#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC9	10060	genome.wustl.edu	37	12	22068664	22068664	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr12:22068664G>T	ENST00000261201.4	-	5	753	c.754C>A	c.(754-756)Cca>Aca	p.P252T	ABCC9_ENST00000261200.4_Missense_Mutation_p.P252T|ABCC9_ENST00000345162.2_Missense_Mutation_p.P252T	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	252					defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	ATTGCTATTGGCAATTTTCCA	0.358																																						dbGAP											0													151.0	139.0	143.0					12																	22068664		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.754C>A	12.37:g.22068664G>T	ENSP00000261201:p.Pro252Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.P252T	ENST00000261201.4	37	c.754	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	G	23.5	4.421096	0.83559	.	.	ENSG00000069431	ENST00000261200;ENST00000261201;ENST00000345162	D;D;D	0.92805	-3.1;-3.11;-3.09	4.91	4.91	0.64330	.	0.105524	0.64402	D	0.000002	D	0.95981	0.8691	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.992	D	0.95919	0.8929	10	0.54805	T	0.06	-14.1181	18.2902	0.90127	0.0:0.0:1.0:0.0	.	252;252	O60706;O60706-2	ABCC9_HUMAN;.	T	252	ENSP00000261200:P252T;ENSP00000261201:P252T;ENSP00000261202:P252T	ENSP00000261200:P252T	P	-	1	0	ABCC9	21959931	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.753000	0.85153	2.548000	0.85928	0.650000	0.86243	CCA	ABCC9	-	NULL	ENSG00000069431		0.358	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	59	0.00	0	G	NM_005691		22068664	22068664	-1	no_errors	ENST00000261200	ensembl	human	known	69_37n	missense	88	15.38	16	SNP	1.000	T
AHRR	57491	genome.wustl.edu	37	5	434764	434764	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr5:434764C>T	ENST00000505113.1	+	11	1965	c.1921C>T	c.(1921-1923)Cgg>Tgg	p.R641W	AHRR_ENST00000506456.1_Missense_Mutation_p.R497W|AHRR_ENST00000316418.5_Missense_Mutation_p.R659W|AHRR_ENST00000512529.1_Missense_Mutation_p.R487W	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	641	Needed for transcriptional repression. {ECO:0000250}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			GCTCTGTGCACGGGGCCGAGG	0.677																																						dbGAP											0													13.0	17.0	16.0					5																	434764		1987	4136	6123	-	-	-	SO:0001583	missense	0			AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.1921C>T	5.37:g.434764C>T	ENSP00000424601:p.Arg641Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Missense_Mutation	SNP	pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pfscan_PAS,pfscan_HLH_DNA-bd	p.R659W	ENST00000505113.1	37	c.1975	CCDS56355.1	5	.	.	.	.	.	.	.	.	.	.	C	15.64	2.892859	0.52121	.	.	ENSG00000063438	ENST00000505113;ENST00000316418;ENST00000512529;ENST00000506456	T;T;T;T	0.24350	2.18;2.18;1.87;1.86	4.66	-0.463	0.12164	.	3.972420	0.00465	N	0.000111	T	0.30572	0.0769	N	0.24115	0.695	0.09310	N	1	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.62298	0.814;0.642;0.9	T	0.16689	-1.0394	10	0.66056	D	0.02	.	1.9831	0.03430	0.2413:0.3293:0.318:0.1114	.	497;641;659	D6RE68;A9YTQ3;A9YTQ3-2	.;AHRR_HUMAN;.	W	641;659;487;497	ENSP00000424601:R641W;ENSP00000323816:R659W;ENSP00000424880:R487W;ENSP00000426932:R497W	ENSP00000323816:R659W	R	+	1	2	AHRR	487764	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.146000	0.10250	0.096000	0.17463	0.491000	0.48974	CGG	AHRR	-	NULL	ENSG00000063438		0.677	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	AHRR	HGNC	protein_coding	OTTHUMT00000367720.1	12	0.00	0	C	NM_020731		434764	434764	+1	no_errors	ENST00000316418	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	0.000	T
ADAMTS12	81792	genome.wustl.edu	37	5	33658359	33658359	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr5:33658359G>A	ENST00000504830.1	-	7	1455	c.1120C>T	c.(1120-1122)Cgc>Tgc	p.R374C	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.R374C|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	374	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R374S(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TTACAACTGCGGTGAGGCTGA	0.507										HNSCC(64;0.19)																												dbGAP											1	Substitution - Missense(1)	lung(1)											144.0	144.0	144.0					5																	33658359		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1120C>T	5.37:g.33658359G>A	ENSP00000422554:p.Arg374Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R374C	ENST00000504830.1	37	c.1120	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285488	0.80803	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	D;D	0.88124	-2.34;-2.34	6.17	5.28	0.74379	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.103576	0.64402	D	0.000004	D	0.93930	0.8057	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.917;0.993	D	0.94767	0.7941	10	0.87932	D	0	.	14.2657	0.66116	0.0:0.0:0.6053:0.3947	.	374;374	P58397-3;P58397	.;ATS12_HUMAN	C	374	ENSP00000422554:R374C;ENSP00000344847:R374C	ENSP00000344847:R374C	R	-	1	0	ADAMTS12	33694116	1.000000	0.71417	0.998000	0.56505	0.935000	0.57460	3.160000	0.50739	1.564000	0.49628	0.655000	0.94253	CGC	ADAMTS12	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000151388		0.507	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2	38	0.00	0	G	NM_030955		33658359	33658359	-1	no_errors	ENST00000504830	ensembl	human	known	69_37n	missense	56	20.00	14	SNP	1.000	A
AVIL	10677	genome.wustl.edu	37	12	58197340	58197341	+	Frame_Shift_Ins	INS	-	-	GT			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr12:58197340_58197341insGT	ENST00000257861.3	-	14	2213_2214	c.1783_1784insAC	c.(1783-1785)ctgfs	p.L595fs	RP11-571M6.17_ENST00000602802.1_lincRNA|AVIL_ENST00000550083.1_Intron|AVIL_ENST00000537081.1_Frame_Shift_Ins_p.L588fs|TSFM_ENST00000548851.1_Intron|RNU6-1083P_ENST00000384022.1_RNA	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	595	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					TTTCCCTCCCAGTAGGTCCCAG	0.589											OREG0021955	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.1782_1783dupAC	12.37:g.58197341_58197342dupGT	ENSP00000257861:p.Leu595fs	Somatic	1029	WXS	Illumina GAIIx	Phase_IV	B2RAU7|Q2NKM9	Frame_Shift_Ins	INS	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,prints_Gelsolin,pfscan_Villin_headpiece	p.L595fs	ENST00000257861.3	37	c.1784_1783	CCDS8959.1	12																																																																																			AVIL	-	smart_Gelsolin,prints_Gelsolin	ENSG00000135407		0.589	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVIL	HGNC	protein_coding	OTTHUMT00000409276.1	13	0.00	0	-	NM_006576		58197340	58197341	-1	no_errors	ENST00000257861	ensembl	human	known	69_37n	frame_shift_ins	36	14.29	6	INS	1.000:0.992	GT
