#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AKAP9	10142	genome.wustl.edu	37	7	91641818	91641818	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr7:91641818C>T	ENST00000359028.2	+	10	3655	c.3430C>T	c.(3430-3432)Cgt>Tgt	p.R1144C	AKAP9_ENST00000358100.2_Missense_Mutation_p.R1144C|AKAP9_ENST00000356239.3_Missense_Mutation_p.R1132C			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1144					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GGATCAGGTTCGTGAATATAT	0.343			T	BRAF	papillary thyroid																																	dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													71.0	74.0	73.0					7																	91641818		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.3430C>T	7.37:g.91641818C>T	ENSP00000351922:p.Arg1144Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.R1144C	ENST00000359028.2	37	c.3430		7	.	.	.	.	.	.	.	.	.	.	C	14.79	2.641294	0.47153	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.04603	3.61;3.61;3.59	5.18	4.3	0.51218	.	0.000000	0.37577	N	0.002024	T	0.15392	0.0371	M	0.67953	2.075	0.48975	D	0.999731	B;D;B;B	0.89917	0.071;1.0;0.116;0.116	B;D;B;B	0.70016	0.007;0.967;0.017;0.017	T	0.00369	-1.1784	10	0.87932	D	0	.	7.0132	0.24873	0.1395:0.7115:0.0:0.149	.	1144;1132;1132;1144	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	C	1132;1144;1144;1144;1144	ENSP00000348573:R1132C;ENSP00000351922:R1144C;ENSP00000350813:R1144C	ENSP00000348573:R1132C	R	+	1	0	AKAP9	91479754	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	2.174000	0.42482	1.282000	0.44496	0.655000	0.94253	CGT	AKAP9	-	NULL	ENSG00000127914		0.343	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		68	0.00	0	C	NM_005751		91641818	91641818	+1	no_errors	ENST00000359028	ensembl	human	known	69_37n	missense	49	16.95	10	SNP	1.000	T
ANKRD36C	400986	genome.wustl.edu	37	2	96581796	96581796	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr2:96581796G>T	ENST00000456556.1	-	38	2465	c.2381C>A	c.(2380-2382)aCa>aAa	p.T794K	ANKRD36C_ENST00000295246.5_5'UTR|ANKRD36C_ENST00000419039.2_5'UTR|ANKRD36C_ENST00000420871.2_5'UTR			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	794							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						CTCATCACTTGTAGCCTGAAT	0.299																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.2381C>A	2.37:g.96581796G>T	ENSP00000403302:p.Thr794Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T794K	ENST00000456556.1	37	c.2381		2	.	.	.	.	.	.	.	.	.	.	N	7.690	0.690941	0.15039	.	.	ENSG00000174501	ENST00000456556	T	0.77877	-1.13	0.843	0.843	0.18935	.	.	.	.	.	T	0.78767	0.4335	M	0.76574	2.34	0.09310	N	1	.	.	.	.	.	.	T	0.69397	-0.5156	7	0.62326	D	0.03	.	5.0435	0.14471	0.0:0.0:1.0:0.0	.	.	.	.	K	794	ENSP00000403302:T794K	ENSP00000403302:T794K	T	-	2	0	AC073995.2	95945523	0.000000	0.05858	0.005000	0.12908	0.004000	0.04260	0.126000	0.15769	0.744000	0.32741	0.186000	0.17326	ACA	ANKRD36C	-	NULL	ENSG00000174501		0.299	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	128	0.00	0	G	NM_001010914		96581796	96581796	-1	no_errors	ENST00000456556	ensembl	human	known	69_37n	missense	153	12.57	22	SNP	0.008	T
ARID1A	8289	genome.wustl.edu	37	1	27099042	27099042	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr1:27099042delC	ENST00000324856.7	+	13	3829	c.3458delC	c.(3457-3459)tccfs	p.S1153fs	ARID1A_ENST00000457599.2_Frame_Shift_Del_p.S1153fs|ARID1A_ENST00000540690.1_5'Flank|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.S770fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1153					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ACCAGCAGTTCCATGGCAGAA	0.547			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	dbGAP		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0													103.0	93.0	97.0					1																	27099042		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3458delC	1.37:g.27099042delC	ENSP00000320485:p.Ser1153fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.M1154fs	ENST00000324856.7	37	c.3458	CCDS285.1	1																																																																																			ARID1A	-	NULL	ENSG00000117713		0.547	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	87	0.00	0	C	NM_139135		27099042	27099042	+1	no_errors	ENST00000324856	ensembl	human	known	69_37n	frame_shift_del	56	24.00	18	DEL	1.000	-
AXL	558	genome.wustl.edu	37	19	41743948	41743948	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr19:41743948C>T	ENST00000301178.4	+	7	1073	c.883C>T	c.(883-885)Cgg>Tgg	p.R295W	AXL_ENST00000593513.1_Missense_Mutation_p.R27W|AXL_ENST00000359092.3_Missense_Mutation_p.R295W	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	295	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.		R -> W (in a lung neuroendocrine carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R295W(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						CCATCAGCTTCGGCTAGGCAG	0.647																																						dbGAP											1	Substitution - Missense(1)	lung(1)											108.0	110.0	109.0					19																	41743948		2203	4300	6503	-	-	-	SO:0001583	missense	0			M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.883C>T	19.37:g.41743948C>T	ENSP00000301178:p.Arg295Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5L2|Q9UD27	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R295W	ENST00000301178.4	37	c.883	CCDS12575.1	19	.	.	.	.	.	.	.	.	.	.	c	12.64	1.999768	0.35320	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.57752	0.38;0.38	4.26	4.26	0.50523	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.538685	0.16878	U	0.195816	T	0.53948	0.1828	L	0.44542	1.39	0.19300	N	0.999979	D;D	0.76494	0.998;0.999	P;P	0.53185	0.599;0.72	T	0.47471	-0.9115	10	0.62326	D	0.03	-20.2483	9.7217	0.40306	0.2067:0.7932:0.0:0.0	.	295;295	P30530-2;P30530	.;UFO_HUMAN	W	295	ENSP00000301178:R295W;ENSP00000351995:R295W	ENSP00000301178:R295W	R	+	1	2	AXL	46435788	0.722000	0.28017	0.874000	0.34290	0.410000	0.31052	1.522000	0.35921	2.347000	0.79759	0.448000	0.29417	CGG	AXL	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000167601		0.647	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXL	HGNC	protein_coding	OTTHUMT00000463323.2	39	0.00	0	C			41743948	41743948	+1	no_errors	ENST00000301178	ensembl	human	known	69_37n	missense	21	44.74	17	SNP	0.280	T
