#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACE	1636	genome.wustl.edu	37	17	61568690	61568690	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr17:61568690G>C	ENST00000290866.4	+	19	2884	c.2860G>C	c.(2860-2862)Gag>Cag	p.E954Q	ACE_ENST00000421982.2_Missense_Mutation_p.E200Q|ACE_ENST00000490216.2_Missense_Mutation_p.E380Q|ACE_ENST00000428043.1_Missense_Mutation_p.E954Q|ACE_ENST00000290863.6_Missense_Mutation_p.E380Q|ACE_ENST00000413513.3_Missense_Mutation_p.E380Q|ACE_ENST00000577647.1_Missense_Mutation_p.E380Q	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	954	Peptidase M2 2.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	CGACGGGCGGGAGGTGGTCTG	0.612																																						dbGAP											0													71.0	70.0	70.0					17																	61568690		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.2860G>C	17.37:g.61568690G>C	ENSP00000290866:p.Glu954Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	pfam_Peptidase_M2,prints_Peptidase_M2	p.E954Q	ENST00000290866.4	37	c.2860	CCDS11637.1	17	.	.	.	.	.	.	.	.	.	.	G	11.49	1.654098	0.29425	.	.	ENSG00000159640	ENST00000290866;ENST00000428043;ENST00000290863;ENST00000413513;ENST00000421982	T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32	5.39	5.39	0.77823	.	0.159198	0.56097	D	0.000029	T	0.50343	0.1610	M	0.64260	1.97	0.51012	D	0.999904	B;P;B;P	0.40553	0.201;0.621;0.319;0.721	B;P;B;B	0.48089	0.288;0.566;0.037;0.132	T	0.51919	-0.8644	10	0.66056	D	0.02	-25.0563	19.1504	0.93485	0.0:0.0:1.0:0.0	.	200;380;380;954	F6X3S4;B4DXI3;P12821-3;P12821	.;.;.;ACE_HUMAN	Q	954;954;380;380;200	ENSP00000290866:E954Q;ENSP00000397593:E954Q;ENSP00000290863:E380Q;ENSP00000392247:E380Q;ENSP00000387760:E200Q	ENSP00000290863:E380Q	E	+	1	0	ACE	58922422	1.000000	0.71417	1.000000	0.80357	0.525000	0.34531	3.656000	0.54467	2.498000	0.84270	0.561000	0.74099	GAG	ACE	-	pfam_Peptidase_M2,prints_Peptidase_M2	ENSG00000159640		0.612	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACE	HGNC	protein_coding	OTTHUMT00000337675.2	42	0.00	0	G			61568690	61568690	+1	no_errors	ENST00000290866	ensembl	human	known	69_37n	missense	34	33.33	17	SNP	1.000	C
ACTL6B	51412	genome.wustl.edu	37	7	100244378	100244378	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr7:100244378C>A	ENST00000160382.5	-	11	1119	c.1013G>T	c.(1012-1014)cGc>cTc	p.R338L		NM_016188.4	NP_057272.1	O94805	ACL6B_HUMAN	actin-like 6B	338					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|nervous system development (GO:0007399)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	structural constituent of cytoskeleton (GO:0005200)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CCTCACCGGGCGAATATCAAT	0.662																																						dbGAP											0													44.0	43.0	43.0					7																	100244378		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015906	CCDS5702.1	7q22	2008-02-01	2004-07-12	2004-07-14	ENSG00000077080	ENSG00000077080			160	protein-coding gene	gene with protein product		612458	"""actin-like 6"""	ACTL6		9799793	Standard	NM_016188		Approved	BAF53B	uc003uvy.3	O94805	OTTHUMG00000159661	ENST00000160382.5:c.1013G>T	7.37:g.100244378C>A	ENSP00000160382:p.Arg338Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2D0|O75421	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.R338L	ENST00000160382.5	37	c.1013	CCDS5702.1	7	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024252	0.75390	.	.	ENSG00000077080	ENST00000160382	D	0.95885	-3.84	5.56	5.56	0.83823	.	0.076105	0.48767	D	0.000171	D	0.97031	0.9030	H	0.95884	3.735	0.80722	D	1	B	0.29646	0.253	B	0.32393	0.145	D	0.96718	0.9530	10	0.87932	D	0	.	17.0184	0.86427	0.0:1.0:0.0:0.0	.	338	O94805	ACL6B_HUMAN	L	338	ENSP00000160382:R338L	ENSP00000160382:R338L	R	-	2	0	ACTL6B	100082314	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.484000	0.66844	2.608000	0.88229	0.655000	0.94253	CGC	ACTL6B	-	pfam_Actin-like,smart_Actin-like	ENSG00000077080		0.662	ACTL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL6B	HGNC	protein_coding	OTTHUMT00000356745.1	9	0.00	0	C	NM_016188		100244378	100244378	-1	no_errors	ENST00000160382	ensembl	human	known	69_37n	missense	6	53.85	7	SNP	1.000	A
AEBP2	121536	genome.wustl.edu	37	12	19653099	19653099	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr12:19653099C>G	ENST00000398864.3	+	5	1269	c.1243C>G	c.(1243-1245)Ctc>Gtc	p.L415V	AEBP2_ENST00000541908.1_Missense_Mutation_p.L186V|AEBP2_ENST00000266508.9_Missense_Mutation_p.L415V|AEBP2_ENST00000360995.4_Missense_Mutation_p.L199V	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2	415	Interaction with SUZ12.				chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					ATGCTTTAACCTCTCAGCTCA	0.328																																						dbGAP											0													69.0	67.0	68.0					12																	19653099		1874	4099	5973	-	-	-	SO:0001583	missense	0				CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.1243C>G	12.37:g.19653099C>G	ENSP00000381840:p.Leu415Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59FS5|Q6ZN62|Q96BG3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L415V	ENST00000398864.3	37	c.1243	CCDS44841.1	12	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442035	0.83993	.	.	ENSG00000139154	ENST00000541908;ENST00000398864;ENST00000435841;ENST00000266508;ENST00000360995;ENST00000512223;ENST00000398731	T;T;T;T	0.70631	-0.42;-0.33;-0.5;-0.33	4.94	4.94	0.65067	.	.	.	.	.	T	0.81475	0.4830	L	0.57536	1.79	0.58432	D	0.999998	D	0.69078	0.997	D	0.72625	0.978	T	0.80487	-0.1361	9	0.37606	T	0.19	-4.3061	18.1518	0.89676	0.0:1.0:0.0:0.0	.	415	Q6ZN18	AEBP2_HUMAN	V	186;415;349;415;199;25;13	ENSP00000437983:L186V;ENSP00000381840:L415V;ENSP00000266508:L415V;ENSP00000354267:L199V	ENSP00000266508:L415V	L	+	1	0	AEBP2	19544366	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.436000	0.66538	2.282000	0.76494	0.561000	0.74099	CTC	AEBP2	-	NULL	ENSG00000139154		0.328	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AEBP2	HGNC	protein_coding	OTTHUMT00000401575.1	126	0.00	0	C	NM_153207		19653099	19653099	+1	no_errors	ENST00000398864	ensembl	human	known	69_37n	missense	88	31.25	40	SNP	1.000	G
ALOX15B	247	genome.wustl.edu	37	17	7945743	7945743	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr17:7945743A>T	ENST00000380183.4	+	4	645	c.506A>T	c.(505-507)gAc>gTc	p.D169V	ALOX15B_ENST00000572022.1_Missense_Mutation_p.D169V|ALOX15B_ENST00000573359.1_Missense_Mutation_p.D169V|ALOX15B_ENST00000380173.2_Missense_Mutation_p.D169V	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	169	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						ACAGTGGAAGACTTGGAGCTC	0.552																																						dbGAP											0													109.0	95.0	100.0					17																	7945743		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.506A>T	17.37:g.7945743A>T	ENSP00000369530:p.Asp169Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	pfam_LipOase_C,pfam_LipOase_LH2,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2,prints_LipOase_mml,prints_LipOase_C	p.D169V	ENST00000380183.4	37	c.506	CCDS11128.1	17	.	.	.	.	.	.	.	.	.	.	A	12.62	1.993508	0.35131	.	.	ENSG00000179593	ENST00000380173;ENST00000339694;ENST00000380183	D;D	0.90732	-2.72;-2.72	4.39	3.21	0.36854	Lipoxygenase, C-terminal (2);	0.168052	0.50627	D	0.000119	D	0.91061	0.7187	M	0.79926	2.475	0.80722	D	1	B;P;B;B	0.39717	0.263;0.684;0.382;0.263	B;P;B;B	0.45449	0.197;0.481;0.36;0.197	D	0.91169	0.4967	10	0.87932	D	0	-20.8545	7.8764	0.29597	0.8158:0.0:0.0:0.1842	.	169;169;169;169	B4DNW8;O15296-2;O15296-4;O15296	.;.;.;LX15B_HUMAN	V	169	ENSP00000369520:D169V;ENSP00000369530:D169V	ENSP00000344337:D169V	D	+	2	0	ALOX15B	7886468	0.000000	0.05858	0.984000	0.44739	0.338000	0.28826	0.429000	0.21412	1.735000	0.51646	0.459000	0.35465	GAC	ALOX15B	-	superfamily_LipOase_C	ENSG00000179593		0.552	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX15B	HGNC	protein_coding	OTTHUMT00000226985.2	36	0.00	0	A			7945743	7945743	+1	no_errors	ENST00000380183	ensembl	human	known	69_37n	missense	5	78.26	18	SNP	0.959	T
AMPH	273	genome.wustl.edu	37	7	38424487	38424487	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr7:38424487G>A	ENST00000356264.2	-	21	2235	c.2020C>T	c.(2020-2022)Ctt>Ttt	p.L674F	AMPH_ENST00000325590.5_Missense_Mutation_p.L632F|AMPH_ENST00000428293.2_Missense_Mutation_p.L632F	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	674	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						CTGTACTGAAGCCAGTCTGAT	0.493																																						dbGAP											0													118.0	111.0	113.0					7																	38424487		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.2020C>T	7.37:g.38424487G>A	ENSP00000348602:p.Leu674Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,prints_Amphiphysin,prints_Amphiphysin_1,prints_SH3_domain	p.L674F	ENST00000356264.2	37	c.2020	CCDS5456.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.01|18.01	3.528472|3.528472	0.64860|0.64860	.|.	.|.	ENSG00000078053|ENSG00000078053	ENST00000441628|ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242	.|T;T;T	.|0.61980	.|0.1;0.12;0.06	5.56|5.56	4.63|4.63	0.57726|0.57726	.|Src homology-3 domain (3);Variant SH3 (1);	.|0.074301	.|0.52532	.|D	.|0.000061	T|T	0.76090|0.76090	0.3939|0.3939	M|M	0.68952|0.68952	2.095|2.095	0.49798|0.49798	D|D	0.999823|0.999823	.|D;D;D	.|0.89917	.|0.993;0.998;1.0	.|P;D;D	.|0.79784	.|0.901;0.971;0.993	T|T	0.74253|0.74253	-0.3725|-0.3725	5|10	.|0.38643	.|T	.|0.18	-21.6398|-21.6398	15.5751|15.5751	0.76373|0.76373	0.0:0.0:0.8616:0.1383|0.0:0.0:0.8616:0.1383	.|.	.|632;674;562	.|P49418-2;P49418;Q8NFL4	.|.;AMPH_HUMAN;.	V|F	556|632;674;632;576	.|ENSP00000317441:L632F;ENSP00000348602:L674F;ENSP00000390734:L632F	.|ENSP00000317441:L632F	A|L	-|-	2|1	0|0	AMPH|AMPH	38391012|38391012	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	3.036000|3.036000	0.49767|0.49767	2.793000|2.793000	0.96121|0.96121	0.650000|0.650000	0.86243|0.86243	GCT|CTT	AMPH	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_Amphiphysin_1	ENSG00000078053		0.493	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPH	HGNC	protein_coding	OTTHUMT00000226953.2	85	0.00	0	G	NM_001635		38424487	38424487	-1	no_errors	ENST00000356264	ensembl	human	known	69_37n	missense	49	37.97	30	SNP	1.000	A
ANO9	338440	genome.wustl.edu	37	11	418935	418935	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr11:418935G>T	ENST00000332826.6	-	21	2073	c.1989C>A	c.(1987-1989)ttC>ttA	p.F663L	SIGIRR_ENST00000382520.2_5'Flank|SIGIRR_ENST00000332725.3_5'Flank|SIGIRR_ENST00000397632.3_5'Flank	NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	663					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						CAGGGTCCTGGAAGTCCTTGG	0.607																																						dbGAP											0													199.0	183.0	188.0					11																	418935		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.1989C>A	11.37:g.418935G>T	ENSP00000332788:p.Phe663Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUC4|B4E134|Q8TEN4	Missense_Mutation	SNP	pfam_Anoctamin	p.F663L	ENST00000332826.6	37	c.1989	CCDS31326.1	11	.	.	.	.	.	.	.	.	.	.	g	9.948	1.219280	0.22373	.	.	ENSG00000185101	ENST00000332826	T	0.67698	-0.28	4.23	3.31	0.37934	.	0.508110	0.18022	N	0.154182	T	0.53498	0.1800	L	0.35414	1.06	0.29304	N	0.868499	B;B	0.19200	0.012;0.034	B;B	0.24848	0.013;0.056	T	0.47959	-0.9076	10	0.27785	T	0.31	.	9.7303	0.40357	0.171:0.0:0.829:0.0	.	364;663	A1A5B4-2;A1A5B4	.;ANO9_HUMAN	L	663	ENSP00000332788:F663L	ENSP00000332788:F663L	F	-	3	2	ANO9	408935	0.000000	0.05858	0.918000	0.36340	0.224000	0.24922	0.099000	0.15210	0.920000	0.36970	0.478000	0.44815	TTC	ANO9	-	pfam_Anoctamin	ENSG00000185101		0.607	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO9	HGNC	protein_coding	OTTHUMT00000384116.1	52	0.00	0	G	NM_001012302		418935	418935	-1	no_errors	ENST00000332826	ensembl	human	known	69_37n	missense	14	46.15	12	SNP	0.962	T
APBA1	320	genome.wustl.edu	37	9	72131068	72131068	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr9:72131068G>C	ENST00000265381.4	-	2	1281	c.1059C>G	c.(1057-1059)atC>atG	p.I353M		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	353					axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						TGGCCTCCTTGATGTCCTTGA	0.672																																						dbGAP											0													114.0	86.0	95.0					9																	72131068		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.1059C>G	9.37:g.72131068G>C	ENSP00000265381:p.Ile353Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O14914|O60570|Q5VYR8	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_PDZ,superfamily_PDZ,smart_PTyr_interaction_dom,smart_PDZ,pfscan_PDZ,pfscan_PTyr_interaction_dom	p.I353M	ENST00000265381.4	37	c.1059	CCDS6630.1	9	.	.	.	.	.	.	.	.	.	.	G	16.83	3.231994	0.58777	.	.	ENSG00000107282	ENST00000265381	T	0.09911	2.93	5.86	3.8	0.43715	.	0.000000	0.85682	D	0.000000	T	0.16685	0.0401	L	0.34521	1.04	0.53688	D	0.999976	D	0.76494	0.999	D	0.80764	0.994	T	0.05146	-1.0903	10	0.41790	T	0.15	-14.2061	4.3004	0.10922	0.4416:0.0:0.5583:0.0	.	353	Q02410	APBA1_HUMAN	M	353	ENSP00000265381:I353M	ENSP00000265381:I353M	I	-	3	3	APBA1	71320888	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.423000	0.59861	1.486000	0.48398	0.655000	0.94253	ATC	APBA1	-	NULL	ENSG00000107282		0.672	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA1	HGNC	protein_coding	OTTHUMT00000052589.2	18	0.00	0	G	NM_001163		72131068	72131068	-1	no_errors	ENST00000265381	ensembl	human	known	69_37n	missense	9	30.77	4	SNP	1.000	C
ASXL3	80816	genome.wustl.edu	37	18	31318818	31318818	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr18:31318818A>C	ENST00000269197.5	+	11	1450	c.1450A>C	c.(1450-1452)Acc>Ccc	p.T484P		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	484					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TGAAAGTCTAACCAATTCTCA	0.383																																						dbGAP											0													42.0	43.0	43.0					18																	31318818		1854	4088	5942	-	-	-	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1450A>C	18.37:g.31318818A>C	ENSP00000269197:p.Thr484Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.T484P	ENST00000269197.5	37	c.1450	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	A	0.029	-1.345889	0.01266	.	.	ENSG00000141431	ENST00000269197	T	0.14391	2.51	4.78	-2.09	0.07232	.	3.099970	0.01095	N	0.005272	T	0.09686	0.0238	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35226	-0.9797	10	0.28530	T	0.3	.	12.8193	0.57683	0.4566:0.0:0.5434:0.0	.	484	Q9C0F0	ASXL3_HUMAN	P	484	ENSP00000269197:T484P	ENSP00000269197:T484P	T	+	1	0	ASXL3	29572816	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	-0.934000	0.03955	-0.376000	0.07943	0.383000	0.25322	ACC	ASXL3	-	NULL	ENSG00000141431		0.383	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	33	0.00	0	A			31318818	31318818	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	0.000	C
ATP13A5	344905	genome.wustl.edu	37	3	193016987	193016987	+	Silent	SNP	T	T	C	rs192788957	byFrequency	TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr3:193016987T>C	ENST00000342358.4	-	25	2898	c.2781A>G	c.(2779-2781)ctA>ctG	p.L927L	ATP13A5_ENST00000495496.1_5'UTR	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	927						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		CAAAGAGTTGTAGTTGCTGAA	0.343													T|||	3	0.000599042	0.0023	0.0	5008	,	,		18312	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													61.0	59.0	59.0					3																	193016987		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.2781A>G	3.37:g.193016987T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWS4|Q6ZWL0	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.L927	ENST00000342358.4	37	c.2781	CCDS33914.1	3																																																																																			ATP13A5	-	tigrfam_ATPase_P-typ_unknown-pump-sp	ENSG00000187527		0.343	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	HGNC	protein_coding	OTTHUMT00000343012.1	63	0.00	0	T	NM_198505		193016987	193016987	-1	no_errors	ENST00000342358	ensembl	human	known	69_37n	silent	9	60.87	14	SNP	0.942	C
ATP1A4	480	genome.wustl.edu	37	1	160129216	160129216	+	Missense_Mutation	SNP	G	G	C	rs201039507		TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:160129216G>C	ENST00000368081.4	+	6	1149	c.678G>C	c.(676-678)ttG>ttC	p.L226F		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	226					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACTCATCCTTGACTGGGGAGT	0.498																																						dbGAP											0													86.0	88.0	87.0					1																	160129216		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.678G>C	1.37:g.160129216G>C	ENSP00000357060:p.Leu226Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.L226F	ENST00000368081.4	37	c.678	CCDS1197.1	1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168316	0.78339	.	.	ENSG00000132681	ENST00000368081	D	0.94000	-3.33	5.01	5.01	0.66863	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.64402	D	0.000001	D	0.97235	0.9096	M	0.92604	3.325	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.98050	1.0387	10	0.87932	D	0	.	16.2001	0.82067	0.0:0.0:1.0:0.0	.	226	Q13733	AT1A4_HUMAN	F	226	ENSP00000357060:L226F	ENSP00000357060:L226F	L	+	3	2	ATP1A4	158395840	0.999000	0.42202	1.000000	0.80357	0.986000	0.74619	0.428000	0.21395	2.481000	0.83766	0.561000	0.74099	TTG	ATP1A4	-	pfam_ATPase_P-typ_ATPase-assoc-dom,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000132681		0.498	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	HGNC	protein_coding	OTTHUMT00000077415.1	65	0.00	0	G	NM_144699		160129216	160129216	+1	no_errors	ENST00000368081	ensembl	human	known	69_37n	missense	23	48.89	22	SNP	1.000	C
ATP2B4	493	genome.wustl.edu	37	1	203683364	203683364	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:203683364G>A	ENST00000357681.5	+	15	3488	c.2365G>A	c.(2365-2367)Gac>Aac	p.D789N	ATP2B4_ENST00000367219.3_Missense_Mutation_p.D777N|ATP2B4_ENST00000391954.2_Missense_Mutation_p.D789N|ATP2B4_ENST00000341360.2_Missense_Mutation_p.D789N|ATP2B4_ENST00000367218.3_Missense_Mutation_p.D789N	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	789					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TGGCACAAATGACGGGCCTGC	0.527																																						dbGAP											0													206.0	169.0	182.0					1																	203683364		2203	4300	6503	-	-	-	SO:0001583	missense	0			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.2365G>A	1.37:g.203683364G>A	ENSP00000350310:p.Asp789Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.D789N	ENST00000357681.5	37	c.2365	CCDS1440.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.538070	0.96460	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	D;D;D;D;D	0.99891	-7.56;-7.56;-7.56;-7.56;-7.56	5.7	5.7	0.88788	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.56097	D	0.000023	D	0.99941	0.9974	H	0.99555	4.625	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.998;0.997;0.995	D	0.96042	0.9025	10	0.87932	D	0	-29.5827	19.4362	0.94796	0.0:0.0:1.0:0.0	.	789;789;789	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	N	789;789;777;789;789	ENSP00000350310:D789N;ENSP00000356187:D789N;ENSP00000356188:D777N;ENSP00000375816:D789N;ENSP00000340930:D789N	ENSP00000340930:D789N	D	+	1	0	ATP2B4	201949987	1.000000	0.71417	0.422000	0.26621	0.931000	0.56810	9.869000	0.99810	2.683000	0.91414	0.655000	0.94253	GAC	ATP2B4	-	pfam_Dehalogen-like_hydro,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000058668		0.527	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	HGNC	protein_coding	OTTHUMT00000087462.1	119	0.00	0	G	NM_001001396		203683364	203683364	+1	no_errors	ENST00000357681	ensembl	human	known	69_37n	missense	71	21.11	19	SNP	1.000	A
BAZ2A	11176	genome.wustl.edu	37	12	56995411	56995412	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G|C	G|C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr12:56995411_56995412GC>AA	ENST00000551812.1	-	20	4188_4189	c.3995_3996GC>TT	c.(3994-3996)tGC>tTT	p.C1332F	BAZ2A_ENST00000553222.1_5'Flank|BAZ2A_ENST00000549884.1_Missense_Mutation_p.C1330F|BAZ2A_ENST00000179765.5_Missense_Mutation_p.C1300F|BAZ2A_ENST00000379441.3_Missense_Mutation_p.C1302F	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1332	Pro-rich.				chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GGGCAGCATTGCAGGGCATCTG	0.589																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.3995_3996delinsAA	12.37:g.56995411_56995412delinsAA	ENSP00000446880:p.Cys1332Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN66|O00536|O15030|Q68DI8|Q96H26	Nonsense_Mutation|Missense_Mutation	SNP	NULL|pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_integrase-typ,superfamily_Znf_FYVE_PHD,smart_Methyl_CpG_DNA-bd,smart_AT_hook_DNA-bd_motif,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.Q1*|p.C1332F	ENST00000551812.1	37	c.1|c.3995	CCDS44924.1	12																																																																																			BAZ2A	-	NULL	ENSG00000076108		0.589	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAZ2A	HGNC	protein_coding	OTTHUMT00000408561.1	39|38	0.00	0	G|C	NM_013449		56995411|56995412	56995411|56995412	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region|no_errors	ENST00000547453|ENST00000551812	ensembl	human	putative|known	69_37n	nonsense|missense	15	44.44	12	SNP	0.990|1.000	A
C16orf78	123970	genome.wustl.edu	37	16	49412426	49412426	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr16:49412426C>G	ENST00000299191.3	+	3	433	c.316C>G	c.(316-318)Ctc>Gtc	p.L106V		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	106						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						CTACCGAAGCCTCTATGGAGT	0.567																																						dbGAP											0													48.0	44.0	45.0					16																	49412426		2199	4300	6499	-	-	-	SO:0001583	missense	0			BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.316C>G	16.37:g.49412426C>G	ENSP00000299191:p.Leu106Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.L106V	ENST00000299191.3	37	c.316	CCDS10738.1	16	.	.	.	.	.	.	.	.	.	.	C	9.465	1.094171	0.20471	.	.	ENSG00000166152	ENST00000299191	T	0.44881	0.91	3.04	-2.82	0.05787	.	2.733350	0.01663	N	0.025208	T	0.37156	0.0993	L	0.27053	0.805	0.09310	N	1	D	0.54207	0.965	P	0.50270	0.636	T	0.30179	-0.9987	9	.	.	.	-3.9414	5.7816	0.18310	0.4124:0.28:0.3075:0.0	.	106	Q8WTQ4	CP078_HUMAN	V	106	ENSP00000299191:L106V	.	L	+	1	0	C16orf78	47969927	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.347000	0.07750	-0.551000	0.06175	-0.502000	0.04539	CTC	C16orf78	-	NULL	ENSG00000166152		0.567	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf78	HGNC	protein_coding	OTTHUMT00000256846.1	37	0.00	0	C	NM_144602		49412426	49412426	+1	no_errors	ENST00000299191	ensembl	human	known	69_37n	missense	10	54.55	12	SNP	0.000	G
C4orf29	80167	genome.wustl.edu	37	4	128938562	128938562	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr4:128938562G>C	ENST00000444616.1	+	8	762	c.515G>C	c.(514-516)gGa>gCa	p.G172A	C4orf29_ENST00000398965.1_Missense_Mutation_p.G172A|C4orf29_ENST00000388795.5_Missense_Mutation_p.G90A			Q0P651	CD029_HUMAN	chromosome 4 open reading frame 29	172						extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						GTGATGGGAGGAGCTCTTGTT	0.408																																						dbGAP											0													76.0	68.0	70.0					4																	128938562		1819	4089	5908	-	-	-	SO:0001583	missense	0			AK024759	CCDS47131.1	4q28.2	2008-02-05			ENSG00000164074	ENSG00000164074			26111	protein-coding gene	gene with protein product						12477932	Standard	XM_006714318		Approved	FLJ21106	uc021xrt.1	Q0P651	OTTHUMG00000133304	ENST00000444616.1:c.515G>C	4.37:g.128938562G>C	ENSP00000397229:p.Gly172Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4W8|A1A4W9|Q9H7A7	Missense_Mutation	SNP	pfam_DUF2048	p.G172A	ENST00000444616.1	37	c.515		4	.	.	.	.	.	.	.	.	.	.	G	29.9	5.044909	0.93685	.	.	ENSG00000164074	ENST00000454347;ENST00000398965;ENST00000444616;ENST00000388795;ENST00000545758;ENST00000437077	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.61123	0.2322	L	0.38175	1.15	0.80722	D	1	B;P	0.37663	0.148;0.604	B;B	0.43194	0.21;0.411	T	0.52305	-0.8593	9	0.21540	T	0.41	-14.3585	20.6243	0.99512	0.0:0.0:1.0:0.0	.	90;172	B7WP89;Q0P651	.;CD029_HUMAN	A	172;172;172;90;90;45	.	ENSP00000373447:G90A	G	+	2	0	C4orf29	129158012	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	9.265000	0.95647	2.879000	0.98667	0.650000	0.86243	GGA	C4orf29	-	pfam_DUF2048	ENSG00000164074		0.408	C4orf29-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	C4orf29	HGNC	protein_coding	OTTHUMT00000257098.1	70	0.00	0	G	NM_001039717		128938562	128938562	+1	no_errors	ENST00000398965	ensembl	human	known	69_37n	missense	40	45.95	34	SNP	1.000	C
