#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA13	154664	genome.wustl.edu	37	7	48308665	48308665	+	Silent	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr7:48308665C>G	ENST00000435803.1	+	16	2118	c.2094C>G	c.(2092-2094)ctC>ctG	p.L698L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	698					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ATAACTTACTCAAGTCTCCAA	0.303																																						dbGAP											0													36.0	36.0	36.0					7																	48308665		1797	4057	5854	-	-	-	SO:0001819	synonymous_variant	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.2094C>G	7.37:g.48308665C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L698	ENST00000435803.1	37	c.2094	CCDS47584.1	7																																																																																			ABCA13	-	NULL	ENSG00000179869		0.303	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	54	0.00	0	C	NM_152701		48308665	48308665	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	silent	23	33.33	12	SNP	0.000	G
ACO2	50	genome.wustl.edu	37	22	41923997	41923997	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr22:41923997C>G	ENST00000216254.4	+	17	2201	c.2179C>G	c.(2179-2181)Cag>Gag	p.Q727E	POLR3H_ENST00000396504.2_3'UTR|POLR3H_ENST00000355209.4_3'UTR|ACO2_ENST00000396512.3_Missense_Mutation_p.Q752E	NM_001098.2	NP_001089.1	Q99798	ACON_HUMAN	aconitase 2, mitochondrial	727					cell death (GO:0008219)|cellular metabolic process (GO:0044237)|citrate metabolic process (GO:0006101)|generation of precursor metabolites and energy (GO:0006091)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron ion binding (GO:0005506)			breast(3)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	23						GCTGACCATTCAGGGCCTGAA	0.612																																						dbGAP											0													121.0	125.0	124.0					22																	41923997		2203	4300	6503	-	-	-	SO:0001583	missense	0			AH006514	CCDS14017.1	22q13.2	2013-05-21			ENSG00000100412	ENSG00000100412	4.2.1.3		118	protein-coding gene	gene with protein product	"""aconitate hydratase, mitochondrial"""	100850				10591208	Standard	NM_001098		Approved	ACONM	uc003bac.3	Q99798	OTTHUMG00000030544	ENST00000216254.4:c.2179C>G	22.37:g.41923997C>G	ENSP00000216254:p.Gln727Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O75809|Q5JZ41|Q6FHX0|Q8TAQ6	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase_mito-like	p.Q727E	ENST00000216254.4	37	c.2179	CCDS14017.1	22	.	.	.	.	.	.	.	.	.	.	c	11.38	1.622330	0.28889	.	.	ENSG00000100412	ENST00000541439;ENST00000544234;ENST00000216254;ENST00000396512	T;T	0.39997	1.05;1.05	5.46	4.44	0.53790	Aconitase/3-isopropylmalate dehydratase, swivel (2);	0.474803	0.24973	N	0.034134	T	0.19604	0.0471	N	0.02916	-0.46	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.04481	-1.0948	10	0.38643	T	0.18	.	10.2681	0.43466	0.12:0.6126:0.2673:0.0	.	752;727	A2A274;Q99798	.;ACON_HUMAN	E	448;708;727;752	ENSP00000216254:Q727E;ENSP00000379769:Q752E	ENSP00000216254:Q727E	Q	+	1	0	ACO2	40253943	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	2.654000	0.46699	1.438000	0.47492	0.556000	0.70494	CAG	ACO2	-	superfamily_Aconitase/3IPM_dehydase_swvl,tigrfam_Aconitase_mito-like	ENSG00000100412		0.612	ACO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACO2	HGNC	protein_coding	OTTHUMT00000259151.1	22	0.00	0	C	NM_001098		41923997	41923997	+1	no_errors	ENST00000216254	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	1.000	G
ACTL7B	10880	genome.wustl.edu	37	9	111617311	111617311	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr9:111617311C>T	ENST00000374667.3	-	1	1928	c.900G>A	c.(898-900)gaG>gaA	p.E300E		NM_006686.3	NP_006677.1	Q9Y614	ACL7B_HUMAN	actin-like 7B	300						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						GGAAGAGCATCTCAGAGCAAC	0.677																																						dbGAP											0													45.0	54.0	51.0					9																	111617311		2199	4295	6494	-	-	-	SO:0001819	synonymous_variant	0			BC033789	CCDS6771.1	9q31	2009-05-15			ENSG00000148156	ENSG00000148156			162	protein-coding gene	gene with protein product		604304				10373328, 12907721	Standard	NM_006686		Approved	Tact1	uc004bdi.3	Q9Y614	OTTHUMG00000020462	ENST00000374667.3:c.900G>A	9.37:g.111617311C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9Q2|Q5JSV1	Silent	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.E300	ENST00000374667.3	37	c.900	CCDS6771.1	9																																																																																			ACTL7B	-	pfam_Actin-like,smart_Actin-like	ENSG00000148156		0.677	ACTL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL7B	HGNC	protein_coding	OTTHUMT00000053571.1	9	0.00	0	C	NM_006686		111617311	111617311	-1	no_errors	ENST00000374667	ensembl	human	known	69_37n	silent	34	17.07	7	SNP	1.000	T
ACTL8	81569	genome.wustl.edu	37	1	18152983	18152983	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:18152983G>C	ENST00000375406.1	+	3	1286	c.1070G>C	c.(1069-1071)cGa>cCa	p.R357P		NM_030812.2	NP_110439.2	Q9H568	ACTL8_HUMAN	actin-like 8	357					epithelial cell differentiation (GO:0030855)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	28		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		TGGATGTCCCGAGAGGAGTAT	0.517											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													52.0	55.0	54.0					1																	18152983		2180	4275	6455	-	-	-	SO:0001583	missense	0			AK057339	CCDS183.1	1p36.2-p35	2009-03-25			ENSG00000117148	ENSG00000117148			24018	protein-coding gene	gene with protein product	"""cancer/testis antigen 57"""						Standard	NM_030812		Approved	CT57	uc001bat.3	Q9H568	OTTHUMG00000002512	ENST00000375406.1:c.1070G>C	1.37:g.18152983G>C	ENSP00000364555:p.Arg357Pro	Somatic	723	WXS	Illumina GAIIx	Phase_IV	Q13104|Q96M75	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.R357P	ENST00000375406.1	37	c.1070	CCDS183.1	1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.848195	0.32699	.	.	ENSG00000117148	ENST00000375406	D	0.95588	-3.75	5.16	-2.66	0.06077	.	0.540328	0.14912	N	0.291184	D	0.95446	0.8521	M	0.70842	2.15	0.09310	N	0.999999	P	0.50819	0.939	P	0.54140	0.743	D	0.91472	0.5197	10	0.87932	D	0	-6.8415	11.4004	0.49866	0.5852:0.0:0.4148:0.0	.	357	Q9H568	ACTL8_HUMAN	P	357	ENSP00000364555:R357P	ENSP00000364555:R357P	R	+	2	0	ACTL8	18025570	0.788000	0.28762	0.002000	0.10522	0.010000	0.07245	0.902000	0.28459	-0.401000	0.07644	-0.345000	0.07892	CGA	ACTL8	-	pfam_Actin-like,smart_Actin-like	ENSG00000117148		0.517	ACTL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL8	HGNC	protein_coding	OTTHUMT00000007143.1	48	0.00	0	G	NM_030812		18152983	18152983	+1	no_errors	ENST00000375406	ensembl	human	known	69_37n	missense	63	21.25	17	SNP	0.162	C
AGAP1	116987	genome.wustl.edu	37	2	236957722	236957722	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:236957722G>C	ENST00000304032.8	+	16	2491	c.1911G>C	c.(1909-1911)ttG>ttC	p.L637F	AGAP1_ENST00000409538.1_Missense_Mutation_p.L849F|AGAP1_ENST00000428334.2_Missense_Mutation_p.L476F|AGAP1_ENST00000336665.5_Missense_Mutation_p.L584F	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	637	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						GGGCCAGTTTGAACTTGGGAG	0.537																																						dbGAP											0													191.0	159.0	170.0					2																	236957722		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.1911G>C	2.37:g.236957722G>C	ENSP00000307634:p.Leu637Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.L637F	ENST00000304032.8	37	c.1911	CCDS33408.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.95|18.95	3.730914|3.730914	0.69074|0.69074	.|.	.|.	ENSG00000157985|ENSG00000157985	ENST00000418654;ENST00000453371|ENST00000304032;ENST00000336665;ENST00000409538;ENST00000428334	.|T;T;T;T	.|0.49432	.|0.78;0.78;0.78;0.78	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.75744|0.75744	0.3891|0.3891	M|M	0.93594|0.93594	3.435|3.435	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.87578	.|0.997;0.998	T|T	0.81924|0.81924	-0.0710|-0.0710	5|10	.|0.87932	.|D	.|0	.|.	13.6275|13.6275	0.62173|0.62173	0.0736:0.0:0.9264:0.0|0.0736:0.0:0.9264:0.0	.|.	.|584;637	.|Q9UPQ3-2;Q9UPQ3	.|.;AGAP1_HUMAN	Q|F	190;39|637;584;849;476	.|ENSP00000307634:L637F;ENSP00000338378:L584F;ENSP00000386897:L849F;ENSP00000411824:L476F	.|ENSP00000307634:L637F	E|L	+|+	1|3	0|2	AGAP1|AGAP1	236622461|236622461	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.978000|0.978000	0.69477|0.69477	3.105000|3.105000	0.50314|0.50314	2.576000|2.576000	0.86940|0.86940	0.655000|0.655000	0.94253|0.94253	GAA|TTG	AGAP1	-	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	ENSG00000157985		0.537	AGAP1-001	KNOWN	basic|CCDS	protein_coding	AGAP1	HGNC	protein_coding	OTTHUMT00000257076.2	86	0.00	0	G	NM_014914		236957722	236957722	+1	no_errors	ENST00000304032	ensembl	human	known	69_37n	missense	125	18.30	28	SNP	1.000	C
AMBN	258	genome.wustl.edu	37	4	71471980	71471980	+	Missense_Mutation	SNP	C	C	T	rs200796492		TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr4:71471980C>T	ENST00000322937.6	+	13	980	c.877C>T	c.(877-879)Ccc>Tcc	p.P293S	AMBN_ENST00000449493.2_Missense_Mutation_p.P278S	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	293					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			TGAGGGAATGCCCCACAACCC	0.552													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18511	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													62.0	65.0	64.0					4																	71471980		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.877C>T	4.37:g.71471980C>T	ENSP00000313809:p.Pro293Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	pfam_Amelin,smart_Amelin	p.P293S	ENST00000322937.6	37	c.877	CCDS3543.1	4	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	12.09	1.834079	0.32421	.	.	ENSG00000178522	ENST00000322937;ENST00000538728;ENST00000449493	T;T	0.33438	1.41;1.41	5.79	1.9	0.25705	.	0.619778	0.15728	N	0.247542	T	0.40222	0.1108	M	0.76574	2.34	0.09310	N	1	P	0.52842	0.956	P	0.53006	0.715	T	0.25572	-1.0128	10	0.66056	D	0.02	0.754	4.3419	0.11113	0.1515:0.4912:0.2757:0.0816	.	293	Q9NP70	AMBN_HUMAN	S	293;292;278	ENSP00000313809:P293S;ENSP00000391234:P278S	ENSP00000313809:P293S	P	+	1	0	AMBN	71506569	0.444000	0.25649	0.079000	0.20413	0.224000	0.24922	0.394000	0.20834	0.333000	0.23563	0.655000	0.94253	CCC	AMBN	-	pfam_Amelin,smart_Amelin	ENSG00000178522		0.552	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBN	HGNC	protein_coding	OTTHUMT00000252165.1	34	0.00	0	C	NM_016519		71471980	71471980	+1	no_errors	ENST00000322937	ensembl	human	known	69_37n	missense	36	23.40	11	SNP	0.093	T
AMPD1	270	genome.wustl.edu	37	1	115226879	115226879	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:115226879G>A	ENST00000520113.2	-	5	602	c.587C>T	c.(586-588)tCc>tTc	p.S196F	AMPD1_ENST00000369538.3_Missense_Mutation_p.S192F|AMPD1_ENST00000353928.6_Missense_Mutation_p.S163F			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	196					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	CAAGTATTTGGAAGGGGTTTT	0.383																																						dbGAP											0													104.0	97.0	99.0					1																	115226879		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.587C>T	1.37:g.115226879G>A	ENSP00000430075:p.Ser196Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.S196F	ENST00000520113.2	37	c.587	CCDS876.2	1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.685597	0.68157	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	T;T;T	0.36520	1.25;1.25;1.25	5.72	5.72	0.89469	.	0.052288	0.85682	D	0.000000	T	0.55609	0.1931	M	0.80746	2.51	0.80722	D	1	D;D	0.65815	0.995;0.985	P;P	0.61070	0.883;0.781	T	0.60146	-0.7320	10	0.72032	D	0.01	-17.5294	19.877	0.96880	0.0:0.0:1.0:0.0	.	192;163	Q5TF02;P23109	.;AMPD1_HUMAN	F	196;192;163	ENSP00000430075:S196F;ENSP00000358551:S192F;ENSP00000316520:S163F	ENSP00000316520:S163F	S	-	2	0	AMPD1	115028402	1.000000	0.71417	0.999000	0.59377	0.128000	0.20619	9.609000	0.98334	2.696000	0.92011	0.650000	0.86243	TCC	AMPD1	-	pirsf_AMP_deaminase,tigrfam_AMP_deaminase	ENSG00000116748		0.383	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	HGNC	protein_coding	OTTHUMT00000032860.4	92	0.00	0	G			115226879	115226879	-1	no_errors	ENST00000520113	ensembl	human	known	69_37n	missense	51	32.00	24	SNP	1.000	A
ANAPC1	64682	genome.wustl.edu	37	2	112588876	112588876	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:112588876C>T	ENST00000341068.3	-	21	3384	c.2612G>A	c.(2611-2613)aGa>aAa	p.R871K		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	871					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						GACTACAAGTCTGCTTCTTTC	0.378																																						dbGAP											0													58.0	53.0	54.0					2																	112588876		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.2612G>A	2.37:g.112588876C>T	ENSP00000339109:p.Arg871Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	NULL	p.R871K	ENST00000341068.3	37	c.2612	CCDS2093.1	2	.	.	.	.	.	.	.	.	.	.	C	3.620	-0.077758	0.07184	.	.	ENSG00000153107	ENST00000341068	T	0.32988	1.43	4.25	-1.24	0.09435	.	0.605491	0.12466	N	0.466408	T	0.10766	0.0263	N	0.04043	-0.29	0.23180	N	0.998167	B	0.02656	0.0	B	0.01281	0.0	T	0.35699	-0.9778	10	0.02654	T	1	-5.5457	9.7703	0.40585	0.0:0.353:0.0:0.647	.	871	Q9H1A4	APC1_HUMAN	K	871	ENSP00000339109:R871K	ENSP00000339109:R871K	R	-	2	0	ANAPC1	112305347	0.999000	0.42202	0.056000	0.19401	0.172000	0.22775	1.708000	0.37899	-0.498000	0.06632	-1.786000	0.00637	AGA	ANAPC1	-	NULL	ENSG00000153107		0.378	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC1	HGNC	protein_coding	OTTHUMT00000254045.2	76	0.00	0	C	NM_022662		112588876	112588876	-1	no_errors	ENST00000341068	ensembl	human	known	69_37n	missense	63	29.21	26	SNP	0.913	T
ANKRD12	23253	genome.wustl.edu	37	18	9280953	9280953	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr18:9280953G>A	ENST00000262126.4	+	13	6258	c.6018G>A	c.(6016-6018)atG>atA	p.M2006I	ANKRD12_ENST00000383440.2_Missense_Mutation_p.M1983I|ANKRD12_ENST00000400020.3_Missense_Mutation_p.M1983I|snoU13_ENST00000459594.1_RNA	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	2006						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						GTCTTTTAATGAGGCAACAAC	0.368																																						dbGAP											0													76.0	80.0	78.0					18																	9280953		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.6018G>A	18.37:g.9280953G>A	ENSP00000262126:p.Met2006Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.M2006I	ENST00000262126.4	37	c.6018	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887633	0.72410	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.67345	-0.26;-0.26	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.79890	0.4524	L	0.60455	1.87	0.80722	D	1	D;D	0.58268	0.982;0.969	D;D	0.68943	0.961;0.914	T	0.81176	-0.1052	10	0.72032	D	0.01	-12.973	19.1218	0.93365	0.0:0.0:1.0:0.0	.	1983;2006	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	I	1983;2006	ENSP00000372932:M1983I;ENSP00000262126:M2006I	ENSP00000262126:M2006I	M	+	3	0	ANKRD12	9270953	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.534000	0.85438	0.591000	0.81541	ATG	ANKRD12	-	NULL	ENSG00000101745		0.368	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	59	0.00	0	G	NM_015208		9280953	9280953	+1	no_errors	ENST00000262126	ensembl	human	known	69_37n	missense	41	32.79	20	SNP	1.000	A
ANKRD20A19P	400110	genome.wustl.edu	37	13	24520315	24520315	+	RNA	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr13:24520315C>T	ENST00000442969.1	-	0	606									ankyrin repeat domain 20 family, member A19, pseudogene																		CTAGAATCCGCGATCCAGCCC	0.587																																						dbGAP											0													67.0	75.0	73.0					13																	24520315		692	1591	2283	-	-	-			0					13q12.12	2012-10-16			ENSG00000196593	ENSG00000196593			42737	pseudogene	pseudogene							Standard	NR_073430		Approved		uc001upb.2		OTTHUMG00000016572		13.37:g.24520315C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000442969.1	37	NULL		13																																																																																			ANKRD20A19P	-	-	ENSG00000196593		0.587	ANKRD20A19P-001	KNOWN	basic	processed_transcript	ANKRD20A19P	HGNC	pseudogene	OTTHUMT00000044167.2	48	0.00	0	C			24520315	24520315	-1	no_errors	ENST00000420143	ensembl	human	known	69_37n	rna	86	12.24	12	SNP	0.690	T
ANKRD34A	284615	genome.wustl.edu	37	1	145473931	145473931	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:145473931C>T	ENST00000323397.4	+	4	1896	c.603C>T	c.(601-603)tcC>tcT	p.S201S	RP11-315I20.1_ENST00000600340.1_RNA	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	201						cytoplasm (GO:0005737)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGATGTTATCCCCTCGCGCCC	0.627																																						dbGAP											0													66.0	71.0	69.0					1																	145473931		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.603C>T	1.37:g.145473931C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSU3	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S201	ENST00000323397.4	37	c.603	CCDS30829.1	1																																																																																			ANKRD34A	-	NULL	ENSG00000181039		0.627	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD34A	HGNC	protein_coding	OTTHUMT00000038512.1	28	0.00	0	C			145473931	145473931	+1	no_errors	ENST00000323397	ensembl	human	known	69_37n	silent	45	10.00	5	SNP	0.961	T
ANKRD50	57182	genome.wustl.edu	37	4	125590860	125590860	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr4:125590860G>C	ENST00000504087.1	-	4	4609	c.3572C>G	c.(3571-3573)tCt>tGt	p.S1191C	ANKRD50_ENST00000515641.1_Missense_Mutation_p.S1012C	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1191	Ser-rich.									NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						AGTTCTCAAAGATGAATTTTT	0.383																																						dbGAP											0													94.0	96.0	95.0					4																	125590860		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.3572C>G	4.37:g.125590860G>C	ENSP00000425658:p.Ser1191Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S1191C	ENST00000504087.1	37	c.3572	CCDS34060.1	4	.	.	.	.	.	.	.	.	.	.	G	21.8	4.195735	0.78902	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.69561	-0.41;-0.38	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.68265	0.2982	N	0.08118	0	0.58432	D	0.999999	D	0.76494	0.999	D	0.77557	0.99	T	0.74777	-0.3550	10	0.54805	T	0.06	.	19.1278	0.93393	0.0:0.0:1.0:0.0	.	1191	Q9ULJ7	ANR50_HUMAN	C	1191;1012	ENSP00000425658:S1191C;ENSP00000425355:S1012C	ENSP00000425658:S1191C	S	-	2	0	ANKRD50	125810310	1.000000	0.71417	0.989000	0.46669	0.998000	0.95712	9.060000	0.93907	2.756000	0.94617	0.561000	0.74099	TCT	ANKRD50	-	NULL	ENSG00000151458		0.383	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD50	HGNC	protein_coding	OTTHUMT00000364775.1	31	0.00	0	G	NM_020337		125590860	125590860	-1	no_errors	ENST00000504087	ensembl	human	known	69_37n	missense	31	31.11	14	SNP	1.000	C
ANXA1	301	genome.wustl.edu	37	9	75773488	75773488	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr9:75773488T>C	ENST00000376911.1	+	1	919	c.37T>C	c.(37-39)Ttt>Ctt	p.F13L	ANXA1_ENST00000257497.6_Missense_Mutation_p.F13L			P04083	ANXA1_HUMAN	annexin A1	13					alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	GCAGGCCTGGTTTATTGAAAA	0.308																																						dbGAP											0													79.0	79.0	79.0					9																	75773488		2203	4300	6503	-	-	-	SO:0001583	missense	0			X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.37T>C	9.37:g.75773488T>C	ENSP00000366109:p.Phe13Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinI	p.F13L	ENST00000376911.1	37	c.37	CCDS6645.1	9	.	.	.	.	.	.	.	.	.	.	T	15.74	2.923296	0.52653	.	.	ENSG00000135046	ENST00000257497;ENST00000456643;ENST00000415424;ENST00000376911	T;T;T;T	0.04156	3.69;3.69;3.69;3.69	5.4	5.4	0.78164	.	0.150888	0.64402	D	0.000010	T	0.04318	0.0119	N	0.19112	0.55	0.38962	D	0.958569	P	0.35383	0.498	B	0.35312	0.2	T	0.56038	-0.8045	10	0.32370	T	0.25	.	13.468	0.61266	0.0:0.0:0.0:1.0	.	13	P04083	ANXA1_HUMAN	L	13;24;13;13	ENSP00000257497:F13L;ENSP00000412489:F24L;ENSP00000414013:F13L;ENSP00000366109:F13L	ENSP00000257497:F13L	F	+	1	0	ANXA1	74963308	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.436000	0.59948	2.168000	0.68352	0.533000	0.62120	TTT	ANXA1	-	prints_AnnexinI	ENSG00000135046		0.308	ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA1	HGNC	protein_coding	OTTHUMT00000052665.1	78	0.00	0	T	NM_000700		75773488	75773488	+1	no_errors	ENST00000257497	ensembl	human	known	69_37n	missense	110	19.71	27	SNP	1.000	C
AP3D1	8943	genome.wustl.edu	37	19	2102199	2102199	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:2102199C>T	ENST00000345016.5	-	30	3666	c.3435G>A	c.(3433-3435)gaG>gaA	p.E1145E	AP3D1_ENST00000356926.4_Silent_p.E1104E|AP3D1_ENST00000350812.6_Silent_p.E976E|AP3D1_ENST00000355272.6_Silent_p.E1207E	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	1145					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGCCTTCATCTCTTCTAACA	0.562																																						dbGAP											0													128.0	135.0	133.0					19																	2102199		2042	4189	6231	-	-	-	SO:0001819	synonymous_variant	0			U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.3435G>A	19.37:g.2102199C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Silent	SNP	pfam_BLV_receptor,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	p.E1207	ENST00000345016.5	37	c.3621	CCDS42459.1	19																																																																																			AP3D1	-	pfam_BLV_receptor	ENSG00000065000		0.562	AP3D1-002	KNOWN	basic|CCDS	protein_coding	AP3D1	HGNC	protein_coding	OTTHUMT00000450912.1	25	0.00	0	C			2102199	2102199	-1	no_errors	ENST00000355272	ensembl	human	known	69_37n	silent	60	14.29	10	SNP	1.000	T
APH1A	51107	genome.wustl.edu	37	1	150240054	150240054	+	Intron	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:150240054G>A	ENST00000369109.3	-	3	547				C1orf54_ENST00000369102.1_5'Flank|APH1A_ENST00000461320.1_Intron|APH1A_ENST00000360244.4_Intron|APH1A_ENST00000414276.2_Intron	NM_001077628.2	NP_001071096.1	Q96BI3	APH1A_HUMAN	APH1A gamma secretase subunit						amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|metanephros development (GO:0001656)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	9	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGGATATTTAGAGACTTCCCT	0.502																																						dbGAP											0													29.0	32.0	31.0					1																	150240054		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF151835	CCDS41390.1, CCDS41391.1, CCDS58025.1	1q21.2	2013-05-01	2013-05-01		ENSG00000117362	ENSG00000117362			29509	protein-coding gene	gene with protein product		607629	"""anterior pharynx defective 1 homolog A (C. elegans)"""			10810093, 12110170	Standard	NM_001077628		Approved	APH-1A, CGI-78	uc001ety.2	Q96BI3	OTTHUMG00000012545	ENST00000369109.3:c.358+61C>T	1.37:g.150240054G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQK0|Q5TB22|Q5TB23|Q969R6|Q9BVG0|Q9Y386	RNA	SNP	-	NULL	ENST00000369109.3	37	NULL	CCDS41390.1	1																																																																																			APH1A	-	-	ENSG00000117362		0.502	APH1A-002	KNOWN	basic|CCDS	protein_coding	APH1A	HGNC	protein_coding	OTTHUMT00000035048.1	14	0.00	0	G	NM_016022		150240054	150240054	-1	no_errors	ENST00000486720	ensembl	human	known	69_37n	rna	36	16.28	7	SNP	0.793	A
