#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCG8	64241	genome.wustl.edu	37	2	44071747	44071747	+	Splice_Site	SNP	G	G	A	rs201997529		TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr2:44071747G>A	ENST00000272286.2	+	2	255	c.165G>A	c.(163-165)caG>caA	p.Q55Q		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	55	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	TCAACTACCAGGTAGAGGCAC	0.572																																						dbGAP											0													50.0	42.0	45.0					2																	44071747		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.165+1G>A	2.37:g.44071747G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QN8	Silent	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,pfscan_ABC_transporter-like	p.Q55	ENST00000272286.2	37	c.165	CCDS1815.1	2																																																																																			ABCG8	-	pfscan_ABC_transporter-like	ENSG00000143921		0.572	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG8	HGNC	protein_coding	OTTHUMT00000250671.1	32	0.00	0	G	NM_022437	Silent	44071747	44071747	+1	no_errors	ENST00000272286	ensembl	human	known	69_37n	silent	14	46.15	12	SNP	1.000	A
ADAMTS16	170690	genome.wustl.edu	37	5	5242237	5242237	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr5:5242237G>T	ENST00000274181.7	+	17	2733	c.2595G>T	c.(2593-2595)caG>caT	p.Q865H		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	865	Spacer.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CCGAGAAGCAGCCCCCTGCCC	0.587																																						dbGAP											0													49.0	55.0	53.0					5																	5242237		2018	4175	6193	-	-	-	SO:0001583	missense	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2595G>T	5.37:g.5242237G>T	ENSP00000274181:p.Gln865His	Somatic		WXS	Illumina GAIIx	Phase_IV	C6G490|Q8IVE2	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.Q865H	ENST00000274181.7	37	c.2595	CCDS43299.1	5	.	.	.	.	.	.	.	.	.	.	G	6.876	0.531119	0.13127	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.61627	0.09	5.73	-1.52	0.08637	.	0.257278	0.36482	N	0.002576	T	0.33206	0.0855	N	0.24115	0.695	0.09310	N	1	P;B	0.35600	0.511;0.003	B;B	0.31751	0.135;0.014	T	0.18304	-1.0341	10	0.36615	T	0.2	.	6.6435	0.22923	0.3931:0.0:0.495:0.1119	.	865;865	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	H	865	ENSP00000274181:Q865H	ENSP00000274181:Q865H	Q	+	3	2	ADAMTS16	5295237	0.483000	0.25956	0.000000	0.03702	0.003000	0.03518	0.398000	0.20899	-0.140000	0.11394	-1.016000	0.02456	CAG	ADAMTS16	-	NULL	ENSG00000145536		0.587	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	HGNC	protein_coding	OTTHUMT00000365657.1	38	0.00	0	G	NM_139056		5242237	5242237	+1	no_errors	ENST00000274181	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.012	T
AKAP9	10142	genome.wustl.edu	37	7	91682267	91682267	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr7:91682267A>C	ENST00000359028.2	+	23	5857	c.5632A>C	c.(5632-5634)Agt>Cgt	p.S1878R	AKAP9_ENST00000358100.2_Missense_Mutation_p.S1878R|AKAP9_ENST00000356239.3_Missense_Mutation_p.S1866R			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1878	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TGAAACTAGCAGTCAGGTAAC	0.368			T	BRAF	papillary thyroid																																	dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													65.0	64.0	64.0					7																	91682267		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.5632A>C	7.37:g.91682267A>C	ENSP00000351922:p.Ser1878Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.S1878R	ENST00000359028.2	37	c.5632		7	.	.	.	.	.	.	.	.	.	.	A	13.93	2.382643	0.42207	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120	T;T;T	0.03065	4.07;4.07;4.06	5.25	2.89	0.33648	.	0.326644	0.22445	N	0.059975	T	0.06096	0.0158	L	0.29908	0.895	0.09310	N	0.999999	P;D;P	0.56035	0.664;0.974;0.773	B;P;B	0.56343	0.168;0.796;0.316	T	0.36359	-0.9751	10	0.26408	T	0.33	.	9.2395	0.37486	0.8526:0.0:0.1474:0.0	.	1878;1866;1866	Q99996;Q99996-2;Q99996-3	AKAP9_HUMAN;.;.	R	1866;1878;1878;1878	ENSP00000348573:S1866R;ENSP00000351922:S1878R;ENSP00000350813:S1878R	ENSP00000348573:S1866R	S	+	1	0	AKAP9	91520203	0.978000	0.34361	0.982000	0.44146	0.769000	0.43574	4.338000	0.59316	0.943000	0.37553	0.482000	0.46254	AGT	AKAP9	-	NULL	ENSG00000127914		0.368	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		29	0.00	0	A	NM_005751		91682267	91682267	+1	no_errors	ENST00000359028	ensembl	human	known	69_37n	missense	35	22.22	10	SNP	0.754	C
APLNR	187	genome.wustl.edu	37	11	57003529	57003529	+	Missense_Mutation	SNP	C	C	T	rs200854787		TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr11:57003529C>T	ENST00000606794.1	-	1	1146	c.950G>A	c.(949-951)cGc>cAc	p.R317H		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	317					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.R317H(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						GCAGGCCTGGCGGAAGCGGGG	0.607																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											79.0	47.0	58.0					11																	57003529		2201	4296	6497	-	-	-	SO:0001583	missense	0			U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.950G>A	11.37:g.57003529C>T	ENSP00000475344:p.Arg317His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,prints_APJ_rcpt,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,prints_ATII_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.R317H	ENST00000606794.1	37	c.950	CCDS7950.1	11	.	.	.	.	.	.	.	.	.	.	C	26.2	4.717007	0.89205	.	.	ENSG00000134817	ENST00000257254;ENST00000326830;ENST00000444275	T	0.58358	0.34	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.61515	0.2353	N	0.19112	0.55	0.54753	D	0.999987	D	0.89917	1.0	D	0.91635	0.999	T	0.67011	-0.5778	10	0.87932	D	0	-31.5793	18.8995	0.92437	0.0:1.0:0.0:0.0	.	317	P35414	APJ_HUMAN	H	317;198;236	ENSP00000257254:R317H	ENSP00000257254:R317H	R	-	2	0	APLNR	56760105	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.003000	0.70701	2.551000	0.86045	0.655000	0.94253	CGC	APLNR	-	pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000134817		0.607	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	APLNR	HGNC	protein_coding	OTTHUMT00000470575.1	23	0.00	0	C	NM_005161		57003529	57003529	-1	no_errors	ENST00000257254	ensembl	human	known	69_37n	missense	5	64.29	9	SNP	1.000	T
HID1	283987	genome.wustl.edu	37	17	72951961	72951961	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr17:72951961G>A	ENST00000425042.2	-	13	1639	c.1562C>T	c.(1561-1563)tCt>tTt	p.S521F		NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	521					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											CTGGGCGGCAGAGAAGAGGAA	0.572																																						dbGAP											0													148.0	135.0	139.0					17																	72951961		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.1562C>T	17.37:g.72951961G>A	ENSP00000413520:p.Ser521Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5L6|Q8TE83|Q9NT34	Missense_Mutation	SNP	pfam_Dymeclin	p.S521F	ENST00000425042.2	37	c.1562	CCDS32726.1	17	.	.	.	.	.	.	.	.	.	.	G	23.5	4.423800	0.83667	.	.	ENSG00000167861	ENST00000525426;ENST00000425042;ENST00000318565	.	.	.	5.1	5.1	0.69264	.	0.118146	0.64402	D	0.000015	D	0.84991	0.5595	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.88203	0.2885	9	0.87932	D	0	-9.2117	18.4905	0.90844	0.0:0.0:1.0:0.0	.	521	Q8IV36	CQ028_HUMAN	F	293;521;293	.	ENSP00000317795:S293F	S	-	2	0	C17orf28	70463556	1.000000	0.71417	0.918000	0.36340	0.725000	0.41563	7.587000	0.82613	2.349000	0.79799	0.650000	0.86243	TCT	C17orf28	-	NULL	ENSG00000167861		0.572	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf28	HGNC	protein_coding	OTTHUMT00000390011.2	46	0.00	0	G	NM_030630		72951961	72951961	-1	no_errors	ENST00000425042	ensembl	human	known	69_37n	missense	149	21.16	40	SNP	1.000	A
C3P1	388503	genome.wustl.edu	37	19	10169599	10169599	+	RNA	SNP	C	C	T			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr19:10169599C>T	ENST00000495140.1	+	0	1999							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)			endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						TTGCCAACAGCTCCCAAGCCA	0.562																																						dbGAP											0													102.0	105.0	104.0					19																	10169599		1986	4164	6150	-	-	-			0			AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10169599C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000495140.1	37	NULL		19																																																																																			C3P1	-	-	ENSG00000167798		0.562	C3P1-002	KNOWN	basic	processed_transcript	C3P1	HGNC	pseudogene	OTTHUMT00000351284.1	55	0.00	0	C	NR_027300		10169599	10169599	+1	no_errors	ENST00000495140	ensembl	human	known	69_37n	rna	34	19.05	8	SNP	0.928	T
CFHR5	81494	genome.wustl.edu	37	1	196952137	196952137	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr1:196952137T>G	ENST00000256785.4	+	2	290	c.181T>G	c.(181-183)Tct>Gct	p.S61A	CFHR5_ENST00000367414.5_Missense_Mutation_p.S85A			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	61	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)				NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						TAATTTTGTGTCTCCTTCAAA	0.388																																						dbGAP											0													110.0	105.0	107.0					1																	196952137		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.181T>G	1.37:g.196952137T>G	ENSP00000256785:p.Ser61Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKK2	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.S85A	ENST00000256785.4	37	c.253	CCDS1387.1	1	.	.	.	.	.	.	.	.	.	.	.	12.33	1.905014	0.33628	.	.	ENSG00000134389	ENST00000367414;ENST00000256785	T;T	0.62788	-0.0;-0.0	2.45	1.3	0.21679	Complement control module (2);Sushi/SCR/CCP (2);	.	.	.	.	T	0.57417	0.2052	L	0.47716	1.5	0.09310	N	1	P	0.41420	0.749	P	0.47864	0.559	T	0.47328	-0.9126	9	0.42905	T	0.14	.	4.1609	0.10284	0.0:0.177:0.0:0.823	.	61	Q9BXR6	FHR5_HUMAN	A	85;61	ENSP00000356384:S85A;ENSP00000256785:S61A	ENSP00000256785:S61A	S	+	1	0	CFHR5	195218760	0.000000	0.05858	0.006000	0.13384	0.389000	0.30415	-0.145000	0.10265	0.370000	0.24538	0.254000	0.18369	TCT	CFHR5	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP	ENSG00000134389		0.388	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR5	HGNC	protein_coding	OTTHUMT00000088814.2	116	0.00	0	T	NM_030787		196952137	196952137	+1	no_errors	ENST00000367414	ensembl	human	known	69_37n	missense	136	18.56	31	SNP	0.007	G