CACNA1E	777	genome.wustl.edu	37	1	181765933	181765933	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:181765933C>A	ENST00000367573.2	+	47	6338	c.6338C>A	c.(6337-6339)tCc>tAc	p.S2113Y	CACNA1E_ENST00000358338.5_Missense_Mutation_p.S2002Y|CACNA1E_ENST00000367567.4_Missense_Mutation_p.S1677Y|CACNA1E_ENST00000367570.1_Missense_Mutation_p.S2070Y|CACNA1E_ENST00000357570.5_Missense_Mutation_p.S2064Y|CACNA1E_ENST00000526775.1_Missense_Mutation_p.S2051Y|CACNA1E_ENST00000360108.3_Missense_Mutation_p.S2094Y	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2113					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GACTGGGAGTCCCCAGAGCGC	0.597																																						dbGAP											0													26.0	30.0	29.0					1																	181765933		2010	4176	6186	-	-	-	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6338C>A	1.37:g.181765933C>A	ENSP00000356545:p.Ser2113Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.S2113Y	ENST00000367573.2	37	c.6338	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463097	0.63513	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.96774	-4.05;-4.05;-4.02;-4.05;-4.12;-4.02;-4.02	5.91	5.91	0.95273	.	0.510465	0.22750	N	0.056092	D	0.92935	0.7752	L	0.29908	0.895	0.53688	D	0.999977	P;P	0.49090	0.85;0.919	B;B	0.40285	0.325;0.325	D	0.93517	0.6858	10	0.72032	D	0.01	.	14.7059	0.69189	0.145:0.855:0.0:0.0	.	2051;2070	Q15878-2;Q15878-3	.;.	Y	2070;2051;2064;2002;1677;2094;2113	ENSP00000356542:S2070Y;ENSP00000434814:S2051Y;ENSP00000350183:S2064Y;ENSP00000351101:S2002Y;ENSP00000356539:S1677Y;ENSP00000353222:S2094Y;ENSP00000356545:S2113Y	ENSP00000350183:S2064Y	S	+	2	0	CACNA1E	180032556	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.204000	0.51082	2.793000	0.96121	0.655000	0.94253	TCC	CACNA1E	-	NULL	ENSG00000198216		0.597	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	15	0.00	0	C	NM_000721		181765933	181765933	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	missense	14	41.67	10	SNP	1.000	A
CAPN14	440854	genome.wustl.edu	37	2	31412173	31412173	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:31412173C>T	ENST00000403897.3	-	13	1600	c.1459G>A	c.(1459-1461)Gtc>Atc	p.V487I	CAPN14_ENST00000444918.2_Missense_Mutation_p.V487I	NM_001145122.1	NP_001138594.1	A8MX76	CAN14_HUMAN	calpain 14	487	Domain III.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)|skin(1)|stomach(2)	7						ACCCTGAGGACGAACTCTGAC	0.542																																						dbGAP											0													111.0	100.0	103.0					2																	31412173		692	1591	2283	-	-	-	SO:0001583	missense	0			AC015980	CCDS46254.1	2p23.1-p21	2013-01-10			ENSG00000214711	ENSG00000214711		"""EF-hand domain containing"""	16664	protein-coding gene	gene with protein product		610229				11675017	Standard	NM_001145122		Approved		uc010yms.2	A8MX76	OTTHUMG00000152039	ENST00000403897.3:c.1459G>A	2.37:g.31412173C>T	ENSP00000385247:p.Val487Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRU9	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.V487I	ENST00000403897.3	37	c.1459	CCDS46254.1	2	.	.	.	.	.	.	.	.	.	.	c	0	-2.663207	0.00107	.	.	ENSG00000214711	ENST00000444918;ENST00000403897	D;D	0.86694	-2.16;-2.16	3.58	-4.61	0.03380	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.475502	0.18467	N	0.140344	T	0.60301	0.2258	N	0.04320	-0.23	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.60110	-0.7327	10	0.02654	T	1	.	6.0504	0.19783	0.0:0.3767:0.3295:0.2938	.	487;311	A8MX76;A8MX76-2	CAN14_HUMAN;.	I	487	ENSP00000398670:V487I;ENSP00000385247:V487I	ENSP00000385247:V487I	V	-	1	0	CAPN14	31265677	0.000000	0.05858	0.043000	0.18650	0.063000	0.16089	-0.825000	0.04433	-0.681000	0.05204	-1.301000	0.01330	GTC	CAPN14	-	pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Calpain_III,prints_Calpain_cysteine_protease	ENSG00000214711		0.542	CAPN14-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CAPN14	HGNC	protein_coding	OTTHUMT00000325010.1	54	0.00	0	C	NM_001145122		31412173	31412173	-1	no_errors	ENST00000444918	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	0.044	T
CAPN6	827	genome.wustl.edu	37	X	110494202	110494202	+	Silent	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chrX:110494202C>G	ENST00000324068.1	-	8	1268	c.1101G>C	c.(1099-1101)ctG>ctC	p.L367L	CAPN6_ENST00000541758.1_Silent_p.L112L	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	367	Domain III.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						AGCGGTTCATCAGGGGATCAT	0.468																																						dbGAP											0													286.0	253.0	264.0					X																	110494202		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.1101G>C	X.37:g.110494202C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUY7|Q9UEQ1|Q9UJA8	Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,pfam_C2_Ca-dep,superfamily_Calpain_domain_III,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_C2_Ca-dep,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.L367	ENST00000324068.1	37	c.1101	CCDS14555.1	X																																																																																			CAPN6	-	pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Calpain_III	ENSG00000077274		0.468	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN6	HGNC	protein_coding	OTTHUMT00000057922.1	83	0.00	0	C			110494202	110494202	-1	no_errors	ENST00000324068	ensembl	human	known	69_37n	silent	33	47.62	30	SNP	0.998	G
CCDC83	220047	genome.wustl.edu	37	11	85606377	85606377	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr11:85606377A>C	ENST00000342404.3	+	6	769	c.553A>C	c.(553-555)Atc>Ctc	p.I185L	CCDC83_ENST00000280245.4_Missense_Mutation_p.I185L|CCDC83_ENST00000376067.1_Missense_Mutation_p.I86L|CCDC83_ENST00000529676.2_3'UTR			Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	185										breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|skin(3)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				AAAGAAAATAATCAAGGAAAC	0.284																																						dbGAP											0													45.0	50.0	49.0					11																	85606377		2203	4293	6496	-	-	-	SO:0001583	missense	0			AK124113	CCDS8271.1, CCDS66196.1	11q14.1-q14.2	2014-01-21			ENSG00000150676	ENSG00000150676			28535	protein-coding gene	gene with protein product						12477932	Standard	XM_005273842		Approved	MGC34732, FLJ42119, CT148	uc001pbg.1	Q8IWF9	OTTHUMG00000166978	ENST00000342404.3:c.553A>C	11.37:g.85606377A>C	ENSP00000344512:p.Ile185Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA49|Q6X7T2|Q6ZVT5|Q8N9Y1	Missense_Mutation	SNP	NULL	p.I185L	ENST00000342404.3	37	c.553		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	3.463|3.463	-0.109466|-0.109466	0.06924|0.06924	.|.	.|.	ENSG00000150676|ENSG00000150676	ENST00000280245;ENST00000376067;ENST00000342404|ENST00000526729	T;T;T|.	0.39229|.	1.09;1.09;1.09|.	4.65|4.65	0.932|0.932	0.19466|0.19466	.|.	1.051530|.	0.07436|.	N|.	0.896433|.	T|.	0.38532|.	0.1044|.	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	1|1	B;B;B|.	0.15930|.	0.015;0.015;0.015|.	B;B;B|.	0.17979|.	0.02;0.013;0.013|.	T|.	0.32561|.	-0.9902|.	9|.	.|.	.|.	.|.	0.0184|0.0184	2.9465|2.9465	0.05847|0.05847	0.5496:0.0:0.2701:0.1803|0.5496:0.0:0.2701:0.1803	.|.	86;185;185|.	Q8IWF9-3;Q8IWF9;Q8IWF9-2|.	.;CCD83_HUMAN;.|.	L|Y	185;86;185|90	ENSP00000280245:I185L;ENSP00000365235:I86L;ENSP00000344512:I185L|.	.|.	I|X	+|+	1|3	0|2	CCDC83|CCDC83	85284025|85284025	0.849000|0.849000	0.29639|0.29639	0.602000|0.602000	0.28890|0.28890	0.054000|0.054000	0.15201|0.15201	1.436000|1.436000	0.34980|0.34980	0.212000|0.212000	0.20703|0.20703	-0.400000|-0.400000	0.06385|0.06385	ATC|TAA	CCDC83	-	NULL	ENSG00000150676		0.284	CCDC83-002	KNOWN	basic|appris_principal	protein_coding	CCDC83	HGNC	protein_coding	OTTHUMT00000392215.1	29	0.00	0	A	NM_173556		85606377	85606377	+1	no_errors	ENST00000280245	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	0.291	C
CDRT1	374286	genome.wustl.edu	37	17	15516055	15516055	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr17:15516055C>G	ENST00000395906.3	-	5	1081	c.1082G>C	c.(1081-1083)aGc>aCc	p.S361T	RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.S671T	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	361										endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		CACACGCATGCTCTTCCCGTC	0.433																																						dbGAP											0													181.0	182.0	181.0					17																	15516055		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.1082G>C	17.37:g.15516055C>G	ENSP00000379242:p.Ser361Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O43848|O95611	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S361T	ENST00000395906.3	37	c.1082	CCDS45619.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.194|8.194	0.796595|0.796595	0.16327|0.16327	.|.	.|.	ENSG00000251537|ENSG00000251537	ENST00000455584|ENST00000261644;ENST00000395906	.|T	.|0.21932	.|1.98	5.34|5.34	-4.9|-4.9	0.03094|0.03094	.|F-box domain, Skp2-like (1);	.|0.657935	.|0.12583	.|U	.|0.456264	T|T	0.05090|0.05090	0.0136|0.0136	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	1|1	.|B;B	.|0.20459	.|0.045;0.0	.|B;B	.|0.17722	.|0.019;0.0	T|T	0.38693|0.38693	-0.9649|-0.9649	5|10	.|0.08381	.|T	.|0.77	.|.	2.1447|2.1447	0.03784|0.03784	0.103:0.3214:0.1875:0.388|0.103:0.3214:0.1875:0.388	.|.	.|361;685	.|O95170;Q59EB2	.|CDRT1_HUMAN;.	P|T	686|391;361	.|ENSP00000379242:S361T	.|ENSP00000261644:S391T	A|S	-|-	1|2	0|0	RP11-385D13.1|RP11-385D13.1	15456780|15456780	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.654000|-0.654000	0.05354|0.05354	-0.348000|-0.348000	0.08286|0.08286	-0.263000|-0.263000	0.10527|0.10527	GCA|AGC	CDRT1	-	superfamily_F-box_dom_cyclin-like	ENSG00000241322		0.433	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT1	HGNC	protein_coding	OTTHUMT00000448127.1	99	0.00	0	C	NM_006382		15516055	15516055	-1	no_errors	ENST00000395906	ensembl	human	known	69_37n	missense	38	26.92	14	SNP	0.000	G
CD300LB	124599	genome.wustl.edu	37	17	72518949	72518949	+	Silent	SNP	G	G	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr17:72518949G>T	ENST00000392621.1	-	4	649	c.645C>A	c.(643-645)gtC>gtA	p.V215V		NM_174892.2	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	178					cellular response to lipopolysaccharide (GO:0071222)|innate immune response (GO:0045087)|neutrophil mediated immunity (GO:0002446)|positive regulation of mast cell activation (GO:0033005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(1)	21						GCTCCTCAGGGACCCTCTGAG	0.537																																						dbGAP											0													135.0	115.0	122.0					17																	72518949		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF427618	CCDS11700.1, CCDS11700.2	17q25.1	2013-01-11	2006-03-29		ENSG00000178789	ENSG00000178789		"""Immunoglobulin superfamily / V-set domain containing"""	30811	protein-coding gene	gene with protein product	"""triggering receptor expressed on myeloid cells 5"""	610705	"""CD300 antigen like family member B"""			12975309	Standard	NM_174892		Approved	TREM5, CLM7	uc002jkx.2	A8K4G0	OTTHUMG00000067606	ENST00000392621.1:c.645C>A	17.37:g.72518949G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q1EG73|Q8IX40|Q8N6D1	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.V215	ENST00000392621.1	37	c.645	CCDS11700.1	17																																																																																			CD300LB	-	NULL	ENSG00000178789		0.537	CD300LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD300LB	HGNC	protein_coding	OTTHUMT00000145082.2	58	0.00	0	G	NM_174892		72518949	72518949	-1	no_errors	ENST00000392621	ensembl	human	known	69_37n	silent	63	11.27	8	SNP	0.002	T
CEACAM16	388551	genome.wustl.edu	37	19	45206762	45206762	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr19:45206762G>A	ENST00000405314.2	+	2	278	c.181G>A	c.(181-183)Gtg>Atg	p.V61M	CTB-171A8.1_ENST00000590796.1_RNA|CEACAM16_ENST00000587331.1_Missense_Mutation_p.V61M			Q2WEN9	CEA16_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 16	61					sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)|stereocilium bundle tip (GO:0032426)				endometrium(3)|large_intestine(2)|lung(3)|ovary(1)	9	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				CACACTCAGCGTGTCATACCT	0.677																																						dbGAP											0													30.0	33.0	32.0					19																	45206762		2086	4206	6292	-	-	-	SO:0001583	missense	0				CCDS54278.1	19q13.31	2014-01-27			ENSG00000213892	ENSG00000213892		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31948	protein-coding gene	gene with protein product		614591				21368133	Standard	NM_001039213		Approved	DFNA4B	uc010xxd.2	Q2WEN9	OTTHUMG00000151519	ENST00000405314.2:c.181G>A	19.37:g.45206762G>A	ENSP00000385576:p.Val61Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A7LI12	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V61M	ENST00000405314.2	37	c.181	CCDS54278.1	19	.	.	.	.	.	.	.	.	.	.	G	6.808	0.518200	0.13005	.	.	ENSG00000213892	ENST00000396750;ENST00000405314	T	0.65916	-0.18	5.16	1.76	0.24704	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.867711	0.09126	U	0.845077	T	0.28928	0.0718	N	0.01048	-1.04	0.09310	N	0.999991	D	0.55800	0.973	B	0.35182	0.197	T	0.12451	-1.0547	10	0.31617	T	0.26	-6.4403	13.4292	0.61044	0.0:0.5776:0.4224:0.0	.	120	Q2WEN9	CEA16_HUMAN	M	126;61	ENSP00000385576:V61M	ENSP00000379974:V126M	V	+	1	0	CEACAM16	49898602	1.000000	0.71417	0.670000	0.29842	0.125000	0.20455	1.005000	0.29834	0.179000	0.19938	-0.302000	0.09304	GTG	CEACAM16	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000213892		0.677	CEACAM16-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	CEACAM16	HGNC	protein_coding		15	0.00	0	G	XM_371177		45206762	45206762	+1	no_errors	ENST00000405314	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	0.541	A
CLDN14	23562	genome.wustl.edu	37	21	37833619	37833619	+	Silent	SNP	G	G	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr21:37833619G>A	ENST00000399137.1	-	3	1241	c.375C>T	c.(373-375)ttC>ttT	p.F125F	AP000695.4_ENST00000454980.1_RNA|CLDN14_ENST00000399135.1_Silent_p.F125F|AP000695.6_ENST00000429588.1_RNA|AP000695.4_ENST00000428667.1_RNA|CLDN14_ENST00000399139.1_Silent_p.F125F|CLDN14_ENST00000342108.2_Silent_p.F125F|CLDN14_ENST00000399136.1_Silent_p.F125F	NM_144492.2	NP_652763.1	O95500	CLD14_HUMAN	claudin 14	125					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|protein complex assembly (GO:0006461)|tight junction assembly (GO:0070830)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|lung(5)|skin(1)	7						CGGCCAGGATGAAGAGGGTGC	0.647																																						dbGAP											0													61.0	65.0	64.0					21																	37833619		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ132445	CCDS13645.1	21q22.3	2008-07-31			ENSG00000159261	ENSG00000159261		"""Claudins"""	2035	protein-coding gene	gene with protein product		605608		DFNB29		11163249	Standard	NM_144492		Approved		uc002yvk.2	O95500	OTTHUMG00000086638	ENST00000399137.1:c.375C>T	21.37:g.37833619G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin14,prints_Claudin,prints_Claudin2	p.F125	ENST00000399137.1	37	c.375	CCDS13645.1	21																																																																																			CLDN14	-	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	ENSG00000159261		0.647	CLDN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN14	HGNC	protein_coding	OTTHUMT00000194697.1	31	0.00	0	G	NM_144492		37833619	37833619	-1	no_errors	ENST00000342108	ensembl	human	known	69_37n	silent	12	33.33	6	SNP	0.846	A
CREBBP	1387	genome.wustl.edu	37	16	3779066	3779066	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr16:3779066C>G	ENST00000262367.5	-	31	6791	c.5982G>C	c.(5980-5982)caG>caC	p.Q1994H	CREBBP_ENST00000382070.3_Missense_Mutation_p.Q1956H	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1994					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CGGGGGCCATCTGGCTCCCCG	0.692			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															dbGAP		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													15.0	15.0	15.0					16																	3779066		2183	4290	6473	-	-	-	SO:0001583	missense	0			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.5982G>C	16.37:g.3779066C>G	ENSP00000262367:p.Gln1994His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.Q1994H	ENST00000262367.5	37	c.5982	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	c	8.032	0.761975	0.15914	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.83992	-1.79;-1.72	5.11	0.607	0.17564	.	0.196908	0.36932	N	0.002336	T	0.61173	0.2326	N	0.11560	0.145	0.33286	D	0.562879	P;P	0.44090	0.826;0.826	B;B	0.41088	0.347;0.347	T	0.64028	-0.6503	10	0.14656	T	0.56	-13.6	5.9365	0.19169	0.0:0.5391:0.2447:0.2161	.	2024;1994	Q4LE28;Q92793	.;CBP_HUMAN	H	1994;2024;1956;529	ENSP00000262367:Q1994H;ENSP00000371502:Q1956H	ENSP00000262367:Q1994H	Q	-	3	2	CREBBP	3719067	0.796000	0.28864	0.991000	0.47740	0.970000	0.65996	0.242000	0.18087	0.177000	0.19895	0.655000	0.94253	CAG	CREBBP	-	NULL	ENSG00000005339		0.692	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	21	0.00	0	C	NM_004380		3779066	3779066	-1	no_errors	ENST00000262367	ensembl	human	known	69_37n	missense	9	60.87	14	SNP	1.000	G
CSE1L	1434	genome.wustl.edu	37	20	47682930	47682930	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr20:47682930G>C	ENST00000262982.2	+	5	482	c.359G>C	c.(358-360)aGa>aCa	p.R120T	CSE1L_ENST00000396192.3_Missense_Mutation_p.R120T|CSE1L_ENST00000542325.1_Intron	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	120					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			ATTATTGGCAGAGAAGATTTT	0.413																																						dbGAP											0													133.0	129.0	130.0					20																	47682930		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.359G>C	20.37:g.47682930G>C	ENSP00000262982:p.Arg120Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Missense_Mutation	SNP	pfam_CAS_CSE1_C,pfam_Exportin/Importin_Cse1-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.R120T	ENST00000262982.2	37	c.359	CCDS13412.1	20	.	.	.	.	.	.	.	.	.	.	G	19.84	3.901516	0.72754	.	.	ENSG00000124207	ENST00000262982;ENST00000396192	T;T	0.68765	-0.35;-0.35	5.57	5.57	0.84162	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67906	0.2943	L	0.58810	1.83	0.80722	D	1	B;P	0.47302	0.409;0.893	B;B	0.43536	0.103;0.423	T	0.67432	-0.5672	10	0.34782	T	0.22	-14.4409	19.5362	0.95254	0.0:0.0:1.0:0.0	.	120;120	F8W904;P55060	.;XPO2_HUMAN	T	120	ENSP00000262982:R120T;ENSP00000379495:R120T	ENSP00000262982:R120T	R	+	2	0	CSE1L	47116337	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.607000	0.88179	0.557000	0.71058	AGA	CSE1L	-	superfamily_ARM-type_fold	ENSG00000124207		0.413	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSE1L	HGNC	protein_coding	OTTHUMT00000080345.2	90	0.00	0	G	NM_001316		47682930	47682930	+1	no_errors	ENST00000262982	ensembl	human	known	69_37n	missense	95	28.57	38	SNP	1.000	C
CSF3R	1441	genome.wustl.edu	37	1	36941196	36941196	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:36941196A>T	ENST00000373106.1	-	4	690	c.143T>A	c.(142-144)aTc>aAc	p.I48N	CSF3R_ENST00000361632.4_Missense_Mutation_p.I48N|CSF3R_ENST00000373103.1_Missense_Mutation_p.I48N|CSF3R_ENST00000440588.2_Missense_Mutation_p.I48N|CSF3R_ENST00000331941.5_Missense_Mutation_p.I48N|CSF3R_ENST00000418048.2_Missense_Mutation_p.I48N|CSF3R_ENST00000338937.5_Missense_Mutation_p.I48N|CSF3R_ENST00000373104.1_Missense_Mutation_p.I48N	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	48	Ig-like C2-type.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GTTCTGCTTGATGATGCAGGA	0.627																																						dbGAP											0													49.0	44.0	46.0					1																	36941196		2203	4300	6503	-	-	-	SO:0001583	missense	0			M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.143T>A	1.37:g.36941196A>T	ENSP00000362198:p.Ile48Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.I48N	ENST00000373106.1	37	c.143	CCDS413.1	1	.	.	.	.	.	.	.	.	.	.	A	16.90	3.249303	0.59103	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	D;D;D;D;D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-2.63	5.74	5.74	0.90152	Immunoglobulin C2-set-like, ligand-binding (1);Immunoglobulin-like fold (1);	0.747357	0.13455	N	0.386621	D	0.94598	0.8259	M	0.71581	2.175	0.42809	D	0.993954	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.74348	0.98;0.941;0.965;0.983	D	0.93069	0.6481	10	0.42905	T	0.14	-21.0612	14.0698	0.64852	1.0:0.0:0.0:0.0	.	48;48;48;48	E1B6W6;Q99062-3;Q99062;Q99062-4	.;.;CSF3R_HUMAN;.	N	48	ENSP00000362198:I48N;ENSP00000362196:I48N;ENSP00000362195:I48N;ENSP00000355406:I48N;ENSP00000332180:I48N;ENSP00000401588:I48N;ENSP00000345013:I48N;ENSP00000397568:I48N	ENSP00000332180:I48N	I	-	2	0	CSF3R	36713783	0.999000	0.42202	0.160000	0.22671	0.417000	0.31264	5.169000	0.64984	2.317000	0.78254	0.459000	0.35465	ATC	CSF3R	-	pfam_IgC2-like_lig-bd	ENSG00000119535		0.627	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF3R	HGNC	protein_coding	OTTHUMT00000021997.2	34	0.00	0	A	NM_156039		36941196	36941196	-1	no_errors	ENST00000373103	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	0.954	T
CYP7A1	1581	genome.wustl.edu	37	8	59407066	59407066	+	Splice_Site	SNP	T	T	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr8:59407066T>G	ENST00000301645.3	-	4	1175	c.1038A>C	c.(1036-1038)ttA>ttC	p.L346F		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	346					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				TATACCCACCTAATACTGGCA	0.343									Neonatal Giant Cell Hepatitis																													dbGAP											0													138.0	118.0	125.0					8																	59407066		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Neonatal Hemochromatosis	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.1039+1A>C	8.37:g.59407066T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	P78454|Q3MIL8|Q7KZ19	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	p.L346F	ENST00000301645.3	37	c.1038	CCDS6171.1	8	.	.	.	.	.	.	.	.	.	.	T	14.82	2.648889	0.47362	.	.	ENSG00000167910	ENST00000301645	T	0.78246	-1.16	5.74	1.85	0.25348	.	0.065482	0.64402	D	0.000013	D	0.84946	0.5585	M	0.84585	2.705	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.80819	-0.1212	10	0.46703	T	0.11	-19.2784	3.4661	0.07550	0.1259:0.0684:0.2621:0.5436	.	346	P22680	CP7A1_HUMAN	F	346	ENSP00000301645:L346F	ENSP00000301645:L346F	L	-	3	2	CYP7A1	59569620	1.000000	0.71417	0.997000	0.53966	0.308000	0.27856	0.958000	0.29227	0.440000	0.26502	-0.321000	0.08615	TTA	CYP7A1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV	ENSG00000167910		0.343	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7A1	HGNC	protein_coding	OTTHUMT00000378190.1	113	0.00	0	T	NM_000780	Missense_Mutation	59407066	59407066	-1	no_errors	ENST00000301645	ensembl	human	known	69_37n	missense	56	38.46	35	SNP	0.999	G
DPH2	1802	genome.wustl.edu	37	1	44437957	44437957	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:44437957G>T	ENST00000255108.3	+	5	1468	c.1296G>T	c.(1294-1296)ttG>ttT	p.L432F	ATP6V0B_ENST00000472174.2_5'Flank|ATP6V0B_ENST00000532642.1_5'Flank|DPH2_ENST00000396758.2_Missense_Mutation_p.L204F|DPH2_ENST00000412950.2_Missense_Mutation_p.L297F|ATP6V0B_ENST00000236067.4_5'Flank|ATP6V0B_ENST00000471859.2_5'Flank	NM_001384.4	NP_001375.2	Q9BQC3	DPH2_HUMAN	DPH2 homolog (S. cerevisiae)	432					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)	cytoplasm (GO:0005737)				autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(2)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				ATGGAAGCTTGGCTCTGACCC	0.562																																						dbGAP											0													71.0	75.0	73.0					1																	44437957		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF053003	CCDS504.1, CCDS41314.1	1p34	2008-02-05	2005-06-03	2005-06-03	ENSG00000132768	ENSG00000132768			3004	protein-coding gene	gene with protein product		603456	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 2 (S. cerevisiae)"", ""DPH2-like 2 (S. cerevisiae)"""	DPH2L2		9782084, 15485916	Standard	XM_005270559		Approved		uc001ckz.3	Q9BQC3	OTTHUMG00000008295	ENST00000255108.3:c.1296G>T	1.37:g.44437957G>T	ENSP00000255108:p.Leu432Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVC9|B2RDE3|B4DNI8|O60623	Missense_Mutation	SNP	pfam_DPH1/DPH2,tigrfam_DPH1/DPH2,tigrfam_DHP2_eu	p.L432F	ENST00000255108.3	37	c.1296	CCDS504.1	1	.	.	.	.	.	.	.	.	.	.	G	6.629	0.484488	0.12641	.	.	ENSG00000132768	ENST00000255108;ENST00000412950;ENST00000396758;ENST00000459879	.	.	.	4.86	-9.71	0.00518	.	0.427283	0.25558	N	0.029842	T	0.19644	0.0472	L	0.28192	0.835	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.02144	-1.1206	9	0.46703	T	0.11	-1.3736	7.5558	0.27822	0.129:0.0791:0.5297:0.2622	.	297;204;432	B4DNI8;A8MVC9;Q9BQC3	.;.;DPH2_HUMAN	F	432;297;204;205	.	ENSP00000255108:L432F	L	+	3	2	DPH2	44210544	0.000000	0.05858	0.006000	0.13384	0.006000	0.05464	-2.053000	0.01400	-2.363000	0.00608	-0.350000	0.07774	TTG	DPH2	-	tigrfam_DHP2_eu	ENSG00000132768		0.562	DPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPH2	HGNC	protein_coding	OTTHUMT00000022832.1	64	0.00	0	G	NM_001384		44437957	44437957	+1	no_errors	ENST00000255108	ensembl	human	known	69_37n	missense	31	38.00	19	SNP	0.001	T
DPP6	1804	genome.wustl.edu	37	7	154561218	154561218	+	Silent	SNP	C	C	T	rs561437580		TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr7:154561218C>T	ENST00000377770.3	+	9	1116	c.975C>T	c.(973-975)atC>atT	p.I325I	DPP6_ENST00000427557.1_Silent_p.I218I|DPP6_ENST00000332007.3_Silent_p.I263I|DPP6_ENST00000404039.1_Silent_p.I261I			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	325					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GTGTCCCCATCATGGAGCTCC	0.537																																					NSCLC(125;1384 1783 2490 7422 34254)	dbGAP											0													62.0	63.0	63.0					7																	154561218		1990	4154	6144	-	-	-	SO:0001819	synonymous_variant	0			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.975C>T	7.37:g.154561218C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_PD40	p.I325	ENST00000377770.3	37	c.975		7																																																																																			DPP6	-	pfam_Peptidase_S9B	ENSG00000130226		0.537	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	HGNC	protein_coding	OTTHUMT00000322932.1	28	0.00	0	C	NM_130797		154561218	154561218	+1	no_errors	ENST00000377770	ensembl	human	known	69_37n	silent	20	37.50	12	SNP	0.168	T