APOA1BP	128240	genome.wustl.edu	37	1	156563832	156563832	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:156563832C>T	ENST00000368234.3	+	6	810	c.767C>T	c.(766-768)cCt>cTt	p.P256L	APOA1BP_ENST00000368235.3_Silent_p.L275L|GPATCH4_ENST00000497287.1_5'Flank					apolipoprotein A-I binding protein											central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|urinary_tract(1)	9	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCAGCTGAACCTGCCACCCTA	0.537																																						dbGAP											0													84.0	79.0	80.0					1																	156563832		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ315849	CCDS1145.1	1q21	2008-08-14			ENSG00000163382	ENSG00000163382			18453	protein-coding gene	gene with protein product	"""apoA-I binding protein"""	608862				11991719, 17533573	Standard	NM_144772		Approved	AIBP, MGC119143, MGC119144, MGC119145, YJEFN1	uc001fph.3	Q8NCW5	OTTHUMG00000033206	ENST00000368234.3:c.767C>T	1.37:g.156563832C>T	ENSP00000357217:p.Pro256Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_YjeF_N,superfamily_YjeF_N	p.P256L	ENST00000368234.3	37	c.767		1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388203	0.82902	.	.	ENSG00000163382	ENST00000368234	T	0.56611	0.45	5.29	3.36	0.38483	.	.	.	.	.	T	0.27629	0.0679	.	.	.	0.80722	D	1	B	0.19445	0.036	B	0.20577	0.03	T	0.14062	-1.0486	8	0.62326	D	0.03	-11.9979	10.1413	0.42736	0.0:0.8301:0.0:0.1699	.	256	Q5T3I3	.	L	256	ENSP00000357217:P256L	ENSP00000357217:P256L	P	+	2	0	APOA1BP	154830456	1.000000	0.71417	0.600000	0.28864	0.963000	0.63663	2.720000	0.47252	0.569000	0.29329	0.563000	0.77884	CCT	APOA1BP	-	NULL	ENSG00000163382		0.537	APOA1BP-002	KNOWN	basic	protein_coding	APOA1BP	HGNC	protein_coding	OTTHUMT00000081045.1	26	0.00	0	C	NM_144772		156563832	156563832	+1	no_errors	ENST00000368234	ensembl	human	known	69_37n	missense	35	22.22	10	SNP	1.000	T
AS3MT	57412	genome.wustl.edu	37	10	104629888	104629888	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr10:104629888C>G	ENST00000369880.3	+	3	167	c.90C>G	c.(88-90)aaC>aaG	p.N30K	RNU6-372P_ENST00000364210.1_RNA|C10orf32-ASMT_ENST00000299353.6_3'UTR	NM_020682.3	NP_065733.2	Q9HBK9	AS3MT_HUMAN	arsenite methyltransferase	30					arsonoacetate metabolic process (GO:0018872)|toxin metabolic process (GO:0009404)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	arsenite methyltransferase activity (GO:0030791)|methylarsonite methyltransferase activity (GO:0030792)			large_intestine(1)|lung(6)	7		Colorectal(252;0.122)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;5.87e-09)|all cancers(201;1.58e-07)|BRCA - Breast invasive adenocarcinoma(275;0.223)		TCCAGACCAACGGCTGTGTCA	0.587																																						dbGAP											0													55.0	63.0	60.0					10																	104629888		2034	4176	6210	-	-	-	SO:0001583	missense	0			AF226730	CCDS41567.1	10q24.33	2014-05-09	2014-05-09		ENSG00000214435	ENSG00000214435	2.1.1.137		17452	protein-coding gene	gene with protein product		611806	"""arsenic (+3 oxidation state) methyltransferase"""			11790780	Standard	NM_020682		Approved	CYT19	uc001kwk.3	Q9HBK9	OTTHUMG00000018972	ENST00000369880.3:c.90C>G	10.37:g.104629888C>G	ENSP00000358896:p.Asn30Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP79|Q0VDK3|Q0VDK4|Q5PZ02	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pfam_Methyltransf_12,pfam_PCMT,pfam_Methyltransferase-rel	p.N30K	ENST00000369880.3	37	c.90	CCDS41567.1	10	.	.	.	.	.	.	.	.	.	.	C	13.73	2.324422	0.41197	.	.	ENSG00000214435	ENST00000369880	T	0.21543	2.0	3.68	-6.26	0.02033	.	0.242584	0.39341	N	0.001391	T	0.14013	0.0339	M	0.64404	1.975	0.80722	D	1	B;B;B	0.22211	0.065;0.066;0.066	B;B;B	0.27715	0.082;0.072;0.072	T	0.08330	-1.0727	10	0.40728	T	0.16	-7.6958	1.36	0.02189	0.1229:0.2589:0.2501:0.368	.	30;30;30	Q0VDK3;Q9HBK9;Q0VDK4	.;AS3MT_HUMAN;.	K	30	ENSP00000358896:N30K	ENSP00000358896:N30K	N	+	3	2	AS3MT	104619878	0.188000	0.23250	0.795000	0.32087	0.808000	0.45660	-0.690000	0.05138	-1.234000	0.02548	-1.421000	0.01109	AAC	AS3MT	-	NULL	ENSG00000214435		0.587	AS3MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AS3MT	HGNC	protein_coding	OTTHUMT00000050107.1	10	0.00	0	C	NM_020682		104629888	104629888	+1	no_errors	ENST00000369880	ensembl	human	known	69_37n	missense	41	24.07	13	SNP	0.957	G
ASXL3	80816	genome.wustl.edu	37	18	31322953	31322953	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr18:31322953G>A	ENST00000269197.5	+	12	3141	c.3141G>A	c.(3139-3141)agG>agA	p.R1047R		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1047					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GTGGCGGGAGGAACACAGGAG	0.577																																						dbGAP											0													28.0	30.0	30.0					18																	31322953		1904	4116	6020	-	-	-	SO:0001819	synonymous_variant	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3141G>A	18.37:g.31322953G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	superfamily_Znf_FYVE_PHD	p.R1047	ENST00000269197.5	37	c.3141	CCDS45847.1	18																																																																																			ASXL3	-	NULL	ENSG00000141431		0.577	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	34	0.00	0	G			31322953	31322953	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	silent	50	25.37	17	SNP	1.000	A
ATG16L2	89849	genome.wustl.edu	37	11	72533924	72533924	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr11:72533924G>T	ENST00000321297.5	+	7	880	c.742G>T	c.(742-744)Gag>Tag	p.E248*	ATG16L2_ENST00000534905.1_Intron	NM_033388.1	NP_203746.1	Q8NAA4	A16L2_HUMAN	autophagy related 16-like 2 (S. cerevisiae)	248					autophagy (GO:0006914)|negative stranded viral RNA replication (GO:0039689)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	14			BRCA - Breast invasive adenocarcinoma(5;2.73e-06)			TGGGATGAGGGAGAGAAGGGA	0.612																																						dbGAP											0													27.0	29.0	28.0					11																	72533924		2192	4284	6476	-	-	-	SO:0001587	stop_gained	0			AK024423	CCDS31634.1	11q13.4	2014-02-12	2012-06-06		ENSG00000168010	ENSG00000168010		"""WD repeat domain containing"""	25464	protein-coding gene	gene with protein product			"""ATG16 autophagy related 16-like 2 (S. cerevisiae)"""			11214971	Standard	XM_005274378		Approved	FLJ00012, WDR80, ATG16B	uc001otd.3	Q8NAA4	OTTHUMG00000167961	ENST00000321297.5:c.742G>T	11.37:g.72533924G>T	ENSP00000326340:p.Glu248*	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL30|B2RPK5|Q658V4|Q6PID3|Q8NBG0	Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_Autophagy-rel_prot_16,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E248*	ENST00000321297.5	37	c.742	CCDS31634.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.01|14.01	2.407729|2.407729	0.42715|0.42715	.|.	.|.	ENSG00000168010|ENSG00000168010	ENST00000321297;ENST00000538973;ENST00000541367|ENST00000535830;ENST00000540222	.|.	.|.	.|.	4.24|4.24	3.3|3.3	0.37823|0.37823	.|.	5.292570|.	0.00166|.	N|.	0.000002|.	.|T	.|0.36799	.|0.0980	.|.	.|.	.|.	0.31585|0.31585	N|N	0.654667|0.654667	.|P	.|0.48162	.|0.906	.|B	.|0.44224	.|0.444	.|T	.|0.41734	.|-0.9492	.|6	0.20046|.	T|.	0.44|.	.|.	10.0777|10.0777	0.42370|0.42370	0.0:0.2037:0.7963:0.0|0.0:0.2037:0.7963:0.0	.|.	.|117	.|B4E090	.|.	X|V	248;79;79|85;46	.|.	ENSP00000326340:E248X|.	E|G	+|+	1|2	0|0	ATG16L2|ATG16L2	72211572|72211572	0.217000|0.217000	0.23597|0.23597	0.060000|0.060000	0.19600|0.19600	0.007000|0.007000	0.05969|0.05969	1.881000|1.881000	0.39638|0.39638	1.332000|1.332000	0.45431|0.45431	0.655000|0.655000	0.94253|0.94253	GAG|GGA	ATG16L2	-	NULL	ENSG00000168010		0.612	ATG16L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG16L2	HGNC	protein_coding	OTTHUMT00000397305.1	36	0.00	0	G	NM_033388		72533924	72533924	+1	no_errors	ENST00000321297	ensembl	human	known	69_37n	nonsense	24	27.27	9	SNP	0.069	T
ATP11C	286410	genome.wustl.edu	37	X	138810984	138810984	+	3'UTR	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chrX:138810984G>A	ENST00000327569.3	-	0	3638				ATP11C_ENST00000361648.2_3'UTR|ATP11C_ENST00000370557.1_3'UTR|ATP11C_ENST00000460773.1_5'UTR	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C						ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					CTAGACATGAGAGTGGTTTAG	0.338																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.*141C>T	X.37:g.138810984G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	RNA	SNP	-	NULL	ENST00000327569.3	37	NULL	CCDS14668.1	X																																																																																			ATP11C	-	-	ENSG00000101974		0.338	ATP11C-008	KNOWN	basic|CCDS	protein_coding	ATP11C	HGNC	protein_coding	OTTHUMT00000354945.1	140	0.00	0	G	NM_173694		138810984	138810984	-1	no_errors	ENST00000460773	ensembl	human	known	69_37n	rna	108	33.33	54	SNP	0.973	A
ATP2B3	492	genome.wustl.edu	37	X	152821798	152821798	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chrX:152821798G>C	ENST00000349466.2	+	14	2574	c.2248G>C	c.(2248-2250)Gag>Cag	p.E750Q	ATP2B3_ENST00000263519.4_Missense_Mutation_p.E750Q|ATP2B3_ENST00000370186.1_Missense_Mutation_p.E736Q|ATP2B3_ENST00000393842.1_Missense_Mutation_p.E736Q|ATP2B3_ENST00000359149.3_Missense_Mutation_p.E750Q|ATP2B3_ENST00000370181.2_Missense_Mutation_p.E736Q			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	750					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GATAGAACAGGAGCGGCTGGA	0.662																																						dbGAP											0													34.0	28.0	30.0					X																	152821798		2201	4300	6501	-	-	-	SO:0001583	missense	0			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.2248G>C	X.37:g.152821798G>C	ENSP00000343886:p.Glu750Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.E750Q	ENST00000349466.2	37	c.2248	CCDS35440.1	X	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760855	0.89932	.	.	ENSG00000067842	ENST00000370186;ENST00000349466;ENST00000393842;ENST00000359149;ENST00000263519;ENST00000370181	D;D;D;D;D;D	0.97161	-4.27;-4.27;-4.27;-4.27;-4.27;-4.27	4.72	4.72	0.59763	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95392	0.8504	L	0.41492	1.28	0.54753	D	0.999984	B;B	0.30937	0.301;0.256	B;B	0.37304	0.246;0.147	D	0.95071	0.8204	10	0.59425	D	0.04	-33.6422	15.9102	0.79467	0.0:0.0:1.0:0.0	.	750;750	Q16720;Q16720-2	AT2B3_HUMAN;.	Q	736;750;736;750;750;736	ENSP00000359205:E736Q;ENSP00000343886:E750Q;ENSP00000377425:E736Q;ENSP00000352062:E750Q;ENSP00000263519:E750Q;ENSP00000359200:E736Q	ENSP00000263519:E750Q	E	+	1	0	ATP2B3	152474992	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.645000	0.83430	2.090000	0.63153	0.436000	0.28706	GAG	ATP2B3	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_PMCA	ENSG00000067842		0.662	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B3	HGNC	protein_coding	OTTHUMT00000060957.1	19	0.00	0	G	NM_021949		152821798	152821798	+1	no_errors	ENST00000263519	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	1.000	C
ATXN3	4287	genome.wustl.edu	37	14	92563069	92563069	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr14:92563069C>G	ENST00000532032.1	-	2	147	c.138G>C	c.(136-138)atG>atC	p.M46I	ATXN3_ENST00000502250.1_Intron|ATXN3_ENST00000340660.6_Intron|ATXN3_ENST00000554491.1_5'UTR|ATXN3_ENST00000503767.1_Missense_Mutation_p.M46I|ATXN3_ENST00000545170.1_Missense_Mutation_p.M46I|ATXN3_ENST00000393287.5_Missense_Mutation_p.M46I|ATXN3_ENST00000429774.2_Missense_Mutation_p.M46I			P54252	ATX3_HUMAN	ataxin 3	46	Josephin. {ECO:0000255|PROSITE- ProRule:PRU00331}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|cellular response to misfolded protein (GO:0071218)|intermediate filament cytoskeleton organization (GO:0045104)|microtubule cytoskeleton organization (GO:0000226)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|monoubiquitinated protein deubiquitination (GO:0035520)|nervous system development (GO:0007399)|nucleotide-excision repair (GO:0006289)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell-substrate adhesion (GO:0010810)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|Lys48-specific deubiquitinase activity (GO:1990380)|Lys63-specific deubiquitinase activity (GO:0061578)|omega peptidase activity (GO:0008242)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	12		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		CTGCCATTCTCATCCTCTCCT	0.363																																					Esophageal Squamous(190;752 2094 29897 44875 49530)	dbGAP											0													196.0	155.0	169.0					14																	92563069		2203	4300	6503	-	-	-	SO:0001583	missense	0			U64820	CCDS9900.1, CCDS32143.1, CCDS45154.1, CCDS53908.1, CCDS73680.1	14q21	2014-09-17	2004-08-12	2004-08-13	ENSG00000066427	ENSG00000066427		"""Ataxins"""	7106	protein-coding gene	gene with protein product		607047	"""Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3)"""	SCA3, MJD		8358439	Standard	NM_004993		Approved	ATX3, JOS	uc001yac.4	P54252	OTTHUMG00000162212	ENST00000532032.1:c.138G>C	14.37:g.92563069C>G	ENSP00000437157:p.Met46Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A7LFZ5|D6RDL9|E9PB63|O15284|O15285|O15286|Q8N189|Q96TC3|Q96TC4|Q9H3N0	Missense_Mutation	SNP	pfam_Josephin,pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,pfscan_Josephin,pfscan_Ubiquitin-int_motif,prints_Josephin	p.M46I	ENST00000532032.1	37	c.138		14	.	.	.	.	.	.	.	.	.	.	C	14.28	2.488706	0.44249	.	.	ENSG00000066427	ENST00000545278;ENST00000539555;ENST00000537884;ENST00000545170;ENST00000447800;ENST00000359819;ENST00000393289;ENST00000429774;ENST00000539454;ENST00000393287;ENST00000503767;ENST00000532032;ENST00000554592;ENST00000553491;ENST00000506466	T;T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	5.77	4.89	0.63831	.	0.034656	0.85682	D	0.000000	T	0.26738	0.0654	N	0.16743	0.435	0.44129	D	0.996917	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.002;0.004;0.003	T	0.05468	-1.0883	10	0.27082	T	0.32	.	11.7546	0.51868	0.0:0.8593:0.0:0.1407	.	46;46;46	P54252;E9PB63;P54252-2	ATX3_HUMAN;.;.	I	46;46;46;46;46;46;46;46;45;46;46;46;46;46;46	ENSP00000445618:M46I;ENSP00000389376:M46I;ENSP00000376965:M46I;ENSP00000426697:M46I;ENSP00000437157:M46I;ENSP00000451385:M46I;ENSP00000451996:M46I;ENSP00000435571:M46I	ENSP00000352324:M46I	M	-	3	0	ATXN3	91632822	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	2.400000	0.44504	1.460000	0.47911	0.549000	0.68633	ATG	ATXN3	-	pfam_Josephin,pfscan_Josephin,prints_Josephin	ENSG00000066427		0.363	ATXN3-015	KNOWN	basic	protein_coding	ATXN3	HGNC	protein_coding	OTTHUMT00000388065.1	108	0.00	0	C	NM_004993		92563069	92563069	-1	no_errors	ENST00000545170	ensembl	human	known	69_37n	missense	98	23.44	30	SNP	1.000	G
B4GALNT2	124872	genome.wustl.edu	37	17	47219453	47219453	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr17:47219453A>G	ENST00000300404.2	+	3	511	c.452A>G	c.(451-453)aAc>aGc	p.N151S	B4GALNT2_ENST00000504681.1_Missense_Mutation_p.N65S|B4GALNT2_ENST00000393354.2_Missense_Mutation_p.N91S	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	151					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)			endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			GGAGGTTACAACTTTCAGGAT	0.502																																					GBM(124;244 1635 8663 18097 33175)	dbGAP											0													123.0	113.0	116.0					17																	47219453		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.452A>G	17.37:g.47219453A>G	ENSP00000300404:p.Asn151Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZE4|Q14CP1|Q86Y40	Missense_Mutation	SNP	pfam_Glyco_trans_2,pirsf_GM2_synthase	p.N151S	ENST00000300404.2	37	c.452	CCDS11544.1	17	.	.	.	.	.	.	.	.	.	.	A	5.062	0.197134	0.09599	.	.	ENSG00000167080	ENST00000504681;ENST00000393354;ENST00000300404	T;T;T	0.32272	1.46;1.46;1.46	5.7	1.98	0.26296	.	0.268241	0.29884	N	0.010957	T	0.14184	0.0343	L	0.27053	0.805	0.09310	N	1	B;B	0.32467	0.372;0.255	B;B	0.24394	0.053;0.053	T	0.21827	-1.0234	10	0.12430	T	0.62	-8.175	5.6916	0.17833	0.5502:0.154:0.0:0.2958	.	91;151	Q8NHY0-2;Q8NHY0	.;B4GN2_HUMAN	S	65;91;151	ENSP00000425510:N65S;ENSP00000377022:N91S;ENSP00000300404:N151S	ENSP00000300404:N151S	N	+	2	0	B4GALNT2	44574452	0.053000	0.20554	0.003000	0.11579	0.149000	0.21700	1.787000	0.38704	0.381000	0.24851	0.533000	0.62120	AAC	B4GALNT2	-	pirsf_GM2_synthase	ENSG00000167080		0.502	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	B4GALNT2	HGNC	protein_coding	OTTHUMT00000364477.1	34	0.00	0	A	NM_153446		47219453	47219453	+1	no_errors	ENST00000300404	ensembl	human	known	69_37n	missense	76	16.48	15	SNP	0.001	G
BEND6	221336	genome.wustl.edu	37	6	56857350	56857350	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr6:56857350C>T	ENST00000370746.3	+	3	564	c.295C>T	c.(295-297)Caa>Taa	p.Q99*	BEND6_ENST00000370748.3_Nonsense_Mutation_p.Q99*|BEND6_ENST00000370745.1_Nonsense_Mutation_p.Q99*|BEND6_ENST00000370750.2_Nonsense_Mutation_p.Q99*	NM_152731.2	NP_689944.2	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6	99					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		RNA polymerase II transcription corepressor activity (GO:0001106)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	17						GGTCATGCTTCAAGGTAAACT	0.358																																						dbGAP											0													138.0	141.0	140.0					6																	56857350		1817	4079	5896	-	-	-	SO:0001587	stop_gained	0			AK054724	CCDS43476.1	6p12.1	2012-11-22	2008-10-03	2008-10-03	ENSG00000151917	ENSG00000151917		"""BEN domain containing"""	20871	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 65"""	C6orf65			Standard	NM_152731		Approved	FLJ30162, bA203B9.1	uc010kab.3	Q5SZJ8	OTTHUMG00000014914	ENST00000370746.3:c.295C>T	6.37:g.56857350C>T	ENSP00000359782:p.Gln99*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0W8|Q8N662|Q96NS6	Nonsense_Mutation	SNP	pfam_BEN_domain	p.Q99*	ENST00000370746.3	37	c.295	CCDS43476.1	6	.	.	.	.	.	.	.	.	.	.	C	34	5.407697	0.96051	.	.	ENSG00000151917	ENST00000322055;ENST00000370750;ENST00000370748;ENST00000370746;ENST00000370745	.	.	.	5.13	5.13	0.70059	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.2042	16.1023	0.81184	0.0:1.0:0.0:0.0	.	.	.	.	X	99	.	ENSP00000322773:Q99X	Q	+	1	0	BEND6	56965309	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.421000	0.59848	2.559000	0.86315	0.561000	0.74099	CAA	BEND6	-	NULL	ENSG00000151917		0.358	BEND6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND6	HGNC	protein_coding	OTTHUMT00000041032.4	62	0.00	0	C	NM_152731		56857350	56857350	+1	no_errors	ENST00000370746	ensembl	human	known	69_37n	nonsense	76	32.14	36	SNP	1.000	T
BRAF	673	genome.wustl.edu	37	7	140482838	140482838	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr7:140482838C>T	ENST00000288602.6	-	10	1357	c.1297G>A	c.(1297-1299)Gaa>Aaa	p.E433K		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	433					activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TTCCTGTCTTCTGAGGATGAA	0.398		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	dbGAP		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	0													81.0	74.0	76.0					7																	140482838		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1297G>A	7.37:g.140482838C>T	ENSP00000288602:p.Glu433Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Raf-like_ras-bd,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,smart_Raf-like_ras-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Raf-like_ras-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_DAG/PE-bd	p.E433K	ENST00000288602.6	37	c.1297	CCDS5863.1	7	.	.	.	.	.	.	.	.	.	.	C	27.0	4.788120	0.90367	.	.	ENSG00000157764	ENST00000288602	T	0.74632	-0.86	5.83	5.83	0.93111	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.71434	0.3339	L	0.47716	1.5	0.80722	D	1	B	0.24882	0.113	B	0.22601	0.04	T	0.65878	-0.6061	10	0.42905	T	0.14	.	20.1047	0.97888	0.0:1.0:0.0:0.0	.	433	P15056	BRAF_HUMAN	K	433	ENSP00000288602:E433K	ENSP00000288602:E433K	E	-	1	0	BRAF	140129307	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.294000	0.78760	2.762000	0.94881	0.655000	0.94253	GAA	BRAF	-	superfamily_Kinase-like_dom	ENSG00000157764		0.398	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRAF	HGNC	protein_coding	OTTHUMT00000348886.1	55	0.00	0	C	NM_004333		140482838	140482838	-1	no_errors	ENST00000288602	ensembl	human	known	69_37n	missense	67	26.37	24	SNP	1.000	T
BTAF1	9044	genome.wustl.edu	37	10	93716365	93716365	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr10:93716365C>A	ENST00000265990.6	+	7	1090	c.782C>A	c.(781-783)tCc>tAc	p.S261Y		NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	261					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				GCAAATGATTCCAAAGTCTTG	0.338																																						dbGAP											0													82.0	77.0	79.0					10																	93716365		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.782C>A	10.37:g.93716365C>A	ENSP00000265990:p.Ser261Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0W6|O43578	Missense_Mutation	SNP	pfam_DUF3535,pfam_SNF2_N,pfam_HEAT,pfam_Helicase_C,superfamily_ARM-type_fold,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S261Y	ENST00000265990.6	37	c.782	CCDS7419.1	10	.	.	.	.	.	.	.	.	.	.	C	14.13	2.444337	0.43429	.	.	ENSG00000095564	ENST00000265990	D	0.90732	-2.72	5.76	5.76	0.90799	Armadillo-type fold (1);	0.518828	0.22927	N	0.053956	D	0.91533	0.7326	M	0.77103	2.36	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	D	0.87339	0.2330	10	0.66056	D	0.02	-7.2667	20.3242	0.98691	0.0:1.0:0.0:0.0	.	261	O14981	BTAF1_HUMAN	Y	261	ENSP00000265990:S261Y	ENSP00000265990:S261Y	S	+	2	0	BTAF1	93706345	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	1.732000	0.38146	2.882000	0.98803	0.655000	0.94253	TCC	BTAF1	-	superfamily_ARM-type_fold	ENSG00000095564		0.338	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTAF1	HGNC	protein_coding	OTTHUMT00000049380.4	72	0.00	0	C	NM_003972		93716365	93716365	+1	no_errors	ENST00000265990	ensembl	human	known	69_37n	missense	41	31.67	19	SNP	1.000	A
BTNL9	153579	genome.wustl.edu	37	5	180477125	180477125	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr5:180477125C>G	ENST00000327705.9	+	4	723	c.492C>G	c.(490-492)ttC>ttG	p.F164L	BTNL9_ENST00000376841.2_Missense_Mutation_p.F164L|BTNL9_ENST00000376842.3_Missense_Mutation_p.F164L|BTNL9_ENST00000515271.1_Missense_Mutation_p.F95L	NM_152547.4	NP_689760.2	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9	164						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(10)|ovary(1)	19	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTGAGGGCTTCAAGGAAGGAG	0.577																																						dbGAP											0													74.0	76.0	75.0					5																	180477125		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057097	CCDS4460.2	5q35.3	2014-01-14			ENSG00000165810	ENSG00000165810		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	24176	protein-coding gene	gene with protein product							Standard	NM_152547		Approved	FLJ32535, BTN8	uc003mmt.3	Q6UXG8	OTTHUMG00000133152	ENST00000327705.9:c.492C>G	5.37:g.180477125C>G	ENSP00000330200:p.Phe164Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL42|Q6P660|Q96DM5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like	p.F164L	ENST00000327705.9	37	c.492	CCDS4460.2	5	.	.	.	.	.	.	.	.	.	.	C	13.93	2.383413	0.42207	.	.	ENSG00000165810	ENST00000376841;ENST00000327705;ENST00000376842;ENST00000376850;ENST00000515271	T;T;T;T	0.04970	3.52;3.52;3.52;3.52	4.57	2.64	0.31445	.	0.000000	0.41097	D	0.000941	T	0.03915	0.0110	L	0.31157	0.91	0.24939	N	0.991868	P;B	0.43352	0.804;0.009	B;B	0.35899	0.213;0.007	T	0.42732	-0.9434	10	0.26408	T	0.33	.	7.2281	0.26026	0.1696:0.7347:0.0:0.0957	.	95;164	B7Z4Y8;Q6UXG8	.;BTNL9_HUMAN	L	164;164;164;164;95	ENSP00000366037:F164L;ENSP00000330200:F164L;ENSP00000366038:F164L;ENSP00000427345:F95L	ENSP00000330200:F164L	F	+	3	2	BTNL9	180409731	0.960000	0.32886	1.000000	0.80357	0.964000	0.63967	0.472000	0.22116	1.300000	0.44818	0.644000	0.83932	TTC	BTNL9	-	NULL	ENSG00000165810		0.577	BTNL9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BTNL9	HGNC	protein_coding	OTTHUMT00000157342.3	27	0.00	0	C	NM_152547		180477125	180477125	+1	no_errors	ENST00000376842	ensembl	human	known	69_37n	missense	65	15.58	12	SNP	0.987	G