CHCHD6	84303	genome.wustl.edu	37	3	126423158	126423158	+	Start_Codon_Del	DEL	G	G	-			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr3:126423158delG	ENST00000290913.3	+	0	96				CHCHD6_ENST00000508789.1_Start_Codon_Del	NM_032343.2	NP_115719.1	Q9BRQ6	MIC25_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 6						cellular response to DNA damage stimulus (GO:0006974)|cristae formation (GO:0042407)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(3)|lung(3)	8						ATCTCGCCATGGGGAGCACGG	0.726																																						dbGAP											0													13.0	15.0	14.0					3																	126423158		2191	4287	6478	-	-	-	SO:0001582	initiator_codon_variant	0			BC006123	CCDS3041.1	3q21.3	2012-04-17			ENSG00000159685	ENSG00000159685		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28184	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 23"", ""coiled-coil-helix cristae morphology 1"""	615634				17624330, 22228767	Standard	NM_032343		Approved	MGC13016, PPP1R23, CHCM1	uc003ejf.2	Q9BRQ6	OTTHUMG00000159601		3.37:g.126423158delG		Somatic		WXS	Illumina GAIIx	Phase_IV	D6R9U0|D6RIB4|H8Y0Y7	Frame_Shift_Del	DEL	pfam_DUF737	p.S3fs	ENST00000290913.3	37	c.3	CCDS3041.1	3																																																																																			CHCHD6	-	NULL	ENSG00000159685		0.726	CHCHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHCHD6	HGNC	protein_coding	OTTHUMT00000356432.1	11	0.00	0	G	NM_032343		126423158	126423158	+1	no_errors	ENST00000290913	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	1.000	-
CPT2	1376	genome.wustl.edu	37	1	53676854	53676854	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr1:53676854G>A	ENST00000371486.3	+	4	2023	c.1508G>A	c.(1507-1509)cGc>cAc	p.R503H	RP5-1024G6.2_ENST00000452466.1_RNA	NM_000098.2	NP_000089.1	P23786	CPT2_HUMAN	carnitine palmitoyltransferase 2	503			R -> C (in CPT2D). {ECO:0000269|PubMed:10090476}.		carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	15					L-Carnitine(DB00583)|Perhexiline(DB01074)	GAGACCATCCGCCCGGCCTCC	0.607																																						dbGAP											0													31.0	29.0	30.0					1																	53676854		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002445	CCDS575.1	1p32.3	2014-01-09	2009-03-04		ENSG00000157184	ENSG00000157184	2.3.1.21		2330	protein-coding gene	gene with protein product		600650	"""carnitine palmitoyltransferase II"""	CPT1		1339389	Standard	NM_000098		Approved	CPTASE	uc001cvb.4	P23786	OTTHUMG00000008942	ENST00000371486.3:c.1508G>A	1.37:g.53676854G>A	ENSP00000360541:p.Arg503His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6S0|Q5SW68|Q9BQ26	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.R503H	ENST00000371486.3	37	c.1508	CCDS575.1	1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785714	0.70337	.	.	ENSG00000157184	ENST00000371486	D	0.97620	-4.46	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.98526	0.9508	M	0.91872	3.25	0.80722	D	1	D	0.65815	0.995	P	0.58077	0.832	D	0.99517	1.0957	10	0.72032	D	0.01	-21.3315	18.9408	0.92604	0.0:0.0:1.0:0.0	.	503	P23786	CPT2_HUMAN	H	503	ENSP00000360541:R503H	ENSP00000360541:R503H	R	+	2	0	CPT2	53449442	1.000000	0.71417	0.973000	0.42090	0.367000	0.29736	9.869000	0.99810	2.478000	0.83669	0.561000	0.74099	CGC	CPT2	-	pfam_Carn_acyl_trans	ENSG00000157184		0.607	CPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT2	HGNC	protein_coding	OTTHUMT00000024757.1	24	0.00	0	G	NM_000098		53676854	53676854	+1	no_errors	ENST00000371486	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	1.000	A
CYP7B1	9420	genome.wustl.edu	37	8	65509378	65509378	+	Nonsense_Mutation	SNP	T	T	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr8:65509378T>A	ENST00000310193.3	-	6	1515	c.1342A>T	c.(1342-1344)Aaa>Taa	p.K448*	CYP7B1_ENST00000523954.1_Intron	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	448					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				CCTGGACATTTGCTGGTTCCA	0.333																																						dbGAP											0													62.0	63.0	63.0					8																	65509378		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.1342A>T	8.37:g.65509378T>A	ENSP00000310721:p.Lys448*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN07|Q9UNF5	Nonsense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	p.K448*	ENST00000310193.3	37	c.1342	CCDS6180.1	8	.	.	.	.	.	.	.	.	.	.	T	37	6.407803	0.97542	.	.	ENSG00000172817	ENST00000310193	.	.	.	5.55	5.55	0.83447	.	0.432236	0.24708	N	0.036256	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.2019	15.6959	0.77499	0.0:0.0:0.0:1.0	.	.	.	.	X	448	.	ENSP00000310721:K448X	K	-	1	0	CYP7B1	65671932	1.000000	0.71417	0.981000	0.43875	0.848000	0.48234	6.201000	0.72124	2.102000	0.63906	0.460000	0.39030	AAA	CYP7B1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	ENSG00000172817		0.333	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7B1	HGNC	protein_coding	OTTHUMT00000378550.1	40	0.00	0	T			65509378	65509378	-1	no_errors	ENST00000310193	ensembl	human	known	69_37n	nonsense	25	35.90	14	SNP	1.000	A
DIS3L2	129563	genome.wustl.edu	37	2	233164783	233164783	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr2:233164783G>A	ENST00000409307.1	+	13	1693	c.1693G>A	c.(1693-1695)Gga>Aga	p.G565R	DIS3L2_ENST00000273009.6_Intron|DIS3L2_ENST00000325385.7_Missense_Mutation_p.G565R					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		CCACGAGACCGGATTGCCTCA	0.463																																						dbGAP											0													85.0	77.0	80.0					2																	233164783		1935	4140	6075	-	-	-	SO:0001583	missense	0			BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.1693G>A	2.37:g.233164783G>A	ENSP00000386799:p.Gly565Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.G565R	ENST00000409307.1	37	c.1693	CCDS42834.1	2	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954051	0.73902	.	.	ENSG00000144535	ENST00000542873;ENST00000325385;ENST00000431466;ENST00000409307;ENST00000424049	T;T;T	0.34859	1.34;1.34;1.34	5.91	5.91	0.95273	Ribonuclease II/R (2);	0.177830	0.49305	D	0.000158	T	0.39860	0.1094	L	0.52573	1.65	0.80722	D	1	P	0.48503	0.911	B	0.43680	0.427	T	0.09143	-1.0688	10	0.37606	T	0.19	-13.2064	18.479	0.90804	0.0:0.0:1.0:0.0	.	565	Q8IYB7	DI3L2_HUMAN	R	565;565;565;565;200	ENSP00000315569:G565R;ENSP00000386799:G565R;ENSP00000415419:G200R	ENSP00000315569:G565R	G	+	1	0	DIS3L2	232873027	1.000000	0.71417	0.992000	0.48379	0.964000	0.63967	5.236000	0.65354	2.793000	0.96121	0.655000	0.94253	GGA	DIS3L2	-	pfam_RNase_II/R,smart_RNase_II/R	ENSG00000144535		0.463	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3L2	HGNC	protein_coding	OTTHUMT00000330988.1	44	0.00	0	G	NM_152383		233164783	233164783	+1	no_errors	ENST00000325385	ensembl	human	known	69_37n	missense	35	30.00	15	SNP	0.999	A
DNAJC17	55192	genome.wustl.edu	37	15	41060225	41060225	+	Silent	SNP	G	G	A	rs550364622		TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr15:41060225G>A	ENST00000220496.4	-	11	858	c.828C>T	c.(826-828)ctC>ctT	p.L276L	DNAJC17_ENST00000558727.1_5'UTR|C15orf62_ENST00000344320.6_5'Flank	NM_018163.2	NP_060633.1	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17	276					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|skin(1)	6		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GCATCATGACGAGGCTCTCGT	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		16381	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													80.0	70.0	73.0					15																	41060225		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001496	CCDS10065.1	15q15.1	2014-02-12			ENSG00000104129	ENSG00000104129		"""Heat shock proteins / DNAJ (HSP40)"", ""RNA binding motif (RRM) containing"""	25556	protein-coding gene	gene with protein product						12477932	Standard	NM_018163		Approved	FLJ10634	uc001zms.2	Q9NVM6	OTTHUMG00000130065	ENST00000220496.4:c.828C>T	15.37:g.41060225G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_DnaJ_N,pfam_RRM_dom,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.L276	ENST00000220496.4	37	c.828	CCDS10065.1	15																																																																																			DNAJC17	-	NULL	ENSG00000104129		0.667	DNAJC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC17	HGNC	protein_coding	OTTHUMT00000252356.2	26	0.00	0	G	NM_018163		41060225	41060225	-1	no_errors	ENST00000220496	ensembl	human	known	69_37n	silent	20	31.03	9	SNP	0.344	A
DSEL	92126	genome.wustl.edu	37	18	65178341	65178341	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr18:65178341G>C	ENST00000310045.7	-	2	5008	c.3535C>G	c.(3535-3537)Ccc>Gcc	p.P1179A	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	1169					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				CCTTCATAGGGAAGGTAAAAA	0.353																																						dbGAP											0													85.0	84.0	84.0					18																	65178341		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.3535C>G	18.37:g.65178341G>C	ENSP00000310565:p.Pro1179Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_Chondroitin_lyas	p.P1179A	ENST00000310045.7	37	c.3535	CCDS11995.1	18	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025984	0.35701	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.21031	2.03	4.7	4.7	0.59300	Sulfotransferase domain (1);	0.303085	0.30428	U	0.009652	T	0.30039	0.0752	L	0.60455	1.87	0.42499	D	0.992926	P	0.43826	0.818	P	0.44673	0.457	T	0.10200	-1.0640	10	0.52906	T	0.07	-9.6151	17.9869	0.89158	0.0:0.0:1.0:0.0	.	1169	Q8IZU8	DSEL_HUMAN	A	1179;1169	ENSP00000310565:P1179A	ENSP00000310565:P1179A	P	-	1	0	DSEL	63329321	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.248000	0.58760	2.309000	0.77851	0.563000	0.77884	CCC	DSEL	-	pfam_Sulfotransferase_dom	ENSG00000171451		0.353	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1	79	0.00	0	G	NM_032160		65178341	65178341	-1	no_errors	ENST00000310045	ensembl	human	known	69_37n	missense	34	35.85	19	SNP	1.000	C
EIF3L	51386	genome.wustl.edu	37	22	38273806	38273808	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	GCA	GCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr22:38273806_38273808delGCA	ENST00000412331.2	+	11	1785_1787	c.1203_1205delGCA	c.(1201-1206)atgcag>atg	p.Q402del	EIF3L_ENST00000381683.6_In_Frame_Del_p.Q354del|EIF3L_ENST00000406934.1_In_Frame_Del_p.Q304del	NM_016091.3	NP_057175.1			eukaryotic translation initiation factor 3, subunit L											kidney(2)|large_intestine(3)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TGTTGCGCATGCAGAAAGGTGAC	0.512																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF083243	CCDS13960.1, CCDS56230.1	22q	2012-12-20	2009-01-07	2009-01-07	ENSG00000100129	ENSG00000100129			18138	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 3, subunit 6 interacting protein"", ""eukaryotic translation initiation factor 3, subunit E interacting protein"""	EIF3S6IP, EIF3EIP		11042152, 11590142	Standard	NM_016091		Approved	HSPC021, HSPC025, EIF3S11	uc003auf.3	Q9Y262	OTTHUMG00000150671	ENST00000412331.2:c.1203_1205delGCA	22.37:g.38273806_38273808delGCA	ENSP00000416892:p.Gln402del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	pfam_TIF3_suL	p.Q445in_frame_del	ENST00000412331.2	37	c.1332_1334	CCDS13960.1	22																																																																																			EIF3L	-	pfam_TIF3_suL	ENSG00000100129		0.512	EIF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3L	HGNC	protein_coding	OTTHUMT00000319551.2	39	0.00	0	GCA	NM_016091		38273806	38273808	+1	no_errors	ENST00000425539	ensembl	human	known	69_37n	in_frame_del	33	28.26	13	DEL	1.000:1.000:1.000	-