FABP12	646486	genome.wustl.edu	37	8	82441695	82441695	+	Missense_Mutation	SNP	G	G	A	rs536105592		TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr8:82441695G>A	ENST00000360464.4	-	2	286	c.224C>T	c.(223-225)aCg>aTg	p.T75M	RP11-257P3.3_ENST00000523380.1_RNA|RP11-257P3.3_ENST00000518637.1_RNA	NM_001105281.1	NP_001098751.1	A6NFH5	FBP12_HUMAN	fatty acid binding protein 12	75							lipid binding (GO:0008289)|transporter activity (GO:0005215)			large_intestine(1)|lung(3)	4						GCCACCTGGCGTGATTTCCTC	0.393													G|||	1	0.000199681	0.0	0.0	5008	,	,		19427	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													163.0	157.0	159.0					8																	82441695		1872	4106	5978	-	-	-	SO:0001583	missense	0				CCDS47882.1	8q21.13	2013-03-01			ENSG00000197416	ENSG00000197416		"""Fatty acid binding protein family"""	34524	protein-coding gene	gene with protein product						18786628	Standard	NM_001105281		Approved		uc011lfp.2	A6NFH5	OTTHUMG00000164679	ENST00000360464.4:c.224C>T	8.37:g.82441695G>A	ENSP00000353650:p.Thr75Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B7SUN0	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.T75M	ENST00000360464.4	37	c.224	CCDS47882.1	8	.	.	.	.	.	.	.	.	.	.	G	15.78	2.933558	0.52866	.	.	ENSG00000197416	ENST00000360464	T	0.09723	2.95	4.96	4.09	0.47781	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.111356	0.64402	D	0.000012	T	0.40886	0.1135	M	0.93594	3.435	0.53688	D	0.999976	D	0.76494	0.999	D	0.68039	0.955	T	0.56171	-0.8023	10	0.87932	D	0	.	13.2566	0.60083	0.0764:0.0:0.9235:0.0	.	75	A6NFH5	FBP12_HUMAN	M	75	ENSP00000353650:T75M	ENSP00000353650:T75M	T	-	2	0	FABP12	82604250	1.000000	0.71417	0.050000	0.19076	0.243000	0.25628	4.762000	0.62250	1.308000	0.44962	0.655000	0.94253	ACG	FABP12	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	ENSG00000197416		0.393	FABP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP12	HGNC	protein_coding	OTTHUMT00000379720.1	115	0.00	0	G	NM_001105281		82441695	82441695	-1	no_errors	ENST00000360464	ensembl	human	known	69_37n	missense	93	23.77	29	SNP	1.000	A
FAM124B	79843	genome.wustl.edu	37	2	225266346	225266346	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:225266346C>G	ENST00000409685.3	-	1	405	c.140G>C	c.(139-141)cGg>cCg	p.R47P	FAM124B_ENST00000243806.2_Missense_Mutation_p.R47P|FAM124B_ENST00000389874.3_Missense_Mutation_p.R47P	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	47										endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		AGGACTGGCCCGTTCAGACAC	0.572																																						dbGAP											0													47.0	49.0	49.0					2																	225266346		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.140G>C	2.37:g.225266346C>G	ENSP00000386895:p.Arg47Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNC7|Q8NBZ4|Q8TAV7	Missense_Mutation	SNP	NULL	p.R47P	ENST00000409685.3	37	c.140	CCDS46527.1	2	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695087	0.68386	.	.	ENSG00000124019	ENST00000389874;ENST00000409685;ENST00000243806	T;T;T	0.55052	0.54;0.54;0.54	5.81	5.81	0.92471	.	0.052994	0.64402	D	0.000001	T	0.76637	0.4015	M	0.83603	2.65	0.58432	D	0.999998	D;D	0.89917	0.986;1.0	D;D	0.79784	0.927;0.993	T	0.78398	-0.2219	10	0.66056	D	0.02	-33.1611	20.0628	0.97684	0.0:1.0:0.0:0.0	.	47;47	Q9H5Z6;Q9H5Z6-2	F124B_HUMAN;.	P	47	ENSP00000374524:R47P;ENSP00000386895:R47P;ENSP00000243806:R47P	ENSP00000243806:R47P	R	-	2	0	FAM124B	224974590	0.968000	0.33430	0.386000	0.26170	0.075000	0.17131	7.294000	0.78760	2.745000	0.94114	0.655000	0.94253	CGG	FAM124B	-	NULL	ENSG00000124019		0.572	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM124B	HGNC	protein_coding	OTTHUMT00000330873.1	24	0.00	0	C	NM_024785		225266346	225266346	-1	no_errors	ENST00000409685	ensembl	human	known	69_37n	missense	3	90.00	27	SNP	0.999	G
LOC101929008	101929008	genome.wustl.edu	37	16	90172970	90172970	+	lincRNA	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr16:90172970C>G	ENST00000562203.1	-	0	0																											TCCTCCTCCTCAGGACCTACT	0.677																																						dbGAP											0																																										-	-	-			0																															16.37:g.90172970C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000562203.1	37	NULL		16																																																																																			FAM157C	-	-	ENSG00000260528		0.677	RP11-356C4.3-001	KNOWN	basic	lincRNA	FAM157C	HGNC	lincRNA	OTTHUMT00000420874.1	16	0.00	0	C			90172970	90172970	+1	no_errors	ENST00000563357	ensembl	human	known	69_37n	rna	10	37.50	6	SNP	0.001	G
FBXO42	54455	genome.wustl.edu	37	1	16577968	16577968	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:16577968C>G	ENST00000375592.3	-	10	1567	c.1351G>C	c.(1351-1353)Gtg>Ctg	p.V451L		NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	451										autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		GAGCCACCCACAGCTGCCGTT	0.552																																						dbGAP											0													25.0	29.0	27.0					1																	16577968		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.1351G>C	1.37:g.16577968C>G	ENSP00000364742:p.Val451Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.V451L	ENST00000375592.3	37	c.1351	CCDS30613.1	1	.	.	.	.	.	.	.	.	.	.	C	9.358	1.067315	0.20067	.	.	ENSG00000037637	ENST00000375592;ENST00000456164;ENST00000444116	T;T;T	0.46451	3.85;0.87;0.87	5.51	4.57	0.56435	.	0.449576	0.20723	N	0.086864	T	0.19327	0.0464	N	0.08118	0	0.26614	N	0.972773	B	0.06786	0.001	B	0.11329	0.006	T	0.21621	-1.0240	10	0.09843	T	0.71	-5.8895	7.5768	0.27942	0.0:0.7436:0.1637:0.0926	.	451	Q6P3S6	FBX42_HUMAN	L	451;169;169	ENSP00000364742:V451L;ENSP00000415663:V169L;ENSP00000412416:V169L	ENSP00000364742:V451L	V	-	1	0	FBXO42	16450555	0.005000	0.15991	0.996000	0.52242	0.864000	0.49448	0.646000	0.24797	1.408000	0.46895	0.650000	0.86243	GTG	FBXO42	-	NULL	ENSG00000037637		0.552	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO42	HGNC	protein_coding	OTTHUMT00000006285.1	29	0.00	0	C			16577968	16577968	-1	no_errors	ENST00000375592	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	0.998	G
FCGBP	8857	genome.wustl.edu	37	19	40376817	40376817	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr19:40376817G>A	ENST00000221347.6	-	24	11612	c.11605C>T	c.(11605-11607)Ccc>Tcc	p.P3869S	FCGBP_ENST00000595713.1_5'Flank	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3869	VWFD 9. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGCCCTGTGGGGCTGGAGAGG	0.612																																						dbGAP											0													9.0	14.0	12.0					19																	40376817		2080	4084	6164	-	-	-	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.11605C>T	19.37:g.40376817G>A	ENSP00000221347:p.Pro3869Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.P3869S	ENST00000221347.6	37	c.11605	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	g	8.513	0.867019	0.17250	.	.	ENSG00000090920	ENST00000221347	T	0.77489	-1.1	3.75	-1.99	0.07457	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.59183	0.2175	L	0.39467	1.215	0.09310	N	1	B	0.17268	0.021	B	0.19666	0.026	T	0.42464	-0.9450	9	0.07990	T	0.79	.	2.651	0.04999	0.1805:0.391:0.296:0.1325	.	3869	Q9Y6R7	FCGBP_HUMAN	S	3869	ENSP00000221347:P3869S	ENSP00000221347:P3869S	P	-	1	0	FCGBP	45068657	0.000000	0.05858	0.006000	0.13384	0.615000	0.37417	-0.001000	0.12947	-0.090000	0.12462	-0.666000	0.03841	CCC	FCGBP	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000090920		0.612	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	52	0.00	0	G	NM_003890		40376817	40376817	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.001	A
FCHSD1	89848	genome.wustl.edu	37	5	141029054	141029054	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr5:141029054C>A	ENST00000435817.2	-	5	333	c.283G>T	c.(283-285)Gct>Tct	p.A95S	FCHSD1_ENST00000522126.1_Missense_Mutation_p.A19S|FCHSD1_ENST00000523856.1_5'Flank|FCHSD1_ENST00000522783.1_Missense_Mutation_p.A93S|FCHSD1_ENST00000519800.1_Missense_Mutation_p.A93S	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	95									FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGCCCCCAGCCACGGTGGCA	0.632																																						dbGAP											0													58.0	70.0	66.0					5																	141029054		2137	4253	6390	-	-	-	SO:0001583	missense	0			AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.283G>T	5.37:g.141029054C>A	ENSP00000399259:p.Ala95Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UX75|Q86Y77|Q9NXX8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_FCH,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain	p.A95S	ENST00000435817.2	37	c.283	CCDS47295.1	5	.	.	.	.	.	.	.	.	.	.	c	13.03	2.114913	0.37339	.	.	ENSG00000197948	ENST00000435817;ENST00000522126;ENST00000522783;ENST00000519800	T;T;T;T	0.13420	2.59;2.59;2.59;2.59	5.19	4.31	0.51392	Fps/Fes/Fer/CIP4 homology (1);	0.618834	0.15476	N	0.260331	T	0.07548	0.0190	N	0.12182	0.205	0.26096	N	0.980888	B	0.20459	0.045	B	0.25405	0.06	T	0.28618	-1.0038	10	0.23302	T	0.38	-8.6304	7.2021	0.25887	0.1666:0.7434:0.0:0.09	.	95	Q86WN1	FCSD1_HUMAN	S	95;19;93;93	ENSP00000399259:A95S;ENSP00000427796:A19S;ENSP00000428677:A93S;ENSP00000428776:A93S	ENSP00000399259:A95S	A	-	1	0	FCHSD1	141009238	0.903000	0.30736	1.000000	0.80357	0.932000	0.56968	1.349000	0.33998	2.412000	0.81896	0.556000	0.70494	GCT	FCHSD1	-	pfam_FCH,smart_FCH	ENSG00000197948		0.632	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCHSD1	HGNC	protein_coding	OTTHUMT00000375282.2	22	0.00	0	C	NM_033449		141029054	141029054	-1	no_errors	ENST00000435817	ensembl	human	known	69_37n	missense	11	50.00	11	SNP	0.982	A
FLG	2312	genome.wustl.edu	37	1	152282807	152282807	+	Missense_Mutation	SNP	G	G	A	rs200756104	byFrequency	TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:152282807G>A	ENST00000368799.1	-	3	4590	c.4555C>T	c.(4555-4557)Cac>Tac	p.H1519Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1519	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGTGGCTGTGATGGTACCCT	0.557									Ichthyosis																													dbGAP											0													317.0	303.0	308.0					1																	152282807		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4555C>T	1.37:g.152282807G>A	ENSP00000357789:p.His1519Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.H1519Y	ENST00000368799.1	37	c.4555	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	4.436	0.080650	0.08533	.	.	ENSG00000143631	ENST00000368799	T	0.01665	4.7	2.94	-5.88	0.02290	.	.	.	.	.	T	0.00552	0.0018	M	0.80982	2.52	0.09310	N	1	B	0.16603	0.018	B	0.13407	0.009	T	0.53244	-0.8466	9	0.02654	T	1	.	5.088	0.14693	0.1061:0.5546:0.1988:0.1406	.	1519	P20930	FILA_HUMAN	Y	1519	ENSP00000357789:H1519Y	ENSP00000357789:H1519Y	H	-	1	0	FLG	150549431	0.003000	0.15002	0.000000	0.03702	0.074000	0.17049	0.775000	0.26689	-1.941000	0.01042	0.485000	0.47835	CAC	FLG	-	NULL	ENSG00000143631		0.557	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	198	0.00	0	G	NM_002016		152282807	152282807	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	96	31.43	44	SNP	0.000	A
FMR1	2332	genome.wustl.edu	37	X	147027089	147027089	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chrX:147027089C>G	ENST00000370475.4	+	16	1818	c.1690C>G	c.(1690-1692)Cgt>Ggt	p.R564G	FMR1_ENST00000440235.2_Missense_Mutation_p.R211G|FMR1_ENST00000439526.2_Missense_Mutation_p.R541G|FMR1_ENST00000370470.1_Missense_Mutation_p.R539G|FMR1_ENST00000370471.3_Missense_Mutation_p.H473Q|FMR1_ENST00000370477.1_Missense_Mutation_p.R531G|FMR1_ENST00000218200.8_Missense_Mutation_p.R543G|FMR1-IT1_ENST00000441414.1_RNA	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	564	Interaction with RANBP9.				central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					TAATCGTCCACGTAATCCAAG	0.383									Fragile X syndrome																													dbGAP											0													125.0	105.0	112.0					X																	147027089		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.1690C>G	X.37:g.147027089C>G	ENSP00000359506:p.Arg564Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet,smart_KH_dom,pfscan_KH_dom_type_1	p.R564G	ENST00000370475.4	37	c.1690	CCDS14682.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.0|22.0	4.224651|4.224651	0.79576|0.79576	.|.	.|.	ENSG00000102081|ENSG00000102081	ENST00000370471|ENST00000218200;ENST00000370477;ENST00000370475;ENST00000439526;ENST00000370470;ENST00000440235	T|T;T;T;T;T;T	0.57595|0.31769	0.39|1.48;1.48;1.48;1.48;1.48;1.48	5.12|5.12	5.12|5.12	0.69794|0.69794	.|.	.|0.099543	.|0.64402	.|D	.|0.000001	T|T	0.47021|0.47021	0.1423|0.1423	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.76494	.|0.998;0.997;0.999;0.984;0.998	.|D;P;D;P;D	.|0.80764	.|0.994;0.868;0.975;0.733;0.994	T|T	0.26087|0.26087	-1.0113|-1.0113	7|10	0.66056|0.26408	D|T	0.02|0.33	-25.1229|-25.1229	16.6502|16.6502	0.85187|0.85187	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|211;564;459;518;541	.|F8W871;Q06787;Q59GC1;Q06787-8;G3V0J0	.|.;FMR1_HUMAN;.;.;.	Q|G	473|543;531;564;541;539;211	ENSP00000359502:H473Q|ENSP00000218200:R543G;ENSP00000359508:R531G;ENSP00000359506:R564G;ENSP00000395923:R541G;ENSP00000359501:R539G;ENSP00000413764:R211G	ENSP00000359502:H473Q|ENSP00000218200:R543G	H|R	+|+	3|1	2|0	FMR1|FMR1	146834781|146834781	0.997000|0.997000	0.39634|0.39634	0.991000|0.991000	0.47740|0.47740	0.987000|0.987000	0.75469|0.75469	3.478000|3.478000	0.53158|0.53158	2.134000|2.134000	0.65973|0.65973	0.429000|0.429000	0.28392|0.28392	CAC|CGT	FMR1	-	pfam_Frag_X_MRP_fam	ENSG00000102081		0.383	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMR1	HGNC	protein_coding	OTTHUMT00000058655.1	72	0.00	0	C	NM_002024		147027089	147027089	+1	no_errors	ENST00000370475	ensembl	human	known	69_37n	missense	37	41.27	26	SNP	0.999	G
FRMD6	122786	genome.wustl.edu	37	14	52187001	52187001	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr14:52187001A>C	ENST00000344768.5	+	11	1449	c.1253A>C	c.(1252-1254)cAc>cCc	p.H418P	FRMD6_ENST00000554167.1_Missense_Mutation_p.H341P|FRMD6_ENST00000395718.2_Missense_Mutation_p.H410P|FRMD6_ENST00000356218.4_Missense_Mutation_p.H410P|FRMD6_ENST00000553556.1_Missense_Mutation_p.H60P			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	418					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					AGTGCCATCCACCGCAAGCTG	0.617																																						dbGAP											0													59.0	57.0	57.0					14																	52187001		2203	4300	6503	-	-	-	SO:0001583	missense	0			BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.1253A>C	14.37:g.52187001A>C	ENSP00000343899:p.His418Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.H418P	ENST00000344768.5	37	c.1253	CCDS58318.1	14	.	.	.	.	.	.	.	.	.	.	A	19.05	3.752783	0.69648	.	.	ENSG00000139926	ENST00000356218;ENST00000395718;ENST00000344768;ENST00000554167;ENST00000555197;ENST00000555703;ENST00000553556	T;T;T;T	0.78816	-1.21;-1.21;-0.98;-0.79	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.71576	0.3356	N	0.24115	0.695	0.54753	D	0.999988	P;P;P	0.48640	0.913;0.859;0.824	P;B;B	0.46629	0.522;0.322;0.394	T	0.71424	-0.4597	10	0.32370	T	0.25	.	16.4696	0.84102	1.0:0.0:0.0:0.0	.	341;418;410	G3V4T7;Q96NE9;Q96NE9-2	.;FRMD6_HUMAN;.	P	410;410;418;341;148;60;60	ENSP00000348550:H410P;ENSP00000379068:H410P;ENSP00000343899:H418P;ENSP00000451977:H341P	ENSP00000343899:H418P	H	+	2	0	FRMD6	51256751	1.000000	0.71417	1.000000	0.80357	0.664000	0.39144	7.538000	0.82048	2.289000	0.77006	0.482000	0.46254	CAC	FRMD6	-	NULL	ENSG00000139926		0.617	FRMD6-002	KNOWN	basic|CCDS	protein_coding	FRMD6	HGNC	protein_coding	OTTHUMT00000276881.1	15	0.00	0	A	NM_152330		52187001	52187001	+1	no_errors	ENST00000344768	ensembl	human	known	69_37n	missense	2	84.62	11	SNP	1.000	C
LYPLA2	11313	genome.wustl.edu	37	1	24123024	24123024	+	IGR	SNP	G	G	A	rs3179864		TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:24123024G>A	ENST00000374514.3	+	0	1810				GALE_ENST00000374497.3_Missense_Mutation_p.A283V|GALE_ENST00000470383.1_5'Flank	NM_007260.2	NP_009191.1	O95372	LYPA2_HUMAN	lysophospholipase II						fatty acid metabolic process (GO:0006631)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)			endometrium(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.79e-24)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;4.22e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		CTTCTCCATAGCCTGGACCAT	0.627																																						dbGAP											0													75.0	74.0	74.0					1																	24123024		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AF098668	CCDS241.1	1p36.11	2008-08-08			ENSG00000011009	ENSG00000011009	3.1.1.5		6738	protein-coding gene	gene with protein product							Standard	NM_007260		Approved	APT-2	uc001bht.3	O95372	OTTHUMG00000002961		1.37:g.24123024G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z4Z2	Missense_Mutation	SNP	pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_dTDP_dehydrorham_reduct,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_Male_sterile_NAD-bd,pfam_PKS_KR,prints_Nuc_sugar_epim,tigrfam_GalE	p.A283V	ENST00000374514.3	37	c.848	CCDS241.1	1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834297	0.91036	.	.	ENSG00000117308	ENST00000374497;ENST00000418277	D;D	0.92048	-2.96;-2.96	4.86	4.86	0.63082	.	0.053616	0.85682	D	0.000000	D	0.94689	0.8287	M	0.87269	2.87	0.80722	D	1	D;P	0.54397	0.966;0.941	P;P	0.49085	0.6;0.533	D	0.95730	0.8774	10	0.87932	D	0	-17.95	18.1862	0.89793	0.0:0.0:1.0:0.0	rs3179864;rs17399531;rs3179864	209;283	B3KQ39;Q14376	.;GALE_HUMAN	V	283;219	ENSP00000363621:A283V;ENSP00000414719:A219V	ENSP00000363621:A283V	A	-	2	0	GALE	23995611	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.797000	0.69087	2.540000	0.85666	0.462000	0.41574	GCT	GALE	-	tigrfam_GalE	ENSG00000117308		0.627	LYPLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALE	HGNC	protein_coding	OTTHUMT00000008245.1	18	0.00	0	G			24123024	24123024	-1	no_errors	ENST00000374497	ensembl	human	known	69_37n	missense	22	35.29	12	SNP	1.000	A
GBA3	57733	genome.wustl.edu	37	4	22748975	22748975	+	RNA	SNP	A	A	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr4:22748975A>G	ENST00000503442.1	+	0	377				GBA3_ENST00000511446.2_RNA|GBA3_ENST00000508166.1_RNA	NM_001128432.2	NP_001121904.1	Q9H227	GBA3_HUMAN	glucosidase, beta, acid 3 (gene/pseudogene)						carbohydrate metabolic process (GO:0005975)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	beta-galactosidase activity (GO:0004565)|beta-glucosidase activity (GO:0008422)|glycosylceramidase activity (GO:0017042)			breast(1)|kidney(2)|large_intestine(4)|lung(20)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GGTTACTCCCATTGTGACCCT	0.373																																						dbGAP											0													137.0	135.0	136.0					4																	22748975		1833	4081	5914	-	-	-			0			AB017913		4p15.2	2013-05-09	2013-05-09		ENSG00000249948	ENSG00000249948	3.2.1.21		19069	protein-coding gene	gene with protein product	"""klotho-related protein"""	606619	"""glucosidase, beta, acid 3 (cytosolic)"""			11389701	Standard	NM_020973		Approved	GLUC, KLrP	uc031sdv.1	Q9H227	OTTHUMG00000160448		4.37:g.22748975A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32LY7|Q3MIH4|Q53GG8|Q6NSF4|Q8NHT8|Q9H3T4|Q9H4C6	Missense_Mutation	SNP	NULL	p.I115V	ENST00000503442.1	37	c.343		4																																																																																			GBA3	-	NULL	ENSG00000249948		0.373	GBA3-003	KNOWN	basic	polymorphic_pseudogene	GBA3	HGNC	polymorphic_pseudogene	OTTHUMT00000360620.2	41	0.00	0	A			22748975	22748975	+1	pseudogene	ENST00000508166	ensembl	human	known	69_37n	missense	23	52.08	25	SNP	0.929	G
GJA5	2702	genome.wustl.edu	37	1	147230977	147230977	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:147230977C>G	ENST00000271348.2	-	2	531	c.370G>C	c.(370-372)Gag>Cag	p.E124Q	GJA5_ENST00000369237.1_Missense_Mutation_p.E124Q|RP11-433J22.2_ENST00000428911.1_RNA	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	124					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			ACCGGGTACTCGTAAGAGCCA	0.607																																						dbGAP											0													68.0	66.0	67.0					1																	147230977		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.370G>C	1.37:g.147230977C>G	ENSP00000271348:p.Glu124Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3B6|Q5U0N6	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin40	p.E124Q	ENST00000271348.2	37	c.370	CCDS929.1	1	.	.	.	.	.	.	.	.	.	.	C	4.448	0.082888	0.08533	.	.	ENSG00000143140	ENST00000271348;ENST00000369237;ENST00000430508	D;D;D	0.97752	-4.46;-4.46;-4.52	5.28	3.35	0.38373	.	0.574012	0.17460	N	0.173497	D	0.90270	0.6957	L	0.40543	1.245	0.36116	D	0.845159	B	0.25007	0.116	B	0.23852	0.049	D	0.84661	0.0706	10	0.30854	T	0.27	.	4.8624	0.13590	0.1433:0.4993:0.2782:0.0792	.	124	P36382	CXA5_HUMAN	Q	124	ENSP00000271348:E124Q;ENSP00000358240:E124Q;ENSP00000407645:E124Q	ENSP00000271348:E124Q	E	-	1	0	GJA5	145697601	1.000000	0.71417	0.326000	0.25389	0.142000	0.21351	1.968000	0.40500	0.753000	0.32945	0.655000	0.94253	GAG	GJA5	-	NULL	ENSG00000143140		0.607	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA5	HGNC	protein_coding	OTTHUMT00000039422.2	28	0.00	0	C	NM_181703		147230977	147230977	-1	no_errors	ENST00000271348	ensembl	human	known	69_37n	missense	21	15.38	4	SNP	0.926	G
GLDC	2731	genome.wustl.edu	37	9	6592147	6592147	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr9:6592147G>C	ENST00000321612.6	-	11	1628	c.1478C>G	c.(1477-1479)tCt>tGt	p.S493C		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	493					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	ACTTACTGCAGATGACTCACA	0.403																																						dbGAP											0													102.0	93.0	96.0					9																	6592147		2203	4300	6503	-	-	-	SO:0001583	missense	0			D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.1478C>G	9.37:g.6592147G>C	ENSP00000370737:p.Ser493Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M2F8	Missense_Mutation	SNP	pfam_GDC-P_N,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_GDC_P_homo	p.S493C	ENST00000321612.6	37	c.1478	CCDS34987.1	9	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934583	0.73442	.	.	ENSG00000178445	ENST00000321612	D	0.99220	-5.58	5.04	5.04	0.67666	.	0.063693	0.64402	D	0.000004	D	0.98160	0.9392	L	0.29908	0.895	0.80722	D	1	D	0.64830	0.994	P	0.49012	0.598	D	0.99297	1.0900	10	0.59425	D	0.04	-15.2706	18.4191	0.90582	0.0:0.0:1.0:0.0	.	493	P23378	GCSP_HUMAN	C	493	ENSP00000370737:S493C	ENSP00000370737:S493C	S	-	2	0	GLDC	6582147	1.000000	0.71417	0.986000	0.45419	0.762000	0.43233	8.713000	0.91408	2.328000	0.79073	0.561000	0.74099	TCT	GLDC	-	tigrfam_GDC_P_homo	ENSG00000178445		0.403	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLDC	HGNC	protein_coding	OTTHUMT00000051674.2	58	0.00	0	G	NM_000170		6592147	6592147	-1	no_errors	ENST00000321612	ensembl	human	known	69_37n	missense	49	14.04	8	SNP	1.000	C
GPR55	9290	genome.wustl.edu	37	2	231774802	231774802	+	Silent	SNP	G	G	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:231774802G>A	ENST00000392040.1	-	2	1068	c.876C>T	c.(874-876)atC>atT	p.I292I	AC012507.4_ENST00000454890.1_RNA|GPR55_ENST00000392039.2_Silent_p.I292I	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	292					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		GGAATTCTTTGATGACAAAGT	0.532																																						dbGAP											0													87.0	88.0	88.0					2																	231774802		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.876C>T	2.37:g.231774802G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N580	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.I292	ENST00000392040.1	37	c.876	CCDS2480.1	2																																																																																			GPR55	-	prints_7TM_GPCR_Rhodpsn	ENSG00000135898		0.532	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR55	HGNC	protein_coding	OTTHUMT00000332618.1	35	0.00	0	G	NM_005683		231774802	231774802	-1	no_errors	ENST00000392039	ensembl	human	known	69_37n	silent	18	35.71	10	SNP	1.000	A
HOXD13	3239	genome.wustl.edu	37	2	176959403	176959403	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:176959403A>C	ENST00000392539.3	+	2	977	c.977A>C	c.(976-978)aAc>aCc	p.N326T		NM_000523.3	NP_000514.2	P35453	HXD13_HUMAN	homeobox D13	326					anterior/posterior pattern specification (GO:0009952)|branch elongation of an epithelium (GO:0060602)|embryonic digit morphogenesis (GO:0042733)|embryonic hindgut morphogenesis (GO:0048619)|male genitalia development (GO:0030539)|morphogenesis of an epithelial fold (GO:0060571)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0526)|READ - Rectum adenocarcinoma(9;0.0678)		TGGTTTCAGAACCGAAGAGTG	0.463			T	NUP98	AML*																																	dbGAP		Dom	yes		2	2q31-q32	3239	homeo box D13		L	0													81.0	76.0	77.0					2																	176959403		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF005219	CCDS2264.2	2q31.1	2011-06-20	2005-12-22		ENSG00000128714	ENSG00000128714		"""Homeoboxes / ANTP class : HOXL subclass"""	5136	protein-coding gene	gene with protein product		142989	"""homeo box D13"""	HOX4I, SPD		2574852, 1973146	Standard	NM_000523		Approved		uc002ukf.1	P35453	OTTHUMG00000132431	ENST00000392539.3:c.977A>C	2.37:g.176959403A>C	ENSP00000376322:p.Asn326Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,pfam_HoxA13_N,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.N326T	ENST00000392539.3	37	c.977	CCDS2264.2	2	.	.	.	.	.	.	.	.	.	.	A	20.8	4.047713	0.75846	.	.	ENSG00000128714	ENST00000392539	D	0.99388	-5.81	4.84	4.84	0.62591	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.64402	D	0.000003	D	0.99616	0.9860	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97629	1.0141	10	0.87932	D	0	.	14.8851	0.70560	1.0:0.0:0.0:0.0	.	326	P35453	HXD13_HUMAN	T	326	ENSP00000376322:N326T	ENSP00000376322:N326T	N	+	2	0	HOXD13	176667649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.087000	0.94110	2.170000	0.68504	0.533000	0.62120	AAC	HOXD13	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000128714		0.463	HOXD13-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HOXD13	HGNC	protein_coding	OTTHUMT00000359256.1	61	0.00	0	A			176959403	176959403	+1	no_errors	ENST00000392539	ensembl	human	putative	69_37n	missense	32	36.00	18	SNP	1.000	C