C10orf71	118461	genome.wustl.edu	37	10	50533042	50533042	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr10:50533042G>C	ENST00000374144.3	+	3	2740	c.2452G>C	c.(2452-2454)Gag>Cag	p.E818Q	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	818										endometrium(1)	1						GGCATCAGCAGAGGAAGCTAA	0.502																																						dbGAP											0													137.0	140.0	139.0					10																	50533042		692	1591	2283	-	-	-	SO:0001583	missense	0			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.2452G>C	10.37:g.50533042G>C	ENSP00000363259:p.Glu818Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVL8	Missense_Mutation	SNP	NULL	p.E818Q	ENST00000374144.3	37	c.2452	CCDS44387.1	10	.	.	.	.	.	.	.	.	.	.	G	15.74	2.922218	0.52653	.	.	ENSG00000177354	ENST00000374144	T	0.05649	3.41	5.25	5.25	0.73442	.	0.000000	0.33457	U	0.004896	T	0.11922	0.0290	L	0.29908	0.895	0.80722	D	1	.	.	.	.	.	.	T	0.02603	-1.1135	8	0.62326	D	0.03	.	17.0325	0.86465	0.0:0.0:1.0:0.0	.	.	.	.	Q	818	ENSP00000363259:E818Q	ENSP00000363259:E818Q	E	+	1	0	C10orf71	50203048	0.979000	0.34478	0.805000	0.32314	0.105000	0.19272	1.761000	0.38440	2.471000	0.83476	0.467000	0.42956	GAG	C10orf71	-	NULL	ENSG00000177354		0.502	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf71	HGNC	protein_coding	OTTHUMT00000047984.2	48	0.00	0	G	NM_199459		50533042	50533042	+1	no_errors	ENST00000374144	ensembl	human	known	69_37n	missense	62	28.74	25	SNP	0.956	C
C12orf36	283422	genome.wustl.edu	37	12	13529258	13529258	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr12:13529258C>T	ENST00000318426.2	-	2	299	c.82G>A	c.(82-84)Gaa>Aaa	p.E28K	C12orf36_ENST00000527705.2_Missense_Mutation_p.E28K|C12orf36_ENST00000539026.1_Missense_Mutation_p.E28K|C12orf36_ENST00000531049.1_5'UTR|C12orf36_ENST00000532841.1_Missense_Mutation_p.E28K					chromosome 12 open reading frame 36											lung(3)|skin(3)	6				BRCA - Breast invasive adenocarcinoma(232;0.198)		gaagtgtcttcatcaggaaca	0.473																																						dbGAP											0													92.0	91.0	92.0					12																	13529258		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091129		12p13.1	2012-08-14			ENSG00000180861	ENSG00000180861			26598	protein-coding gene	gene with protein product							Standard	NR_036555		Approved	FLJ33810	uc001rbs.2	Q495D7	OTTHUMG00000167562	ENST00000318426.2:c.82G>A	12.37:g.13529258C>T	ENSP00000443007:p.Glu28Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E28K	ENST00000318426.2	37	c.82		12	.	.	.	.	.	.	.	.	.	.	C	6.807	0.518005	0.13005	.	.	ENSG00000180861	ENST00000318426;ENST00000527705;ENST00000539026;ENST00000532841	T;T;T;T	0.57752	1.58;1.58;0.48;0.38	2.58	0.211	0.15236	.	.	.	.	.	T	0.37865	0.1019	.	.	.	0.09310	N	1	B	0.23891	0.093	B	0.22386	0.039	T	0.35076	-0.9803	8	0.87932	D	0	.	4.2961	0.10902	0.0:0.5067:0.0:0.4933	.	28	Q495D7	CL036_HUMAN	K	28	ENSP00000443007:E28K;ENSP00000443346:E28K;ENSP00000445251:E28K;ENSP00000440159:E28K	ENSP00000443007:E28K	E	-	1	0	C12orf36	13420525	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	-0.208000	0.09371	0.035000	0.15519	0.462000	0.41574	GAA	C12orf36	-	NULL	ENSG00000180861		0.473	C12orf36-001	KNOWN	basic|appris_candidate_longest	protein_coding	C12orf36	HGNC	protein_coding	OTTHUMT00000395025.2	50	0.00	0	C	NM_182558		13529258	13529258	-1	no_errors	ENST00000318426	ensembl	human	known	69_37n	missense	87	25.00	29	SNP	0.002	T
C1orf159	54991	genome.wustl.edu	37	1	1018321	1018321	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:1018321G>A	ENST00000379339.1	-	12	1305	c.1095C>T	c.(1093-1095)gcC>gcT	p.A365A	C1orf159_ENST00000294576.5_Silent_p.A329A|C1orf159_ENST00000448924.1_Silent_p.A365A|C1orf159_ENST00000379319.1_Silent_p.A183A|C1orf159_ENST00000421241.2_Silent_p.A183A|C1orf159_ENST00000482816.1_5'Flank|C1orf159_ENST00000379320.1_Silent_p.A329A			Q96HA4	CA159_HUMAN	chromosome 1 open reading frame 159	365						integral component of membrane (GO:0016021)						all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.96e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.77e-22)|Colorectal(212;6.51e-05)|COAD - Colon adenocarcinoma(227;0.000214)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CGGGATCCGTGGCCCTGTCCA	0.687																																						dbGAP											0													29.0	29.0	29.0					1																	1018321		1327	2305	3632	-	-	-	SO:0001819	synonymous_variant	0			AK128434	CCDS7.2	1p36.33	2008-02-05			ENSG00000131591	ENSG00000131591			26062	protein-coding gene	gene with protein product						12975309	Standard	NM_017891		Approved	FLJ20584	uc001acu.2	Q96HA4	OTTHUMG00000000745	ENST00000379339.1:c.1095C>T	1.37:g.1018321G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ46|Q5T2W6|Q6UX67|Q6ZR77|Q9NWV0	Missense_Mutation	SNP	NULL	p.H216Y	ENST00000379339.1	37	c.646		1	.	.	.	.	.	.	.	.	.	.	G	8.353	0.831254	0.16820	.	.	ENSG00000131591	ENST00000434641	.	.	.	3.28	-1.34	0.09143	.	.	.	.	.	T	0.34337	0.0894	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39187	-0.9626	5	0.87932	D	0	-11.3298	2.8197	0.05468	0.3893:0.0:0.4082:0.2025	.	.	.	.	Y	216	.	ENSP00000390635:H216Y	H	-	1	0	C1orf159	1008184	0.000000	0.05858	0.000000	0.03702	0.175000	0.22909	0.166000	0.16583	-0.404000	0.07610	0.290000	0.19541	CAC	C1orf159	-	NULL	ENSG00000131591		0.687	C1orf159-002	KNOWN	basic|appris_candidate_longest	protein_coding	C1orf159	HGNC	protein_coding	OTTHUMT00000001851.2	16	0.00	0	G	NM_017891		1018321	1018321	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000434641	ensembl	human	putative	69_37n	missense	18	34.48	10	SNP	0.000	A
C3orf36	80111	genome.wustl.edu	37	3	133647532	133647532	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:133647532G>A	ENST00000408895.2	-	1	1124	c.116C>T	c.(115-117)tCa>tTa	p.S39L		NM_025041.2	NP_079317.2	Q3SXR2	CC036_HUMAN	chromosome 3 open reading frame 36	39										breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	6						TCCAGGCCCTGAGGGGGCAGA	0.612																																						dbGAP											0													44.0	46.0	45.0					3																	133647532		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025826	CCDS3083.1	3q22.1	2011-09-30			ENSG00000221972	ENSG00000221972			26170	protein-coding gene	gene with protein product						12477932	Standard	NM_025041		Approved	FLJ22173	uc003epz.1	Q3SXR2		ENST00000408895.2:c.116C>T	3.37:g.133647532G>A	ENSP00000386219:p.Ser39Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SXR3|Q9H6K8	Missense_Mutation	SNP	NULL	p.S39L	ENST00000408895.2	37	c.116	CCDS3083.1	3	.	.	.	.	.	.	.	.	.	.	G	9.674	1.147507	0.21288	.	.	ENSG00000221972	ENST00000408895	.	.	.	2.11	0.155	0.14906	.	.	.	.	.	T	0.13243	0.0321	N	0.08118	0	0.09310	N	1	P	0.40050	0.7	B	0.36845	0.234	T	0.13980	-1.0489	8	0.87932	D	0	.	4.1105	0.10057	0.4165:0.0:0.5835:0.0	.	39	Q3SXR2	CC036_HUMAN	L	39	.	ENSP00000386219:S39L	S	-	2	0	C3orf36	135130222	0.000000	0.05858	0.002000	0.10522	0.019000	0.09904	-0.283000	0.08433	0.025000	0.15241	0.313000	0.20887	TCA	C3orf36	-	NULL	ENSG00000221972		0.612	C3orf36-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf36	HGNC	protein_coding		13	0.00	0	G	NM_025041		133647532	133647532	-1	no_errors	ENST00000408895	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	0.002	A
CACNA1F	778	genome.wustl.edu	37	X	49065766	49065766	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chrX:49065766C>T	ENST00000376265.2	-	42	5003	c.4942G>A	c.(4942-4944)Gag>Aag	p.E1648K	CACNA1F_ENST00000376251.1_Missense_Mutation_p.E1583K|CACNA1F_ENST00000323022.5_Missense_Mutation_p.E1637K	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1648					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	tccactccctcctgcccctct	0.542																																						dbGAP											0													165.0	110.0	129.0					X																	49065766		2203	4299	6502	-	-	-	SO:0001583	missense	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.4942G>A	X.37:g.49065766C>T	ENSP00000365441:p.Glu1648Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.E1648K	ENST00000376265.2	37	c.4942	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	C	8.293	0.818159	0.16607	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265;ENST00000486943	D;D;D	0.96334	-3.98;-3.9;-3.9	4.43	-1.27	0.09347	.	1.965080	0.02645	N	0.105722	D	0.92612	0.7653	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.82356	-0.0498	10	0.20046	T	0.44	.	11.5925	0.50953	0.0:0.3451:0.5705:0.0844	.	1637;1648	F5CIQ9;O60840	.;CAC1F_HUMAN	K	1583;1637;1648;58	ENSP00000365427:E1583K;ENSP00000321618:E1637K;ENSP00000365441:E1648K	ENSP00000321618:E1637K	E	-	1	0	CACNA1F	48952710	0.006000	0.16342	0.000000	0.03702	0.930000	0.56654	1.427000	0.34881	-0.181000	0.10619	0.600000	0.82982	GAG	CACNA1F	-	NULL	ENSG00000102001		0.542	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	82	0.00	0	C	NM_005183		49065766	49065766	-1	no_errors	ENST00000376265	ensembl	human	known	69_37n	missense	94	30.88	42	SNP	0.000	T
CACNG5	27091	genome.wustl.edu	37	17	64880746	64880746	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr17:64880746G>T	ENST00000533854.1	+	5	775	c.538G>T	c.(538-540)Gcc>Tcc	p.A180S	CACNG5_ENST00000169565.3_Missense_Mutation_p.A180S|CACNG5_ENST00000307139.3_Missense_Mutation_p.A180S			Q9UF02	CCG5_HUMAN	calcium channel, voltage-dependent, gamma subunit 5	180					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ion transmembrane transporter activity (GO:0015075)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	24			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)			GTGGTCGTTTGCCTTCGCCGC	0.562																																						dbGAP											0													132.0	116.0	121.0					17																	64880746		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF148220	CCDS11665.1	17q24	2004-02-16				ENSG00000075429		"""Calcium channel subunits"""	1409	protein-coding gene	gene with protein product		606405				10613843	Standard	NM_145811		Approved		uc010wqj.2	Q9UF02		ENST00000533854.1:c.538G>T	17.37:g.64880746G>T	ENSP00000436836:p.Ala180Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2A6|Q547R3|Q8WXS7|Q9UHM3	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu,prints_VDCC_g5su	p.A180S	ENST00000533854.1	37	c.538	CCDS11665.1	17	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177427	0.57692	.	.	ENSG00000075429	ENST00000533854;ENST00000307139;ENST00000169565	D;D;D	0.89050	-2.46;-2.46;-2.46	3.86	2.87	0.33458	.	0.000000	0.85682	D	0.000000	D	0.92136	0.7507	M	0.67953	2.075	0.53005	D	0.999961	D	0.69078	0.997	D	0.80764	0.994	D	0.89824	0.3991	10	0.22706	T	0.39	-44.5442	12.6913	0.56976	0.0:0.0:0.8336:0.1664	.	180	Q9UF02	CCG5_HUMAN	S	180	ENSP00000436836:A180S;ENSP00000303092:A180S;ENSP00000169565:A180S	ENSP00000169565:A180S	A	+	1	0	CACNG5	62311208	1.000000	0.71417	0.888000	0.34837	0.979000	0.70002	9.053000	0.93860	1.195000	0.43115	0.609000	0.83330	GCC	CACNG5	-	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu	ENSG00000075429		0.562	CACNG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG5	HGNC	protein_coding	OTTHUMT00000389882.1	57	0.00	0	G	NM_014404, NM_145811		64880746	64880746	+1	no_errors	ENST00000169565	ensembl	human	known	69_37n	missense	42	37.31	25	SNP	1.000	T
CBX5	23468	genome.wustl.edu	37	12	54645846	54645846	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr12:54645846G>C	ENST00000439541.2	-	3	428	c.303C>G	c.(301-303)atC>atG	p.I101M	CBX5_ENST00000209875.4_Missense_Mutation_p.I101M|CBX5_ENST00000550411.1_Missense_Mutation_p.I101M	NM_001127321.1	NP_001120793.1	P45973	CBX5_HUMAN	chromobox homolog 5	101					blood coagulation (GO:0007596)|negative regulation of transcription, DNA-templated (GO:0045892)|viral process (GO:0016032)	chromocenter (GO:0010369)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear heterochromatin (GO:0005720)|nuclear pericentric heterochromatin (GO:0031618)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|protein binding, bridging (GO:0030674)|repressing transcription factor binding (GO:0070491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	8						TTTTAGATTTGATGTCATCGG	0.318																																					Colon(153;588 2459 18334 48613)	dbGAP											0													152.0	158.0	156.0					12																	54645846		2203	4300	6503	-	-	-	SO:0001583	missense	0			U26311	CCDS8875.1	12q13.13	2010-07-06	2010-06-24		ENSG00000094916	ENSG00000094916			1555	protein-coding gene	gene with protein product	"""HP1 alpha homolog (Drosophila)"""	604478	"""chromobox homolog 5 (Drosophila HP1 alpha)"", ""chromobox homolog 5 (HP1 alpha homolog, Drosophila)"""			8663349	Standard	NM_012117		Approved	HP1Hs-alpha, HP1, HP1-ALPHA	uc001sfj.4	P45973		ENST00000439541.2:c.303C>G	12.37:g.54645846G>C	ENSP00000401009:p.Ile101Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8T9	Missense_Mutation	SNP	pfam_Chromo_shadow_dom,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Chromo_shadow_dom,pfscan_Chromo_domain/shadow,prints_Chromo_dom_subgr	p.I101M	ENST00000439541.2	37	c.303	CCDS8875.1	12	.	.	.	.	.	.	.	.	.	.	G	12.53	1.966918	0.34659	.	.	ENSG00000094916	ENST00000209875;ENST00000439541;ENST00000550489;ENST00000550411	T;T;T	0.42131	0.98;0.98;0.98	5.22	4.32	0.51571	.	0.195714	0.39909	N	0.001226	T	0.24431	0.0592	N	0.14661	0.345	0.41525	D	0.988424	P;P	0.49447	0.924;0.518	B;B	0.41646	0.362;0.086	T	0.04347	-1.0958	10	0.48119	T	0.1	-4.2433	7.429	0.27115	0.1927:0.0:0.8073:0.0	.	101;101	G3V1X9;P45973	.;CBX5_HUMAN	M	101	ENSP00000209875:I101M;ENSP00000401009:I101M;ENSP00000449207:I101M	ENSP00000209875:I101M	I	-	3	3	CBX5	52932113	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.824000	0.27379	1.557000	0.49525	0.655000	0.94253	ATC	CBX5	-	NULL	ENSG00000094916		0.318	CBX5-004	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CBX5	HGNC	protein_coding	OTTHUMT00000405468.1	128	0.00	0	G	NM_012117		54645846	54645846	-1	no_errors	ENST00000209875	ensembl	human	known	69_37n	missense	133	18.90	31	SNP	1.000	C
CCDC154	645811	genome.wustl.edu	37	16	1493974	1493974	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr16:1493974G>A	ENST00000389176.3	-	2	213	c.47C>T	c.(46-48)tCc>tTc	p.S16F	LA16c-390E6.5_ENST00000566287.1_RNA|CCDC154_ENST00000409671.1_5'UTR	NM_001143980.1	NP_001137452.1	A6NI56	CC154_HUMAN	coiled-coil domain containing 154	16						endosome (GO:0005768)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)	5						TCTCAGCTGGGAAGGGGCCGA	0.672																																						dbGAP											0													33.0	40.0	38.0					16																	1493974		692	1590	2282	-	-	-	SO:0001583	missense	0					16p13.3	2012-12-13			ENSG00000197599	ENSG00000197599			34454	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 29"""	C16orf29			Standard	NM_001143980		Approved	LOC645811	uc010uve.2	A6NI56	OTTHUMG00000154097	ENST00000389176.3:c.47C>T	16.37:g.1493974G>A	ENSP00000373828:p.Ser16Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	G9JV18	Missense_Mutation	SNP	NULL	p.S16F	ENST00000389176.3	37	c.47		16	.	.	.	.	.	.	.	.	.	.	G	16.12	3.034062	0.54896	.	.	ENSG00000197599	ENST00000389176	.	.	.	2.94	2.94	0.34122	.	0.000000	0.34959	N	0.003555	T	0.44891	0.1315	L	0.29908	0.895	0.09310	N	1	D	0.69078	0.997	P	0.62184	0.899	T	0.15723	-1.0427	9	0.59425	D	0.04	-5.6019	9.5748	0.39450	0.0:0.0:1.0:0.0	.	16	A6NI56	CC154_HUMAN	F	16	.	ENSP00000373828:S16F	S	-	2	0	CCDC154	1433975	0.179000	0.23135	0.007000	0.13788	0.011000	0.07611	1.588000	0.36633	1.958000	0.56883	0.549000	0.68633	TCC	CCDC154	-	NULL	ENSG00000197599		0.672	CCDC154-201	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC154	HGNC	protein_coding		20	0.00	0	G	NM_001143980		1493974	1493974	-1	no_errors	ENST00000389176	ensembl	human	known	69_37n	missense	38	25.49	13	SNP	0.026	A
CCT3	7203	genome.wustl.edu	37	1	156305630	156305630	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:156305630G>A	ENST00000295688.3	-	2	361	c.81C>T	c.(79-81)atC>atT	p.I27I	TSACC_ENST00000470342.1_5'Flank|CCT3_ENST00000472765.2_5'UTR|CCT3_ENST00000368256.3_5'UTR|CCT3_ENST00000368261.3_5'UTR|TSACC_ENST00000368252.1_5'Flank|CCT3_ENST00000368259.2_Silent_p.I27I|TSACC_ENST00000368253.2_5'Flank|TSACC_ENST00000368254.1_5'Flank|TSACC_ENST00000466306.1_5'Flank|TSACC_ENST00000368255.3_5'Flank|TSACC_ENST00000481479.1_5'Flank	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	27					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					TGGCAGCATTGATGTTTCCAG	0.433																																						dbGAP											0													199.0	162.0	174.0					1																	156305630		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.81C>T	1.37:g.156305630G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NE14|Q5SZY1|Q9BR64	Silent	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_gamma	p.I27	ENST00000295688.3	37	c.81	CCDS1140.2	1																																																																																			CCT3	-	superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_gamma	ENSG00000163468		0.433	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT3	HGNC	protein_coding	OTTHUMT00000060602.3	88	0.00	0	G	NM_005998		156305630	156305630	-1	no_errors	ENST00000295688	ensembl	human	known	69_37n	silent	209	11.44	27	SNP	1.000	A
CDCA2	157313	genome.wustl.edu	37	8	25319576	25319576	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr8:25319576C>T	ENST00000330560.3	+	4	716	c.239C>T	c.(238-240)tCa>tTa	p.S80L	CDCA2_ENST00000380665.3_Missense_Mutation_p.S65L	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	80					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		ACAGGAAAGTCATCATCCTAC	0.423																																						dbGAP											0													87.0	87.0	87.0					8																	25319576		2203	4300	6503	-	-	-	SO:0001583	missense	0			BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.239C>T	8.37:g.25319576C>T	ENSP00000328228:p.Ser80Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	NULL	p.S80L	ENST00000330560.3	37	c.239	CCDS6049.1	8	.	.	.	.	.	.	.	.	.	.	C	19.86	3.905216	0.72868	.	.	ENSG00000184661	ENST00000330560;ENST00000380665	T;T	0.45668	0.89;0.89	5.45	5.45	0.79879	.	0.726703	0.11771	N	0.531113	T	0.56746	0.2006	M	0.76002	2.32	0.33203	D	0.552438	D;D;D	0.57257	0.979;0.979;0.979	P;P;P	0.50617	0.646;0.646;0.646	T	0.68311	-0.5442	10	0.87932	D	0	-1.992	14.7814	0.69769	0.0:1.0:0.0:0.0	.	80;65;80	B7Z5Q5;E9PEI0;Q69YH5	.;.;CDCA2_HUMAN	L	80;65	ENSP00000328228:S80L;ENSP00000370040:S65L	ENSP00000328228:S80L	S	+	2	0	CDCA2	25375493	0.078000	0.21339	0.798000	0.32154	0.351000	0.29236	1.458000	0.35223	2.546000	0.85860	0.491000	0.48974	TCA	CDCA2	-	NULL	ENSG00000184661		0.423	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA2	HGNC	protein_coding	OTTHUMT00000216891.3	57	0.00	0	C	NM_152562		25319576	25319576	+1	no_errors	ENST00000330560	ensembl	human	known	69_37n	missense	47	45.35	39	SNP	0.942	T
CDH1	999	genome.wustl.edu	37	16	68772218	68772218	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr16:68772218C>T	ENST00000261769.5	+	2	258	c.67C>T	c.(67-69)Cag>Tag	p.Q23*	CDH1_ENST00000422392.2_Nonsense_Mutation_p.Q23*	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	23					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.V17fs*1(3)|p.?(2)|p.W20fs*7(1)|p.Q23*(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TTGGCTCTGCCAGGAGCCGGA	0.677			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	7	Deletion - Frameshift(4)|Unknown(2)|Substitution - Nonsense(1)	breast(7)											14.0	17.0	16.0					16																	68772218		1763	3312	5075	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.67C>T	16.37:g.68772218C>T	ENSP00000261769:p.Gln23*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q23*	ENST00000261769.5	37	c.67	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175447	0.78564	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	4.76	1.47	0.22746	.	0.000000	0.34652	N	0.003783	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	13.0323	0.58848	0.0:0.551:0.449:0.0	.	.	.	.	X	23	.	ENSP00000261769:Q23X	Q	+	1	0	CDH1	67329719	0.998000	0.40836	0.961000	0.40146	0.242000	0.25591	0.719000	0.25881	0.574000	0.29417	0.563000	0.77884	CAG	CDH1	-	superfamily_Cadherin-like	ENSG00000039068		0.677	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	16	0.00	0	C	NM_004360		68772218	68772218	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	11	26.67	4	SNP	0.982	T
CDH24	64403	genome.wustl.edu	37	14	23521790	23521790	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr14:23521790C>T	ENST00000267383.5	-	7	1347	c.1255G>A	c.(1255-1257)Gag>Aag	p.E419K	CDH24_ENST00000397359.3_Missense_Mutation_p.E419K|CDH24_ENST00000554034.1_Missense_Mutation_p.E419K|CDH24_ENST00000487137.2_Missense_Mutation_p.E419K|CDH24_ENST00000485922.1_5'Flank			Q86UP0	CAD24_HUMAN	cadherin 24, type 2	419	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		AAGCAACGCTCCGGATCTGAG	0.612																																						dbGAP											0													78.0	72.0	74.0					14																	23521790		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137477	CCDS9585.1, CCDS9586.1	14q11.2	2010-08-20	2009-11-20		ENSG00000139880	ENSG00000139880		"""Cadherins / Major cadherins"""	14265	protein-coding gene	gene with protein product			"""cadherin-like 24"""			12734196	Standard	NM_022478		Approved	CDH11L	uc001wil.3	Q86UP0	OTTHUMG00000028715	ENST00000267383.5:c.1255G>A	14.37:g.23521790C>T	ENSP00000267383:p.Glu419Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS44|Q86UP1|Q9NT84	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E419K	ENST00000267383.5	37	c.1255	CCDS9585.1	14	.	.	.	.	.	.	.	.	.	.	C	29.7	5.027562	0.93518	.	.	ENSG00000139880	ENST00000397359;ENST00000487137;ENST00000554034;ENST00000267383	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	4.83	4.83	0.62350	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.47820	0.1466	N	0.04320	-0.23	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.91635	0.998;0.977;0.999	T	0.59904	-0.7366	10	0.48119	T	0.1	.	16.8388	0.85963	0.0:1.0:0.0:0.0	.	419;419;419	Q86UP0-2;Q96LQ7;Q86UP0	.;.;CAD24_HUMAN	K	419	ENSP00000380517:E419K;ENSP00000434821:E419K;ENSP00000452493:E419K;ENSP00000267383:E419K	ENSP00000267383:E419K	E	-	1	0	CDH24	22591630	1.000000	0.71417	0.346000	0.25655	0.795000	0.44927	4.473000	0.60196	2.501000	0.84356	0.561000	0.74099	GAG	CDH24	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000139880		0.612	CDH24-006	KNOWN	basic|CCDS	protein_coding	CDH24	HGNC	protein_coding	OTTHUMT00000257241.2	26	0.00	0	C	NM_022478		23521790	23521790	-1	no_errors	ENST00000267383	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	0.993	T
CDRT1	374286	genome.wustl.edu	37	17	15517307	15517307	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr17:15517307C>T	ENST00000395906.3	-	3	710	c.711G>A	c.(709-711)atG>atA	p.M237I	RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.M547I	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	237										endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		ACAGCCTATTCATTTCGGATA	0.488																																						dbGAP											0													45.0	90.0	75.0					17																	15517307		2107	4277	6384	-	-	-	SO:0001583	missense	0			U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.711G>A	17.37:g.15517307C>T	ENSP00000379242:p.Met237Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O43848|O95611	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.M237I	ENST00000395906.3	37	c.711	CCDS45619.1	17	.	.	.	.	.	.	.	.	.	.	C	10.10	1.257932	0.22965	.	.	ENSG00000251537	ENST00000261644;ENST00000395906	T	0.28069	1.63	4.82	2.64	0.31445	.	0.162307	0.30293	N	0.009956	T	0.18676	0.0448	L	0.36672	1.1	0.09310	N	0.999998	B;B	0.15473	0.013;0.012	B;B	0.10450	0.005;0.004	T	0.14420	-1.0473	10	0.16420	T	0.52	.	5.7458	0.18120	0.1901:0.7104:0.0:0.0995	.	237;561	O95170;Q59EB2	CDRT1_HUMAN;.	I	237	ENSP00000379242:M237I	ENSP00000261644:M237I	M	-	3	0	RP11-385D13.1	15458032	0.982000	0.34865	0.917000	0.36280	0.036000	0.12997	0.998000	0.29744	1.356000	0.45884	0.484000	0.47621	ATG	CDRT1	-	NULL	ENSG00000241322		0.488	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT1	HGNC	protein_coding	OTTHUMT00000448127.1	37	0.00	0	C	NM_006382		15517307	15517307	-1	no_errors	ENST00000395906	ensembl	human	known	69_37n	missense	37	42.19	27	SNP	0.143	T