BLOC1S6	26258	genome.wustl.edu	37	15	45884474	45884474	+	Splice_Site	SNP	C	C	G			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr15:45884474C>G	ENST00000220531.3	+	2	545	c.224C>G	c.(223-225)aCa>aGa	p.T75R	BLOC1S6_ENST00000562384.1_Intron|BLOC1S6_ENST00000567461.1_Intron|BLOC1S6_ENST00000568816.1_5'UTR|BLOC1S6_ENST00000565323.1_Splice_Site_p.T80R|BLOC1S6_ENST00000565216.1_Intron|RP11-96O20.4_ENST00000564080.1_Intron|Y_RNA_ENST00000363549.1_RNA|BLOC1S6_ENST00000565409.1_5'UTR|BLOC1S6_ENST00000567740.1_Intron|BLOC1S6_ENST00000566753.1_Splice_Site_p.T75S|BLOC1S6_ENST00000564765.1_5'UTR	NM_012388.2	NP_036520.1	Q9UL45	BL1S6_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 6, pallidin	75					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|blood coagulation (GO:0007596)|endosome to melanosome transport (GO:0035646)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of pigment cell differentiation (GO:0050942)|post-Golgi vesicle-mediated transport (GO:0006892)|secretion of lysosomal enzymes (GO:0033299)|synaptic vesicle docking involved in exocytosis (GO:0016081)	BLOC-1 complex (GO:0031083)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|transport vesicle (GO:0030133)	actin filament binding (GO:0051015)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)										CAGGAACTCACGTAAGCTAAT	0.363																																						dbGAP											0													80.0	80.0	80.0					15																	45884474		2198	4298	6496	-	-	-	SO:0001630	splice_region_variant	0			AF080470	CCDS10126.1	15q21.1	2013-09-27	2012-08-07	2012-08-01	ENSG00000104164	ENSG00000104164		"""Biogenesis of lysosomal organelles complex-1 subunits"""	8549	protein-coding gene	gene with protein product		604310	"""pallid (mouse) homolog, pallidin"", ""pallidin homolog (mouse)"""	PA, PLDN		10610180	Standard	NM_012388		Approved	HPS9	uc001zvq.3	Q9UL45	OTTHUMG00000131477	ENST00000220531.3:c.224+1C>G	15.37:g.45884474C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pirsf_BLOC-1_complex_pallidin	p.T75R	ENST00000220531.3	37	c.224	CCDS10126.1	15	.	.	.	.	.	.	.	.	.	.	C	23.9	4.472811	0.84640	.	.	ENSG00000104164	ENST00000220531	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.80330	0.4603	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.81210	-0.1036	9	0.54805	T	0.06	-15.6222	17.4112	0.87486	0.0:1.0:0.0:0.0	.	75	Q9UL45	PLDN_HUMAN	R	75	.	ENSP00000220531:T75R	T	+	2	0	PLDN	43671766	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.791000	0.69045	2.707000	0.92482	0.563000	0.77884	ACA	BLOC1S6	-	pirsf_BLOC-1_complex_pallidin	ENSG00000104164		0.363	BLOC1S6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLOC1S6	HGNC	protein_coding	OTTHUMT00000254320.2	66	0.00	0	C	NM_012388	Missense_Mutation	45884474	45884474	+1	no_errors	ENST00000220531	ensembl	human	known	69_37n	missense	57	20.83	15	SNP	1.000	G
CARD6	84674	genome.wustl.edu	37	5	40853931	40853931	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr5:40853931C>A	ENST00000254691.5	+	3	2696	c.2497C>A	c.(2497-2499)Cca>Aca	p.P833T	CARD6_ENST00000381677.3_Intron	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	833					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						CCCTGAGAGACCACAAATGAT	0.507																																						dbGAP											0													219.0	225.0	223.0					5																	40853931		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.2497C>A	5.37:g.40853931C>A	ENSP00000254691:p.Pro833Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LR2	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	p.P833T	ENST00000254691.5	37	c.2497	CCDS3935.1	5	.	.	.	.	.	.	.	.	.	.	C	6.049	0.377350	0.11466	.	.	ENSG00000132357	ENST00000254691	T	0.11169	2.8	4.79	-4.27	0.03744	.	0.871612	0.09757	N	0.759831	T	0.05960	0.0155	L	0.27053	0.805	0.09310	N	0.999999	B	0.18310	0.027	B	0.10450	0.005	T	0.37244	-0.9714	10	0.44086	T	0.13	0.004	4.0138	0.09634	0.3831:0.2843:0.0:0.3325	.	833	Q9BX69	CARD6_HUMAN	T	833	ENSP00000254691:P833T	ENSP00000254691:P833T	P	+	1	0	CARD6	40889688	0.000000	0.05858	0.000000	0.03702	0.076000	0.17211	-0.733000	0.04898	-0.789000	0.04498	0.313000	0.20887	CCA	CARD6	-	NULL	ENSG00000132357		0.507	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD6	HGNC	protein_coding	OTTHUMT00000211584.3	48	0.00	0	C			40853931	40853931	+1	no_errors	ENST00000254691	ensembl	human	known	69_37n	missense	28	17.65	6	SNP	0.000	A
CLCF1	23529	genome.wustl.edu	37	11	67132963	67132963	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr11:67132963C>T	ENST00000312438.7	-	3	519	c.322G>A	c.(322-324)Gag>Aag	p.E108K	CLCF1_ENST00000528474.1_Missense_Mutation_p.E98K|RN7SKP239_ENST00000364814.1_RNA|CLCF1_ENST00000533438.1_Missense_Mutation_p.E98K|AP003419.11_ENST00000543494.1_RNA	NM_013246.2	NP_037378.1	Q9UBD9	CLCF1_HUMAN	cardiotrophin-like cytokine factor 1	108					B cell differentiation (GO:0030183)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)	CNTFR-CLCF1 complex (GO:0097059)|CRLF-CLCF1 complex (GO:0097058)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	ciliary neurotrophic factor receptor binding (GO:0005127)|cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)			endometrium(1)|urinary_tract(1)	2			BRCA - Breast invasive adenocarcinoma(15;2.39e-06)			CTGTAGGCCTCGTAGTTCTGG	0.632																																						dbGAP											0													69.0	60.0	63.0					11																	67132963		2200	4295	6495	-	-	-	SO:0001583	missense	0			BC012939	CCDS31617.1, CCDS53666.1	11q13.3	2014-01-28	2006-07-03		ENSG00000175505	ENSG00000175505			17412	protein-coding gene	gene with protein product	"""B-cell stimulating factor 3"", ""cold-induced sweating syndrome 2"", ""novel neurotrophin-1"""	607672	"""CRLF1 associated cytokine-like factor 1"""			10500198, 10448081, 16782820	Standard	NM_001166212		Approved	NNT1, BSF3, CLC, NR6, CISS2, BSF-3, NNT-1	uc010rpp.2	Q9UBD9	OTTHUMG00000167669	ENST00000312438.7:c.322G>A	11.37:g.67132963C>T	ENSP00000309338:p.Glu108Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNT4|Q6NZA4	Missense_Mutation	SNP	pfam_PRF,pfam_Ciliary_neurotrophic_fac_CNTF,superfamily_4_helix_cytokine-like_core	p.E108K	ENST00000312438.7	37	c.322	CCDS31617.1	11	.	