CD200R1	131450	genome.wustl.edu	37	3	112648154	112648154	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr3:112648154C>A	ENST00000471858.1	-	3	566	c.334G>T	c.(334-336)Gat>Tat	p.D112Y	CD200R1_ENST00000440122.2_Missense_Mutation_p.D135Y|CD200R1_ENST00000490004.1_Missense_Mutation_p.D112Y|CD200R1_ENST00000295863.4_Missense_Mutation_p.D90Y|CD200R1_ENST00000308611.3_Missense_Mutation_p.D135Y	NM_170780.2	NP_740750.1	Q8TD46	MO2R1_HUMAN	CD200 receptor 1	112	Ig-like V-type.				regulation of immune response (GO:0050776)|viral process (GO:0016032)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	26						GAATTCTGATCAGGTCTGGAG	0.463																																						dbGAP											0													183.0	177.0	179.0					3																	112648154		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK126349	CCDS2969.1, CCDS2970.1, CCDS46889.1, CCDS54623.1	3q13	2014-05-15	2004-08-31	2004-09-01	ENSG00000163606	ENSG00000163606		"""Immunoglobulin superfamily / C2-set domain containing"""	24235	protein-coding gene	gene with protein product		607546	"""MOX2 receptor"""	MOX2R		10981966, 11133863	Standard	NM_138806		Approved	OX2R, HCRTR2, CD200R	uc003dzj.1	Q8TD46	OTTHUMG00000159298	ENST00000471858.1:c.334G>T	3.37:g.112648154C>A	ENSP00000418928:p.Asp112Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWZ9|E9PCM9|Q52LJ7|Q6IS95|Q6UW94|Q6WHB8|Q8TD44|Q8TD45|Q8TD52	Missense_Mutation	SNP	pfam_CD80_C2-set,pfscan_Ig-like	p.D135Y	ENST00000471858.1	37	c.403	CCDS2970.1	3	.	.	.	.	.	.	.	.	.	.	C	10.89	1.478648	0.26511	.	.	ENSG00000163606	ENST00000471858;ENST00000308611;ENST00000295863;ENST00000440122;ENST00000490004	T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46	5.47	2.63	0.31362	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.427571	0.23876	N	0.043682	T	0.46171	0.1379	M	0.79475	2.455	0.29414	N	0.861001	D;D;D;D;D	0.89917	1.0;0.999;1.0;0.998;1.0	D;D;D;P;D	0.76071	0.987;0.943;0.967;0.879;0.967	T	0.45116	-0.9283	10	0.10111	T	0.7	.	6.1756	0.20441	0.1487:0.6913:0.0:0.16	.	90;112;135;112;135	B4E2U2;Q8TD46-3;Q8TD46-2;Q8TD46;Q8TD46-4	.;.;.;MO2R1_HUMAN;.	Y	112;135;90;135;112	ENSP00000418928:D112Y;ENSP00000311035:D135Y;ENSP00000295863:D90Y;ENSP00000405733:D135Y;ENSP00000418801:D112Y	ENSP00000295863:D90Y	D	-	1	0	CD200R1	114130844	0.253000	0.23982	0.030000	0.17652	0.025000	0.11179	1.418000	0.34782	0.247000	0.21414	-0.262000	0.10625	GAT	CD200R1	-	NULL	ENSG00000163606		0.463	CD200R1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD200R1	HGNC	protein_coding	OTTHUMT00000354467.1	108	0.00	0	C	NM_138806		112648154	112648154	-1	no_errors	ENST00000308611	ensembl	human	known	69_37n	missense	149	10.78	18	SNP	0.552	A
CDH1	999	genome.wustl.edu	37	16	68842433	68842433	+	Frame_Shift_Del	DEL	A	A	-			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr16:68842433delA	ENST00000261769.5	+	4	685	c.494delA	c.(493-495)gaafs	p.E165fs	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Frame_Shift_Del_p.E165fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	165	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)|p.V157_Q177del(1)|p.E165_P170del(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		AGCTGCCCAGAAAATGAAAAA	0.463			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	4	Unknown(2)|Deletion - In frame(2)	breast(2)|lung(1)|stomach(1)											62.0	62.0	62.0					16																	68842433		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.494delA	16.37:g.68842433delA	ENSP00000261769:p.Glu165fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N166fs	ENST00000261769.5	37	c.494	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin,superfamily_Cadherin-like	ENSG00000039068		0.463	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	39	0.00	0	A	NM_004360		68842433	68842433	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_del	38	26.92	14	DEL	1.000	-
CNTRL	11064	genome.wustl.edu	37	9	123922564	123922564	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr9:123922564G>A	ENST00000373855.1	+	32	5333	c.5073G>A	c.(5071-5073)atG>atA	p.M1691I	CNTRL_ENST00000373850.1_Missense_Mutation_p.M1139I|CNTRL_ENST00000373844.1_Missense_Mutation_p.M136I|CNTRL_ENST00000238341.5_Missense_Mutation_p.M1691I|CNTRL_ENST00000373845.2_3'UTR			Q7Z7A1	CNTRL_HUMAN	centriolin	1691					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						TAAGGCAGATGTCTAAACATA	0.308																																						dbGAP											0													70.0	82.0	78.0					9																	123922564		2202	4289	6491	-	-	-	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.5073G>A	9.37:g.123922564G>A	ENSP00000362962:p.Met1691Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.M1691I	ENST00000373855.1	37	c.5073	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	G	2.966	-0.213450	0.06140	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373850;ENST00000373845;ENST00000373844	T;T;T	0.28666	1.6;1.6;1.6	5.62	4.62	0.57501	.	.	.	.	.	T	0.14227	0.0344	N	0.17474	0.49	0.24266	N	0.99526	B	0.06786	0.001	B	0.01281	0.0	T	0.29243	-1.0018	9	0.14252	T	0.57	.	1.1511	0.01786	0.1727:0.2066:0.4077:0.2129	.	1691	Q7Z7A1	CNTRL_HUMAN	I	1691;1691;1691;447;1139;373;136	ENSP00000362962:M1691I;ENSP00000238341:M1691I;ENSP00000362956:M1139I	ENSP00000238341:M1691I	M	+	3	0	CNTRL	122962385	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.990000	0.40717	2.642000	0.89623	0.591000	0.81541	ATG	CNTRL	-	NULL	ENSG00000119397		0.308	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	13	0.00	0	G	NM_007018		123922564	123922564	+1	no_errors	ENST00000238341	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	1.000	A
CROCCP2	84809	genome.wustl.edu	37	1	16946407	16946407	+	lincRNA	SNP	T	T	G	rs10796418		TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr1:16946407T>G	ENST00000412962.1	-	0	1112				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											AGCAATCTCCTCACTCAGCTG	0.672																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16946407T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.672	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	46	0.00	0	T	NR_026752.1		16946407	16946407	-1	no_errors	ENST00000412962	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	1.000	G
CSPP1	79848	genome.wustl.edu	37	8	68062079	68062079	+	Silent	SNP	A	A	G			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr8:68062079A>G	ENST00000262210.5	+	16	2053	c.2022A>G	c.(2020-2022)acA>acG	p.T674T	CSPP1_ENST00000412460.1_Intron	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	709	Poly-Gly.				positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			ATGCAAGAACATATGAAGATA	0.353																																						dbGAP											0													223.0	219.0	220.0					8																	68062079		1859	4089	5948	-	-	-	SO:0001819	synonymous_variant	0			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.2022A>G	8.37:g.68062079A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND63|Q70F00|Q8TBC1	Silent	SNP	NULL	p.T674	ENST00000262210.5	37	c.2022	CCDS43744.1	8																																																																																			CSPP1	-	NULL	ENSG00000104218		0.353	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSPP1	HGNC	protein_coding	OTTHUMT00000379254.1	47	0.00	0	A	NM_024790		68062079	68062079	+1	no_errors	ENST00000262210	ensembl	human	known	69_37n	silent	84	16.83	17	SNP	0.175	G