ENOSF1	55556	genome.wustl.edu	37	18	674341	674341	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr18:674341T>A	ENST00000251101.7	-	16	1384	c.1296A>T	c.(1294-1296)gaA>gaT	p.E432D	ENOSF1_ENST00000340116.7_Missense_Mutation_p.E439D|ENOSF1_ENST00000580982.1_Missense_Mutation_p.E356D|ENOSF1_ENST00000383578.3_Missense_Mutation_p.E350D|ENOSF1_ENST00000583973.1_5'UTR|ENOSF1_ENST00000319815.6_Missense_Mutation_p.E202D	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1	432					cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						TCTTCCAAACTTCACCATCTG	0.383																																						dbGAP											0													220.0	232.0	228.0					18																	674341		2203	4300	6503	-	-	-	SO:0001583	missense	0			X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.1296A>T	18.37:g.674341T>A	ENSP00000251101:p.Glu432Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Missense_Mutation	SNP	pfam_Mandelate_racemase_C,pfam_Mandelate_racemase_N,smart_Mandelate_racemase_C	p.E439D	ENST00000251101.7	37	c.1317	CCDS11822.1	18	.	.	.	.	.	.	.	.	.	.	T	11.12	1.545805	0.27652	.	.	ENSG00000132199	ENST00000383578;ENST00000319815;ENST00000251101;ENST00000340116	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.3	-0.303	0.12792	.	0.296020	0.36303	N	0.002675	T	0.22166	0.0534	L	0.38531	1.155	0.80722	D	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.09100	-1.0690	10	0.18710	T	0.47	.	0.7474	0.00984	0.2599:0.15:0.1346:0.4555	.	439;251;463;432;350	A6NMP3;B3KXE4;Q6ZS08;Q7L5Y1;Q7L5Y1-2	.;.;.;ENOF1_HUMAN;.	D	350;202;432;439	ENSP00000373072:E350D;ENSP00000313346:E202D;ENSP00000251101:E432D;ENSP00000345974:E439D	ENSP00000251101:E432D	E	-	3	2	ENOSF1	664341	0.291000	0.24352	0.991000	0.47740	0.980000	0.70556	-0.723000	0.04952	-0.286000	0.09076	-0.250000	0.11733	GAA	ENOSF1	-	NULL	ENSG00000132199		0.383	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENOSF1	HGNC	protein_coding	OTTHUMT00000254312.2	118	0.00	0	T	NM_017512		674341	674341	-1	no_errors	ENST00000340116	ensembl	human	known	69_37n	missense	146	10.43	17	SNP	0.988	A
FAM21A	387680	genome.wustl.edu	37	10	51853633	51853633	+	Missense_Mutation	SNP	C	C	T	rs199520696	byFrequency	TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr10:51853633C>T	ENST00000282633.5	+	13	1181	c.1136C>T	c.(1135-1137)aCg>aTg	p.T379M	FAM21A_ENST00000399339.2_Missense_Mutation_p.T291M|FAM21A_ENST00000351071.6_Missense_Mutation_p.T379M|FAM21A_ENST00000314664.7_Missense_Mutation_p.T379M	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	379					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						GACCTCTTCACGGAAGCCCCC	0.488																																						dbGAP											0													1.0	1.0	1.0					10																	51853633		353	936	1289	-	-	-	SO:0001583	missense	0			BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.1136C>T	10.37:g.51853633C>T	ENSP00000282633:p.Thr379Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	NULL	p.T379M	ENST00000282633.5	37	c.1136	CCDS41527.1	10	.	.	.	.	.	.	.	.	.	.	C	6.414	0.444490	0.12164	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633;ENST00000399339	.	.	.	3.88	-5.37	0.02681	.	0.781535	0.12699	N	0.446536	T	0.14527	0.0351	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.29253	0.05;0.02;0.005;0.02;0.239	B;B;B;B;B	0.16722	0.013;0.013;0.003;0.013;0.016	T	0.05767	-1.0865	9	0.42905	T	0.14	2.3495	2.2948	0.04147	0.3714:0.2592:0.2739:0.0955	.	379;379;291;379;273	E7ESD2;Q641Q2-2;F8W7U3;Q641Q2;Q5T1D7	.;.;.;FA21A_HUMAN;.	M	379;379;273;379;291	.	ENSP00000282633:T379M	T	+	2	0	FAM21A	51523639	0.024000	0.19004	0.096000	0.21009	0.033000	0.12548	-0.884000	0.04166	-1.796000	0.01253	-1.109000	0.02080	ACG	FAM21A	-	NULL	ENSG00000099290		0.488	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM21A	HGNC	protein_coding	OTTHUMT00000276917.2	17	0.00	0	C	NM_001005751		51853633	51853633	+1	no_errors	ENST00000282633	ensembl	human	known	69_37n	missense	8	27.27	3	SNP	0.370	T
FCAR	2204	genome.wustl.edu	37	19	55399502	55399502	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr19:55399502C>A	ENST00000355524.3	+	4	500	c.490C>A	c.(490-492)Ctt>Att	p.L164I	FCAR_ENST00000391725.3_Missense_Mutation_p.L164I|FCAR_ENST00000359272.4_Missense_Mutation_p.L152I|FCAR_ENST00000391723.3_Missense_Mutation_p.L152I|FCAR_ENST00000469767.1_Missense_Mutation_p.L164I|FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000391724.3_Missense_Mutation_p.L152I|CTB-61M7.2_ENST00000594721.1_lincRNA|FCAR_ENST00000391726.3_Intron|FCAR_ENST00000353758.4_Missense_Mutation_p.L55I|FCAR_ENST00000345937.4_Intron	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	164	Ig-like C2-type 2.				immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		GGAGGGAGAACTTTCTCTGCC	0.522																																						dbGAP											0													75.0	65.0	68.0					19																	55399502		2203	4300	6503	-	-	-	SO:0001583	missense	0			X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.490C>A	19.37:g.55399502C>A	ENSP00000347714:p.Leu164Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Missense_Mutation	SNP	smart_Ig_sub	p.L164I	ENST00000355524.3	37	c.490	CCDS12907.1	19	.	.	.	.	.	.	.	.	.	.	C	2.882	-0.231686	0.05983	.	.	ENSG00000186431	ENST00000433231;ENST00000355524;ENST00000391725;ENST00000353758;ENST00000359272;ENST00000391723;ENST00000391724	T;T;T;T;T;T	0.12774	2.65;2.65;2.65;2.65;2.65;2.65	2.86	-2.34	0.06704	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.09024	0.0223	L	0.27053	0.805	0.09310	N	1	B;B;B;B;B;B;B	0.27140	0.041;0.015;0.12;0.037;0.029;0.018;0.169	B;B;B;B;B;B;B	0.36244	0.102;0.11;0.216;0.22;0.188;0.127;0.172	T	0.43228	-0.9404	9	0.36615	T	0.2	.	2.0998	0.03677	0.1267:0.3928:0.3001:0.1804	.	55;152;152;152;164;164;164	Q92592;Q92588;Q92593;Q9UEK0;Q53X39;P24071;P24071-4	.;.;.;.;.;FCAR_HUMAN;.	I	164;164;164;55;152;152;152	ENSP00000347714:L164I;ENSP00000375605:L164I;ENSP00000338058:L55I;ENSP00000352218:L152I;ENSP00000375603:L152I;ENSP00000375604:L152I	ENSP00000338058:L55I	L	+	1	0	FCAR	60091314	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-1.652000	0.01988	-0.370000	0.08016	-0.344000	0.07964	CTT	FCAR	-	smart_Ig_sub	ENSG00000186431		0.522	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCAR	HGNC	protein_coding	OTTHUMT00000141243.1	26	0.00	0	C	NM_002000		55399502	55399502	+1	no_errors	ENST00000355524	ensembl	human	known	69_37n	missense	23	42.50	17	SNP	0.000	A
GATA1	2623	genome.wustl.edu	37	X	48650324	48650324	+	Silent	SNP	C	C	T			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chrX:48650324C>T	ENST00000376670.3	+	3	405	c.294C>T	c.(292-294)taC>taT	p.Y98Y	GATA1_ENST00000376665.3_Silent_p.Y98Y	NM_002049.3	NP_002040.1	P15976	GATA1_HUMAN	GATA binding protein 1 (globin transcription factor 1)	98					basophil differentiation (GO:0030221)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cellular response to thyroid hormone stimulus (GO:0097067)|dendritic cell differentiation (GO:0097028)|embryonic hemopoiesis (GO:0035162)|eosinophil differentiation (GO:0030222)|eosinophil fate commitment (GO:0035854)|erythrocyte development (GO:0048821)|erythrocyte differentiation (GO:0030218)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|megakaryocyte differentiation (GO:0030219)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of definitive erythrocyte differentiation (GO:0010724)|regulation of glycoprotein biosynthetic process (GO:0010559)|transcription from RNA polymerase II promoter (GO:0006366)|transcriptional activation by promoter-enhancer looping (GO:0071733)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	C2H2 zinc finger domain binding (GO:0070742)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.?(2)|p.V77_A120>A(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(259)|large_intestine(8)|lung(9)|prostate(1)	283						GCTGGGCCTACGGCAAGACGG	0.612			"""Mis, F"""		megakaryoblastic leukemia of Downs Syndrome																																Pancreas(9;429 505 11287 29617)	dbGAP		Dom	yes		X	Xp11.23	2623	GATA binding protein 1 (globin transcription factor 1)		L	3	Unknown(2)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(3)											49.0	48.0	49.0					X																	48650324		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			X17254	CCDS14305.1	Xp11.23	2014-09-17	2001-11-28		ENSG00000102145	ENSG00000102145		"""GATA zinc finger domain containing"""	4170	protein-coding gene	gene with protein product	"""nuclear factor, erythroid 1"""	305371	"""GATA-binding protein 1 (globin transcription factor 1)"""	GF1		1999341	Standard	NM_002049		Approved	ERYF1, NFE1, GATA-1, NF-E1	uc004dkq.4	P15976	OTTHUMG00000021504	ENST00000376670.3:c.294C>T	X.37:g.48650324C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96GB8	Silent	SNP	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.Y98	ENST00000376670.3	37	c.294	CCDS14305.1	X																																																																																			GATA1	-	pirsf_TF_GATA-1/2/3	ENSG00000102145		0.612	GATA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATA1	HGNC	protein_coding	OTTHUMT00000056517.1	20	0.00	0	C	NM_002049		48650324	48650324	+1	no_errors	ENST00000376670	ensembl	human	known	69_37n	silent	15	31.82	7	SNP	0.736	T
GH2	2689	genome.wustl.edu	37	17	61958411	61958411	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr17:61958411C>A	ENST00000423893.2	-	3	330	c.269G>T	c.(268-270)aGg>aTg	p.R90M	GH2_ENST00000332800.7_Missense_Mutation_p.R90M|GH2_ENST00000456543.2_Missense_Mutation_p.R90M|GH2_ENST00000449787.2_Missense_Mutation_p.R75M			P01242	SOM2_HUMAN	growth hormone 2	90			R -> W (in dbSNP:rs5389).		JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						CGTTTTCACCCTGTTGGAAGG	0.557																																						dbGAP											0													162.0	170.0	168.0					17																	61958411		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.269G>T	17.37:g.61958411C>A	ENSP00000409294:p.Arg90Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B1A4H5|B1A4H7|O14643|O14644|P09587	Missense_Mutation	SNP	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	p.R90M	ENST00000423893.2	37	c.269	CCDS11647.1	17	.	.	.	.	.	.	.	.	.	.	c	0.224	-1.026224	0.02045	.	.	ENSG00000136487	ENST00000332800;ENST00000456543;ENST00000423893;ENST00000449787	D;D;D;D	0.90069	-2.61;-2.61;-2.61;-2.61	2.91	0.413	0.16401	Somatotropin hormone, conserved site (1);Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.154121	0.56097	D	0.000030	D	0.86732	0.6003	L	0.31157	0.91	0.22489	N	0.99906	P;D;B;D;P	0.71674	0.911;0.998;0.18;0.979;0.911	P;D;B;P;P	0.79108	0.781;0.992;0.114;0.803;0.781	T	0.75741	-0.3211	10	0.30854	T	0.27	.	3.5166	0.07727	0.1956:0.1215:0.0:0.6829	.	90;75;90;90;90	P01242;O14643;O14644;B1A4H7;B1A4H5	SOM2_HUMAN;.;.;.;.	M	90;90;90;75	ENSP00000333157:R90M;ENSP00000394122:R90M;ENSP00000409294:R90M;ENSP00000410618:R75M	ENSP00000333157:R90M	R	-	2	0	GH2	59312143	0.986000	0.35501	0.100000	0.21137	0.001000	0.01503	1.448000	0.35112	-0.034000	0.13713	-2.021000	0.00431	AGG	GH2	-	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	ENSG00000136487		0.557	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GH2	HGNC	protein_coding	OTTHUMT00000417665.1	70	0.00	0	C	NM_002059		61958411	61958411	-1	no_errors	ENST00000332800	ensembl	human	known	69_37n	missense	179	21.15	48	SNP	0.961	A
