#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADPRH	141	genome.wustl.edu	37	3	119301156	119301156	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr3:119301156A>T	ENST00000478399.1	+	2	1545	c.140A>T	c.(139-141)gAc>gTc	p.D47V	ADPRH_ENST00000478927.1_Missense_Mutation_p.D47V|ADPRH_ENST00000357003.3_Missense_Mutation_p.D47V|ADPRH_ENST00000471850.1_Intron|RP11-190C22.9_ENST00000609385.1_RNA|ADPRH_ENST00000465513.1_Missense_Mutation_p.D47V			P54922	ADPRH_HUMAN	ADP-ribosylarginine hydrolase	47					cellular protein modification process (GO:0006464)|protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)			breast(1)|kidney(1)|lung(10)|ovary(1)	13		Lung NSC(201;0.0977)		GBM - Glioblastoma multiforme(114;0.23)		GATGCCCTAGACGTGGGAAGG	0.562																																					GBM(133;579 1804 5989 9967 40052)	dbGAP											0													91.0	85.0	87.0					3																	119301156		2203	4300	6503	-	-	-	SO:0001583	missense	0			L13291	CCDS2990.1	3q13.31-q13.33	2004-02-27			ENSG00000144843	ENSG00000144843			269	protein-coding gene	gene with protein product		603081				8349667, 12070318	Standard	NM_001125		Approved	ARH1	uc003ecs.3	P54922	OTTHUMG00000159420	ENST00000478399.1:c.140A>T	3.37:g.119301156A>T	ENSP00000420200:p.Asp47Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8H1|D3DN83	Missense_Mutation	SNP	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1,pirsf_ADP-ribosylarg_hydro	p.D47V	ENST00000478399.1	37	c.140	CCDS2990.1	3	.	.	.	.	.	.	.	.	.	.	A	9.864	1.197182	0.22037	.	.	ENSG00000144843	ENST00000478399;ENST00000481816;ENST00000478927;ENST00000357003;ENST00000465513	T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45	5.89	4.72	0.59763	.	0.219434	0.46442	D	0.000283	T	0.19366	0.0465	N	0.13299	0.325	0.25606	N	0.986548	B	0.14438	0.01	B	0.23018	0.043	T	0.16364	-1.0405	10	0.33141	T	0.24	-9.3278	11.4503	0.50149	0.8488:0.1512:0.0:0.0	.	47	P54922	ADPRH_HUMAN	V	47	ENSP00000420200:D47V;ENSP00000419703:D47V;ENSP00000417528:D47V;ENSP00000349496:D47V;ENSP00000417430:D47V	ENSP00000349496:D47V	D	+	2	0	ADPRH	120783846	0.428000	0.25522	0.914000	0.36105	0.611000	0.37282	4.347000	0.59373	1.026000	0.39733	0.455000	0.32223	GAC	ADPRH	-	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1,pirsf_ADP-ribosylarg_hydro	ENSG00000144843		0.562	ADPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPRH	HGNC	protein_coding	OTTHUMT00000355199.1	38	0.00	0	A	NM_001125		119301156	119301156	+1	no_errors	ENST00000357003	ensembl	human	known	69_37n	missense	70	30.69	31	SNP	0.079	T
ADCY5	111	genome.wustl.edu	37	3	123166299	123166302	+	Frame_Shift_Del	DEL	GCGA	GCGA	-			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	GCGA	GCGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr3:123166299_123166302delGCGA	ENST00000462833.1	-	1	2303_2306	c.1091_1094delTCGC	c.(1090-1095)atcgccfs	p.IA364fs		NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	364					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		GGTGCGCAGGGCGATGGCCAGGTG	0.681																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.1091_1094delTCGC	3.37:g.123166299_123166302delGCGA	ENSP00000419361:p.Ile364fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8A6|Q7RTV7|Q8NFM3	Frame_Shift_Del	DEL	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.I364fs	ENST00000462833.1	37	c.1094_1091	CCDS3022.1	3																																																																																			ADCY5	-	NULL	ENSG00000173175		0.681	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY5	HGNC	protein_coding	OTTHUMT00000355889.4	17	0.00	0	GCGA	XM_171048		123166299	123166302	-1	no_errors	ENST00000462833	ensembl	human	known	69_37n	frame_shift_del	17	28.00	7	DEL	1.000:1.000:0.999:1.000	-
ABCC5	10057	genome.wustl.edu	37	3	183665225	183665225	+	Missense_Mutation	SNP	G	G	A	rs11552530		TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr3:183665225G>A	ENST00000334444.6	-	23	3541	c.3301C>T	c.(3301-3303)Cgg>Tgg	p.R1101W	ABCC5_ENST00000265586.6_Missense_Mutation_p.R1058W	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1101	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	AGGTCCAGCCGCACAGCCAGC	0.552																																						dbGAP											0													50.0	62.0	58.0					3																	183665225		2051	4200	6251	-	-	-	SO:0001583	missense	0			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3301C>T	3.37:g.183665225G>A	ENSP00000333926:p.Arg1101Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.R1101W	ENST00000334444.6	37	c.3301	CCDS43176.1	3	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629410	0.87660	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	D;D	0.87887	-2.31;-2.31	5.53	5.53	0.82687	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.92087	0.7492	M	0.84585	2.705	0.58432	D	0.999999	D;P	0.65815	0.995;0.872	P;P	0.55508	0.777;0.583	D	0.91942	0.5564	10	0.42905	T	0.14	-21.4497	15.111	0.72355	0.0:0.0:0.8579:0.1421	rs11552530	1058;1101	Q86UX3;O15440	.;MRP5_HUMAN	W	1101;1058	ENSP00000333926:R1101W;ENSP00000265586:R1058W	ENSP00000265586:R1058W	R	-	1	2	ABCC5	185147919	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.679000	0.61649	2.607000	0.88179	0.655000	0.94253	CGG	ABCC5	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000114770		0.552	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC5	HGNC	protein_coding	OTTHUMT00000346350.1	26	0.00	0	G	NM_005688		183665225	183665225	-1	no_errors	ENST00000334444	ensembl	human	known	69_37n	missense	47	35.62	26	SNP	1.000	A
ANK1	286	genome.wustl.edu	37	8	41575713	41575713	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr8:41575713T>C	ENST00000347528.4	-	11	1200	c.1117A>G	c.(1117-1119)Acc>Gcc	p.T373A	ANK1_ENST00000352337.4_Missense_Mutation_p.T373A|ANK1_ENST00000396942.1_Missense_Mutation_p.T373A|ANK1_ENST00000379758.2_Missense_Mutation_p.T373A|ANK1_ENST00000265709.8_Missense_Mutation_p.T406A|ANK1_ENST00000396945.1_Missense_Mutation_p.T373A|ANK1_ENST00000289734.7_Missense_Mutation_p.T373A	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	373	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TGTAAGGGGGTAAAGCCATTC	0.577																																						dbGAP											0													75.0	67.0	69.0					8																	41575713		2203	4300	6503	-	-	-	SO:0001583	missense	0			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1117A>G	8.37:g.41575713T>C	ENSP00000339620:p.Thr373Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.T373A	ENST00000347528.4	37	c.1117	CCDS6119.1	8	.	.	.	.	.	.	.	.	.	.	T	26.4	4.734179	0.89482	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64	5.49	5.49	0.81192	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.57548	0.2061	M	0.77616	2.38	0.80722	D	1	D;D;D;D;D	0.89917	0.998;0.998;0.987;1.0;0.998	D;D;P;D;D	0.79784	0.993;0.993;0.823;0.989;0.993	T	0.63129	-0.6706	10	0.87932	D	0	.	15.5805	0.76432	0.0:0.0:0.0:1.0	.	406;373;373;373;373	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	A	373;373;373;373;373;373;406;373	ENSP00000339620:T373A;ENSP00000289734:T373A;ENSP00000369082:T373A;ENSP00000380149:T373A;ENSP00000380147:T373A;ENSP00000309131:T373A;ENSP00000265709:T406A	ENSP00000265709:T406A	T	-	1	0	ANK1	41694870	1.000000	0.71417	0.999000	0.59377	0.819000	0.46315	8.018000	0.88722	2.088000	0.63022	0.482000	0.46254	ACC	ANK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000029534		0.577	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	31	0.00	0	T	NM_020475		41575713	41575713	-1	no_errors	ENST00000396942	ensembl	human	known	69_37n	missense	39	35.94	23	SNP	1.000	C
ANKH	56172	genome.wustl.edu	37	5	14871377	14871377	+	Intron	SNP	C	C	T			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr5:14871377C>T	ENST00000284268.6	-	1	427				CTB-40H15.4_ENST00000607026.1_lincRNA	NM_054027.4	NP_473368.1	Q9HCJ1	ANKH_HUMAN	ANKH inorganic pyrophosphate transport regulator						locomotory behavior (GO:0007626)|regulation of bone mineralization (GO:0030500)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	inorganic diphosphate transmembrane transporter activity (GO:0030504)|inorganic phosphate transmembrane transporter activity (GO:0005315)|phosphate ion transmembrane transporter activity (GO:0015114)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						GGACTCGGAGCAGGTGACTCC	0.642																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF274753	CCDS3885.1	5p15.2	2013-06-19	2013-06-19		ENSG00000154122	ENSG00000154122			15492	protein-coding gene	gene with protein product		605145	"""ankylosis, progressive (mouse) homolog"", ""craniometaphyseal dysplasia, Jackson type (dominant)"", ""ankylosis, progressive homolog (mouse)"""	CCAL2, CMDJ		10894769, 12297989, 11326338	Standard	NM_054027		Approved	HANK, ANK, CPPDD	uc003jfm.4	Q9HCJ1	OTTHUMG00000090539	ENST00000284268.6:c.96+83G>A	5.37:g.14871377C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCA7|B3KMG4|D3DTD4|Q9NQW2	Silent	SNP	pfam_ANKH	p.L60	ENST00000284268.6	37	c.180	CCDS3885.1	5																																																																																			ANKH	-	NULL	ENSG00000154122		0.642	ANKH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKH	HGNC	protein_coding	OTTHUMT00000207063.1	10	0.00	0	C	NM_054027		14871377	14871377	-1	no_errors	ENST00000505140	ensembl	human	known	69_37n	silent	12	38.10	8	SNP	0.988	T
APOBEC2	10930	genome.wustl.edu	37	6	41029494	41029494	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr6:41029494G>A	ENST00000244669.2	+	2	603	c.559G>A	c.(559-561)Gtc>Atc	p.V187I		NM_006789.3	NP_006780.1	Q9Y235	ABEC2_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2	187					cytidine deamination (GO:0009972)|DNA demethylation (GO:0080111)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)		cytidine deaminase activity (GO:0004126)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)|skin(1)	10	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTTCGAATATGTCTGGCAGAA	0.522																																					Ovarian(118;1320 2185 8096 29684)	dbGAP											0													73.0	78.0	77.0					6																	41029494		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161698	CCDS4848.1	6p21	2008-02-05			ENSG00000124701	ENSG00000124701		"""Apolipoprotein B mRNA editing enzymes"""	605	protein-coding gene	gene with protein product		604797				10403781	Standard	NM_006789		Approved	ARCD1, ARP1	uc003opl.3	Q9Y235	OTTHUMG00000014670	ENST00000244669.2:c.559G>A	6.37:g.41029494G>A	ENSP00000244669:p.Val187Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R899|Q53F28|Q5TGU5|Q5TGU6	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.V187I	ENST00000244669.2	37	c.559	CCDS4848.1	6	.	.	.	.	.	.	.	.	.	.	g	14.58	2.577558	0.45902	.	.	ENSG00000124701	ENST00000244669	T	0.65549	-0.16	5.9	-9.43	0.00607	APOBEC-like, C-terminal (1);Cytidine deaminase-like (1);	0.565950	0.20164	N	0.097890	T	0.32376	0.0827	L	0.55481	1.735	0.28552	N	0.91158	B	0.09022	0.002	B	0.08055	0.003	T	0.03364	-1.1044	10	0.59425	D	0.04	.	16.3837	0.83490	0.1109:0.0912:0.7979:0.0	.	187	Q9Y235	ABEC2_HUMAN	I	187	ENSP00000244669:V187I	ENSP00000244669:V187I	V	+	1	0	APOBEC2	41137472	0.462000	0.25791	0.226000	0.23910	0.945000	0.59286	0.326000	0.19646	-1.961000	0.01016	-0.298000	0.09462	GTC	APOBEC2	-	pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	ENSG00000124701		0.522	APOBEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC2	HGNC	protein_coding	OTTHUMT00000040498.1	12	0.00	0	G	NM_006789		41029494	41029494	+1	no_errors	ENST00000244669	ensembl	human	known	69_37n	missense	41	32.79	20	SNP	0.278	A