.	.	.	.	.	.	.	.	.	c	1.406	-0.576700	0.03854	.	.	ENSG00000175505	ENST00000312438;ENST00000533438;ENST00000528474	T;T;T	0.76060	-0.99;-0.99;-0.99	5.13	4.15	0.48705	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.249928	0.36409	N	0.002618	T	0.52008	0.1708	N	0.03608	-0.345	0.27343	N	0.95646	B	0.13594	0.008	B	0.12156	0.007	T	0.54057	-0.8350	10	0.87932	D	0	-15.7099	12.2899	0.54812	0.0:0.6079:0.3921:0.0	.	108	Q9UBD9	CLCF1_HUMAN	K	108;98;98	ENSP00000309338:E108K;ENSP00000434122:E98K;ENSP00000432553:E98K	ENSP00000309338:E108K	E	-	1	0	CLCF1	66889539	1.000000	0.71417	0.993000	0.49108	0.461000	0.32589	3.217000	0.51184	2.564000	0.86499	0.556000	0.70494	GAG	CLCF1	-	pfam_PRF,pfam_Ciliary_neurotrophic_fac_CNTF,superfamily_4_helix_cytokine-like_core	ENSG00000175505		0.632	CLCF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCF1	HGNC	protein_coding	OTTHUMT00000395478.1	43	0.00	0	C	NM_013246		67132963	67132963	-1	no_errors	ENST00000312438	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.999	T
CROCCP2	84809	genome.wustl.edu	37	1	16946417	16946417	+	lincRNA	SNP	G	G	C	rs572479688	byFrequency	TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr1:16946417G>C	ENST00000412962.1	-	0	1102				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											TCACTCAGCTGTTCCTTCTCA	0.677													.|||	143	0.0285543	0.0121	0.0461	5008	,	,		65688	0.001		0.0676	False		,,,				2504	0.0266					dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16946417G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.677	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	17	0.00	0	G	NR_026752.1		16946417	16946417	-1	no_errors	ENST00000412962	ensembl	human	known	69_37n	rna	11	38.89	7	SNP	0.997	C
EPRS	2058	genome.wustl.edu	37	1	220170582	220170582	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr1:220170582C>T	ENST00000366923.3	-	18	2553	c.2284G>A	c.(2284-2286)Gat>Aat	p.D762N		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	762	3 X 57 AA approximate repeats.|WHEP-TRS 1.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	CGAACCACATCTCCTTGAACA	0.388																																						dbGAP											0													82.0	85.0	84.0					1																	220170582		2202	4300	6502	-	-	-	SO:0001583	missense	0			X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.2284G>A	1.37:g.220170582C>T	ENSP00000355890:p.Asp762Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,pfam_WHEP-TRS,pfam_Glu/Gln-tRNA-synth_Ib_codon-bd,pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Pro-tRNA_synth_II_C,pfam_Anticodon-bd,superfamily_Ribosomal_L25/Gln-tRNA_synth,superfamily_Anticodon-bd,superfamily_Pro-tRNA_synth_II,superfamily_S15_NS1_RNA-bd,superfamily_Glutathione-S-Trfase_C-like,smart_Pro-tRNA_synth_II_C,prints_Glu/Gln-tRNA-synth_Ib,prints_Pro-tRNA-synth_IIa,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,tigrfam_Pro-tRNA-synth_IIa_arc-type,tigrfam_Glu-tRNA-synth_Ib_arc/euk	p.D762N	ENST00000366923.3	37	c.2284	CCDS31027.1	1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068527	0.76301	.	.	ENSG00000136628	ENST00000366923;ENST00000536921;ENST00000435048	T	0.35048	1.33	5.62	5.62	0.85841	WHEP-TRS (3);S15/NS1, RNA-binding (2);	0.092549	0.64402	D	0.000001	T	0.38108	0.1028	N	0.25332	0.735	0.80722	D	1	B;B;B	0.28350	0.174;0.085;0.208	B;B;B	0.40375	0.106;0.094;0.327	T	0.14755	-1.0461	10	0.33940	T	0.23	-28.6101	19.6764	0.95936	0.0:1.0:0.0:0.0	.	786;769;762	E7EMN0;Q3KQZ8;P07814	.;.;SYEP_HUMAN	N	762;769;786	ENSP00000355890:D762N	ENSP00000355890:D762N	D	-	1	0	EPRS	218237205	1.000000	0.71417	0.792000	0.32020	0.991000	0.79684	5.289000	0.65656	2.660000	0.90430	0.655000	0.94253	GAT	EPRS	-	pfam_WHEP-TRS,superfamily_S15_NS1_RNA-bd,pfscan_WHEP-TRS	ENSG00000136628		0.388	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPRS	HGNC	protein_coding	OTTHUMT00000091133.2	59	0.00	0	C	NM_004446		220170582	220170582	-1	no_errors	ENST00000366923	ensembl	human	known	69_37n	missense	84	15.15	15	SNP	0.999	T
FAM13C	220965	genome.wustl.edu	37	10	61028447	61028447	+	Missense_Mutation	SNP	G	G	A	rs199908790	byFrequency	TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr10:61028447G>A	ENST00000373868.2	-	8	895	c.808C>T	c.(808-810)Cgg>Tgg	p.R270W	FAM13C_ENST00000435852.2_Missense_Mutation_p.R270W|FAM13C_ENST00000468840.2_Missense_Mutation_p.R187W|FAM13C_ENST00000419214.2_Missense_Mutation_p.R270W|FAM13C_ENST00000277705.6_Missense_Mutation_p.R291W|FAM13C_ENST00000373867.3_Missense_Mutation_p.R187W|FAM13C_ENST00000422313.2_Missense_Mutation_p.R270W|FAM13C_ENST00000442566.3_Missense_Mutation_p.R291W	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	270										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GAAGAACTCCGCGGCCTGCAG	0.493													G|||	2	0.000399361	0.0	0.0	5008	,	,		17736	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													43.0	41.0	41.0					10																	61028447		2203	4300	6503	-	-	-	SO:0001583	missense	0			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.808C>T	10.37:g.61028447G>A	ENSP00000362975:p.Arg270Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	NULL	p.R270W	ENST00000373868.2	37	c.808	CCDS7255.1	10	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	17.50	3.404702	0.62288	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313;ENST00000468696	T;T;T;T;T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;0.34;-1.08;-1.08;-1.08;-1.08	6.04	4.01	0.46588	.	