HDAC2	3066	genome.wustl.edu	37	6	114292109	114292110	+	5'UTR	INS	-	-	CTG	rs545748113|rs528988883	byFrequency	TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr6:114292109_114292110insCTG	ENST00000519065.1	-	0	339_340				HDAC2_ENST00000368632.2_5'UTR|HDAC2_ENST00000519108.1_5'Flank|RP3-399L15.3_ENST00000449620.2_RNA|RP3-399L15.3_ENST00000521888.1_RNA|RP3-399L15.3_ENST00000436876.2_RNA|RP3-399L15.3_ENST00000520891.1_RNA|RP3-399L15.3_ENST00000520554.1_RNA|HDAC2_ENST00000398283.2_In_Frame_Ins_p.81_82insS|RP3-399L15.3_ENST00000519104.1_RNA|RP3-399L15.3_ENST00000522844.1_RNA			Q92769	HDAC2_HUMAN	histone deacetylase 2						ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|cardiac muscle cell development (GO:0055013)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|dendrite development (GO:0016358)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|hair follicle placode formation (GO:0060789)|hippocampus development (GO:0021766)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|maintenance of chromatin silencing (GO:0006344)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell cycle (GO:0045786)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of neuron projection development (GO:0010977)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of proteolysis (GO:0045862)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein deacetylation (GO:0090311)|regulation of protein kinase B signaling (GO:0051896)|regulation of sarcomere organization (GO:0060297)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|replication fork (GO:0005657)|Sin3 complex (GO:0016580)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|poly(A) RNA binding (GO:0044822)|protein deacetylase activity (GO:0033558)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			biliary_tract(1)|central_nervous_system(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Aminophylline(DB01223)|Lovastatin(DB00227)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Valproic Acid(DB00313)|Vorinostat(DB02546)	GGCTCCTCCTCctgctgctgct	0.688														365	0.0728834	0.0227	0.1297	5008	,	,		15962	0.0258		0.1034	False		,,,				2504	0.1176					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			U31814	CCDS43493.1, CCDS43493.2	6q21	2008-08-29			ENSG00000196591	ENSG00000196591			4853	protein-coding gene	gene with protein product		605164				9782097	Standard	NM_001527		Approved	RPD3, YAF1	uc003pwd.2	Q92769	OTTHUMG00000015411	ENST00000519065.1:c.-38->CAG	6.37:g.114292116_114292118dupCTG		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRS5|B4DL58|E1P561|Q5SRI8|Q5SZ86|Q8NEH4	In_Frame_Ins	INS	pfam_His_deacetylse_dom,prints_His_deacetylse_1,prints_His_deacetylse	p.82in_frame_insS	ENST00000519065.1	37	c.246_245	CCDS43493.2	6																																																																																			HDAC2	-	NULL	ENSG00000196591		0.688	HDAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC2	HGNC	protein_coding	OTTHUMT00000041909.2	8	0.00	0	-			114292109	114292110	-1	no_errors	ENST00000398283	ensembl	human	known	69_37n	in_frame_ins	10	23.08	3	INS	0.014:0.004	CTG
KLHL3	26249	genome.wustl.edu	37	5	136969761	136969762	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr5:136969761_136969762delTA	ENST00000309755.4	-	12	1857_1858	c.1414_1415delTA	c.(1414-1416)tacfs	p.Y472fs	KLHL3_ENST00000541417.1_Intron|KLHL3_ENST00000506873.1_5'UTR|KLHL3_ENST00000508657.1_Frame_Shift_Del_p.Y440fs|KLHL3_ENST00000506491.1_Frame_Shift_Del_p.Y390fs	NM_017415.2	NP_059111.2	Q9UH77	KLHL3_HUMAN	kelch-like family member 3	472					distal tubule morphogenesis (GO:0072156)|ion homeostasis (GO:0050801)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|renal sodium ion absorption (GO:0070294)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|stomach(1)|upper_aerodigestive_tract(1)	21		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		GTCCGCCACGTATATCCATTCA	0.535																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB032955	CCDS4192.1, CCDS58969.1, CCDS58970.1	5q31	2013-01-30	2013-01-30		ENSG00000146021	ENSG00000146021		"""Kelch-like"", ""BTB/POZ domain containing"""	6354	protein-coding gene	gene with protein product		605775	"""kelch (Drosophila)-like 3"", ""kelch-like 3 (Drosophila)"""			10843806	Standard	NM_017415		Approved	KIAA1129	uc010jek.3	Q9UH77	OTTHUMG00000129155	ENST00000309755.4:c.1414_1415delTA	5.37:g.136969763_136969764delTA	ENSP00000312397:p.Tyr472fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBK7|Q9UH75|Q9UH76|Q9ULU0|Q9Y6V6	Frame_Shift_Del	DEL	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.Y472fs	ENST00000309755.4	37	c.1415_1414	CCDS4192.1	5																																																																																			KLHL3	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000146021		0.535	KLHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL3	HGNC	protein_coding	OTTHUMT00000251220.2	17	0.00	0	TA			136969761	136969762	-1	no_errors	ENST00000309755	ensembl	human	known	69_37n	frame_shift_del	25	27.78	10	DEL	1.000:0.998	-
MFAP3L	9848	genome.wustl.edu	37	4	170912535	170912535	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr4:170912535A>T	ENST00000361618.3	-	3	1531	c.1224T>A	c.(1222-1224)caT>caA	p.H408Q	MFAP3L_ENST00000393704.3_Missense_Mutation_p.H305Q|RP11-6E9.4_ENST00000508955.1_RNA	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	408						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		GGTATTAGACATGGCTTTCGT	0.473																																						dbGAP											0													153.0	138.0	143.0					4																	170912535		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.1224T>A	4.37:g.170912535A>T	ENSP00000354583:p.His408Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.H408Q	ENST00000361618.3	37	c.1224	CCDS34103.1	4	.	.	.	.	.	.	.	.	.	.	A	18.18	3.566090	0.65651	.	.	ENSG00000198948	ENST00000393704;ENST00000361618	D;D	0.98419	-4.92;-2.04	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.98083	0.9368	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.99899	1.1157	10	0.87932	D	0	-7.1361	16.3998	0.83635	1.0:0.0:0.0:0.0	.	408	O75121	MFA3L_HUMAN	Q	305;408	ENSP00000377307:H305Q;ENSP00000354583:H408Q	ENSP00000354583:H408Q	H	-	3	2	MFAP3L	171149110	1.000000	0.71417	1.000000	0.80357	0.545000	0.35147	7.251000	0.78297	2.275000	0.75901	0.528000	0.53228	CAT	MFAP3L	-	NULL	ENSG00000198948		0.473	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP3L	HGNC	protein_coding	OTTHUMT00000363043.2	62	0.00	0	A	NM_021647		170912535	170912535	-1	no_errors	ENST00000361618	ensembl	human	known	69_37n	missense	72	28.00	28	SNP	1.000	T
MYH9	4627	genome.wustl.edu	37	22	36684952	36684952	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr22:36684952C>A	ENST00000216181.5	-	33	4821	c.4591G>T	c.(4591-4593)Gag>Tag	p.E1531*	MYH9_ENST00000475726.1_5'Flank	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1531					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						ACCTGCTGCTCTAGGGCCCGC	0.637			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																													dbGAP		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													83.0	78.0	80.0					22																	36684952		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.4591G>T	22.37:g.36684952C>A	ENSP00000216181:p.Glu1531*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E4|O60805|Q60FE2|Q86T83	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.E1531*	ENST00000216181.5	37	c.4591	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	c	46	12.414538	0.99665	.	.	ENSG00000100345	ENST00000337818;ENST00000397231;ENST00000216181	.	.	.	5.25	4.24	0.50183	.	0.050650	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.4056	0.67081	0.0:0.9286:0.0:0.0714	.	.	.	.	X	953;133;1531	.	ENSP00000216181:E1531X	E	-	1	0	MYH9	35014898	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.050000	0.71063	1.349000	0.45751	-0.215000	0.12644	GAG	MYH9	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000100345		0.637	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	70	0.00	0	C	NM_002473		36684952	36684952	-1	no_errors	ENST00000216181	ensembl	human	known	69_37n	nonsense	41	34.92	22	SNP	1.000	A
MYO1G	64005	genome.wustl.edu	37	7	45004603	45004603	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr7:45004603G>T	ENST00000258787.7	-	18	2603	c.2467C>A	c.(2467-2469)Caa>Aaa	p.Q823K		NM_033054.2	NP_149043.2	B0I1T2	MYO1G_HUMAN	myosin IG	823	Myosin tail. {ECO:0000255}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|skin(4)	28						CGAAGCCCTTGCAGGGCCCCC	0.682																																						dbGAP											0													43.0	51.0	48.0					7																	45004603		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF380932	CCDS34629.1	7p13-p11.2	2011-09-27			ENSG00000136286	ENSG00000136286		"""Myosins / Myosin superfamily : Class I"""	13880	protein-coding gene	gene with protein product	"""minor histocompatibility antigen HA-2"""	600642					Standard	NM_033054		Approved	HA-2	uc003tmh.2	B0I1T2	OTTHUMG00000155821	ENST00000258787.7:c.2467C>A	7.37:g.45004603G>T	ENSP00000258787:p.Gln823Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEI9|Q8TES2|Q96BE2|Q96RI5|Q96RI6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.Q823K	ENST00000258787.7	37	c.2467	CCDS34629.1	7	.	.	.	.	.	.	.	.	.	.	G	1.572	-0.533819	0.04082	.	.	ENSG00000136286	ENST00000258787	T	0.31247	1.5	4.29	4.29	0.51040	Myosin tail 2 (1);	0.000000	0.36665	N	0.002469	T	0.17577	0.0422	L	0.27053	0.805	0.29312	N	0.86798	B	0.06786	0.001	B	0.14023	0.01	T	0.18777	-1.0326	10	0.02654	T	1	.	11.028	0.47757	0.0:0.0:0.8138:0.1861	.	823	B0I1T2	MYO1G_HUMAN	K	823	ENSP00000258787:Q823K	ENSP00000258787:Q823K	Q	-	1	0	MYO1G	44971128	1.000000	0.71417	0.303000	0.25071	0.733000	0.41908	1.703000	0.37846	2.101000	0.63845	0.561000	0.74099	CAA	MYO1G	-	pfam_Myosin_tail_2	ENSG00000136286		0.682	MYO1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1G	HGNC	protein_coding	OTTHUMT00000341832.2	13	0.00	0	G			45004603	45004603	-1	no_errors	ENST00000258787	ensembl	human	known	69_37n	missense	12	42.86	9	SNP	0.999	T
NHSL2	340527	genome.wustl.edu	37	X	71360164	71360164	+	Silent	SNP	G	G	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chrX:71360164G>A	ENST00000373677.1	+	2	2930	c.1668G>A	c.(1666-1668)acG>acA	p.T556T	NHSL2_ENST00000510661.1_Silent_p.T691T|NHSL2_ENST00000535692.1_Silent_p.T556T|NHSL2_ENST00000540800.1_Silent_p.T922T			Q5HYW2	NHSL2_HUMAN	NHS-like 2	556										NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					ACAGCTACACGGTAGTGCGGA	0.537																																						dbGAP											0													86.0	66.0	73.0					X																	71360164		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.1668G>A	X.37:g.71360164G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN94	Silent	SNP	NULL	p.T922	ENST00000373677.1	37	c.2766		X																																																																																			NHSL2	-	NULL	ENSG00000204131		0.537	NHSL2-001	KNOWN	basic	protein_coding	NHSL2	HGNC	protein_coding	OTTHUMT00000057170.1	44	0.00	0	G	NM_001013627		71360164	71360164	+1	no_errors	ENST00000540800	ensembl	human	known	69_37n	silent	38	29.63	16	SNP	0.001	A