APPBP2	10513	genome.wustl.edu	37	17	58525152	58525152	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr17:58525152A>T	ENST00000083182.3	-	13	1835	c.1548T>A	c.(1546-1548)gaT>gaA	p.D516E		NM_001282476.1|NM_006380.2	NP_001269405.1|NP_006371.2	Q92624	APBP2_HUMAN	amyloid beta precursor protein (cytoplasmic tail) binding protein 2	516					intracellular protein transport (GO:0006886)|intracellular transport (GO:0046907)|metabolic process (GO:0008152)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	microtubule motor activity (GO:0003777)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(17)|pancreas(1)|urinary_tract(1)	25	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			GACCTCGATAATCATATTCTA	0.358																																						dbGAP											0													80.0	80.0	80.0					17																	58525152		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017782	CCDS32699.1	17q23.2	2012-09-20	2001-11-28		ENSG00000062725	ENSG00000062725			622	protein-coding gene	gene with protein product	"""protein interacting with APP tail 1"""	605324	"""amyloid beta precursor protein (cytoplasmic tail)-binding protein 2"""			9843960	Standard	NM_006380		Approved	KIAA0228, Hs.84084, PAT1	uc002iys.1	Q92624		ENST00000083182.3:c.1548T>A	17.37:g.58525152A>T	ENSP00000083182:p.Asp516Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K862|O95095|Q8WVC9	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D516E	ENST00000083182.3	37	c.1548	CCDS32699.1	17	.	.	.	.	.	.	.	.	.	.	A	16.93	3.257614	0.59321	.	.	ENSG00000062725	ENST00000083182	T	0.62639	0.01	5.78	3.51	0.40186	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.71837	0.3387	M	0.67397	2.05	0.58432	D	0.999999	P	0.44690	0.841	P	0.58820	0.846	T	0.70502	-0.4854	10	0.72032	D	0.01	-19.0256	8.6415	0.33981	0.7216:0.0:0.2784:0.0	.	516	Q92624	APBP2_HUMAN	E	516	ENSP00000083182:D516E	ENSP00000083182:D516E	D	-	3	2	APPBP2	55879934	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.857000	0.48349	0.418000	0.25898	0.533000	0.62120	GAT	APPBP2	-	NULL	ENSG00000062725		0.358	APPBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APPBP2	HGNC	protein_coding	OTTHUMT00000449465.1	26	0.00	0	A	NM_006380		58525152	58525152	-1	no_errors	ENST00000083182	ensembl	human	known	69_37n	missense	17	50.00	17	SNP	1.000	T
BAG6	7917	genome.wustl.edu	37	6	31611965	31611965	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr6:31611965T>C	ENST00000375964.6	-	12	1785	c.1472A>G	c.(1471-1473)cAg>cGg	p.Q491R	BAG6_ENST00000375976.4_Missense_Mutation_p.Q485R|BAG6_ENST00000439687.2_Missense_Mutation_p.Q485R|BAG6_ENST00000404765.2_Missense_Mutation_p.Q521R|BAG6_ENST00000362049.6_Missense_Mutation_p.Q485R|BAG6_ENST00000211379.5_Missense_Mutation_p.Q485R|BAG6_ENST00000470875.1_5'UTR	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	491	4 X 29 AA approximate repeats.|Pro-rich.				brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						GCCTGGCACCTGCTGTCCTGT	0.667																																						dbGAP											0													40.0	45.0	43.0					6																	31611965		2203	4300	6503	-	-	-	SO:0001583	missense	0			M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.1472A>G	6.37:g.31611965T>C	ENSP00000365131:p.Gln491Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Missense_Mutation	SNP	pfam_DUF3538,pfam_Ubiquitin,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	p.Q521R	ENST00000375964.6	37	c.1562	CCDS47403.1	6	.	.	.	.	.	.	.	.	.	.	t	19.76	3.887838	0.72410	.	.	ENSG00000204463	ENST00000375976;ENST00000375964;ENST00000211379;ENST00000404765;ENST00000439687;ENST00000362049;ENST00000437771;ENST00000438149;ENST00000436214	T;T;T;T;T;T;T;T	0.54071	1.41;1.39;1.41;1.27;0.71;1.45;0.59;0.69	4.8	4.8	0.61643	.	0.446072	0.23674	N	0.045684	T	0.46073	0.1374	L	0.34521	1.04	0.37978	D	0.933501	P;P;B;B	0.42039	0.659;0.769;0.323;0.452	B;P;B;P	0.61397	0.403;0.888;0.363;0.465	T	0.42292	-0.9460	10	0.22706	T	0.39	.	11.948	0.52938	0.0:0.0:0.0:1.0	.	485;485;491;485	E7EMZ4;F8VXY4;P46379;P46379-2	.;.;BAG6_HUMAN;.	R	485;491;485;521;485;485;521;79;99	ENSP00000365143:Q485R;ENSP00000365131:Q491R;ENSP00000211379:Q485R;ENSP00000384494:Q521R;ENSP00000402856:Q485R;ENSP00000354875:Q485R;ENSP00000397978:Q521R;ENSP00000410280:Q79R	ENSP00000211379:Q485R	Q	-	2	0	BAG6	31719944	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	3.141000	0.50593	1.797000	0.52628	0.450000	0.29827	CAG	BAG6	-	NULL	ENSG00000204463		0.667	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAG6	HGNC	protein_coding		24	0.00	0	T	NM_080703		31611965	31611965	-1	no_errors	ENST00000404765	ensembl	human	known	69_37n	missense	57	27.85	22	SNP	1.000	C
C6orf89	221477	genome.wustl.edu	37	6	36884276	36884276	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr6:36884276C>G	ENST00000480824.2	+	7	1045	c.751C>G	c.(751-753)Cac>Gac	p.H251D	C6orf89_ENST00000373685.1_Missense_Mutation_p.H251D|C6orf89_ENST00000359359.2_Missense_Mutation_p.H145D|C6orf89_ENST00000510325.2_Missense_Mutation_p.H145D|C6orf89_ENST00000355190.3_Missense_Mutation_p.H258D			Q6UWU4	CF089_HUMAN	chromosome 6 open reading frame 89	251					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	15						TGTTTTCACTCACCTGCCATT	0.408																																						dbGAP											0													110.0	104.0	106.0					6																	36884276		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058086	CCDS4827.1, CCDS69100.1, CCDS75444.1	6p21.31	2013-03-14			ENSG00000198663	ENSG00000198663			21114	protein-coding gene	gene with protein product	"""bombesin receptor activated protein"""					21857995, 23460338	Standard	NM_152734		Approved	FLJ25357, BRAP	uc003omw.3	Q6UWU4	OTTHUMG00000014613	ENST00000480824.2:c.751C>G	6.37:g.36884276C>G	ENSP00000475947:p.His251Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	NULL	p.H258D	ENST00000480824.2	37	c.772		6	.	.	.	.	.	.	.	.	.	.	C	10.84	1.464710	0.26335	.	.	ENSG00000198663	ENST00000359359;ENST00000510325;ENST00000355190;ENST00000373685	.	.	.	6.17	0.283	0.15696	.	1.002730	0.08029	N	0.993145	T	0.04998	0.0134	N	0.08118	0	0.09310	N	1	B;B	0.23990	0.095;0.095	B;B	0.18871	0.023;0.023	T	0.35699	-0.9778	9	0.36615	T	0.2	-0.1539	1.5756	0.02624	0.1664:0.3981:0.1949:0.2406	.	251;258	Q6UWU4;Q6UWU4-2	CF089_HUMAN;.	D	145;145;258;251	.	ENSP00000347322:H258D	H	+	1	0	C6orf89	36992254	0.000000	0.05858	0.142000	0.22268	0.947000	0.59692	-0.115000	0.10741	0.072000	0.16694	-0.211000	0.12701	CAC	C6orf89	-	NULL	ENSG00000198663		0.408	C6orf89-004	KNOWN	alternative_5_UTR|basic	protein_coding	C6orf89	HGNC	protein_coding	OTTHUMT00000040387.2	61	0.00	0	C	NM_152734		36884276	36884276	+1	no_errors	ENST00000355190	ensembl	human	known	69_37n	missense	99	33.11	49	SNP	0.007	G
CARD9	64170	genome.wustl.edu	37	9	139265150	139265150	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr9:139265150C>T	ENST00000371732.5	-	5	796	c.631G>A	c.(631-633)Gac>Aac	p.D211N	CARD9_ENST00000315908.7_Missense_Mutation_p.D211N|CARD9_ENST00000371734.3_Missense_Mutation_p.D211N	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9	211					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		TTGAGCTGGTCAATCTGCAGA	0.687																																						dbGAP											0													85.0	65.0	72.0					9																	139265150		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.631G>A	9.37:g.139265150C>T	ENSP00000360797:p.Asp211Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SXM5|Q5SXM6|Q9H854	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_CARD	p.D211N	ENST00000371732.5	37	c.631	CCDS6997.1	9	.	.	.	.	.	.	.	.	.	.	C	13.41	2.228584	0.39399	.	.	ENSG00000187796	ENST00000371734;ENST00000371732;ENST00000315908	T;T;T	0.36520	1.25;1.25;1.25	3.58	3.58	0.41010	.	0.259167	0.36134	N	0.002773	T	0.37183	0.0994	M	0.72118	2.19	0.49389	D	0.999786	P;B;B	0.41848	0.763;0.328;0.22	B;B;B	0.37144	0.242;0.232;0.074	T	0.46119	-0.9214	10	0.44086	T	0.13	-18.5942	14.6957	0.69121	0.0:1.0:0.0:0.0	.	107;211;211	B4DIK5;Q9H257-2;Q9H257	.;.;CARD9_HUMAN	N	211	ENSP00000360799:D211N;ENSP00000360797:D211N;ENSP00000323719:D211N	ENSP00000323719:D211N	D	-	1	0	CARD9	138384971	1.000000	0.71417	0.637000	0.29366	0.381000	0.30169	4.881000	0.63114	1.989000	0.58080	0.563000	0.77884	GAC	CARD9	-	NULL	ENSG00000187796		0.687	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD9	HGNC	protein_coding	OTTHUMT00000055053.1	18	0.00	0	C	NM_052813		139265150	139265150	-1	no_errors	ENST00000371732	ensembl	human	known	69_37n	missense	7	58.82	10	SNP	0.992	T
CD44	960	genome.wustl.edu	37	11	35226171	35226171	+	Silent	SNP	G	G	C	rs546397935		TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr11:35226171G>C	ENST00000428726.2	+	10	1389	c.1266G>C	c.(1264-1266)tcG>tcC	p.S422S	CD44_ENST00000263398.6_Intron|CD44_ENST00000434472.2_Intron|CD44_ENST00000449691.2_Intron|CD44_ENST00000352818.4_Intron|CD44_ENST00000360158.4_Intron|CD44_ENST00000437706.2_Silent_p.S422S|CD44_ENST00000433892.2_Intron|CD44_ENST00000415148.2_Silent_p.S379S|CD44_ENST00000526669.2_Intron|CD44_ENST00000433354.2_Silent_p.S423S|CD44_ENST00000278386.6_Intron	NM_000610.3	NP_000601.3	P16070	CD44_HUMAN	CD44 molecule (Indian blood group)	422	Stem.				blood coagulation (GO:0007596)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|monocyte aggregation (GO:0070487)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|Wnt signaling pathway (GO:0016055)|wound healing involved in inflammatory response (GO:0002246)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|skin(1)	23	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronan(DB08818)	ACTCCCATTCGACAACAGGGA	0.438																																						dbGAP											0													134.0	116.0	122.0					11																	35226171		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			M59040	CCDS7897.1, CCDS31455.1, CCDS31456.1, CCDS31457.1, CCDS31458.1, CCDS55754.1, CCDS55755.1	11p13	2014-07-18	2006-03-28		ENSG00000026508	ENSG00000026508		"""CD molecules"", ""Blood group antigens"", ""Proteoglycans / Cell surface : Other"""	1681	protein-coding gene	gene with protein product	"""hematopoietic cell E- and L-selectin ligand"", ""chondroitin sulfate proteoglycan 8"""	107269	"""CD44 antigen (homing function and Indian blood group system)"""	MIC4, MDU2, MDU3		2454887	Standard	NM_001202555		Approved	IN, MC56, Pgp1, CD44R, HCELL, CSPG8	uc001mvu.3	P16070	OTTHUMG00000044388	ENST00000428726.2:c.1266G>C	11.37:g.35226171G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A5YRN9|B6EAT9|D3DR12|D3DR13|O95370|P22511|Q04858|Q13419|Q13957|Q13958|Q13959|Q13960|Q13961|Q13967|Q13968|Q13980|Q15861|Q16064|Q16065|Q16066|Q16208|Q16522|Q86T72|Q86Z27|Q8N694|Q92493|Q96J24|Q9H5A5|Q9UC28|Q9UC29|Q9UC30|Q9UCB0|Q9UJ36	Missense_Mutation	SNP	NULL	p.D76H	ENST00000428726.2	37	c.226	CCDS7897.1	11	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.703298	0.00719	.	.	ENSG00000026508	ENST00000526553	.	.	.	5.15	-1.66	0.08265	.	.	.	.	.	T	0.21761	0.0524	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.29119	-1.0022	4	.	.	.	-12.8243	4.1534	0.10249	0.4431:0.0:0.3889:0.168	.	.	.	.	H	76	.	.	D	+	1	0	CD44	35182747	0.911000	0.30947	0.003000	0.11579	0.000000	0.00434	0.359000	0.20233	-0.058000	0.13177	-0.982000	0.02568	GAC	CD44	-	NULL	ENSG00000026508		0.438	CD44-001	KNOWN	basic|CCDS	protein_coding	CD44	HGNC	protein_coding	OTTHUMT00000388927.1	49	0.00	0	G	NM_000610		35226171	35226171	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000526553	ensembl	human	novel	69_37n	missense	47	34.72	25	SNP	0.037	C
CDKL4	344387	genome.wustl.edu	37	2	39456599	39456599	+	Silent	SNP	G	G	A	rs56089528		TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr2:39456599G>A	ENST00000395035.3	-	1	74	c.75C>T	c.(73-75)acC>acT	p.T25T	CDKL4_ENST00000378803.1_Silent_p.T25T			Q5MAI5	CDKL4_HUMAN	cyclin-dependent kinase-like 4	25	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(1)|large_intestine(2)|liver(1)|lung(7)|ovary(1)	12		all_hematologic(82;0.248)				CTTGTCCAGAGGTTTTGTTTC	0.333																																						dbGAP											0													125.0	127.0	127.0					2																	39456599		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS33184.1	2p22.3	2011-11-04			ENSG00000205111	ENSG00000205111		"""Cyclin-dependent kinases"""	19287	protein-coding gene	gene with protein product							Standard	NM_001009565		Approved		uc002rrm.3	Q5MAI5	OTTHUMG00000133574	ENST00000395035.3:c.75C>T	2.37:g.39456599G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NME9	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T25	ENST00000395035.3	37	c.75		2																																																																																			CDKL4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000205111		0.333	CDKL4-002	NOVEL	basic|appris_candidate_longest	protein_coding	CDKL4	HGNC	protein_coding	OTTHUMT00000331655.1	85	0.00	0	G	XM_293029		39456599	39456599	-1	no_errors	ENST00000378803	ensembl	human	known	69_37n	silent	58	35.87	33	SNP	1.000	A