0.000000	0.64402	D	0.000002	D	0.87330	0.6150	M	0.81112	2.525	0.44012	D	0.996726	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	D	0.88884	0.3341	10	0.87932	D	0	-6.5079	12.4947	0.55921	0.0:0.0:0.4388:0.5612	.	270;187;270;270;270	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	W	187;270;291;291;270;187;270;270;48	ENSP00000362974:R187W;ENSP00000362975:R270W;ENSP00000395661:R291W;ENSP00000277705:R291W;ENSP00000391993:R270W;ENSP00000423896:R187W;ENSP00000392302:R270W;ENSP00000400241:R270W;ENSP00000445068:R48W	ENSP00000277705:R291W	R	-	1	2	FAM13C	60698453	1.000000	0.71417	1.000000	0.80357	0.444000	0.32077	2.986000	0.49370	1.527000	0.49086	0.650000	0.86243	CGG	FAM13C	-	NULL	ENSG00000148541		0.493	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM13C	HGNC	protein_coding	OTTHUMT00000048162.2	72	0.00	0	G			61028447	61028447	-1	no_errors	ENST00000373868	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	0.998	A
FBXO33	254170	genome.wustl.edu	37	14	39870722	39870722	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr14:39870722C>T	ENST00000298097.7	-	3	1391	c.1054G>A	c.(1054-1056)Gac>Aac	p.D352N	FBXO33_ENST00000554190.1_Intron	NM_203301.3	NP_976046.1	Q7Z6M2	FBX33_HUMAN	F-box protein 33	352					protein ubiquitination (GO:0016567)					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	9	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	GBM - Glioblastoma multiforme(112;0.0425)		GGCATGTTGTCCAGAGACTTG	0.428																																						dbGAP											0													122.0	109.0	114.0					14																	39870722		2203	4300	6503	-	-	-	SO:0001583	missense	0			BI460761	CCDS9677.1	14q13.3	2004-08-24	2004-06-15		ENSG00000165355	ENSG00000165355		"""F-boxes /  ""other"""""	19833	protein-coding gene	gene with protein product		609103	"""F-box only protein 33"""				Standard	NM_203301		Approved	Fbx33	uc001wvk.3	Q7Z6M2	OTTHUMG00000140257	ENST00000298097.7:c.1054G>A	14.37:g.39870722C>T	ENSP00000298097:p.Asp352Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PIR2|Q86TR2|Q86YE0	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.D352N	ENST00000298097.7	37	c.1054	CCDS9677.1	14	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297925	0.60086	.	.	ENSG00000165355	ENST00000298097	T	0.00958	5.5	5.87	4.99	0.66335	.	0.138193	0.64402	N	0.000004	T	0.01320	0.0043	L	0.44542	1.39	0.80722	D	1	B	0.11235	0.004	B	0.11329	0.006	T	0.61322	-0.7086	9	.	.	.	-35.3943	14.9913	0.71390	0.0:0.9319:0.0:0.0681	.	352	Q7Z6M2	FBX33_HUMAN	N	352	ENSP00000298097:D352N	.	D	-	1	0	FBXO33	38940473	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.653000	0.67967	1.499000	0.48617	0.591000	0.81541	GAC	FBXO33	-	NULL	ENSG00000165355		0.428	FBXO33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO33	HGNC	protein_coding	OTTHUMT00000276769.2	58	0.00	0	C			39870722	39870722	-1	no_errors	ENST00000298097	ensembl	human	known	69_37n	missense	45	31.82	21	SNP	1.000	T
GOLGA8A	23015	genome.wustl.edu	37	15	34676192	34676192	+	Silent	SNP	C	C	T			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr15:34676192C>T	ENST00000359187.4	-	8	688	c.624G>A	c.(622-624)gaG>gaA	p.E208E	GOLGA8A_ENST00000360553.3_Silent_p.E208E|GOLGA8A_ENST00000432566.2_Silent_p.E238E|MIR1233-1_ENST00000408722.1_RNA|GOLGA8A_ENST00000543376.1_Silent_p.E65E	NM_181077.3	NP_851422.1	A7E2F4	GOG8A_HUMAN	golgin A8 family, member A	236						Golgi apparatus (GO:0005794)|membrane (GO:0016020)							all_lung(180;2.78e-08)		all cancers(64;8.27e-19)|GBM - Glioblastoma multiforme(113;6.98e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		GCAGTATCTGCTCCCGTATGG	0.562																																						dbGAP											0													1.0	1.0	1.0					15																	34676192		819	2154	2973	-	-	-	SO:0001819	synonymous_variant	0			BX648160	CCDS10038.1	15q14	2011-10-25	2010-02-12		ENSG00000175265	ENSG00000175265			31972	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 8A"""			10660574, 10677249	Standard	NM_181077		Approved	GM88, GOLGIN-67	uc001zii.3	A7E2F4	OTTHUMG00000129447	ENST00000359187.4:c.624G>A	15.37:g.34676192C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MCY9|B7ZMK5|O94937|Q52M46|Q68DK6|Q9NZG8|Q9NZW0|Q9NZW3	Silent	SNP	NULL	p.E238	ENST00000359187.4	37	c.714	CCDS10038.1	15																																																																																			GOLGA8A	-	NULL	ENSG00000175265		0.562	GOLGA8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA8A	HGNC	protein_coding	OTTHUMT00000251830.2	18	0.00	0	C	NM_181076		34676192	34676192	-1	no_errors	ENST00000432566	ensembl	human	known	69_37n	silent	10	28.57	4	SNP	0.015	T
HTR1B	3351	genome.wustl.edu	37	6	78172317	78172317	+	Silent	SNP	G	G	C			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr6:78172317G>C	ENST00000369947.2	-	1	1173	c.804C>G	c.(802-804)acC>acG	p.T268T		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	268					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	AGTTAATAGAGGTGACCGAGG	0.602																																						dbGAP											0													82.0	95.0	91.0					6																	78172317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.804C>G	6.37:g.78172317G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAY7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_5HT1B_rcpt,prints_5HT_rcpt,prints_Adrnrgc_rcpt	p.T268	ENST00000369947.2	37	c.804	CCDS4986.1	6																																																																																			HTR1B	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT1B_rcpt	ENSG00000135312		0.602	HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1B	HGNC	protein_coding	OTTHUMT00000041292.1	39	0.00	0	G	NM_000863		78172317	78172317	-1	no_errors	ENST00000369947	ensembl	human	known	69_37n	silent	26	25.71	9	SNP	0.994	C