ITGAV	3685	genome.wustl.edu	37	2	187455104	187455104	+	Silent	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:187455104C>G	ENST00000261023.3	+	1	313	c.39C>G	c.(37-39)ccC>ccG	p.P13P	ITGAV_ENST00000374907.3_Silent_p.P13P	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	13					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	GCCTCGGTCCCCGCGGCCTCC	0.711																																					Melanoma(58;108 1995 6081)	dbGAP											0													20.0	23.0	22.0					2																	187455104		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.39C>G	2.37:g.187455104C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Silent	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.P13	ENST00000261023.3	37	c.39	CCDS2292.1	2																																																																																			ITGAV	-	NULL	ENSG00000138448		0.711	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAV	HGNC	protein_coding	OTTHUMT00000255882.2	19	0.00	0	C	NM_002210		187455104	187455104	+1	no_errors	ENST00000261023	ensembl	human	known	69_37n	silent	11	47.62	10	SNP	0.000	G
HJURP	55355	genome.wustl.edu	37	2	234758445	234758445	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:234758445G>C	ENST00000411486.2	-	4	366	c.301C>G	c.(301-303)Cct>Gct	p.P101A	HJURP_ENST00000441687.1_Intron|HJURP_ENST00000432087.1_Intron	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	101					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		GGAAGCTCAGGACCCCAGGCT	0.572																																						dbGAP											0													36.0	29.0	32.0					2																	234758445		2173	4252	6425	-	-	-	SO:0001583	missense	0				CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.301C>G	2.37:g.234758445G>C	ENSP00000414109:p.Pro101Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	pfam_HJURP,pfam_HJURP_C,pfam_Centromere_Scm3_N	p.P101A	ENST00000411486.2	37	c.301	CCDS33406.1	2	.	.	.	.	.	.	.	.	.	.	g	3.029	-0.200009	0.06219	.	.	ENSG00000123485	ENST00000411486	T	0.06142	3.34	3.34	-0.711	0.11230	.	3.993220	0.00589	N	0.000343	T	0.05777	0.0151	L	0.50333	1.59	0.09310	N	1	B	0.30326	0.276	B	0.23275	0.045	T	0.33599	-0.9862	10	0.12103	T	0.63	9.3608	2.395	0.04387	0.1152:0.3715:0.3372:0.176	.	101	Q8NCD3	HJURP_HUMAN	A	101	ENSP00000414109:P101A	ENSP00000414109:P101A	P	-	1	0	HJURP	234423184	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.192000	0.09587	-0.158000	0.11040	-0.119000	0.15052	CCT	HJURP	-	NULL	ENSG00000123485		0.572	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HJURP	HGNC	protein_coding	OTTHUMT00000130996.6	27	0.00	0	G	NM_018410		234758445	234758445	-1	no_errors	ENST00000411486	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	0.000	C
KCNMB3	27094	genome.wustl.edu	37	3	178968569	178968569	+	Silent	SNP	G	G	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr3:178968569G>A	ENST00000314235.5	-	2	733	c.222C>T	c.(220-222)ttC>ttT	p.F74F	KCNMB3_ENST00000485523.1_Silent_p.F52F|KCNMB3_ENST00000349697.2_Silent_p.F72F|KCNMB3_ENST00000497599.1_Silent_p.F72F|KCNMB3_ENST00000392685.2_Silent_p.F70F	NM_014407.3	NP_055222.3	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M beta member 3	74					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)		Miconazole(DB01110)|Procaine(DB00721)	TTCCGAGCAAGAAGAACATTA	0.488																																						dbGAP											0													103.0	100.0	101.0					3																	178968569		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF139471	CCDS3225.1, CCDS3226.1, CCDS43172.1, CCDS43173.1, CCDS54683.1	3q26.3-q27	2010-09-30			ENSG00000171121	ENSG00000171121		"""Potassium channels"""	6287	protein-coding gene	gene with protein product		605222		KCNMB2, KCNMBL		10585773	Standard	NM_001163677		Approved		uc003fjm.3	Q9NPA1	OTTHUMG00000157337	ENST00000314235.5:c.222C>T	3.37:g.178968569G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Silent	SNP	pfam_K_chnl_Ca-activ_BK_bsu	p.F74	ENST00000314235.5	37	c.222	CCDS3226.1	3																																																																																			KCNMB3	-	pfam_K_chnl_Ca-activ_BK_bsu	ENSG00000171121		0.488	KCNMB3-004	KNOWN	basic|CCDS	protein_coding	KCNMB3	HGNC	protein_coding	OTTHUMT00000348484.1	72	0.00	0	G			178968569	178968569	-1	no_errors	ENST00000314235	ensembl	human	known	69_37n	silent	62	19.48	15	SNP	1.000	A
ICE1	23379	genome.wustl.edu	37	5	5444434	5444434	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr5:5444434T>C	ENST00000296564.7	+	7	641	c.419T>C	c.(418-420)cTg>cCg	p.L140P	KIAA0947_ENST00000512608.1_3'UTR	NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		140					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						GTGAAGAAGCTGCAAGGTAAG	0.343																																						dbGAP											0													117.0	107.0	110.0					5																	5444434		1909	4110	6019	-	-	-	SO:0001583	missense	0																														ENST00000296564.7:c.419T>C	5.37:g.5444434T>C	ENSP00000296564:p.Leu140Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.L140P	ENST00000296564.7	37	c.419	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	T	19.03	3.747919	0.69533	.	.	ENSG00000164151	ENST00000296564	T	0.19669	2.13	5.55	5.55	0.83447	.	0.465293	0.18926	N	0.127333	T	0.34221	0.0890	L	0.29908	0.895	0.48511	D	0.999662	D	0.89917	1.0	D	0.91635	0.999	T	0.07986	-1.0744	10	0.87932	D	0	-15.7893	12.3624	0.55211	0.0:0.0:0.0:1.0	.	140	Q9Y2F5	K0947_HUMAN	P	140	ENSP00000296564:L140P	ENSP00000296564:L140P	L	+	2	0	KIAA0947	5497434	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	4.609000	0.61148	2.234000	0.73211	0.460000	0.39030	CTG	KIAA0947	-	NULL	ENSG00000164151		0.343	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	169	0.00	0	T			5444434	5444434	+1	no_errors	ENST00000296564	ensembl	human	known	69_37n	missense	162	22.49	47	SNP	1.000	C
ICE1	23379	genome.wustl.edu	37	5	5464629	5464629	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr5:5464629C>T	ENST00000296564.7	+	13	5404	c.5182C>T	c.(5182-5184)Cct>Tct	p.P1728S		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1728	Pro-rich.				positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						ACTTCCTGTGCCTGGCCGACT	0.577																																						dbGAP											0													46.0	47.0	47.0					5																	5464629		2076	4217	6293	-	-	-	SO:0001583	missense	0																														ENST00000296564.7:c.5182C>T	5.37:g.5464629C>T	ENSP00000296564:p.Pro1728Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.P1728S	ENST00000296564.7	37	c.5182	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817529	0.90790	.	.	ENSG00000164151	ENST00000296564	T	0.47177	0.85	5.47	5.47	0.80525	.	.	.	.	.	T	0.66287	0.2774	L	0.56769	1.78	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	T	0.68364	-0.5428	9	0.87932	D	0	-10.8926	16.8165	0.85735	0.0:1.0:0.0:0.0	.	1728	Q9Y2F5	K0947_HUMAN	S	1728	ENSP00000296564:P1728S	ENSP00000296564:P1728S	P	+	1	0	KIAA0947	5517629	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	7.151000	0.77411	2.559000	0.86315	0.460000	0.39030	CCT	KIAA0947	-	NULL	ENSG00000164151		0.577	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	29	0.00	0	C			5464629	5464629	+1	no_errors	ENST00000296564	ensembl	human	known	69_37n	missense	20	42.86	15	SNP	1.000	T
NWD2	57495	genome.wustl.edu	37	4	37445491	37445491	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr4:37445491A>T	ENST00000309447.5	+	7	2729	c.1881A>T	c.(1879-1881)aaA>aaT	p.K627N		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		627	NACHT.									breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						GATCTCACAAAGACGTCGATG	0.478																																						dbGAP											0													142.0	114.0	122.0					4																	37445491		692	1591	2283	-	-	-	SO:0001583	missense	0																														ENST00000309447.5:c.1881A>T	4.37:g.37445491A>T	ENSP00000309501:p.Lys627Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRU1	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.K627N	ENST00000309447.5	37	c.1881	CCDS47040.1	4	.	.	.	.	.	.	.	.	.	.	A	11.52	1.662118	0.29515	.	.	ENSG00000174145	ENST00000309447	T	0.81163	-1.46	6.07	1.04	0.20106	.	0.149401	0.64402	D	0.000015	T	0.71896	0.3394	L	0.47716	1.5	0.49687	D	0.999812	B	0.29301	0.241	B	0.33454	0.164	T	0.61806	-0.6987	10	0.18710	T	0.47	.	11.0056	0.47633	0.7028:0.0:0.2972:0.0	.	627	Q9ULI1	K1239_HUMAN	N	627	ENSP00000309501:K627N	ENSP00000309501:K627N	K	+	3	2	KIAA1239	37121886	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	1.543000	0.36147	0.509000	0.28195	0.528000	0.53228	AAA	KIAA1239	-	NULL	ENSG00000174145		0.478	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1239	HGNC	protein_coding	OTTHUMT00000347551.2	55	0.00	0	A			37445491	37445491	+1	no_errors	ENST00000309447	ensembl	human	known	69_37n	missense	21	43.24	16	SNP	1.000	T
KIAA1257	57501	genome.wustl.edu	37	3	128707723	128707723	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr3:128707723T>C	ENST00000265068.5	-	3	468	c.301A>G	c.(301-303)Aag>Gag	p.K101E	KIAA1257_ENST00000511438.1_Missense_Mutation_p.K101E|KIAA1257_ENST00000515659.1_De_novo_Start_OutOfFrame|KIAA1257_ENST00000510149.1_5'UTR	NM_020741.2	NP_065792.1	Q9ULG3	K1257_HUMAN	KIAA1257	101										breast(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(2)	14						GGGTGTTTCTTATATTTTTCA	0.378																																						dbGAP											0													84.0	83.0	83.0					3																	128707723		1875	4094	5969	-	-	-	SO:0001583	missense	0			AB033083	CCDS46905.1	3q21.3	2011-11-07			ENSG00000114656	ENSG00000114656			29231	protein-coding gene	gene with protein product						10574462	Standard	NM_020741		Approved		uc003elj.4	Q9ULG3	OTTHUMG00000159946	ENST00000265068.5:c.301A>G	3.37:g.128707723T>C	ENSP00000265068:p.Lys101Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXY7|Q8N5T4	Missense_Mutation	SNP	NULL	p.K101E	ENST00000265068.5	37	c.301	CCDS46905.1	3	.	.	.	.	.	.	.	.	.	.	T	13.50	2.255061	0.39896	.	.	ENSG00000114656	ENST00000511438;ENST00000265068	.	.	.	4.95	3.75	0.43078	.	.	.	.	.	T	0.24044	0.0582	N	0.19112	0.55	0.21290	N	0.99974	P;P	0.42518	0.782;0.557	B;B	0.39339	0.297;0.297	T	0.05500	-1.0881	8	0.49607	T	0.09	-5.3162	9.086	0.36581	0.0:0.0:0.1852:0.8148	.	101;101	Q9ULG3;D6RH05	K1257_HUMAN;.	E	101	.	ENSP00000265068:K101E	K	-	1	0	KIAA1257	130190413	0.009000	0.17119	0.001000	0.08648	0.101000	0.19017	1.907000	0.39897	0.938000	0.37419	0.528000	0.53228	AAG	KIAA1257	-	NULL	ENSG00000114656		0.378	KIAA1257-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	KIAA1257	HGNC	protein_coding	OTTHUMT00000358430.1	79	0.00	0	T	NM_020741		128707723	128707723	-1	no_errors	ENST00000265068	ensembl	human	known	69_37n	missense	51	28.17	20	SNP	0.002	C
KRTAP5-1	387264	genome.wustl.edu	37	11	1606146	1606147	+	In_Frame_Ins	INS	-	-	GCC	rs138363822|rs199501537	byFrequency	TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr11:1606146_1606147insGCC	ENST00000382171.2	-	1	366_367	c.333_334insGGC	c.(331-336)tcttgt>tctGGCtgt	p.111_112SC>SGC	KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	111	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GATCCCCCACAAGAGCCACAGC	0.663																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.333_334insGGC	11.37:g.1606146_1606147insGCC	ENSP00000371606:p.Ser111_Cys112insGly	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Ins	INS	NULL	p.111in_frame_insG	ENST00000382171.2	37	c.334_333	CCDS31330.1	11																																																																																			KRTAP5-1	-	NULL	ENSG00000205869		0.663	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-1	HGNC	protein_coding	OTTHUMT00000127922.1	38	0.00	0	-	NM_001005922		1606146	1606147	-1	no_errors	ENST00000382171	ensembl	human	known	69_37n	in_frame_ins	12	20.00	3	INS	0.458:0.354	GCC
KY	339855	genome.wustl.edu	37	3	134327635	134327635	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr3:134327635C>G	ENST00000423778.2	-	10	1007	c.946G>C	c.(946-948)Gac>Cac	p.D316H	KY_ENST00000503669.1_Intron|KY_ENST00000508956.1_Missense_Mutation_p.D295H	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	316					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)			central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						GGGAAGTGGTCCTCGATGAAC	0.507																																						dbGAP											0													105.0	105.0	105.0					3																	134327635		2016	4188	6204	-	-	-	SO:0001583	missense	0			AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.946G>C	3.37:g.134327635C>G	ENSP00000397598:p.Asp316His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1S4|Q6ZT15	Missense_Mutation	SNP	pfam_Transglutaminase-like,smart_Transglutaminase-like	p.D316H	ENST00000423778.2	37	c.946	CCDS46920.1	3	.	.	.	.	.	.	.	.	.	.	C	17.09	3.300208	0.60195	.	.	ENSG00000174611	ENST00000508956;ENST00000423778;ENST00000310263	.	.	.	5.02	5.02	0.67125	.	0.176058	0.36167	N	0.002758	T	0.69708	0.3141	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	0.995;1.0	P;D	0.71870	0.908;0.975	T	0.71968	-0.4432	9	0.66056	D	0.02	-10.1833	9.6849	0.40091	0.0:0.8701:0.0:0.1299	.	295;316	Q8NBH2-3;Q8NBH2-4	.;.	H	295;316;316	.	ENSP00000309520:D316H	D	-	1	0	KY	135810325	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	1.299000	0.33424	2.331000	0.79229	0.462000	0.41574	GAC	KY	-	NULL	ENSG00000174611		0.507	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KY	HGNC	protein_coding	OTTHUMT00000357320.1	94	0.00	0	C	NM_178554		134327635	134327635	-1	no_errors	ENST00000423778	ensembl	human	known	69_37n	missense	39	46.58	34	SNP	1.000	G
LHCGR	3973	genome.wustl.edu	37	2	48936098	48936098	+	Silent	SNP	C	C	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:48936098C>A	ENST00000294954.7	-	8	690	c.669G>T	c.(667-669)ggG>ggT	p.G223G	LHCGR_ENST00000405626.1_Silent_p.G223G|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000401907.1_Silent_p.G223G|LHCGR_ENST00000344775.3_Silent_p.G223G|LHCGR_ENST00000403273.1_Silent_p.G223G	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	223					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	AGGTTTTCGGCCCTGTGGCCC	0.547																																						dbGAP											0													229.0	196.0	207.0					2																	48936098		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.669G>T	2.37:g.48936098C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14751|Q15996|Q9UEW9	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_LSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_TSH_rcpt	p.G223	ENST00000294954.7	37	c.669	CCDS1842.1	2																																																																																			LHCGR	-	NULL	ENSG00000138039		0.547	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	HGNC	protein_coding	OTTHUMT00000251364.4	78	0.00	0	C	NM_000233.3		48936098	48936098	-1	no_errors	ENST00000294954	ensembl	human	known	69_37n	silent	45	28.57	18	SNP	0.998	A
MAPKAPK2	9261	genome.wustl.edu	37	1	206904486	206904486	+	Silent	SNP	G	G	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:206904486G>A	ENST00000367103.3	+	7	964	c.771G>A	c.(769-771)ctG>ctA	p.L257L	MAPKAPK2_ENST00000294981.4_Silent_p.L257L	NM_004759.4|NM_032960.3	NP_004750.1|NP_116584.2	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated protein kinase 2	257	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|arachidonic acid metabolic process (GO:0019369)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|G2 DNA damage checkpoint (GO:0031572)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|leukotriene metabolic process (GO:0006691)|macropinocytosis (GO:0044351)|MAPK cascade (GO:0000165)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of interleukin-6 production (GO:0032675)|regulation of tumor necrosis factor production (GO:0032680)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	19	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			GATGCAGGCTGTGTGGGTATC	0.532																																						dbGAP											0													122.0	112.0	115.0					1																	206904486		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U12779	CCDS1466.1, CCDS31001.1	1q32	2008-02-05			ENSG00000162889	ENSG00000162889			6887	protein-coding gene	gene with protein product		602006				8179591, 8280084	Standard	NM_004759		Approved		uc001hem.2	P49137	OTTHUMG00000036342	ENST00000367103.3:c.771G>A	1.37:g.206904486G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SY30|Q5SY41|Q8IYD6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L257	ENST00000367103.3	37	c.771	CCDS31001.1	1																																																																																			MAPKAPK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000162889		0.532	MAPKAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPKAPK2	HGNC	protein_coding	OTTHUMT00000088465.1	50	0.00	0	G	NM_004759		206904486	206904486	+1	no_errors	ENST00000367103	ensembl	human	known	69_37n	silent	51	21.54	14	SNP	0.999	A
MDN1	23195	genome.wustl.edu	37	6	90388361	90388361	+	Frame_Shift_Del	DEL	T	T	-			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr6:90388361delT	ENST00000369393.3	-	75	12484	c.12369delA	c.(12367-12369)aaafs	p.K4123fs	MDN1_ENST00000428876.1_Frame_Shift_Del_p.K4123fs|RP1-122O8.7_ENST00000438877.1_RNA			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4123					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AAGCTCGCTGTTTTTGCATGA	0.443																																						dbGAP											0													189.0	170.0	177.0					6																	90388361		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.12369delA	6.37:g.90388361delT	ENSP00000358400:p.Lys4123fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O15019|Q5T794	Frame_Shift_Del	DEL	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.K4123fs	ENST00000369393.3	37	c.12369	CCDS5024.1	6																																																																																			MDN1	-	pirsf_Midasin	ENSG00000112159		0.443	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	88	0.00	0	T			90388361	90388361	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	frame_shift_del	51	33.77	26	DEL	1.000	-
MEP1B	4225	genome.wustl.edu	37	18	29775426	29775426	+	Silent	SNP	A	A	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr18:29775426A>G	ENST00000269202.6	+	5	275	c.228A>G	c.(226-228)ccA>ccG	p.P76P	MEP1B_ENST00000581447.1_Silent_p.P76P	NM_005925.2	NP_005916.2	Q16820	MEP1B_HUMAN	meprin A, beta	76	Metalloprotease.				digestion (GO:0007586)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						ATACCATTCCATATGTTCTAG	0.348																																						dbGAP											0													155.0	141.0	146.0					18																	29775426		1831	4083	5914	-	-	-	SO:0001819	synonymous_variant	0			X81333	CCDS45846.1	18q12.2-q12.3	2003-12-17				ENSG00000141434	3.4.24.18		7020	protein-coding gene	gene with protein product		600389				7774936	Standard	NM_005925		Approved		uc002kxj.4	Q16820		ENST00000269202.6:c.228A>G	18.37:g.29775426A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM35|B9EGL6|Q670J1	Silent	SNP	pirsf_Pept_M12A_Meprin,pfam_Peptidase_M12A,pfam_MAM_dom,pfam_MATH,superfamily_TRAF-like,superfamily_ConA-like_lec_gl,smart_Peptidase_Metallo,smart_MAM_dom,smart_MATH,prints_Peptidase_M12A,prints_MAM_dom,pfscan_EG-like_dom,pfscan_MATH,pfscan_MAM_dom	p.P76	ENST00000269202.6	37	c.228	CCDS45846.1	18																																																																																			MEP1B	-	pirsf_Pept_M12A_Meprin,pfam_Peptidase_M12A,smart_Peptidase_Metallo	ENSG00000141434		0.348	MEP1B-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MEP1B	HGNC	protein_coding	OTTHUMT00000447755.1	109	0.00	0	A	NM_005925		29775426	29775426	+1	no_errors	ENST00000269202	ensembl	human	known	69_37n	silent	73	45.93	62	SNP	0.250	G
METRNL	284207	genome.wustl.edu	37	17	81043180	81043180	+	Silent	SNP	G	G	C	rs201518596		TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr17:81043180G>C	ENST00000320095.7	+	2	662	c.537G>C	c.(535-537)tcG>tcC	p.S179S	METRNL_ENST00000571814.1_Silent_p.S97S|METRNL_ENST00000570778.1_Silent_p.S97S	NM_001004431.1	NP_001004431.1	Q641Q3	METRL_HUMAN	meteorin, glial cell differentiation regulator-like	179					brown fat cell differentiation (GO:0050873)|fat cell differentiation (GO:0045444)|negative regulation of inflammatory response (GO:0050728)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of energy homeostasis (GO:2000507)|response to cold (GO:0009409)|response to muscle activity (GO:0014850)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone activity (GO:0005179)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)		BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			ACAGGGCGTCGGACCTGCACG	0.667																																						dbGAP											0													46.0	53.0	51.0					17																	81043180		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AK093748	CCDS32779.1	17q25.3	2004-12-01				ENSG00000176845			27584	protein-coding gene	gene with protein product							Standard	NM_001004431		Approved		uc002kgh.3	Q641Q3		ENST00000320095.7:c.537G>C	17.37:g.81043180G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSJ5|Q86VM0	Silent	SNP	NULL	p.S179	ENST00000320095.7	37	c.537	CCDS32779.1	17																																																																																			METRNL	-	NULL	ENSG00000176845		0.667	METRNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METRNL	HGNC	protein_coding	OTTHUMT00000438902.1	21	0.00	0	G	NM_001004431		81043180	81043180	+1	no_errors	ENST00000320095	ensembl	human	known	69_37n	silent	20	35.48	11	SNP	0.002	C
MFI2	4241	genome.wustl.edu	37	3	196735702	196735702	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr3:196735702A>G	ENST00000296350.5	-	12	1773	c.1660T>C	c.(1660-1662)Tac>Cac	p.Y554H		NM_005929.5	NP_005920.2	P08582	TRFM_HUMAN	antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5	554	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of plasminogen activation (GO:0010756)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ferric iron binding (GO:0008199)|iron ion binding (GO:0005506)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(1)	20	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		CGGTAGCCGTAATACCGCTCC	0.667																																						dbGAP											0													83.0	75.0	78.0					3																	196735702		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3325.1, CCDS3326.1	3q28-q29	2012-10-02			ENSG00000163975	ENSG00000163975		"""CD molecules"""	7037	protein-coding gene	gene with protein product	"""melanotransferrin"", ""membrane-bound transferrin-like protein"""	155750					Standard	NM_033316		Approved	CD228, FLJ38863, MAP97, MGC4856, MTF1	uc003fxk.4	P08582	OTTHUMG00000155518	ENST00000296350.5:c.1660T>C	3.37:g.196735702A>G	ENSP00000296350:p.Tyr554His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQE2	Missense_Mutation	SNP	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	p.Y554H	ENST00000296350.5	37	c.1660	CCDS3325.1	3	.	.	.	.	.	.	.	.	.	.	A	13.79	2.342797	0.41498	.	.	ENSG00000163975	ENST00000296350	T	0.37058	1.22	4.96	4.96	0.65561	.	0.197587	0.45361	D	0.000377	T	0.60011	0.2236	M	0.80746	2.51	0.80722	D	1	D	0.64830	0.994	D	0.67900	0.954	T	0.64960	-0.6284	10	0.56958	D	0.05	-23.9072	13.4985	0.61440	1.0:0.0:0.0:0.0	.	554	P08582	TRFM_HUMAN	H	554	ENSP00000296350:Y554H	ENSP00000296350:Y554H	Y	-	1	0	MFI2	198220099	1.000000	0.71417	0.997000	0.53966	0.091000	0.18340	3.733000	0.55029	1.852000	0.53769	0.455000	0.32223	TAC	MFI2	-	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin	ENSG00000163975		0.667	MFI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MFI2	HGNC	protein_coding	OTTHUMT00000340458.1	50	0.00	0	A			196735702	196735702	-1	no_errors	ENST00000296350	ensembl	human	known	69_37n	missense	18	58.14	25	SNP	1.000	G
MIR450A1	554214	genome.wustl.edu	37	X	133674577	133674577	+	RNA	SNP	C	C	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chrX:133674577C>T	ENST00000362262.1	-	0	0				MIR450A2_ENST00000385022.1_RNA|MIR542_ENST00000385050.1_RNA|MIR450B_ENST00000401182.1_RNA	NR_029962.1				microRNA 450a-1																		AAAATGTCCCCAATACATTTA	0.343																																						dbGAP											0													151.0	119.0	129.0					X																	133674577		1567	3581	5148	-	-	-			0					Xq26.3	2011-09-12	2007-10-23	2008-12-18	ENSG00000199132	ENSG00000199132		"""ncRNAs / Micro RNAs"""	28008	non-coding RNA	RNA, micro			"""microRNA 450"", ""microRNA 450-1"""	MIRN450, MIRN450-1, MIRN450A1			Standard	NR_029962		Approved	hsa-mir-450, hsa-mir-450-1, hsa-mir-450a-1	uc011mvl.2				X.37:g.133674577C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000362262.1	37	NULL		X																																																																																			MIR450A2	-	-	ENSG00000207755		0.343	MIR450A1-201	KNOWN	basic	miRNA	MIR450A2	HGNC	miRNA		141	0.00	0	C	NR_029962		133674577	133674577	-1	no_errors	ENST00000385022	ensembl	human	known	69_37n	rna	115	19.01	27	SNP	1.000	T