CERS1	10715	genome.wustl.edu	37	19	18994959	18994959	+	Missense_Mutation	SNP	G	G	A	rs555889038		TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:18994959G>A	ENST00000427170.2	-	3	598	c.527C>T	c.(526-528)tCg>tTg	p.S176L	CERS1_ENST00000542296.2_Missense_Mutation_p.S78L|GDF1_ENST00000247005.6_5'UTR|CERS1_ENST00000429504.2_Missense_Mutation_p.S176L|AC005197.2_ENST00000597769.1_RNA	NM_001492.4|NM_021267.3	NP_001483.3|NP_067090.1	P27544	CERS1_HUMAN	ceramide synthase 1	176	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				cellular response to dithiothreitol (GO:0072721)|cellular response to drug (GO:0035690)|cellular response to mycotoxin (GO:0036146)|cellular response to UV-A (GO:0071492)|ceramide biosynthetic process (GO:0046513)|negative regulation of telomerase activity (GO:0051974)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	sphingosine N-acyltransferase activity (GO:0050291)			endometrium(3)|lung(2)	5						CATGACCACCGAGTCCTTGCG	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		17105	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													85.0	102.0	96.0					19																	18994959		2176	4280	6456	-	-	-	SO:0001583	missense	0			AF105005	CCDS46021.1	19p12	2011-07-08	2011-07-08	2011-07-08		ENSG00000223802			14253	protein-coding gene	gene with protein product		606919	"""longevity assurance (LAG1, S. cerevisiae) homolog 1"", ""LAG1 longevity assurance homolog 1 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 1"""	LASS1		9872981, 2034669	Standard	NM_198207		Approved	LAG1, UOG1	uc002nkj.3	P27544		ENST00000427170.2:c.527C>T	19.37:g.18994959G>A	ENSP00000402697:p.Ser176Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_TLC-dom,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom	p.S176L	ENST00000427170.2	37	c.527	CCDS46020.1	19	.	.	.	.	.	.	.	.	.	.	G	23.6	4.432424	0.83776	.	.	ENSG00000223802	ENST00000427170;ENST00000429504;ENST00000542296	D;D;D	0.84660	-1.88;-1.88;-1.88	4.44	4.44	0.53790	TRAM/LAG1/CLN8 homology domain (3);	.	.	.	.	D	0.91489	0.7313	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	D	0.92404	0.5932	9	0.59425	D	0.04	.	15.6276	0.76874	0.0:0.0:1.0:0.0	.	176	P27544	CERS1_HUMAN	L	176;176;78	ENSP00000402697:S176L;ENSP00000389044:S176L;ENSP00000437648:S78L	ENSP00000402697:S176L	S	-	2	0	CERS1	18855959	1.000000	0.71417	1.000000	0.80357	0.566000	0.35808	9.039000	0.93777	2.021000	0.59480	0.313000	0.20887	TCG	CERS1	-	pfam_TLC-dom,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom	ENSG00000223802		0.612	CERS1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CERS1	HGNC	protein_coding		38	0.00	0	G			18994959	18994959	-1	no_errors	ENST00000427170	ensembl	human	known	69_37n	missense	115	21.23	31	SNP	1.000	A
CHD4	1108	genome.wustl.edu	37	12	6680152	6680152	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr12:6680152C>T	ENST00000357008.2	-	39	5767	c.5604G>A	c.(5602-5604)gtG>gtA	p.V1868V	CHD4_ENST00000309577.6_Silent_p.V1896V|NOP2_ENST00000382421.3_5'Flank|CHD4_ENST00000544484.1_Silent_p.V1893V|CHD4_ENST00000544040.1_Silent_p.V1861V|NOP2_ENST00000542015.1_5'Flank|NOP2_ENST00000545200.1_5'Flank|NOP2_ENST00000540228.1_5'Flank|NOP2_ENST00000541778.1_5'Flank|NOP2_ENST00000545915.1_5'Flank|NOP2_ENST00000399466.2_5'Flank|NOP2_ENST00000322166.5_5'Flank	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1868	Required for interaction with PCNT.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						GGAGTCGAGTCACATCAGCTT	0.547																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													235.0	231.0	232.0					12																	6680152		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.5604G>A	12.37:g.6680152C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXZ5	Silent	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.V1896	ENST00000357008.2	37	c.5688	CCDS8552.1	12																																																																																			CHD4	-	pfam_CHD_C2	ENSG00000111642		0.547	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		72	0.00	0	C	NM_001273		6680152	6680152	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	silent	84	23.64	26	SNP	1.000	T
CLCN3	1182	genome.wustl.edu	37	4	170601266	170601266	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr4:170601266G>T	ENST00000513761.1	+	3	785	c.226G>T	c.(226-228)Gat>Tat	p.D76Y	CLCN3_ENST00000504131.2_Missense_Mutation_p.D59Y|CLCN3_ENST00000347613.4_Missense_Mutation_p.D76Y|CLCN3_ENST00000360642.3_Missense_Mutation_p.D76Y	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	76					chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)			breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		GGATCTTTTGGATGAACCAAT	0.368																																						dbGAP											0													131.0	124.0	127.0					4																	170601266		2203	4297	6500	-	-	-	SO:0001583	missense	0			X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.226G>T	4.37:g.170601266G>T	ENSP00000424603:p.Asp76Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-3	p.D76Y	ENST00000513761.1	37	c.226	CCDS34101.1	4	.	.	.	.	.	.	.	.	.	.	G	19.35	3.810126	0.70797	.	.	ENSG00000109572	ENST00000511092;ENST00000513761;ENST00000347613;ENST00000360642;ENST00000512813;ENST00000538301;ENST00000504131;ENST00000507875	D;D;D;D;D;D;D	0.92299	-3.01;-2.54;-2.55;-2.54;-2.54;-2.55;-2.41	4.75	4.75	0.60458	.	0.092535	0.64402	D	0.000001	D	0.92286	0.7553	L	0.52126	1.63	0.80722	D	1	B;P;B;B;P	0.40230	0.356;0.585;0.356;0.356;0.708	B;B;B;B;P	0.46585	0.258;0.344;0.344;0.258;0.521	D	0.93406	0.6764	10	0.87932	D	0	-10.4161	17.7381	0.88400	0.0:0.0:1.0:0.0	.	76;59;49;76;76	B7Z932;B9EGJ9;E9PE15;P51790;P51790-2	.;.;.;CLCN3_HUMAN;.	Y	76;76;76;76;76;76;59;49	ENSP00000425160:D76Y;ENSP00000424603:D76Y;ENSP00000261514:D76Y;ENSP00000353857:D76Y;ENSP00000425823:D76Y;ENSP00000424540:D59Y;ENSP00000425323:D49Y	ENSP00000261514:D76Y	D	+	1	0	CLCN3	170837841	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.480000	0.97931	2.189000	0.69895	0.462000	0.41574	GAT	CLCN3	-	NULL	ENSG00000109572		0.368	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CLCN3	HGNC	protein_coding	OTTHUMT00000363210.2	100	0.00	0	G			170601266	170601266	+1	no_errors	ENST00000347613	ensembl	human	known	69_37n	missense	125	20.89	33	SNP	1.000	T
CLN3	1201	genome.wustl.edu	37	16	28499967	28499967	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr16:28499967G>A	ENST00000569430.1	-	6	1058	c.239C>T	c.(238-240)aCg>aTg	p.T80M	CLN3_ENST00000535392.1_Intron|CLN3_ENST00000567963.1_Missense_Mutation_p.T80M|CLN3_ENST00000360019.2_Missense_Mutation_p.T80M|CLN3_ENST00000354630.5_Missense_Mutation_p.T80M|CLN3_ENST00000565316.1_Missense_Mutation_p.T80M|CLN3_ENST00000395653.4_Missense_Mutation_p.R7C|CLN3_ENST00000568224.1_Intron|CLN3_ENST00000357857.9_Missense_Mutation_p.T26M|CLN3_ENST00000333496.9_Intron|CLN3_ENST00000359984.7_Missense_Mutation_p.T80M|CLN3_ENST00000357076.5_Missense_Mutation_p.T80M|CLN3_ENST00000357806.7_Missense_Mutation_p.T80M|CLN3_ENST00000355477.5_Missense_Mutation_p.T80M			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	80					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						GGGGATCGGCGTTGGGCCTGG	0.587																																						dbGAP											0													222.0	186.0	198.0					16																	28499967		2197	4300	6497	-	-	-	SO:0001583	missense	0			U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.239C>T	16.37:g.28499967G>A	ENSP00000454229:p.Thr80Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Missense_Mutation	SNP	pfam_Battenin_disease_Cln3,superfamily_MFS_dom_general_subst_transpt,pirsf_Battenin_disease_Cln3_subgr,prints_Battenin_disease_Cln3	p.T80M	ENST00000569430.1	37	c.239	CCDS10632.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	16.20|16.20	3.055667|3.055667	0.55325|0.55325	.|.	.|.	ENSG00000188603|ENSG00000188603	ENST00000395653|ENST00000359984;ENST00000360019;ENST00000354630;ENST00000355477;ENST00000357857;ENST00000357806;ENST00000357076	D|D;D;D;D;D;D;D	0.96459|0.96232	-4.02|-3.95;-3.95;-3.95;-3.95;-3.95;-3.95;-3.95	5.39|5.39	1.21|1.21	0.21127|0.21127	.|Major facilitator superfamily domain, general substrate transporter (1);	.|1.434080	.|0.03738	.|N	.|0.254475	D|D	0.96629|0.96629	0.8900|0.8900	L|L	0.45581|0.45581	1.43|1.43	0.09310|0.09310	N|N	1|1	B;B|D;D;P;B;D;P;P;B	0.09022|0.64830	0.002;0.001|0.994;0.993;0.936;0.203;0.994;0.955;0.842;0.097	B;B|P;P;B;B;P;P;P;B	0.04013|0.61328	0.001;0.0|0.636;0.82;0.352;0.017;0.887;0.641;0.596;0.025	D|D	0.87966|0.87966	0.2733|0.2733	9|10	0.87932|0.49607	D|T	0|0.09	3.565|3.565	7.8097|7.8097	0.29223|0.29223	0.3276:0.0:0.6724:0.0|0.3276:0.0:0.6724:0.0	.|.	7;7|80;80;131;26;26;80;80;80	B4DFT5;B4DMY6|Q13286-3;Q13286-4;B4DIA8;O95093;O95086;Q13286-2;Q13286;O95089	.;.|.;.;.;.;.;.;CLN3_HUMAN;.	C|M	7|80;80;80;80;26;80;80	ENSP00000379014:R7C|ENSP00000353073:T80M;ENSP00000353116:T80M;ENSP00000346650:T80M;ENSP00000347660:T80M;ENSP00000350523:T26M;ENSP00000350457:T80M;ENSP00000349586:T80M	ENSP00000379014:R7C|ENSP00000346650:T80M	R|T	-|-	1|2	0|0	CLN3|CLN3	28407468|28407468	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.012000|0.012000	0.07955|0.07955	-0.086000|-0.086000	0.11233|0.11233	0.009000|0.009000	0.14813|0.14813	0.651000|0.651000	0.88453|0.88453	CGC|ACG	CLN3	-	pfam_Battenin_disease_Cln3,superfamily_MFS_dom_general_subst_transpt,pirsf_Battenin_disease_Cln3_subgr	ENSG00000188603		0.587	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLN3	HGNC	protein_coding	OTTHUMT00000214115.2	52	0.00	0	G			28499967	28499967	-1	no_errors	ENST00000359984	ensembl	human	known	69_37n	missense	108	22.86	32	SNP	0.000	A
CLEC18B	497190	genome.wustl.edu	37	16	74451961	74451961	+	Missense_Mutation	SNP	G	G	A	rs151079980	byFrequency	TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr16:74451961G>A	ENST00000339953.5	-	3	573	c.452C>T	c.(451-453)aCg>aTg	p.T151M		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	151	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.T151K(1)		endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						ACTCACCTGCGTGTAGTGGGT	0.592																																						dbGAP											1	Substitution - Missense(1)	lung(1)											9.0	10.0	9.0					16																	74451961		1775	3623	5398	-	-	-	SO:0001583	missense	0			AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.452C>T	16.37:g.74451961G>A	ENSP00000341051:p.Thr151Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF90	Missense_Mutation	SNP	pfam_CAP_domain,pfam_C-type_lectin,superfamily_CAP_domain,superfamily_C-type_lectin_fold,smart_Allrgn_V5/Tpx1,smart_EGF-like,smart_C-type_lectin,pfscan_EG-like_dom,pfscan_C-type_lectin,prints_Allrgn_V5/Tpx1	p.T151M	ENST00000339953.5	37	c.452	CCDS32484.1	16	91	0.041666666666666664	5	0.01016260162601626	17	0.04696132596685083	20	0.03496503496503497	49	0.06464379947229551	g	16.79	3.221692	0.58560	.	.	ENSG00000140839	ENST00000429489;ENST00000339953;ENST00000268492	T	0.16073	2.37	3.57	3.57	0.40892	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.09686	0.0238	H	0.95982	3.75	0.46113	D	0.998879	D;D	0.89917	0.999;1.0	D;D	0.66716	0.943;0.946	T	0.45920	-0.9228	10	0.66056	D	0.02	.	10.55	0.45083	0.0:0.0:1.0:0.0	.	151;151	C9JSV1;Q6UXF7	.;CL18B_HUMAN	M	151	ENSP00000341051:T151M	ENSP00000268492:T151M	T	-	2	0	CLEC18B	73009462	1.000000	0.71417	0.986000	0.45419	0.699000	0.40488	5.199000	0.65152	1.821000	0.53095	0.531000	0.56144	ACG	CLEC18B	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	ENSG00000140839		0.592	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC18B	HGNC	protein_coding	OTTHUMT00000434697.1	26	0.00	0	G	NM_001011880		74451961	74451961	-1	no_errors	ENST00000339953	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	0.991	A
CLTC	1213	genome.wustl.edu	37	17	57724970	57724970	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr17:57724970C>G	ENST00000269122.3	+	3	736	c.462C>G	c.(460-462)atC>atG	p.I154M	CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Missense_Mutation_p.I154M	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	154	Globular terminal domain.|WD40-like repeat 4.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GCCAGATTATCAATTACCGTA	0.383			T	"""ALK, TFE3"""	"""ALCL, renal """																																	dbGAP		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	0													136.0	129.0	132.0					17																	57724970		2203	4300	6503	-	-	-	SO:0001583	missense	0			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.462C>G	17.37:g.57724970C>G	ENSP00000269122:p.Ile154Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.I154M	ENST00000269122.3	37	c.462	CCDS32696.1	17	.	.	.	.	.	.	.	.	.	.	C	11.81	1.749876	0.30955	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.30981	1.51;1.51	5.79	3.82	0.43975	Clathrin, heavy chain, propeller, N-terminal (1);Clathrin, heavy chain, linker/propeller domain (1);	0.047640	0.85682	D	0.000000	T	0.59376	0.2189	M	0.90252	3.1	0.80722	D	1	D;D	0.76494	0.99;0.999	D;D	0.83275	0.993;0.996	T	0.64045	-0.6499	10	0.87932	D	0	.	9.6514	0.39899	0.0:0.7897:0.0:0.2103	.	154;154	Q00610;Q00610-2	CLH1_HUMAN;.	M	154	ENSP00000269122:I154M;ENSP00000376763:I154M	ENSP00000269122:I154M	I	+	3	3	CLTC	55079752	1.000000	0.71417	1.000000	0.80357	0.116000	0.19942	3.337000	0.52120	0.806000	0.34183	-0.150000	0.13652	ATC	CLTC	-	pfam_Clathrin_H-chain_propeller_rpt,superfamily_Clathrin_H-chain_propeller_N,pirsf_Clathrin_heavy_chain	ENSG00000141367		0.383	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLTC	HGNC	protein_coding	OTTHUMT00000258859.1	83	0.00	0	C	NM_004859		57724970	57724970	+1	no_errors	ENST00000269122	ensembl	human	known	69_37n	missense	121	39.80	80	SNP	1.000	G
COG6	57511	genome.wustl.edu	37	13	40251714	40251714	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr13:40251714G>A	ENST00000455146.3	+	5	588	c.538G>A	c.(538-540)Gag>Aag	p.E180K	COG6_ENST00000416691.1_Missense_Mutation_p.E180K	NM_020751.2	NP_065802.1	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6	180					glycosylation (GO:0070085)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				NS(1)|kidney(2)|large_intestine(5)|lung(4)|skin(1)	13		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		ACCCATTACTGAGGTATCCTG	0.353																																						dbGAP											0													69.0	64.0	66.0					13																	40251714		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026638	CCDS9370.1, CCDS45042.1	13q13.2	2011-08-01			ENSG00000133103	ENSG00000133103		"""Components of oligomeric golgi complex"""	18621	protein-coding gene	gene with protein product		606977				11980916	Standard	NM_020751		Approved	COD2, KIAA1134	uc001uxh.2	Q9Y2V7	OTTHUMG00000016768	ENST00000455146.3:c.538G>A	13.37:g.40251714G>A	ENSP00000397441:p.Glu180Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T0U1|Q6AI19|Q86V49|Q9ULT5	Missense_Mutation	SNP	pfam_COG_su6	p.E180K	ENST00000455146.3	37	c.538	CCDS9370.1	13	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075570	0.76415	.	.	ENSG00000133103	ENST00000416691;ENST00000255468;ENST00000422759;ENST00000455146	T;T;T	0.58358	0.34;0.34;0.34	5.78	4.04	0.47022	.	0.000000	0.85682	D	0.000000	T	0.70141	0.3190	M	0.81942	2.565	0.80722	D	1	D;D	0.76494	0.999;0.99	D;P	0.72982	0.979;0.903	T	0.69401	-0.5155	10	0.40728	T	0.16	-1.2749	10.7759	0.46350	0.0708:0.1316:0.7977:0.0	.	201;180	Q5T0U2;Q9Y2V7	.;COG6_HUMAN	K	180;211;180;180	ENSP00000403733:E180K;ENSP00000412877:E180K;ENSP00000397441:E180K	ENSP00000255468:E211K	E	+	1	0	COG6	39149714	1.000000	0.71417	0.935000	0.37517	0.608000	0.37181	8.570000	0.90748	0.773000	0.33404	0.585000	0.79938	GAG	COG6	-	pfam_COG_su6	ENSG00000133103		0.353	COG6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COG6	HGNC	protein_coding	OTTHUMT00000044622.3	37	0.00	0	G			40251714	40251714	+1	no_errors	ENST00000455146	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.996	A
CPA1	1357	genome.wustl.edu	37	7	130023264	130023264	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr7:130023264C>G	ENST00000011292.3	+	5	666	c.516C>G	c.(514-516)atC>atG	p.I172M	CPA1_ENST00000484324.1_Missense_Mutation_p.I84M	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	172					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					GTCCAGCCATCTGGATCGACA	0.612																																						dbGAP											0													50.0	54.0	53.0					7																	130023264		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.516C>G	7.37:g.130023264C>G	ENSP00000011292:p.Ile172Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.I172M	ENST00000011292.3	37	c.516	CCDS5820.1	7	.	.	.	.	.	.	.	.	.	.	C	15.72	2.917906	0.52546	.	.	ENSG00000091704	ENST00000481342;ENST00000011292;ENST00000476062;ENST00000484324	T;T;T;T	0.14516	2.5;2.5;2.5;2.5	5.58	5.58	0.84498	Peptidase M14, carboxypeptidase A (4);	0.194350	0.53938	D	0.000047	T	0.43722	0.1260	M	0.88105	2.93	0.58432	D	0.999999	P;B	0.34684	0.463;0.109	P;P	0.56088	0.791;0.505	T	0.37798	-0.9690	10	0.72032	D	0.01	.	13.8945	0.63764	0.0:0.9246:0.0:0.0754	.	84;172	B4DDW9;P15085	.;CBPA1_HUMAN	M	84;172;84;84	ENSP00000420218:I84M;ENSP00000011292:I172M;ENSP00000419408:I84M;ENSP00000419497:I84M	ENSP00000011292:I172M	I	+	3	3	CPA1	129810500	1.000000	0.71417	1.000000	0.80357	0.215000	0.24574	1.954000	0.40362	2.641000	0.89580	0.650000	0.86243	ATC	CPA1	-	pfam_Peptidase_M14,smart_Peptidase_M14,prints_Peptidase_M14	ENSG00000091704		0.612	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA1	HGNC	protein_coding	OTTHUMT00000349736.2	29	0.00	0	C	NM_001868		130023264	130023264	+1	no_errors	ENST00000011292	ensembl	human	known	69_37n	missense	34	20.93	9	SNP	1.000	G
DCAF8	50717	genome.wustl.edu	37	1	160195422	160195422	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:160195422C>G	ENST00000368073.3	-	8	1536	c.1102G>C	c.(1102-1104)Gag>Cag	p.E368Q	DCAF8_ENST00000326837.2_Missense_Mutation_p.E368Q|DCAF8_ENST00000608310.1_Missense_Mutation_p.E522Q|DCAF8_ENST00000556710.1_Missense_Mutation_p.E522Q|DCAF8_ENST00000368074.1_Missense_Mutation_p.E368Q			Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	368					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(16)|skin(3)|upper_aerodigestive_tract(1)	33						CCATTGTTCTCATTCTCATCA	0.428																																						dbGAP											0													127.0	114.0	118.0					1																	160195422		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093176	CCDS1200.1	1q22-q23	2013-01-09	2009-07-17	2009-07-17	ENSG00000132716	ENSG00000132716		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24891	protein-coding gene	gene with protein product		615820	"""WD repeat domain 42A"""	WDR42A		11401431	Standard	NM_015726		Approved	H326, FLJ35857	uc010pjb.1	Q5TAQ9	OTTHUMG00000031604	ENST00000368073.3:c.1102G>C	1.37:g.160195422C>G	ENSP00000357052:p.Glu368Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVE6|Q12839|Q4QQI6|Q53F14|Q66K50|Q68CS7|Q96E00	Missense_Mutation	SNP	pfam_Pex19,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E522Q	ENST00000368073.3	37	c.1564	CCDS1200.1	1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.166271	0.57476	.	.	ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000258465	ENST00000368073;ENST00000326837;ENST00000368074;ENST00000555195;ENST00000540855;ENST00000556710	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.16;-0.16	5.18	5.18	0.71444	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.147412	0.44097	U	0.000484	T	0.50497	0.1619	L	0.59436	1.845	0.42704	D	0.993629	B;B	0.34015	0.435;0.027	B;B	0.31751	0.135;0.031	T	0.51880	-0.8649	10	0.21540	T	0.41	-12.8887	17.6136	0.88061	0.0:1.0:0.0:0.0	.	522;368	G3V3G9;Q5TAQ9	.;DCAF8_HUMAN	Q	368;368;368;522;349;522	ENSP00000357052:E368Q;ENSP00000318227:E368Q;ENSP00000357053:E368Q;ENSP00000451989:E522Q;ENSP00000451235:E522Q	ENSP00000318227:E368Q	E	-	1	0	RP11-574F21.3;DCAF8	158462046	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.801000	0.75170	2.701000	0.92244	0.655000	0.94253	GAG	DCAF8	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000132716		0.428	DCAF8-001	KNOWN	basic|CCDS	protein_coding	DCAF8	HGNC	protein_coding	OTTHUMT00000077402.2	64	0.00	0	C	NM_015726		160195422	160195422	-1	no_errors	ENST00000555195	ensembl	human	known	69_37n	missense	145	13.69	23	SNP	1.000	G
DCAF6	55827	genome.wustl.edu	37	1	168034845	168034845	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:168034845C>T	ENST00000312263.6	+	16	2388	c.2184C>T	c.(2182-2184)ttC>ttT	p.F728F	DCAF6_ENST00000367840.3_Silent_p.F819F|DCAF6_ENST00000367843.3_Silent_p.F748F|DCAF6_ENST00000432587.2_Silent_p.F788F	NM_001017977.2	NP_001017977.1	Q58WW2	DCAF6_HUMAN	DDB1 and CUL4 associated factor 6	728					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	36						AAGCCAATTTCTGGGGTGCTA	0.328																																						dbGAP											0													47.0	48.0	47.0					1																	168034845		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136738	CCDS1267.2, CCDS30933.1, CCDS55657.1, CCDS55658.1	1q23.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000143164	ENSG00000143164		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30002	protein-coding gene	gene with protein product		610494	"""IQ motif and WD repeats 1"""	IQWD1		12032826	Standard	NM_018442		Approved	PC326	uc001gex.3	Q58WW2	OTTHUMG00000034572	ENST00000312263.6:c.2184C>T	1.37:g.168034845C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A295|B4DNB8|Q7L8I0|Q8IXH3|Q8TB19	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_IQ_motif_EF-hand-BS,pfscan_WD40_repeat_dom	p.F819	ENST00000312263.6	37	c.2457	CCDS30933.1	1																																																																																			DCAF6	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000143164		0.328	DCAF6-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCAF6	HGNC	protein_coding	OTTHUMT00000083661.2	65	0.00	0	C	NM_018442		168034845	168034845	+1	no_errors	ENST00000367840	ensembl	human	known	69_37n	silent	141	19.89	35	SNP	1.000	T
DDX3X	1654	genome.wustl.edu	37	X	41205487	41205487	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chrX:41205487G>C	ENST00000399959.2	+	13	2176	c.1321G>C	c.(1321-1323)Gat>Cat	p.D441H	DDX3X_ENST00000441189.2_Intron|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000542215.1_3'UTR|DDX3X_ENST00000457138.2_Missense_Mutation_p.D425H|DDX3X_ENST00000478993.1_3'UTR	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	441	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with GSK3B.|Necessary for interaction with XPO1.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						GACAGGCAAGGATTCACTGAC	0.378										HNSCC(61;0.18)																												dbGAP											0													110.0	107.0	108.0					X																	41205487		2185	4294	6479	-	-	-	SO:0001583	missense	0			U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1321G>C	X.37:g.41205487G>C	ENSP00000382840:p.Asp441His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K538|B4E3E8|O15536	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.D441H	ENST00000399959.2	37	c.1321	CCDS43931.1	X	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224834	0.79576	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	T;T	0.04917	3.53;3.53	5.41	5.41	0.78517	Helicase, C-terminal (1);	0.043044	0.85682	D	0.000000	T	0.11153	0.0272	L	0.42686	1.345	0.80722	D	1	B;D;D	0.63046	0.071;0.992;0.992	B;P;P	0.46389	0.009;0.515;0.515	T	0.01259	-1.1403	10	0.72032	D	0.01	-16.0775	18.3066	0.90184	0.0:0.0:1.0:0.0	.	425;453;441	B4E3E8;Q59GX6;O00571	.;.;DDX3X_HUMAN	H	441;425	ENSP00000382840:D441H;ENSP00000392494:D425H	ENSP00000382840:D441H	D	+	1	0	DDX3X	41090431	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	7.960000	0.87893	2.262000	0.75019	0.600000	0.82982	GAT	DDX3X	-	pfscan_Helicase_C	ENSG00000215301		0.378	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3X	HGNC	protein_coding	OTTHUMT00000056253.1	74	0.00	0	G	NM_024005		41205487	41205487	+1	no_errors	ENST00000399959	ensembl	human	known	69_37n	missense	75	16.67	15	SNP	1.000	C