CSMD2	114784	genome.wustl.edu	37	1	33988932	33988932	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr1:33988932T>C	ENST00000373381.4	-	67	10660	c.10484A>G	c.(10483-10485)gAt>gGt	p.D3495G		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3351						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCAGTGATCATCTTTGAACTT	0.458																																						dbGAP											0													145.0	128.0	134.0					1																	33988932		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.10484A>G	1.37:g.33988932T>C	ENSP00000362479:p.Asp3495Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.D3495G	ENST00000373381.4	37	c.10484		1	.	.	.	.	.	.	.	.	.	.	T	14.38	2.518079	0.44763	.	.	ENSG00000121904	ENST00000373381	T	0.24723	1.84	5.77	4.63	0.57726	.	0.185340	0.46758	D	0.000269	T	0.21307	0.0513	L	0.40543	1.245	0.80722	D	1	B;B	0.28552	0.215;0.129	B;B	0.26614	0.071;0.071	T	0.02728	-1.1118	10	0.39692	T	0.17	.	11.2896	0.49241	0.0:0.0717:0.0:0.9283	.	3351;3495	Q7Z408;E7EUA6	CSMD2_HUMAN;.	G	3495	ENSP00000362479:D3495G	ENSP00000241312:D3351G	D	-	2	0	CSMD2	33761519	0.996000	0.38824	0.803000	0.32268	0.924000	0.55760	2.706000	0.47135	0.989000	0.38761	0.533000	0.62120	GAT	CSMD2	-	NULL	ENSG00000121904		0.458	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		87	0.00	0	T	NM_052896		33988932	33988932	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	82	38.81	52	SNP	0.982	C
CSMD3	114788	genome.wustl.edu	37	8	114326893	114326893	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr8:114326893A>G	ENST00000297405.5	-	2	552	c.308T>C	c.(307-309)aTa>aCa	p.I103T	CSMD3_ENST00000343508.3_Missense_Mutation_p.I63T|CSMD3_ENST00000352409.3_Missense_Mutation_p.I103T|CSMD3_ENST00000455883.2_Missense_Mutation_p.I103T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	103	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AACAATTTGTATTCTATTTCG	0.358										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													170.0	162.0	164.0					8																	114326893		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.308T>C	8.37:g.114326893A>G	ENSP00000297405:p.Ile103Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.I103T	ENST00000297405.5	37	c.308	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	A	19.00	3.741889	0.69304	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.27402	1.67;1.67;1.67;1.67	5.72	5.72	0.89469	CUB (5);	0.000000	0.64402	D	0.000004	T	0.71117	0.3302	H	0.97896	4.1	0.41857	D	0.990204	D;D;D;D;P	0.89917	0.989;0.999;1.0;0.968;0.566	D;D;D;D;B	0.91635	0.985;0.994;0.999;0.969;0.341	T	0.83152	-0.0103	10	0.87932	D	0	.	15.1878	0.73020	1.0:0.0:0.0:0.0	.	103;103;103;103;63	Q7Z407-3;Q7Z407-4;Q7Z407-5;Q7Z407;Q7Z407-2	.;.;.;CSMD3_HUMAN;.	T	63;103;103;103	ENSP00000345799:I63T;ENSP00000297405:I103T;ENSP00000412263:I103T;ENSP00000343124:I103T	ENSP00000297405:I103T	I	-	2	0	CSMD3	114396069	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.332000	0.96446	2.178000	0.69098	0.455000	0.32223	ATA	CSMD3	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000164796		0.358	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	72	0.00	0	A	NM_052900		114326893	114326893	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	missense	109	24.31	35	SNP	1.000	G
EGFR	1956	genome.wustl.edu	37	7	55268034	55268034	+	Silent	SNP	C	C	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr7:55268034C>A	ENST00000275493.2	+	24	3051	c.2874C>A	c.(2872-2874)cgC>cgA	p.R958R	EGFR_ENST00000442591.1_Intron|EGFR_ENST00000454757.2_Silent_p.R905R|EGFR_ENST00000455089.1_Silent_p.R913R	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	958	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CAGATAGTCGCCCAAAGTTCC	0.453		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																												dbGAP	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	0													182.0	156.0	164.0					7																	55268034		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2874C>A	7.37:g.55268034C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Silent	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R958	ENST00000275493.2	37	c.2874	CCDS5514.1	7																																																																																			EGFR	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000146648		0.453	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFR	HGNC	protein_coding	OTTHUMT00000251456.2	73	0.00	0	C	NM_005228		55268034	55268034	+1	no_errors	ENST00000275493	ensembl	human	known	69_37n	silent	135	25.82	47	SNP	1.000	A
EPB41L5	57669	genome.wustl.edu	37	2	120799675	120799675	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr2:120799675G>C	ENST00000263713.5	+	3	488	c.274G>C	c.(274-276)Gca>Cca	p.A92P	EPB41L5_ENST00000443124.1_Missense_Mutation_p.A92P|EPB41L5_ENST00000331393.4_Missense_Mutation_p.A92P|EPB41L5_ENST00000452780.1_Missense_Mutation_p.A92P|EPB41L5_ENST00000443902.2_Missense_Mutation_p.A92P	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	92	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						TATGGATTCAGCACAAGTAGC	0.358																																						dbGAP											0													140.0	131.0	134.0					2																	120799675		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.274G>C	2.37:g.120799675G>C	ENSP00000263713:p.Ala92Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5S1|Q8IZ12|Q9H975	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.A92P	ENST00000263713.5	37	c.274	CCDS2130.1	2	.	.	.	.	.	.	.	.	.	.	G	23.5	4.426006	0.83667	.	.	ENSG00000115109	ENST00000263713;ENST00000443902;ENST00000331393;ENST00000443124;ENST00000452780	T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09	5.18	5.18	0.71444	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.178561	0.33364	N	0.004988	D	0.83161	0.5194	L	0.40543	1.245	0.80722	D	1	D;P;D	0.89917	1.0;0.942;1.0	D;P;D	0.80764	0.986;0.708;0.994	T	0.81102	-0.1085	10	0.30854	T	0.27	.	17.4618	0.87621	0.0:0.0:1.0:0.0	.	92;92;92	Q9HCM4-4;Q9HCM4-2;Q9HCM4	.;.;E41L5_HUMAN	P	92	ENSP00000263713:A92P;ENSP00000393856:A92P;ENSP00000329687:A92P;ENSP00000393722:A92P;ENSP00000390439:A92P	ENSP00000263713:A92P	A	+	1	0	EPB41L5	120516145	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.275000	0.95738	2.420000	0.82092	0.460000	0.39030	GCA	EPB41L5	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000115109		0.358	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	EPB41L5	HGNC	protein_coding	OTTHUMT00000254230.2	64	0.00	0	G	NM_020909		120799675	120799675	+1	no_errors	ENST00000263713	ensembl	human	known	69_37n	missense	91	19.47	22	SNP	1.000	C
FLG2	388698	genome.wustl.edu	37	1	152327278	152327278	+	Missense_Mutation	SNP	C	C	T	rs536296630		TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr1:152327278C>T	ENST00000388718.5	-	3	3056	c.2984G>A	c.(2983-2985)aGt>aAt	p.S995N	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	995	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATTAGACTGACTTGATCTAGA	0.493																																						dbGAP											0													278.0	275.0	276.0					1																	152327278		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2984G>A	1.37:g.152327278C>T	ENSP00000373370:p.Ser995Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.S995N	ENST00000388718.5	37	c.2984	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	C	6.106	0.387786	0.11581	.	.	ENSG00000143520	ENST00000388718	T	0.16597	2.33	3.48	2.56	0.30785	.	.	.	.	.	T	0.02083	0.0065	N	0.08118	0	0.09310	N	0.999997	B	0.25105	0.118	B	0.21151	0.033	T	0.47983	-0.9074	9	0.18276	T	0.48	0.4356	7.0081	0.24848	0.0:0.8654:0.0:0.1346	.	995	Q5D862	FILA2_HUMAN	N	995	ENSP00000373370:S995N	ENSP00000373370:S995N	S	-	2	0	FLG2	150593902	0.009000	0.17119	0.012000	0.15200	0.006000	0.05464	0.878000	0.28126	0.454000	0.26884	-0.698000	0.03680	AGT	FLG2	-	NULL	ENSG00000143520		0.493	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	146	0.00	0	C	NM_001014342		152327278	152327278	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	missense	136	19.53	33	SNP	0.780	T
GDAP1	54332	genome.wustl.edu	37	8	75276444	75276444	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr8:75276444A>G	ENST00000220822.7	+	6	999	c.919A>G	c.(919-921)Aca>Gca	p.T307A	GDAP1_ENST00000521096.1_3'UTR|GDAP1_ENST00000434412.2_Missense_Mutation_p.T239A	NM_001040875.2|NM_018972.2	NP_001035808.1|NP_061845.2	Q8TB36	GDAP1_HUMAN	ganglioside induced differentiation associated protein 1	307	GST C-terminal.				cell death (GO:0008219)|mitochondrial fission (GO:0000266)|protein targeting to mitochondrion (GO:0006626)|response to retinoic acid (GO:0032526)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			AGTGCTGCCAACAGCATTCCG	0.428																																						dbGAP											0													70.0	74.0	73.0					8																	75276444		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34911.1, CCDS47877.1	8q13.3	2014-09-17	2012-02-09						15968	protein-coding gene	gene with protein product		606598	"""Charcot-Marie-Tooth neuropathy 4A"""	CMT4A		8268915, 11743579	Standard	NM_018972		Approved	CMT4	uc003yah.3	Q8TB36		ENST00000220822.7:c.919A>G	8.37:g.75276444A>G	ENSP00000220822:p.Thr307Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K957|E7FJF3|E7FJF4	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like	p.T307A	ENST00000220822.7	37	c.919	CCDS34911.1	8	.	.	.	.	.	.	.	.	.	.	A	14.61	2.587105	0.46110	.	.	ENSG00000104381	ENST00000220822;ENST00000434412	D;D	0.97378	-4.36;-4.36	4.99	4.99	0.66335	Glutathione S-transferase/chloride channel, C-terminal (1);	0.126851	0.53938	D	0.000044	D	0.93926	0.8056	N	0.25647	0.755	0.41343	D	0.987314	B	0.29552	0.248	B	0.32465	0.146	D	0.92847	0.6294	10	0.40728	T	0.16	-14.4058	15.1492	0.72684	1.0:0.0:0.0:0.0	.	307	Q8TB36	GDAP1_HUMAN	A	307;239	ENSP00000220822:T307A;ENSP00000417006:T239A	ENSP00000220822:T307A	T	+	1	0	GDAP1	75438999	0.992000	0.36948	1.000000	0.80357	0.999000	0.98932	3.844000	0.55873	2.234000	0.73211	0.533000	0.62120	ACA	GDAP1	-	NULL	ENSG00000104381		0.428	GDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDAP1	HGNC	protein_coding	OTTHUMT00000379061.1	44	0.00	0	A	NM_018972		75276444	75276444	+1	no_errors	ENST00000220822	ensembl	human	known	69_37n	missense	61	40.20	41	SNP	1.000	G
HMCN1	83872	genome.wustl.edu	37	1	185951458	185951458	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr1:185951458G>T	ENST00000271588.4	+	18	2956	c.2727G>T	c.(2725-2727)ttG>ttT	p.L909F	HMCN1_ENST00000367492.2_Missense_Mutation_p.L909F|HMCN1_ENST00000485744.1_3'UTR	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	909	Ig-like C2-type 6.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGCTTACTTTGCCCTGTACTC	0.413																																						dbGAP											0													170.0	161.0	164.0					1																	185951458		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.2727G>T	1.37:g.185951458G>T	ENSP00000271588:p.Leu909Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.L909F	ENST00000271588.4	37	c.2727	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.265164	0.59431	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.60672	0.17;0.17	4.79	1.88	0.25563	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.60689	0.2288	L	0.41415	1.275	0.54753	D	0.999981	D;P	0.54772	0.968;0.934	D;P	0.64321	0.924;0.609	T	0.52601	-0.8554	10	0.28530	T	0.3	.	9.8821	0.41240	0.2265:0.0:0.7735:0.0	.	293;909	Q96RW7-3;Q96RW7	.;HMCN1_HUMAN	F	909	ENSP00000271588:L909F;ENSP00000356462:L909F	ENSP00000271588:L909F	L	+	3	2	HMCN1	184218081	1.000000	0.71417	0.984000	0.44739	0.912000	0.54170	2.389000	0.44407	0.106000	0.17784	-0.224000	0.12420	TTG	HMCN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000143341		0.413	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	72	0.00	0	G	NM_031935		185951458	185951458	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	80	52.10	87	SNP	1.000	T