MMP25	64386	genome.wustl.edu	37	16	3100510	3100510	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr16:3100510C>G	ENST00000336577.4	+	4	861	c.624C>G	c.(622-624)caC>caG	p.H208Q	RP11-473M20.7_ENST00000573130.1_RNA|MMP25_ENST00000570755.1_3'UTR|RP11-473M20.7_ENST00000576250.1_RNA	NM_022468.4	NP_071913.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 25	217					negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	14					Marimastat(DB00786)	GGGACACTCACTTTGACGATG	0.552																																					NSCLC(147;665 1067 3888 6863 19894 30469 40247 45633 51336)	dbGAP											0													44.0	47.0	46.0					16																	3100510		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF145442	CCDS10492.1	16p13.3	2008-02-05	2005-08-08			ENSG00000008516			14246	protein-coding gene	gene with protein product		608482	"""matrix metalloproteinase 25"", ""matrix metallopeptidase-like 1"""	MMPL1, MMP20		10628838, 10706098	Standard	NM_022468		Approved	MT6-MMP	uc002cth.3	Q9NPA2		ENST00000336577.4:c.624C>G	16.37:g.3100510C>G	ENSP00000337816:p.His208Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96F04|Q96TE2	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.H208Q	ENST00000336577.4	37	c.624	CCDS10492.1	16	.	.	.	.	.	.	.	.	.	.	C	17.71	3.455817	0.63401	.	.	ENSG00000008516	ENST00000336577;ENST00000325800	T	0.29917	1.55	5.08	2.04	0.26737	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.124946	0.35646	N	0.003080	T	0.58032	0.2094	M	0.93106	3.38	0.43965	D	0.996648	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.963	T	0.59010	-0.7534	10	0.87932	D	0	.	6.3311	0.21270	0.0:0.6123:0.0:0.3877	.	132;208	O43923;Q9NPA2	.;MMP25_HUMAN	Q	208;135	ENSP00000337816:H208Q	ENSP00000324953:H135Q	H	+	3	2	MMP25	3040511	0.998000	0.40836	0.998000	0.56505	0.976000	0.68499	0.654000	0.24918	0.543000	0.28864	-0.140000	0.14226	CAC	MMP25	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,pirsf_Pept_M10A_matrix_strom	ENSG00000008516		0.552	MMP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP25	HGNC	protein_coding	OTTHUMT00000437116.1	26	0.00	0	C	NM_022468		3100510	3100510	+1	no_errors	ENST00000336577	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	1.000	G
MRPL24	79590	genome.wustl.edu	37	1	156707244	156707244	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:156707244C>G	ENST00000361531.2	-	6	733	c.597G>C	c.(595-597)atG>atC	p.M199I	MRPL24_ENST00000368211.4_Missense_Mutation_p.M199I|MRPL24_ENST00000478899.1_5'UTR			Q96A35	RM24_HUMAN	mitochondrial ribosomal protein L24	199					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(1)|lung(4)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCATGGCCTCCATCACCTCCT	0.512																																						dbGAP											0													135.0	137.0	136.0					1																	156707244		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051341	CCDS1155.1	1q23.1	2012-11-14			ENSG00000143314	ENSG00000143314		"""Mitochondrial ribosomal proteins / large subunits"""	14037	protein-coding gene	gene with protein product		611836					Standard	NM_145729		Approved	MRP-L18	uc001fpx.1	Q96A35	OTTHUMG00000041296	ENST00000361531.2:c.597G>C	1.37:g.156707244C>G	ENSP00000354525:p.Met199Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVC8|Q53G65|Q53HT0|Q5SYZ9|Q5SZ00|Q5SZ02|Q96Q70|Q9H7G3	Missense_Mutation	SNP	pfam_KOW,superfamily_Translation_prot_SH3-like,smart_KOW,tigrfam_Ribosomal_L24	p.M199I	ENST00000361531.2	37	c.597	CCDS1155.1	1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034446	0.75617	.	.	ENSG00000143314	ENST00000361531;ENST00000368211	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.73110	0.3545	M	0.89904	3.07	0.80722	D	1	D	0.53885	0.963	P	0.49752	0.621	T	0.79412	-0.1814	9	0.72032	D	0.01	-35.1372	18.8601	0.92268	0.0:1.0:0.0:0.0	.	199	Q96A35	RM24_HUMAN	I	199	.	ENSP00000354525:M199I	M	-	3	0	MRPL24	154973868	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.682000	0.84083	2.813000	0.96785	0.655000	0.94253	ATG	MRPL24	-	NULL	ENSG00000143314		0.512	MRPL24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL24	HGNC	protein_coding	OTTHUMT00000098955.1	84	0.00	0	C	NM_145729		156707244	156707244	-1	no_errors	ENST00000361531	ensembl	human	known	69_37n	missense	49	39.51	32	SNP	1.000	G
MTMR3	8897	genome.wustl.edu	37	22	30421701	30421701	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr22:30421701G>C	ENST00000401950.2	+	20	3850	c.3508G>C	c.(3508-3510)Gta>Cta	p.V1170L	MTMR3_ENST00000323630.5_Missense_Mutation_p.V1034L|MTMR3_ENST00000406629.1_Missense_Mutation_p.V1142L|CTA-85E5.10_ENST00000453743.2_RNA|MTMR3_ENST00000351488.3_Missense_Mutation_p.V1133L|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000333027.3_Missense_Mutation_p.V1142L	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	1170					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			ACCCAGTCGAGTATGCAAGTC	0.488																																						dbGAP											0													130.0	113.0	119.0					22																	30421701		2203	4300	6503	-	-	-	SO:0001583	missense	0			U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.3508G>C	22.37:g.30421701G>C	ENSP00000384651:p.Val1170Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Missense_Mutation	SNP	pfam_Myotub-related,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Tyr_Pase_cat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.V1170L	ENST00000401950.2	37	c.3508	CCDS13870.1	22	.	.	.	.	.	.	.	.	.	.	G	22.7	4.329069	0.81690	.	.	ENSG00000100330	ENST00000401950;ENST00000333027;ENST00000323630;ENST00000351488;ENST00000406629	T;T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99;-0.99	4.93	4.93	0.64822	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.85669	0.5750	M	0.75777	2.31	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.971	D;D;P	0.80764	0.994;0.992;0.761	D	0.86157	0.1591	10	0.51188	T	0.08	.	17.3248	0.87244	0.0:0.0:1.0:0.0	.	1133;1170;1142	Q13615-3;Q13615;Q13615-2	.;MTMR3_HUMAN;.	L	1170;1142;1034;1133;1142	ENSP00000384651:V1170L;ENSP00000331649:V1142L;ENSP00000318070:V1034L;ENSP00000307271:V1133L;ENSP00000384077:V1142L	ENSP00000318070:V1034L	V	+	1	0	MTMR3	28751701	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.192000	0.94947	2.587000	0.87381	0.655000	0.94253	GTA	MTMR3	-	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	ENSG00000100330		0.488	MTMR3-001	KNOWN	basic|CCDS	protein_coding	MTMR3	HGNC	protein_coding	OTTHUMT00000322066.1	92	0.00	0	G	NM_021090		30421701	30421701	+1	no_errors	ENST00000401950	ensembl	human	known	69_37n	missense	33	39.29	22	SNP	1.000	C
MYH1	4619	genome.wustl.edu	37	17	10398288	10398288	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr17:10398288A>T	ENST00000226207.5	-	37	5520	c.5426T>A	c.(5425-5427)cTg>cAg	p.L1809Q	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1809					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CCCACCCTTCAGGGCCAGCTG	0.532																																						dbGAP											0													130.0	129.0	129.0					17																	10398288		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.5426T>A	17.37:g.10398288A>T	ENSP00000226207:p.Leu1809Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CA4|Q9Y622	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1809Q	ENST00000226207.5	37	c.5426	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	A	27.0	4.791829	0.90453	.	.	ENSG00000109061	ENST00000226207	T	0.80738	-1.41	5.26	5.26	0.73747	Myosin tail (1);	0.000000	0.34291	U	0.004086	D	0.91660	0.7364	M	0.93016	3.37	0.51012	D	0.999903	D	0.62365	0.991	D	0.70935	0.971	D	0.93673	0.6992	10	0.87932	D	0	.	15.4634	0.75377	1.0:0.0:0.0:0.0	.	1809	P12882	MYH1_HUMAN	Q	1809	ENSP00000226207:L1809Q	ENSP00000226207:L1809Q	L	-	2	0	MYH1	10339013	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.283000	0.95860	2.114000	0.64651	0.459000	0.35465	CTG	MYH1	-	pfam_Myosin_tail	ENSG00000109061		0.532	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	173	0.00	0	A	NM_005963		10398288	10398288	-1	no_errors	ENST00000226207	ensembl	human	known	69_37n	missense	34	51.43	36	SNP	1.000	T
TRPC4AP	26133	genome.wustl.edu	37	20	33587427	33587427	+	IGR	SNP	G	G	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr20:33587427G>A	ENST00000252015.2	-	0	3226				MYH7B_ENST00000262873.7_Missense_Mutation_p.E1574K			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein						calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GAGCATCCAGGAACTGGAGAA	0.607																																						dbGAP											0													54.0	66.0	62.0					20																	33587427		2115	4235	6350	-	-	-	SO:0001628	intergenic_variant	0			AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319		20.37:g.33587427G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1574K	ENST00000252015.2	37	c.4720	CCDS13246.1	20	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519119	0.85495	.	.	ENSG00000078814	ENST00000262873	D	0.83673	-1.75	4.22	4.22	0.49857	Myosin tail (1);	0.000000	0.35436	N	0.003219	D	0.93700	0.7987	H	0.95365	3.66	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	D	0.95524	0.8597	10	0.66056	D	0.02	.	17.1977	0.86898	0.0:0.0:1.0:0.0	.	1532	A7E2Y1	MYH7B_HUMAN	K	1574	ENSP00000262873:E1574K	ENSP00000262873:E1574K	E	+	1	0	MYH7B	33051088	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	9.588000	0.98232	2.353000	0.79882	0.555000	0.69702	GAA	MYH7B	-	pfam_Myosin_tail,superfamily_t-SNARE	ENSG00000078814		0.607	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078832.2	37	0.00	0	G	NM_015638		33587427	33587427	+1	no_errors	ENST00000262873	ensembl	human	novel	69_37n	missense	29	40.82	20	SNP	1.000	A
MYH8	4626	genome.wustl.edu	37	17	10318835	10318835	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr17:10318835A>G	ENST00000403437.2	-	7	696	c.602T>C	c.(601-603)aTt>aCt	p.I201T	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	201	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						AGTAACTGCAATTGTTGCAAA	0.453									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																													dbGAP											0													142.0	133.0	136.0					17																	10318835		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.602T>C	17.37:g.10318835A>G	ENSP00000384330:p.Ile201Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14910	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I201T	ENST00000403437.2	37	c.602	CCDS11153.1	17	.	.	.	.	.	.	.	.	.	.	A	19.53	3.844389	0.71488	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.88431	-2.38	4.44	4.44	0.53790	Myosin head, motor domain (2);	0.000000	0.42294	U	0.000735	D	0.94039	0.8090	M	0.80183	2.485	0.58432	D	0.999996	P	0.37466	0.596	P	0.58577	0.841	D	0.94757	0.7932	10	0.87932	D	0	.	13.8469	0.63472	1.0:0.0:0.0:0.0	.	201	P13535	MYH8_HUMAN	T	201	ENSP00000384330:I201T	ENSP00000252173:I201T	I	-	2	0	MYH8	10259560	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.981000	0.93465	1.870000	0.54199	0.482000	0.46254	ATT	MYH8	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000133020		0.453	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	110	0.00	0	A	NM_002472		10318835	10318835	-1	no_errors	ENST00000403437	ensembl	human	known	69_37n	missense	24	57.14	32	SNP	1.000	G
NBAS	51594	genome.wustl.edu	37	2	15326973	15326973	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:15326973T>C	ENST00000281513.5	-	50	6629	c.6604A>G	c.(6604-6606)Aca>Gca	p.T2202A	NBAS_ENST00000441750.1_Missense_Mutation_p.T2082A	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	2202					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						AGCATCACTGTAGCTAGTCTC	0.383																																						dbGAP											0													196.0	175.0	182.0					2																	15326973		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.6604A>G	2.37:g.15326973T>C	ENSP00000281513:p.Thr2202Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	pfam_Sec39,superfamily_Quino_amine_DH_bsu	p.T2202A	ENST00000281513.5	37	c.6604	CCDS1685.1	2	.	.	.	.	.	.	.	.	.	.	T	14.89	2.670172	0.47677	.	.	ENSG00000151779	ENST00000441750;ENST00000281513;ENST00000433283;ENST00000423602	T;T	0.19394	2.15;2.15	5.9	3.5	0.40072	.	0.209103	0.50627	N	0.000111	T	0.20618	0.0496	L	0.60455	1.87	0.09310	N	1	B;B	0.24963	0.115;0.001	B;B	0.18561	0.022;0.001	T	0.20009	-1.0288	10	0.87932	D	0	.	9.7836	0.40662	0.0:0.1442:0.0:0.8558	.	2082;2202	A2RRP1-2;A2RRP1	.;NBAS_HUMAN	A	2082;2202;58;56	ENSP00000413201:T2082A;ENSP00000281513:T2202A	ENSP00000281513:T2202A	T	-	1	0	NBAS	15244424	0.085000	0.21516	0.029000	0.17559	0.667000	0.39255	1.144000	0.31565	1.058000	0.40530	0.460000	0.39030	ACA	NBAS	-	NULL	ENSG00000151779		0.383	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	HGNC	protein_coding	OTTHUMT00000241638.1	130	0.00	0	T	NM_015909		15326973	15326973	-1	no_errors	ENST00000281513	ensembl	human	known	69_37n	missense	61	31.46	28	SNP	0.019	C
NCKAP5	344148	genome.wustl.edu	37	2	133540494	133540494	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:133540494A>G	ENST00000409261.1	-	14	4263	c.3890T>C	c.(3889-3891)gTc>gCc	p.V1297A	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.V1297A|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1297										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CTGAGTGCGGACTTTGCCTGA	0.572																																						dbGAP											0													86.0	87.0	86.0					2																	133540494		1965	4160	6125	-	-	-	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3890T>C	2.37:g.133540494A>G	ENSP00000387128:p.Val1297Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.V1297A	ENST00000409261.1	37	c.3890	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	A	14.86	2.662813	0.47572	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.14640	2.49;2.49	5.5	5.5	0.81552	.	0.218004	0.22389	U	0.060706	T	0.11922	0.0290	L	0.29908	0.895	0.80722	D	1	B	0.29627	0.252	B	0.29785	0.107	T	0.15464	-1.0436	10	0.28530	T	0.3	.	14.344	0.66646	1.0:0.0:0.0:0.0	.	1297	O14513	NCKP5_HUMAN	A	1297	ENSP00000387128:V1297A;ENSP00000380603:V1297A	ENSP00000380603:V1297A	V	-	2	0	NCKAP5	133256964	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	7.847000	0.86896	2.302000	0.77476	0.533000	0.62120	GTC	NCKAP5	-	NULL	ENSG00000176771		0.572	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	41	0.00	0	A	NM_207481		133540494	133540494	-1	no_errors	ENST00000317721	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	1.000	G
NCOA3	8202	genome.wustl.edu	37	20	46268762	46268762	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr20:46268762C>G	ENST00000371998.3	+	16	3238	c.3047C>G	c.(3046-3048)tCc>tGc	p.S1016C	NCOA3_ENST00000371997.3_Missense_Mutation_p.S1011C|NCOA3_ENST00000341724.6_Missense_Mutation_p.S946C|NCOA3_ENST00000372004.3_Missense_Mutation_p.S1016C			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1016					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GGCATGTTGTCCATGGAACAA	0.498																																						dbGAP											0													109.0	97.0	101.0					20																	46268762		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3047C>G	20.37:g.46268762C>G	ENSP00000361066:p.Ser1016Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_SRC-1,pfam_PAS_fold,superfamily_Nuc_rcpt_coact,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_HLH_DNA-bd	p.S1016C	ENST00000371998.3	37	c.3047	CCDS13407.1	20	.	.	.	.	.	.	.	.	.	.	C	14.22	2.471237	0.43942	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.02258	4.38;4.55;4.55;4.37	5.85	5.85	0.93711	.	0.291763	0.30085	N	0.010447	T	0.09992	0.0245	L	0.56769	1.78	0.32208	N	0.576884	D;D;D;D;D;D	0.76494	0.991;0.999;0.991;0.991;0.995;0.991	P;P;P;P;P;P	0.61722	0.76;0.893;0.76;0.76;0.879;0.76	T	0.00086	-1.2096	10	0.72032	D	0.01	-11.0228	18.3455	0.90321	0.0:1.0:0.0:0.0	.	1016;1011;1020;1016;1016;1016	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	C	1016;946;1016;1016;1011	ENSP00000342123:S946C;ENSP00000361073:S1016C;ENSP00000361066:S1016C;ENSP00000361065:S1011C	ENSP00000345671:S1016C	S	+	2	0	NCOA3	45702169	0.163000	0.22920	0.765000	0.31456	0.185000	0.23345	2.207000	0.42788	2.753000	0.94483	0.655000	0.94253	TCC	NCOA3	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000124151		0.498	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	HGNC	protein_coding	OTTHUMT00000080405.1	92	0.00	0	C	NM_006534		46268762	46268762	+1	no_errors	ENST00000371998	ensembl	human	known	69_37n	missense	69	35.51	38	SNP	0.876	G
NEB	4703	genome.wustl.edu	37	2	152543948	152543948	+	Silent	SNP	G	G	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:152543948G>A	ENST00000172853.10	-	27	2769	c.2622C>T	c.(2620-2622)gcC>gcT	p.A874A	NEB_ENST00000427231.2_Silent_p.A874A|NEB_ENST00000409198.1_Silent_p.A874A|NEB_ENST00000604864.1_Silent_p.A874A|NEB_ENST00000397345.3_Silent_p.A874A|NEB_ENST00000603639.1_Silent_p.A874A			P20929	NEBU_HUMAN	nebulin	874					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCTGGTTTTTGGCTGTCTTCA	0.423																																						dbGAP											0													217.0	209.0	211.0					2																	152543948		1976	4165	6141	-	-	-	SO:0001819	synonymous_variant	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.2622C>T	2.37:g.152543948G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.A874	ENST00000172853.10	37	c.2622		2																																																																																			NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.423	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		153	0.00	0	G	NM_004543		152543948	152543948	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	silent	146	21.51	40	SNP	1.000	A
NPLOC4	55666	genome.wustl.edu	37	17	79536048	79536048	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr17:79536048C>G	ENST00000331134.6	-	14	1658	c.1443G>C	c.(1441-1443)gaG>gaC	p.E481D	NPLOC4_ENST00000572760.1_5'Flank|NPLOC4_ENST00000539314.1_Missense_Mutation_p.E320D|NPLOC4_ENST00000573876.1_5'Flank|NPLOC4_ENST00000374747.5_Missense_Mutation_p.E481D	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	481					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			TCACCTGTGTCTCACCCAATA	0.353																																						dbGAP											0													93.0	91.0	91.0					17																	79536048		1861	4098	5959	-	-	-	SO:0001583	missense	0			AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.1443G>C	17.37:g.79536048C>G	ENSP00000331487:p.Glu481Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Missense_Mutation	SNP	pfam_NPL4,pfam_NPL4_Zn-bd_put,pfam_Npl4_Ub-like_dom,pirsf_PolyUb_recognition_cplx_Npl4	p.E481D	ENST00000331134.6	37	c.1443	CCDS45812.1	17	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972705	0.53614	.	.	ENSG00000182446	ENST00000331134;ENST00000374747;ENST00000539314	.	.	.	5.63	3.62	0.41486	Nuclear pore localisation protein NPL4 (1);	0.045571	0.85682	D	0.000000	T	0.51176	0.1659	L	0.38733	1.17	0.53005	D	0.99996	B;B;B	0.16802	0.011;0.003;0.019	B;B;B	0.23852	0.049;0.013;0.022	T	0.40534	-0.9558	9	0.31617	T	0.26	-38.8461	11.7124	0.51633	0.0:0.8518:0.0:0.1482	.	320;481;481	B4DG89;Q8TAT6-2;Q8TAT6	.;.;NPL4_HUMAN	D	481;480;320	.	ENSP00000331487:E481D	E	-	3	2	NPLOC4	77146485	0.987000	0.35691	1.000000	0.80357	0.984000	0.73092	0.263000	0.18478	0.723000	0.32274	0.563000	0.77884	GAG	NPLOC4	-	pfam_NPL4,pirsf_PolyUb_recognition_cplx_Npl4	ENSG00000182446		0.353	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPLOC4	HGNC	protein_coding	OTTHUMT00000440140.1	87	0.00	0	C			79536048	79536048	-1	no_errors	ENST00000374747	ensembl	human	known	69_37n	missense	62	26.19	22	SNP	1.000	G
TENM3	55714	genome.wustl.edu	37	4	183603098	183603098	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr4:183603098G>T	ENST00000511685.1	+	11	2089	c.1966G>T	c.(1966-1968)Gga>Tga	p.G656*	TENM3_ENST00000406950.2_Nonsense_Mutation_p.G656*|TENM3_ENST00000502950.1_3'UTR			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	656	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CTCCGGCCACGGAACGTATCT	0.512																																						dbGAP											0													89.0	87.0	88.0					4																	183603098		1999	4160	6159	-	-	-	SO:0001587	stop_gained	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.1966G>T	4.37:g.183603098G>T	ENSP00000424226:p.Gly656*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Nonsense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c_dom,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.G656*	ENST00000511685.1	37	c.1966	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	G	38	7.175089	0.98114	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.5916	0.95514	0.0:0.0:1.0:0.0	.	.	.	.	X	656	.	ENSP00000385276:G656X	G	+	1	0	ODZ3	183840092	1.000000	0.71417	0.972000	0.41901	0.614000	0.37383	9.657000	0.98554	2.861000	0.98227	0.655000	0.94253	GGA	ODZ3	-	smart_EGF-like,pfscan_EG-like_dom	ENSG00000218336		0.512	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ3	HGNC	protein_coding	OTTHUMT00000361734.1	47	0.00	0	G			183603098	183603098	+1	no_errors	ENST00000406950	ensembl	human	known	69_37n	nonsense	11	42.11	8	SNP	1.000	T
OR10H3	26532	genome.wustl.edu	37	19	15852362	15852362	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr19:15852362C>T	ENST00000305892.1	+	1	160	c.160C>T	c.(160-162)Cgc>Tgc	p.R54C		NM_013938.1	NP_039226.1	O60404	O10H3_HUMAN	olfactory receptor, family 10, subfamily H, member 3	54			R -> H (in dbSNP:rs11670007).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						TTGGATTGAACGCAGACTCCA	0.527																																						dbGAP											0													409.0	358.0	375.0					19																	15852362		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12334.1	19p13.1	2012-08-09				ENSG00000171936		"""GPCR / Class A : Olfactory receptors"""	8174	protein-coding gene	gene with protein product							Standard	NM_013938		Approved		uc010xoq.2	O60404		ENST00000305892.1:c.160C>T	19.37:g.15852362C>T	ENSP00000307130:p.Arg54Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2HIZ3|Q6IFQ0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R54C	ENST00000305892.1	37	c.160	CCDS12334.1	19	.	.	.	.	.	.	.	.	.	.	.	1.973	-0.436021	0.04636	.	.	ENSG00000171936	ENST00000305892	T	0.01084	5.36	2.35	1.29	0.21616	GPCR, rhodopsin-like superfamily (1);	0.910830	0.09011	U	0.861532	T	0.01287	0.0042	L	0.43923	1.385	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.45512	-0.9256	10	0.49607	T	0.09	.	3.7208	0.08456	0.0:0.6422:0.0:0.3578	.	54	O60404	O10H3_HUMAN	C	54	ENSP00000307130:R54C	ENSP00000307130:R54C	R	+	1	0	OR10H3	15713362	0.000000	0.05858	0.220000	0.23810	0.112000	0.19704	-0.145000	0.10265	1.320000	0.45209	0.185000	0.17295	CGC	OR10H3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000171936		0.527	OR10H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H3	HGNC	protein_coding	OTTHUMT00000460918.1	220	0.00	0	C			15852362	15852362	+1	no_errors	ENST00000305892	ensembl	human	known	69_37n	missense	76	33.33	38	SNP	0.000	T
OR10R2	343406	genome.wustl.edu	37	1	158450097	158450097	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:158450097G>T	ENST00000368152.1	+	1	430	c.430G>T	c.(430-432)Gct>Tct	p.A144S	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					TGATCGCTATGCTGCCATTTG	0.488																																						dbGAP											0													309.0	268.0	282.0					1																	158450097		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.430G>T	1.37:g.158450097G>T	ENSP00000357134:p.Ala144Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A144S	ENST00000368152.1	37	c.430	CCDS30898.1	1	.	.	.	.	.	.	.	.	.	.	g	16.06	3.015389	0.54468	.	.	ENSG00000198965	ENST00000368152	T	0.02121	4.44	4.48	3.57	0.40892	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01320	0.0043	L	0.48877	1.53	0.22305	N	0.999219	P	0.37548	0.599	B	0.38880	0.284	T	0.43972	-0.9358	9	0.87932	D	0	.	11.394	0.49830	0.0901:0.0:0.9099:0.0	.	144	Q8NGX6	O10R2_HUMAN	S	144	ENSP00000357134:A144S	ENSP00000357134:A144S	A	+	1	0	OR10R2	156716721	0.002000	0.14202	0.703000	0.30354	0.855000	0.48748	1.160000	0.31761	1.073000	0.40885	0.655000	0.94253	GCT	OR10R2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000198965		0.488	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10R2	HGNC	protein_coding	OTTHUMT00000051847.2	120	0.00	0	G	NM_001004472		158450097	158450097	+1	no_errors	ENST00000368152	ensembl	human	known	69_37n	missense	47	44.05	37	SNP	0.994	T
PDCD4	27250	genome.wustl.edu	37	10	112650367	112650367	+	Missense_Mutation	SNP	G	G	A	rs550404806		TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr10:112650367G>A	ENST00000280154.7	+	8	1203	c.929G>A	c.(928-930)cGt>cAt	p.R310H	PDCD4_ENST00000393104.2_Missense_Mutation_p.R299H|PDCD4_ENST00000481353.1_3'UTR	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	Q53EL6	PDCD4_HUMAN	programmed cell death 4 (neoplastic transformation inhibitor)	310					apoptotic process (GO:0006915)|cell aging (GO:0007569)|negative regulation of cell cycle (GO:0045786)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	13		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		GGTGGAAAGCGTAAAGATAGT	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		13782	0.001		0.0	False		,,,				2504	0.0				Ovarian(115;1498 1603 9363 40056 40885)	dbGAP											0													177.0	180.0	179.0					10																	112650367		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83908	CCDS7567.1, CCDS44478.1	10q24	2008-08-01			ENSG00000150593	ENSG00000150593			8763	protein-coding gene	gene with protein product	"""nuclear antigen H731"""	608610				9759869	Standard	NM_014456		Approved	H731	uc001kzh.3	Q53EL6	OTTHUMG00000019048	ENST00000280154.7:c.929G>A	10.37:g.112650367G>A	ENSP00000280154:p.Arg310His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCV4|B5ME91|O15501|Q5VZS6|Q6PJI5|Q8TAR5|Q99834	Missense_Mutation	SNP	pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_Initiation_fac_eIF4g_MI	p.R310H	ENST00000280154.7	37	c.929	CCDS7567.1	10	.	.	.	.	.	.	.	.	.	.	G	19.16	3.773291	0.69992	.	.	ENSG00000150593	ENST00000280154;ENST00000393104	T;T	0.46063	0.88;0.88	5.16	5.16	0.70880	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.43919	0.1269	M	0.63843	1.955	0.80722	D	1	B;B;B	0.25206	0.12;0.056;0.12	B;B;B	0.23574	0.047;0.029;0.047	T	0.32052	-0.9921	10	0.27785	T	0.31	-1.8939	18.6411	0.91396	0.0:0.0:1.0:0.0	.	296;310;299	B4DKX4;Q53EL6;B5ME91	.;PDCD4_HUMAN;.	H	310;299	ENSP00000280154:R310H;ENSP00000376816:R299H	ENSP00000280154:R310H	R	+	2	0	PDCD4	112640357	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.384000	0.97219	2.404000	0.81709	0.650000	0.86243	CGT	PDCD4	-	superfamily_ARM-type_fold	ENSG00000150593		0.388	PDCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD4	HGNC	protein_coding	OTTHUMT00000050361.1	136	0.00	0	G	NM_014456		112650367	112650367	+1	no_errors	ENST00000280154	ensembl	human	known	69_37n	missense	55	33.73	28	SNP	1.000	A