OR51E2	81285	genome.wustl.edu	37	11	4703136	4703136	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr11:4703136G>T	ENST00000396950.3	-	2	1045	c.806C>A	c.(805-807)cCc>cAc	p.P269H		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	269					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		ACGCACAATGGGATGAAGGCT	0.507																																						dbGAP											0													172.0	125.0	141.0					11																	4703136		2201	4298	6499	-	-	-	SO:0001583	missense	0			AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.806C>A	11.37:g.4703136G>T	ENSP00000380153:p.Pro269His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA63|Q6IF94	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.P269H	ENST00000396950.3	37	c.806	CCDS7751.1	11	.	.	.	.	.	.	.	.	.	.	G	7.628	0.678189	0.14841	.	.	ENSG00000167332	ENST00000396950	T	0.00231	8.49	5.18	3.27	0.37495	GPCR, rhodopsin-like superfamily (1);	0.149343	0.31370	N	0.007768	T	0.00300	0.0009	L	0.41079	1.255	0.09310	N	1	D	0.76494	0.999	D	0.74023	0.982	T	0.55648	-0.8108	10	0.30078	T	0.28	.	6.4097	0.21684	0.0922:0.0:0.7287:0.1791	.	269	Q9H255	O51E2_HUMAN	H	269	ENSP00000380153:P269H	ENSP00000380153:P269H	P	-	2	0	OR51E2	4659712	0.001000	0.12720	0.944000	0.38274	0.098000	0.18820	0.640000	0.24705	0.730000	0.32425	-0.150000	0.13652	CCC	OR51E2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000167332		0.507	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51E2	HGNC	protein_coding	OTTHUMT00000257198.1	41	0.00	0	G	NM_030774		4703136	4703136	-1	no_errors	ENST00000396950	ensembl	human	known	69_37n	missense	27	27.03	10	SNP	0.071	T
PAPPA	5069	genome.wustl.edu	37	9	119115961	119115961	+	Silent	SNP	T	T	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr9:119115961T>A	ENST00000328252.3	+	17	4605	c.4236T>A	c.(4234-4236)ccT>ccA	p.P1412P	PAPPA_ENST00000534838.1_Silent_p.P450P	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1412	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CTTGTGTTCCTGTGACCTGTG	0.512																																						dbGAP											0													227.0	191.0	203.0					9																	119115961		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.4236T>A	9.37:g.119115961T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.P1412	ENST00000328252.3	37	c.4236	CCDS6813.1	9																																																																																			PAPPA	-	superfamily_Complement_control_module	ENSG00000182752		0.512	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	86	0.00	0	T	NM_002581		119115961	119115961	+1	no_errors	ENST00000328252	ensembl	human	known	69_37n	silent	58	33.33	29	SNP	0.918	A
PCF11	51585	genome.wustl.edu	37	11	82877694	82877694	+	Silent	SNP	A	A	G			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr11:82877694A>G	ENST00000298281.4	+	5	2207	c.1755A>G	c.(1753-1755)gtA>gtG	p.V585V		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	585					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						AGGAGAATGTAGAAAACTGGC	0.393																																						dbGAP											0													67.0	67.0	67.0					11																	82877694		1812	4033	5845	-	-	-	SO:0001819	synonymous_variant	0			AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1755A>G	11.37:g.82877694A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W7|O43671|Q6P0X8	Silent	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	p.V585	ENST00000298281.4	37	c.1755	CCDS44689.1	11																																																																																			PCF11	-	NULL	ENSG00000165494		0.393	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCF11	HGNC	protein_coding	OTTHUMT00000392548.2	10	0.00	0	A	NM_015885		82877694	82877694	+1	no_errors	ENST00000298281	ensembl	human	known	69_37n	silent	1	87.50	7	SNP	0.521	G
PKHD1L1	93035	genome.wustl.edu	37	8	110424512	110424512	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr8:110424512C>A	ENST00000378402.5	+	20	2208	c.2104C>A	c.(2104-2106)Cag>Aag	p.Q702K		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	702					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TAACAGAGGGCAGAAGACAGC	0.408										HNSCC(38;0.096)																												dbGAP											0													116.0	108.0	111.0					8																	110424512		1858	4106	5964	-	-	-	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.2104C>A	8.37:g.110424512C>A	ENSP00000367655:p.Gln702Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.Q702K	ENST00000378402.5	37	c.2104	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	C	12.58	1.979360	0.34942	.	.	ENSG00000205038	ENST00000378402	D	0.85411	-1.98	4.9	4.9	0.64082	.	0.485483	0.20250	N	0.096101	T	0.76104	0.3941	L	0.36672	1.1	0.26955	N	0.965948	B	0.02656	0.0	B	0.06405	0.002	T	0.56444	-0.7978	10	0.06236	T	0.91	.	13.9775	0.64282	0.0:1.0:0.0:0.0	.	702	Q86WI1	PKHL1_HUMAN	K	702	ENSP00000367655:Q702K	ENSP00000367655:Q702K	Q	+	1	0	PKHD1L1	110493688	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	1.716000	0.37981	2.429000	0.82318	0.485000	0.47835	CAG	PKHD1L1	-	NULL	ENSG00000205038		0.408	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	69	0.00	0	C	NM_177531		110424512	110424512	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	missense	46	33.33	23	SNP	1.000	A
PLD1	5337	genome.wustl.edu	37	3	171455363	171455363	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr3:171455363C>T	ENST00000351298.4	-	3	373	c.247G>A	c.(247-249)Gca>Aca	p.A83T	PLD1_ENST00000340989.4_Missense_Mutation_p.A83T|PLD1_ENST00000356327.5_Missense_Mutation_p.A83T|PLD1_ENST00000342215.6_Missense_Mutation_p.A83T	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	83	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	AGAACTTGTGCTTTTATTGGA	0.368																																					NSCLC(149;2174 3517 34058)	dbGAP											0													119.0	117.0	118.0					3																	171455363		2203	4300	6503	-	-	-	SO:0001583	missense	0			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.247G>A	3.37:g.171455363C>T	ENSP00000342793:p.Ala83Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Phox,pfam_PLipase_D/transphosphatidylase,pfam_Pleckstrin_homology,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.A83T	ENST00000351298.4	37	c.247	CCDS3216.1	3	.	.	.	.	.	.	.	.	.	.	C	24.7	4.557771	0.86231	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000342215;ENST00000340989;ENST00000418087	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	5.27	5.27	0.74061	Phox homologous domain (5);	0.248281	0.38778	N	0.001571	T	0.42108	0.1188	L	0.45352	1.415	0.28562	N	0.911058	P;B	0.37398	0.593;0.181	P;B	0.48571	0.582;0.287	T	0.33701	-0.9858	10	0.52906	T	0.07	-8.452	18.8565	0.92254	0.0:1.0:0.0:0.0	.	106;83	Q59EA4;Q13393	.;PLD1_HUMAN	T	83	ENSP00000348681:A83T;ENSP00000342793:A83T;ENSP00000339936:A83T;ENSP00000340326:A83T;ENSP00000400639:A83T	ENSP00000340326:A83T	A	-	1	0	PLD1	172938057	1.000000	0.71417	0.172000	0.22920	0.994000	0.84299	6.147000	0.71783	2.614000	0.88457	0.655000	0.94253	GCA	PLD1	-	pfam_Phox,superfamily_Phox,smart_Phox,pirsf_PLipase_D_euk,pfscan_Phox	ENSG00000075651		0.368	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	HGNC	protein_coding	OTTHUMT00000346730.2	84	0.00	0	C	NM_002662		171455363	171455363	-1	no_errors	ENST00000351298	ensembl	human	known	69_37n	missense	86	23.21	26	SNP	0.345	T
PTGES3	10728	genome.wustl.edu	37	12	57065615	57065615	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr12:57065615C>G	ENST00000262033.6	-	4	503	c.203G>C	c.(202-204)aGa>aCa	p.R68T	PTGES3_ENST00000436399.2_Intron|PTGES3_ENST00000456859.2_Intron|PTGES3_ENST00000537473.1_5'UTR|PTGES3_ENST00000414274.3_Missense_Mutation_p.R68T|RN7SL809P_ENST00000482040.2_RNA|PTGES3_ENST00000448157.2_Missense_Mutation_p.R68T	NM_006601.5	NP_006592.3	Q15185	TEBP_HUMAN	prostaglandin E synthase 3 (cytosolic)	68	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				arachidonic acid metabolic process (GO:0019369)|cell proliferation (GO:0008283)|chaperone cofactor-dependent protein refolding (GO:0070389)|cyclooxygenase pathway (GO:0019371)|glucocorticoid receptor signaling pathway (GO:0042921)|glycogen biosynthetic process (GO:0005978)|lung saccule development (GO:0060430)|prostaglandin biosynthetic process (GO:0001516)|RNA-dependent DNA replication (GO:0006278)|signal transduction (GO:0007165)|skin development (GO:0043588)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	prostaglandin-E synthase activity (GO:0050220)|telomerase activity (GO:0003720)|unfolded protein binding (GO:0051082)			large_intestine(1)|lung(1)	2						TCTGTCCGTTCTTTTATGCTT	0.368																																						dbGAP											0													72.0	70.0	71.0					12																	57065615		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC003005	CCDS31836.1, CCDS61158.1, CCDS61159.1, CCDS61160.1, CCDS73485.1	12q13.13	2012-03-14			ENSG00000110958	ENSG00000110958			16049	protein-coding gene	gene with protein product		607061				8114727, 12077419	Standard	XR_245889		Approved	p23, TEBP, cPGES	uc001slu.4	Q15185	OTTHUMG00000170217	ENST00000262033.6:c.203G>C	12.37:g.57065615C>G	ENSP00000262033:p.Arg68Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7D0|B4DHP2|B4DP11|B4DP21|Q8WU70	Missense_Mutation	SNP	pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	p.R68T	ENST00000262033.6	37	c.203	CCDS31836.1	12	.	.	.	.	.	.	.	.	.	.	C	21.0	4.088560	0.76756	.	.	ENSG00000110958	ENST00000262033;ENST00000414274;ENST00000448157	T;T;T	0.12984	2.63;2.63;2.63	5.7	4.81	0.61882	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.046655	0.85682	D	0.000000	T	0.34542	0.0901	M	0.74881	2.28	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.68765	0.932;0.96;0.932	T	0.06991	-1.0796	10	0.31617	T	0.26	.	13.5471	0.61711	0.0:0.9237:0.0:0.0763	.	68;68;68	B4DP11;B4DP21;Q15185	.;.;TEBP_HUMAN	T	68	ENSP00000262033:R68T;ENSP00000405299:R68T;ENSP00000414892:R68T	ENSP00000262033:R68T	R	-	2	0	PTGES3	55351882	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.718000	0.84743	1.408000	0.46895	0.585000	0.79938	AGA	PTGES3	-	pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	ENSG00000110958		0.368	PTGES3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGES3	HGNC	protein_coding	OTTHUMT00000408054.1	54	0.00	0	C	NM_006601		57065615	57065615	-1	no_errors	ENST00000262033	ensembl	human	known	69_37n	missense	51	27.14	19	SNP	1.000	G