FAM189A1	23359	genome.wustl.edu	37	15	29443953	29443953	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr15:29443953G>C	ENST00000261275.4	-	5	613	c.614C>G	c.(613-615)tCc>tGc	p.S205C		NM_015307.1	NP_056122.1	O60320	F1891_HUMAN	family with sequence similarity 189, member A1	205						integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|kidney(1)|lung(1)|stomach(1)	7						CAGGACATCGGAGGAGACCAT	0.582																																						dbGAP											0													125.0	110.0	114.0					15																	29443953		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45198.1	15q12	2014-02-12				ENSG00000104059			29075	protein-coding gene	gene with protein product	"""transmembrane protein 228"""					9628581	Standard	NM_015307		Approved	KIAA0574, TMEM228	uc010azk.1	O60320		ENST00000261275.4:c.614C>G	15.37:g.29443953G>C	ENSP00000261275:p.Ser205Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK09	Missense_Mutation	SNP	pfam_CD20-like	p.S205C	ENST00000261275.4	37	c.614	CCDS45198.1	15	.	.	.	.	.	.	.	.	.	.	G	15.64	2.893215	0.52121	.	.	ENSG00000104059	ENST00000261275	T	0.03413	3.94	5.14	4.22	0.49857	.	0.426260	0.23756	N	0.044878	T	0.06600	0.0169	L	0.50333	1.59	0.09310	N	0.999993	D	0.56521	0.976	P	0.46975	0.533	T	0.17899	-1.0354	10	0.52906	T	0.07	-30.6529	11.6693	0.51391	0.0876:0.0:0.9124:0.0	.	205	O60320	F1891_HUMAN	C	205	ENSP00000261275:S205C	ENSP00000261275:S205C	S	-	2	0	FAM189A1	27231245	0.996000	0.38824	0.002000	0.10522	0.647000	0.38526	5.783000	0.68982	1.297000	0.44761	0.563000	0.77884	TCC	FAM189A1	-	NULL	ENSG00000104059		0.582	FAM189A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM189A1	HGNC	protein_coding	OTTHUMT00000417254.1	33	0.00	0	G	NM_015307		29443953	29443953	-1	no_errors	ENST00000261275	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	0.332	C
GABRA1	2554	genome.wustl.edu	37	5	161324182	161324182	+	Silent	SNP	C	C	T			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr5:161324182C>T	ENST00000428797.2	+	11	1480	c.1125C>T	c.(1123-1125)taC>taT	p.Y375Y	GABRA1_ENST00000420560.1_Silent_p.Y375Y|GABRA1_ENST00000444819.1_Silent_p.Y375Y|GABRA1_ENST00000393943.4_Silent_p.Y375Y|GABRA1_ENST00000023897.6_Silent_p.Y375Y|GABRA1_ENST00000437025.2_Silent_p.Y375Y	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	375					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	CAACCAGCTACACCCCTAATT	0.443																																						dbGAP											0													104.0	115.0	111.0					5																	161324182		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.1125C>T	5.37:g.161324182C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQK6|Q8N629	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa1_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.Y375	ENST00000428797.2	37	c.1125	CCDS4357.1	5																																																																																			GABRA1	-	superfamily_Neurotrans-gated_channel_TM	ENSG00000022355		0.443	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA1	HGNC	protein_coding	OTTHUMT00000252702.2	56	0.00	0	C	NM_000806.5		161324182	161324182	+1	no_errors	ENST00000023897	ensembl	human	known	69_37n	silent	68	15.00	12	SNP	0.997	T
GPRC6A	222545	genome.wustl.edu	37	6	117130687	117130687	+	Silent	SNP	C	C	G	rs372861140		TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr6:117130687C>G	ENST00000310357.3	-	2	309	c.288G>C	c.(286-288)ggG>ggC	p.G96G	GPRC6A_ENST00000368549.3_Silent_p.G96G|GPRC6A_ENST00000530250.1_Silent_p.G96G	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	96					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		AGATTTCATACCCCAGTTTGA	0.403																																						dbGAP											0													116.0	107.0	110.0					6																	117130687		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.288G>C	6.37:g.117130687C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Silent	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_vmron_rcpt_2	p.G96	ENST00000310357.3	37	c.288	CCDS5112.1	6																																																																																			GPRC6A	-	pfam_ANF_lig-bd_rcpt,prints_GPCR_3	ENSG00000173612		0.403	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC6A	HGNC	protein_coding	OTTHUMT00000041966.2	55	0.00	0	C			117130687	117130687	-1	no_errors	ENST00000310357	ensembl	human	known	69_37n	silent	64	15.79	12	SNP	0.830	G
GTSE1	51512	genome.wustl.edu	37	22	46719150	46719150	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr22:46719150C>T	ENST00000454366.1	+	8	1708	c.1496C>T	c.(1495-1497)tCa>tTa	p.S499L		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	480					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		TCGTGCACGTCAGTTGGCAGG	0.547																																					GBM(153;542 1915 12487 29016 50495)	dbGAP											0													142.0	145.0	144.0					22																	46719150		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.1496C>T	22.37:g.46719150C>T	ENSP00000415430:p.Ser499Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Missense_Mutation	SNP	NULL	p.S499L	ENST00000454366.1	37	c.1496	CCDS14074.2	22	.	.	.	.	.	.	.	.	.	.	C	16.29	3.082597	0.55861	.	.	ENSG00000075218	ENST00000454366;ENST00000361934	T	0.09255	3.0	3.31	3.31	0.37934	.	0.749701	0.12358	N	0.475937	T	0.22003	0.0530	M	0.67953	2.075	0.09310	N	1	D;P	0.57571	0.98;0.939	P;P	0.54856	0.762;0.659	T	0.04216	-1.0968	10	0.37606	T	0.19	-4.7232	10.3851	0.44134	0.0:1.0:0.0:0.0	.	480;459	Q9NYZ3;B4DZT6	GTSE1_HUMAN;.	L	499;459	ENSP00000415430:S499L	ENSP00000354634:S459L	S	+	2	0	GTSE1	45097814	0.025000	0.19082	0.004000	0.12327	0.097000	0.18754	2.732000	0.47352	2.147000	0.66899	0.313000	0.20887	TCA	GTSE1	-	NULL	ENSG00000075218		0.547	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTSE1	HGNC	protein_coding	OTTHUMT00000318360.2	43	0.00	0	C	NM_016426		46719150	46719150	+1	no_errors	ENST00000454366	ensembl	human	known	69_37n	missense	30	16.22	6	SNP	0.004	T
IKBKAP	8518	genome.wustl.edu	37	9	111663920	111663920	+	Silent	SNP	G	G	A			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr9:111663920G>A	ENST00000374647.5	-	17	2203	c.1896C>T	c.(1894-1896)atC>atT	p.I632I	IKBKAP_ENST00000537196.1_Silent_p.I283I	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	632					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CAATGTCATTGATGAAAAAGC	0.423																																						dbGAP											0													159.0	140.0	146.0					9																	111663920		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.1896C>T	9.37:g.111663920G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSV2|Q9H327|Q9UG87	Silent	SNP	pfam_IKI3,superfamily_ARM-type_fold,superfamily_UBA-like,pirsf_IKI3	p.I632	ENST00000374647.5	37	c.1896	CCDS6773.1	9																																																																																			IKBKAP	-	pfam_IKI3,pirsf_IKI3	ENSG00000070061		0.423	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKAP	HGNC	protein_coding	OTTHUMT00000053574.1	39	0.00	0	G			111663920	111663920	-1	no_errors	ENST00000374647	ensembl	human	known	69_37n	silent	61	15.28	11	SNP	1.000	A