DHPS	1725	genome.wustl.edu	37	19	12792434	12792434	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:12792434G>A	ENST00000210060.7	-	1	282	c.147C>T	c.(145-147)ttC>ttT	p.F49F	DHPS_ENST00000599481.1_5'Flank|DHPS_ENST00000351660.5_Silent_p.F49F|DHPS_ENST00000594424.1_5'Flank|CTD-2192J16.26_ENST00000593554.1_lincRNA	NM_001930.3	NP_001921.1	P49366	DHYS_HUMAN	deoxyhypusine synthase	49					cellular protein metabolic process (GO:0044267)|deoxyhypusine biosynthetic process from spermidine (GO:0050983)|glucose homeostasis (GO:0042593)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell proliferation (GO:0042102)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|translation (GO:0006412)	cytosol (GO:0005829)	deoxyhypusine synthase activity (GO:0034038)			central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)	8						CGGTGGTGCCGAAGGCCTCCA	0.632																																						dbGAP											0													59.0	60.0	60.0					19																	12792434		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U79262	CCDS12276.1, CCDS12277.1, CCDS59354.1	19p13.2	2011-11-24			ENSG00000095059	ENSG00000095059			2869	protein-coding gene	gene with protein product	"""migration-inducing gene 13"""	600944				7673224	Standard	NM_001930		Approved	MIG13	uc002muh.2	P49366		ENST00000210060.7:c.147C>T	19.37:g.12792434G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K688|M0R1I5|Q13184|Q13276|Q9UDG0	Silent	SNP	pfam_Deoxyhypusine_synthase,tigrfam_Deoxyhypusine_synthase	p.F49	ENST00000210060.7	37	c.147	CCDS12276.1	19																																																																																			DHPS	-	pfam_Deoxyhypusine_synthase,tigrfam_Deoxyhypusine_synthase	ENSG00000095059		0.632	DHPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHPS	HGNC	protein_coding	OTTHUMT00000462708.1	36	0.00	0	G	NM_001930		12792434	12792434	-1	no_errors	ENST00000210060	ensembl	human	known	69_37n	silent	55	33.73	28	SNP	0.838	A
DIEXF	27042	genome.wustl.edu	37	1	210010373	210010373	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:210010373C>G	ENST00000491415.2	+	6	936	c.879C>G	c.(877-879)ttC>ttG	p.F293L		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	293					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						GGGACCTGTTCTACCCGGAAA	0.493																																						dbGAP											0													75.0	78.0	77.0					1																	210010373		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.879C>G	1.37:g.210010373C>G	ENSP00000419005:p.Phe293Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O75992|Q4VY00|Q63HL9	Missense_Mutation	SNP	pfam_Digest_organ_expansion_fac-prd	p.F293L	ENST00000491415.2	37	c.879	CCDS1493.1	1	.	.	.	.	.	.	.	.	.	.	C	12.34	1.909293	0.33721	.	.	ENSG00000117597	ENST00000491415	T	0.37058	1.22	5.81	1.76	0.24704	.	0.190233	0.64402	D	0.000020	T	0.14960	0.0361	N	0.17312	0.475	0.45690	D	0.9986	B	0.11235	0.004	B	0.09377	0.004	T	0.16217	-1.0410	10	0.02654	T	1	-23.3802	5.5959	0.17327	0.118:0.6335:0.1146:0.1339	.	293	Q68CQ4	DIEXF_HUMAN	L	293	ENSP00000419005:F293L	ENSP00000419005:F293L	F	+	3	2	DIEXF	208076996	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	0.979000	0.29500	1.454000	0.47793	0.655000	0.94253	TTC	DIEXF	-	NULL	ENSG00000117597		0.493	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIEXF	HGNC	protein_coding	OTTHUMT00000089127.2	53	0.00	0	C	NM_014388		210010373	210010373	+1	no_errors	ENST00000491415	ensembl	human	known	69_37n	missense	116	22.15	33	SNP	1.000	G
DIS3L	115752	genome.wustl.edu	37	15	66621447	66621447	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr15:66621447G>A	ENST00000319212.4	+	13	2391	c.2341G>A	c.(2341-2343)Gag>Aag	p.E781K	DIS3L_ENST00000319194.5_Missense_Mutation_p.E698K|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	781					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TGCGGAGGAGGAGTTCCATCA	0.463																																						dbGAP											0													72.0	71.0	71.0					15																	66621447		2201	4299	6500	-	-	-	SO:0001583	missense	0				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.2341G>A	15.37:g.66621447G>A	ENSP00000321711:p.Glu781Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.E781K	ENST00000319212.4	37	c.2341	CCDS45286.1	15	.	.	.	.	.	.	.	.	.	.	G	15.11	2.736921	0.49045	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	T;T	0.41758	0.99;0.99	5.76	5.76	0.90799	Ribonuclease II/R (2);	0.279389	0.42053	D	0.000762	T	0.45617	0.1351	L	0.49256	1.55	0.80722	D	1	B	0.28178	0.202	B	0.36989	0.238	T	0.35525	-0.9785	10	0.45353	T	0.12	-2.9354	16.0558	0.80805	0.0:0.1339:0.8661:0.0	.	781	Q8TF46	DI3L1_HUMAN	K	698;781	ENSP00000321583:E698K;ENSP00000321711:E781K	ENSP00000321583:E698K	E	+	1	0	DIS3L	64408501	1.000000	0.71417	0.965000	0.40720	0.237000	0.25408	5.473000	0.66774	2.715000	0.92844	0.563000	0.77884	GAG	DIS3L	-	pfam_RNase_II/R,smart_RNase_II/R	ENSG00000166938		0.463	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIS3L	HGNC	protein_coding	OTTHUMT00000382792.2	54	0.00	0	G	NM_133375		66621447	66621447	+1	no_errors	ENST00000319212	ensembl	human	known	69_37n	missense	83	19.42	20	SNP	0.994	A
DMGDH	29958	genome.wustl.edu	37	5	78324375	78324375	+	Missense_Mutation	SNP	C	C	T	rs149499124	byFrequency	TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr5:78324375C>T	ENST00000255189.3	-	12	1941	c.1913G>A	c.(1912-1914)aGa>aAa	p.R638K	DMGDH_ENST00000380311.4_Missense_Mutation_p.R437K|DMGDH_ENST00000540686.1_Missense_Mutation_p.R258K	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	638					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		AAGGACCTTTCTTGCCTGTGG	0.403																																						dbGAP											0													199.0	203.0	201.0					5																	78324375		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.1913G>A	5.37:g.78324375C>T	ENSP00000255189:p.Arg638Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBN0|B4E1J9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_SoxG	p.R638K	ENST00000255189.3	37	c.1913	CCDS4044.1	5	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811465	0.90707	.	.	ENSG00000132837	ENST00000255189;ENST00000523732;ENST00000380311;ENST00000540686;ENST00000539598	T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12	5.92	5.92	0.95590	Glycine cleavage T-protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91449	0.7301	M	0.92604	3.325	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;0.994;0.995	D;D;D;D	0.79784	0.993;0.987;0.945;0.955	D	0.92399	0.5928	10	0.72032	D	0.01	.	20.3206	0.98668	0.0:1.0:0.0:0.0	.	258;437;488;638	B4E1J9;F8W6P8;F5H1C7;Q9UI17	.;.;.;M2GD_HUMAN	K	638;477;437;258;488	ENSP00000255189:R638K;ENSP00000430972:R477K;ENSP00000369667:R437K;ENSP00000439478:R258K	ENSP00000255189:R638K	R	-	2	0	DMGDH	78360131	1.000000	0.71417	0.997000	0.53966	0.661000	0.39034	5.692000	0.68256	2.809000	0.96659	0.655000	0.94253	AGA	DMGDH	-	pfam_GCV_T_N,pfam_SoxG	ENSG00000132837		0.403	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMGDH	HGNC	protein_coding	OTTHUMT00000226963.3	72	0.00	0	C	NM_013391		78324375	78324375	-1	no_errors	ENST00000255189	ensembl	human	known	69_37n	missense	121	15.38	22	SNP	1.000	T
DNAH14	127602	genome.wustl.edu	37	1	225533762	225533762	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:225533762G>A	ENST00000445597.2	+	48	8089	c.8089G>A	c.(8089-8091)Gaa>Aaa	p.E2697K	DNAH14_ENST00000439375.2_Missense_Mutation_p.E3500K|DNAH14_ENST00000430092.1_Missense_Mutation_p.E3500K			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2697					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AAAAAAAGCTGAAAGTGAAAT	0.388																																						dbGAP											0													126.0	95.0	104.0					1																	225533762		692	1591	2283	-	-	-	SO:0001583	missense	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.8089G>A	1.37:g.225533762G>A	ENSP00000409472:p.Glu2697Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Tautomerase,smart_AAA+_ATPase	p.E3500K	ENST00000445597.2	37	c.10498		1	.	.	.	.	.	.	.	.	.	.	G	18.75	3.690015	0.68271	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.54071	0.59;0.59;0.59	5.34	2.45	0.29901	.	.	.	.	.	T	0.66426	0.2788	.	.	.	0.41050	D	0.985292	D	0.69078	0.997	D	0.64506	0.926	T	0.65298	-0.6202	8	0.56958	D	0.05	.	9.4541	0.38745	0.236:0.0:0.764:0.0	.	3500	Q0VDD8-4	.	K	2697;3500;3500	ENSP00000409472:E2697K;ENSP00000414402:E3500K;ENSP00000392061:E3500K	ENSP00000414402:E3500K	E	+	1	0	DNAH14	223600385	0.998000	0.40836	0.002000	0.10522	0.942000	0.58702	2.570000	0.45981	0.237000	0.21200	0.508000	0.49915	GAA	DNAH14	-	NULL	ENSG00000185842		0.388	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	46	0.00	0	G	XM_059166		225533762	225533762	+1	no_errors	ENST00000430092	ensembl	human	known	69_37n	missense	103	19.53	25	SNP	0.202	A
DOCK10	55619	genome.wustl.edu	37	2	225659734	225659734	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:225659734C>T	ENST00000258390.7	-	45	5083	c.5016G>A	c.(5014-5016)aaG>aaA	p.K1672K	DOCK10_ENST00000409592.3_Silent_p.K1666K	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1672					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TCTCGTGCTCCTTCATCTGAG	0.527																																						dbGAP											0													149.0	153.0	151.0					2																	225659734		2057	4220	6277	-	-	-	SO:0001819	synonymous_variant	0			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.5016G>A	2.37:g.225659734C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	NULL	p.G398R	ENST00000258390.7	37	c.1192	CCDS46528.1	2																																																																																			DOCK10	-	NULL	ENSG00000135905		0.527	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1	72	0.00	0	C			225659734	225659734	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000409802	ensembl	human	known	69_37n	missense	110	31.68	51	SNP	1.000	T
DOCK11	139818	genome.wustl.edu	37	X	117739287	117739287	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chrX:117739287C>T	ENST00000276202.7	+	24	2712	c.2649C>T	c.(2647-2649)acC>acT	p.T883T	DOCK11_ENST00000276204.6_Silent_p.T883T	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	883					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						CAAATATGACCCATGAAGATG	0.348																																						dbGAP											0													146.0	128.0	134.0					X																	117739287		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.2649C>T	X.37:g.117739287C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Silent	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.T883	ENST00000276202.7	37	c.2649	CCDS35373.1	X																																																																																			DOCK11	-	NULL	ENSG00000147251		0.348	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	76	0.00	0	C	NM_144658		117739287	117739287	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	silent	56	34.12	29	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56362779	56362779	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr6:56362779C>G	ENST00000361203.3	-	76	19016	c.19009G>C	c.(19009-19011)Gaa>Caa	p.E6337Q	DST_ENST00000370769.4_Missense_Mutation_p.E6448Q|DST_ENST00000244364.6_Missense_Mutation_p.E4034Q|DST_ENST00000340834.4_5'UTR|DST_ENST00000312431.6_3'UTR|DST_ENST00000421834.2_Missense_Mutation_p.E4360Q|DST_ENST00000370788.2_Missense_Mutation_p.E4251Q|DST_ENST00000370754.5_Missense_Mutation_p.E6626Q|DST_ENST00000446842.2_Missense_Mutation_p.E6122Q			Q03001	DYST_HUMAN	dystonin	6336					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GCACTTGATTCAATTAGATCA	0.378																																						dbGAP											0													190.0	176.0	180.0					6																	56362779		1890	4124	6014	-	-	-	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.19009G>C	6.37:g.56362779C>G	ENSP00000354508:p.Glu6337Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.E6626Q	ENST00000361203.3	37	c.19876		6	.	.	.	.	.	.	.	.	.	.	C	15.77	2.931279	0.52866	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.8	5.8	0.92144	.	0.000000	0.52532	D	0.000071	T	0.43456	0.1248	L	0.43598	1.365	0.30798	N	0.740163	B;B;B;B;B	0.31968	0.044;0.349;0.199;0.125;0.333	B;B;B;B;P	0.46452	0.04;0.303;0.099;0.053;0.517	T	0.40646	-0.9552	9	0.38643	T	0.18	.	16.3119	0.82874	0.0:0.8679:0.1321:0.0	.	4360;6448;6626;6446;4034	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	Q	4034;6626;6448;4360;6122;4251;6337	ENSP00000244364:E4034Q;ENSP00000359790:E6626Q;ENSP00000359805:E6448Q;ENSP00000400883:E4360Q;ENSP00000393645:E6122Q;ENSP00000359824:E4251Q;ENSP00000354508:E6337Q	ENSP00000244364:E4034Q	E	-	1	0	DST	56470738	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.706000	0.54830	2.736000	0.93811	0.591000	0.81541	GAA	DST	-	pfam_Spectrin_repeat,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000151914		0.378	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	107	0.00	0	C	NM_001723		56362779	56362779	-1	no_errors	ENST00000370754	ensembl	human	known	69_37n	missense	175	25.32	60	SNP	1.000	G
DST	667	genome.wustl.edu	37	6	56458841	56458841	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr6:56458841C>T	ENST00000361203.3	-	44	11720	c.11713G>A	c.(11713-11715)Gaa>Aaa	p.E3905K	DST_ENST00000370769.4_Missense_Mutation_p.E3907K|DST_ENST00000244364.6_Missense_Mutation_p.E1493K|DST_ENST00000312431.6_Missense_Mutation_p.E3905K|DST_ENST00000421834.2_Missense_Mutation_p.E1819K|DST_ENST00000370788.2_Missense_Mutation_p.E1819K|DST_ENST00000370754.5_Missense_Mutation_p.E4085K|DST_ENST00000446842.2_Missense_Mutation_p.E3581K			Q03001	DYST_HUMAN	dystonin	3905					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGTGCAGTTTCATAATGCACT	0.408																																						dbGAP											0													83.0	75.0	77.0					6																	56458841		1895	4122	6017	-	-	-	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.11713G>A	6.37:g.56458841C>T	ENSP00000354508:p.Glu3905Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.E4085K	ENST00000361203.3	37	c.12253		6	.	.	.	.	.	.	.	.	.	.	C	15.59	2.877227	0.51801	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29	5.55	5.55	0.83447	.	0.000000	0.56097	D	0.000032	T	0.46073	0.1374	M	0.65975	2.015	0.27398	N	0.954931	B;P;P;P;B	0.45902	0.209;0.752;0.868;0.734;0.228	B;P;P;B;B	0.56648	0.079;0.507;0.803;0.19;0.287	T	0.09100	-1.0690	9	0.25751	T	0.34	.	19.8703	0.96847	0.0:1.0:0.0:0.0	.	1819;3907;4085;3905;1493	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	K	1493;4085;3907;1819;3581;3905;1819;3905	ENSP00000244364:E1493K;ENSP00000359790:E4085K;ENSP00000359805:E3907K;ENSP00000400883:E1819K;ENSP00000393645:E3581K;ENSP00000307959:E3905K;ENSP00000359824:E1819K;ENSP00000354508:E3905K	ENSP00000244364:E1493K	E	-	1	0	DST	56566800	1.000000	0.71417	0.302000	0.25058	0.052000	0.14988	5.717000	0.68446	2.770000	0.95276	0.650000	0.86243	GAA	DST	-	superfamily_ABC_transptrTM_dom_typ1	ENSG00000151914		0.408	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	41	0.00	0	C	NM_001723		56458841	56458841	-1	no_errors	ENST00000370754	ensembl	human	known	69_37n	missense	80	15.79	15	SNP	1.000	T
DTL	51514	genome.wustl.edu	37	1	212241661	212241661	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:212241661G>A	ENST00000366991.4	+	9	1123	c.809G>A	c.(808-810)cGa>cAa	p.R270Q	DTL_ENST00000542077.1_Missense_Mutation_p.R228Q|DTL_ENST00000475419.1_Intron	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)	270					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		AGCAGCACTCGAAAACTTGGT	0.338																																						dbGAP											0													70.0	67.0	68.0					1																	212241661		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.809G>A	1.37:g.212241661G>A	ENSP00000355958:p.Arg270Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R270Q	ENST00000366991.4	37	c.809	CCDS1502.1	1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.842059	0.91197	.	.	ENSG00000143476	ENST00000366991;ENST00000542077	T;T	0.75704	-0.91;-0.96	5.58	4.67	0.58626	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.86777	0.6014	M	0.84948	2.725	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.88458	0.3053	10	0.59425	D	0.04	-26.614	13.8214	0.63322	0.0751:0.0:0.9249:0.0	.	228;270	F5GZ90;Q9NZJ0	.;DTL_HUMAN	Q	270;228	ENSP00000355958:R270Q;ENSP00000443870:R228Q	ENSP00000355958:R270Q	R	+	2	0	DTL	210308284	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	8.159000	0.89651	1.491000	0.48482	0.637000	0.83480	CGA	DTL	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000143476		0.338	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTL	HGNC	protein_coding	OTTHUMT00000090182.1	53	0.00	0	G	NM_016448		212241661	212241661	+1	no_errors	ENST00000366991	ensembl	human	known	69_37n	missense	63	23.17	19	SNP	1.000	A
DYNC2H1	79659	genome.wustl.edu	37	11	103306688	103306688	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr11:103306688G>C	ENST00000375735.2	+	85	12528	c.12384G>C	c.(12382-12384)caG>caC	p.Q4128H	DYNC2H1_ENST00000334267.7_Missense_Mutation_p.Q741H|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.Q4135H	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	4128					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TCGCATGGCAGAGCAAGTGGG	0.413																																						dbGAP											0													75.0	74.0	74.0					11																	103306688		1889	4101	5990	-	-	-	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.12384G>C	11.37:g.103306688G>C	ENSP00000364887:p.Gln4128His	Somatic		WXS	Illumina GAIIx	Phase_IV	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Q4135H	ENST00000375735.2	37	c.12405	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	g	11.85	1.761147	0.31137	.	.	ENSG00000187240	ENST00000375735;ENST00000334267;ENST00000398093;ENST00000540621;ENST00000533197	T;T;T;T	0.08807	3.05;3.05;3.05;3.05	5.36	4.44	0.53790	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.11879	0.0289	L	0.41236	1.265	0.51767	D	0.999935	P;B;B	0.44734	0.842;0.074;0.06	P;B;B	0.47075	0.536;0.087;0.052	T	0.02047	-1.1223	10	0.66056	D	0.02	.	12.0906	0.53724	0.0874:0.0:0.9126:0.0	.	741;4128;4135	Q8NCM8-3;Q8NCM8;Q8NCM8-2	.;DYHC2_HUMAN;.	H	4128;741;4135;374;45	ENSP00000364887:Q4128H;ENSP00000334021:Q741H;ENSP00000381167:Q4135H;ENSP00000436736:Q45H	ENSP00000334021:Q741H	Q	+	3	2	DYNC2H1	102811898	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.647000	0.54403	1.354000	0.45846	0.650000	0.86243	CAG	DYNC2H1	-	pfam_Dynein_heavy	ENSG00000187240		0.413	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	70	0.00	0	G	XM_370652		103306688	103306688	+1	no_errors	ENST00000398093	ensembl	human	known	69_37n	missense	34	39.29	22	SNP	1.000	C
EFCAB8	388795	genome.wustl.edu	37	20	31481037	31481037	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr20:31481037C>T	ENST00000400522.4	+	9	910	c.816C>T	c.(814-816)gtC>gtT	p.V272V				A8MWE9	EFCB8_HUMAN	EF-hand calcium binding domain 8	0							calcium ion binding (GO:0005509)			endometrium(2)	2						ACGTCATTGTCTTCACCTCCG	0.577																																						dbGAP											0													167.0	165.0	166.0					20																	31481037		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0					20q11.21	2013-01-10			ENSG00000215529	ENSG00000215529		"""WD repeat domain containing"", ""EF-hand domain containing"""	34532	protein-coding gene	gene with protein product							Standard	XM_006710086		Approved			A8MWE9	OTTHUMG00000153693	ENST00000400522.4:c.816C>T	20.37:g.31481037C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,pfscan_EF_HAND_2	p.V272	ENST00000400522.4	37	c.816		20	.	.	.	.	.	.	.	.	.	.	C	0.664	-0.804720	0.02819	.	.	ENSG00000215529	ENST00000400522	.	.	.	4.59	2.52	0.30459	.	.	.	.	.	T	0.37320	0.0999	.	.	.	0.31024	N	0.717955	.	.	.	.	.	.	T	0.41502	-0.9505	3	.	.	.	.	4.5852	0.12279	0.2134:0.6679:0.0:0.1187	.	.	.	.	F	280	.	.	S	+	2	0	EFCAB8	30944698	0.972000	0.33761	0.909000	0.35828	0.059000	0.15707	0.171000	0.16685	0.470000	0.27294	0.561000	0.74099	TCT	EFCAB8	-	superfamily_WD40_repeat_dom	ENSG00000215529		0.577	EFCAB8-001	PUTATIVE	mRNA_end_NF|cds_end_NF|basic|exp_conf	protein_coding	EFCAB8	HGNC	protein_coding	OTTHUMT00000332144.2	58	0.00	0	C	XM_371397		31481037	31481037	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000400522	ensembl	human	putative	69_37n	silent	95	18.10	21	SNP	0.965	T
EIF2B4	8890	genome.wustl.edu	37	2	27591285	27591285	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:27591285G>A	ENST00000347454.4	-	6	715	c.544C>T	c.(544-546)Cac>Tac	p.H182Y	SNX17_ENST00000233575.2_5'Flank|EIF2B4_ENST00000493344.2_Missense_Mutation_p.H203Y|EIF2B4_ENST00000451130.2_Missense_Mutation_p.H202Y|SNX17_ENST00000542478.1_5'Flank|EIF2B4_ENST00000445933.2_Missense_Mutation_p.H181Y|SNX17_ENST00000537606.1_5'Flank|SNX17_ENST00000543024.1_5'Flank|AC074117.10_ENST00000412749.1_RNA	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	182					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGGGTAGGTGAGAGAAGAGA	0.423																																						dbGAP											0													123.0	115.0	118.0					2																	27591285		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.544C>T	2.37:g.27591285G>A	ENSP00000233552:p.His182Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Missense_Mutation	SNP	pfam_IF-2B-related	p.H182Y	ENST00000347454.4	37	c.544	CCDS33164.1	2	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617382	0.87359	.	.	ENSG00000115211	ENST00000347454;ENST00000414437;ENST00000445933;ENST00000451130;ENST00000493344	D;D;D;D	0.94092	-3.35;-3.35;-3.35;-3.35	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	D	0.97294	0.9115	M	0.89601	3.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	1.0;1.0;0.998;0.966	D	0.97808	1.0249	10	0.72032	D	0.01	-13.7723	17.4534	0.87599	0.0:0.0:1.0:0.0	.	179;181;182;202	F5H6W1;Q9UI10-3;Q9UI10;Q9UI10-2	.;.;EI2BD_HUMAN;.	Y	182;179;181;202;203	ENSP00000233552:H182Y;ENSP00000394397:H181Y;ENSP00000394869:H202Y;ENSP00000429323:H203Y	ENSP00000233552:H182Y	H	-	1	0	EIF2B4	27444789	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.661000	0.91125	2.709000	0.92574	0.561000	0.74099	CAC	EIF2B4	-	NULL	ENSG00000115211		0.423	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EIF2B4	HGNC	protein_coding	OTTHUMT00000324448.1	75	0.00	0	G			27591285	27591285	-1	no_errors	ENST00000347454	ensembl	human	known	69_37n	missense	67	22.99	20	SNP	1.000	A
EIF3A	8661	genome.wustl.edu	37	10	120817696	120817696	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr10:120817696C>G	ENST00000369144.3	-	12	1876	c.1749G>C	c.(1747-1749)gaG>gaC	p.E583D	EIF3A_ENST00000541549.1_Missense_Mutation_p.E549D|SNORA19_ENST00000410656.1_RNA|SNORA19_ENST00000384737.1_RNA	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		TATTCAGACTCTCAAGGCGCT	0.502																																						dbGAP											0													62.0	56.0	58.0					10																	120817696		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.1749G>C	10.37:g.120817696C>G	ENSP00000358140:p.Glu583Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.E583D	ENST00000369144.3	37	c.1749	CCDS7608.1	10	.	.	.	.	.	.	.	.	.	.	C	16.41	3.116351	0.56505	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.54071	0.59;0.59	5.5	2.58	0.30949	.	0.000000	0.39687	N	0.001282	T	0.66973	0.2844	M	0.75615	2.305	0.58432	D	0.999998	D	0.64830	0.994	D	0.70716	0.97	T	0.64715	-0.6342	10	0.52906	T	0.07	-23.551	8.7126	0.34393	0.0:0.6181:0.0:0.3819	.	583	Q14152	EIF3A_HUMAN	D	583;549	ENSP00000358140:E583D;ENSP00000438178:E549D	ENSP00000358140:E583D	E	-	3	2	EIF3A	120807686	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	1.607000	0.36836	0.342000	0.23796	0.585000	0.79938	GAG	EIF3A	-	NULL	ENSG00000107581		0.502	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3A	HGNC	protein_coding	OTTHUMT00000050634.1	63	0.00	0	C	NM_003750		120817696	120817696	-1	no_errors	ENST00000369144	ensembl	human	known	69_37n	missense	101	29.86	43	SNP	1.000	G