HPS3	84343	genome.wustl.edu	37	3	148880113	148880113	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr3:148880113T>A	ENST00000296051.2	+	12	2425	c.2285T>A	c.(2284-2286)tTt>tAt	p.F762Y	HPS3_ENST00000460120.1_Missense_Mutation_p.F597Y	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	762					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GCAGATTCCTTTTTTAAGGTT	0.398									Hermansky-Pudlak syndrome																													dbGAP											0													73.0	75.0	74.0					3																	148880113		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.2285T>A	3.37:g.148880113T>A	ENSP00000296051:p.Phe762Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	pirsf_BLOC-2_complex_Hps3_subunit	p.F762Y	ENST00000296051.2	37	c.2285	CCDS3140.1	3	.	.	.	.	.	.	.	.	.	.	T	22.8	4.339737	0.81911	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	T;T	0.67171	-0.25;-0.24	5.98	5.98	0.97165	.	0.103697	0.64402	D	0.000004	T	0.62097	0.2400	L	0.59436	1.845	0.80722	D	1	P;P	0.48350	0.909;0.909	B;B	0.40506	0.331;0.331	T	0.65356	-0.6188	10	0.44086	T	0.13	-25.0332	12.124	0.53907	0.1283:0.0:0.0:0.8717	.	597;762	G5E9V4;Q969F9	.;HPS3_HUMAN	Y	762;597	ENSP00000296051:F762Y;ENSP00000418230:F597Y	ENSP00000296051:F762Y	F	+	2	0	HPS3	150362803	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	4.377000	0.59562	2.289000	0.77006	0.460000	0.39030	TTT	HPS3	-	pirsf_BLOC-2_complex_Hps3_subunit	ENSG00000163755		0.398	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS3	HGNC	protein_coding	OTTHUMT00000356151.1	47	0.00	0	T	NM_032383		148880113	148880113	+1	no_errors	ENST00000296051	ensembl	human	known	69_37n	missense	66	38.32	41	SNP	0.994	A
HSD3B1	3283	genome.wustl.edu	37	1	120054136	120054136	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr1:120054136C>A	ENST00000369413.3	+	3	301	c.156C>A	c.(154-156)aaC>aaA	p.N52K	HSD3B1_ENST00000528909.1_Missense_Mutation_p.N52K|HSD3B1_ENST00000235547.6_Missense_Mutation_p.N54K			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	52					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	AACTCCAGAACAAGACCAAGC	0.478																																						dbGAP											0													74.0	67.0	69.0					1																	120054136		2203	4300	6503	-	-	-	SO:0001583	missense	0			S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.156C>A	1.37:g.120054136C>A	ENSP00000358421:p.Asn52Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K691|Q14545|Q8IV65	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_PKS_KR,pfam_NmrA	p.N54K	ENST00000369413.3	37	c.162	CCDS903.1	1	.	.	.	.	.	.	.	.	.	.	C	4.493	0.091401	0.08632	.	.	ENSG00000203857	ENST00000531340;ENST00000369413;ENST00000235547;ENST00000528909	D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8	3.27	2.3	0.28687	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.446534	0.21881	N	0.067727	T	0.38825	0.1055	N	0.04132	-0.27	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.002;0.004	T	0.37502	-0.9703	10	0.19590	T	0.45	-1.5741	7.762	0.28957	0.5693:0.4306:0.0:0.0	.	54;52	Q5TDG2;P14060	.;3BHS1_HUMAN	K	52;52;54;52	ENSP00000435999:N52K;ENSP00000358421:N52K;ENSP00000235547:N54K;ENSP00000432268:N52K	ENSP00000235547:N54K	N	+	3	2	HSD3B1	119855659	0.947000	0.32204	0.007000	0.13788	0.445000	0.32107	0.006000	0.13152	0.477000	0.27464	0.491000	0.48974	AAC	HSD3B1	-	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_PKS_KR,pfam_NmrA	ENSG00000203857		0.478	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HSD3B1	HGNC	protein_coding	OTTHUMT00000034993.3	39	0.00	0	C	NM_000862		120054136	120054136	+1	no_errors	ENST00000235547	ensembl	human	known	69_37n	missense	45	45.12	37	SNP	0.311	A
HUWE1	10075	genome.wustl.edu	37	X	53581746	53581746	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chrX:53581746C>T	ENST00000342160.3	-	60	8799	c.8342G>A	c.(8341-8343)gGa>gAa	p.G2781E	MIRLET7F2_ENST00000385277.1_RNA|MIR98_ENST00000606724.1_RNA|HUWE1_ENST00000262854.6_Missense_Mutation_p.G2781E			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2781					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						AGGAACCTCTCCCAAAGCTGG	0.552																																						dbGAP											0													109.0	88.0	95.0					X																	53581746		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.8342G>A	X.37:g.53581746C>T	ENSP00000340648:p.Gly2781Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.G2781E	ENST00000342160.3	37	c.8342	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	C	10.89	1.479251	0.26511	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.32272	1.46;1.46	5.84	4.98	0.66077	.	0.683101	0.13545	N	0.379873	T	0.13114	0.0318	N	0.08118	0	0.19575	N	0.999967	B;B	0.32160	0.244;0.358	B;B	0.31191	0.059;0.125	T	0.21211	-1.0252	10	0.02654	T	1	.	8.6219	0.33866	0.0:0.7677:0.149:0.0833	.	2781;2781	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	E	2781	ENSP00000340648:G2781E;ENSP00000262854:G2781E	ENSP00000262854:G2781E	G	-	2	0	HUWE1	53598471	0.838000	0.29461	0.991000	0.47740	0.993000	0.82548	1.388000	0.34442	1.232000	0.43678	0.600000	0.82982	GGA	HUWE1	-	NULL	ENSG00000086758		0.552	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	81	0.00	0	C	XM_497119		53581746	53581746	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	119	33.89	61	SNP	0.392	T
IGSF10	285313	genome.wustl.edu	37	3	151162894	151162894	+	Silent	SNP	T	T	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr3:151162894T>A	ENST00000282466.3	-	4	4874	c.4875A>T	c.(4873-4875)ccA>ccT	p.P1625P		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1625					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTTCTTGAACTGGTTTCTTAT	0.423																																						dbGAP											0													270.0	236.0	248.0					3																	151162894		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.4875A>T	3.37:g.151162894T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.P1625	ENST00000282466.3	37	c.4875	CCDS3160.1	3																																																																																			IGSF10	-	NULL	ENSG00000152580		0.423	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	150	0.00	0	T	NM_178822		151162894	151162894	-1	no_errors	ENST00000282466	ensembl	human	known	69_37n	silent	141	36.61	82	SNP	0.000	A
IL11	3589	genome.wustl.edu	37	19	55880300	55880300	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr19:55880300C>G	ENST00000264563.2	-	2	79	c.17G>C	c.(16-18)cGc>cCc	p.R6P	IL11_ENST00000590625.1_Intron|IL11_ENST00000585513.1_Missense_Mutation_p.R6P	NM_000641.3	NP_000632.1	P20809	IL11_HUMAN	interleukin 11	6					B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|fat cell differentiation (GO:0045444)|megakaryocyte differentiation (GO:0030219)|negative regulation of hormone secretion (GO:0046888)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-11 receptor binding (GO:0005142)			large_intestine(1)|skin(1)	2	Breast(117;0.191)	Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		CAGGACCAGGCGGCAAACACC	0.687																																						dbGAP											0													14.0	14.0	14.0					19																	55880300		2160	4254	6414	-	-	-	SO:0001583	missense	0			X58377	CCDS12923.1, CCDS59423.1	19q13.3-q13.4	2014-01-30			ENSG00000095752	ENSG00000095752		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	5966	protein-coding gene	gene with protein product	"""adipogenesis inhibitory factor"", ""oprelvekin"""	147681				1386338	Standard	NM_001267718		Approved	IL-11, AGIF	uc002qks.2	P20809		ENST00000264563.2:c.17G>C	19.37:g.55880300C>G	ENSP00000264563:p.Arg6Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQV5|Q96EB4	Missense_Mutation	SNP	pfam_Interleukin-11,superfamily_4_helix_cytokine-like_core,prints_Interleukin-11_mammalian,prints_Interleukin-11	p.R6P	ENST00000264563.2	37	c.17	CCDS12923.1	19	.	.	.	.	.	.	.	.	.	.	c	11.47	1.648806	0.29336	.	.	ENSG00000095752	ENST00000264563	T	0.41065	1.01	4.03	-0.904	0.10530	.	0.899723	0.09405	N	0.806693	T	0.27098	0.0664	N	0.14661	0.345	0.24599	N	0.993787	B	0.24533	0.105	B	0.32928	0.155	T	0.37686	-0.9695	10	0.36615	T	0.2	-22.9656	8.6915	0.34269	0.0:0.6808:0.0:0.3192	.	6	P20809	IL11_HUMAN	P	6	ENSP00000264563:R6P	ENSP00000264563:R6P	R	-	2	0	IL11	60572112	0.000000	0.05858	0.990000	0.47175	0.543000	0.35085	-1.701000	0.01903	-0.265000	0.09352	-0.455000	0.05494	CGC	IL11	-	pfam_Interleukin-11	ENSG00000095752		0.687	IL11-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	IL11	HGNC	protein_coding	OTTHUMT00000453027.1	14	0.00	0	C	NM_000641		55880300	55880300	-1	no_errors	ENST00000264563	ensembl	human	known	69_37n	missense	3	76.92	10	SNP	0.997	G
ITGA11	22801	genome.wustl.edu	37	15	68612682	68612682	+	Silent	SNP	T	T	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr15:68612682T>A	ENST00000315757.7	-	20	2543	c.2457A>T	c.(2455-2457)gcA>gcT	p.A819A	ITGA11_ENST00000423218.2_Silent_p.A819A	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	819					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						ACAGCGTGTATGCGGAGCAGT	0.592																																						dbGAP											0													46.0	47.0	47.0					15																	68612682		2113	4243	6356	-	-	-	SO:0001819	synonymous_variant	0			AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.2457A>T	15.37:g.68612682T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	J3KQM2|Q8WYI8|Q9UKQ1	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.A819	ENST00000315757.7	37	c.2457	CCDS45291.1	15																																																																																			ITGA11	-	pfam_Integrin_alpha-2	ENSG00000137809		0.592	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA11	HGNC	protein_coding		31	0.00	0	T	NM_012211		68612682	68612682	-1	no_errors	ENST00000315757	ensembl	human	known	69_37n	silent	29	44.23	23	SNP	0.005	A
ITSN2	50618	genome.wustl.edu	37	2	24494689	24494689	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr2:24494689C>G	ENST00000355123.4	-	19	2646	c.2203G>C	c.(2203-2205)Gct>Cct	p.A735P	ITSN2_ENST00000361999.3_Missense_Mutation_p.A708P|ITSN2_ENST00000406921.3_Missense_Mutation_p.A735P|SCARNA21_ENST00000515996.1_RNA	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	735					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ttctcctcagctttccgttcc	0.353																																						dbGAP											0													215.0	199.0	205.0					2																	24494689		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.2203G>C	2.37:g.24494689C>G	ENSP00000347244:p.Ala735Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,pfam_C2_Ca-dep,superfamily_DH-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_p67phox	p.A735P	ENST00000355123.4	37	c.2203	CCDS1710.2	2	.	.	.	.	.	.	.	.	.	.	C	12.10	1.836526	0.32421	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000406921	T;T;T;T	0.61158	1.62;0.13;1.62;0.61	4.41	1.52	0.23074	.	7.185350	0.02107	U	0.054458	T	0.44603	0.1301	L	0.34521	1.04	0.25749	N	0.985078	P;B;B	0.35656	0.514;0.226;0.145	B;B;B	0.28709	0.093;0.093;0.043	T	0.28776	-1.0033	10	0.30854	T	0.27	.	7.2	0.25874	0.0:0.6085:0.0:0.3915	.	735;708;735	Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;ITSN2_HUMAN	P	708;735;708;735	ENSP00000354561:A708P;ENSP00000347244:A735P;ENSP00000370250:A708P;ENSP00000384499:A735P	ENSP00000347244:A735P	A	-	1	0	ITSN2	24348193	0.952000	0.32445	0.989000	0.46669	0.907000	0.53573	-0.171000	0.09883	0.180000	0.19960	0.456000	0.33151	GCT	ITSN2	-	NULL	ENSG00000198399		0.353	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ITSN2	HGNC	protein_coding	OTTHUMT00000207620.2	248	0.00	0	C	NM_006277		24494689	24494689	-1	no_errors	ENST00000355123	ensembl	human	known	69_37n	missense	161	42.91	121	SNP	0.974	G
KCNG1	3755	genome.wustl.edu	37	20	49626537	49626537	+	Silent	SNP	G	G	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr20:49626537G>A	ENST00000371571.4	-	2	624	c.339C>T	c.(337-339)aaC>aaT	p.N113N	RP5-955M13.4_ENST00000424566.1_RNA|KCNG1_ENST00000396017.3_Silent_p.N113N|KCNG1_ENST00000506387.1_5'Flank	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	113					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						AGAAGAACTCGTTGCAGGTGA	0.647																																						dbGAP											0													62.0	51.0	55.0					20																	49626537		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.339C>T	20.37:g.49626537G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3S4|O43528|Q5JXL5|Q9BRC1	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.N113	ENST00000371571.4	37	c.339	CCDS13436.1	20																																																																																			KCNG1	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv9	ENSG00000026559		0.647	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNG1	HGNC	protein_coding	OTTHUMT00000079726.4	20	0.00	0	G	NM_002237		49626537	49626537	-1	no_errors	ENST00000371571	ensembl	human	known	69_37n	silent	8	80.00	32	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	3	195346312	195346312	+	IGR	SNP	C	C	T	rs369994739		TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr3:195346312C>T								APOD (35236 upstream) : RP11-141C7.4 (20548 downstream)																							TCCGACGGCCCCCATCCAGTC	0.622																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															3.37:g.195346312C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.P205L		37	c.614		3	.	.	.	.	.	.	.	.	.	.	.	9.559	1.117882	0.20877	.	.	ENSG00000176945	ENST00000381954	.	.	.	.	.	.	.	.	.	.	.	T	0.35595	0.0937	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.31971	-0.9924	3	0.46703	T	0.11	.	.	.	.	.	.	.	.	L	205	.	ENSP00000371380:P205L	P	+	2	0	MUC20	196827601	0.000000	0.05858	0.122000	0.21767	0.237000	0.25408	-0.301000	0.08232	0.149000	0.19098	0.152000	0.16155	CCC	MUC20	-	NULL	ENSG00000176945	0	0.622					MUC20	HGNC			33	0.00	0	C			195346312	195346312	+1	no_errors	ENST00000381954	ensembl	human	known	69_37n	missense	71	15.48	13	SNP	0.132	T