INPP1	3628	genome.wustl.edu	37	2	191236038	191236038	+	Silent	SNP	A	A	G			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr2:191236038A>G	ENST00000322522.4	+	6	1566	c.1110A>G	c.(1108-1110)ggA>ggG	p.G370G	INPP1_ENST00000392329.2_Silent_p.G370G|INPP1_ENST00000541441.1_Silent_p.G370G	NM_002194.3	NP_002185.1	P49441	INPP_HUMAN	inositol polyphosphate-1-phosphatase	370					dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-1,3,4-trisphosphate 1-phosphatase activity (GO:0052829)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|metal ion binding (GO:0046872)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.000286)|Epithelial(96;0.0186)|all cancers(119;0.057)			CCAACAAGGGAGGACTCATTG	0.532																																					Melanoma(130;184 1743 2185 19805 38428)	dbGAP											0													69.0	67.0	67.0					2																	191236038		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2305.1	2q32	2008-02-07			ENSG00000151689	ENSG00000151689	3.1.3.57		6071	protein-coding gene	gene with protein product		147263				8390685	Standard	NM_002194		Approved		uc010fsb.3	P49441	OTTHUMG00000132672	ENST00000322522.4:c.1110A>G	2.37:g.191236038A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Inositol_monophosphatase	p.G370	ENST00000322522.4	37	c.1110	CCDS2305.1	2																																																																																			INPP1	-	pfam_Inositol_monophosphatase	ENSG00000151689		0.532	INPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP1	HGNC	protein_coding	OTTHUMT00000255932.2	41	0.00	0	A			191236038	191236038	+1	no_errors	ENST00000322522	ensembl	human	known	69_37n	silent	36	16.28	7	SNP	0.935	G
KIAA1109	84162	genome.wustl.edu	37	4	123254965	123254965	+	Splice_Site	SNP	G	G	T			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr4:123254965G>T	ENST00000264501.4	+	68	12019		c.e68+1		KIAA1109_ENST00000388738.3_Splice_Site			Q2LD37	K1109_HUMAN	KIAA1109						regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TGATGTAAAGGTAAAAACCCA	0.353																																						dbGAP											0													70.0	61.0	64.0					4																	123254965		1839	4084	5923	-	-	-	SO:0001630	splice_region_variant	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.11646+1G>T	4.37:g.123254965G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Splice_Site	SNP	-	e66+1	ENST00000264501.4	37	c.11646+1	CCDS43267.1	4	.	.	.	.	.	.	.	.	.	.	G	24.6	4.549307	0.86127	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707;ENST00000306802	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3465	0.94365	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA1109	123474415	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.813000	0.99286	2.641000	0.89580	0.591000	0.81541	.	KIAA1109	-	-	ENSG00000138688		0.353	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	56	0.00	0	G	NM_020797	Intron	123254965	123254965	+1	no_errors	ENST00000264501	ensembl	human	known	69_37n	splice_site	37	33.93	19	SNP	1.000	T
LARP4B	23185	genome.wustl.edu	37	10	882385	882385	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr10:882385G>T	ENST00000316157.3	-	7	748	c.708C>A	c.(706-708)tgC>tgA	p.C236*		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	236	HTH La-type RNA-binding. {ECO:0000255|PROSITE-ProRule:PRU00332}.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						ATATTACTATGCAGCGATTTT	0.363																																						dbGAP											0													174.0	169.0	171.0					10																	882385		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.708C>A	10.37:g.882385G>T	ENSP00000326128:p.Cys236*	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Nonsense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.C236*	ENST00000316157.3	37	c.708	CCDS31131.1	10	.	.	.	.	.	.	.	.	.	.	g	32	5.121684	0.94385	.	.	ENSG00000107929	ENST00000316157	.	.	.	5.85	4.03	0.46877	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.5698	10.7342	0.46115	0.2183:0.0:0.7817:0.0	.	.	.	.	X	236	.	ENSP00000326128:C236X	C	-	3	2	LARP4B	872385	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	3.380000	0.52448	0.838000	0.34948	-0.119000	0.15052	TGC	LARP4B	-	pfscan_Lupus_La_RNA-bd	ENSG00000107929		0.363	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP4B	HGNC	protein_coding	OTTHUMT00000046395.2	164	0.00	0	G	NM_015155		882385	882385	-1	no_errors	ENST00000316157	ensembl	human	known	69_37n	nonsense	130	28.18	51	SNP	1.000	T
MAPK4	5596	genome.wustl.edu	37	18	48190626	48190626	+	Missense_Mutation	SNP	G	G	A	rs199714690	byFrequency	TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr18:48190626G>A	ENST00000400384.2	+	2	1334	c.298G>A	c.(298-300)Gtg>Atg	p.V100M	MAPK4_ENST00000540640.1_Intron|MAPK4_ENST00000592595.1_Missense_Mutation_p.V100M|MAPK4_ENST00000588540.1_Missense_Mutation_p.V100M	NM_002747.3	NP_002738.2	P31152	MK04_HUMAN	mitogen-activated protein kinase 4	100	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			lung(4)|skin(3)|upper_aerodigestive_tract(1)	8		Colorectal(6;0.0297)		Colorectal(21;0.156)		CAAGTTCAGCGTGGCGTACAT	0.587													G|||	2	0.000399361	0.0	0.0	5008	,	,		19255	0.0		0.0	False		,,,				2504	0.002					dbGAP											0													78.0	80.0	80.0					18																	48190626		2199	4289	6488	-	-	-	SO:0001583	missense	0			X59727	CCDS42437.1	18q21.1	2012-10-02			ENSG00000141639	ENSG00000141639		"""Mitogen-activated protein kinase cascade / Kinases"""	6878	protein-coding gene	gene with protein product		176949		PRKM4		8290275	Standard	XM_005258299		Approved	Erk3-related, Erk4	uc002lev.3	P31152	OTTHUMG00000179853	ENST00000400384.2:c.298G>A	18.37:g.48190626G>A	ENSP00000383234:p.Val100Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4C4|Q0VG04	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK3/4	p.V100M	ENST00000400384.2	37	c.298	CCDS42437.1	18	.	.	.	.	.	.	.	.	.	.	G	12.15	1.850416	0.32699	.	.	ENSG00000141639	ENST00000400384	T	0.65732	-0.17	5.86	3.76	0.43208	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.202341	0.35466	N	0.003200	T	0.41673	0.1169	N	0.16708	0.43	0.32096	N	0.591162	B;B	0.20459	0.045;0.045	B;B	0.23419	0.046;0.046	T	0.44967	-0.9293	10	0.46703	T	0.11	0.0675	5.1426	0.14967	0.2229:0.0:0.6148:0.1623	.	100;100	Q0VG04;P31152	.;MK04_HUMAN	M	100	ENSP00000383234:V100M	ENSP00000383234:V100M	V	+	1	0	MAPK4	46444624	0.943000	0.32029	1.000000	0.80357	0.975000	0.68041	0.556000	0.23438	1.487000	0.48415	0.555000	0.69702	GTG	MAPK4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000141639		0.587	MAPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK4	HGNC	protein_coding	OTTHUMT00000448631.2	29	0.00	0	G	NM_002747		48190626	48190626	+1	no_errors	ENST00000400384	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	1.000	A