KLB	152831	genome.wustl.edu	37	4	39439521	39439521	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr4:39439521G>A	ENST00000257408.4	+	3	1608	c.1511G>A	c.(1510-1512)cGa>cAa	p.R504Q		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	504	Glycosyl hydrolase-1 1.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						CAGATCATACGAGAAAATGGT	0.428																																						dbGAP											0													114.0	107.0	109.0					4																	39439521		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.1511G>A	4.37:g.39439521G>A	ENSP00000257408:p.Arg504Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3K8	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.R504Q	ENST00000257408.4	37	c.1511	CCDS3451.1	4	.	.	.	.	.	.	.	.	.	.	G	5.945	0.358344	0.11239	.	.	ENSG00000134962	ENST00000257408	T	0.30981	1.51	6.03	-2.21	0.06973	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.861630	0.10764	N	0.636753	T	0.15522	0.0374	N	0.12443	0.215	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.04013	0.001;0.001	T	0.32929	-0.9888	10	0.14656	T	0.56	-0.4478	12.8762	0.57991	0.5837:0.0:0.4163:0.0	.	504;504	B7ZL50;Q86Z14	.;KLOTB_HUMAN	Q	504	ENSP00000257408:R504Q	ENSP00000257408:R504Q	R	+	2	0	KLB	39115916	0.000000	0.05858	0.710000	0.30468	0.766000	0.43426	-0.358000	0.07641	-0.604000	0.05760	-0.140000	0.14226	CGA	KLB	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000134962		0.428	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLB	HGNC	protein_coding	OTTHUMT00000250429.1	55	0.00	0	G	NM_175737		39439521	39439521	+1	no_errors	ENST00000257408	ensembl	human	known	69_37n	missense	64	15.38	12	SNP	0.001	A
LGALS2	3957	genome.wustl.edu	37	22	37966365	37966365	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr22:37966365C>A	ENST00000215886.4	-	4	478	c.304G>T	c.(304-306)Gag>Tag	p.E102*		NM_006498.2	NP_006489.1	P05162	LEG2_HUMAN	lectin, galactoside-binding, soluble, 2	102	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)|galactoside binding (GO:0016936)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)	11	Melanoma(58;0.0574)					AAAGTCAGCTCGTGCCCATCT	0.527																																					GBM(193;1840 2185 13711 20676 24505)	dbGAP											0													93.0	91.0	92.0					22																	37966365		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS13950.1	22q13.1	2011-08-04	2007-02-01		ENSG00000100079	ENSG00000100079		"""Lectins, galactoside-binding"""	6562	protein-coding gene	gene with protein product	"""galectin 2"""	150571				1988031, 15356130	Standard	NM_006498		Approved	HL14	uc003ata.3	P05162	OTTHUMG00000150590	ENST00000215886.4:c.304G>T	22.37:g.37966365C>A	ENSP00000215886:p.Glu102*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FGY4	Nonsense_Mutation	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	p.E102*	ENST00000215886.4	37	c.304	CCDS13950.1	22	.	.	.	.	.	.	.	.	.	.	C	11.36	1.615722	0.28801	.	.	ENSG00000100079	ENST00000215886	.	.	.	5.83	-4.59	0.03400	.	1.284180	0.04840	N	0.440320	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-7.5266	19.8599	0.96779	0.0663:0.7826:0.1512:0.0	.	.	.	.	X	102	.	ENSP00000215886:E102X	E	-	1	0	LGALS2	36296311	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	-1.970000	0.01504	-0.461000	0.06993	-0.270000	0.10280	GAG	LGALS2	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	ENSG00000100079		0.527	LGALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS2	HGNC	protein_coding	OTTHUMT00000318991.1	54	0.00	0	C	NM_006498		37966365	37966365	-1	no_errors	ENST00000215886	ensembl	human	known	69_37n	nonsense	48	11.11	6	SNP	0.009	A
MAS1L	116511	genome.wustl.edu	37	6	29455668	29455668	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr6:29455668delC	ENST00000377127.3	-	1	70	c.12delG	c.(10-12)gggfs	p.G4fs		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	4					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						AGCAAATTTTCCCCCAGACCA	0.562																																					NSCLC(153;755 1987 3859 11251 32945)	dbGAP											0													43.0	44.0	43.0					6																	29455668		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.12delG	6.37:g.29455668delC	ENSP00000366331:p.Gly4fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SUN5	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.I6fs	ENST00000377127.3	37	c.12	CCDS4661.1	6																																																																																			MAS1L	-	NULL	ENSG00000204687		0.562	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAS1L	HGNC	protein_coding	OTTHUMT00000076126.2	17	0.00	0	C	NM_052967		29455668	29455668	-1	no_errors	ENST00000377127	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	0.005	-
MBNL1	4154	genome.wustl.edu	37	3	152165442	152165442	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr3:152165442A>G	ENST00000463374.1	+	6	1406	c.895A>G	c.(895-897)Aag>Gag	p.K299E	MBNL1_ENST00000498502.1_Missense_Mutation_p.K299E|MBNL1_ENST00000357472.3_Missense_Mutation_p.K281E|MBNL1_ENST00000324196.5_Intron|MBNL1_ENST00000485910.1_Missense_Mutation_p.K213E|MBNL1_ENST00000282486.6_Missense_Mutation_p.K299E|MBNL1_ENST00000485509.1_Intron|MBNL1_ENST00000324210.5_Missense_Mutation_p.K281E|Y_RNA_ENST00000364347.1_RNA|MBNL1_ENST00000282488.7_Missense_Mutation_p.K213E|MBNL1_ENST00000545754.1_Missense_Mutation_p.K213E|MBNL1_ENST00000355460.2_Missense_Mutation_p.K281E|MBNL1_ENST00000492948.1_Missense_Mutation_p.K281E|MBNL1_ENST00000493459.1_Missense_Mutation_p.K242E	NM_207293.1	NP_997176.1	Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1	299					alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			CCCATTACCAAAGAGGCCTGC	0.393																																						dbGAP											0													95.0	94.0	94.0					3																	152165442		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000463374.1:c.895A>G	3.37:g.152165442A>G	ENSP00000418108:p.Lys299Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	Missense_Mutation	SNP	smart_Znf_CCCH	p.K299E	ENST00000463374.1	37	c.895	CCDS3165.1	3	.	.	.	.	.	.	.	.	.	.	A	20.3	3.967400	0.74131	.	.	ENSG00000152601	ENST00000282486;ENST00000282488;ENST00000355460;ENST00000493459;ENST00000324210;ENST00000498502;ENST00000545754;ENST00000357472;ENST00000485910;ENST00000463374;ENST00000465907;ENST00000492948	.	.	.	5.5	5.5	0.81552	.	0.130308	0.64402	D	0.000001	T	0.80798	0.4692	M	0.83953	2.67	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;0.995;1.0;1.0;1.0;1.0;0.998	D;D;D;D;D;D;D	0.91635	0.996;0.941;0.999;0.998;0.999;0.999;0.998	D	0.83883	0.0280	9	0.72032	D	0.01	.	15.6131	0.76744	1.0:0.0:0.0:0.0	.	213;213;299;281;242;281;281	Q9NR56-3;Q96RE3;Q9NR56;Q86UV8;Q86VM6;Q9NR56-2;Q96P92	.;.;MBNL1_HUMAN;.;.;.;.	E	299;213;281;242;281;299;213;281;213;299;213;281	.	ENSP00000282486:K299E	K	+	1	0	MBNL1	153648132	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.210000	0.95106	2.084000	0.62774	0.533000	0.62120	AAG	MBNL1	-	NULL	ENSG00000152601		0.393	MBNL1-006	KNOWN	basic|CCDS	protein_coding	MBNL1	HGNC	protein_coding	OTTHUMT00000353604.1	41	0.00	0	A	NM_021038		152165442	152165442	+1	no_errors	ENST00000282486	ensembl	human	known	69_37n	missense	59	15.71	11	SNP	1.000	G