MYBL1	4603	genome.wustl.edu	37	8	67488508	67488508	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr8:67488508C>A	ENST00000522677.3	-	10	1614	c.1204G>T	c.(1204-1206)Gaa>Taa	p.E402*	MYBL1_ENST00000517885.1_Intron|MYBL1_ENST00000524176.2_Nonsense_Mutation_p.E402*	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	402	Negative regulatory domain. {ECO:0000250}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			ATGGCTCCTTCATTGTGCTGA	0.413																																						dbGAP											0													206.0	192.0	196.0					8																	67488508		1871	4117	5988	-	-	-	SO:0001587	stop_gained	0			X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.1204G>T	8.37:g.67488508C>A	ENSP00000429633:p.Glu402*	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EW29|Q495F9	Nonsense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.E402*	ENST00000522677.3	37	c.1204	CCDS47867.1	8	.	.	.	.	.	.	.	.	.	.	C	40	8.229891	0.98717	.	.	ENSG00000185697	ENST00000522677;ENST00000524176	.	.	.	5.5	5.5	0.81552	.	0.183733	0.48286	D	0.000196	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-18.5676	17.5839	0.87976	0.0:1.0:0.0:0.0	.	.	.	.	X	402	.	ENSP00000429633:E402X	E	-	1	0	MYBL1	67651062	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.324000	0.65863	2.600000	0.87896	0.591000	0.81541	GAA	MYBL1	-	NULL	ENSG00000185697		0.413	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBL1	HGNC	protein_coding	OTTHUMT00000379221.3	67	0.00	0	C	XM_034274		67488508	67488508	-1	no_errors	ENST00000522677	ensembl	human	known	69_37n	nonsense	81	41.01	57	SNP	1.000	A
MYF6	4618	genome.wustl.edu	37	12	81101569	81101569	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr12:81101569C>A	ENST00000228641.3	+	1	293	c.71C>A	c.(70-72)cCa>cAa	p.P24Q		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	24					muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						ACTCTGCAGCCATTAGAAGTG	0.527																																						dbGAP											0													95.0	98.0	97.0					12																	81101569		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.71C>A	12.37:g.81101569C>A	ENSP00000228641:p.Pro24Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R898|Q53X80|Q6FHI9	Missense_Mutation	SNP	pfam_Basic,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_Basic,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.P24Q	ENST00000228641.3	37	c.71	CCDS9019.1	12	.	.	.	.	.	.	.	.	.	.	C	9.184	1.024341	0.19433	.	.	ENSG00000111046	ENST00000228641	T	0.74947	-0.89	5.62	4.65	0.58169	Myogenic basic muscle-specific protein (2);	0.279607	0.41097	D	0.000952	T	0.46034	0.1372	N	0.02011	-0.69	0.42066	D	0.99118	B	0.02656	0.0	B	0.04013	0.001	T	0.45687	-0.9244	10	0.19590	T	0.45	.	11.1918	0.48690	0.4037:0.5963:0.0:0.0	.	24	P23409	MYF6_HUMAN	Q	24	ENSP00000228641:P24Q	ENSP00000228641:P24Q	P	+	2	0	MYF6	79625700	0.998000	0.40836	0.963000	0.40424	0.985000	0.73830	3.842000	0.55858	2.662000	0.90505	0.655000	0.94253	CCA	MYF6	-	pfam_Basic,smart_Basic	ENSG00000111046		0.527	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF6	HGNC	protein_coding	OTTHUMT00000407756.1	56	0.00	0	C	NM_002469		81101569	81101569	+1	no_errors	ENST00000228641	ensembl	human	known	69_37n	missense	18	67.27	37	SNP	0.996	A
OR2Z1	284383	genome.wustl.edu	37	19	8841963	8841963	+	Missense_Mutation	SNP	T	T	A	rs890848|rs374555313	byFrequency	TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr19:8841963T>A	ENST00000324060.2	+	1	648	c.573T>A	c.(571-573)gaT>gaA	p.D191E		NM_001004699.1	NP_001004699.1	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z, member 1	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CCTGTGCAGATACCTGTGCCT	0.572																																						dbGAP											0													154.0	139.0	144.0					19																	8841963		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC008753	CCDS32895.1	19p13.2	2013-09-20	2002-11-13		ENSG00000181733	ENSG00000181733		"""GPCR / Class A : Olfactory receptors"""	15391	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily Z, member 2"""	OR2Z2			Standard	NM_001004699		Approved		uc010xkg.2	Q8NG97	OTTHUMG00000182195	ENST00000324060.2:c.573T>A	19.37:g.8841963T>A	ENSP00000316284:p.Asp191Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH50|Q6IFK0|Q96R25	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.D191E	ENST00000324060.2	37	c.573	CCDS32895.1	19	.	.	.	.	.	.	.	.	.	.	t	12.72	2.023948	0.35701	.	.	ENSG00000181733	ENST00000324060	T	0.00227	8.5	4.56	1.25	0.21368	GPCR, rhodopsin-like superfamily (1);	0.084785	0.50627	D	0.000101	T	0.00412	0.0013	M	0.76328	2.33	0.22787	N	0.998734	P	0.44195	0.828	P	0.59357	0.856	T	0.30208	-0.9986	10	0.87932	D	0	.	9.0233	0.36213	0.0:0.7222:0.0:0.2778	.	191	Q8NG97	OR2Z1_HUMAN	E	191	ENSP00000316284:D191E	ENSP00000316284:D191E	D	+	3	2	OR2Z1	8702963	0.745000	0.28261	0.753000	0.31225	0.003000	0.03518	0.509000	0.22707	0.137000	0.18759	-1.349000	0.01238	GAT	OR2Z1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000181733		0.572	OR2Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2Z1	HGNC	protein_coding	OTTHUMT00000459954.1	56	0.00	0	T			8841963	8841963	+1	no_errors	ENST00000324060	ensembl	human	known	69_37n	missense	137	27.13	51	SNP	0.993	A
OR2Z1	284383	genome.wustl.edu	37	19	8842092	8842092	+	Missense_Mutation	SNP	A	A	T	rs199597814		TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr19:8842092A>T	ENST00000324060.2	+	1	777	c.702A>T	c.(700-702)agA>agT	p.R234S		NM_001004699.1	NP_001004699.1	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z, member 1	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						AGGAGGCCAGACACAAGGCTG	0.587													A|||	1	0.000199681	0.0	0.0014	5008	,	,		21924	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													125.0	99.0	108.0					19																	8842092		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC008753	CCDS32895.1	19p13.2	2013-09-20	2002-11-13		ENSG00000181733	ENSG00000181733		"""GPCR / Class A : Olfactory receptors"""	15391	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily Z, member 2"""	OR2Z2			Standard	NM_001004699		Approved		uc010xkg.2	Q8NG97	OTTHUMG00000182195	ENST00000324060.2:c.702A>T	19.37:g.8842092A>T	ENSP00000316284:p.Arg234Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH50|Q6IFK0|Q96R25	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R234S	ENST00000324060.2	37	c.702	CCDS32895.1	19	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	12.97	2.097733	0.37048	.	.	ENSG00000181733	ENST00000324060	T	0.00311	8.15	4.67	-5.29	0.02747	GPCR, rhodopsin-like superfamily (1);	0.417225	0.19958	N	0.102273	T	0.00384	0.0012	M	0.81179	2.53	0.09310	N	1	D	0.59767	0.986	D	0.63113	0.911	T	0.46555	-0.9183	10	0.87932	D	0	.	3.1199	0.06387	0.173:0.3923:0.3151:0.1196	.	234	Q8NG97	OR2Z1_HUMAN	S	234	ENSP00000316284:R234S	ENSP00000316284:R234S	R	+	3	2	OR2Z1	8703092	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.213000	0.17521	-0.682000	0.05197	-0.486000	0.04755	AGA	OR2Z1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181733		0.587	OR2Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2Z1	HGNC	protein_coding	OTTHUMT00000459954.1	50	0.00	0	A			8842092	8842092	+1	no_errors	ENST00000324060	ensembl	human	known	69_37n	missense	96	31.21	44	SNP	0.002	T
NFIX	4784	genome.wustl.edu	37	19	13186433	13186433	+	Silent	SNP	C	C	G			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr19:13186433C>G	ENST00000592199.1	+	6	903	c.903C>G	c.(901-903)tcC>tcG	p.S301S	NFIX_ENST00000588228.1_Silent_p.S254S|NFIX_ENST00000587760.1_Silent_p.S293S|NFIX_ENST00000397661.2_Silent_p.S301S|NFIX_ENST00000360105.4_Silent_p.S304S|NFIX_ENST00000587260.1_Silent_p.S300S|NFIX_ENST00000585575.1_Silent_p.S293S|NFIX_ENST00000358552.3_Silent_p.S300S			Q14938	NFIX_HUMAN	nuclear factor I/X (CCAAT-binding transcription factor)	301					astrocyte differentiation (GO:0048708)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell layer development (GO:0021680)|DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			CAGGCCGTTCCCCAGCAGCTG	0.612																																						dbGAP											0													33.0	39.0	37.0					19																	13186433		2052	4198	6250	-	-	-	SO:0001819	synonymous_variant	0			U18761	CCDS45996.1, CCDS59359.1	19p13.3	2008-02-05				ENSG00000008441			7788	protein-coding gene	gene with protein product		164005				8340106, 7590749	Standard	NM_001271043		Approved	NF1A	uc010xmx.2	Q14938		ENST00000592199.1:c.903C>G	19.37:g.13186433C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DM25|O60413|Q0VG09|Q12859|Q13050|Q13052|Q5U094|Q9UPH1|Q9Y6R8	Silent	SNP	pfam_CTF/NFI,pfam_CTF/NFI_DNA-bd_N,pfam_MAD_homology1_Dwarfin-type,smart_MAD_homology1_Dwarfin-type,pfscan_CTF/NFI_DNA-bd-dom	p.S293	ENST00000592199.1	37	c.879		19																																																																																			NFIX	-	pfam_CTF/NFI	ENSG00000008441		0.612	NFIX-013	NOVEL	basic	protein_coding	NFIX	HGNC	protein_coding	OTTHUMT00000452763.1	20	0.00	0	C	NM_002501		13186433	13186433	+1	no_errors	ENST00000585575	ensembl	human	known	69_37n	silent	32	42.86	24	SNP	1.000	G
OR5W2	390148	genome.wustl.edu	37	11	55681285	55681285	+	Missense_Mutation	SNP	C	C	T	rs377281518		TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr11:55681285C>T	ENST00000344514.1	-	1	773	c.774G>A	c.(772-774)atG>atA	p.M258I		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GCCGGAAATACATAAAGAGCA	0.443																																					Melanoma(48;171 1190 15239 43886 49348)	dbGAP											0													82.0	94.0	90.0					11																	55681285		2201	4296	6497	-	-	-	SO:0001583	missense	0			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.774G>A	11.37:g.55681285C>T	ENSP00000342448:p.Met258Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M258I	ENST00000344514.1	37	c.774	CCDS31513.1	11	.	.	.	.	.	.	.	.	.	.	C	13.12	2.142107	0.37825	.	.	ENSG00000187612	ENST00000344514	T	0.00145	8.67	5.01	2.05	0.26809	GPCR, rhodopsin-like superfamily (1);	0.134115	0.34025	N	0.004334	T	0.00109	0.0003	N	0.21545	0.675	0.28577	N	0.910315	B	0.12013	0.005	B	0.22880	0.042	T	0.14420	-1.0473	10	0.42905	T	0.14	.	4.5174	0.11943	0.0:0.5656:0.1638:0.2706	.	258	Q8NH69	OR5W2_HUMAN	I	258	ENSP00000342448:M258I	ENSP00000342448:M258I	M	-	3	0	OR5W2	55437861	0.058000	0.20735	0.922000	0.36590	0.953000	0.61014	0.306000	0.19279	0.142000	0.18901	0.549000	0.68633	ATG	OR5W2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187612		0.443	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5W2	HGNC	protein_coding	OTTHUMT00000391523.1	33	0.00	0	C	NM_001001960		55681285	55681285	-1	no_errors	ENST00000344514	ensembl	human	known	69_37n	missense	31	46.55	27	SNP	0.995	T