MOV10L1	54456	genome.wustl.edu	37	22	50563962	50563962	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr22:50563962C>T	ENST00000262794.5	+	11	1794	c.1711C>T	c.(1711-1713)Cca>Tca	p.P571S	MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000545383.1_Missense_Mutation_p.P571S|MOV10L1_ENST00000395858.3_Missense_Mutation_p.P571S|MOV10L1_ENST00000540615.1_Missense_Mutation_p.P551S	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	571					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TCTGGAGGTCCCAGGGTTGGC	0.488																																						dbGAP											0													131.0	132.0	131.0					22																	50563962		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.1711C>T	22.37:g.50563962C>T	ENSP00000262794:p.Pro571Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold-like	p.P571S	ENST00000262794.5	37	c.1711	CCDS14084.1	22	.	.	.	.	.	.	.	.	.	.	C	18.25	3.582804	0.65992	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000540615	D;D;D;D	0.90444	-2.49;-2.49;-2.08;-2.67	5.41	5.41	0.78517	.	0.052369	0.85682	D	0.000000	D	0.95765	0.8622	M	0.84585	2.705	0.80722	D	1	D;D;D;D	0.89917	0.992;0.999;0.998;1.0	D;D;D;D	0.72982	0.923;0.979;0.953;0.972	D	0.96010	0.9001	10	0.72032	D	0.01	-24.2781	18.3109	0.90199	0.0:1.0:0.0:0.0	.	332;551;571;571	B7Z893;F5H403;A8MXC6;Q9BXT6	.;.;.;M10L1_HUMAN	S	571;571;571;551	ENSP00000438978:P571S;ENSP00000262794:P571S;ENSP00000379199:P571S;ENSP00000438542:P551S	ENSP00000262794:P571S	P	+	1	0	MOV10L1	48906089	0.994000	0.37717	0.996000	0.52242	0.356000	0.29392	5.809000	0.69172	2.679000	0.91253	0.544000	0.68410	CCA	MOV10L1	-	NULL	ENSG00000073146		0.488	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOV10L1	HGNC	protein_coding	OTTHUMT00000075009.2	123	0.00	0	C	NM_018995		50563962	50563962	+1	no_errors	ENST00000262794	ensembl	human	known	69_37n	missense	87	17.14	18	SNP	0.999	T
MXRA5	25878	genome.wustl.edu	37	X	3235330	3235330	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chrX:3235330G>A	ENST00000217939.6	-	6	6546	c.6392C>T	c.(6391-6393)gCg>gTg	p.A2131V		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2131	Ig-like C2-type 5.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CGTCCTGCGCGCGGAGCCTAC	0.662																																						dbGAP											0													34.0	27.0	30.0					X																	3235330		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6392C>T	X.37:g.3235330G>A	ENSP00000217939:p.Ala2131Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.A2131V	ENST00000217939.6	37	c.6392	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	g	13.86	2.362333	0.41902	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.67171	-0.25	3.48	3.48	0.39840	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.36628	U	0.002485	T	0.71787	0.3381	L	0.31371	0.925	0.28126	N	0.930383	D	0.89917	1.0	D	0.85130	0.997	T	0.67432	-0.5672	10	0.46703	T	0.11	.	14.7878	0.69816	0.0:0.0:1.0:0.0	.	2131	Q9NR99	MXRA5_HUMAN	V	2131	ENSP00000217939:A2131V	ENSP00000217939:A2131V	A	-	2	0	MXRA5	3245330	1.000000	0.71417	0.982000	0.44146	0.157000	0.22087	4.237000	0.58681	1.354000	0.45846	0.597000	0.82753	GCG	MXRA5	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000101825		0.662	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	19	0.00	0	G	NM_015419		3235330	3235330	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	missense	4	63.64	7	SNP	0.978	A
PCDHAC2	56134	genome.wustl.edu	37	5	140348477	140348477	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr5:140348477T>C	ENST00000289269.5	+	1	2658	c.2126T>C	c.(2125-2127)aTa>aCa	p.I709T	PCDHA13_ENST00000289272.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	709					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTATCTAATAATAGCATTA	0.413																																					Melanoma(190;638 2083 3390 11909 52360)	dbGAP											0													68.0	70.0	69.0					5																	140348477		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.2126T>C	5.37:g.140348477T>C	ENSP00000289269:p.Ile709Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.I709T	ENST00000289269.5	37	c.2126	CCDS4242.1	5	.	.	.	.	.	.	.	.	.	.	T	12.84	2.057456	0.36277	.	.	ENSG00000243232	ENST00000289269	T	0.13657	2.57	5.77	5.77	0.91146	.	0.000000	0.47455	D	0.000228	T	0.40932	0.1137	M	0.88979	2.995	0.80722	D	1	P;P	0.49783	0.928;0.473	P;B	0.57425	0.82;0.056	T	0.47686	-0.9098	10	0.87932	D	0	.	16.0919	0.81098	0.0:0.0:0.0:1.0	.	709;709	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	T	709	ENSP00000289269:I709T	ENSP00000289269:I709T	I	+	2	0	PCDHAC2	140328661	1.000000	0.71417	0.993000	0.49108	0.989000	0.77384	7.694000	0.84235	2.201000	0.70794	0.459000	0.35465	ATA	PCDHAC2	-	NULL	ENSG00000243232		0.413	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	HGNC	protein_coding	OTTHUMT00000251802.2	35	0.00	0	T	NM_018899		140348477	140348477	+1	no_errors	ENST00000289269	ensembl	human	known	69_37n	missense	19	40.62	13	SNP	1.000	C