MEGF10	84466	genome.wustl.edu	37	5	126792857	126792857	+	Silent	SNP	T	T	C			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr5:126792857T>C	ENST00000274473.6	+	26	3537	c.3270T>C	c.(3268-3270)aaT>aaC	p.N1090N	MEGF10_ENST00000503335.2_Silent_p.N1090N	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	1090	Necessary for formation of large intracellular vacuoles.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TATTCAGCAATAATGGGCGTC	0.428																																						dbGAP											0													145.0	125.0	132.0					5																	126792857		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.3270T>C	5.37:g.126792857T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DE5|Q8WUL3	Silent	SNP	pfam_EGF_laminin,pfam_EGF_extracell,superfamily_Proteinase_amylase_inhib_dom,smart_EGF-like,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.N1090	ENST00000274473.6	37	c.3270	CCDS4142.1	5																																																																																			MEGF10	-	NULL	ENSG00000145794		0.428	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF10	HGNC	protein_coding	OTTHUMT00000250973.2	46	0.00	0	T	NM_032446		126792857	126792857	+1	no_errors	ENST00000274473	ensembl	human	known	69_37n	silent	49	16.95	10	SNP	0.501	C
OR2T33	391195	genome.wustl.edu	37	1	248436177	248436177	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr1:248436177T>C	ENST00000318021.2	-	1	961	c.940A>G	c.(940-942)Aat>Gat	p.N314D		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	314						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TGGGCCTCATTTTGCTGGTGT	0.413																																						dbGAP											0													145.0	146.0	146.0					1																	248436177		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.940A>G	1.37:g.248436177T>C	ENSP00000324687:p.Asn314Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNN0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.N314D	ENST00000318021.2	37	c.940	CCDS31109.1	1	.	.	.	.	.	.	.	.	.	.	-	6.309	0.425114	0.11987	.	.	ENSG00000177212	ENST00000318021	T	0.00620	6.17	1.39	1.39	0.22231	.	.	.	.	.	T	0.00412	0.0013	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40136	-0.9579	9	0.12430	T	0.62	.	6.6243	0.22820	0.0:0.0:0.0:1.0	.	314	Q8NG76	O2T33_HUMAN	D	314	ENSP00000324687:N314D	ENSP00000324687:N314D	N	-	1	0	OR2T33	246502800	0.000000	0.05858	0.006000	0.13384	0.053000	0.15095	-1.432000	0.02430	0.895000	0.36342	0.147000	0.16070	AAT	OR2T33	-	NULL	ENSG00000177212		0.413	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T33	HGNC	protein_coding	OTTHUMT00000097354.1	35	0.00	0	T	NM_001004695		248436177	248436177	-1	no_errors	ENST00000318021	ensembl	human	known	69_37n	missense	43	18.87	10	SNP	0.015	C
PCDHGB1	56104	genome.wustl.edu	37	5	140730020	140730020	+	Missense_Mutation	SNP	C	C	T	rs373789913		TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr5:140730020C>T	ENST00000523390.1	+	1	193	c.193C>T	c.(193-195)Cgg>Tgg	p.R65W	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	65	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGAAAACTGCGGGTTAGTGC	0.512											OREG0016856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													82.0	81.0	81.0					5																	140730020		1880	4102	5982	-	-	-	SO:0001583	missense	0			AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.193C>T	5.37:g.140730020C>T	ENSP00000429273:p.Arg65Trp	Somatic	1658	WXS	Illumina GAIIx	Phase_IV	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R65W	ENST00000523390.1	37	c.193	CCDS54923.1	5	.	.	.	.	.	.	.	.	.	.	.	16.30	3.083704	0.55861	.	.	ENSG00000254221	ENST00000523390	T	0.38887	1.11	5.52	-1.18	0.09617	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.56077	0.1961	H	0.99286	4.5	0.09310	N	0.999999	P;P	0.41624	0.629;0.757	B;B	0.39419	0.168;0.299	T	0.56774	-0.7923	9	0.87932	D	0	.	2.4872	0.04601	0.3293:0.3409:0.2048:0.125	.	65;65	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	W	65	ENSP00000429273:R65W	ENSP00000429273:R65W	R	+	1	2	PCDHGB1	140710204	0.004000	0.15560	0.559000	0.28332	0.991000	0.79684	0.112000	0.15479	-0.472000	0.06881	0.563000	0.77884	CGG	PCDHGB1	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254221		0.512	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB1	HGNC	protein_coding	OTTHUMT00000374740.1	50	0.00	0	C	NM_018922		140730020	140730020	+1	no_errors	ENST00000523390	ensembl	human	known	69_37n	missense	47	44.71	38	SNP	0.229	T
PLVAP	83483	genome.wustl.edu	37	19	17476703	17476703	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr19:17476703G>A	ENST00000252590.4	-	3	632	c.571C>T	c.(571-573)Cgc>Tgc	p.R191C		NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	191					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TCCGCCACGCGTTTGTTCAGC	0.547																																						dbGAP											0													73.0	70.0	71.0					19																	17476703		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.571C>T	19.37:g.17476703G>A	ENSP00000252590:p.Arg191Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Missense_Mutation	SNP	pfam_PV-1	p.R191C	ENST00000252590.4	37	c.571	CCDS32952.1	19	.	.	.	.	.	.	.	.	.	.	G	16.18	3.051568	0.55218	.	.	ENSG00000130300	ENST00000252590	.	.	.	4.74	2.37	0.29283	.	0.430329	0.24238	N	0.040289	T	0.39759	0.1090	L	0.29908	0.895	0.09310	N	0.999999	D	0.76494	0.999	P	0.60609	0.877	T	0.10613	-1.0622	9	0.62326	D	0.03	-24.4342	9.4379	0.38650	0.0:0.0:0.6148:0.3852	.	191	Q9BX97	PLVAP_HUMAN	C	191	.	ENSP00000252590:R191C	R	-	1	0	PLVAP	17337703	0.026000	0.19158	0.013000	0.15412	0.057000	0.15508	0.388000	0.20735	1.101000	0.41535	0.305000	0.20034	CGC	PLVAP	-	pfam_PV-1	ENSG00000130300		0.547	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLVAP	HGNC	protein_coding	OTTHUMT00000463655.1	28	0.00	0	G	NM_031310		17476703	17476703	-1	no_errors	ENST00000252590	ensembl	human	known	69_37n	missense	31	21.43	9	SNP	0.009	A