PHOSPHO2	493911	genome.wustl.edu	37	2	170558059	170558059	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr2:170558059A>G	ENST00000359744.3	+	4	966	c.578A>G	c.(577-579)gAt>gGt	p.D193G	KLHL23_ENST00000272797.4_Intron|KLHL23_ENST00000602521.1_Intron	NM_001008489.3|NM_001199285.1|NM_001199286.1|NM_001199288.1	NP_001008489.1|NP_001186214.1|NP_001186215.1|NP_001186217.1	Q8TCD6	PHOP2_HUMAN	phosphatase, orphan 2	193							metal ion binding (GO:0046872)|pyridoxal phosphatase activity (GO:0033883)			breast(1)|large_intestine(1)|lung(6)|skin(2)	10						TTAAAGAATGATGATGTTGCC	0.363																																						dbGAP											0													83.0	83.0	83.0					2																	170558059		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022324	CCDS33319.1	2q31.1	2008-02-05			ENSG00000144362	ENSG00000144362			28316	protein-coding gene	gene with protein product						16054448	Standard	NM_001199285		Approved	MGC22679	uc021vsh.1	Q8TCD6	OTTHUMG00000153981	ENST00000359744.3:c.578A>G	2.37:g.170558059A>G	ENSP00000352782:p.Asp193Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC30|D3DPC7	Missense_Mutation	SNP	pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,pirsf_Pase_PHOSPHO-typ,tigrfam_PyrdxlP_Pase-rel,tigrfam_HAD-SF_hydro_IB_PSP-like	p.D193G	ENST00000359744.3	37	c.578	CCDS33319.1	2	.	.	.	.	.	.	.	.	.	.	A	0.033	-1.324122	0.01309	.	.	ENSG00000144362	ENST00000359744	T	0.43688	0.94	5.96	3.58	0.41010	HAD-like domain (1);	0.503671	0.20364	U	0.093797	T	0.11024	0.0269	N	0.00325	-1.645	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30060	-0.9991	10	0.10636	T	0.68	.	9.2559	0.37584	0.734:0.0:0.266:0.0	.	193	Q8TCD6	PHOP2_HUMAN	G	193	ENSP00000352782:D193G	ENSP00000352782:D193G	D	+	2	0	PHOSPHO2	170266305	0.010000	0.17322	0.337000	0.25536	0.803000	0.45373	0.913000	0.28611	0.498000	0.27948	0.482000	0.46254	GAT	PHOSPHO2	-	pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,pirsf_Pase_PHOSPHO-typ,tigrfam_PyrdxlP_Pase-rel	ENSG00000144362		0.363	PHOSPHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHOSPHO2	HGNC	protein_coding	OTTHUMT00000333304.1	12	0.00	0	A	NM_001008489		170558059	170558059	+1	no_errors	ENST00000359744	ensembl	human	known	69_37n	missense	10	67.74	21	SNP	0.136	G
PIK3CD	5293	genome.wustl.edu	37	1	9777639	9777639	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr1:9777639C>G	ENST00000377346.4	+	8	1170	c.975C>G	c.(973-975)atC>atG	p.I325M	PIK3CD_ENST00000536656.1_Missense_Mutation_p.I290M|PIK3CD_ENST00000543390.1_5'Flank|PIK3CD_ENST00000361110.2_Missense_Mutation_p.I290M	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	325	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	CGTTCCGCATCGAGCTCATCC	0.597																																						dbGAP											0													62.0	65.0	64.0					1																	9777639		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.975C>G	1.37:g.9777639C>G	ENSP00000366563:p.Ile325Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,pfam_PI3K_Ras-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.I290M	ENST00000377346.4	37	c.870	CCDS104.1	1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.067542	0.76301	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563	T;T;T	0.71461	-0.57;-0.57;-0.57	5.44	-10.9	0.00192	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.371433	0.29932	N	0.010828	T	0.68375	0.2994	M	0.71206	2.165	0.80722	D	1	B;P;P	0.46020	0.304;0.871;0.624	B;P;P	0.51742	0.291;0.678;0.619	T	0.83174	-0.0092	10	0.51188	T	0.08	-15.2079	11.3503	0.49583	0.0:0.1417:0.4716:0.3868	.	325;290;325	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	M	290;325;290;290	ENSP00000446444:I290M;ENSP00000366563:I325M;ENSP00000354410:I290M	ENSP00000353766:I290M	I	+	3	3	PIK3CD	9700226	0.001000	0.12720	0.045000	0.18777	0.957000	0.61999	-1.527000	0.02227	-2.406000	0.00574	-0.768000	0.03414	ATC	PIK3CD	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom	ENSG00000171608		0.597	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CD	HGNC	protein_coding	OTTHUMT00000004235.1	43	0.00	0	C	NM_005026		9777639	9777639	+1	no_errors	ENST00000536656	ensembl	human	known	69_37n	missense	12	76.00	38	SNP	0.008	G
PKLR	5313	genome.wustl.edu	37	1	155263003	155263003	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr1:155263003A>C	ENST00000342741.4	-	9	1439	c.1401T>G	c.(1399-1401)tgT>tgG	p.C467W	PKLR_ENST00000392414.3_Missense_Mutation_p.C436W	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	467					ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	TGGCAGCAGCACAGCACTTGA	0.617																																						dbGAP											0													90.0	78.0	82.0					1																	155263003		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.1401T>G	1.37:g.155263003A>C	ENSP00000339933:p.Cys467Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O75758|P11973	Missense_Mutation	SNP	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.C467W	ENST00000342741.4	37	c.1401	CCDS1109.1	1	.	.	.	.	.	.	.	.	.	.	A	15.48	2.845804	0.51164	.	.	ENSG00000143627	ENST00000423816;ENST00000392414;ENST00000342741;ENST00000271946	D;D	0.99032	-5.35;-5.35	4.54	0.933	0.19471	Pyruvate kinase, C-terminal (2);Pyruvate kinase, alpha/beta (1);	0.047997	0.85682	D	0.000000	D	0.98713	0.9568	M	0.87180	2.865	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.64321	0.924;0.924	D	0.98354	1.0545	10	0.66056	D	0.02	-11.5736	7.4747	0.27369	0.728:0.0:0.272:0.0	.	467;458	P30613;B1AVT1	KPYR_HUMAN;.	W	492;436;467;381	ENSP00000376214:C436W;ENSP00000339933:C467W	ENSP00000271946:C381W	C	-	3	2	PKLR	153529627	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	0.740000	0.26188	0.056000	0.16144	-0.411000	0.06167	TGT	PKLR	-	pfam_Pyrv_Knase_C,superfamily_Pyrv_Knase_C,tigrfam_Pyr_Knase	ENSG00000143627		0.617	PKLR-001	KNOWN	basic|CCDS	protein_coding	PKLR	HGNC	protein_coding	OTTHUMT00000087407.2	36	0.00	0	A	NM_000298		155263003	155263003	-1	no_errors	ENST00000342741	ensembl	human	known	69_37n	missense	78	22.77	23	SNP	1.000	C
PLIN4	729359	genome.wustl.edu	37	19	4513410	4513410	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr19:4513410G>A	ENST00000301286.3	-	3	519	c.520C>T	c.(520-522)Cag>Tag	p.Q174*		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	174	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						ACACCGGCCTGTACGGTCCCT	0.617																																						dbGAP											0													82.0	88.0	86.0					19																	4513410		2057	4191	6248	-	-	-	SO:0001587	stop_gained	0			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.520C>T	19.37:g.4513410G>A	ENSP00000301286:p.Gln174*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEI2	Nonsense_Mutation	SNP	pfam_Perilipin,superfamily_Ankyrin_rpt-contain_dom	p.Q174*	ENST00000301286.3	37	c.520	CCDS45927.1	19	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743106	0.89663	.	.	ENSG00000167676	ENST00000301286	.	.	.	5.43	5.43	0.79202	.	0.137917	0.32970	N	0.005435	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-19.3643	14.7206	0.69302	0.0:0.0:1.0:0.0	.	.	.	.	X	174	.	ENSP00000301286:Q174X	Q	-	1	0	PLIN4	4464410	0.106000	0.21978	0.644000	0.29465	0.062000	0.15995	1.528000	0.35985	2.545000	0.85829	0.561000	0.74099	CAG	PLIN4	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000167676		0.617	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLIN4	HGNC	protein_coding	OTTHUMT00000395095.1	36	0.00	0	G	XM_170901		4513410	4513410	-1	no_errors	ENST00000301286	ensembl	human	novel	69_37n	nonsense	45	55.00	55	SNP	0.887	A
RAB14	51552	genome.wustl.edu	37	9	123943823	123943823	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr9:123943823C>G	ENST00000373840.4	-	8	736	c.499G>C	c.(499-501)Gag>Cag	p.E167Q		NM_016322.3	NP_057406.2	P61106	RAB14_HUMAN	RAB14, member RAS oncogene family	167					embryo development (GO:0009790)|endocytic recycling (GO:0032456)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi to endosome transport (GO:0006895)|GTP catabolic process (GO:0006184)|intracellular transport (GO:0046907)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|rough endoplasmic reticulum (GO:0005791)|trans-Golgi network transport vesicle (GO:0030140)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5						TTGGCAGCCTCAAGGAAGGCA	0.448																																						dbGAP											0													82.0	77.0	79.0					9																	123943823		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152463	CCDS6827.1	9q32-q34.11	2008-07-21			ENSG00000119396	ENSG00000119396		"""RAB, member RAS oncogene"""	16524	protein-coding gene	gene with protein product	"""F protein-binding protein 1"", ""bA165P4.3 (member RAS oncogene family)"", ""small GTP binding protein RAB14"""	612673				9792283, 15004230	Standard	NM_016322		Approved	FBP, RAB-14	uc004blc.3	P61106	OTTHUMG00000020582	ENST00000373840.4:c.499G>C	9.37:g.123943823C>G	ENSP00000362946:p.Glu167Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR31|P35287|Q5JVD4|Q6Q7K5|Q969L0|Q9UI11	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E167Q	ENST00000373840.4	37	c.499	CCDS6827.1	9	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076731	0.36662	.	.	ENSG00000119396	ENST00000373840;ENST00000451303	T;T	0.80123	-1.34;-1.14	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.75917	0.3915	N	0.21324	0.655	0.80722	D	1	P	0.35780	0.52	B	0.42771	0.397	T	0.70673	-0.4807	10	0.20046	T	0.44	.	19.3618	0.94442	0.0:1.0:0.0:0.0	.	167	P61106	RAB14_HUMAN	Q	167	ENSP00000362946:E167Q;ENSP00000400107:E167Q	ENSP00000362946:E167Q	E	-	1	0	RAB14	122983644	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.731000	0.84895	2.820000	0.97059	0.650000	0.86243	GAG	RAB14	-	pfam_Small_GTPase,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase	ENSG00000119396		0.448	RAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB14	HGNC	protein_coding	OTTHUMT00000053857.1	48	0.00	0	C	NM_016322		123943823	123943823	-1	no_errors	ENST00000373840	ensembl	human	known	69_37n	missense	11	73.17	30	SNP	1.000	G
RELN	5649	genome.wustl.edu	37	7	103183246	103183246	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr7:103183246G>C	ENST00000428762.1	-	43	6762	c.6603C>G	c.(6601-6603)aaC>aaG	p.N2201K	RELN_ENST00000343529.5_Missense_Mutation_p.N2201K|RELN_ENST00000424685.2_Missense_Mutation_p.N2201K	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2201					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AAAAGAGGTTGTTTCCACTAG	0.373																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											0													115.0	108.0	111.0					7																	103183246		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6603C>G	7.37:g.103183246G>C	ENSP00000392423:p.Asn2201Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.N2201K	ENST00000428762.1	37	c.6603	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	G	12.48	1.951328	0.34471	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.24538	1.85;1.85;1.85	5.79	4.92	0.64577	Neuraminidase (1);	0.054406	0.64402	D	0.000001	T	0.39036	0.1063	L	0.34521	1.04	0.52501	D	0.99995	D;P	0.76494	0.999;0.497	D;B	0.74023	0.982;0.436	T	0.11842	-1.0571	10	0.39692	T	0.17	.	14.7076	0.69203	0.0693:0.0:0.9307:0.0	.	2201;2201	P78509-2;P78509	.;RELN_HUMAN	K	2201	ENSP00000392423:N2201K;ENSP00000345694:N2201K;ENSP00000388446:N2201K	ENSP00000345694:N2201K	N	-	3	2	RELN	102970482	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.484000	0.53201	1.449000	0.47699	0.591000	0.81541	AAC	RELN	-	superfamily_Neuraminidase	ENSG00000189056		0.373	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	53	0.00	0	G	NM_005045		103183246	103183246	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	40	36.51	23	SNP	1.000	C
SALL2	6297	genome.wustl.edu	37	14	22005013	22005013	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr14:22005013C>G	ENST00000327430.3	-	1	337	c.43G>C	c.(43-45)Gac>Cac	p.D15H	SALL2_ENST00000317492.5_Missense_Mutation_p.D15H	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	15					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		CCTTCGCAGTCCGAGATTAAC	0.637																																						dbGAP											0													91.0	87.0	88.0					14																	22005013		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.43G>C	14.37:g.22005013C>G	ENSP00000333537:p.Asp15His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D15H	ENST00000327430.3	37	c.43	CCDS32045.1	14	.	.	.	.	.	.	.	.	.	.	C	19.24	3.790379	0.70337	.	.	ENSG00000165821	ENST00000327430;ENST00000317492;ENST00000541876	T;T	0.52754	2.61;0.65	5.2	5.2	0.72013	.	0.000000	0.39083	U	0.001477	T	0.64659	0.2618	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.993	T	0.67321	-0.5700	10	0.87932	D	0	-6.4602	15.6582	0.77158	0.0:1.0:0.0:0.0	.	15;15	F5GY43;Q9Y467	.;SALL2_HUMAN	H	15	ENSP00000333537:D15H;ENSP00000320536:D15H	ENSP00000320536:D15H	D	-	1	0	SALL2	21074853	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.961000	0.56759	2.421000	0.82119	0.655000	0.94253	GAC	SALL2	-	NULL	ENSG00000165821		0.637	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL2	HGNC	protein_coding	OTTHUMT00000401242.1	56	0.00	0	C	NM_005407		22005013	22005013	-1	no_errors	ENST00000327430	ensembl	human	known	69_37n	missense	18	48.57	17	SNP	1.000	G