PLCB3	5331	genome.wustl.edu	37	11	64030194	64030194	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr11:64030194G>A	ENST00000540288.1	+	19	2372	c.2269G>A	c.(2269-2271)Gat>Aat	p.D757N	PLCB3_ENST00000325234.5_Missense_Mutation_p.D690N|PLCB3_ENST00000279230.6_Missense_Mutation_p.D757N	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	757	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						CCTCCCTGTTGATACGCGGCG	0.632																																						dbGAP											0													163.0	140.0	148.0					11																	64030194		2201	4297	6498	-	-	-	SO:0001583	missense	0			Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.2269G>A	11.37:g.64030194G>A	ENSP00000443631:p.Asp757Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKZ6|G5E960|Q8N1A4	Missense_Mutation	SNP	pirsf_PLC-beta,pfam_PLC-beta_C,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,pfam_PLC-beta_CS,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.D757N	ENST00000540288.1	37	c.2269	CCDS8064.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.444948	0.96187	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	T;T;T	0.16457	2.34;2.34;2.34	5.21	5.21	0.72293	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.54255	0.1847	M	0.94101	3.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67741	-0.5592	10	0.87932	D	0	.	17.5322	0.87818	0.0:0.0:1.0:0.0	.	690;757	G5E960;Q01970	.;PLCB3_HUMAN	N	757;757;690	ENSP00000279230:D757N;ENSP00000443631:D757N;ENSP00000324660:D690N	ENSP00000279230:D757N	D	+	1	0	PLCB3	63786770	1.000000	0.71417	0.827000	0.32855	0.933000	0.57130	9.808000	0.99193	2.437000	0.82529	0.591000	0.81541	GAT	PLCB3	-	pirsf_PLC-beta,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000149782		0.632	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	PLCB3	HGNC	protein_coding	OTTHUMT00000396405.1	27	0.00	0	G			64030194	64030194	+1	no_errors	ENST00000279230	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	1.000	A
PLXNB3	5365	genome.wustl.edu	37	X	153043430	153043430	+	Silent	SNP	C	C	T			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chrX:153043430C>T	ENST00000361971.5	+	32	5403	c.5289C>T	c.(5287-5289)gcC>gcT	p.A1763A	PLXNB3_ENST00000538966.1_Silent_p.A1786A|PLXNB3_ENST00000538776.1_Silent_p.A1416A|PLXNB3_ENST00000485980.1_3'UTR|SRPK3_ENST00000489426.1_5'UTR	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1763					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGTGAATGCCTTGAAGAACC	0.607																																						dbGAP											0													71.0	54.0	60.0					X																	153043430		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.5289C>T	X.37:g.153043430C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	p.P67L	ENST00000361971.5	37	c.200	CCDS14729.1	X	.	.	.	.	.	.	.	.	.	.	C	10.63	1.403369	0.25291	.	.	ENSG00000198753	ENST00000448847	.	.	.	4.86	0.762	0.18454	.	.	.	.	.	T	0.43233	0.1238	.	.	.	0.53688	D	0.999973	.	.	.	.	.	.	T	0.18618	-1.0331	4	.	.	.	.	2.7875	0.05378	0.1382:0.2945:0.3998:0.1676	.	.	.	.	L	67	.	.	P	+	2	0	PLXNB3	152696624	0.882000	0.30256	0.001000	0.08648	0.919000	0.55068	0.703000	0.25646	-0.209000	0.10156	0.529000	0.55759	CCT	PLXNB3	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000198753		0.607	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLXNB3	HGNC	protein_coding	OTTHUMT00000061063.1	36	0.00	0	C			153043430	153043430	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000448847	ensembl	human	known	69_37n	missense	55	14.06	9	SNP	0.868	T
RGPD4	285190	genome.wustl.edu	37	2	108487890	108487890	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr2:108487890C>G	ENST00000408999.3	+	20	3507	c.3430C>G	c.(3430-3432)Cta>Gta	p.L1144V	RGPD4_ENST00000354986.4_Missense_Mutation_p.L1144V	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1144	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TGATGCCAAACTAGAGCGGTT	0.438																																						dbGAP											0													8.0	8.0	8.0					2																	108487890		124	656	780	-	-	-	SO:0001583	missense	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3430C>G	2.37:g.108487890C>G	ENSP00000386810:p.Leu1144Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A029	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.L1144V	ENST00000408999.3	37	c.3430	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	0.010	-1.743481	0.00675	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.42131	0.98;0.98	2.33	2.33	0.28932	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.34048	0.0884	N	0.16368	0.405	0.28015	N	0.934765	B	0.28258	0.205	P	0.47376	0.545	T	0.50432	-0.8829	9	0.07644	T	0.81	-13.4186	6.293	0.21071	0.0:0.8469:0.0:0.1531	.	1144	Q7Z3J3	RGPD4_HUMAN	V	1144;1144;902	ENSP00000347081:L1144V;ENSP00000386810:L1144V	ENSP00000347081:L1144V	L	+	1	2	RGPD4	107854322	0.989000	0.36119	0.992000	0.48379	0.148000	0.21650	0.485000	0.22324	1.303000	0.44873	0.162000	0.16502	CTA	RGPD4	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	ENSG00000196862		0.438	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	46	0.00	0	C	XM_496581		108487890	108487890	+1	no_errors	ENST00000354986	ensembl	human	known	69_37n	missense	19	34.48	10	SNP	0.988	G
CTBS	1486	genome.wustl.edu	37	1	85018771	85018772	+	3'UTR	INS	-	-	A			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr1:85018771_85018772insA	ENST00000370630.5	-	0	3116_3117				CTBS_ENST00000477677.1_5'Flank	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-						chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)	p.I452fs*1(2)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		AACTGGCACAGAAAAAAAAAAT	0.238																																						dbGAP											2	Deletion - Frameshift(2)	large_intestine(1)|central_nervous_system(1)																																								-	-	-	SO:0001624	3_prime_UTR_variant	0			M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.*1911->T	1.37:g.85018781_85018781dupA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VX50	RNA	INS	-	NULL	ENST00000370630.5	37	NULL	CCDS698.1	1																																																																																			SPATA1	-	-	ENSG00000122432		0.238	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA1	HGNC	protein_coding	OTTHUMT00000027457.2	13	0.00	0	-	NM_004388		85018771	85018772	+1	no_errors	ENST00000460286	ensembl	human	known	69_37n	rna	17	15.00	3	INS	1.000:1.000	A