POGZ	23126	genome.wustl.edu	37	1	151379720	151379720	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr1:151379720T>C	ENST00000271715.2	-	16	2737	c.2423A>G	c.(2422-2424)aAt>aGt	p.N808S	POGZ_ENST00000368863.2_Missense_Mutation_p.N713S|POGZ_ENST00000409503.1_Missense_Mutation_p.N799S|POGZ_ENST00000491586.1_Missense_Mutation_p.N764S|POGZ_ENST00000540984.1_Missense_Mutation_p.N170S|POGZ_ENST00000361398.3_Missense_Mutation_p.N755S|POGZ_ENST00000531094.1_Missense_Mutation_p.N746S|POGZ_ENST00000392723.1_Missense_Mutation_p.N755S	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	808					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CCTCACAGAATTTTTAAACAA	0.363																																						dbGAP											0													65.0	66.0	65.0					1																	151379720		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.2423A>G	1.37:g.151379720T>C	ENSP00000271715:p.Asn808Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_Znf_C2H2	p.N808S	ENST00000271715.2	37	c.2423	CCDS997.1	1	.	.	.	.	.	.	.	.	.	.	T	13.70	2.314467	0.40996	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000540984;ENST00000491586;ENST00000529669	T;T;T;T;T;T;T;T;T	0.31247	5.85;5.87;5.85;5.82;5.86;5.85;1.85;5.32;1.5	6.02	6.02	0.97574	.	0.069407	0.64402	D	0.000017	T	0.05823	0.0152	N	0.02011	-0.69	0.35943	D	0.833366	B;B;B;B;B;B	0.33022	0.15;0.128;0.234;0.394;0.202;0.15	B;B;B;B;B;B	0.34652	0.046;0.064;0.14;0.187;0.135;0.046	T	0.15178	-1.0446	10	0.36615	T	0.2	-19.4266	9.7959	0.40735	0.0:0.0765:0.0:0.9235	.	746;799;713;764;755;808	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	S	755;808;755;713;799;746;170;764;208	ENSP00000376484:N755S;ENSP00000271715:N808S;ENSP00000354467:N755S;ENSP00000357856:N713S;ENSP00000386836:N799S;ENSP00000431259:N746S;ENSP00000443547:N170S;ENSP00000418408:N764S;ENSP00000432295:N208S	ENSP00000271715:N808S	N	-	2	0	POGZ	149646344	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.559000	0.53756	2.304000	0.77564	0.528000	0.53228	AAT	POGZ	-	NULL	ENSG00000143442		0.363	POGZ-001	KNOWN	basic|CCDS	protein_coding	POGZ	HGNC	protein_coding	OTTHUMT00000034915.2	55	0.00	0	T	NM_207171		151379720	151379720	-1	no_errors	ENST00000271715	ensembl	human	known	69_37n	missense	72	14.29	12	SNP	1.000	C
PSMG3	84262	genome.wustl.edu	37	7	1607460	1607460	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr7:1607460G>C	ENST00000288607.2	-	2	896	c.243C>G	c.(241-243)aaC>aaG	p.N81K	PSMG3_ENST00000252329.3_Missense_Mutation_p.N81K|PSMG3_ENST00000404674.3_Missense_Mutation_p.N81K|PSMG3-AS1_ENST00000437621.2_lincRNA	NM_032302.3	NP_115678.1	Q9BT73	PSMG3_HUMAN	proteasome (prosome, macropain) assembly chaperone 3	81										lung(2)	2		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.63e-15)		ACGCTACCAGGTTCTTTGCAA	0.488																																						dbGAP											0													80.0	71.0	74.0					7																	1607460		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC027171	CCDS5327.1	7p22.3	2010-07-07	2007-08-16	2007-08-16	ENSG00000157778	ENSG00000157778			22420	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 48"""	C7orf48		17189198	Standard	NM_032302		Approved	MGC10911, PAC3	uc011jvx.1	Q9BT73	OTTHUMG00000119043	ENST00000288607.2:c.243C>G	7.37:g.1607460G>C	ENSP00000288607:p.Asn81Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D216|A8MPW2	Missense_Mutation	SNP	pfam_Proteasome_assmbl_chp_3	p.N81K	ENST00000288607.2	37	c.243	CCDS5327.1	7	.	.	.	.	.	.	.	.	.	.	G	18.45	3.626191	0.66901	.	.	ENSG00000157778	ENST00000288607;ENST00000404674;ENST00000252329	.	.	.	5.7	2.91	0.33838	.	0.000000	0.85682	D	0.000000	T	0.71281	0.3321	M	0.79805	2.47	0.50632	D	0.999885	D	0.71674	0.998	D	0.65010	0.931	T	0.71718	-0.4508	9	0.59425	D	0.04	-47.7656	8.566	0.33540	0.3535:0.0:0.6465:0.0	.	81	Q9BT73	PSMG3_HUMAN	K	81	.	ENSP00000252329:N81K	N	-	3	2	PSMG3	1573986	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.471000	0.35365	0.759000	0.33084	0.655000	0.94253	AAC	PSMG3	-	pfam_Proteasome_assmbl_chp_3	ENSG00000157778		0.488	PSMG3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PSMG3	HGNC	protein_coding	OTTHUMT00000239254.2	32	0.00	0	G	NM_032302		1607460	1607460	-1	no_errors	ENST00000252329	ensembl	human	known	69_37n	missense	34	14.63	6	SNP	1.000	C
RBMX	27316	genome.wustl.edu	37	X	135960146	135960147	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chrX:135960146_135960147insAA	ENST00000320676.7	-	4	469_470	c.315_316insTT	c.(313-318)cctccafs	p.P106fs	RBMX_ENST00000562646.1_Frame_Shift_Ins_p.P106fs|RBMX_ENST00000431446.3_Intron|RBMX_ENST00000565438.1_5'UTR|RBMX_ENST00000570135.1_Intron|SNORD61_ENST00000384252.1_RNA	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	106					cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.P106fs*32(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					AGACCTCTTGGAGGGCCTCTAC	0.535																																						dbGAP											1	Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.315_316insTT	X.37:g.135960146_135960147insAA	ENSP00000359645:p.Pro106fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Frame_Shift_Ins	INS	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.P105fs	ENST00000320676.7	37	c.316_315	CCDS14661.1	X																																																																																			RBMX	-	NULL	ENSG00000147274		0.535	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMX	HGNC	protein_coding	OTTHUMT00000058507.1	49	0.00	0	-	NM_002139		135960146	135960147	-1	no_errors	ENST00000320676	ensembl	human	known	69_37n	frame_shift_ins	61	11.59	8	INS	1.000:1.000	AA
RYR2	6262	genome.wustl.edu	37	1	237777819	237777819	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr1:237777819A>T	ENST00000366574.2	+	37	5708	c.5391A>T	c.(5389-5391)gaA>gaT	p.E1797D	RYR2_ENST00000542537.1_Missense_Mutation_p.E1781D|RYR2_ENST00000360064.6_Missense_Mutation_p.E1795D	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1797	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGCTGACAGAAGCTGTTAAAG	0.468																																						dbGAP											0													164.0	157.0	159.0					1																	237777819		1945	4144	6089	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5391A>T	1.37:g.237777819A>T	ENSP00000355533:p.Glu1797Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E1795D	ENST00000366574.2	37	c.5385	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	A	14.48	2.548395	0.45383	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.75050	-0.9;-0.9;-0.9	5.62	-2.61	0.06171	.	0.000000	0.64402	D	0.000008	T	0.72787	0.3504	L	0.42008	1.315	0.80722	D	1	D	0.65815	0.995	P	0.57101	0.813	T	0.69041	-0.5250	10	0.33141	T	0.24	.	12.5618	0.56286	0.5952:0.0:0.4048:0.0	.	1797	Q92736	RYR2_HUMAN	D	1797;1795;1781	ENSP00000355533:E1797D;ENSP00000353174:E1795D;ENSP00000443798:E1781D	ENSP00000353174:E1795D	E	+	3	2	RYR2	235844442	0.947000	0.32204	0.140000	0.22221	0.214000	0.24535	0.194000	0.17135	-0.764000	0.04651	0.528000	0.53228	GAA	RYR2	-	NULL	ENSG00000198626		0.468	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	30	0.00	0	A	NM_001035		237777819	237777819	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	41	34.92	22	SNP	0.968	T
