		8577364	8577364	-1	no_errors	ENST00000393927	ensembl	human	known	69_37n	missense	56	48.25	55	SNP	1.000	T
ZNF90	7643	genome.wustl.edu	37	19	20228629	20228629	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1Y3-01A-11D-A159-09	TCGA-D8-A1Y3-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	64fa29ff-534f-4b22-b0c4-513e8657edb1	f063a7c5-7db1-4c0a-864f-f9bbf945537e	g.chr19:20228629A>G	ENST00000418063.2	+	4	378	c.266A>G	c.(265-267)cAg>cGg	p.Q89R	ZNF90_ENST00000474284.1_Intron	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	89					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						TGTCCAGAGCAGAGCCTAAAA	0.338																																						dbGAP											0													88.0	79.0	82.0					19																	20228629		692	1591	2283	-	-	-	SO:0001583	missense	0			M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.266A>G	19.37:g.20228629A>G	ENSP00000410466:p.Gln89Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q89R	ENST00000418063.2	37	c.266	CCDS46028.1	19	.	.	.	.	.	.	.	.	.	.	A	6.330	0.428970	0.11987	.	.	ENSG00000213988	ENST00000418063	T	0.04862	3.54	0.487	0.487	0.16842	.	.	.	.	.	T	0.08223	0.0205	M	0.73962	2.25	0.09310	N	1	B	0.30406	0.278	B	0.24974	0.057	T	0.21586	-1.0241	8	0.45353	T	0.12	.	.	.	.	.	89	Q03938	ZNF90_HUMAN	R	89	ENSP00000410466:Q89R	ENSP00000410466:Q89R	Q	+	2	0	ZNF90	20089629	0.044000	0.20184	0.006000	0.13384	0.071000	0.16799	0.702000	0.25631	0.418000	0.25898	0.155000	0.16302	CAG	ZNF90	-	NULL	ENSG00000213988		0.338	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF90	HGNC	protein_coding	OTTHUMT00000350101.1	87	0.00	0	A	NM_007138		20228629	20228629	+1	no_errors	ENST00000418063	ensembl	human	known	69_37n	missense	104	17.46	22	SNP	0.005	G