RBBP4	5928	genome.wustl.edu	37	1	33138484	33138484	+	Silent	SNP	C	C	T			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr1:33138484C>T	ENST00000373493.5	+	11	1353	c.1194C>T	c.(1192-1194)atC>atT	p.I398I	RBBP4_ENST00000544435.1_Silent_p.I146I|RBBP4_ENST00000458695.2_Silent_p.I363I|RBBP4_ENST00000414241.3_Silent_p.I397I|RBBP4_ENST00000373485.1_Silent_p.I398I	NM_001135255.1|NM_005610.2	NP_001128727.1|NP_005601.1	Q09028	RBBP4_HUMAN	retinoblastoma binding protein 4	398					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin assembly (GO:0031497)|chromatin remodeling (GO:0006338)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|nucleosome assembly (GO:0006334)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|NURF complex (GO:0016589)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				AAGACAATATCATGCAAGTGT	0.343																																						dbGAP											0													80.0	78.0	78.0					1																	33138484		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC053904	CCDS366.1, CCDS44105.1, CCDS44106.1	1p35.1	2014-07-17	2001-11-28		ENSG00000162521	ENSG00000162521		"""WD repeat domain containing"""	9887	protein-coding gene	gene with protein product		602923	"""retinoblastoma-binding protein 4"""			8350924, 14609955, 17531812	Standard	NM_005610		Approved	RbAp48, NURF55, lin-53	uc001bvr.3	Q09028	OTTHUMG00000007998	ENST00000373493.5:c.1194C>T	1.37:g.33138484C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6G9|B4DRH0|D3DPQ3|P31149|Q53H02|Q96BV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S158L	ENST00000373493.5	37	c.473	CCDS366.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.971|8.971	0.972920|0.972920	0.18736|0.18736	.|.	.|.	ENSG00000162521|ENSG00000162521	ENST00000475321|ENST00000463378	.|.	.|.	.|.	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	.|.	.|.	.|.	.|.	T|T	0.73345|0.73345	0.3575|0.3575	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.72988|0.72988	-0.4124|-0.4124	4|4	.|.	.|.	.|.	.|.	17.2994|17.2994	0.87178|0.87178	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	Y|L	201|158	.|.	.|.	H|S	+|+	1|2	0|0	RBBP4|RBBP4	32911071|32911071	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.971000|3.971000	0.56831|0.56831	2.398000|2.398000	0.81561|0.81561	0.591000|0.591000	0.81541|0.81541	CAT|TCA	RBBP4	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000162521		0.343	RBBP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBBP4	HGNC	protein_coding	OTTHUMT00000021957.3	89	0.00	0	C	NM_005610		33138484	33138484	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000463378	ensembl	human	putative	69_37n	missense	70	31.37	32	SNP	1.000	T
SAMD14	201191	genome.wustl.edu	37	17	48191567	48191567	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr17:48191567G>A	ENST00000330175.4	-	8	1243	c.926C>T	c.(925-927)tCt>tTt	p.S309F	SAMD14_ENST00000503131.1_Missense_Mutation_p.S337F|SAMD14_ENST00000503734.1_5'Flank	NM_001257359.1	NP_001244288.1	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	309										breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	15						TGAAGACTGAGACAGCGTGTG	0.622																																						dbGAP											0													70.0	68.0	69.0					17																	48191567		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11560.1, CCDS58562.1	17q21.33	2013-01-10				ENSG00000167100		"""Sterile alpha motif (SAM) domain containing"""	27312	protein-coding gene	gene with protein product						8619474	Standard	NM_174920		Approved	FLJ36890	uc002iqg.4	Q8IZD0		ENST00000330175.4:c.926C>T	17.37:g.48191567G>A	ENSP00000329144:p.Ser309Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8V1|Q8N2X0	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.S337F	ENST00000330175.4	37	c.1010	CCDS58562.1	17	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812878	0.70912	.	.	ENSG00000167100	ENST00000330175;ENST00000285206;ENST00000503131	.	.	.	5.11	5.11	0.69529	.	0.000000	0.64402	D	0.000018	T	0.64136	0.2571	L	0.44542	1.39	0.48452	D	0.999651	P;D	0.54047	0.94;0.964	P;P	0.55713	0.459;0.782	T	0.67158	-0.5741	9	0.66056	D	0.02	-9.9672	15.4679	0.75416	0.0:0.0:1.0:0.0	.	309;337	Q8IZD0;Q8IZD0-2	SAM14_HUMAN;.	F	309;321;337	.	ENSP00000285206:S321F	S	-	2	0	SAMD14	45546566	1.000000	0.71417	1.000000	0.80357	0.586000	0.36452	5.968000	0.70413	2.379000	0.81126	0.462000	0.41574	TCT	SAMD14	-	NULL	ENSG00000167100		0.622	SAMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD14	HGNC	protein_coding	OTTHUMT00000366661.1	34	0.00	0	G	NM_174920		48191567	48191567	-1	no_errors	ENST00000503131	ensembl	human	known	69_37n	missense	31	72.07	80	SNP	1.000	A
SEPT5	5413	genome.wustl.edu	37	22	19708187	19708187	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr22:19708187C>T	ENST00000455784.2	+	7	738	c.613C>T	c.(613-615)Cgg>Tgg	p.R205W	SEPT5_ENST00000406395.1_Missense_Mutation_p.R205W|SEPT5_ENST00000438754.2_Missense_Mutation_p.R214W|GP1BB_ENST00000366425.3_5'Flank|SEPT5_ENST00000383045.3_Missense_Mutation_p.R214W	NM_002688.5	NP_002679.2	Q99719	SEPT5_HUMAN	septin 5	205	Septin-type G.				cytokinesis (GO:0000910)|GTP catabolic process (GO:0006184)|regulation of exocytosis (GO:0017157)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic vesicle targeting (GO:0016080)	plasma membrane (GO:0005886)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			lung(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					GCTGAAGGAGCGGGTGAGCCT	0.597																																						dbGAP											0													52.0	50.0	50.0					22																	19708187		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11593	CCDS13764.1, CCDS56224.1	22q11.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000184702	ENSG00000184702		"""Septins"""	9164	protein-coding gene	gene with protein product		602724	"""peanut-like 1 (Drosophila)"""	PNUTL1		9385360, 9611266	Standard	NM_002688		Approved	HCDCREL-1, H5		Q99719	OTTHUMG00000150399	ENST00000455784.2:c.613C>T	22.37:g.19708187C>T	ENSP00000391311:p.Arg205Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O15251|Q96MY5	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,pirsf_Septin	p.R214W	ENST00000455784.2	37	c.640	CCDS13764.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.76|14.76	2.630420|2.630420	0.46944|0.46944	.|.	.|.	ENSG00000184702|ENSG00000184702	ENST00000413258|ENST00000455784;ENST00000406395;ENST00000412544;ENST00000431124;ENST00000383045;ENST00000438754;ENST00000395109	.|T;T;T;T;T;T;T	.|0.54866	.|0.55;0.55;0.55;0.55;0.55;0.55;0.55	3.13|3.13	2.06|2.06	0.26882|0.26882	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75317|0.75317	0.3833|0.3833	M|M	0.92317|0.92317	3.295|3.295	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	T|T	0.79004|0.79004	-0.1980|-0.1980	5|10	.|0.87932	.|D	.|0	.|.	10.2822|10.2822	0.43545|0.43545	0.4402:0.5598:0.0:0.0|0.4402:0.5598:0.0:0.0	.|.	.|205	.|Q99719	.|SEPT5_HUMAN	V|W	70|205;205;158;243;214;214;158	.|ENSP00000391311:R205W;ENSP00000384535:R205W;ENSP00000408678:R158W;ENSP00000414488:R243W;ENSP00000372515:R214W;ENSP00000394541:R214W;ENSP00000378541:R158W	.|ENSP00000372515:R214W	A|R	+|+	2|1	0|2	SEPT5|SEPT5	18088187|18088187	0.924000|0.924000	0.31332|0.31332	0.998000|0.998000	0.56505|0.56505	0.312000|0.312000	0.27988|0.27988	1.653000|1.653000	0.37323|0.37323	0.813000|0.813000	0.34350|0.34350	0.313000|0.313000	0.20887|0.20887	GCG|CGG	SEPT5	-	pfam_Cell_div_GTP-bd,pirsf_Septin	ENSG00000184702		0.597	SEPT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT5	HGNC	protein_coding	OTTHUMT00000317937.1	17	0.00	0	C	NM_002688		19708187	19708187	+1	no_errors	ENST00000383045	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	0.998	T
SBF1	6305	genome.wustl.edu	37	22	50906107	50906107	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr22:50906107C>T	ENST00000390679.3	-	4	476	c.292G>A	c.(292-294)Gtg>Atg	p.V98M	SBF1_ENST00000348911.6_Missense_Mutation_p.V99M|SBF1_ENST00000380817.3_Missense_Mutation_p.V98M			O95248	MTMR5_HUMAN	SET binding factor 1	98					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		GCATCCTCCACGCGCGTCGTT	0.652																																						dbGAP											0													58.0	60.0	59.0					22																	50906107		2092	4177	6269	-	-	-	SO:0001583	missense	0			U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.292G>A	22.37:g.50906107C>T	ENSP00000375097:p.Val98Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	pfam_SBF2,pfam_DENN_dom,pfam_uDENN_dom,pfam_Myotub-related,pfam_dDENN_dom,pfam_GRAM,pfam_Pleckstrin_homology,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_GRAM,smart_Pleckstrin_homology,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_Pleckstrin_homology	p.V98M	ENST00000390679.3	37	c.292		22	.	.	.	.	.	.	.	.	.	.	C	3.279	-0.147406	0.06627	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000356279;ENST00000337034;ENST00000390679	D;D;D	0.86097	-2.07;-2.07;-2.07	4.39	-8.77	0.00827	.	1.863050	0.03082	N	0.158685	T	0.64735	0.2625	N	0.08118	0	0.09310	N	1	B;B	0.21520	0.011;0.057	B;B	0.11329	0.002;0.006	T	0.57659	-0.7773	10	0.48119	T	0.1	.	3.0486	0.06161	0.2121:0.4429:0.1981:0.1469	.	99;98	G5E933;O95248-4	.;.	M	98;99;109;108;98	ENSP00000370196:V98M;ENSP00000252027:V99M;ENSP00000375097:V98M	ENSP00000336522:V108M	V	-	1	0	SBF1	49252973	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.433000	0.01021	-2.442000	0.00549	-0.397000	0.06425	GTG	SBF1	-	NULL	ENSG00000100241		0.652	SBF1-201	KNOWN	basic	protein_coding	SBF1	HGNC	protein_coding		31	0.00	0	C			50906107	50906107	-1	no_errors	ENST00000380817	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	0.000	T
SERBP1	26135	genome.wustl.edu	37	1	67891834	67891834	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr1:67891834C>T	ENST00000370995.2	-	2	533	c.448G>A	c.(448-450)Gaa>Aaa	p.E150K	SERBP1_ENST00000370994.4_Missense_Mutation_p.E150K|SERBP1_ENST00000484880.1_5'Flank|SERBP1_ENST00000361219.6_Missense_Mutation_p.E150K|SERBP1_ENST00000370990.5_Missense_Mutation_p.E150K			Q8NC51	PAIRB_HUMAN	SERPINE1 mRNA binding protein 1	150					regulation of apoptotic process (GO:0042981)|regulation of mRNA stability (GO:0043488)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	13						ACTGAAAATTCGCCTCCTTCA	0.458																																						dbGAP											0													164.0	164.0	164.0					1																	67891834		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151813	CCDS639.1, CCDS30746.1, CCDS30747.1, CCDS30748.1	1p31	2009-12-17			ENSG00000142864	ENSG00000142864			17860	protein-coding gene	gene with protein product		607378				11001948, 10810093, 18440126, 17698176	Standard	NM_001018067		Approved	PAI-RBP1, DKFZP564M2423, CGI-55, HABP4L, PAIRBP1, CHD3IP	uc001ddv.3	Q8NC51	OTTHUMG00000009372	ENST00000370995.2:c.448G>A	1.37:g.67891834C>T	ENSP00000360034:p.Glu150Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VU19|Q5VU20|Q5VU22|Q8WUH0|Q96SE2|Q9BTY3|Q9BUM4|Q9Y367|Q9Y4S3	Missense_Mutation	SNP	pfam_HABP4_PAIRBP1-bd	p.E150K	ENST00000370995.2	37	c.448	CCDS30746.1	1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782367	0.90282	.	.	ENSG00000142864	ENST00000370994;ENST00000370995;ENST00000361219;ENST00000370990	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.60495	0.2273	L	0.44542	1.39	0.80722	D	1	D;D;D;D	0.89917	0.999;0.997;0.999;1.0	D;D;D;D	0.76575	0.959;0.955;0.988;0.988	T	0.53851	-0.8380	9	0.22706	T	0.39	-23.7222	17.5446	0.87857	0.0:1.0:0.0:0.0	.	213;213;150;150	D3DQ69;D3DQ70;Q8NC51-3;Q8NC51	.;.;.;PAIRB_HUMAN	K	150	.	ENSP00000354591:E150K	E	-	1	0	SERBP1	67664422	1.000000	0.71417	0.972000	0.41901	0.880000	0.50808	6.581000	0.74045	2.524000	0.85096	0.460000	0.39030	GAA	SERBP1	-	NULL	ENSG00000142864		0.458	SERBP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SERBP1	HGNC	protein_coding	OTTHUMT00000025984.2	112	0.00	0	C	NM_001018067		67891834	67891834	-1	no_errors	ENST00000370995	ensembl	human	known	69_37n	missense	76	36.13	43	SNP	1.000	T