PFDN6	10471	genome.wustl.edu	37	6	33257979	33257979	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr6:33257979G>C	ENST00000395131.1	+	3	499	c.93G>C	c.(91-93)caG>caC	p.Q31H	WDR46_ENST00000477718.1_5'Flank|PFDN6_ENST00000374606.5_Missense_Mutation_p.Q31H|PFDN6_ENST00000374607.1_Missense_Mutation_p.Q31H|RGL2_ENST00000437840.2_5'Flank|PFDN6_ENST00000463584.1_Missense_Mutation_p.Q31H|WDR46_ENST00000374617.4_5'Flank|PFDN6_ENST00000374610.2_Missense_Mutation_p.Q31H			O15212	PFD6_HUMAN	prefoldin subunit 6	31					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)	prefoldin complex (GO:0016272)	chaperone binding (GO:0051087)|unfolded protein binding (GO:0051082)			kidney(1)|large_intestine(1)	2						CGGGGAGGCAGAAACTTGAAG	0.468																																						dbGAP											0													94.0	93.0	93.0					6																	33257979		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC039033	CCDS4773.1	6p21.3	2006-02-24	2006-02-24	2006-02-24	ENSG00000204220	ENSG00000204220			4926	protein-coding gene	gene with protein product		605660	"""HLA class II region expressed gene KE2"", ""prefoldin 6"""	HKE2		9545376, 9630229	Standard	NM_001185181		Approved	KE-2, H2-KE2, PFD6	uc031sny.1	O15212	OTTHUMG00000031247	ENST00000395131.1:c.93G>C	6.37:g.33257979G>C	ENSP00000378563:p.Gln31His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PFD_beta-like,superfamily_Prefoldin	p.Q31H	ENST00000395131.1	37	c.93	CCDS4773.1	6	.	.	.	.	.	.	.	.	.	.	G	27.2	4.808948	0.90707	.	.	ENSG00000204220	ENST00000395131;ENST00000374606;ENST00000374610;ENST00000374607;ENST00000463584	T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81	5.63	5.63	0.86233	Prefoldin beta-like (1);Prefoldin (1);	0.000000	0.85682	D	0.000000	T	0.69531	0.3121	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.73871	-0.3846	10	0.62326	D	0.03	.	15.0523	0.71885	0.0:0.0:1.0:0.0	.	31	O15212	PFD6_HUMAN	H	31	ENSP00000378563:Q31H;ENSP00000363734:Q31H;ENSP00000363738:Q31H;ENSP00000363735:Q31H;ENSP00000420135:Q31H	ENSP00000363734:Q31H	Q	+	3	2	PFDN6	33365957	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.946000	0.70234	2.932000	0.99384	0.643000	0.83706	CAG	PFDN6	-	pfam_PFD_beta-like,superfamily_Prefoldin	ENSG00000204220		0.468	PFDN6-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PFDN6	HGNC	protein_coding	OTTHUMT00000276361.1	101	0.00	0	G	NM_014260		33257979	33257979	+1	no_errors	ENST00000374606	ensembl	human	known	69_37n	missense	44	49.44	44	SNP	1.000	C
PHF20	51230	genome.wustl.edu	37	20	34451203	34451203	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr20:34451203A>C	ENST00000374012.3	+	6	818	c.689A>C	c.(688-690)gAg>gCg	p.E230A	PHF20_ENST00000481202.1_3'UTR|PHF20_ENST00000439301.1_Missense_Mutation_p.E230A			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	230					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					AATGACAGAGAGTATTCTGGA	0.418																																						dbGAP											0													123.0	127.0	126.0					20																	34451203		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.689A>C	20.37:g.34451203A>C	ENSP00000363124:p.Glu230Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	pfam_DUF3776,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_C2H2	p.E230A	ENST00000374012.3	37	c.689	CCDS13268.1	20	.	.	.	.	.	.	.	.	.	.	A	17.99	3.524258	0.64747	.	.	ENSG00000025293	ENST00000374012;ENST00000439301;ENST00000339089;ENST00000374000;ENST00000449988	T;T;T;T	0.59906	1.22;0.23;0.47;0.47	5.61	5.61	0.85477	.	0.252050	0.40385	N	0.001106	T	0.64897	0.2640	L	0.29908	0.895	0.51482	D	0.999926	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.997;0.989	T	0.61337	-0.7083	10	0.24483	T	0.36	.	15.804	0.78477	1.0:0.0:0.0:0.0	.	230;230;230	Q566Q2;Q9BVI0;Q66K49	.;PHF20_HUMAN;.	A	230;230;230;230;123	ENSP00000363124:E230A;ENSP00000410373:E230A;ENSP00000341900:E230A;ENSP00000363112:E230A	ENSP00000341900:E230A	E	+	2	0	PHF20	33914617	1.000000	0.71417	1.000000	0.80357	0.547000	0.35210	6.414000	0.73318	2.138000	0.66242	0.459000	0.35465	GAG	PHF20	-	pfam_DUF3776	ENSG00000025293		0.418	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF20	HGNC	protein_coding	OTTHUMT00000078949.2	49	0.00	0	A	NM_016436		34451203	34451203	+1	no_errors	ENST00000374012	ensembl	human	known	69_37n	missense	72	25.77	25	SNP	1.000	C
PLD2	5338	genome.wustl.edu	37	17	4713241	4713241	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr17:4713241G>C	ENST00000263088.6	+	9	908	c.777G>C	c.(775-777)caG>caC	p.Q259H	PLD2_ENST00000572940.1_Missense_Mutation_p.Q259H|RP11-81A22.5_ENST00000571067.1_lincRNA	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	259	PH.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	CATTTGTTCAGCTCTTTGACC	0.597																																						dbGAP											0													172.0	149.0	156.0					17																	4713241		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.777G>C	17.37:g.4713241G>C	ENSP00000263088:p.Gln259His	Somatic		WXS	Illumina GAIIx	Phase_IV	I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Missense_Mutation	SNP	pfam_Phox,pfam_PLipase_D/transphosphatidylase,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.Q259H	ENST00000263088.6	37	c.777	CCDS11057.1	17	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541373	0.85917	.	.	ENSG00000129219	ENST00000263088	T	0.06371	3.31	5.83	4.85	0.62838	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.068962	0.64402	D	0.000016	T	0.10809	0.0264	N	0.22421	0.69	0.46096	D	0.998869	D;D;D	0.57899	0.981;0.975;0.979	P;P;P	0.56343	0.592;0.796;0.659	T	0.07139	-1.0788	10	0.72032	D	0.01	-28.2481	13.1057	0.59246	0.0784:0.0:0.9216:0.0	.	116;259;259	B7Z905;O14939-2;O14939	.;.;PLD2_HUMAN	H	259	ENSP00000263088:Q259H	ENSP00000263088:Q259H	Q	+	3	2	PLD2	4660205	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.948000	0.63590	1.442000	0.47568	0.561000	0.74099	CAG	PLD2	-	smart_Pleckstrin_homology,pirsf_PLipase_D_euk	ENSG00000129219		0.597	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD2	HGNC	protein_coding	OTTHUMT00000207561.3	94	0.00	0	G	NM_002663		4713241	4713241	+1	no_errors	ENST00000263088	ensembl	human	known	69_37n	missense	17	56.41	22	SNP	1.000	C
POTEE	445582	genome.wustl.edu	37	2	132022031	132022031	+	Silent	SNP	C	C	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:132022031C>T	ENST00000356920.5	+	15	3097	c.3003C>T	c.(3001-3003)ggC>ggT	p.G1001G	PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	1001	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											TGCTGTCTGGCGGCACCACCA	0.537																																						dbGAP											0													1.0	1.0	1.0					2																	132022031		335	417	752	-	-	-	SO:0001819	synonymous_variant	0			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.3003C>T	2.37:g.132022031C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6S8J4|Q6S8J5|Q6S8J8	Silent	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.G1001	ENST00000356920.5	37	c.3003	CCDS46414.1	2																																																																																			AC131180.1	-	pfam_Actin-like,smart_Actin-like	ENSG00000188219		0.537	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	Clone_based_ensembl_gene	protein_coding		13	0.00	0	C	NM_001083538		132022031	132022031	+1	no_errors	ENST00000356920	ensembl	human	known	69_37n	silent	3	40.00	2	SNP	1.000	T
PPP1R12A	4659	genome.wustl.edu	37	12	80226269	80226269	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr12:80226269C>A	ENST00000450142.2	-	4	756	c.490G>T	c.(490-492)Gtt>Ttt	p.V164F	PPP1R12A_ENST00000546369.1_Missense_Mutation_p.V77F|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.V164F|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.V164F|PPP1R12A_ENST00000437004.2_Missense_Mutation_p.V164F	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	164					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						TCTATATCAACCCCTGATAAA	0.328																																						dbGAP											0													108.0	101.0	103.0					12																	80226269		1833	4082	5915	-	-	-	SO:0001583	missense	0			D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.490G>T	12.37:g.80226269C>A	ENSP00000389168:p.Val164Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	pirsf_Pase-1_reg_su_12A/B/C_euk,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V164F	ENST00000450142.2	37	c.490	CCDS44947.1	12	.	.	.	.	.	.	.	.	.	.	C	24.7	4.565562	0.86439	.	.	ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107;ENST00000547330;ENST00000550510;ENST00000548318	T;T;T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59	5.49	5.49	0.81192	Ankyrin repeat-containing domain (3);	0.188495	0.45606	D	0.000354	T	0.63307	0.2500	M	0.63843	1.955	0.80722	D	1	D;P;D;D	0.65815	0.995;0.943;0.962;0.991	P;P;P;P	0.56042	0.774;0.79;0.753;0.599	T	0.66779	-0.5837	10	0.87932	D	0	.	12.6918	0.56978	0.0:0.9247:0.0:0.0753	.	164;164;164;164	F8W8Q6;O14974-2;O14974-3;O14974	.;.;.;MYPT1_HUMAN	F	164;164;164;164;164;164;164;77;164;164;92;14	ENSP00000261207:V164F;ENSP00000389168:V164F;ENSP00000416769:V164F;ENSP00000449514:V77F;ENSP00000446855:V164F;ENSP00000446816:V164F;ENSP00000447338:V92F;ENSP00000449843:V14F	ENSP00000261207:V164F	V	-	1	0	PPP1R12A	78750400	0.999000	0.42202	0.993000	0.49108	0.896000	0.52359	3.974000	0.56852	2.562000	0.86427	0.650000	0.86243	GTT	PPP1R12A	-	pirsf_Pase-1_reg_su_12A/B/C_euk,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000058272		0.328	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R12A	HGNC	protein_coding	OTTHUMT00000407254.2	64	0.00	0	C	NM_002480		80226269	80226269	-1	no_errors	ENST00000261207	ensembl	human	known	69_37n	missense	37	32.73	18	SNP	1.000	A
RELN	5649	genome.wustl.edu	37	7	103183194	103183194	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr7:103183194C>G	ENST00000428762.1	-	43	6814	c.6655G>C	c.(6655-6657)Gat>Cat	p.D2219H	RELN_ENST00000424685.2_Missense_Mutation_p.D2219H|RELN_ENST00000343529.5_Missense_Mutation_p.D2219H	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2219					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TGTGATAAATCCAGGTCTCGT	0.398																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											0													110.0	105.0	106.0					7																	103183194		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6655G>C	7.37:g.103183194C>G	ENSP00000392423:p.Asp2219His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.D2219H	ENST00000428762.1	37	c.6655	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	21.2	4.116950	0.77323	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.38560	1.13;1.13;1.13	5.93	5.93	0.95920	Neuraminidase (1);	0.111431	0.64402	D	0.000012	T	0.68732	0.3033	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	T	0.70197	-0.4938	10	0.87932	D	0	.	20.3495	0.98807	0.0:1.0:0.0:0.0	.	2219;2219	P78509-2;P78509	.;RELN_HUMAN	H	2219	ENSP00000392423:D2219H;ENSP00000345694:D2219H;ENSP00000388446:D2219H	ENSP00000345694:D2219H	D	-	1	0	RELN	102970430	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.469000	0.60169	2.814000	0.96858	0.591000	0.81541	GAT	RELN	-	superfamily_Neuraminidase	ENSG00000189056		0.398	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	73	0.00	0	C	NM_005045		103183194	103183194	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	23	34.29	12	SNP	1.000	G
RGS3	5998	genome.wustl.edu	37	9	116226093	116226093	+	Intron	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr9:116226093C>G	ENST00000374140.2	+	4	624				RGS3_ENST00000350696.5_Intron|RGS3_ENST00000317613.6_Missense_Mutation_p.S4C	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3						inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						ATGGAGCGCTCCCTGCACCGC	0.697																																						dbGAP											0													30.0	31.0	31.0					9																	116226093		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.415+1612C>G	9.37:g.116226093C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,smart_C2_Ca-dep,smart_PDZ,pfscan_C2_membr_targeting,pfscan_PDZ	p.S4C	ENST00000374140.2	37	c.11	CCDS43869.1	9	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098530	0.76870	.	.	ENSG00000138835	ENST00000317613	T	0.38401	1.14	4.02	4.02	0.46733	.	.	.	.	.	T	0.40040	0.1101	.	.	.	0.80722	D	1	P	0.35656	0.514	B	0.42163	0.378	T	0.43491	-0.9388	8	0.87932	D	0	.	11.8867	0.52606	0.0:1.0:0.0:0.0	.	4	P49796-5	.	C	4	ENSP00000312844:S4C	ENSP00000312844:S4C	S	+	2	0	RGS3	115265914	0.569000	0.26643	1.000000	0.80357	0.874000	0.50279	2.081000	0.41596	2.257000	0.74773	0.298000	0.19748	TCC	RGS3	-	NULL	ENSG00000138835		0.697	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	HGNC	protein_coding	OTTHUMT00000055561.3	8	0.00	0	C	NM_017790		116226093	116226093	+1	no_errors	ENST00000317613	ensembl	human	known	69_37n	missense	3	57.14	4	SNP	1.000	G
RNF146	81847	genome.wustl.edu	37	6	127608175	127608175	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr6:127608175A>C	ENST00000368314.1	+	3	841	c.417A>C	c.(415-417)ttA>ttC	p.L139F	RNF146_ENST00000309649.3_Missense_Mutation_p.L138F|RNF146_ENST00000356799.2_3'UTR|RNF146_ENST00000610153.1_Missense_Mutation_p.L139F|RNF146_ENST00000608991.1_Missense_Mutation_p.L138F	NM_001242850.1|NM_001242851.1	NP_001229779.1|NP_001229780.1	Q9NTX7	RN146_HUMAN	ring finger protein 146	139	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.				positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly-ADP-D-ribose binding (GO:0072572)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(226;0.0407)|all cancers(137;0.2)		CTGAAATGTTAATTGCTGGCT	0.398																																						dbGAP											0													82.0	75.0	77.0					6																	127608175		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027558	CCDS5136.1, CCDS56449.1	6q22.1-q22.33	2008-02-05			ENSG00000118518	ENSG00000118518		"""RING-type (C3HC4) zinc fingers"""	21336	protein-coding gene	gene with protein product		612137					Standard	NM_001242844		Approved	DKFZp434O1427, dactylidin, dJ351K20.1	uc021zes.1	Q9NTX7	OTTHUMG00000015522	ENST00000368314.1:c.417A>C	6.37:g.127608175A>C	ENSP00000357297:p.Leu139Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P572|Q6FIB2|Q7L8H4|Q96K03|Q96T06|Q9NTX6	Missense_Mutation	SNP	pfam_WWE-dom,smart_Znf_RING,smart_WWE-dom_subgr,pfscan_WWE-dom,pfscan_Znf_RING	p.L139F	ENST00000368314.1	37	c.417	CCDS56449.1	6	.	.	.	.	.	.	.	.	.	.	A	15.64	2.894732	0.52121	.	.	ENSG00000118518	ENST00000368314;ENST00000356799;ENST00000309649	T;T;T	0.42131	0.98;0.98;0.98	5.8	4.66	0.58398	WWE domain (2);WWE domain, subgroup (1);	0.000000	0.64402	D	0.000001	T	0.49915	0.1585	M	0.67953	2.075	0.58432	D	0.999997	D	0.89917	1.0	D	0.83275	0.996	T	0.55049	-0.8201	10	0.66056	D	0.02	-9.5015	8.5553	0.33478	0.8567:0.0:0.1433:0.0	.	139	Q9NTX7	RN146_HUMAN	F	139;138;138	ENSP00000357297:L139F;ENSP00000349253:L138F;ENSP00000309365:L138F	ENSP00000309365:L138F	L	+	3	2	RNF146	127649868	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.914000	0.28624	2.219000	0.72066	0.533000	0.62120	TTA	RNF146	-	pfam_WWE-dom,smart_WWE-dom_subgr,pfscan_WWE-dom	ENSG00000118518		0.398	RNF146-001	KNOWN	basic|CCDS	protein_coding	RNF146	HGNC	protein_coding	OTTHUMT00000042112.1	39	0.00	0	A	NM_030963		127608175	127608175	+1	no_errors	ENST00000368314	ensembl	human	known	69_37n	missense	20	33.33	10	SNP	1.000	C
RNF214	257160	genome.wustl.edu	37	11	117110556	117110556	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr11:117110556C>G	ENST00000531452.1	+	4	704	c.658C>G	c.(658-660)Caa>Gaa	p.Q220E	RNF214_ENST00000530849.1_Missense_Mutation_p.Q65E|RNF214_ENST00000531287.1_Missense_Mutation_p.Q65E|RNF214_ENST00000300650.4_Missense_Mutation_p.Q220E	NM_001077239.1|NM_001278249.1	NP_001070707.1|NP_001265178.1	Q8ND24	RN214_HUMAN	ring finger protein 214	220							zinc ion binding (GO:0008270)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		AAACACAGATCAAGATATTGA	0.318																																						dbGAP											0													73.0	70.0	71.0					11																	117110556		1814	4073	5887	-	-	-	SO:0001583	missense	0			AL834448	CCDS41720.1, CCDS60976.1	11q23.3	2014-02-12	2007-02-16		ENSG00000167257	ENSG00000167257		"""RING-type (C3HC4) zinc fingers"""	25335	protein-coding gene	gene with protein product							Standard	NM_001077239		Approved	DKFZp547C195	uc001pqt.4	Q8ND24	OTTHUMG00000167069	ENST00000531452.1:c.658C>G	11.37:g.117110556C>G	ENSP00000431643:p.Gln220Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUW0|B4DTD1	Missense_Mutation	SNP	pfscan_Znf_RING	p.Q220E	ENST00000531452.1	37	c.658	CCDS41720.1	11	.	.	.	.	.	.	.	.	.	.	C	5.169	0.216739	0.09810	.	.	ENSG00000167257	ENST00000531287;ENST00000531452;ENST00000530849;ENST00000300650	T;T;D;T	0.94330	2.66;1.2;-3.4;1.2	5.96	5.96	0.96718	.	0.224065	0.39544	N	0.001338	D	0.90198	0.6936	L	0.57536	1.79	0.34728	D	0.729407	B;B	0.16802	0.002;0.019	B;B	0.23419	0.014;0.046	D	0.84023	0.0355	10	0.02654	T	1	-0.4666	14.2673	0.66126	0.1486:0.8514:0.0:0.0	.	65;220	B4DTD1;Q8ND24	.;RN214_HUMAN	E	65;220;65;220	ENSP00000435361:Q65E;ENSP00000431643:Q220E;ENSP00000432903:Q65E;ENSP00000300650:Q220E	ENSP00000300650:Q220E	Q	+	1	0	RNF214	116615766	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.265000	0.51561	2.831000	0.97527	0.650000	0.86243	CAA	RNF214	-	NULL	ENSG00000167257		0.318	RNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF214	HGNC	protein_coding	OTTHUMT00000392884.1	56	0.00	0	C	NM_001077239		117110556	117110556	+1	no_errors	ENST00000300650	ensembl	human	known	69_37n	missense	14	70.83	34	SNP	1.000	G
ROCK2	9475	genome.wustl.edu	37	2	11354992	11354992	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:11354992C>A	ENST00000315872.6	-	16	2358	c.1910G>T	c.(1909-1911)gGa>gTa	p.G637V	ROCK2_ENST00000401753.1_Missense_Mutation_p.G394V	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	637	Interaction with PPP1R12A.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TATCTCTGATCCATGGGTTCG	0.338																																						dbGAP											0													66.0	63.0	64.0					2																	11354992		1819	4083	5902	-	-	-	SO:0001583	missense	0			D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.1910G>T	2.37:g.11354992C>A	ENSP00000317985:p.Gly637Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_tRNA-bd_arm,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.G637V	ENST00000315872.6	37	c.1910	CCDS42654.1	2	.	.	.	.	.	.	.	.	.	.	C	15.16	2.750645	0.49257	.	.	ENSG00000134318	ENST00000315872;ENST00000401753	T;T	0.62232	0.04;1.09	5.03	5.03	0.67393	.	0.057838	0.64402	D	0.000001	T	0.61788	0.2375	M	0.68952	2.095	0.80722	D	1	B	0.29716	0.255	B	0.26969	0.075	T	0.61322	-0.7086	10	0.33940	T	0.23	.	18.3685	0.90399	0.0:1.0:0.0:0.0	.	637	O75116	ROCK2_HUMAN	V	637;394	ENSP00000317985:G637V;ENSP00000385509:G394V	ENSP00000317985:G637V	G	-	2	0	ROCK2	11272443	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.723000	0.68492	2.326000	0.78906	0.650000	0.86243	GGA	ROCK2	-	pirsf_Rho-assoc_coiled-coil_kinase	ENSG00000134318		0.338	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK2	HGNC	protein_coding	OTTHUMT00000313886.3	69	0.00	0	C			11354992	11354992	-1	no_errors	ENST00000315872	ensembl	human	known	69_37n	missense	26	50.00	26	SNP	1.000	A
RRNAD1	51093	genome.wustl.edu	37	1	156701823	156701823	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:156701823C>T	ENST00000368216.4	+	2	782	c.152C>T	c.(151-153)tCa>tTa	p.S51L	RRNAD1_ENST00000476229.1_5'UTR|RRNAD1_ENST00000368218.4_Missense_Mutation_p.S51L|RRNAD1_ENST00000524343.1_Intron	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	51						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						CTCCCTTGCTCATGGCAGGAA	0.537																																						dbGAP											0													118.0	111.0	113.0					1																	156701823		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.152C>T	1.37:g.156701823C>T	ENSP00000357199:p.Ser51Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Missense_Mutation	SNP	NULL	p.S51L	ENST00000368216.4	37	c.152	CCDS1154.1	1	.	.	.	.	.	.	.	.	.	.	C	14.12	2.440413	0.43326	.	.	ENSG00000143303	ENST00000368218;ENST00000368216;ENST00000519086	T	0.47869	0.83	4.49	4.49	0.54785	.	0.306471	0.30293	N	0.009952	T	0.37046	0.0989	M	0.67397	2.05	0.80722	D	1	P;B	0.41313	0.745;0.264	B;B	0.39258	0.295;0.19	T	0.44452	-0.9327	10	0.49607	T	0.09	-2.1104	15.9177	0.79535	0.0:1.0:0.0:0.0	.	51;51	Q4VX71;Q96FB5	.;RRNAD_HUMAN	L	51	ENSP00000357199:S51L	ENSP00000357199:S51L	S	+	2	0	RRNAD1	154968447	0.096000	0.21769	0.996000	0.52242	0.565000	0.35776	2.317000	0.43770	2.299000	0.77371	0.561000	0.74099	TCA	RRNAD1	-	NULL	ENSG00000143303		0.537	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRNAD1	HGNC	protein_coding	OTTHUMT00000098973.1	54	0.00	0	C	NM_015997		156701823	156701823	+1	no_errors	ENST00000368216	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	0.914	T
SCARB2	950	genome.wustl.edu	37	4	77100814	77100814	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr4:77100814G>C	ENST00000264896.2	-	4	817	c.468C>G	c.(466-468)atC>atG	p.I156M	SCARB2_ENST00000452464.2_Intron	NM_005506.3	NP_005497.1	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	156	Important for interaction with GBA.				cell adhesion (GO:0007155)|protein targeting to lysosome (GO:0006622)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(3)|prostate(2)|skin(1)	22			Lung(101;0.196)			ACATGGCCTCGATGATCTCCC	0.498											OREG0016231	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													206.0	193.0	197.0					4																	77100814		2203	4300	6503	-	-	-	SO:0001583	missense	0			D12676	CCDS3577.1, CCDS56335.1	4q21.1	2014-07-11	2002-09-06	2002-09-06	ENSG00000138760	ENSG00000138760			1665	protein-coding gene	gene with protein product		602257	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II)"""	CD36L2		1374238	Standard	NM_005506		Approved	HLGP85, LIMPII, SR-BII, LIMP-2	uc003hju.2	Q14108	OTTHUMG00000130099	ENST00000264896.2:c.468C>G	4.37:g.77100814G>C	ENSP00000264896:p.Ile156Met	Somatic	1173	WXS	Illumina GAIIx	Phase_IV	B4DKD8|E7EM68|Q53Y63	Missense_Mutation	SNP	pfam_CD36,superfamily_NA-bd_OB-fold-like,prints_LimpII,prints_CD36,prints_CD36_antigen	p.I156M	ENST00000264896.2	37	c.468	CCDS3577.1	4	.	.	.	.	.	.	.	.	.	.	G	14.76	2.630827	0.46944	.	.	ENSG00000138760	ENST00000264896	T	0.74421	-0.84	5.95	3.09	0.35607	.	0.289991	0.37857	N	0.001915	T	0.63094	0.2482	L	0.41356	1.27	0.80722	D	1	B	0.23490	0.086	B	0.34991	0.193	T	0.49560	-0.8927	10	0.16896	T	0.51	.	5.4957	0.16802	0.0811:0.288:0.5112:0.1197	.	156	Q14108	SCRB2_HUMAN	M	156	ENSP00000264896:I156M	ENSP00000264896:I156M	I	-	3	3	SCARB2	77319838	0.001000	0.12720	0.995000	0.50966	0.742000	0.42306	-0.735000	0.04888	0.813000	0.34350	0.655000	0.94253	ATC	SCARB2	-	pfam_CD36,prints_LimpII	ENSG00000138760		0.498	SCARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARB2	HGNC	protein_coding	OTTHUMT00000252403.1	48	0.00	0	G	NM_005506		77100814	77100814	-1	no_errors	ENST00000264896	ensembl	human	known	69_37n	missense	4	75.00	12	SNP	0.974	C
SERPINB13	5275	genome.wustl.edu	37	18	61264417	61264417	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr18:61264417C>G	ENST00000344731.5	+	8	1098	c.996C>G	c.(994-996)caC>caG	p.H332Q	SERPINB13_ENST00000269489.5_Missense_Mutation_p.H280Q	NM_012397.3	NP_036529.1	Q9UIV8	SPB13_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 13	332					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						AGTTCCTGCACAGTTCCTTTG	0.572																																						dbGAP											0													75.0	68.0	70.0					18																	61264417		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169949, BC101821	CCDS11985.1	18q21.33	2014-02-18	2005-08-18		ENSG00000197641	ENSG00000197641		"""Serine (or cysteine) peptidase inhibitors"""	8944	protein-coding gene	gene with protein product		604445	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13"""	PI13		9297979, 10512713, 24172014	Standard	NM_012397		Approved	HUR7, hurpin, headpin	uc002ljc.3	Q9UIV8	OTTHUMG00000060406	ENST00000344731.5:c.996C>G	18.37:g.61264417C>G	ENSP00000341584:p.His332Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Q8|Q3MII2|Q9HCX1|Q9UBW1|Q9UKG0	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.H332Q	ENST00000344731.5	37	c.996	CCDS11985.1	18	.	.	.	.	.	.	.	.	.	.	C	12.45	1.940801	0.34283	.	.	ENSG00000197641	ENST00000269489;ENST00000539341;ENST00000344731	D;D	0.88509	-2.39;-2.14	5.3	0.942	0.19525	Serpin domain (3);	0.000000	0.56097	D	0.000039	D	0.91788	0.7402	M	0.66939	2.045	0.42364	D	0.992424	D;D;D	0.89917	0.995;0.992;1.0	D;P;D	0.87578	0.919;0.806;0.998	D	0.89880	0.4029	10	0.87932	D	0	.	8.1418	0.31089	0.0:0.6544:0.1188:0.2268	.	341;250;332	B7ZKV6;F5GZ40;Q9UIV8	.;.;SPB13_HUMAN	Q	280;250;332	ENSP00000269489:H280Q;ENSP00000341584:H332Q	ENSP00000269489:H280Q	H	+	3	2	SERPINB13	59415397	0.042000	0.20092	0.309000	0.25155	0.022000	0.10575	0.511000	0.22739	0.246000	0.21394	0.557000	0.71058	CAC	SERPINB13	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000197641		0.572	SERPINB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB13	HGNC	protein_coding	OTTHUMT00000133798.1	46	0.00	0	C	NM_012397		61264417	61264417	+1	no_errors	ENST00000344731	ensembl	human	known	69_37n	missense	26	43.48	20	SNP	0.399	G