EIF3B	8662	genome.wustl.edu	37	7	2418363	2418363	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr7:2418363G>C	ENST00000360876.4	+	16	2250	c.2194G>C	c.(2194-2196)Gaa>Caa	p.E732Q	EIF3B_ENST00000397011.2_Missense_Mutation_p.E732Q	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		TAAGATCTTTGAACAGAAGGA	0.433																																						dbGAP											0													96.0	89.0	91.0					7																	2418363		2203	4300	6503	-	-	-	SO:0001583	missense	0			U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.2194G>C	7.37:g.2418363G>C	ENSP00000354125:p.Glu732Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_TIF2A_beta_prop-like,pfam_RRM_dom,smart_RRM_dom,pirsf_eIF3b,pfscan_RRM_dom	p.E732Q	ENST00000360876.4	37	c.2194	CCDS5332.1	7	.	.	.	.	.	.	.	.	.	.	G	33	5.262011	0.95368	.	.	ENSG00000106263	ENST00000314800;ENST00000360876;ENST00000397011;ENST00000489558	T;T	0.28895	1.59;1.59	5.61	5.61	0.85477	.	0.042290	0.85682	D	0.000000	T	0.66982	0.2845	M	0.92412	3.305	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.75357	-0.3346	10	0.87932	D	0	-41.3716	19.6435	0.95767	0.0:0.0:1.0:0.0	.	732	P55884	EIF3B_HUMAN	Q	732;732;732;656	ENSP00000354125:E732Q;ENSP00000380206:E732Q	ENSP00000316638:E732Q	E	+	1	0	EIF3B	2384889	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.680000	0.98651	2.638000	0.89438	0.655000	0.94253	GAA	EIF3B	-	pirsf_eIF3b	ENSG00000106263		0.433	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	EIF3B	HGNC	protein_coding	OTTHUMT00000207006.1	50	0.00	0	G			2418363	2418363	+1	no_errors	ENST00000360876	ensembl	human	known	69_37n	missense	51	34.62	27	SNP	1.000	C
EIF4G3	8672	genome.wustl.edu	37	1	21143962	21143962	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:21143962C>T	ENST00000264211.8	-	28	4464	c.4270G>A	c.(4270-4272)Gaa>Aaa	p.E1424K	EIF4G3_ENST00000537738.1_Missense_Mutation_p.E914K|EIF4G3_ENST00000536266.1_Missense_Mutation_p.E1028K|EIF4G3_ENST00000602326.1_Missense_Mutation_p.E1430K|EIF4G3_ENST00000374937.3_Missense_Mutation_p.E1430K|EIF4G3_ENST00000400422.1_Missense_Mutation_p.E1424K|EIF4G3_ENST00000374935.3_Missense_Mutation_p.E1144K	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1424	W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		TACAGCTCTTCGGCAGACAGT	0.403																																						dbGAP											0													103.0	103.0	103.0					1																	21143962		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.4270G>A	1.37:g.21143962C>T	ENSP00000264211:p.Glu1424Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,pfam_W2_domain,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.E1430K	ENST00000264211.8	37	c.4288	CCDS214.1	1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.543727	0.86022	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266	T;T;T;T;T;T	0.07114	3.74;3.74;3.58;3.22;3.74;3.44	5.4	5.4	0.78164	eIF4-gamma/eIF5/eIF2-epsilon (1);MIF4-like, type 1/2/3 (1);	0.159177	0.53938	D	0.000044	T	0.09774	0.0240	L	0.55481	1.735	0.80722	D	1	P;P;P;P;P	0.51240	0.943;0.893;0.784;0.701;0.673	B;B;B;B;B	0.34873	0.182;0.191;0.179;0.059;0.067	T	0.20806	-1.0264	10	0.31617	T	0.26	-11.0482	19.236	0.93861	0.0:1.0:0.0:0.0	.	1619;1144;1028;1430;1424	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	K	1424;1620;1424;1144;914;1430;1028	ENSP00000264211:E1424K;ENSP00000383274:E1424K;ENSP00000364071:E1144K;ENSP00000442010:E914K;ENSP00000364073:E1430K;ENSP00000444693:E1028K	ENSP00000264211:E1424K	E	-	1	0	EIF4G3	21016549	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.268000	0.78473	2.546000	0.85860	0.558000	0.71614	GAA	EIF4G3	-	NULL	ENSG00000075151		0.403	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4G3	HGNC	protein_coding	OTTHUMT00000007467.3	72	0.00	0	C	NM_003760		21143962	21143962	-1	no_errors	ENST00000374937	ensembl	human	known	69_37n	missense	71	31.73	33	SNP	1.000	T
EMILIN3	90187	genome.wustl.edu	37	20	39993715	39993715	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr20:39993715G>A	ENST00000332312.3	-	2	442	c.250C>T	c.(250-252)Cgg>Tgg	p.R84W		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	84	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)				biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				CTACACTGCCGGTATTCAGCC	0.577																																						dbGAP											0													206.0	159.0	175.0					20																	39993715		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.250C>T	20.37:g.39993715G>A	ENSP00000332806:p.Arg84Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495S5|Q495S6|Q495S7|Q76KT4	Missense_Mutation	SNP	pfam_EMI_domain,pfscan_EMI_domain	p.R84W	ENST00000332312.3	37	c.250	CCDS13316.1	20	.	.	.	.	.	.	.	.	.	.	G	23.9	4.476057	0.84640	.	.	ENSG00000183798	ENST00000332312	T	0.44482	0.92	4.48	4.48	0.54585	EMI domain (2);	0.374349	0.27311	N	0.019942	T	0.56292	0.1975	L	0.44542	1.39	0.41724	D	0.989522	D	0.89917	1.0	D	0.73708	0.981	T	0.54655	-0.8261	9	.	.	.	-20.5859	17.3473	0.87313	0.0:0.0:1.0:0.0	.	84	Q9NT22	EMIL3_HUMAN	W	84	ENSP00000332806:R84W	.	R	-	1	2	EMILIN3	39427129	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.645000	0.91049	2.308000	0.77769	0.655000	0.94253	CGG	EMILIN3	-	pfam_EMI_domain,pfscan_EMI_domain	ENSG00000183798		0.577	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN3	HGNC	protein_coding	OTTHUMT00000106876.2	42	0.00	0	G	XM_029741		39993715	39993715	-1	no_errors	ENST00000332312	ensembl	human	known	69_37n	missense	101	22.31	29	SNP	1.000	A
EP400NL	347918	genome.wustl.edu	37	12	132610986	132610986	+	IGR	SNP	G	G	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr12:132610986G>T	ENST00000376625.4	+	0	3487				EP400NL_ENST00000475841.1_3'UTR			Q6ZTU2	E400N_HUMAN	EP400 N-terminal like											endometrium(1)|lung(1)|prostate(2)|urinary_tract(1)	5						TTCGGTAGGAGCTTTTCACCA	0.408																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AK091234		12q24.33	2013-02-15			ENSG00000185684	ENSG00000185684			26602	protein-coding gene	gene with protein product						12477932	Standard	NR_003290		Approved	FLJ33915	uc009zyq.3	Q6ZTU2	OTTHUMG00000168251		12.37:g.132610986G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLB7|A8K0Z5|B3KQY2|Q6NXP1|Q8N253|Q8N7S7|Q9UFJ3	RNA	SNP	-	NULL	ENST00000376625.4	37	NULL		12																																																																																			EP400NL	-	-	ENSG00000185684		0.408	EP400NL-202	KNOWN	basic|appris_candidate_longest	protein_coding	EP400NL	HGNC	protein_coding		32	0.00	0	G	NM_182613		132610986	132610986	+1	no_errors	ENST00000475841	ensembl	human	known	69_37n	rna	14	17.65	3	SNP	0.009	T
ESR1	2099	genome.wustl.edu	37	6	152332832	152332832	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr6:152332832G>C	ENST00000206249.3	+	5	1500	c.1138G>C	c.(1138-1140)Gaa>Caa	p.E380Q	ESR1_ENST00000443427.1_Missense_Mutation_p.E380Q|ESR1_ENST00000406599.1_Intron|ESR1_ENST00000440973.1_Missense_Mutation_p.E380Q|ESR1_ENST00000427531.2_Missense_Mutation_p.E207Q|ESR1_ENST00000456483.2_Missense_Mutation_p.E268Q|ESR1_ENST00000338799.5_Missense_Mutation_p.E380Q	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	380	Interaction with AKAP13.|Self-association.|Steroid-binding.|Transactivation AF-2.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	CCACCTTCTAGAATGTGCCTG	0.478																																						dbGAP											0													143.0	128.0	133.0					6																	152332832		2203	4300	6503	-	-	-	SO:0001583	missense	0			X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.1138G>C	6.37:g.152332832G>C	ENSP00000206249:p.Glu380Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Missense_Mutation	SNP	pfam_Oestr_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Oestr_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.E380Q	ENST00000206249.3	37	c.1138	CCDS5234.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.8|28.8	4.954027|4.954027	0.92660|0.92660	.|.	.|.	ENSG00000091831|ENSG00000091831	ENST00000440973;ENST00000338799;ENST00000456483;ENST00000431219;ENST00000443427;ENST00000206249;ENST00000431590;ENST00000544394;ENST00000415488|ENST00000427531	D;D;D;D;D;D;T|.	0.96200|.	-3.94;-3.94;-3.94;-3.94;-3.94;-3.94;0.74|.	5.32|5.32	5.32|5.32	0.75619|0.75619	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.57403|.	0.2051|.	L|L	0.39397|0.39397	1.21|1.21	0.80722|0.80722	D|D	1|1	D;D;D;P;D;D|.	0.89917|.	1.0;1.0;0.995;0.904;1.0;1.0|.	D;D;D;P;D;D|.	0.97110|.	1.0;0.999;0.985;0.785;0.996;0.998|.	T|.	0.54417|.	-0.8297|.	10|.	0.87932|.	D|.	0|.	.|.	18.994|18.994	0.92804|0.92804	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	284;161;75;379;380;380|.	B0QYW6;E7EVR3;C8CJL6;A8KAF4;G4XH65;P03372|.	.;.;.;.;.;ESR1_HUMAN|.	Q|Y	380;380;268;161;380;380;308;207;53|284	ENSP00000405330:E380Q;ENSP00000342630:E380Q;ENSP00000415934:E268Q;ENSP00000387500:E380Q;ENSP00000206249:E380Q;ENSP00000445454:E207Q;ENSP00000401995:E53Q|.	ENSP00000206249:E380Q|.	E|X	+|+	1|3	0|2	ESR1|ESR1	152374525|152374525	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.635000|7.635000	0.83286|0.83286	2.494000|2.494000	0.84150|0.84150	0.591000|0.591000	0.81541|0.81541	GAA|TAG	ESR1	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	ENSG00000091831		0.478	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESR1	HGNC	protein_coding	OTTHUMT00000043308.1	64	0.00	0	G			152332832	152332832	+1	no_errors	ENST00000206249	ensembl	human	known	69_37n	missense	62	29.55	26	SNP	1.000	C
ETV3L	440695	genome.wustl.edu	37	1	157069072	157069072	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:157069072C>T	ENST00000454449.2	-	2	441	c.157G>A	c.(157-159)Gag>Aag	p.E53K		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	53					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				TGGCGGAACTCTTCCTTCTGC	0.602																																						dbGAP											0													44.0	45.0	44.0					1																	157069072		2203	4296	6499	-	-	-	SO:0001583	missense	0			AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.157G>A	1.37:g.157069072C>T	ENSP00000430271:p.Glu53Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ets,smart_Ets,prints_Ets,pfscan_Ets	p.E53K	ENST00000454449.2	37	c.157	CCDS30893.1	1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.893761	0.91889	.	.	ENSG00000253831	ENST00000454449	T	0.55234	0.53	4.86	4.86	0.63082	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (3);	0.000000	0.38663	N	0.001607	T	0.55609	0.1931	L	0.33792	1.035	0.46725	D	0.999179	D	0.76494	0.999	D	0.79108	0.992	T	0.59658	-0.7413	10	0.59425	D	0.04	.	16.9231	0.86168	0.0:1.0:0.0:0.0	.	53	Q6ZN32	ETV3L_HUMAN	K	53	ENSP00000430271:E53K	ENSP00000430271:E53K	E	-	1	0	ETV3L	155335696	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.546000	0.82137	2.500000	0.84329	0.655000	0.94253	GAG	ETV3L	-	pfam_Ets,smart_Ets,pfscan_Ets	ENSG00000253831		0.602	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3L	HGNC	protein_coding	OTTHUMT00000099024.2	32	0.00	0	C	NM_001004341		157069072	157069072	-1	no_errors	ENST00000454449	ensembl	human	known	69_37n	missense	151	12.64	22	SNP	1.000	T
FAM193A	8603	genome.wustl.edu	37	4	2701776	2701776	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr4:2701776G>A	ENST00000324666.5	+	17	3355	c.3004G>A	c.(3004-3006)Gat>Aat	p.D1002N	FAM193A_ENST00000545951.1_Missense_Mutation_p.D1002N|FAM193A_ENST00000505311.1_Missense_Mutation_p.D1002N|FAM193A_ENST00000382839.3_Missense_Mutation_p.D1002N|FAM193A_ENST00000502458.1_Missense_Mutation_p.D1024N	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	1002										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						GCTAGGGGCTGATGGGGATGC	0.542																																						dbGAP											0													74.0	77.0	76.0					4																	2701776		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.3004G>A	4.37:g.2701776G>A	ENSP00000324587:p.Asp1002Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	NULL	p.D1002N	ENST00000324666.5	37	c.3004	CCDS58875.1	4	.	.	.	.	.	.	.	.	.	.	G	1.069	-0.670427	0.03403	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.28895	1.6;2.01;1.59;1.6;1.59	4.78	2.88	0.33553	.	0.964781	0.08579	N	0.924860	T	0.13670	0.0331	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.001;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.0;0.002;0.001;0.0;0.001	T	0.32981	-0.9886	10	0.16896	T	0.51	-4.9992	3.6878	0.08335	0.0935:0.1647:0.5724:0.1693	.	1002;1024;1002;1024;1002	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	N	1002;1002;1002;1024;856	ENSP00000372290:D1002N;ENSP00000324587:D1002N;ENSP00000443617:D1002N;ENSP00000427505:D1024N;ENSP00000427260:D856N	ENSP00000324587:D1002N	D	+	1	0	FAM193A	2671574	0.001000	0.12720	0.010000	0.14722	0.009000	0.06853	0.513000	0.22770	0.987000	0.38709	0.655000	0.94253	GAT	FAM193A	-	NULL	ENSG00000125386		0.542	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM193A	HGNC	protein_coding	OTTHUMT00000360903.1	29	0.00	0	G	NM_003704		2701776	2701776	+1	no_errors	ENST00000324666	ensembl	human	known	69_37n	missense	29	34.09	15	SNP	0.004	A
ERICH6	131831	genome.wustl.edu	37	3	150396303	150396303	+	Missense_Mutation	SNP	C	C	A	rs374414297		TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:150396303C>A	ENST00000295910.6	-	10	1202	c.1150G>T	c.(1150-1152)Gtg>Ttg	p.V384L	FAM194A_ENST00000491361.1_Missense_Mutation_p.V238L	NM_152394.3	NP_689607.2														NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						GGAATATCCACAGAAAGTTGA	0.294																																						dbGAP											0													62.0	60.0	60.0					3																	150396303		2201	4292	6493	-	-	-	SO:0001583	missense	0																														ENST00000295910.6:c.1150G>T	3.37:g.150396303C>A	ENSP00000295910:p.Val384Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.V384L	ENST00000295910.6	37	c.1150	CCDS3151.2	3	.	.	.	.	.	.	.	.	.	.	C	8.521	0.868790	0.17322	.	.	ENSG00000163645	ENST00000295910;ENST00000491361;ENST00000313811	T;T	0.14391	2.72;2.51	3.85	-7.7	0.01259	.	2.478720	0.01654	N	0.024722	T	0.09598	0.0236	L	0.40543	1.245	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.19224	-1.0312	10	0.26408	T	0.33	0.1543	4.1238	0.10118	0.1147:0.1831:0.1138:0.5884	.	384	Q7L0X2	F194A_HUMAN	L	384;238;342	ENSP00000295910:V384L;ENSP00000419366:V238L	ENSP00000295910:V384L	V	-	1	0	FAM194A	151878993	0.000000	0.05858	0.000000	0.03702	0.485000	0.33311	-3.702000	0.00389	-1.903000	0.01093	-0.484000	0.04775	GTG	FAM194A	-	NULL	ENSG00000163645		0.294	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194A	HGNC	protein_coding	OTTHUMT00000257666.1	88	0.00	0	C			150396303	150396303	-1	no_errors	ENST00000295910	ensembl	human	known	69_37n	missense	55	26.67	20	SNP	0.000	A
FBN1	2200	genome.wustl.edu	37	15	48717998	48717998	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr15:48717998C>T	ENST00000316623.5	-	59	7723	c.7268G>A	c.(7267-7269)gGa>gAa	p.G2423E		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2423	EGF-like 41; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ATGATATGATCCTCTGTCATT	0.353																																						dbGAP											0													138.0	118.0	125.0					15																	48717998		2198	4296	6494	-	-	-	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.7268G>A	15.37:g.48717998C>T	ENSP00000325527:p.Gly2423Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.G2423E	ENST00000316623.5	37	c.7268	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.423829	0.96111	.	.	ENSG00000166147	ENST00000316623	D	0.99557	-6.16	6.11	6.11	0.99139	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99760	0.9903	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97746	1.0211	10	0.72032	D	0.01	.	20.3293	0.98710	0.0:1.0:0.0:0.0	.	2423	P35555	FBN1_HUMAN	E	2423	ENSP00000325527:G2423E	ENSP00000325527:G2423E	G	-	2	0	FBN1	46505290	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	5.950000	0.70265	2.906000	0.99361	0.655000	0.94253	GGA	FBN1	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Fibrillin,pfscan_EG-like_dom	ENSG00000166147		0.353	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	88	0.00	0	C			48717998	48717998	-1	no_errors	ENST00000316623	ensembl	human	known	69_37n	missense	91	28.91	37	SNP	1.000	T
FBXO34	55030	genome.wustl.edu	37	14	55818543	55818543	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr14:55818543C>T	ENST00000313833.4	+	2	1680	c.1435C>T	c.(1435-1437)Cca>Tca	p.P479S	FBXO34_ENST00000440021.1_Missense_Mutation_p.P479S	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	479										breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						AGACCCAGTTCCAGGGATGTT	0.428																																						dbGAP											0													100.0	98.0	99.0					14																	55818543		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.1435C>T	14.37:g.55818543C>T	ENSP00000313159:p.Pro479Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2VPB5|Q4VBP5|Q86TY4	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.P479S	ENST00000313833.4	37	c.1435	CCDS32086.1	14	.	.	.	.	.	.	.	.	.	.	C	21.1	4.105677	0.77096	.	.	ENSG00000178974	ENST00000313833;ENST00000440021	T;T	0.52057	0.68;0.68	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.70859	0.3272	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72640	-0.4232	10	0.87932	D	0	-2.2021	19.5755	0.95441	0.0:1.0:0.0:0.0	.	479	Q9NWN3	FBX34_HUMAN	S	479	ENSP00000313159:P479S;ENSP00000394117:P479S	ENSP00000313159:P479S	P	+	1	0	FBXO34	54888296	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.454000	0.73493	2.865000	0.98341	0.655000	0.94253	CCA	FBXO34	-	NULL	ENSG00000178974		0.428	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO34	HGNC	protein_coding	OTTHUMT00000411322.1	45	0.00	0	C			55818543	55818543	+1	no_errors	ENST00000313833	ensembl	human	known	69_37n	missense	62	27.06	23	SNP	1.000	T
FCAMR	83953	genome.wustl.edu	37	1	207134516	207134516	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:207134516C>G	ENST00000324852.4	-	6	1179	c.705G>C	c.(703-705)atG>atC	p.M235I	FCAMR_ENST00000400962.3_Intron|FCAMR_ENST00000486178.1_5'Flank|FCAMR_ENST00000450945.2_Intron	NM_001170631.1	NP_001164102.1	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity	190					immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(1)	11						CATAGGATCTCATGGTGAGCT	0.627																																					Ovarian(199;1883 2142 16966 44409 45154)	dbGAP											0													60.0	51.0	54.0					1																	207134516		692	1591	2283	-	-	-	SO:0001583	missense	0			AF354295	CCDS41460.1, CCDS53468.1	1q32.1	2013-01-14			ENSG00000162897	ENSG00000162897		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	24692	protein-coding gene	gene with protein product		605484				11779189	Standard	NM_001122979		Approved	FKSG87, FCA/MR, CD351	uc001hfa.4	Q8WWV6	OTTHUMG00000036579	ENST00000324852.4:c.705G>C	1.37:g.207134516C>G	ENSP00000316491:p.Met235Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32M82|Q8WWV5|Q96SA2	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.M235I	ENST00000324852.4	37	c.705	CCDS53468.1	1	.	.	.	.	.	.	.	.	.	.	C	10.22	1.290546	0.23564	.	.	ENSG00000162897	ENST00000324852;ENST00000367087	T	0.04862	3.54	5.36	0.248	0.15526	.	1.756160	0.02632	N	0.104373	T	0.05502	0.0145	L	0.29908	0.895	0.09310	N	1	B;B	0.29716	0.255;0.156	B;B	0.19148	0.024;0.016	T	0.38308	-0.9667	10	0.28530	T	0.3	1.2306	7.3735	0.26815	0.0:0.2886:0.0:0.7114	.	210;190	D2KTA8;Q8WWV6	.;FCAMR_HUMAN	I	235;211	ENSP00000316491:M235I	ENSP00000316491:M235I	M	-	3	0	FCAMR	205201139	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.669000	0.05262	0.197000	0.20387	-0.140000	0.14226	ATG	FCAMR	-	NULL	ENSG00000162897		0.627	FCAMR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	FCAMR	HGNC	protein_coding	OTTHUMT00000088969.2	38	0.00	0	C	NM_032029		207134516	207134516	-1	no_errors	ENST00000324852	ensembl	human	novel	69_37n	missense	113	22.07	32	SNP	0.000	G
FLYWCH1	84256	genome.wustl.edu	37	16	2988210	2988210	+	Silent	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr16:2988210G>C	ENST00000253928.9	+	8	2208	c.1803G>C	c.(1801-1803)ctG>ctC	p.L601L	FLYWCH1_ENST00000416288.2_Silent_p.L600L|FLYWCH1_ENST00000399667.2_Silent_p.L650L|FLYWCH1_ENST00000570752.1_3'UTR|LA16c-321D4.2_ENST00000573260.1_RNA			Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1	601						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|lung(3)	4						TGGAGTTCCTGAGGACTTCCC	0.627																																						dbGAP											0													21.0	23.0	22.0					16																	2988210		1865	4102	5967	-	-	-	SO:0001819	synonymous_variant	0			AL136585	CCDS45390.1	16p13.3	2013-01-10	2007-06-21	2007-06-21	ENSG00000059122	ENSG00000059122		"""Zinc fingers"""	25404	protein-coding gene	gene with protein product						11230166, 10997877	Standard	XM_006720959		Approved	DKFZp761A132	uc002csc.3	Q4VC44		ENST00000253928.9:c.1803G>C	16.37:g.2988210G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUA1|Q6ZSQ1|Q8WV62|Q9BQG6|Q9BUS5|Q9HCM0	Missense_Mutation	SNP	pfam_Znf_FLYWCH	p.E379Q	ENST00000253928.9	37	c.1135		16																																																																																			FLYWCH1	-	pfam_Znf_FLYWCH	ENSG00000059122		0.627	FLYWCH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	FLYWCH1	HGNC	protein_coding	OTTHUMT00000436479.1	13	0.00	0	G	NM_032296		2988210	2988210	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000344592	ensembl	human	novel	69_37n	missense	19	25.93	7	SNP	0.996	C
GALNT12	79695	genome.wustl.edu	37	9	101594117	101594117	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr9:101594117C>T	ENST00000375011.3	+	4	795	c.795C>T	c.(793-795)ttC>ttT	p.F265F		NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	265					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				GGAACACCTTCGAATACCTGG	0.572																																						dbGAP											0													93.0	85.0	88.0					9																	101594117		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.795C>T	9.37:g.101594117C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TCF7|Q8NG54|Q96CT9|Q9H771	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.F265	ENST00000375011.3	37	c.795	CCDS6737.1	9																																																																																			GALNT12	-	pfam_Glyco_trans_2	ENSG00000119514		0.572	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT12	HGNC	protein_coding	OTTHUMT00000053382.1	45	0.00	0	C	NM_024642		101594117	101594117	+1	no_errors	ENST00000375011	ensembl	human	known	69_37n	silent	114	17.39	24	SNP	0.620	T