LINC00969	440993	genome.wustl.edu	37	3	195399395	195399395	+	lincRNA	SNP	C	C	G	rs201046867	byFrequency	TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr3:195399395C>G	ENST00000445430.1	+	0	1129									long intergenic non-protein coding RNA 969																		CCTGCAGCTGCACCACCTACC	0.567																																						dbGAP											0																																										-	-	-			0			AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195399395C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000445430.1	37	NULL		3																																																																																			SDHAP2	-	-	ENSG00000215837		0.567	LINC00969-038	KNOWN	basic	lincRNA	SDHAP2	HGNC	lincRNA	OTTHUMT00000341951.1	9	0.00	0	C			195399395	195399395	+1	no_errors	ENST00000429897	ensembl	human	known	69_37n	rna	18	41.94	13	SNP	1.000	G
CCDC152	100129792	genome.wustl.edu	37	5	42800932	42800932	+	3'UTR	SNP	G	G	C			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr5:42800932G>C	ENST00000361970.5	+	0	1901				SEPP1_ENST00000511224.1_Missense_Mutation_p.R346G|SEPP1_ENST00000509276.1_5'Flank|SEPP1_ENST00000507920.1_3'UTR|SEPP1_ENST00000514985.1_Missense_Mutation_p.R346G|SEPP1_ENST00000506577.1_Missense_Mutation_p.R346G	NM_001134848.1	NP_001128320.1	Q4G0S7	CC152_HUMAN	coiled-coil domain containing 152											endometrium(1)	1						GGAGGCAAACGTCACTGACAA	0.473																																						dbGAP											0													85.0	82.0	83.0					5																	42800932		1961	4158	6119	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS47203.1	5p12	2008-07-14			ENSG00000198865	ENSG00000198865			34438	protein-coding gene	gene with protein product							Standard	NM_001134848		Approved	LOC100129792	uc003jmx.3	Q4G0S7	OTTHUMG00000162141	ENST00000361970.5:c.*1049G>C	5.37:g.42800932G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXI4|B4E0P7|Q5BLP6	Missense_Mutation	SNP	pfam_Selenoprotein-P_N,pfam_SelP_C	p.R346G	ENST00000361970.5	37	c.1036	CCDS47203.1	5	.	.	.	.	.	.	.	.	.	.	G	18.95	3.732629	0.69189	.	.	ENSG00000250722	ENST00000514985;ENST00000511224;ENST00000506577	T;T;T	0.33438	1.41;1.41;1.41	5.78	4.89	0.63831	.	0.161638	0.29192	N	0.012876	T	0.37348	0.1000	L	0.32530	0.975	0.80722	D	1	.	.	.	.	.	.	T	0.24225	-1.0166	8	0.87932	D	0	.	15.4349	0.75137	0.0:0.0:0.8557:0.1443	.	.	.	.	G	346	ENSP00000420939:R346G;ENSP00000427671:R346G;ENSP00000425915:R346G	ENSP00000425915:R346G	R	-	1	0	SEPP1	42836689	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.322000	0.72886	1.384000	0.46424	0.591000	0.81541	CGT	SEPP1	-	pfam_SelP_C	ENSG00000250722		0.473	CCDC152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPP1	HGNC	protein_coding	OTTHUMT00000367497.1	55	0.00	0	G	XM_001717416		42800932	42800932	-1	pseudogene	ENST00000506577	ensembl	human	known	69_37n	missense	63	41.12	44	SNP	1.000	C
SIGLEC5	8778	genome.wustl.edu	37	19	52115496	52115496	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr19:52115496C>G	ENST00000534261.2	-	10	2043	c.1644G>C	c.(1642-1644)aaG>aaC	p.K548N	SIGLEC5_ENST00000599649.1_Missense_Mutation_p.K548N|SIGLEC5_ENST00000429354.3_Missense_Mutation_p.K548N|SIGLEC5_ENST00000570106.2_Missense_Mutation_p.K548N|SIGLEC5_ENST00000222107.4_Missense_Mutation_p.K548N			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	548					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		ACTTGCTTGTCTTGATCTCCG	0.542																																						dbGAP											0													136.0	113.0	121.0					19																	52115496		2203	4300	6503	-	-	-	SO:0001583	missense	0			U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.1644G>C	19.37:g.52115496C>G	ENSP00000473238:p.Lys548Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.K548N	ENST00000534261.2	37	c.1644	CCDS33088.1	19	.	.	.	.	.	.	.	.	.	.	C	14.16	2.451559	0.43531	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	T;T	0.06849	3.25;3.25	3.51	-3.63	0.04529	.	.	.	.	.	T	0.10637	0.0260	L	0.48642	1.525	0.09310	N	1	D	0.64830	0.994	P	0.54544	0.755	T	0.14587	-1.0467	9	0.87932	D	0	.	1.0457	0.01569	0.1606:0.293:0.3149:0.2315	.	548	O15389	SIGL5_HUMAN	N	548	ENSP00000222107:K548N;ENSP00000415200:K548N	ENSP00000222107:K548N	K	-	3	2	SIGLEC5	56807308	0.000000	0.05858	0.008000	0.14137	0.010000	0.07245	-0.490000	0.06482	-0.532000	0.06332	0.650000	0.86243	AAG	SIGLEC5	-	NULL	ENSG00000105501		0.542	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	SIGLEC5	HGNC	protein_coding	OTTHUMT00000466897.2	64	0.00	0	C	NM_003830		52115496	52115496	-1	no_errors	ENST00000222107	ensembl	human	known	69_37n	missense	11	69.44	25	SNP	0.010	G
SLC34A1	6569	genome.wustl.edu	37	5	176813238	176813238	+	Silent	SNP	C	C	G	rs199844043	byFrequency	TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr5:176813238C>G	ENST00000324417.5	+	4	367	c.276C>G	c.(274-276)ccC>ccG	p.P92P	SLC34A1_ENST00000512593.1_Silent_p.P92P	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	92					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCTGGTCCCCAAGCTGCGCC	0.662																																						dbGAP											0													84.0	76.0	79.0					5																	176813238		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.276C>G	5.37:g.176813238C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPE3	Silent	SNP	pfam_Na/Pi_transpt,tigrfam_Na/Pi_transpt	p.P92	ENST00000324417.5	37	c.276	CCDS4418.1	5																																																																																			SLC34A1	-	NULL	ENSG00000131183		0.662	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC34A1	HGNC	protein_coding	OTTHUMT00000253431.1	43	0.00	0	C	NM_003052		176813238	176813238	+1	no_errors	ENST00000324417	ensembl	human	known	69_37n	silent	16	62.79	27	SNP	0.022	G
SLC9A5	6553	genome.wustl.edu	37	16	67283105	67283105	+	Splice_Site	SNP	G	G	T			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr16:67283105G>T	ENST00000299798.11	+	1	252		c.e1+1		SLC9A5_ENST00000561472.2_Splice_Site|FHOD1_ENST00000258201.4_5'Flank	NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5						ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		GCCAAAATCGGTGAGTGCGTG	0.687																																						dbGAP											0													32.0	48.0	43.0					16																	67283105		2046	4189	6235	-	-	-	SO:0001630	splice_region_variant	0				CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.187+1G>T	16.37:g.67283105G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKY7|Q9Y626	Splice_Site	SNP	-	e1+1	ENST00000299798.11	37	c.187+1	CCDS42178.1	16	.	.	.	.	.	.	.	.	.	.	G	14.69	2.611025	0.46631	.	.	ENSG00000135740	ENST00000299798	.	.	.	3.91	3.91	0.45181	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1195	0.59318	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC9A5	65840606	1.000000	0.71417	1.000000	0.80357	0.299000	0.27559	8.555000	0.90693	2.165000	0.68154	0.462000	0.41574	.	SLC9A5	-	-	ENSG00000135740		0.687	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A5	HGNC	protein_coding	OTTHUMT00000421386.1	27	0.00	0	G		Intron	67283105	67283105	+1	no_errors	ENST00000299798	ensembl	human	known	69_37n	splice_site	26	31.58	12	SNP	1.000	T
STARD9	57519	genome.wustl.edu	37	15	42977022	42977022	+	Silent	SNP	A	A	C			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr15:42977022A>C	ENST00000290607.7	+	23	3303	c.3246A>C	c.(3244-3246)ccA>ccC	p.P1082P		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	1082					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						CCATGGTCCCACTCACAGATT	0.418																																						dbGAP											0													66.0	61.0	62.0					15																	42977022		692	1590	2282	-	-	-	SO:0001819	synonymous_variant	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.3246A>C	15.37:g.42977022A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Silent	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P1082	ENST00000290607.7	37	c.3246	CCDS53935.1	15																																																																																			STARD9	-	NULL	ENSG00000159433		0.418	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	25	0.00	0	A			42977022	42977022	+1	no_errors	ENST00000290607	ensembl	human	known	69_37n	silent	18	56.10	23	SNP	0.000	C
TCTA	6988	genome.wustl.edu	37	3	49450057	49450057	+	Silent	SNP	G	G	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr3:49450057G>A	ENST00000273590.3	+	1	419	c.198G>A	c.(196-198)ggG>ggA	p.G66G	RHOA_ENST00000265538.3_Intron|RHOA_ENST00000454011.2_5'Flank|TCTA_ENST00000493381.1_3'UTR|RHOA_ENST00000418115.1_5'Flank|RHOA_ENST00000422781.1_5'Flank	NM_022171.2	NP_071503.1	P57738	TCTA_HUMAN	T-cell leukemia translocation altered	66						integral component of membrane (GO:0016021)				large_intestine(4)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CAGTGACCGGGTTGTATCACC	0.617																																						dbGAP											0													101.0	109.0	106.0					3																	49450057		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2796.1	3p21	2012-02-27	2012-02-27		ENSG00000145022	ENSG00000145022			11692	protein-coding gene	gene with protein product		600690	"""T-cell leukemia translocation altered gene"""			7728759	Standard	NM_022171		Approved		uc003cwv.4	P57738	OTTHUMG00000156846	ENST00000273590.3:c.198G>A	3.37:g.49450057G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4I4|Q6I9U4|Q9BSB0	Silent	SNP	pirsf_T-cell_leukemia_transloc-assoc	p.G66	ENST00000273590.3	37	c.198	CCDS2796.1	3																																																																																			TCTA	-	pirsf_T-cell_leukemia_transloc-assoc	ENSG00000145022		0.617	TCTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTA	HGNC	protein_coding	OTTHUMT00000346210.1	41	0.00	0	G	NM_022171		49450057	49450057	+1	no_errors	ENST00000273590	ensembl	human	known	69_37n	silent	22	62.71	37	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577558	7577558	+	Frame_Shift_Del	DEL	G	G	-	rs397516437		TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr17:7577558delG	ENST00000269305.4	-	7	912	c.723delC	c.(721-723)tccfs	p.S241fs	TP53_ENST00000420246.2_Frame_Shift_Del_p.S241fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.S241fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.S241fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.S241fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.S241fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C242fs*5(9)|p.0?(8)|p.?(5)|p.S241del(5)|p.S241F(5)|p.N239_C242delNSSC(3)|p.S241S(3)|p.N239_C242>S(1)|p.S241_C242insX(1)|p.C238fs*21(1)|p.C242fs*20(1)|p.C242fs*23(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGCCCATGCAGGAACTGTTAC	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	50	Deletion - In frame(13)|Deletion - Frameshift(13)|Whole gene deletion(8)|Unknown(5)|Substitution - Missense(5)|Substitution - coding silent(3)|Insertion - Frameshift(1)|Insertion - In frame(1)|Complex - deletion inframe(1)	large_intestine(8)|biliary_tract(6)|breast(5)|upper_aerodigestive_tract(4)|stomach(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|central_nervous_system(2)|urinary_tract(2)|oesophagus(2)|skin(2)|eye(2)|pancreas(2)|liver(1)											138.0	107.0	117.0					17																	7577558		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.723delC	17.37:g.7577558delG	ENSP00000269305:p.Ser241fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C242fs	ENST00000269305.4	37	c.723	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	49	0.00	0	G	NM_000546		7577558	7577558	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	24	69.32	61	DEL	1.000	-
TSPEAR	54084	genome.wustl.edu	37	21	45947265	45947265	+	Silent	SNP	G	G	C			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr21:45947265G>C	ENST00000323084.4	-	7	1124	c.1059C>G	c.(1057-1059)gtC>gtG	p.V353V	TSPEAR_ENST00000397916.1_Silent_p.V285V	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	353					sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						TCCACTTGTAGACGGCGGATG	0.552																																						dbGAP											0													276.0	253.0	261.0					21																	45947265		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.1059C>G	21.37:g.45947265G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_EPTP,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_EAR	p.V353	ENST00000323084.4	37	c.1059	CCDS13712.1	21																																																																																			TSPEAR	-	pfscan_EAR	ENSG00000175894		0.552	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPEAR	HGNC	protein_coding	OTTHUMT00000098761.1	131	0.00	0	G	NM_144991		45947265	45947265	-1	no_errors	ENST00000323084	ensembl	human	known	69_37n	silent	172	38.79	109	SNP	1.000	C