SCN8A	6334	genome.wustl.edu	37	12	52162755	52162755	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr12:52162755G>A	ENST00000354534.6	+	17	3186	c.3008G>A	c.(3007-3009)cGt>cAt	p.R1003H	SCN8A_ENST00000545061.1_Missense_Mutation_p.R1003H	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1003					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	TCAGTGATCCGTATCAAGAAG	0.537																																						dbGAP											0													97.0	95.0	96.0					12																	52162755		2038	4204	6242	-	-	-	SO:0001583	missense	0			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.3008G>A	12.37:g.52162755G>A	ENSP00000346534:p.Arg1003His	Somatic		WXS	Illumina GAIIx	Phase_IV	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.R1003H	ENST00000354534.6	37	c.3008	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	G	29.8	5.036800	0.93630	.	.	ENSG00000196876	ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D	0.98105	-4.72;-4.72;-4.72	4.66	4.66	0.58398	Sodium ion transport-associated (1);	0.000000	0.85682	D	0.000000	D	0.99227	0.9731	H	0.96576	3.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.98686	1.0694	10	0.87932	D	0	.	18.8687	0.92303	0.0:0.0:1.0:0.0	.	1003;1003	F8VWM7;Q9UQD0	.;SCN8A_HUMAN	H	1003;1003;1003;916	ENSP00000346534:R1003H;ENSP00000440360:R1003H;ENSP00000347255:R1003H	ENSP00000346534:R1003H	R	+	2	0	SCN8A	50449022	1.000000	0.71417	0.967000	0.41034	0.975000	0.68041	9.601000	0.98297	2.873000	0.98535	0.563000	0.77884	CGT	SCN8A	-	pfam_Na_trans_assoc	ENSG00000196876		0.537	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	36	0.00	0	G	NM_014191		52162755	52162755	+1	no_errors	ENST00000354534	ensembl	human	known	69_37n	missense	39	20.41	10	SNP	1.000	A
SCNN1G	6340	genome.wustl.edu	37	16	23200787	23200787	+	Missense_Mutation	SNP	G	G	A	rs267604464		TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr16:23200787G>A	ENST00000300061.2	+	3	556	c.413G>A	c.(412-414)cGa>cAa	p.R138Q		NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	138					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	CGGAAGCGCCGAGAGGCGGAG	0.587																																						dbGAP											0													87.0	97.0	94.0					16																	23200787		2197	4300	6497	-	-	-	SO:0001583	missense	0			U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.413G>A	16.37:g.23200787G>A	ENSP00000300061:p.Arg138Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.R138Q	ENST00000300061.2	37	c.413	CCDS10608.1	16	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127476	0.56721	.	.	ENSG00000166828	ENST00000300061	T	0.62788	-0.0	5.75	5.75	0.90469	.	0.000000	0.45126	D	0.000389	T	0.52565	0.1742	N	0.01352	-0.895	0.38292	D	0.942725	D	0.89917	1.0	D	0.87578	0.998	T	0.60485	-0.7254	10	0.11485	T	0.65	-10.8778	17.1001	0.86647	0.0:0.0:1.0:0.0	.	138	P51170	SCNNG_HUMAN	Q	138	ENSP00000300061:R138Q	ENSP00000300061:R138Q	R	+	2	0	SCNN1G	23108288	1.000000	0.71417	0.318000	0.25279	0.182000	0.23217	6.174000	0.71943	2.721000	0.93114	0.511000	0.50034	CGA	SCNN1G	-	pfam_Na+channel_ASC,tigrfam_EnaC	ENSG00000166828		0.587	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCNN1G	HGNC	protein_coding	OTTHUMT00000254496.1	24	0.00	0	G	NM_001039		23200787	23200787	+1	no_errors	ENST00000300061	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	0.682	A
SLC22A12	116085	genome.wustl.edu	37	11	64361228	64361228	+	Silent	SNP	G	G	T			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr11:64361228G>T	ENST00000377574.1	+	4	1530	c.783G>T	c.(781-783)ctG>ctT	p.L261L	SLC22A12_ENST00000336464.7_Silent_p.L227L|SLC22A12_ENST00000377567.2_Intron|SLC22A12_ENST00000473690.1_Silent_p.L40L|SLC22A12_ENST00000377572.1_Intron	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	261					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	GGACACTGCTGCAGCTGGTGG	0.622																																						dbGAP											0													132.0	122.0	126.0					11																	64361228		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.783G>T	11.37:g.64361228G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L261	ENST00000377574.1	37	c.783	CCDS8075.1	11																																																																																			SLC22A12	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000197891		0.622	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A12	HGNC	protein_coding	OTTHUMT00000104966.2	48	0.00	0	G	NM_144585		64361228	64361228	+1	no_errors	ENST00000377574	ensembl	human	known	69_37n	silent	51	10.53	6	SNP	0.707	T
TMPRSS15	5651	genome.wustl.edu	37	21	19770211	19770211	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr21:19770211C>G	ENST00000284885.3	-	3	362	c.329G>C	c.(328-330)aGa>aCa	p.R110T		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	110	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TTGTAAAACTCTTGAGTTCTT	0.249																																						dbGAP											0													16.0	17.0	16.0					21																	19770211		2134	4211	6345	-	-	-	SO:0001583	missense	0				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.329G>C	21.37:g.19770211C>G	ENSP00000284885:p.Arg110Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKL7	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_MAM_dom,pfam_SEA,pfam_LDrepeatLR_classA_rpt,pfam_Peptidase_S1A_nudel,pfam_Srcr_rcpt,superfamily_Pept_cys/ser_Trypsin-like,superfamily_ConA-like_lec_gl,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_SEA,smart_LDrepeatLR_classA_rpt,smart_CUB,smart_MAM_dom,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,pfscan_SEA,pfscan_Srcr_rcpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.R110T	ENST00000284885.3	37	c.329	CCDS13571.1	21	.	.	.	.	.	.	.	.	.	.	C	11.37	1.619235	0.28801	.	.	ENSG00000154646	ENST00000284885;ENST00000422787	T;T	0.39592	1.07;1.07	4.78	1.9	0.25705	SEA (3);	0.399802	0.26220	N	0.025626	T	0.30541	0.0768	L	0.50333	1.59	0.24316	N	0.995067	B	0.17038	0.02	B	0.17433	0.018	T	0.13575	-1.0504	9	.	.	.	.	4.84	0.13485	0.0:0.6299:0.1766:0.1935	.	110	P98073	ENTK_HUMAN	T	110;65	ENSP00000284885:R110T;ENSP00000398253:R65T	.	R	-	2	0	TMPRSS15	18692082	0.996000	0.38824	0.849000	0.33467	0.983000	0.72400	0.572000	0.23684	0.688000	0.31529	0.643000	0.83706	AGA	TMPRSS15	-	pfam_SEA,smart_SEA,pfscan_SEA	ENSG00000154646		0.249	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS15	HGNC	protein_coding	OTTHUMT00000158231.2	23	0.00	0	C	NM_002772		19770211	19770211	-1	no_errors	ENST00000284885	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	0.869	G