SLC22A11	55867	genome.wustl.edu	37	11	64338508	64338508	+	Silent	SNP	G	G	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr11:64338508G>A	ENST00000301891.4	+	10	2021	c.1647G>A	c.(1645-1647)tcG>tcA	p.S549S	SLC22A11_ENST00000377585.3_Silent_p.S441S|SLC22A11_ENST00000377581.3_Silent_p.S480S	NM_018484.2	NP_060954.1	Q9NSA0	S22AB_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 11	549					organic anion transport (GO:0015711)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23					Aminohippurate(DB00345)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Estradiol(DB00783)|Furosemide(DB00695)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Novobiocin(DB01051)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Salicylic acid(DB00936)|Tetracycline(DB00759)|Zidovudine(DB00495)	AAAGTACCTCGCTCTAGAAAT	0.527																																						dbGAP											0													95.0	95.0	95.0					11																	64338508		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			AB026116	CCDS8074.1	11q13.3	2013-05-22	2008-01-11		ENSG00000168065	ENSG00000168065		"""Solute carriers"""	18120	protein-coding gene	gene with protein product		607097				10660625, 15576633, 17229912	Standard	NM_018484		Approved	OAT4	uc001oai.3	Q9NSA0	OTTHUMG00000045142	ENST00000301891.4:c.1647G>A	11.37:g.64338508G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K426|Q53GR2|Q6ZP72|Q8NBU4	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S549	ENST00000301891.4	37	c.1647	CCDS8074.1	11																																																																																			SLC22A11	-	NULL	ENSG00000168065		0.527	SLC22A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A11	HGNC	protein_coding	OTTHUMT00000104886.4	52	0.00	0	G	NM_018484		64338508	64338508	+1	no_errors	ENST00000301891	ensembl	human	known	69_37n	silent	61	20.51	16	SNP	0.973	A
SUGP1	57794	genome.wustl.edu	37	19	19390149	19390149	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr19:19390149G>T	ENST00000247001.5	-	10	1748	c.1401C>A	c.(1399-1401)gaC>gaA	p.D467E		NM_172231.3	NP_757386.2	Q8IWZ8	SUGP1_HUMAN	SURP and G patch domain containing 1	467	Gln/Met-rich.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	22						GCAGCTGCATGTCCTGCATGG	0.627																																						dbGAP											0													80.0	52.0	61.0					19																	19390149		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF521128	CCDS12399.1	19p13	2013-01-28	2010-08-10	2010-08-10		ENSG00000105705		"""G patch domain containing"""	18643	protein-coding gene	gene with protein product		607992	"""splicing factor 4"""	SF4		12594045	Standard	NM_172231		Approved	F23858, DKFZp434E2216, RBP	uc002nmh.3	Q8IWZ8		ENST00000247001.5:c.1401C>A	19.37:g.19390149G>T	ENSP00000247001:p.Asp467Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O60378|Q6P3X9|Q8TCQ4|Q8WWT4|Q8WWT5|Q9NTG3	Missense_Mutation	SNP	pfam_Surp,pfam_G_patch_dom,superfamily_Surp,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.D467E	ENST00000247001.5	37	c.1401	CCDS12399.1	19	.	.	.	.	.	.	.	.	.	.	G	3.599	-0.082004	0.07141	.	.	ENSG00000105705	ENST00000247001	T	0.19394	2.15	5.04	3.97	0.46021	.	0.187626	0.44688	D	0.000435	T	0.05640	0.0148	N	0.01352	-0.895	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.26430	-1.0103	10	0.02654	T	1	.	8.6388	0.33964	0.0:0.3107:0.5295:0.1598	.	467	Q8IWZ8	SUGP1_HUMAN	E	467	ENSP00000247001:D467E	ENSP00000247001:D467E	D	-	3	2	SUGP1	19251149	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.331000	0.33793	1.072000	0.40860	0.561000	0.74099	GAC	SUGP1	-	NULL	ENSG00000105705		0.627	SUGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUGP1	HGNC	protein_coding	OTTHUMT00000460128.4	34	0.00	0	G	NM_021164		19390149	19390149	-1	no_errors	ENST00000247001	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	20	0.00	0	C	NM_000546		7578406	7578406	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	5	75.00	15	SNP	1.000	T
TRUB1	142940	genome.wustl.edu	37	10	116710886	116710886	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr10:116710886C>T	ENST00000298746.3	+	3	480	c.419C>T	c.(418-420)aCc>aTc	p.T140I	TRUB1_ENST00000485065.1_3'UTR	NM_139169.4	NP_631908.1	Q8WWH5	TRUB1_HUMAN	TruB pseudouridine (psi) synthase family member 1	140					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			breast(2)|kidney(2)|large_intestine(1)|lung(5)|urinary_tract(2)	12		Colorectal(252;0.09)|Breast(234;0.174)|Lung NSC(174;0.245)		Epithelial(162;0.00879)|all cancers(201;0.0243)		AAAATGTTGACCAGTATGTTG	0.289																																						dbGAP											0													193.0	196.0	195.0					10																	116710886		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF448144	CCDS7591.1	10q25.3	2013-09-02	2013-09-02		ENSG00000165832	ENSG00000165832			16060	protein-coding gene	gene with protein product		610726	"""TruB pseudouridine (psi) synthase homolog 1 (E. coli)"""			12736709	Standard	NM_139169		Approved	PUS4	uc001lcd.3	Q8WWH5	OTTHUMG00000019094	ENST00000298746.3:c.419C>T	10.37:g.116710886C>T	ENSP00000298746:p.Thr140Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R716|Q53ES2	Missense_Mutation	SNP	pfam_PsdUridine_synth,superfamily_PsdUridine_synth_cat_dom,tigrfam_tRNA_psdUridine_synth_TruB	p.T140I	ENST00000298746.3	37	c.419	CCDS7591.1	10	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007986	0.54361	.	.	ENSG00000165832	ENST00000298746	T	0.14266	2.52	5.42	3.42	0.39159	Pseudouridine synthase, catalytic domain (1);	0.412793	0.25472	N	0.030433	T	0.24699	0.0599	M	0.66439	2.03	0.36250	D	0.853848	P	0.46621	0.881	P	0.51266	0.664	T	0.28902	-1.0029	10	0.54805	T	0.06	-13.4911	11.9052	0.52708	0.0:0.6619:0.338:0.0	.	140	Q8WWH5	TRUB1_HUMAN	I	140	ENSP00000298746:T140I	ENSP00000298746:T140I	T	+	2	0	TRUB1	116700876	0.987000	0.35691	1.000000	0.80357	0.994000	0.84299	0.663000	0.25053	1.396000	0.46663	0.591000	0.81541	ACC	TRUB1	-	pfam_PsdUridine_synth,superfamily_PsdUridine_synth_cat_dom,tigrfam_tRNA_psdUridine_synth_TruB	ENSG00000165832		0.289	TRUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRUB1	HGNC	protein_coding	OTTHUMT00000050504.1	206	0.00	0	C	NM_139169		116710886	116710886	+1	no_errors	ENST00000298746	ensembl	human	known	69_37n	missense	135	30.41	59	SNP	1.000	T
USP42	84132	genome.wustl.edu	37	7	6175584	6175584	+	Splice_Site	SNP	T	T	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr7:6175584T>A	ENST00000306177.5	+	4	711		c.e4+2			NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42						cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		AGATGCGGCGTAAGTATTAAC	0.353																																						dbGAP											0													105.0	94.0	97.0					7																	6175584		1835	4081	5916	-	-	-	SO:0001630	splice_region_variant	0			AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.553+2T>A	7.37:g.6175584T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Splice_Site	SNP	-	e3+2	ENST00000306177.5	37	c.553+2	CCDS47535.1	7	.	.	.	.	.	.	.	.	.	.	T	24.2	4.510345	0.85389	.	.	ENSG00000106346	ENST00000306177;ENST00000465073;ENST00000426246	.	.	.	5.19	5.19	0.71726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9961	0.71433	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	USP42	6142110	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.306000	0.78905	2.083000	0.62718	0.383000	0.25322	.	USP42	-	-	ENSG00000106346		0.353	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	USP42	HGNC	protein_coding	OTTHUMT00000324262.3	71	0.00	0	T	XM_166526	Intron	6175584	6175584	+1	no_errors	ENST00000306177	ensembl	human	known	69_37n	splice_site	68	26.88	25	SNP	1.000	A
VARS	7407	genome.wustl.edu	37	6	31749701	31749701	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr6:31749701delC	ENST00000375663.3	-	19	2710	c.2270delG	c.(2269-2271)ggafs	p.G757fs	VARS_ENST00000444930.2_3'UTR|VARS_ENST00000482996.1_5'UTR	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	757					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	CTCATTGCGTCCACTCACCCA	0.632																																						dbGAP											0													122.0	140.0	134.0					6																	31749701		1511	2709	4220	-	-	-	SO:0001589	frameshift_variant	0			BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.2270delG	6.37:g.31749701delC	ENSP00000364815:p.Gly757fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Frame_Shift_Del	DEL	pfam_aa-tRNA-synth_Ia,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Glutathione_S-Trfase_N,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_GST_C,superfamily_Val/Leu/Ile-tRNA-synth_edit,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,superfamily_tRNA-bd_arm,prints_Valyl-tRNA_synthetase,tigrfam_Valyl-tRNA_synthetase	p.G757fs	ENST00000375663.3	37	c.2270	CCDS34412.1	6																																																																																			VARS	-	pfam_aa-tRNA-synth_Ia,tigrfam_Valyl-tRNA_synthetase	ENSG00000204394		0.632	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VARS	HGNC	protein_coding	OTTHUMT00000076619.2	10	0.00	0	C	NM_006295		31749701	31749701	-1	no_errors	ENST00000375663	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	1.000	-
VLDLR	7436	genome.wustl.edu	37	9	2648254	2648254	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr9:2648254G>A	ENST00000382100.3	+	13	2225	c.1869G>A	c.(1867-1869)atG>atA	p.M623I	VLDLR_ENST00000382099.2_Missense_Mutation_p.M623I	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor	623					cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		AGTTGCACATGTTATCCAGCG	0.413																																						dbGAP											0													125.0	121.0	122.0					9																	2648254		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.1869G>A	9.37:g.2648254G>A	ENSP00000371532:p.Met623Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMZ7|D3DRH6|Q5VVF6	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd,superfamily_LDrepeatLR_classA_rpt,superfamily_Growth_fac_rcpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.M623I	ENST00000382100.3	37	c.1869	CCDS6446.1	9	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228379	0.58777	.	.	ENSG00000147852	ENST00000382100;ENST00000382099;ENST00000382092	D;D	0.95724	-3.79;-3.79	5.79	5.79	0.91817	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.64402	D	0.000006	D	0.91243	0.7240	N	0.17872	0.535	0.58432	D	0.999991	P;P;P	0.37688	0.481;0.536;0.605	B;B;B	0.40702	0.228;0.338;0.309	D	0.89576	0.3817	10	0.27785	T	0.31	.	13.2582	0.60091	0.0721:0.0:0.9279:0.0	.	623;623;623	P98155-2;Q5VVF5;P98155	.;.;VLDLR_HUMAN	I	623;623;502	ENSP00000371532:M623I;ENSP00000371531:M623I	ENSP00000371524:M502I	M	+	3	0	VLDLR	2638254	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.741000	0.68638	2.734000	0.93682	0.655000	0.94253	ATG	VLDLR	-	pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000147852		0.413	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VLDLR	HGNC	protein_coding	OTTHUMT00000051519.2	58	0.00	0	G	NM_003383		2648254	2648254	+1	no_errors	ENST00000382100	ensembl	human	known	69_37n	missense	34	40.35	23	SNP	1.000	A