SKP2	6502	genome.wustl.edu	37	5	36177372	36177372	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr5:36177372G>C	ENST00000274255.6	+	9	1235	c.1039G>C	c.(1039-1041)Gat>Cat	p.D347H	SKP2_ENST00000508514.1_Missense_Mutation_p.D140H|SKP2_ENST00000546211.1_Missense_Mutation_p.D133H|SKP2_ENST00000274254.5_Missense_Mutation_p.D347H	NM_005983.3	NP_005974.2	Q13309	SKP2_HUMAN	S-phase kinase-associated protein 2, E3 ubiquitin protein ligase	347					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|cellular response to cell-matrix adhesion (GO:0071460)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	identical protein binding (GO:0042802)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|ovary(1)	4	all_lung(31;5.63e-05)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCGGTGCTATGATATAATACC	0.378																																						dbGAP											0													129.0	120.0	124.0					5																	36177372		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33761	CCDS3915.1, CCDS3916.1, CCDS58944.1	5p13	2012-02-23	2012-02-23		ENSG00000145604	ENSG00000145604		"""F-boxes / Leucine-rich repeats"""	10901	protein-coding gene	gene with protein product		601436	"""S-phase kinase-associated protein 2 (p45)"""			8646875	Standard	NM_005983		Approved	FBXL1, FBL1, p45	uc003jkc.2	Q13309	OTTHUMG00000131106	ENST00000274255.6:c.1039G>C	5.37:g.36177372G>C	ENSP00000274255:p.Asp347His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E0|B4DJT4|Q8TDZ0|Q8TDZ1|Q9BV69	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.D347H	ENST00000274255.6	37	c.1039	CCDS3916.1	5	.	.	.	.	.	.	.	.	.	.	G	12.84	2.058259	0.36277	.	.	ENSG00000145604	ENST00000274254;ENST00000274255;ENST00000308927;ENST00000508514;ENST00000546211	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	4.64	4.64	0.57946	.	0.195482	0.46145	D	0.000312	T	0.32763	0.0840	L	0.36672	1.1	0.35283	D	0.781473	B;B;B	0.26195	0.02;0.144;0.009	B;B;B	0.17722	0.003;0.019;0.003	T	0.44590	-0.9318	10	0.56958	D	0.05	-13.3891	12.4735	0.55799	0.0:0.308:0.692:0.0	.	133;347;347	B4DJT4;Q13309-2;Q13309	.;.;SKP2_HUMAN	H	347;347;313;140;133	ENSP00000274254:D347H;ENSP00000274255:D347H;ENSP00000421941:D140H;ENSP00000443492:D133H	ENSP00000274254:D347H	D	+	1	0	SKP2	36213129	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.785000	0.62418	2.564000	0.86499	0.557000	0.71058	GAT	SKP2	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000145604		0.378	SKP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SKP2	HGNC	protein_coding	OTTHUMT00000253769.2	107	0.00	0	G	NM_005983		36177372	36177372	+1	no_errors	ENST00000274255	ensembl	human	known	69_37n	missense	99	22.66	29	SNP	1.000	C
SLC10A3	8273	genome.wustl.edu	37	X	153716037	153716037	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chrX:153716037G>A	ENST00000393587.4	-	3	1506	c.1243C>T	c.(1243-1245)Cgg>Tgg	p.R415W	SLC10A3_ENST00000369649.4_Missense_Mutation_p.R386W|SLC10A3_ENST00000393586.1_Missense_Mutation_p.R470W|UBL4A_ENST00000369653.4_5'Flank|UBL4A_ENST00000369660.4_5'Flank|UBL4A_ENST00000477777.1_5'Flank|SLC10A3_ENST00000263512.4_Missense_Mutation_p.R415W	NM_001142391.1|NM_001142392.1	NP_001135863.1|NP_001135864.1	P09131	P3_HUMAN	solute carrier family 10, member 3	415					response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGACCGTCCGCCGCTGGGCC	0.642																																						dbGAP											0													42.0	35.0	38.0					X																	153716037		2201	4297	6498	-	-	-	SO:0001583	missense	0			X12458	CCDS14755.1, CCDS48195.1	Xq28	2013-07-18	2013-07-18		ENSG00000126903	ENSG00000126903		"""Solute carriers"""	22979	protein-coding gene	gene with protein product		312090				8733135	Standard	NM_019848		Approved	P3, DXS253E	uc004flq.3	P09131	OTTHUMG00000013369	ENST00000393587.4:c.1243C>T	X.37:g.153716037G>A	ENSP00000377212:p.Arg415Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5HY79|Q9BSL2	Missense_Mutation	SNP	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	p.R415W	ENST00000393587.4	37	c.1243	CCDS14755.1	X	.	.	.	.	.	.	.	.	.	.	G	16.58	3.163613	0.57476	.	.	ENSG00000126903	ENST00000369649;ENST00000393586;ENST00000263512;ENST00000393587	T;T;T;T	0.14516	2.63;2.5;2.5;2.5	5.4	2.56	0.30785	.	0.073137	0.51477	U	0.000089	T	0.38401	0.1039	M	0.91406	3.205	0.41755	D	0.989682	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.987	T	0.15206	-1.0445	10	0.87932	D	0	-6.7375	4.9614	0.14068	0.1661:0.0:0.5491:0.2848	.	386;415	Q9BSL2;P09131	.;P3_HUMAN	W	386;470;415;415	ENSP00000358663:R386W;ENSP00000377211:R470W;ENSP00000263512:R415W;ENSP00000377212:R415W	ENSP00000263512:R415W	R	-	1	2	SLC10A3	153369231	1.000000	0.71417	0.715000	0.30552	0.828000	0.46876	4.850000	0.62889	0.475000	0.27415	0.513000	0.50165	CGG	SLC10A3	-	tigrfam_Bil_ac_transpt	ENSG00000126903		0.642	SLC10A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A3	HGNC	protein_coding	OTTHUMT00000037235.3	20	0.00	0	G	NM_019848		153716037	153716037	-1	no_errors	ENST00000263512	ensembl	human	known	69_37n	missense	12	58.62	17	SNP	0.990	A
SLC35D1	23169	genome.wustl.edu	37	1	67486085	67486085	+	Silent	SNP	A	A	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:67486085A>C	ENST00000235345.5	-	10	928	c.843T>G	c.(841-843)tcT>tcG	p.S281S	SLC35D1_ENST00000506472.2_Silent_p.S202S	NM_015139.2	NP_055954.1	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-GlcA/UDP-GalNAc transporter), member D1	281					carbohydrate transport (GO:0008643)|cellular glucuronidation (GO:0052695)|chondroitin sulfate biosynthetic process (GO:0030206)|embryonic skeletal system development (GO:0048706)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|UDP-glucuronate biosynthetic process (GO:0006065)|UDP-glucuronic acid transport (GO:0015787)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	UDP-glucuronic acid transmembrane transporter activity (GO:0005461)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	10						TTGTAAGAGCAGAATTATACT	0.328																																						dbGAP											0													110.0	109.0	110.0					1																	67486085		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB044343	CCDS636.1	1p32-p31	2013-07-17	2013-07-17		ENSG00000116704	ENSG00000116704		"""Solute carriers"""	20800	protein-coding gene	gene with protein product		610804	"""solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1"""			11322953	Standard	NM_015139		Approved	UGTREL7, KIAA0260	uc001ddk.2	Q9NTN3	OTTHUMG00000009360	ENST00000235345.5:c.843T>G	1.37:g.67486085A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K185|B7Z3X2|Q52LU5|Q92548	Silent	SNP	pfam_DUF250	p.S281	ENST00000235345.5	37	c.843	CCDS636.1	1																																																																																			SLC35D1	-	pfam_DUF250	ENSG00000116704		0.328	SLC35D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35D1	HGNC	protein_coding	OTTHUMT00000025948.1	84	0.00	0	A	NM_015139		67486085	67486085	-1	no_errors	ENST00000235345	ensembl	human	known	69_37n	silent	55	36.05	31	SNP	1.000	C
SLITRK3	22865	genome.wustl.edu	37	3	164908611	164908611	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr3:164908611G>A	ENST00000475390.1	-	2	451	c.8C>T	c.(7-9)cCt>cTt	p.P3L	SLITRK3_ENST00000241274.3_Missense_Mutation_p.P3L			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	3					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						AGCTATGGAAGGTTTCATCGT	0.383										HNSCC(40;0.11)																												dbGAP											0													59.0	54.0	56.0					3																	164908611		2188	4272	6460	-	-	-	SO:0001583	missense	0			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.8C>T	3.37:g.164908611G>A	ENSP00000420091:p.Pro3Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1RMY6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.P3L	ENST00000475390.1	37	c.8	CCDS3197.1	3	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772379	0.31411	.	.	ENSG00000121871	ENST00000475390;ENST00000241274;ENST00000497724	T;T;T	0.70399	0.43;0.43;-0.48	6.01	3.24	0.37175	.	0.469726	0.16015	N	0.233610	T	0.49270	0.1547	N	0.08118	0	0.39625	D	0.970089	B	0.02656	0.0	B	0.01281	0.0	T	0.47086	-0.9144	10	0.72032	D	0.01	-5.0E-4	8.99	0.36017	0.1327:0.1238:0.7435:0.0	.	3	O94933	SLIK3_HUMAN	L	3	ENSP00000420091:P3L;ENSP00000241274:P3L;ENSP00000419611:P3L	ENSP00000241274:P3L	P	-	2	0	SLITRK3	166391305	1.000000	0.71417	0.887000	0.34795	0.961000	0.63080	2.946000	0.49050	0.865000	0.35603	0.655000	0.94253	CCT	SLITRK3	-	NULL	ENSG00000121871		0.383	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	HGNC	protein_coding	OTTHUMT00000350126.1	68	0.00	0	G	NM_014926		164908611	164908611	-1	no_errors	ENST00000241274	ensembl	human	known	69_37n	missense	65	24.42	21	SNP	1.000	A
SMG8	55181	genome.wustl.edu	37	17	57288711	57288711	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr17:57288711G>C	ENST00000543872.2	+	2	1563	c.1299G>C	c.(1297-1299)agG>agC	p.R433S	SMG8_ENST00000580498.1_Intron|SMG8_ENST00000300917.5_Missense_Mutation_p.R433S|CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000578922.1_Missense_Mutation_p.R433S			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	433					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						GTGTGGGCAGGAACCCACAGC	0.468																																						dbGAP											0													72.0	69.0	70.0					17																	57288711		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.1299G>C	17.37:g.57288711G>C	ENSP00000438748:p.Arg433Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	pfam_Smg8/Smg9	p.R433S	ENST00000543872.2	37	c.1299	CCDS11615.1	17	.	.	.	.	.	.	.	.	.	.	G	15.54	2.864983	0.51482	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.54279	0.58;0.58	6.06	0.754	0.18410	.	0.000000	0.85682	D	0.000000	T	0.60919	0.2306	L	0.47716	1.5	0.50632	D	0.999887	D	0.62365	0.991	D	0.76071	0.987	T	0.58578	-0.7612	10	0.72032	D	0.01	-15.6404	9.685	0.40094	0.3717:0.0:0.6283:0.0	.	433	Q8ND04	SMG8_HUMAN	S	433	ENSP00000300917:R433S;ENSP00000438748:R433S	ENSP00000300917:R433S	R	+	3	2	SMG8	54643493	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	1.379000	0.34340	-0.041000	0.13558	0.655000	0.94253	AGG	SMG8	-	pfam_Smg8/Smg9	ENSG00000167447		0.468	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG8	HGNC	protein_coding	OTTHUMT00000445960.2	32	0.00	0	G	NM_018149		57288711	57288711	+1	no_errors	ENST00000300917	ensembl	human	known	69_37n	missense	45	13.46	7	SNP	0.997	C
SYF2	25949	genome.wustl.edu	37	1	25554645	25554645	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:25554645T>G	ENST00000236273.4	-	4	365	c.340A>C	c.(340-342)Aaa>Caa	p.K114Q	SYF2_ENST00000354361.3_Missense_Mutation_p.K72Q|SYF2_ENST00000476231.1_5'Flank	NM_015484.4	NP_056299.1	O95926	SYF2_HUMAN	SYF2 pre-mRNA-splicing factor	114					embryonic organ development (GO:0048568)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|mitotic G2 DNA damage checkpoint (GO:0007095)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(4)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-26)|Colorectal(126;2.54e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000455)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00145)|GBM - Glioblastoma multiforme(114;0.00443)|READ - Rectum adenocarcinoma(331;0.0936)|Lung(427;0.201)		CTCTTCTTTTTCCTCTCCCAT	0.413																																						dbGAP											0													136.0	131.0	132.0					1																	25554645		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF273089	CCDS258.1, CCDS259.1	1p36.11	2013-08-21	2013-08-21	2005-09-14	ENSG00000117614	ENSG00000117614			19824	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 29"""	607090	"""CCNDBP1 interactor"", ""SYF2 homolog, RNA splicing factor (S. cerevisiae)"""	CBPIN		11118353	Standard	NM_207170		Approved	p29, DKFZp564O2082, NTC31, fSAP29	uc001bjt.1	O95926	OTTHUMG00000043610	ENST00000236273.4:c.340A>C	1.37:g.25554645T>G	ENSP00000236273:p.Lys114Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TH73	Missense_Mutation	SNP	pfam_mRNA_splic_SYF2	p.K114Q	ENST00000236273.4	37	c.340	CCDS259.1	1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.782437	0.90282	.	.	ENSG00000117614	ENST00000236273;ENST00000354361	T;T	0.62498	0.4;0.02	5.96	5.96	0.96718	.	0.043772	0.85682	D	0.000000	D	0.84156	0.5410	M	0.93720	3.45	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.996	D;D;D	0.77557	0.99;0.97;0.961	D	0.88241	0.2910	10	0.87932	D	0	-6.0236	15.2725	0.73717	0.0:0.0:0.0:1.0	.	114;114;114	B4E0Y8;B2RBX8;O95926	.;.;SYF2_HUMAN	Q	114;72	ENSP00000236273:K114Q;ENSP00000346330:K72Q	ENSP00000236273:K114Q	K	-	1	0	SYF2	25427232	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.698000	0.84413	2.285000	0.76669	0.533000	0.62120	AAA	SYF2	-	pfam_mRNA_splic_SYF2	ENSG00000117614		0.413	SYF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYF2	HGNC	protein_coding	OTTHUMT00000101962.1	142	0.00	0	T	NM_015484		25554645	25554645	-1	no_errors	ENST00000236273	ensembl	human	known	69_37n	missense	61	42.99	46	SNP	1.000	G
SYNE1	23345	genome.wustl.edu	37	6	152686119	152686119	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr6:152686119C>G	ENST00000367255.5	-	63	10609	c.10008G>C	c.(10006-10008)caG>caC	p.Q3336H	SYNE1_ENST00000265368.4_Missense_Mutation_p.Q3336H|SYNE1_ENST00000448038.1_Missense_Mutation_p.Q3343H|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q3343H|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q3375H	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3336					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCATTTTCATCTGAATCTCTT	0.393										HNSCC(10;0.0054)																												dbGAP											0													134.0	124.0	127.0					6																	152686119		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10008G>C	6.37:g.152686119C>G	ENSP00000356224:p.Gln3336His	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q3336H	ENST00000367255.5	37	c.10008	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	14.10	2.436002	0.43224	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.53206	1.2;1.2;1.2;1.2;0.63	5.38	4.32	0.51571	.	0.000000	0.56097	D	0.000027	T	0.56202	0.1969	M	0.74881	2.28	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.74674	0.94;0.94;0.94;0.984	T	0.56962	-0.7892	10	0.45353	T	0.12	.	9.698	0.40169	0.0:0.8391:0.0:0.1609	.	3336;3336;3336;3343	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	H	3336;3343;3336;3343;3375	ENSP00000356224:Q3336H;ENSP00000396024:Q3343H;ENSP00000265368:Q3336H;ENSP00000390975:Q3343H;ENSP00000341887:Q3375H	ENSP00000265368:Q3336H	Q	-	3	2	SYNE1	152727812	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.968000	0.40500	2.515000	0.84797	0.650000	0.86243	CAG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.393	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	97	0.00	0	C	NM_182961		152686119	152686119	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	63	11.27	8	SNP	1.000	G
THBS1	7057	genome.wustl.edu	37	15	39886350	39886350	+	Silent	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr15:39886350C>G	ENST00000260356.5	+	20	3483	c.3318C>G	c.(3316-3318)acC>acG	p.T1106T	CTD-2033D15.1_ENST00000560769.1_RNA	NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	1106	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		AAGATTTCACCGCCTACAGAT	0.483																																						dbGAP											0													60.0	59.0	59.0					15																	39886350		2200	4297	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.3318C>G	15.37:g.39886350C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Silent	SNP	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.T1106	ENST00000260356.5	37	c.3318	CCDS32194.1	15																																																																																			THBS1	-	pfam_Thrombospondin_C,superfamily_ConA-like_lec_gl	ENSG00000137801		0.483	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS1	HGNC	protein_coding	OTTHUMT00000257831.2	80	0.00	0	C	NM_003246		39886350	39886350	+1	no_errors	ENST00000260356	ensembl	human	known	69_37n	silent	8	70.37	19	SNP	0.943	G
TMEM2	23670	genome.wustl.edu	37	9	74345042	74345042	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr9:74345042T>G	ENST00000377044.4	-	9	2440	c.1901A>C	c.(1900-1902)gAt>gCt	p.D634A	TMEM2_ENST00000377066.5_Missense_Mutation_p.D571A	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	634					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		GTTGTTCCTATCGGTGGGCAG	0.453																																						dbGAP											0													144.0	128.0	133.0					9																	74345042		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.1901A>C	9.37:g.74345042T>G	ENSP00000366243:p.Asp634Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.D634A	ENST00000377044.4	37	c.1901	CCDS6638.1	9	.	.	.	.	.	.	.	.	.	.	T	25.3	4.625382	0.87560	.	.	ENSG00000135048	ENST00000377044;ENST00000377066	T;T	0.56611	0.45;0.45	5.72	5.72	0.89469	Pectin lyase fold/virulence factor (1);	0.000000	0.85682	D	0.000000	T	0.80939	0.4720	H	0.95294	3.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.86342	0.1705	10	0.59425	D	0.04	.	16.0011	0.80292	0.0:0.0:0.0:1.0	.	634;571	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	A	634;571	ENSP00000366243:D634A;ENSP00000366266:D571A	ENSP00000366243:D634A	D	-	2	0	TMEM2	73534862	1.000000	0.71417	0.357000	0.25798	0.981000	0.71138	7.579000	0.82511	2.177000	0.69029	0.528000	0.53228	GAT	TMEM2	-	superfamily_Pectin_lyase_fold/virulence	ENSG00000135048		0.453	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM2	HGNC	protein_coding	OTTHUMT00000052618.2	56	0.00	0	T	NM_013390		74345042	74345042	-1	no_errors	ENST00000377044	ensembl	human	known	69_37n	missense	38	34.48	20	SNP	1.000	G
TMEM235	283999	genome.wustl.edu	37	17	76235908	76235908	+	3'UTR	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr17:76235908C>G	ENST00000551068.3	+	0	828				TMEM235_ENST00000550981.3_3'UTR|TMEM235_ENST00000374946.3_3'UTR|TMEM235_ENST00000586400.1_3'UTR|TMEM235_ENST00000421688.1_Silent_p.A346A			A6NFC5	TM235_HUMAN	transmembrane protein 235							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			lung(1)	1						cccagatcgcctggcgccaga	0.612																																						dbGAP											0													29.0	34.0	32.0					17																	76235908		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC042066	CCDS56048.1, CCDS56046.1, CCDS56047.1	17q25.3	2011-02-18	2011-02-18	2011-02-18	ENSG00000204278	ENSG00000204278			27563	protein-coding gene	gene with protein product							Standard	NM_001204210		Approved		uc002jvk.3	A6NFC5		ENST00000551068.3:c.*35C>G	17.37:g.76235908C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JRE6	Silent	SNP	NULL	p.A346	ENST00000551068.3	37	c.1038	CCDS56046.1	17																																																																																			TMEM235	-	NULL	ENSG00000204278		0.612	TMEM235-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM235	HGNC	protein_coding	OTTHUMT00000408606.1	21	0.00	0	C	NM_001204211		76235908	76235908	+1	no_errors	ENST00000421688	ensembl	human	known	69_37n	silent	19	20.83	5	SNP	0.000	G
TNR	7143	genome.wustl.edu	37	1	175375432	175375432	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:175375432C>T	ENST00000367674.2	-	3	1127	c.419G>A	c.(418-420)cGg>cAg	p.R140Q	TNR_ENST00000263525.2_Missense_Mutation_p.R140Q			Q92752	TENR_HUMAN	tenascin R	140					associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CATCTCGATCCGGCTCAGCAG	0.597																																						dbGAP											0													142.0	124.0	130.0					1																	175375432		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.419G>A	1.37:g.175375432C>T	ENSP00000356646:p.Arg140Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_Fibronectin_type3	p.R140Q	ENST00000367674.2	37	c.419	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561824	0.86335	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.35421	1.31;1.31	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.64505	0.2604	M	0.81341	2.54	0.58432	D	0.999994	D;D	0.89917	0.999;1.0	D;D	0.83275	0.978;0.996	T	0.69672	-0.5082	10	0.87932	D	0	.	18.4464	0.90685	0.0:1.0:0.0:0.0	.	140;140	B4DIX8;Q92752	.;TENR_HUMAN	Q	140	ENSP00000356646:R140Q;ENSP00000263525:R140Q	ENSP00000263525:R140Q	R	-	2	0	TNR	173642055	1.000000	0.71417	0.963000	0.40424	0.950000	0.60333	7.711000	0.84669	2.445000	0.82738	0.561000	0.74099	CGG	TNR	-	NULL	ENSG00000116147		0.597	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	120	0.00	0	C	NM_003285		175375432	175375432	-1	no_errors	ENST00000263525	ensembl	human	known	69_37n	missense	33	45.00	27	SNP	1.000	T
TOP1	7150	genome.wustl.edu	37	20	39750739	39750739	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr20:39750739G>C	ENST00000361337.2	+	20	2389	c.2139G>C	c.(2137-2139)caG>caC	p.Q713H	RP1-1J6.2_ENST00000454626.1_RNA	NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	713					chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	AAAATAAACAGATTGCCCTGG	0.478			T	NUP98	AML*																																	dbGAP		Dom	yes		20	20q12-q13.1	7150	topoisomerase (DNA) I		L	0													97.0	92.0	94.0					20																	39750739		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.2139G>C	20.37:g.39750739G>C	ENSP00000354522:p.Gln713His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Missense_Mutation	SNP	pfam_TopoI_DNA-bd_euk,pfam_TopoI_cat_euk,superfamily_TopoI_DNA-bd_euk,superfamily_DNA_brk_join_enz,superfamily_TopoI_insert_euk,smart_TopoI_euk,prints_TopoI	p.Q713H	ENST00000361337.2	37	c.2139	CCDS13312.1	20	.	.	.	.	.	.	.	.	.	.	G	14.45	2.538502	0.45176	.	.	ENSG00000198900	ENST00000361337	T	0.44482	0.92	5.63	-4.13	0.03904	DNA breaking-rejoining enzyme, catalytic core (1);DNA topoisomerase I, C-terminal, eukaryotic-type (1);DNA topoisomerase I, catalytic core, alpha/beta subdomain, eukaryotic-type (1);	0.143822	0.64402	D	0.000005	T	0.48960	0.1529	M	0.88377	2.95	0.58432	D	0.999999	B	0.27882	0.192	B	0.32805	0.153	T	0.57046	-0.7878	10	0.62326	D	0.03	-26.0126	15.8033	0.78473	0.3979:0.0:0.6021:0.0	.	713	P11387	TOP1_HUMAN	H	713	ENSP00000354522:Q713H	ENSP00000354522:Q713H	Q	+	3	2	TOP1	39184153	1.000000	0.71417	0.966000	0.40874	0.904000	0.53231	1.248000	0.32827	-0.707000	0.05022	-1.934000	0.00508	CAG	TOP1	-	superfamily_DNA_brk_join_enz,smart_TopoI_euk	ENSG00000198900		0.478	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP1	HGNC	protein_coding	OTTHUMT00000080397.2	58	0.00	0	G			39750739	39750739	+1	no_errors	ENST00000361337	ensembl	human	known	69_37n	missense	77	18.09	17	SNP	0.994	C
TRBC2	28638	genome.wustl.edu	37	7	142498863	142498864	+	RNA	DNP	TG	TG	AA			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	T|G	T|G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr7:142498863_142498864TG>AA	ENST00000466254.1	+	0	139_140							A0A5B9	TRBC2_HUMAN	T cell receptor beta constant 2							integral component of membrane (GO:0016021)											AGCTGGTGGGTGAATGGGAAGG	0.614																																						dbGAP											0																																										-	-	-			0			M12888		7q34	2012-02-08			ENSG00000211772	ENSG00000211772		"""T cell receptors / TRB locus"""	12157	other	T cell receptor gene		615445				3860845, 8951372	Standard	NG_001333		Approved	TCRBC2		A0A5B9	OTTHUMG00000158912	Exception_encountered	7.37:g.142498863_142498864delinsAA		Somatic		WXS	Illumina GAIIx	Phase_IV		Nonstop_Mutation|Silent	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.*47R|p.*47	ENST00000466254.1	37	c.139|c.140		7																																																																																			TRBC2	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000211772		0.614	TRBC2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	TR_C_gene	TRBC2	HGNC	TR_C_gene	OTTHUMT00000352524.2	76|78	0.00	0	T|G	NG_001333		142498863|142498864	142498863|142498864	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000466254	ensembl	human	known	69_37n	nonstop|silent	50	23.08	15	SNP	1.000	A
TRPC3	7222	genome.wustl.edu	37	4	122825607	122825607	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr4:122825607A>G	ENST00000379645.3	-	8	2196	c.2123T>C	c.(2122-2124)gTg>gCg	p.V708A	TRPC3_ENST00000513531.1_Missense_Mutation_p.V580A|TRPC3_ENST00000264811.5_Missense_Mutation_p.V635A	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	623					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						ATATTTGAGCACAACGGAAGT	0.308																																						dbGAP											0													85.0	82.0	83.0					4																	122825607		2203	4298	6501	-	-	-	SO:0001583	missense	0			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.2123T>C	4.37:g.122825607A>G	ENSP00000368966:p.Val708Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPC3_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.V708A	ENST00000379645.3	37	c.2123	CCDS47130.1	4	.	.	.	.	.	.	.	.	.	.	A	21.1	4.096767	0.76870	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	D;D;D	0.98329	-4.87;-4.87;-4.87	5.77	5.77	0.91146	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.98604	0.9533	M	0.81497	2.545	0.80722	D	1	P;P;D	0.63880	0.766;0.869;0.993	P;P;D	0.69307	0.688;0.739;0.963	D	0.99951	1.1545	10	0.09084	T	0.74	-5.5867	16.3948	0.83586	1.0:0.0:0.0:0.0	.	623;580;708	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	A	635;708;580	ENSP00000264811:V635A;ENSP00000368966:V708A;ENSP00000426899:V580A	ENSP00000264811:V635A	V	-	2	0	TRPC3	123045057	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.178000	0.94855	2.326000	0.78906	0.533000	0.62120	GTG	TRPC3	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel,tigrfam_TRP_channel	ENSG00000138741		0.308	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC3	HGNC	protein_coding	OTTHUMT00000364252.1	72	0.00	0	A	NM_003305		122825607	122825607	-1	no_errors	ENST00000379645	ensembl	human	known	69_37n	missense	39	33.90	20	SNP	1.000	G