SLC45A3	85414	genome.wustl.edu	37	1	205632534	205632534	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr1:205632534C>A	ENST00000367145.3	-	3	680	c.385G>T	c.(385-387)Gtg>Ttg	p.V129L	SLC45A3_ENST00000460934.1_5'Flank	NM_033102.2	NP_149093.1	Q96JT2	S45A3_HUMAN	solute carrier family 45, member 3	129					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)			SLC45A3/BRAF(2)|SLC45A3/ELK4(18)|SLC45A3/ETV1(3)|SLC45A3/ETV5_ENST00000306376(2)|SLC45A3/ERG(50)	cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|ovary(3)|prostate(5)	21	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			AGCAGCCCCACGCCCAGGATG	0.662			T	"""ETV1, ETV5, ELK4, ERG"""	prostate																																	dbGAP		Dom	yes		1	1q32	85414	"""solute carrier family 45, member 3"""		E	0													21.0	21.0	21.0					1																	205632534		2194	4291	6485	-	-	-	SO:0001583	missense	0			AF109301	CCDS1458.1	1q32.1	2013-05-22	2005-10-04	2005-10-04	ENSG00000158715	ENSG00000158715		"""Solute carriers"""	8642	protein-coding gene	gene with protein product		605097	"""prostate cancer associated protein 6"", ""prostate cancer associated protein 2"", ""prostate cancer associated protein 8"""	PCANAP6, PCANAP2, PCANAP8		10613842, 11245466	Standard	XM_005245556		Approved	IPCA-6, prostein, IPCA-2, IPCA-8	uc001hda.1	Q96JT2	OTTHUMG00000037223	ENST00000367145.3:c.385G>T	1.37:g.205632534C>A	ENSP00000356113:p.Val129Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2U9	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.V129L	ENST00000367145.3	37	c.385	CCDS1458.1	1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.018823	0.75275	.	.	ENSG00000158715	ENST00000367145	T	0.56275	0.47	5.5	5.5	0.81552	Major facilitator superfamily domain, general substrate transporter (1);	0.162599	0.49916	D	0.000127	T	0.57431	0.2053	M	0.67700	2.07	0.49483	D	0.999796	D	0.54397	0.966	P	0.53062	0.717	T	0.54589	-0.8271	10	0.25106	T	0.35	-11.8858	7.8776	0.29603	0.0:0.8044:0.0:0.1956	.	129	Q96JT2	S45A3_HUMAN	L	129	ENSP00000356113:V129L	ENSP00000356113:V129L	V	-	1	0	SLC45A3	203899157	0.987000	0.35691	0.974000	0.42286	0.975000	0.68041	2.496000	0.45346	2.735000	0.93741	0.655000	0.94253	GTG	SLC45A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000158715		0.662	SLC45A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A3	HGNC	protein_coding	OTTHUMT00000090619.1	8	0.00	0	C	NM_033102		205632534	205632534	-1	no_errors	ENST00000367145	ensembl	human	known	69_37n	missense	1	83.33	5	SNP	0.980	A
TAOK1	57551	genome.wustl.edu	37	17	27822641	27822641	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr17:27822641G>T	ENST00000261716.3	+	11	1414	c.895G>T	c.(895-897)Gat>Tat	p.D299Y	TAOK1_ENST00000536202.1_Missense_Mutation_p.D299Y	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	299					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			GAGGACAAAGGATGCAGTAAG	0.423																																						dbGAP											0													120.0	112.0	115.0					17																	27822641		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.895G>T	17.37:g.27822641G>T	ENSP00000261716:p.Asp299Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Homeodomain-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D299Y	ENST00000261716.3	37	c.895	CCDS32601.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.217554	0.95104	.	.	ENSG00000160551	ENST00000261716;ENST00000536202	D;D	0.85171	-1.95;-1.95	5.22	5.22	0.72569	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.91613	0.7350	M	0.68317	2.08	0.80722	D	1	D;D;D	0.71674	0.991;0.998;0.996	P;D;P	0.71184	0.882;0.972;0.86	D	0.92143	0.5722	10	0.72032	D	0.01	.	19.1509	0.93488	0.0:0.0:1.0:0.0	.	299;125;299	B7ZLV6;Q7L7X3-2;Q7L7X3	.;.;TAOK1_HUMAN	Y	299	ENSP00000261716:D299Y;ENSP00000438819:D299Y	ENSP00000261716:D299Y	D	+	1	0	TAOK1	24846767	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.660000	0.98599	2.599000	0.87857	0.563000	0.77884	GAT	TAOK1	-	superfamily_Kinase-like_dom	ENSG00000160551		0.423	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK1	HGNC	protein_coding	OTTHUMT00000447790.1	46	0.00	0	G	NM_020791		27822641	27822641	+1	no_errors	ENST00000261716	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	1.000	T
TLL1	7092	genome.wustl.edu	37	4	166999053	166999053	+	Splice_Site	SNP	A	A	T			TCGA-D8-A27R-01A-11D-A16D-09	TCGA-D8-A27R-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	27741c13-8d5f-43b8-8651-caf69acef0e4	eabe627c-2cc9-48cd-85c5-c7482f2077ed	g.chr4:166999053A>T	ENST00000061240.2	+	18	2961		c.e18-1		TLL1_ENST00000507499.1_Splice_Site	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1						cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TTATTGGTGCAGCTGAGTGTG	0.488																																						dbGAP											0													114.0	93.0	100.0					4																	166999053		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2315-1A>T	4.37:g.166999053A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMU2|Q96AN3|Q9NQS4	Splice_Site	SNP	-	e18-2	ENST00000061240.2	37	c.2315-2	CCDS3811.1	4	.	.	.	.	.	.	.	.	.	.	A	18.41	3.618852	0.66787	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5494	0.84464	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TLL1	167218503	1.000000	0.71417	1.000000	0.80357	0.477000	0.33069	9.287000	0.95975	2.299000	0.77371	0.528000	0.53228	.	TLL1	-	-	ENSG00000038295		0.488	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	HGNC	protein_coding	OTTHUMT00000363821.1	36	0	0	A		Intron	166999053	166999053	+1	no_errors	ENST00000061240	ensembl	human	known	69_37n	splice_site	33	19.51	8	SNP	1.000	T