FUBP3	8939	genome.wustl.edu	37	9	133491806	133491806	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr9:133491806G>T	ENST00000319725.9	+	7	544	c.469G>T	c.(469-471)Gac>Tac	p.D157Y		NM_003934.1	NP_003925.1	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	157					positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|urinary_tract(2)	21				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		CTTTCATAATGACATAGACAG	0.502																																						dbGAP											0													76.0	76.0	76.0					9																	133491806		2011	4171	6182	-	-	-	SO:0001583	missense	0			U69127	CCDS43893.1	9q34.11	2008-02-05			ENSG00000107164	ENSG00000107164			4005	protein-coding gene	gene with protein product		603536		FBP3		8940189	Standard	NM_003934		Approved		uc004bzr.1	Q96I24	OTTHUMG00000020809	ENST00000319725.9:c.469G>T	9.37:g.133491806G>T	ENSP00000318177:p.Asp157Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFK8|A3KFL0|Q92946|Q9BVB6	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	p.D157Y	ENST00000319725.9	37	c.469	CCDS43893.1	9	.	.	.	.	.	.	.	.	.	.	G	12.24	1.879135	0.33162	.	.	ENSG00000107164	ENST00000358721;ENST00000319725;ENST00000372376	T	0.49720	0.77	5.31	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.60301	0.2258	L	0.52126	1.63	0.53688	D	0.999974	P;D;D	0.76494	0.886;0.999;0.999	P;D;D	0.65443	0.637;0.935;0.935	T	0.63001	-0.6734	10	0.66056	D	0.02	-20.9443	13.1729	0.59609	0.077:0.0:0.923:0.0	.	97;157;157	Q96I24-2;A3KFK8;Q96I24	.;.;FUBP3_HUMAN	Y	144;157;97	ENSP00000318177:D157Y	ENSP00000318177:D157Y	D	+	1	0	FUBP3	132481627	1.000000	0.71417	0.048000	0.18961	0.972000	0.66771	6.457000	0.73505	1.250000	0.43966	0.561000	0.74099	GAC	FUBP3	-	NULL	ENSG00000107164		0.502	FUBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FUBP3	HGNC	protein_coding	OTTHUMT00000054666.1	37	0.00	0	G			133491806	133491806	+1	no_errors	ENST00000319725	ensembl	human	known	69_37n	missense	83	19.42	20	SNP	0.998	T
GCLM	2730	genome.wustl.edu	37	1	94362251	94362251	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:94362251G>A	ENST00000370238.3	-	5	709	c.463C>T	c.(463-465)Cag>Tag	p.Q155*	GCLM_ENST00000467772.1_5'UTR	NM_002061.2	NP_002052.1	P48507	GSH0_HUMAN	glutamate-cysteine ligase, modifier subunit	155					apoptotic mitochondrial changes (GO:0008637)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of glutamate-cysteine ligase activity (GO:0035229)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	glutamate-cysteine ligase activity (GO:0004357)|glutamate-cysteine ligase catalytic subunit binding (GO:0035226)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_lung(203;0.000815)|Lung NSC(277;0.00363)		all cancers(265;0.00566)|GBM - Glioblastoma multiforme(16;0.0203)|Epithelial(280;0.131)	L-Cysteine(DB00151)	TTTTTGCTCTGAACTAAGTTT	0.438																																						dbGAP											0													197.0	183.0	187.0					1																	94362251		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L35546	CCDS746.1	1p21	2008-02-05			ENSG00000023909	ENSG00000023909	6.3.2.2		4312	protein-coding gene	gene with protein product	"""gamma-glutamylcysteine synthetase"""	601176		GLCLR		7826375	Standard	NM_002061		Approved		uc001dqg.1	P48507	OTTHUMG00000010562	ENST00000370238.3:c.463C>T	1.37:g.94362251G>A	ENSP00000359258:p.Gln155*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K334|D3DT45|M5A959|Q6FHC1|Q9NPX9|Q9NU74	Nonsense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	p.Q155*	ENST00000370238.3	37	c.463	CCDS746.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.224274	0.97390	.	.	ENSG00000023909	ENST00000370238	.	.	.	5.5	5.5	0.81552	.	0.280340	0.41294	D	0.000919	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.7615	0.85513	0.0:0.1287:0.8713:0.0	.	.	.	.	X	155	.	ENSP00000359258:Q155X	Q	-	1	0	GCLM	94134839	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	2.870000	0.48451	2.748000	0.94277	0.655000	0.94253	CAG	GCLM	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	ENSG00000023909		0.438	GCLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCLM	HGNC	protein_coding	OTTHUMT00000029169.1	53	0.00	0	G	NM_002061		94362251	94362251	-1	no_errors	ENST00000370238	ensembl	human	known	69_37n	nonsense	85	26.72	31	SNP	1.000	A
GEMIN6	79833	genome.wustl.edu	37	2	39008833	39008833	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:39008833G>A	ENST00000281950.3	+	3	419	c.303G>A	c.(301-303)gaG>gaA	p.E101E	GEMIN6_ENST00000409566.1_3'UTR|GEMIN6_ENST00000409011.1_3'UTR	NM_024775.9	NP_079051.9	Q8WXD5	GEMI6_HUMAN	gem (nuclear organelle) associated protein 6	101					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				kidney(1)|large_intestine(3)|pancreas(1)	5		all_hematologic(82;0.21)				ATCTGGAAGAGAGAAAGAACA	0.493																																						dbGAP											0													89.0	77.0	81.0					2																	39008833		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF453443	CCDS1799.1	2p22.1	2014-05-14			ENSG00000152147	ENSG00000152147			20044	protein-coding gene	gene with protein product		607006				11748230	Standard	NM_024775		Approved	FLJ23459	uc002rrc.3	Q8WXD5	OTTHUMG00000128588	ENST00000281950.3:c.303G>A	2.37:g.39008833G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDP8|Q53SI5|Q8WVB4|Q9H5G6	Silent	SNP	pfam_Gemin6	p.E101	ENST00000281950.3	37	c.303	CCDS1799.1	2																																																																																			GEMIN6	-	pfam_Gemin6	ENSG00000152147		0.493	GEMIN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN6	HGNC	protein_coding	OTTHUMT00000250441.3	36	0.00	0	G			39008833	39008833	+1	no_errors	ENST00000281950	ensembl	human	known	69_37n	silent	46	33.33	23	SNP	0.917	A
GXYLT2	727936	genome.wustl.edu	37	3	73024283	73024283	+	Silent	SNP	C	C	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:73024283C>A	ENST00000389617.4	+	7	1466	c.1305C>A	c.(1303-1305)atC>atA	p.I435I		NM_001080393.1	NP_001073862.1	A0PJZ3	GXLT2_HUMAN	glucoside xylosyltransferase 2	435					O-glycan processing (GO:0016266)	integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	18						ACGTCATCATCCATGTTGGCC	0.418																																						dbGAP											0													91.0	88.0	89.0					3																	73024283		1907	4114	6021	-	-	-	SO:0001819	synonymous_variant	0			AC098481	CCDS46870.1	3p13	2013-02-22	2009-11-17	2009-11-17	ENSG00000172986	ENSG00000172986		"""Glycosyltransferase family 8 domain containing"""	33383	protein-coding gene	gene with protein product		613322	"""glycosyltransferase 8 domain containing 4"""	GLT8D4		19940119	Standard	NM_001080393		Approved		uc003dpg.3	A0PJZ3	OTTHUMG00000158815	ENST00000389617.4:c.1305C>A	3.37:g.73024283C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Glyco_trans_8	p.I435	ENST00000389617.4	37	c.1305	CCDS46870.1	3																																																																																			GXYLT2	-	NULL	ENSG00000172986		0.418	GXYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GXYLT2	HGNC	protein_coding	OTTHUMT00000352318.1	49	0.00	0	C	NM_001080393		73024283	73024283	+1	no_errors	ENST00000389617	ensembl	human	known	69_37n	silent	53	27.40	20	SNP	0.997	A
HCLS1	3059	genome.wustl.edu	37	3	121363760	121363760	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:121363760C>G	ENST00000314583.3	-	5	395	c.304G>C	c.(304-306)Gag>Cag	p.E102Q	HCLS1_ENST00000473883.1_5'Flank|HCLS1_ENST00000428394.2_Missense_Mutation_p.E102Q	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	102					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		GCAACATACTCATGGCCCACT	0.463																																						dbGAP											0													116.0	102.0	107.0					3																	121363760		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.304G>C	3.37:g.121363760C>G	ENSP00000320176:p.Glu102Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Missense_Mutation	SNP	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.E102Q	ENST00000314583.3	37	c.304	CCDS3003.1	3	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730552	0.48939	.	.	ENSG00000180353	ENST00000314583;ENST00000428394	T;T	0.24350	1.86;1.92	4.96	4.96	0.65561	.	0.242136	0.49305	D	0.000158	T	0.47395	0.1443	L	0.61218	1.895	0.39423	D	0.966945	D;D;D	0.76494	0.979;0.999;0.982	P;D;D	0.67103	0.906;0.932;0.949	T	0.49934	-0.8886	10	0.72032	D	0.01	-27.0924	15.7504	0.77980	0.0:1.0:0.0:0.0	.	102;102;102	B4DTP2;E7EVW7;P14317	.;.;HCLS1_HUMAN	Q	102	ENSP00000320176:E102Q;ENSP00000387645:E102Q	ENSP00000320176:E102Q	E	-	1	0	HCLS1	122846450	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.911000	0.39937	2.582000	0.87167	0.650000	0.86243	GAG	HCLS1	-	pfam_Hs1_Cortactin,pfscan_Hs1_Cortactin	ENSG00000180353		0.463	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCLS1	HGNC	protein_coding	OTTHUMT00000355144.1	39	0.00	0	C	NM_005335		121363760	121363760	-1	no_errors	ENST00000314583	ensembl	human	known	69_37n	missense	29	38.78	19	SNP	1.000	G
HCN1	348980	genome.wustl.edu	37	5	45645589	45645589	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr5:45645589C>G	ENST00000303230.4	-	2	604	c.547G>C	c.(547-549)Gat>Cat	p.D183H		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	183					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						AAAACTGTATCTGATGCCACA	0.383																																						dbGAP											0													91.0	89.0	90.0					5																	45645589		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.547G>C	5.37:g.45645589C>G	ENSP00000307342:p.Asp183His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.D183H	ENST00000303230.4	37	c.547	CCDS3952.1	5	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327169	0.81690	.	.	ENSG00000164588	ENST00000303230	D	0.96041	-3.89	5.37	5.37	0.77165	Ion transport (1);	0.000000	0.64402	D	0.000011	D	0.98501	0.9500	H	0.95328	3.655	0.80722	D	1	D	0.58268	0.982	D	0.70016	0.967	D	0.99541	1.0963	10	0.87932	D	0	.	19.1028	0.93281	0.0:1.0:0.0:0.0	.	183	O60741	HCN1_HUMAN	H	183	ENSP00000307342:D183H	ENSP00000307342:D183H	D	-	1	0	HCN1	45681346	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.520000	0.84964	0.555000	0.69702	GAT	HCN1	-	pfam_Ion_trans_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	ENSG00000164588		0.383	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN1	HGNC	protein_coding	OTTHUMT00000253847.1	37	0.00	0	C	NM_021072		45645589	45645589	-1	no_errors	ENST00000303230	ensembl	human	known	69_37n	missense	36	28.00	14	SNP	1.000	G
HERC1	8925	genome.wustl.edu	37	15	63935169	63935169	+	Nonsense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr15:63935169G>C	ENST00000443617.2	-	59	11507	c.11420C>G	c.(11419-11421)tCa>tGa	p.S3807*		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3807					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TGATCTATTTgagcaagcagc	0.393																																						dbGAP											0													64.0	59.0	61.0					15																	63935169		1878	4112	5990	-	-	-	SO:0001587	stop_gained	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.11420C>G	15.37:g.63935169G>C	ENSP00000390158:p.Ser3807*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW65	Nonsense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.S3807*	ENST00000443617.2	37	c.11420	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	G	53	20.323213	0.99929	.	.	ENSG00000103657	ENST00000443617	.	.	.	4.85	4.85	0.62838	.	0.079544	0.50627	U	0.000102	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	13.8199	0.63313	0.0:0.0:1.0:0.0	.	.	.	.	X	3807	.	ENSP00000390158:S3807X	S	-	2	0	HERC1	61722222	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.024000	0.64090	2.389000	0.81357	0.467000	0.42956	TCA	HERC1	-	NULL	ENSG00000103657		0.393	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	51	0.00	0	G	NM_003922		63935169	63935169	-1	no_errors	ENST00000443617	ensembl	human	known	69_37n	nonsense	50	34.21	26	SNP	1.000	C
HIVEP1	3096	genome.wustl.edu	37	6	12121104	12121104	+	Nonsense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr6:12121104C>G	ENST00000379388.2	+	4	1408	c.1076C>G	c.(1075-1077)tCa>tGa	p.S359*		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	359					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TCACCTTTGTCAATAAGTCCG	0.418																																						dbGAP											0													152.0	143.0	146.0					6																	12121104		2024	4197	6221	-	-	-	SO:0001587	stop_gained	0			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.1076C>G	6.37:g.12121104C>G	ENSP00000368698:p.Ser359*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU3|Q14122|Q5MPB1|Q5VW60	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S359*	ENST00000379388.2	37	c.1076	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	C	38	6.820342	0.97861	.	.	ENSG00000095951	ENST00000379388	.	.	.	5.2	5.2	0.72013	.	0.321806	0.17507	N	0.171757	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.5684	16.9265	0.86178	0.0:1.0:0.0:0.0	.	.	.	.	X	359	.	.	S	+	2	0	HIVEP1	12229090	0.996000	0.38824	0.026000	0.17262	0.803000	0.45373	3.183000	0.50918	2.411000	0.81874	0.650000	0.86243	TCA	HIVEP1	-	NULL	ENSG00000095951		0.418	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2	42	0.00	0	C	NM_002114		12121104	12121104	+1	no_errors	ENST00000379388	ensembl	human	known	69_37n	nonsense	33	49.23	32	SNP	0.997	G
HIST1H4H	8365	genome.wustl.edu	37	6	26285573	26285573	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr6:26285573T>C	ENST00000377727.1	-	1	164	c.155A>G	c.(154-156)tAt>tGt	p.Y52C	HIST1H4H_ENST00000289352.1_Missense_Mutation_p.Y52C	NM_003543.3	NP_003534.1	P62805	H4_HUMAN	histone cluster 1, H4h	52					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			lung(2)|ovary(2)|upper_aerodigestive_tract(3)	7						AGTCTCCTCATAGATAAGGCC	0.542										HNSCC(76;0.23)																												dbGAP											0													154.0	132.0	139.0					6																	26285573		2203	4300	6503	-	-	-	SO:0001583	missense	0			X60487	CCDS4604.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000158406	ENSG00000158406		"""Histones / Replication-dependent"""	4788	protein-coding gene	gene with protein product		602828	"""H4 histone family, member H"", ""histone 1, H4h"""	H4FH		9119399, 12408966	Standard	NM_003543		Approved	H4/h	uc003nhm.2	P62805	OTTHUMG00000014454	ENST00000377727.1:c.155A>G	6.37:g.26285573T>C	ENSP00000366956:p.Tyr52Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.Y52C	ENST00000377727.1	37	c.155	CCDS4604.1	6	.	.	.	.	.	.	.	.	.	.	.	15.74	2.923423	0.52653	.	.	ENSG00000158406	ENST00000289352;ENST00000377727	T;T	0.68624	-0.34;-0.34	4.4	4.4	0.53042	.	0.000000	0.48767	U	0.000164	T	0.68531	0.3011	.	.	.	0.43394	D	0.995519	.	.	.	.	.	.	T	0.74318	-0.3704	7	0.87932	D	0	.	11.8938	0.52646	0.0:0.0:0.0:1.0	.	.	.	.	C	52	ENSP00000289352:Y52C;ENSP00000366956:Y52C	ENSP00000289352:Y52C	Y	-	2	0	HIST1H4H	26393552	1.000000	0.71417	0.976000	0.42696	0.026000	0.11368	7.920000	0.87521	1.770000	0.52166	0.402000	0.26972	TAT	HIST1H4H	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	ENSG00000158406		0.542	HIST1H4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4H	HGNC	protein_coding	OTTHUMT00000040119.1	48	0.00	0	T	NM_003543		26285573	26285573	-1	no_errors	ENST00000289352	ensembl	human	known	69_37n	missense	65	44.44	52	SNP	1.000	C
HNRNPF	3185	genome.wustl.edu	37	10	43882375	43882375	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr10:43882375C>G	ENST00000544000.1	-	4	1365	c.958G>C	c.(958-960)Gag>Cag	p.E320Q	HNRNPF_ENST00000337970.3_Missense_Mutation_p.E320Q|HNRNPF_ENST00000498176.1_5'Flank|HNRNPF_ENST00000357065.4_Missense_Mutation_p.E320Q|HNRNPF_ENST00000443950.2_Missense_Mutation_p.E320Q|HNRNPF_ENST00000356053.3_Missense_Mutation_p.E320Q	NM_001098207.1	NP_001091677.1	P52597	HNRPF_HUMAN	heterogeneous nuclear ribonucleoprotein F	320	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|urinary_tract(1)	19						GGGCCAATCTCAATATGGACT	0.507																																						dbGAP											0													77.0	72.0	74.0					10																	43882375		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7204.1	10q11.21	2013-02-12		2008-04-18	ENSG00000169813	ENSG00000169813		"""RNA binding motif (RRM) containing"""	5039	protein-coding gene	gene with protein product		601037		HNRPF		7499401	Standard	NM_001098208		Approved		uc001jas.2	P52597	OTTHUMG00000018029	ENST00000544000.1:c.958G>C	10.37:g.43882375C>G	ENSP00000438061:p.Glu320Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KM84|Q5T0N2|Q96AU2	Missense_Mutation	SNP	pfam_RRM_dom,pfam_Znf_CHHC,smart_RRM_dom,pfscan_RRM_dom	p.E320Q	ENST00000544000.1	37	c.958	CCDS7204.1	10	.	.	.	.	.	.	.	.	.	.	C	15.72	2.918269	0.52546	.	.	ENSG00000169813	ENST00000544000;ENST00000443950;ENST00000356053;ENST00000357065;ENST00000337970;ENST00000540544	T;T;T;T;T	0.07567	3.18;3.18;3.18;3.18;3.18	4.38	4.38	0.52667	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.12603	0.0306	L	0.42686	1.345	0.80722	D	1	B	0.26809	0.16	B	0.41510	0.359	T	0.15752	-1.0426	10	0.14252	T	0.57	-42.201	15.2569	0.73593	0.0:1.0:0.0:0.0	.	320	P52597	HNRPF_HUMAN	Q	320;320;320;320;320;243	ENSP00000438061:E320Q;ENSP00000400433:E320Q;ENSP00000348345:E320Q;ENSP00000349573:E320Q;ENSP00000338477:E320Q	ENSP00000338477:E320Q	E	-	1	0	HNRNPF	43202381	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.000000	0.76290	2.726000	0.93360	0.655000	0.94253	GAG	HNRNPF	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000169813		0.507	HNRNPF-202	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPF	HGNC	protein_coding	OTTHUMT00000047705.2	45	0.00	0	C			43882375	43882375	-1	no_errors	ENST00000337970	ensembl	human	known	69_37n	missense	49	22.22	14	SNP	1.000	G
HK1	3098	genome.wustl.edu	37	10	71060618	71060618	+	Splice_Site	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr10:71060618G>C	ENST00000360289.2	+	5	526		c.e5+1		HK1_ENST00000404387.2_Intron|HK1_ENST00000448642.2_Intron	NM_033497.2|NM_033498.2|NM_033500.2	NP_277032.1|NP_277033.1|NP_277035.2	P19367	HXK1_HUMAN	hexokinase 1						carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						Gcatgattttgtacgtagaaa	0.378																																						dbGAP											0													56.0	58.0	57.0					10																	71060618		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000360289.2:c.27+1G>C	10.37:g.71060618G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Splice_Site	SNP	-	e1+1	ENST00000360289.2	37	c.27+1	CCDS7290.1	10																																																																																			HK1	-	-	ENSG00000156515		0.378	HK1-202	KNOWN	basic|CCDS	protein_coding	HK1	HGNC	protein_coding		67	0.00	0	G	NM_000188	Intron	71060618	71060618	+1	no_errors	ENST00000360289	ensembl	human	known	69_37n	splice_site	35	30.00	15	SNP	0.054	C
HS6ST1	9394	genome.wustl.edu	37	2	129026227	129026227	+	Missense_Mutation	SNP	G	G	T	rs3958533		TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:129026227G>T	ENST00000259241.6	-	2	758	c.745C>A	c.(745-747)Cgc>Agc	p.R249S		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	249					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)	p.R249S(1)		endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		CGCACCTGGCGGTTGTTGGCC	0.672																																						dbGAP											1	Substitution - Missense(1)	skin(1)											14.0	18.0	17.0					2																	129026227		1971	4143	6114	-	-	-	SO:0001583	missense	0			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.745C>A	2.37:g.129026227G>T	ENSP00000259241:p.Arg249Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	pfam_Sulfotransferase	p.R249S	ENST00000259241.6	37	c.745	CCDS42748.1	2	257	0.11767399267399267	38	0.07723577235772358	38	0.10497237569060773	62	0.10839160839160839	119	0.15699208443271767	G	27.0	4.792392	0.90453	.	.	ENSG00000136720	ENST00000259241	T	0.75821	-0.97	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.02571	0.0078	M	0.89601	3.045	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	T	0.48305	-0.9047	9	.	.	.	-0.1889	18.424	0.90602	0.0:0.0:1.0:0.0	rs3958533	249	O60243	H6ST1_HUMAN	S	249	ENSP00000259241:R249S	.	R	-	1	0	HS6ST1	128742697	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.939000	0.70179	2.346000	0.79739	0.462000	0.41574	CGC	HS6ST1	-	pfam_Sulfotransferase	ENSG00000136720		0.672	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST1	HGNC	protein_coding	OTTHUMT00000331572.1	13	0.00	0	G	NM_004807		129026227	129026227	-1	no_errors	ENST00000259241	ensembl	human	known	69_37n	missense	29	27.50	11	SNP	1.000	T
IDI1	3422	genome.wustl.edu	37	10	1087147	1087147	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr10:1087147C>T	ENST00000381344.3	-	5	1001	c.835G>A	c.(835-837)Gag>Aag	p.E279K	IDI2-AS1_ENST00000437374.1_RNA|IDI2-AS1_ENST00000536039.1_RNA|IDI2-AS1_ENST00000428780.2_RNA|IDI2-AS1_ENST00000420381.1_RNA|RNU7-163P_ENST00000459467.1_RNA|IDI1_ENST00000491735.1_5'UTR	NM_004508.2	NP_004499.2	Q13907	IDI1_HUMAN	isopentenyl-diphosphate delta isomerase 1	222					cholesterol biosynthetic process (GO:0006695)|dimethylallyl diphosphate biosynthetic process (GO:0050992)|isoprenoid biosynthetic process (GO:0008299)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|isopentenyl-diphosphate delta-isomerase activity (GO:0004452)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)			large_intestine(3)|lung(2)|prostate(1)	6		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.221)	Epithelial(11;0.0972)		TATATTTTCTCATGGTCAACA	0.279																																						dbGAP											0													24.0	23.0	23.0					10																	1087147		2199	4280	6479	-	-	-	SO:0001583	missense	0			BC006999	CCDS7056.1	10p15.3	2003-11-12	2005-07-25		ENSG00000067064	ENSG00000067064	5.3.3.2		5387	protein-coding gene	gene with protein product	"""IPP isomerase"""	604055	"""isopentenyl-diphosphate delta isomerase"""			8020941	Standard	NM_004508		Approved		uc001iga.3	Q13907	OTTHUMG00000017536	ENST00000381344.3:c.835G>A	10.37:g.1087147C>T	ENSP00000370748:p.Glu279Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E155|Q32Q13|Q53GQ6|Q86U81|Q8WUX8|Q96IZ4|Q9BQ74	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,pirsf_IsopentenylPP_isomerase_typ1,tigrfam_IsopentenylPP_isomerase_typ1	p.E279K	ENST00000381344.3	37	c.835	CCDS7056.1	10	.	.	.	.	.	.	.	.	.	.	C	10.98	1.503232	0.26949	.	.	ENSG00000067064	ENST00000381344	.	.	.	5.72	4.82	0.62117	.	0.344128	0.37219	N	0.002199	T	0.40347	0.1113	N	0.13299	0.325	0.40018	D	0.975371	B	0.06786	0.001	B	0.04013	0.001	T	0.22417	-1.0217	9	0.20046	T	0.44	-41.0499	15.3417	0.74303	0.0:0.9326:0.0:0.0674	.	279	Q13907-2	.	K	279	.	ENSP00000370748:E279K	E	-	1	0	IDI1	1077147	0.998000	0.40836	1.000000	0.80357	0.993000	0.82548	0.581000	0.23819	1.548000	0.49413	0.650000	0.86243	GAG	IDI1	-	pirsf_IsopentenylPP_isomerase_typ1	ENSG00000067064		0.279	IDI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	IDI1	HGNC	protein_coding	OTTHUMT00000046409.2	34	0.00	0	C	NM_004508		1087147	1087147	-1	no_errors	ENST00000381344	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	1.000	T
HSPA12A	259217	genome.wustl.edu	37	10	118464780	118464780	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr10:118464780C>T	ENST00000369209.3	-	3	240	c.136G>A	c.(136-138)Gac>Aac	p.D46N		NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	46						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		ACGTTGGAGTCAGTGTCGTTC	0.582																																						dbGAP											0													174.0	185.0	182.0					10																	118464780		2150	4270	6420	-	-	-	SO:0001583	missense	0			AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.136G>A	10.37:g.118464780C>T	ENSP00000358211:p.Asp46Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.D46N	ENST00000369209.3	37	c.136	CCDS41569.1	10	.	.	.	.	.	.	.	.	.	.	C	23.4	4.405772	0.83230	.	.	ENSG00000165868	ENST00000369209	T	0.42900	0.96	5.93	5.93	0.95920	.	0.043238	0.85682	D	0.000000	T	0.39517	0.1081	L	0.36672	1.1	0.80722	D	1	P	0.37663	0.604	B	0.38225	0.268	T	0.06463	-1.0825	10	0.28530	T	0.3	.	20.3507	0.98813	0.0:1.0:0.0:0.0	.	46	O43301	HS12A_HUMAN	N	46	ENSP00000358211:D46N	ENSP00000358211:D46N	D	-	1	0	HSPA12A	118454770	0.998000	0.40836	0.515000	0.27774	0.344000	0.29017	3.911000	0.56378	2.808000	0.96608	0.655000	0.94253	GAC	HSPA12A	-	NULL	ENSG00000165868		0.582	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA12A	HGNC	protein_coding	OTTHUMT00000050530.1	71	0.00	0	C	NM_025015		118464780	118464780	-1	no_errors	ENST00000369209	ensembl	human	known	69_37n	missense	127	27.01	47	SNP	0.997	T