TUBA3E	112714	genome.wustl.edu	37	2	130949653	130949653	+	Silent	SNP	C	C	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:130949653C>T	ENST00000312988.7	-	5	1204	c.1104G>A	c.(1102-1104)ctG>ctA	p.L368L		NM_207312.2	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	368					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|kidney(7)|large_intestine(6)|lung(9)|skin(2)	28	Colorectal(110;0.1)					GCACCTTGGCCAGGTCTCCCC	0.582																																						dbGAP											0													31.0	32.0	31.0					2																	130949653		2203	4287	6490	-	-	-	SO:0001819	synonymous_variant	0			BC057811	CCDS2158.1	2q21.1	2007-03-16			ENSG00000152086	ENSG00000152086		"""Tubulins"""	20765	protein-coding gene	gene with protein product							Standard	NM_207312		Approved		uc002tqv.3	Q6PEY2	OTTHUMG00000131626	ENST00000312988.7:c.1104G>A	2.37:g.130949653C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin	p.L368	ENST00000312988.7	37	c.1104	CCDS2158.1	2																																																																																			TUBA3E	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Delta_tubulin	ENSG00000152086		0.582	TUBA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3E	HGNC	protein_coding	OTTHUMT00000254519.1	58	0.00	0	C	NM_207312		130949653	130949653	-1	no_errors	ENST00000312988	ensembl	human	known	69_37n	silent	14	73.58	39	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179445095	179445095	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:179445095C>G	ENST00000591111.1	-	267	62312	c.62088G>C	c.(62086-62088)gaG>gaC	p.E20696D	TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E19769D|TTN_ENST00000589042.1_Missense_Mutation_p.E22337D|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E13272D|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E13464D|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586707.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E13397D|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20696					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACAGCTGTTCTCCAGGGTTA	0.323																																						dbGAP											0													176.0	163.0	167.0					2																	179445095		1847	4092	5939	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.62088G>C	2.37:g.179445095C>G	ENSP00000465570:p.Glu20696Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E19769D	ENST00000591111.1	37	c.59307		2	.	.	.	.	.	.	.	.	.	.	C	10.54	1.377528	0.24944	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.45	3.37	0.38596	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.72961	0.3526	M	0.64676	1.99	0.44587	D	0.997558	D;D;D;D	0.61697	0.99;0.99;0.99;0.981	P;P;P;P	0.59012	0.85;0.85;0.85;0.793	T	0.73972	-0.3814	9	0.87932	D	0	.	8.4144	0.32662	0.0:0.7295:0.0:0.2705	.	13272;13397;13464;20696	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	19769;13272;13464;13397;13270	ENSP00000343764:E19769D;ENSP00000434586:E13272D;ENSP00000340554:E13464D;ENSP00000352154:E13397D	ENSP00000340554:E13464D	E	-	3	2	TTN	179153341	0.987000	0.35691	1.000000	0.80357	0.993000	0.82548	0.348000	0.20031	1.048000	0.40298	0.563000	0.77884	GAG	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2	ENSG00000155657		0.323	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	139	0.00	0	C	NM_133378		179445095	179445095	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	81	35.20	44	SNP	1.000	G
UBN2	254048	genome.wustl.edu	37	7	138968722	138968722	+	Missense_Mutation	SNP	C	C	T	rs200304697		TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr7:138968722C>T	ENST00000473989.3	+	15	3071	c.3071C>T	c.(3070-3072)aCg>aTg	p.T1024M	UBN2_ENST00000288561.8_Missense_Mutation_p.T941M	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	1024	Ser-rich.					extracellular space (GO:0005615)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						CAGATCTCCACGCAGGGTTTC	0.542																																						dbGAP											0													82.0	89.0	86.0					7																	138968722		2021	4176	6197	-	-	-	SO:0001583	missense	0			AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.3071C>T	7.37:g.138968722C>T	ENSP00000418648:p.Thr1024Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Missense_Mutation	SNP	NULL	p.T1024M	ENST00000473989.3	37	c.3071	CCDS43655.2	7	.	.	.	.	.	.	.	.	.	.	C	12.32	1.902698	0.33628	.	.	ENSG00000157741	ENST00000473989;ENST00000288561	T;T	0.36878	1.23;1.28	5.31	4.43	0.53597	.	0.298701	0.33127	N	0.005246	T	0.22360	0.0539	N	0.22421	0.69	0.28620	N	0.908233	P	0.36282	0.546	B	0.19666	0.026	T	0.14090	-1.0485	10	0.56958	D	0.05	-0.898	14.7457	0.69488	0.0:0.9293:0.0:0.0707	.	1024	Q6ZU65	UBN2_HUMAN	M	1024;941	ENSP00000418648:T1024M;ENSP00000288561:T941M	ENSP00000288561:T941M	T	+	2	0	UBN2	138619262	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.260000	0.65490	1.564000	0.49628	0.557000	0.71058	ACG	UBN2	-	NULL	ENSG00000157741		0.542	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBN2	HGNC	protein_coding	OTTHUMT00000349272.3	55	0.00	0	C	NM_173569		138968722	138968722	+1	no_errors	ENST00000473989	ensembl	human	known	69_37n	missense	28	48.15	26	SNP	1.000	T
UTP20	27340	genome.wustl.edu	37	12	101693508	101693508	+	Silent	SNP	G	G	A			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr12:101693508G>A	ENST00000261637.4	+	13	1653	c.1479G>A	c.(1477-1479)caG>caA	p.Q493Q		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	493					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GAAACGAACAGTTTCCAGTAT	0.358																																						dbGAP											0													61.0	63.0	62.0					12																	101693508		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.1479G>A	12.37:g.101693508G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3H4	Silent	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.Q493	ENST00000261637.4	37	c.1479	CCDS9081.1	12																																																																																			UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.358	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	34	0.00	0	G	NM_014503		101693508	101693508	+1	no_errors	ENST00000261637	ensembl	human	known	69_37n	silent	31	20.51	8	SNP	0.000	A
WDR33	55339	genome.wustl.edu	37	2	128471382	128471382	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr2:128471382C>T	ENST00000322313.4	-	18	3241	c.3083G>A	c.(3082-3084)cGg>cAg	p.R1028Q		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	1028					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		TTCACGTAACCGGTGGCCAAA	0.607																																						dbGAP											0													142.0	145.0	144.0					2																	128471382		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.3083G>A	2.37:g.128471382C>T	ENSP00000325377:p.Arg1028Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Collagen,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1028Q	ENST00000322313.4	37	c.3083	CCDS2150.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.198753	0.94997	.	.	ENSG00000136709	ENST00000322313	D	0.90385	-2.66	5.81	5.81	0.92471	.	0.070231	0.53938	D	0.000043	D	0.84942	0.5584	N	0.14661	0.345	0.80722	D	1	D	0.63880	0.993	B	0.44108	0.441	D	0.83919	0.0300	10	0.25106	T	0.35	-2.2672	20.0726	0.97729	0.0:1.0:0.0:0.0	.	1028	Q9C0J8	WDR33_HUMAN	Q	1028	ENSP00000325377:R1028Q	ENSP00000325377:R1028Q	R	-	2	0	WDR33	128187852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.784000	0.68990	2.738000	0.93877	0.655000	0.94253	CGG	WDR33	-	NULL	ENSG00000136709		0.607	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR33	HGNC	protein_coding	OTTHUMT00000331141.2	38	0.00	0	C	NM_018383		128471382	128471382	-1	no_errors	ENST00000322313	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	1.000	T
WRAP73	49856	genome.wustl.edu	37	1	3550035	3550035	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr1:3550035C>G	ENST00000270708.7	-	9	922	c.849G>C	c.(847-849)caG>caC	p.Q283H	WRAP73_ENST00000378322.3_Missense_Mutation_p.Q283H	NM_017818.3	NP_060288.3	Q9P2S5	WRP73_HUMAN	WD repeat containing, antisense to TP73	283						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)	12						CCAGTCCCAGCTGTGGGCTCT	0.622																																						dbGAP											0													23.0	27.0	25.0					1																	3550035		2198	4297	6495	-	-	-	SO:0001583	missense	0			AB034912, EF494669	CCDS48.1	1p36.3	2013-05-21	2011-04-13	2011-04-13	ENSG00000116213	ENSG00000116213		"""WD repeat domain containing"""	12759	protein-coding gene	gene with protein product		606040	"""WD repeat domain 8"""	WDR8			Standard	NM_017818		Approved		uc001ako.3	Q9P2S5	OTTHUMG00000000612	ENST00000270708.7:c.849G>C	1.37:g.3550035C>G	ENSP00000270708:p.Gln283His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T0D6|Q9BUH7|Q9NTK7|Q9NX56	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.Q283H	ENST00000270708.7	37	c.849	CCDS48.1	1	.	.	.	.	.	.	.	.	.	.	C	9.747	1.166420	0.21621	.	.	ENSG00000116213	ENST00000270708;ENST00000378322;ENST00000424367	T;T;T	0.47869	0.85;0.83;0.87	4.5	-1.07	0.09968	WD40 repeat-like-containing domain (1);	1.520630	0.03740	N	0.254898	T	0.32496	0.0831	L	0.28192	0.835	0.09310	N	1	B;B	0.29037	0.231;0.066	B;B	0.33690	0.081;0.168	T	0.18053	-1.0349	10	0.32370	T	0.25	-2.1877	0.7757	0.01032	0.2276:0.4078:0.1555:0.2091	.	283;238	Q9P2S5;Q5T0D5	WRP73_HUMAN;.	H	283;283;238	ENSP00000270708:Q283H;ENSP00000367573:Q283H;ENSP00000416192:Q238H	ENSP00000270708:Q283H	Q	-	3	2	WRAP73	3539895	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.546000	0.06062	0.061000	0.16311	-0.312000	0.09012	CAG	WRAP73	-	superfamily_WD40_repeat_dom	ENSG00000116213		0.622	WRAP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRAP73	HGNC	protein_coding	OTTHUMT00000001470.1	17	0.00	0	C			3550035	3550035	-1	no_errors	ENST00000270708	ensembl	human	known	69_37n	missense	15	40.00	10	SNP	0.000	G
XRN1	54464	genome.wustl.edu	37	3	142137414	142137414	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr3:142137414A>T	ENST00000264951.4	-	12	1395	c.1278T>A	c.(1276-1278)ttT>ttA	p.F426L	XRN1_ENST00000544157.1_Missense_Mutation_p.F216L|RNU1-100P_ENST00000365255.1_RNA|XRN1_ENST00000392981.2_Missense_Mutation_p.F426L|XRN1_ENST00000463916.1_Missense_Mutation_p.F426L	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	426					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						ACTCAGTTTCAAATAGGTCAT	0.328																																						dbGAP											0													126.0	125.0	125.0					3																	142137414		2203	4297	6500	-	-	-	SO:0001583	missense	0			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1278T>A	3.37:g.142137414A>T	ENSP00000264951:p.Phe426Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	pfam_Put_53exo,pirsf_5_3_exoribonuclease_1	p.F426L	ENST00000264951.4	37	c.1278	CCDS3123.1	3	.	.	.	.	.	.	.	.	.	.	A	17.01	3.278051	0.59758	.	.	ENSG00000114127	ENST00000264951;ENST00000392981;ENST00000463916;ENST00000544157	T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93	5.49	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.75466	0.3853	M	0.69823	2.125	0.80722	D	1	P;D;B;B;B	0.55605	0.652;0.972;0.012;0.113;0.024	P;P;B;B;B	0.48524	0.58;0.488;0.032;0.032;0.014	T	0.72293	-0.4336	10	0.23891	T	0.37	-19.6107	11.5191	0.50541	0.9292:0.0:0.0708:0.0	.	216;426;287;426;426	B4E2K3;Q8IZH2-3;B3KW17;Q8IZH2-2;Q8IZH2	.;.;.;.;XRN1_HUMAN	L	426;426;426;216	ENSP00000264951:F426L;ENSP00000376707:F426L;ENSP00000418404:F426L;ENSP00000444310:F216L	ENSP00000264951:F426L	F	-	3	2	XRN1	143620104	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.662000	0.68032	0.896000	0.36366	0.383000	0.25322	TTT	XRN1	-	pirsf_5_3_exoribonuclease_1	ENSG00000114127		0.328	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	100	0.00	0	A	NM_019001		142137414	142137414	-1	no_errors	ENST00000264951	ensembl	human	known	69_37n	missense	106	20.90	28	SNP	1.000	T
ZNF302	55900	genome.wustl.edu	37	19	35174103	35174103	+	Silent	SNP	T	T	C			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr19:35174103T>C	ENST00000446502.2	+	5	514	c.306T>C	c.(304-306)gaT>gaC	p.D102D	ZNF302_ENST00000507959.1_Silent_p.D59D|ZNF302_ENST00000505242.1_Silent_p.D58D|ZNF302_ENST00000505365.2_Silent_p.D58D|ZNF302_ENST00000423823.2_Silent_p.D58D|ZNF302_ENST00000509528.1_Intron|ZNF302_ENST00000457781.2_Silent_p.D58D			Q9NR11	ZN302_HUMAN	zinc finger protein 302	58					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(2)|skin(1)	6	all_lung(56;6.16e-07)|Lung NSC(56;9.71e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			TATTGGAGGATGGAAAAGAGC	0.383																																						dbGAP											0													133.0	131.0	132.0					19																	35174103		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF155656	CCDS46042.1, CCDS74330.1, CCDS74331.1, CCDS74332.1, CCDS74333.1	19q13.2	2013-01-08			ENSG00000089335	ENSG00000089335		"""Zinc fingers, C2H2-type"", ""-"""	13848	protein-coding gene	gene with protein product							Standard	NM_018675		Approved	ZNF327, ZNF135L, ZNF140L	uc002nvq.1	Q9NR11	OTTHUMG00000163329	ENST00000446502.2:c.306T>C	19.37:g.35174103T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q658J3|Q9BZD8|Q9P0J4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D58	ENST00000446502.2	37	c.174		19																																																																																			ZNF302	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000089335		0.383	ZNF302-004	NOVEL	basic|exp_conf	protein_coding	ZNF302	HGNC	protein_coding	OTTHUMT00000372731.1	98	0.00	0	T			35174103	35174103	+1	no_errors	ENST00000423823	ensembl	human	known	69_37n	silent	52	27.78	20	SNP	0.969	C
ZNF445	353274	genome.wustl.edu	37	3	44488277	44488277	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr3:44488277G>T	ENST00000396077.2	-	8	3233	c.2886C>A	c.(2884-2886)agC>agA	p.S962R	ZNF445_ENST00000425708.2_Missense_Mutation_p.S962R	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	962					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		TGAGCCTGGAGCTCTGGCTGC	0.468																																						dbGAP											0													134.0	131.0	132.0					3																	44488277		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.2886C>A	3.37:g.44488277G>T	ENSP00000379387:p.Ser962Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJD1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.S962R	ENST00000396077.2	37	c.2886	CCDS2713.1	3	.	.	.	.	.	.	.	.	.	.	G	8.579	0.881770	0.17467	.	.	ENSG00000185219	ENST00000425708;ENST00000396077	T;T	0.05855	3.38;3.38	4.79	-0.249	0.13011	.	0.306844	0.28952	N	0.013603	T	0.03390	0.0098	L	0.31420	0.93	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.10450	0.005;0.005	T	0.41161	-0.9524	10	0.19590	T	0.45	.	1.7751	0.03020	0.1731:0.2996:0.3735:0.1538	.	950;962	B7ZKX2;P59923	.;ZN445_HUMAN	R	962	ENSP00000413073:S962R;ENSP00000379387:S962R	ENSP00000379387:S962R	S	-	3	2	ZNF445	44463281	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.068000	0.11561	-0.051000	0.13334	-0.175000	0.13238	AGC	ZNF445	-	NULL	ENSG00000185219		0.468	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF445	HGNC	protein_coding	OTTHUMT00000256647.2	107	0.00	0	G	NM_181489		44488277	44488277	-1	no_errors	ENST00000396077	ensembl	human	known	69_37n	missense	16	54.29	19	SNP	0.000	T
ZNF816	125893	genome.wustl.edu	37	19	53453742	53453742	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr19:53453742A>T	ENST00000357666.4	-	5	1586	c.1286T>A	c.(1285-1287)gTt>gAt	p.V429D	ZNF321P_ENST00000391777.3_Intron|ZNF816_ENST00000444460.2_Missense_Mutation_p.V429D|ZNF816_ENST00000434371.2_Intron	NM_001031665.2	NP_001026835.1	Q0VGE8	ZN816_HUMAN	zinc finger protein 816	429					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(10)|lung(9)|stomach(1)|urinary_tract(2)	27						CTTGTCACAAACCTTACATTT	0.393																																						dbGAP											0													117.0	119.0	118.0					19																	53453742		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC063805	CCDS33096.1	19q13.41	2013-01-08	2010-07-23	2010-07-23		ENSG00000180257		"""Zinc fingers, C2H2-type"", ""-"""	26995	protein-coding gene	gene with protein product			"""zinc finger protein 816A"""	ZNF816A			Standard	NM_001031665		Approved		uc002qam.2	Q0VGE8		ENST00000357666.4:c.1286T>A	19.37:g.53453742A>T	ENSP00000350295:p.Val429Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7H5|Q3KR39|Q659B3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V429D	ENST00000357666.4	37	c.1286	CCDS33096.1	19	.	.	.	.	.	.	.	.	.	.	-	6.493	0.459222	0.12342	.	.	ENSG00000180257	ENST00000357666;ENST00000444460	T;T	0.11063	2.81;2.81	1.79	-1.83	0.07833	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07863	0.0197	L	0.35341	1.055	0.09310	N	1	B	0.10296	0.003	B	0.20577	0.03	T	0.35674	-0.9779	9	0.46703	T	0.11	.	5.9837	0.19421	0.3927:0.0:0.0:0.6073	.	429	Q0VGE8	ZN816_HUMAN	D	429	ENSP00000350295:V429D;ENSP00000403266:V429D	ENSP00000350295:V429D	V	-	2	0	ZNF816	58145554	0.000000	0.05858	0.001000	0.08648	0.047000	0.14425	-0.045000	0.12003	-0.706000	0.05028	0.172000	0.16884	GTT	ZNF816	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000180257		0.393	ZNF816-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF816	HGNC	protein_coding	OTTHUMT00000396132.1	72	0.00	0	A	NM_001031665		53453742	53453742	-1	no_errors	ENST00000357666	ensembl	human	known	69_37n	missense	62	31.11	28	SNP	0.014	T
ZNF525	170958	genome.wustl.edu	37	19	53884173	53884173	+	5'Flank	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr19:53884173C>G	ENST00000355326.3	+	0	0				ZNF525_ENST00000474037.1_Missense_Mutation_p.T114R|ZNF525_ENST00000475179.1_Intron|ZNF525_ENST00000593918.1_Intron|ZNF525_ENST00000600148.1_3'UTR|ZNF525_ENST00000467003.1_Missense_Mutation_p.T78R			Q8N782	ZN525_HUMAN	zinc finger protein 525						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						GCACCCATGACAAAAATCAAA	0.368																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277		19.37:g.53884173C>G	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TF23	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T114R	ENST00000355326.3	37	c.341		19	.	.	.	.	.	.	.	.	.	.	C	11.28	1.592468	0.28357	.	.	ENSG00000203326	ENST00000474037;ENST00000467003	T;T	0.09630	3.15;2.96	0.785	0.785	0.18584	.	.	.	.	.	T	0.07007	0.0178	.	.	.	0.20563	N	0.999885	.	.	.	.	.	.	T	0.41502	-0.9505	6	0.24483	T	0.36	.	4.6163	0.12428	0.0:0.7635:0.0:0.2365	.	.	.	.	R	114;78	ENSP00000417696:T114R;ENSP00000419136:T78R	ENSP00000419136:T78R	T	+	2	0	ZNF525	58575985	0.000000	0.05858	0.054000	0.19295	0.141000	0.21300	-0.369000	0.07533	0.724000	0.32296	0.298000	0.19748	ACA	ZNF525	-	NULL	ENSG00000203326		0.368	ZNF525-201	KNOWN	basic	protein_coding	ZNF525	HGNC	protein_coding		83	0.00	0	C	NR_003699		53884173	53884173	+1	no_errors	ENST00000474037	ensembl	human	putative	69_37n	missense	47	29.85	20	SNP	0.181	G
ZSCAN23	222696	genome.wustl.edu	37	6	28402746	28402746	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr6:28402746C>G	ENST00000289788.4	-	4	811	c.666G>C	c.(664-666)caG>caC	p.Q222H	ZSCAN23_ENST00000486481.1_5'UTR	NM_001012455.1	NP_001012458.1	Q3MJ62	ZSC23_HUMAN	zinc finger and SCAN domain containing 23	222					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)|stomach(2)	4						ACTCAGGAATCTGAGTAATAT	0.438																																						dbGAP											0													57.0	49.0	51.0					6																	28402746		692	1591	2283	-	-	-	SO:0001583	missense	0			AK092117	CCDS47393.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000187987	ENSG00000187987		"""-"", ""Zinc fingers, C2H2-type"""	21193	protein-coding gene	gene with protein product			"""zinc finger protein 453"", ""zinc finger protein 390"""	ZNF453, ZNF390			Standard	NM_001012455		Approved	dJ29K1.3.1	uc003nli.4	Q3MJ62	OTTHUMG00000016346	ENST00000289788.4:c.666G>C	6.37:g.28402746C>G	ENSP00000289788:p.Gln222His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96KV9	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q222H	ENST00000289788.4	37	c.666	CCDS47393.1	6	.	.	.	.	.	.	.	.	.	.	C	10.30	1.310805	0.23821	.	.	ENSG00000187987	ENST00000289788	T	0.06449	3.3	4.32	-0.761	0.11038	.	0.810925	0.10412	N	0.677754	T	0.01940	0.0061	L	0.42245	1.32	0.09310	N	1	P	0.36438	0.553	B	0.35550	0.205	T	0.43065	-0.9414	10	0.48119	T	0.1	.	7.3436	0.26650	0.0:0.4113:0.0:0.5887	.	222	Q3MJ62	ZSC23_HUMAN	H	222	ENSP00000289788:Q222H	ENSP00000289788:Q222H	Q	-	3	2	ZSCAN23	28510725	0.000000	0.05858	0.001000	0.08648	0.911000	0.54048	-0.313000	0.08103	-0.062000	0.13088	0.650000	0.86243	CAG	ZSCAN23	-	NULL	ENSG00000187987		0.438	ZSCAN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN23	HGNC	protein_coding	OTTHUMT00000043751.2	34	0.00	0	C	XM_167147		28402746	28402746	-1	no_errors	ENST00000289788	ensembl	human	known	69_37n	missense	22	35.29	12	SNP	0.000	G
ZWILCH	55055	genome.wustl.edu	37	15	66819708	66819708	+	Missense_Mutation	SNP	G	G	C	rs374210878		TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr15:66819708G>C	ENST00000307897.5	+	9	1280	c.900G>C	c.(898-900)caG>caC	p.Q300H	ZWILCH_ENST00000446801.2_Missense_Mutation_p.Q186H|ZWILCH_ENST00000565627.1_Missense_Mutation_p.Q186H|ZWILCH_ENST00000535141.2_Missense_Mutation_p.Q186H|RPL4_ENST00000568588.1_5'Flank	NM_017975.3	NP_060445.3	Q9H900	ZWILC_HUMAN	zwilch kinetochore protein	300					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(1)|lung(6)|ovary(1)	18						AACTTGTTCAGGAATTTCTGA	0.348																																						dbGAP											0													103.0	103.0	103.0					15																	66819708		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK023175	CCDS10219.1, CCDS73746.1	15q22.31	2013-01-17	2012-12-13		ENSG00000174442	ENSG00000174442			25468	protein-coding gene	gene with protein product		609984	"""Zwilch, kinetochore associated, homolog (Drosophila)"""			12686595	Standard	NM_017975		Approved	FLJ10036, KNTC1AP	uc002aqb.3	Q9H900	OTTHUMG00000133194	ENST00000307897.5:c.900G>C	15.37:g.66819708G>C	ENSP00000311429:p.Gln300His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVB8|Q6N049|Q8N404|Q96SY7|Q9NWG7	Missense_Mutation	SNP	pfam_RZZ-complex_zwilch	p.Q300H	ENST00000307897.5	37	c.900	CCDS10219.1	15	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522927	0.64747	.	.	ENSG00000174442	ENST00000307897;ENST00000446801;ENST00000535141	T;T;T	0.47528	0.84;0.84;0.84	5.83	3.97	0.46021	.	0.163794	0.53938	D	0.000047	T	0.65312	0.2679	M	0.71581	2.175	0.47441	D	0.999423	D	0.89917	1.0	D	0.79784	0.993	T	0.66960	-0.5791	10	0.66056	D	0.02	-15.6499	11.6618	0.51352	0.1421:0.0:0.8579:0.0	.	300	Q9H900	ZWILC_HUMAN	H	300;186;186	ENSP00000311429:Q300H;ENSP00000402217:Q186H;ENSP00000437749:Q186H	ENSP00000311429:Q300H	Q	+	3	2	ZWILCH	64606762	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.015000	0.29963	0.829000	0.34733	0.655000	0.94253	CAG	ZWILCH	-	pfam_RZZ-complex_zwilch	ENSG00000174442		0.348	ZWILCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZWILCH	HGNC	protein_coding	OTTHUMT00000256904.4	113	0.00	0	G	NM_017975		66819708	66819708	+1	no_errors	ENST00000307897	ensembl	human	known	69_37n	missense	133	20.36	34	SNP	1.000	C
ZXDC	79364	genome.wustl.edu	37	3	126191121	126191121	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27H-01A-11D-A16D-09	TCGA-D8-A27H-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78e51220-c9f8-44b2-bc1c-b34a56af3b54	2a7c7ae5-3522-4626-8f91-1ffb98df5c70	g.chr3:126191121C>G	ENST00000389709.3	-	2	988	c.935G>C	c.(934-936)aGt>aCt	p.S312T	ZXDC_ENST00000336332.5_Missense_Mutation_p.S312T	NM_025112.4	NP_079388.3	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C	312					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|LRR domain binding (GO:0030275)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(1)	17				GBM - Glioblastoma multiforme(114;0.155)		AAACAGGGCACTCACTGTGAT	0.473																																						dbGAP											0													83.0	88.0	86.0					3																	126191121		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK023923	CCDS43145.1, CCDS43146.1	3q21.3	2014-02-12			ENSG00000070476	ENSG00000070476		"""Zinc fingers, C2H2-type"""	28160	protein-coding gene	gene with protein product		615746				8619474, 9110174	Standard	XM_005247757		Approved	MGC11349, FLJ13861	uc003eiv.3	Q2QGD7	OTTHUMG00000162754	ENST00000389709.3:c.935G>C	3.37:g.126191121C>G	ENSP00000374359:p.Ser312Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C5J0H9|Q6DKI8|Q7L3L1|Q8NAU2	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S312T	ENST00000389709.3	37	c.935	CCDS43145.1	3	.	.	.	.	.	.	.	.	.	.	C	10.67	1.414446	0.25465	.	.	ENSG00000070476	ENST00000389709;ENST00000336332	T;T	0.36157	1.27;1.27	4.39	4.39	0.52855	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.048896	0.85682	D	0.000000	T	0.24353	0.0590	N	0.14661	0.345	0.46927	D	0.999251	P;P	0.46142	0.873;0.799	B;B	0.43225	0.412;0.234	T	0.05305	-1.0893	10	0.59425	D	0.04	-13.0245	10.8276	0.46643	0.0:0.8076:0.1924:0.0	.	312;312	Q2QGD7-2;Q2QGD7	.;ZXDC_HUMAN	T	312	ENSP00000374359:S312T;ENSP00000337694:S312T	ENSP00000337694:S312T	S	-	2	0	ZXDC	127673811	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	4.898000	0.63238	2.163000	0.67991	0.491000	0.48974	AGT	ZXDC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000070476		0.473	ZXDC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZXDC	HGNC	protein_coding	OTTHUMT00000370327.2	54	0.00	0	C	NM_025112		126191121	126191121	-1	no_errors	ENST00000389709	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	1.000	G