UBXN2B	137886	genome.wustl.edu	37	8	59352284	59352284	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr8:59352284G>C	ENST00000399598.2	+	6	748	c.626G>C	c.(625-627)aGa>aCa	p.R209T		NM_001077619.1	NP_001071087.1	Q14CS0	UBX2B_HUMAN	UBX domain protein 2B	209						endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	13						ATAAAACCTAGATTGAGGTTC	0.378																																						dbGAP											0													92.0	86.0	88.0					8																	59352284		1842	4080	5922	-	-	-	SO:0001583	missense	0			AK054658	CCDS43741.1	8q12.1	2008-08-08			ENSG00000215114	ENSG00000215114		"""UBX domain containing"""	27035	protein-coding gene	gene with protein product		610686				8619474, 9110174	Standard	NM_001077619		Approved	p37	uc003xtl.3	Q14CS0	OTTHUMG00000164300	ENST00000399598.2:c.626G>C	8.37:g.59352284G>C	ENSP00000382507:p.Arg209Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWZ3	Missense_Mutation	SNP	pfam_SEP_domain,pfam_UBX,superfamily_SEP_domain,smart_SEP_domain,smart_UBX,pfscan_UBX	p.R209T	ENST00000399598.2	37	c.626	CCDS43741.1	8	.	.	.	.	.	.	.	.	.	.	G	15.82	2.947292	0.53186	.	.	ENSG00000215114	ENST00000399598	T	0.44881	0.91	5.42	4.54	0.55810	SEP domain (3);	0.000000	0.47093	U	0.000248	T	0.48677	0.1513	L	0.50333	1.59	0.33452	D	0.583791	D	0.53619	0.961	P	0.53224	0.721	T	0.61787	-0.6991	10	0.51188	T	0.08	-7.4361	12.8783	0.58001	0.0771:0.0:0.9229:0.0	.	209	Q14CS0	UBX2B_HUMAN	T	209	ENSP00000382507:R209T	ENSP00000382507:R209T	R	+	2	0	UBXN2B	59514838	0.981000	0.34729	0.824000	0.32777	0.993000	0.82548	3.522000	0.53480	2.561000	0.86390	0.603000	0.83216	AGA	UBXN2B	-	pfam_SEP_domain,superfamily_SEP_domain,smart_SEP_domain	ENSG00000215114		0.378	UBXN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN2B	HGNC	protein_coding	OTTHUMT00000378184.1	67	0.00	0	G	NM_001077619		59352284	59352284	+1	no_errors	ENST00000399598	ensembl	human	known	69_37n	missense	58	41.58	42	SNP	0.696	C
WDFY4	57705	genome.wustl.edu	37	10	50025362	50025362	+	Missense_Mutation	SNP	G	G	A	rs536727293		TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr10:50025362G>A	ENST00000325239.5	+	31	5440	c.5413G>A	c.(5413-5415)Gtc>Atc	p.V1805I	WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1805						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CCTCAGCCTCGTCCACCGCAC	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		16804	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													39.0	48.0	45.0					10																	50025362		692	1591	2283	-	-	-	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.5413G>A	10.37:g.50025362G>A	ENSP00000320563:p.Val1805Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V1805I	ENST00000325239.5	37	c.5413	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.608|5.608	0.296998|0.296998	0.10622|0.10622	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000312002;ENST00000374161|ENST00000426033;ENST00000325239	.|T	.|0.55760	.|0.5	5.45|5.45	3.35|3.35	0.38373|0.38373	.|.	.|0.263447	.|0.20804	.|N	.|0.085380	T|T	0.39358|0.39358	0.1075|0.1075	L|L	0.48642|0.48642	1.525|1.525	0.38282|0.38282	D|D	0.942459|0.942459	.|B;B	.|0.21905	.|0.062;0.002	.|B;B	.|0.15052	.|0.012;0.001	T|T	0.29181|0.29181	-1.0020|-1.0020	5|9	.|.	.|.	.|.	.|.	5.7946|5.7946	0.18379|0.18379	0.1447:0.2063:0.649:0.0|0.1447:0.2063:0.649:0.0	.|.	.|333;1805	.|F2Z372;Q6ZS81	.|.;WDFY4_HUMAN	H|I	895;351|1805	.|ENSP00000320563:V1805I	.|.	R|V	+|+	2|1	0|0	WDFY4|WDFY4	49695368|49695368	0.958000|0.958000	0.32768|0.32768	0.584000|0.584000	0.28653|0.28653	0.052000|0.052000	0.14988|0.14988	1.615000|1.615000	0.36922|0.36922	1.307000|1.307000	0.44944|0.44944	-0.150000|-0.150000	0.13652|0.13652	CGT|GTC	WDFY4	-	NULL	ENSG00000128815		0.657	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		12	0.00	0	G	XM_033379		50025362	50025362	+1	no_errors	ENST00000325239	ensembl	human	known	69_37n	missense	22	38.89	14	SNP	0.138	A
ZCWPW2	152098	genome.wustl.edu	37	3	28557108	28557108	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr3:28557108C>A	ENST00000383768.2	+	8	968	c.780C>A	c.(778-780)aaC>aaA	p.N260K	ZCWPW2_ENST00000421010.1_Missense_Mutation_p.N260K			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	260							zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						CAAAGGAGAACAGGGGTATGT	0.313																																						dbGAP											0													48.0	49.0	48.0					3																	28557108		2203	4296	6499	-	-	-	SO:0001583	missense	0			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.780C>A	3.37:g.28557108C>A	ENSP00000373278:p.Asn260Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_CW,pfam_PWWP,pfscan_PWWP,pfscan_Znf_CW	p.N260K	ENST00000383768.2	37	c.780	CCDS33723.1	3	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	14.29|14.29|14.29	2.489813|2.489813|2.489813	0.44249|0.44249|0.44249	.|.|.	.|.|.	ENSG00000206559|ENSG00000206559|ENSG00000206559	ENST00000383768;ENST00000421010|ENST00000419130|ENST00000457897	T;T|.|.	0.40756|.|.	1.02;1.02|.|.	5.61|5.61|5.61	0.737|0.737|0.737	0.18314|0.18314|0.18314	.|.|.	0.325343|.|.	0.26503|.|.	N|.|.	0.024018|.|.	T|T|T	0.33000|0.33000|0.33000	0.0848|0.0848|0.0848	L|L|L	0.34521|0.34521|0.34521	1.04|1.04|1.04	0.27266|0.27266|0.27266	N|N|N	0.95851|0.95851|0.95851	D|.|.	0.58620|.|.	0.983|.|.	P|.|.	0.47102|.|.	0.537|.|.	T|T|T	0.28235|0.28235|0.28235	-1.0050|-1.0050|-1.0050	10|5|5	0.72032|.|.	D|.|.	0.01|.|.	-13.1397|-13.1397|-13.1397	8.4228|8.4228|8.4228	0.32712|0.32712|0.32712	0.0:0.5914:0.0:0.4086|0.0:0.5914:0.0:0.4086|0.0:0.5914:0.0:0.4086	.|.|.	260|.|.	Q504Y3|.|.	ZCPW2_HUMAN|.|.	K|K|K	260|145|83	ENSP00000373278:N260K;ENSP00000412386:N260K|.|.	ENSP00000373278:N260K|.|.	N|Q|T	+|+|+	3|1|2	2|0|0	ZCWPW2|ZCWPW2|ZCWPW2	28532112|28532112|28532112	0.363000|0.363000|0.363000	0.24989|0.24989|0.24989	0.991000|0.991000|0.991000	0.47740|0.47740|0.47740	0.451000|0.451000|0.451000	0.32288|0.32288|0.32288	-0.707000|-0.707000|-0.707000	0.05041|0.05041|0.05041	0.072000|0.072000|0.072000	0.16694|0.16694|0.16694	-0.145000|-0.145000|-0.145000	0.13849|0.13849|0.13849	AAC|CAG|ACA	ZCWPW2	-	NULL	ENSG00000206559		0.313	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCWPW2	HGNC	protein_coding	OTTHUMT00000341318.1	41	0.00	0	C	XM_087384		28557108	28557108	+1	no_errors	ENST00000383768	ensembl	human	known	69_37n	missense	13	70.45	31	SNP	0.990	A
ZFHX4	79776	genome.wustl.edu	37	8	77764960	77764960	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr8:77764960G>A	ENST00000521891.2	+	10	6251	c.5803G>A	c.(5803-5805)Ggc>Agc	p.G1935S	ZFHX4_ENST00000050961.6_Missense_Mutation_p.G1890S|ZFHX4_ENST00000455469.2_Missense_Mutation_p.G1890S|ZFHX4_ENST00000518282.1_Missense_Mutation_p.G1909S	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1890					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ACAGAAGAAGGGCAAAAGTGG	0.398										HNSCC(33;0.089)																												dbGAP											0													58.0	54.0	55.0					8																	77764960		1950	4160	6110	-	-	-	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.5803G>A	8.37:g.77764960G>A	ENSP00000430497:p.Gly1935Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.G1935S	ENST00000521891.2	37	c.5803	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	g	11.51	1.661112	0.29515	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.48836	0.8;0.85;0.82;0.82	4.2	0.591	0.17465	.	0.563877	0.14755	N	0.300379	T	0.27866	0.0686	L	0.36672	1.1	0.21719	N	0.999579	B;B;B	0.09022	0.001;0.0;0.002	B;B;B	0.08055	0.001;0.003;0.003	T	0.25117	-1.0141	10	0.07175	T	0.84	.	4.7542	0.13075	0.4356:0.1561:0.4083:0.0	.	1890;1890;1935	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	S	1935;1935;1890;1890;1909	ENSP00000430497:G1935S;ENSP00000399605:G1890S;ENSP00000050961:G1890S;ENSP00000430848:G1909S	ENSP00000050961:G1890S	G	+	1	0	ZFHX4	77927515	0.999000	0.42202	0.778000	0.31720	0.973000	0.67179	0.830000	0.27462	0.148000	0.19059	-0.265000	0.10407	GGC	ZFHX4	-	NULL	ENSG00000091656		0.398	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	17	0.00	0	G	NM_024721		77764960	77764960	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	missense	15	48.28	14	SNP	0.994	A
ZNF407	55628	genome.wustl.edu	37	18	72775227	72775227	+	Silent	SNP	C	C	G			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr18:72775227C>G	ENST00000299687.5	+	8	5550	c.5550C>G	c.(5548-5550)ctC>ctG	p.L1850L		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1850					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		AGAAGCCCCTCAGAAGCAGCA	0.652																																						dbGAP											0													63.0	78.0	73.0					18																	72775227		2071	4208	6279	-	-	-	SO:0001819	synonymous_variant	0			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.5550C>G	18.37:g.72775227C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.L1850	ENST00000299687.5	37	c.5550	CCDS45885.1	18																																																																																			ZNF407	-	NULL	ENSG00000215421		0.652	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1	16	0.00	0	C	NM_017757		72775227	72775227	+1	no_errors	ENST00000299687	ensembl	human	known	69_37n	silent	6	82.86	29	SNP	0.000	G
ZNF733P	643955	genome.wustl.edu	37	7	62752982	62752982	+	RNA	SNP	T	T	A			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr7:62752982T>A	ENST00000331425.6	-	0	453					NR_003952.1				zinc finger protein 733, pseudogene																		CTTTGACATATTTATGAGTCT	0.308																																						dbGAP											0																																										-	-	-			0					7q11.21	2012-04-20	2012-04-20	2012-04-20	ENSG00000185037	ENSG00000185037			32473	pseudogene	pseudogene			"""zinc finger protein 733"""	ZNF733			Standard	NR_003952		Approved		uc011kdj.2		OTTHUMG00000156270		7.37:g.62752982T>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000331425.6	37	NULL		7																																																																																			ZNF733P	-	-	ENSG00000185037		0.308	ZNF733P-002	KNOWN	basic	processed_transcript	ZNF733P	HGNC	pseudogene	OTTHUMT00000343679.1	12	0.00	0	T			62752982	62752982	-1	no_errors	ENST00000331425	ensembl	human	known	69_37n	rna	5	50.00	5	SNP	0.365	A
ZNF80	7634	genome.wustl.edu	37	3	113955515	113955515	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27F-01A-11D-A16D-09	TCGA-D8-A27F-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fc6d77a9-121b-48ab-a899-713c3d1319a2	a070d518-b1fe-4505-86b5-fc08201a4b61	g.chr3:113955515C>T	ENST00000482457.2	-	1	910	c.407G>A	c.(406-408)aGc>aAc	p.S136N	RP11-553L6.2_ENST00000493033.1_RNA|RP11-553L6.2_ENST00000481773.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	136					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				TCCACACTCGCTGCACTCATA	0.527																																					GBM(23;986 1114 21716)	dbGAP											0													72.0	71.0	71.0					3																	113955515		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.407G>A	3.37:g.113955515C>T	ENSP00000417192:p.Ser136Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NSW4|Q6NT14	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S136N	ENST00000482457.2	37	c.407	CCDS2979.1	3	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.642827	0.00792	.	.	ENSG00000174255	ENST00000482457	T	0.07567	3.18	3.23	-1.12	0.09808	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04770	0.0129	L	0.35288	1.05	0.09310	N	1	B	0.16166	0.016	B	0.14023	0.01	T	0.46596	-0.9180	9	0.02654	T	1	.	6.4174	0.21723	0.0:0.2579:0.5318:0.2103	.	136	P51504	ZNF80_HUMAN	N	136	ENSP00000417192:S136N	ENSP00000309812:S136N	S	-	2	0	ZNF80	115438205	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.761000	0.00786	-0.255000	0.09486	-0.878000	0.02970	AGC	ZNF80	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000174255		0.527	ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF80	HGNC	protein_coding	OTTHUMT00000354696.2	37	0.00	0	C	NM_007136		113955515	113955515	-1	no_errors	ENST00000308095	ensembl	human	known	69_37n	missense	43	44.16	34	SNP	0.000	T