TTLL6	284076	genome.wustl.edu	37	17	46846360	46846360	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr17:46846360C>G	ENST00000393382.3	-	15	2808	c.2667G>C	c.(2665-2667)gaG>gaC	p.E889D	TTLL6_ENST00000433608.2_Missense_Mutation_p.E582D	NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6											endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						CCTAGCTCCTCTCACATCCTT	0.498																																						dbGAP											0													172.0	145.0	154.0					17																	46846360		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.2667G>C	17.37:g.46846360C>G	ENSP00000377043:p.Glu889Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.E889D	ENST00000393382.3	37	c.2667	CCDS45724.1	17	.	.	.	.	.	.	.	.	.	.	C	9.015	0.983477	0.18889	.	.	ENSG00000170703	ENST00000440941;ENST00000305326;ENST00000433608;ENST00000393382	.	.	.	5.19	2.01	0.26516	.	.	.	.	.	T	0.33000	0.0848	L	0.40543	1.245	0.19575	N	0.999968	B;B	0.20052	0.009;0.041	B;B	0.20184	0.007;0.028	T	0.31641	-0.9936	8	0.87932	D	0	.	7.4689	0.27336	0.0:0.5941:0.3189:0.087	.	841;582	Q8N841;G5E937	TTLL6_HUMAN;.	D	889;582;567;841	.	ENSP00000302547:E582D	E	-	3	2	TTLL6	44201359	0.000000	0.05858	0.859000	0.33776	0.127000	0.20565	-0.273000	0.08548	0.410000	0.25675	0.563000	0.77884	GAG	TTLL6	-	NULL	ENSG00000170703		0.498	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	TTLL6	HGNC	protein_coding	OTTHUMT00000346939.3	40	0.00	0	C	NM_173623		46846360	46846360	-1	no_errors	ENST00000393382	ensembl	human	known	69_37n	missense	54	10.00	6	SNP	0.696	G
USP47	55031	genome.wustl.edu	37	11	11964387	11964387	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr11:11964387A>G	ENST00000399455.2	+	21	2999	c.2879A>G	c.(2878-2880)gAt>gGt	p.D960G	USP47_ENST00000539466.1_5'UTR|USP47_ENST00000527733.1_Missense_Mutation_p.D940G|USP47_ENST00000339865.5_Missense_Mutation_p.D872G	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	960					base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		GTGGACAGTGATATTCTTAGC	0.408																																						dbGAP											0													163.0	148.0	153.0					11																	11964387		1953	4149	6102	-	-	-	SO:0001583	missense	0			AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.2879A>G	11.37:g.11964387A>G	ENSP00000382382:p.Asp960Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.D960G	ENST00000399455.2	37	c.2879		11	.	.	.	.	.	.	.	.	.	.	A	21.5	4.163157	0.78226	.	.	ENSG00000170242	ENST00000339865;ENST00000527733;ENST00000399455;ENST00000540365	T;T;T	0.04862	3.55;3.55;3.54	6.02	6.02	0.97574	.	0.087933	0.85682	D	0.000000	T	0.15652	0.0377	L	0.27053	0.805	0.80722	D	1	D;D;D	0.67145	0.993;0.993;0.996	D;D;D	0.76071	0.971;0.971;0.987	T	0.01951	-1.1241	10	0.56958	D	0.05	.	16.1925	0.82004	1.0:0.0:0.0:0.0	.	960;940;872	Q96K76;E9PM46;Q96K76-2	UBP47_HUMAN;.;.	G	872;940;960;157	ENSP00000339957:D872G;ENSP00000433146:D940G;ENSP00000382382:D960G	ENSP00000339957:D872G	D	+	2	0	USP47	11920963	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.962000	0.93254	2.306000	0.77630	0.482000	0.46254	GAT	USP47	-	NULL	ENSG00000170242		0.408	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	USP47	HGNC	protein_coding	OTTHUMT00000385853.2	39	0.00	0	A	NM_017944		11964387	11964387	+1	no_errors	ENST00000399455	ensembl	human	known	69_37n	missense	40	27.27	15	SNP	1.000	G
VCX3B	425054	genome.wustl.edu	37	X	8434101	8434101	+	Missense_Mutation	SNP	G	G	A	rs201156439		TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chrX:8434101G>A	ENST00000381032.1	+	3	725	c.418G>A	c.(418-420)Gtg>Atg	p.V140M	VCX3B_ENST00000381029.4_Missense_Mutation_p.V118M|VCX3B_ENST00000440654.2_Intron|VCX3B_ENST00000444481.1_Intron|VCX3B_ENST00000453306.1_Missense_Mutation_p.V140M	NM_001001888.3	NP_001001888.3	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	140	14 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.					nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|urinary_tract(3)	11						GGAGAGCGAGGTGGAAGAACC	0.592																																						dbGAP											0													4.0	6.0	5.0					X																	8434101		445	2387	2832	-	-	-	SO:0001583	missense	0				CCDS48077.1, CCDS48077.2	Xp22.31	2009-01-14			ENSG00000205642	ENSG00000205642			31838	protein-coding gene	gene with protein product							Standard	NM_001001888		Approved	VCX-C	uc011mht.2	Q9H321	OTTHUMG00000021106	ENST00000381032.1:c.418G>A	X.37:g.8434101G>A	ENSP00000370420:p.Val140Met	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JS46|Q4KN12	Missense_Mutation	SNP	NULL	p.V118M	ENST00000381032.1	37	c.352	CCDS48077.2	X	.	.	.	.	.	.	.	.	.	.	-	3.969	-0.008672	0.07727	.	.	ENSG00000205642	ENST00000381032;ENST00000453306;ENST00000381029	T;T;T	0.22539	1.95;1.95;2.09	0.816	-0.246	0.13022	.	.	.	.	.	T	0.10294	0.0252	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.33111	-0.9881	7	0.41790	T	0.15	.	6.2832	0.21019	0.0:0.3122:0.6877:0.0	.	.	.	.	M	140;140;118	ENSP00000370420:V140M;ENSP00000411785:V140M;ENSP00000370417:V118M	ENSP00000370417:V118M	V	+	1	0	VCX3B	8394101	0.010000	0.17322	0.000000	0.03702	0.000000	0.00434	0.013000	0.13310	-0.110000	0.12022	-0.722000	0.03604	GTG	VCX3B	-	NULL	ENSG00000205642		0.592	VCX3B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	VCX3B	HGNC	protein_coding	OTTHUMT00000055691.1	34	0.00	0	G			8434101	8434101	+1	no_errors	ENST00000381029	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.004	A
ZNF425	155054	genome.wustl.edu	37	7	148815337	148815337	+	Missense_Mutation	SNP	T	T	C	rs549520699		TCGA-D8-A27I-01A-11D-A16D-09	TCGA-D8-A27I-10A-02D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47c0db0a-fc37-4fa0-832c-e67f089d3889	2e8da00b-a2d6-4240-8844-5ecbd238eb8c	g.chr7:148815337T>C	ENST00000378061.2	-	2	254	c.122A>G	c.(121-123)aAt>aGt	p.N41S		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	41	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GGTCTCGTAATTGGTCTTCAT	0.438													T|||	1	0.000199681	0.0	0.0	5008	,	,		17299	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													327.0	293.0	304.0					7																	148815337		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.122A>G	7.37:g.148815337T>C	ENSP00000367300:p.Asn41Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPM1|Q08AG3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.N41S	ENST00000378061.2	37	c.122	CCDS34773.1	7	.	.	.	.	.	.	.	.	.	.	-	18.11	3.550702	0.65311	.	.	ENSG00000204947	ENST00000378061;ENST00000483014	T;T	0.03635	3.86;3.86	3.61	3.61	0.41365	Krueppel-associated box (4);	.	.	.	.	T	0.14442	0.0349	M	0.74467	2.265	0.24507	N	0.994224	D	0.65815	0.995	D	0.67548	0.952	T	0.03139	-1.1068	9	0.72032	D	0.01	.	8.5343	0.33353	0.0:0.0:0.0:1.0	.	41	Q6IV72	ZN425_HUMAN	S	41;63	ENSP00000367300:N41S;ENSP00000420379:N63S	ENSP00000367300:N41S	N	-	2	0	ZNF425	148446270	0.908000	0.30866	0.926000	0.36857	0.991000	0.79684	3.523000	0.53488	1.499000	0.48617	0.524000	0.50904	AAT	ZNF425	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	ENSG00000204947		0.438	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF425	HGNC	protein_coding	OTTHUMT00000352726.1	112	0.88	1	T	XM_088140		148815337	148815337	-1	no_errors	ENST00000378061	ensembl	human	known	69_37n	missense	138	19.89	35	SNP	0.969	C