VPS8	23355	genome.wustl.edu	37	3	184570300	184570300	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr3:184570300C>G	ENST00000437079.3	+	11	937	c.766C>G	c.(766-768)Cca>Gca	p.P256A	VPS8_ENST00000446204.2_Missense_Mutation_p.P254A|VPS8_ENST00000287546.4_Missense_Mutation_p.P256A|VPS8_ENST00000436792.2_Missense_Mutation_p.P254A	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	256							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			TACAGATGATCCAACTCTTGC	0.318																																						dbGAP											0													83.0	77.0	79.0					3																	184570300		1813	4073	5886	-	-	-	SO:0001583	missense	0			AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.766C>G	3.37:g.184570300C>G	ENSP00000397879:p.Pro256Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P256A	ENST00000437079.3	37	c.766	CCDS46971.1	3	.	.	.	.	.	.	.	.	.	.	C	25.5	4.639882	0.87760	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04	5.77	5.77	0.91146	.	0.099330	0.64402	D	0.000001	T	0.77061	0.4075	L	0.61218	1.895	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.70000	-0.4992	10	0.19590	T	0.45	-19.0033	19.9981	0.97395	0.0:1.0:0.0:0.0	.	254;254	Q8N3P4-2;Q8N3P4-3	.;.	A	256;256;254;254	ENSP00000287546:P256A;ENSP00000397879:P256A;ENSP00000404704:P254A;ENSP00000405483:P254A	ENSP00000287546:P256A	P	+	1	0	VPS8	186052994	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.401000	0.79962	2.729000	0.93468	0.655000	0.94253	CCA	VPS8	-	superfamily_Quinonprotein_ADH-like	ENSG00000156931		0.318	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS8	HGNC	protein_coding		82	0.00	0	C	NM_015303		184570300	184570300	+1	no_errors	ENST00000287546	ensembl	human	known	69_37n	missense	22	50.00	22	SNP	1.000	G
XXYLT1	152002	genome.wustl.edu	37	3	194790704	194790704	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr3:194790704G>A	ENST00000310380.6	-	4	1030	c.922C>T	c.(922-924)Cgc>Tgc	p.R308C	XXYLT1_ENST00000356740.5_Missense_Mutation_p.R102C|XXYLT1_ENST00000460582.1_5'UTR|XXYLT1_ENST00000437101.1_Missense_Mutation_p.R105C|XXYLT1_ENST00000355729.4_Missense_Mutation_p.R105C|XXYLT1_ENST00000429994.1_Missense_Mutation_p.R162C	NM_152531.4	NP_689744.3	Q8NBI6	XXLT1_HUMAN	xyloside xylosyltransferase 1	308						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring pentosyl groups (GO:0016763)										TCCAGCAGGCGGCTGTAGAGC	0.692																																						dbGAP											0													31.0	37.0	35.0					3																	194790704		1931	4133	6064	-	-	-	SO:0001583	missense	0			AK075551	CCDS43188.1	3q29	2013-02-22	2011-10-19	2011-10-19	ENSG00000173950	ENSG00000173950		"""Glycosyltransferase family 8 domain containing"""	26639	protein-coding gene	gene with protein product		614552	"""chromosome 3 open reading frame 21"""	C3orf21		22117070	Standard	NM_152531		Approved	FLJ35155	uc003fum.4	Q8NBI6	OTTHUMG00000155915	ENST00000310380.6:c.922C>T	3.37:g.194790704G>A	ENSP00000309640:p.Arg308Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNW5|Q8NAL3|Q8WV03|Q96ME0	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.R308C	ENST00000310380.6	37	c.922	CCDS43188.1	3	.	.	.	.	.	.	.	.	.	.	G	21.4	4.145017	0.77888	.	.	ENSG00000173950	ENST00000310380;ENST00000437101;ENST00000355729;ENST00000429994;ENST00000356740	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.89	5.02	0.67125	.	0.320597	0.34386	N	0.004009	T	0.33089	0.0851	N	0.14661	0.345	0.40247	D	0.978029	P;D;B	0.59767	0.807;0.986;0.055	B;P;B	0.49502	0.347;0.613;0.007	T	0.26360	-1.0105	10	0.62326	D	0.03	-3.4521	9.875	0.41197	0.0728:0.1386:0.7887:0.0	.	308;105;102	Q8NBI6;Q8NBI6-2;Q8NBI6-3	XXLT1_HUMAN;.;.	C	308;105;105;162;102	ENSP00000309640:R308C;ENSP00000409865:R105C;ENSP00000347967:R105C;ENSP00000399422:R162C;ENSP00000349179:R102C	ENSP00000309640:R308C	R	-	1	0	C3orf21	196271993	1.000000	0.71417	0.992000	0.48379	0.974000	0.67602	4.519000	0.60517	1.506000	0.48736	0.563000	0.77884	CGC	XXYLT1	-	pfam_Glyco_trans_8	ENSG00000173950		0.692	XXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XXYLT1	HGNC	protein_coding	OTTHUMT00000342290.1	8	0.00	0	G	NM_152531		194790704	194790704	-1	no_errors	ENST00000310380	ensembl	human	known	69_37n	missense	25	26.47	9	SNP	0.999	A
ZC3HC1	51530	genome.wustl.edu	37	7	129664182	129664182	+	Missense_Mutation	SNP	C	C	A	rs532243281		TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr7:129664182C>A	ENST00000358303.4	-	7	1025	c.941G>T	c.(940-942)cGc>cTc	p.R314L	RNA5SP245_ENST00000364239.1_RNA|RP11-306G20.1_ENST00000587038.1_RNA|ZC3HC1_ENST00000311873.5_Missense_Mutation_p.R293L|RP11-306G20.1_ENST00000480018.1_RNA|ZC3HC1_ENST00000360708.5_Missense_Mutation_p.R314L|ZC3HC1_ENST00000481503.1_Missense_Mutation_p.R271L	NM_016478.3	NP_057562.3	Q86WB0	NIPA_HUMAN	zinc finger, C3HC-type containing 1	314					mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein ubiquitination (GO:0016567)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(6)|large_intestine(10)|lung(2)|prostate(1)|urinary_tract(1)	22	Melanoma(18;0.0435)					CAGAGGTAAGCGCTCTGGTCG	0.572																																					Melanoma(115;540 1606 16325 28853 48167)	dbGAP											0													68.0	65.0	66.0					7																	129664182		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151050	CCDS34753.1, CCDS64767.1, CCDS75659.1	7q32.2	2013-01-17			ENSG00000091732	ENSG00000091732		"""Zinc fingers, C3HC-type"""	29913	protein-coding gene	gene with protein product	"""nuclear interaction partner of ALK"""					11042152	Standard	XM_005250403		Approved	NIPA	uc003vpi.3	Q86WB0	OTTHUMG00000157648	ENST00000358303.4:c.941G>T	7.37:g.129664182C>A	ENSP00000351052:p.Arg314Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH66|Q75MF3|Q75MF4|Q8N330|Q96F75|Q9HA34|Q9NVX4|Q9P0R0	Missense_Mutation	SNP	pfam_Znf_C3HC-like,pfam_NIPA/Rsm1	p.R314L	ENST00000358303.4	37	c.941	CCDS34753.1	7	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869687	0.51588	.	.	ENSG00000091732	ENST00000358303;ENST00000360708;ENST00000311873;ENST00000481503	T;T;T;T	0.51817	1.02;1.02;1.02;0.69	5.48	3.66	0.41972	Nuclear-interacting partner of ALK/Rsm1-like (1);	0.448888	0.24276	N	0.039948	T	0.46425	0.1392	L	0.60455	1.87	0.37013	D	0.895825	P;P;P	0.47484	0.632;0.896;0.799	B;P;B	0.44696	0.259;0.458;0.176	T	0.52457	-0.8573	10	0.46703	T	0.11	-10.714	10.2393	0.43301	0.0:0.8356:0.0:0.1644	.	314;314;271	Q86WB0-3;Q86WB0;C9J0I9	.;NIPA_HUMAN;.	L	314;314;293;271	ENSP00000351052:R314L;ENSP00000353933:R314L;ENSP00000309301:R293L;ENSP00000418533:R271L	ENSP00000309301:R293L	R	-	2	0	ZC3HC1	129451418	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	2.825000	0.48096	0.672000	0.31204	0.563000	0.77884	CGC	ZC3HC1	-	pfam_NIPA/Rsm1	ENSG00000091732		0.572	ZC3HC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3HC1	HGNC	protein_coding	OTTHUMT00000349316.1	23	0.00	0	C	NM_016478		129664182	129664182	-1	no_errors	ENST00000358303	ensembl	human	known	69_37n	missense	20	41.67	15	SNP	1.000	A
ZDHHC18	84243	genome.wustl.edu	37	1	27176930	27176930	+	Splice_Site	SNP	G	G	A			TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr1:27176930G>A	ENST00000374142.4	+	4	879		c.e4+1			NM_032283.2	NP_115659.1	Q9NUE0	ZDH18_HUMAN	zinc finger, DHHC-type containing 18						cellular protein localization (GO:0034613)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)	3		all_cancers(24;5.82e-22)|all_epithelial(13;9.91e-20)|Colorectal(325;0.000147)|Breast(348;0.000706)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;5.71e-53)|Epithelial(14;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(117;1.53e-29)|Colorectal(126;1.9e-09)|COAD - Colon adenocarcinoma(152;4.2e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000548)|STAD - Stomach adenocarcinoma(196;0.00065)|KIRC - Kidney renal clear cell carcinoma(1967;0.000779)|GBM - Glioblastoma multiforme(114;0.0265)|READ - Rectum adenocarcinoma(331;0.0455)|Lung(427;0.163)|LUSC - Lung squamous cell carcinoma(448;0.237)		CTGACGTTGCGTGAGTTGTGG	0.572																																						dbGAP											0													153.0	134.0	141.0					1																	27176930		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK056427	CCDS30650.1	1p36.11	2008-05-02			ENSG00000204160	ENSG00000204160		"""Zinc fingers, DHHC-type"""	20712	protein-coding gene	gene with protein product							Standard	NM_032283		Approved	DKFZp667O2416	uc001bnb.3	Q9NUE0	OTTHUMG00000004092	ENST00000374142.4:c.784+1G>A	1.37:g.27176930G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHY9|B4DQ84|Q5JYH0|Q9H020	Splice_Site	SNP	-	e4+1	ENST00000374142.4	37	c.784+1	CCDS30650.1	1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.098231	0.76870	.	.	ENSG00000204160	ENST00000374142;ENST00000374141;ENST00000534643;ENST00000488397	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5889	0.91202	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZDHHC18	27049517	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	9.259000	0.95561	2.617000	0.88574	0.561000	0.74099	.	ZDHHC18	-	-	ENSG00000204160		0.572	ZDHHC18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC18	HGNC	protein_coding	OTTHUMT00000011706.3	57	0.00	0	G	NM_032283	Intron	27176930	27176930	+1	no_errors	ENST00000374142	ensembl	human	known	69_37n	splice_site	58	24.68	19	SNP	1.000	A
ZNF271	10778	genome.wustl.edu	37	18	32887914	32887914	+	RNA	SNP	A	A	G	rs1131709	byFrequency	TCGA-D8-A27N-01A-11D-A16D-09	TCGA-D8-A27N-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6a411174-582a-4c68-bb04-5ea2e504bf7c	de420622-f742-4781-873a-e9faffc94dd3	g.chr18:32887914A>G	ENST00000399070.3	+	0	2308					NR_024565.1|NR_024566.1		Q14591	ZN271_HUMAN	zinc finger protein 271						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(9)	12						CATTAAAACCACACTGGATCC	0.423													A|||	2447	0.488618	0.5666	0.4553	5008	,	,		19419	0.372		0.5338	False		,,,				2504	0.4806					dbGAP											0																																										-	-	-			0			X78930		18q12.2	2013-04-03			ENSG00000257267	ENSG00000257267		"""Zinc fingers, C2H2-type"""	13065	other	unknown		604754				7865130, 11777961	Standard	NR_024565		Approved	HZF7, ZNFEB	uc002kyp.4	Q14591	OTTHUMG00000132563		18.37:g.32887914A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN34|Q96T29|Q9BSX2|Q9UN33|Q9Y5B7	RNA	SNP	-	NULL	ENST00000399070.3	37	NULL		18																																																																																			ZNF271	-	-	ENSG00000257267		0.423	ZNF271-002	KNOWN	basic	processed_transcript	ZNF271	HGNC	pseudogene	OTTHUMT00000255767.2	12	0.00	0	A	NR_024565		32887914	32887914	+1	no_errors	ENST00000399070	ensembl	human	known	69_37n	rna	7	52.94	9	SNP	0.990	G