IGKV2-30	28919	genome.wustl.edu	37	2	89545005	89545005	+	RNA	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:89545005G>C	ENST00000468494.1	-	0	74									immunoglobulin kappa variable 2-30																		CCTTACCTGGGACCCAGAGCA	0.567																																						dbGAP											0													26.0	27.0	27.0					2																	89545005		1778	4035	5813	-	-	-			0			X63403		2p11.2	2012-02-08			ENSG00000243238	ENSG00000243238		"""Immunoglobulins / IGK locus"""	5785	other	immunoglobulin gene							Standard	NG_000834		Approved				OTTHUMG00000151692		2.37:g.89545005G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.V15	ENST00000468494.1	37	c.45		2																																																																																			IGKV2-30	-	NULL	ENSG00000243238		0.567	IGKV2-30-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV2-30	HGNC	IG_V_gene	OTTHUMT00000323491.1	63	0.00	0	G	NG_000834		89545005	89545005	-1	no_stop_codon	ENST00000468494	ensembl	human	known	69_37n	silent	73	15.12	13	SNP	0.027	C
IKBKAP	8518	genome.wustl.edu	37	9	111653584	111653584	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr9:111653584G>A	ENST00000374647.5	-	28	3366	c.3059C>T	c.(3058-3060)tCa>tTa	p.S1020L	IKBKAP_ENST00000537196.1_Missense_Mutation_p.S671L|IKBKAP_ENST00000467959.1_5'Flank	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	1020					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CAGAAAGGCTGAGAGAGCTTT	0.562																																						dbGAP											0													88.0	83.0	85.0					9																	111653584		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.3059C>T	9.37:g.111653584G>A	ENSP00000363779:p.Ser1020Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSV2|Q9H327|Q9UG87	Nonsense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_UBA-like	p.Q67*	ENST00000374647.5	37	c.199	CCDS6773.1	9	.	.	.	.	.	.	.	.	.	.	G	12.74	2.029965	0.35797	.	.	ENSG00000070061	ENST00000374647;ENST00000537196	T;T	0.27720	2.04;1.65	5.76	1.13	0.20643	.	0.946846	0.08940	N	0.871782	T	0.24122	0.0584	L	0.44542	1.39	0.09310	N	1	B	0.20887	0.049	B	0.18263	0.021	T	0.29701	-1.0003	10	0.27082	T	0.32	0.012	7.0404	0.25017	0.0:0.1793:0.1807:0.6399	.	1020	O95163	ELP1_HUMAN	L	1020;671	ENSP00000363779:S1020L;ENSP00000439367:S671L	ENSP00000363779:S1020L	S	-	2	0	IKBKAP	110693405	0.160000	0.22878	0.001000	0.08648	0.922000	0.55478	1.980000	0.40618	-0.027000	0.13873	0.591000	0.81541	TCA	IKBKAP	-	superfamily_ARM-type_fold	ENSG00000070061		0.562	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKAP	HGNC	protein_coding	OTTHUMT00000053574.1	28	0.00	0	G			111653584	111653584	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000495759	ensembl	human	known	69_37n	nonsense	58	19.44	14	SNP	0.055	A
ING1	3621	genome.wustl.edu	37	13	111371698	111371698	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr13:111371698G>A	ENST00000375774.3	+	2	1150	c.688G>A	c.(688-690)Gag>Aag	p.E230K	ING1_ENST00000464141.1_3'UTR|ING1_ENST00000333219.7_Missense_Mutation_p.E87K|ING1_ENST00000375775.3_Missense_Mutation_p.E18K|ING1_ENST00000338450.7_Missense_Mutation_p.E43K	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	230					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GCTGGGCGACGAGAAGATCCA	0.667																																						dbGAP											0													48.0	58.0	55.0					13																	111371698		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.688G>A	13.37:g.111371698G>A	ENSP00000364929:p.Glu230Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E230K	ENST00000375774.3	37	c.688	CCDS9517.1	13	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224486	0.79576	.	.	ENSG00000153487	ENST00000338450;ENST00000333219;ENST00000375775;ENST00000375774	T;T	0.58210	1.01;0.35	5.13	5.13	0.70059	Inhibitor of growth protein, N-terminal (1);	0.048524	0.85682	D	0.000000	T	0.64327	0.2588	M	0.77616	2.38	0.80722	D	1	P;B;D	0.61697	0.929;0.048;0.99	B;B;P	0.48425	0.44;0.015;0.577	T	0.72290	-0.4337	10	0.87932	D	0	-47.5296	18.5935	0.91223	0.0:0.0:1.0:0.0	.	230;87;43	Q9UK53;Q5T9H0;Q9UK53-4	ING1_HUMAN;.;.	K	43;87;18;230	ENSP00000328436:E87K;ENSP00000364929:E230K	ENSP00000328436:E87K	E	+	1	0	ING1	110169699	1.000000	0.71417	0.960000	0.40013	0.914000	0.54420	9.228000	0.95250	2.385000	0.81259	0.484000	0.47621	GAG	ING1	-	NULL	ENSG00000153487		0.667	ING1-004	KNOWN	basic|CCDS	protein_coding	ING1	HGNC	protein_coding	OTTHUMT00000045770.2	13	0.00	0	G	NM_005537		111371698	111371698	+1	no_errors	ENST00000375774	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	1.000	A
IREB2	3658	genome.wustl.edu	37	15	78780591	78780591	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr15:78780591C>T	ENST00000258886.8	+	15	2013	c.1864C>T	c.(1864-1866)Cgt>Tgt	p.R622C		NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	622					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		TGATTGTGTTCGTGCCAATTA	0.378																																					NSCLC(200;764 2208 35157 49871 50830)	dbGAP											0													175.0	176.0	175.0					15																	78780591		2196	4293	6489	-	-	-	SO:0001583	missense	0			M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.1864C>T	15.37:g.78780591C>T	ENSP00000258886:p.Arg622Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2	p.R622C	ENST00000258886.8	37	c.1864	CCDS10302.1	15	.	.	.	.	.	.	.	.	.	.	C	18.24	3.581191	0.65992	.	.	ENSG00000136381	ENST00000258886	T	0.51574	0.7	5.4	5.4	0.78164	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3 (1);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);	0.048163	0.85682	D	0.000000	T	0.55226	0.1907	M	0.88450	2.955	0.80722	D	1	B	0.18166	0.026	B	0.14023	0.01	T	0.60177	-0.7314	10	0.87932	D	0	-15.7756	12.5168	0.56036	0.0:0.9239:0.0:0.0761	.	622	P48200	IREB2_HUMAN	C	622	ENSP00000258886:R622C	ENSP00000258886:R622C	R	+	1	0	IREB2	76567646	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.673000	0.61604	2.551000	0.86045	0.650000	0.86243	CGT	IREB2	-	pfam_Acoase/IPM_deHydtase_lsu_aba,superfamily_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2	ENSG00000136381		0.378	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IREB2	HGNC	protein_coding	OTTHUMT00000290109.3	139	0.71	1	C	NM_004136		78780591	78780591	+1	no_errors	ENST00000258886	ensembl	human	known	69_37n	missense	162	22.12	46	SNP	1.000	T
ITGAM	3684	genome.wustl.edu	37	16	31340573	31340573	+	Silent	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr16:31340573C>G	ENST00000287497.8	+	24	2892	c.2817C>G	c.(2815-2817)ctC>ctG	p.L939L	ITGAM_ENST00000544665.3_Silent_p.L940L			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	939					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						CTAAATATCTCAACTTCACGG	0.542																																						dbGAP											0													72.0	71.0	71.0					16																	31340573		1945	4157	6102	-	-	-	SO:0001819	synonymous_variant	0			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.2817C>G	16.37:g.31340573C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAK0|Q4VAK1|Q4VAK2	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.L940	ENST00000287497.8	37	c.2820	CCDS45470.1	16																																																																																			ITGAM	-	pfam_Integrin_alpha-2	ENSG00000169896		0.542	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAM	HGNC	protein_coding	OTTHUMT00000432816.1	60	0.00	0	C	NM_000632		31340573	31340573	+1	no_errors	ENST00000544665	ensembl	human	known	69_37n	silent	104	21.80	29	SNP	1.000	G
JAK1	3716	genome.wustl.edu	37	1	65335085	65335085	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:65335085C>G	ENST00000342505.4	-	6	804	c.556G>C	c.(556-558)Gag>Cag	p.E186Q		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	186	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CACTCGTTCTCAATATCATGT	0.502			Mis		ALL																																	dbGAP		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	0													141.0	136.0	138.0					1																	65335085		2018	4178	6196	-	-	-	SO:0001583	missense	0			M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.556G>C	1.37:g.65335085C>G	ENSP00000343204:p.Glu186Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GQ2|Q9UD26	Missense_Mutation	SNP	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak1,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_cat_dom	p.E186Q	ENST00000342505.4	37	c.556	CCDS41346.1	1	.	.	.	.	.	.	.	.	.	.	C	6.697	0.497152	0.12762	.	.	ENSG00000162434	ENST00000342505	T	0.53640	0.61	5.33	5.33	0.75918	FERM central domain (1);Band 4.1 domain (1);FERM domain (1);	.	.	.	.	T	0.14700	0.0355	N	0.19112	0.55	0.51482	D	0.999922	B	0.32653	0.379	B	0.26517	0.07	T	0.06180	-1.0841	9	0.07175	T	0.84	.	15.7354	0.77839	0.0:0.8634:0.1366:0.0	.	186	P23458	JAK1_HUMAN	Q	186	ENSP00000343204:E186Q	ENSP00000343204:E186Q	E	-	1	0	JAK1	65107673	1.000000	0.71417	0.905000	0.35620	0.717000	0.41224	4.615000	0.61190	2.663000	0.90544	0.655000	0.94253	GAG	JAK1	-	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000162434		0.502	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK1	HGNC	protein_coding	OTTHUMT00000025791.1	61	0.00	0	C	NM_002227		65335085	65335085	-1	no_errors	ENST00000342505	ensembl	human	known	69_37n	missense	94	29.85	40	SNP	1.000	G
JAKMIP2	9832	genome.wustl.edu	37	5	147019219	147019219	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr5:147019219G>A	ENST00000265272.5	-	10	1973	c.1506C>T	c.(1504-1506)atC>atT	p.I502I	JAKMIP2_ENST00000507386.1_Silent_p.I502I|JAKMIP2_ENST00000333010.6_Silent_p.I460I	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	502						Golgi apparatus (GO:0005794)		p.I502I(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCGTCGATGATGCCTCCCG	0.453																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											346.0	342.0	344.0					5																	147019219		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.1506C>T	5.37:g.147019219G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Silent	SNP	NULL	p.I502	ENST00000265272.5	37	c.1506	CCDS4285.1	5																																																																																			JAKMIP2	-	NULL	ENSG00000176049		0.453	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP2	HGNC	protein_coding	OTTHUMT00000251941.1	85	0.00	0	G	NM_014790		147019219	147019219	-1	no_errors	ENST00000265272	ensembl	human	known	69_37n	silent	145	23.68	45	SNP	1.000	A
KCNH1	3756	genome.wustl.edu	37	1	210970868	210970868	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:210970868C>G	ENST00000271751.4	-	9	1924	c.1897G>C	c.(1897-1899)Gag>Cag	p.E633Q	KCNH1_ENST00000367007.4_Missense_Mutation_p.E606Q			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	633					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GCCACCACCTCATCATCTTGG	0.562																																						dbGAP											0													115.0	121.0	119.0					1																	210970868		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1897G>C	1.37:g.210970868C>G	ENSP00000271751:p.Glu633Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.E633Q	ENST00000271751.4	37	c.1897	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442142	0.83993	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.96716	-4.1;-4.1	5.21	5.21	0.72293	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.97714	0.9250	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.98455	1.0593	10	0.66056	D	0.02	.	18.7569	0.91836	0.0:1.0:0.0:0.0	.	606;633	Q14CL3;O95259	.;KCNH1_HUMAN	Q	633;606	ENSP00000271751:E633Q;ENSP00000355974:E606Q	ENSP00000271751:E633Q	E	-	1	0	KCNH1	209037491	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	7.531000	0.81973	2.429000	0.82318	0.655000	0.94253	GAG	KCNH1	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000143473		0.562	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	HGNC	protein_coding	OTTHUMT00000088332.1	39	0.00	0	C	NM_002238		210970868	210970868	-1	no_errors	ENST00000271751	ensembl	human	known	69_37n	missense	65	14.47	11	SNP	1.000	G
KCNJ15	3772	genome.wustl.edu	37	21	39671692	39671692	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr21:39671692G>C	ENST00000328656.4	+	4	812	c.509G>C	c.(508-510)aGa>aCa	p.R170T	KCNJ15_ENST00000398938.2_Missense_Mutation_p.R170T|KCNJ15_ENST00000398932.1_Missense_Mutation_p.R170T|KCNJ15_ENST00000398930.1_Missense_Mutation_p.R170T|KCNJ15_ENST00000398934.1_Missense_Mutation_p.R170T	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	170					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	AAAATCGCCAGACCCAAAAAG	0.507																																						dbGAP											0													64.0	61.0	62.0					21																	39671692		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.509G>C	21.37:g.39671692G>C	ENSP00000331698:p.Arg170Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir1.3,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir1.1	p.R170T	ENST00000328656.4	37	c.509	CCDS13656.1	21	.	.	.	.	.	.	.	.	.	.	G	19.42	3.823813	0.71143	.	.	ENSG00000157551	ENST00000328656;ENST00000398938;ENST00000398932;ENST00000438657;ENST00000398930;ENST00000398934	D;D;D;D;D;D	0.93859	-3.3;-3.3;-3.3;-3.3;-3.3;-3.3	5.83	5.83	0.93111	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.97096	0.9051	M	0.85462	2.755	0.58432	D	0.999998	D	0.89917	1.0	D	0.74674	0.984	D	0.96642	0.9475	9	.	.	.	.	20.1338	0.98010	0.0:0.0:1.0:0.0	.	170	Q99712	IRK15_HUMAN	T	170	ENSP00000331698:R170T;ENSP00000381911:R170T;ENSP00000381905:R170T;ENSP00000414487:R170T;ENSP00000381904:R170T;ENSP00000381907:R170T	.	R	+	2	0	KCNJ15	38593562	1.000000	0.71417	0.997000	0.53966	0.746000	0.42486	4.377000	0.59562	2.770000	0.95276	0.655000	0.94253	AGA	KCNJ15	-	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000157551		0.507	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ15	HGNC	protein_coding	OTTHUMT00000207181.2	20	0.00	0	G	NM_002243		39671692	39671692	+1	no_errors	ENST00000328656	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	1.000	C
KDELR3	11015	genome.wustl.edu	37	22	38875754	38875754	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr22:38875754G>C	ENST00000216014.4	+	3	521	c.349G>C	c.(349-351)Gag>Cag	p.E117Q	KDELR3_ENST00000471268.1_3'UTR|KDELR3_ENST00000409006.3_Missense_Mutation_p.E117Q	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3	117					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					CACTCTGCTGGAGGTAAGGGA	0.483																																					Ovarian(11;103 529 24120 28493 32980)	dbGAP											0													182.0	188.0	186.0					22																	38875754		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520	ENST00000216014.4:c.349G>C	22.37:g.38875754G>C	ENSP00000216014:p.Glu117Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Missense_Mutation	SNP	pfam_ER_ret_rcpt,superfamily_Cyt_c_oxidase_su2-like_TM_dom,prints_ER_ret_rcpt	p.E117Q	ENST00000216014.4	37	c.349	CCDS13972.1	22	.	.	.	.	.	.	.	.	.	.	G	22.8	4.340143	0.81911	.	.	ENSG00000100196	ENST00000216014;ENST00000409006	T;T	0.29142	1.58;1.58	4.39	4.39	0.52855	.	0.053689	0.64402	N	0.000001	T	0.53158	0.1779	M	0.89968	3.075	0.80722	D	1	P;P	0.45011	0.848;0.648	P;P	0.48952	0.58;0.596	T	0.65869	-0.6063	10	0.56958	D	0.05	.	17.18	0.86852	0.0:0.0:1.0:0.0	.	117;117	O43731;O43731-2	ERD23_HUMAN;.	Q	117	ENSP00000216014:E117Q;ENSP00000386918:E117Q	ENSP00000216014:E117Q	E	+	1	0	KDELR3	37205700	1.000000	0.71417	0.998000	0.56505	0.856000	0.48823	9.420000	0.97426	2.284000	0.76573	0.655000	0.94253	GAG	KDELR3	-	pfam_ER_ret_rcpt,superfamily_Cyt_c_oxidase_su2-like_TM_dom	ENSG00000100196		0.483	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELR3	HGNC	protein_coding	OTTHUMT00000331474.1	65	0.00	0	G			38875754	38875754	+1	no_errors	ENST00000409006	ensembl	human	known	69_37n	missense	44	24.14	14	SNP	1.000	C
CEP162	22832	genome.wustl.edu	37	6	84870632	84870632	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr6:84870632C>T	ENST00000403245.3	-	21	2794	c.2680G>A	c.(2680-2682)Gag>Aag	p.E894K	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_Missense_Mutation_p.E818K	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		TTCAGTTTCTCAATCTGTCAA	0.348																																						dbGAP											0													108.0	107.0	107.0					6																	84870632		2203	4299	6502	-	-	-	SO:0001583	missense	0																														ENST00000403245.3:c.2680G>A	6.37:g.84870632C>T	ENSP00000385215:p.Glu894Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E894K	ENST00000403245.3	37	c.2680	CCDS34494.2	6	.	.	.	.	.	.	.	.	.	.	C	17.41	3.382546	0.61845	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.29142	1.58;1.58	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000003	T	0.41328	0.1154	L	0.44542	1.39	0.54753	D	0.999985	D	0.76494	0.999	D	0.74674	0.984	T	0.05699	-1.0869	10	0.39692	T	0.17	-16.0403	19.8165	0.96571	0.0:1.0:0.0:0.0	.	894	Q5TB80	QN1_HUMAN	K	818;894	ENSP00000257766:E818K;ENSP00000385215:E894K	ENSP00000257766:E818K	E	-	1	0	KIAA1009	84927351	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	5.355000	0.66046	2.683000	0.91414	0.655000	0.94253	GAG	KIAA1009	-	NULL	ENSG00000135315		0.348	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1009	HGNC	protein_coding	OTTHUMT00000317315.1	126	0.00	0	C			84870632	84870632	-1	no_errors	ENST00000403245	ensembl	human	known	69_37n	missense	97	41.92	70	SNP	1.000	T
KLRK1	22914	genome.wustl.edu	37	12	10531234	10531234	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr12:10531234C>G	ENST00000240618.6	-	6	488	c.348G>C	c.(346-348)gaG>gaC	p.E116D	RP11-277P12.20_ENST00000500682.1_RNA|KLRK1_ENST00000540818.1_Missense_Mutation_p.E116D|KLRC4-KLRK1_ENST00000539300.1_3'UTR	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	116	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						AGTTTTTACTCTCATCAAAAA	0.343																																						dbGAP											0													84.0	89.0	87.0					12																	10531234		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.348G>C	12.37:g.10531234C>G	ENSP00000240618:p.Glu116Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.E116D	ENST00000240618.6	37	c.348	CCDS8623.1	12	.	.	.	.	.	.	.	.	.	.	C	12.10	1.836108	0.32421	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.58940	0.3;0.3	5.96	-2.42	0.06542	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.099903	0.43747	D	0.000534	T	0.67720	0.2923	M	0.65975	2.015	0.09310	N	0.999999	D;D	0.89917	1.0;0.987	D;D	0.97110	1.0;0.959	T	0.62201	-0.6904	10	0.72032	D	0.01	.	10.353	0.43948	0.0:0.3704:0.0:0.6296	.	97;116	Q1HEA1;P26718	.;NKG2D_HUMAN	D	116	ENSP00000240618:E116D;ENSP00000446003:E116D	ENSP00000240618:E116D	E	-	3	2	KLRK1	10422501	0.025000	0.19082	0.002000	0.10522	0.004000	0.04260	-0.025000	0.12413	-0.298000	0.08921	-0.150000	0.13652	GAG	KLRK1	-	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	ENSG00000213809		0.343	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRK1	HGNC	protein_coding	OTTHUMT00000400269.1	85	0.00	0	C	NM_007360		10531234	10531234	-1	no_errors	ENST00000240618	ensembl	human	known	69_37n	missense	74	20.21	19	SNP	0.004	G
KMO	8564	genome.wustl.edu	37	1	241729857	241729857	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:241729857G>C	ENST00000366559.4	+	9	1065	c.754G>C	c.(754-756)Gat>Cat	p.D252H	KMO_ENST00000366557.4_Missense_Mutation_p.D252H|KMO_ENST00000366558.3_Missense_Mutation_p.D252H	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)											NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			AACCAGTAATGATGTGGTAGA	0.373																																						dbGAP											0													127.0	123.0	125.0					1																	241729857		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.754G>C	1.37:g.241729857G>C	ENSP00000355517:p.Asp252His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_mOase_FAD-bd,prints_Rng_hydrolase-like	p.D252H	ENST00000366559.4	37	c.754	CCDS1618.1	1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598422	0.46318	.	.	ENSG00000117009	ENST00000366559;ENST00000366558;ENST00000366557	T;T;T	0.53423	0.62;0.62;0.62	5.92	5.01	0.66863	Monooxygenase, FAD-binding (1);	0.193701	0.53938	D	0.000044	T	0.65439	0.2691	M	0.72894	2.215	0.46678	D	0.999154	D;B;D	0.71674	0.997;0.412;0.998	D;B;D	0.65773	0.933;0.301;0.938	T	0.69217	-0.5203	10	0.66056	D	0.02	.	13.4521	0.61178	0.0:0.3001:0.6999:0.0	.	252;252;252	O15229;A8K693;O15229-2	KMO_HUMAN;.;.	H	252	ENSP00000355517:D252H;ENSP00000355516:D252H;ENSP00000355515:D252H	ENSP00000355515:D252H	D	+	1	0	KMO	239796480	1.000000	0.71417	0.841000	0.33234	0.850000	0.48378	4.122000	0.57910	1.502000	0.48669	0.650000	0.86243	GAT	KMO	-	pfam_mOase_FAD-bd	ENSG00000117009		0.373	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMO	HGNC	protein_coding	OTTHUMT00000095612.1	76	0.00	0	G	NM_003679		241729857	241729857	+1	no_errors	ENST00000366559	ensembl	human	known	69_37n	missense	126	14.29	21	SNP	0.959	C
KRTAP6-1	337966	genome.wustl.edu	37	21	31986143	31986143	+	Silent	SNP	A	A	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr21:31986143A>G	ENST00000329122.2	-	1	106	c.81T>C	c.(79-81)taT>taC	p.Y27Y	KRTAP20-1_ENST00000334664.2_5'Flank	NM_181602.1	NP_853633.1	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	27						cytosol (GO:0005829)|intermediate filament (GO:0005882)				breast(2)|endometrium(1)|lung(7)	10						CCAGGCCTCCATAGCCATAGC	0.597																																						dbGAP											0													163.0	163.0	163.0					21																	31986143		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AP001708	CCDS13602.1	21q22.1	2006-03-13			ENSG00000184724	ENSG00000184724		"""Keratin associated proteins"""	18931	protein-coding gene	gene with protein product						12359730	Standard	NM_181602		Approved	KAP6.1, C21orf103	uc002yop.3	Q3LI64	OTTHUMG00000057788	ENST00000329122.2:c.81T>C	21.37:g.31986143A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.Y27	ENST00000329122.2	37	c.81	CCDS13602.1	21																																																																																			KRTAP6-1	-	NULL	ENSG00000184724		0.597	KRTAP6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP6-1	HGNC	protein_coding	OTTHUMT00000128240.2	114	0.00	0	A	NM_181602		31986143	31986143	-1	no_errors	ENST00000329122	ensembl	human	known	69_37n	silent	139	26.70	51	SNP	0.881	G
LCMT2	9836	genome.wustl.edu	37	15	43622050	43622050	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr15:43622050G>T	ENST00000305641.5	-	1	753	c.638C>A	c.(637-639)gCc>gAc	p.A213D	LCMT2_ENST00000544735.1_Intron|ADAL_ENST00000389651.4_5'Flank|ADAL_ENST00000428046.3_5'Flank|ADAL_ENST00000422466.2_5'Flank|LCMT2_ENST00000567039.1_Intron	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	213					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	CACGAAAAGGGCATTAGGAAA	0.617																																						dbGAP											0													41.0	35.0	37.0					15																	43622050		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.638C>A	15.37:g.43622050G>T	ENSP00000307214:p.Ala213Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4JFT6|Q96B55|Q9NR10	Missense_Mutation	SNP	pfam_LCM_MeTrfase	p.A213D	ENST00000305641.5	37	c.638	CCDS10094.1	15	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104758	0.77096	.	.	ENSG00000168806	ENST00000305641	T	0.22134	1.97	5.39	5.39	0.77823	.	0.067543	0.64402	D	0.000012	T	0.49525	0.1562	M	0.88377	2.95	0.80722	D	1	D	0.69078	0.997	P	0.61397	0.888	T	0.56553	-0.7960	10	0.72032	D	0.01	-29.1224	14.535	0.67953	0.0:0.0:1.0:0.0	.	213	O60294	LCMT2_HUMAN	D	213	ENSP00000307214:A213D	ENSP00000307214:A213D	A	-	2	0	LCMT2	41409342	1.000000	0.71417	0.968000	0.41197	0.938000	0.57974	7.481000	0.81124	2.804000	0.96469	0.655000	0.94253	GCC	LCMT2	-	NULL	ENSG00000168806		0.617	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCMT2	HGNC	protein_coding	OTTHUMT00000253205.1	15	0.00	0	G	NM_014793		43622050	43622050	-1	no_errors	ENST00000305641	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	0.756	T
LCTL	197021	genome.wustl.edu	37	15	66845480	66845480	+	Missense_Mutation	SNP	G	G	A	rs536892584		TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr15:66845480G>A	ENST00000341509.5	-	9	1170	c.1039C>T	c.(1039-1041)Cgg>Tgg	p.R347W	LCTL_ENST00000537670.1_Missense_Mutation_p.R174W	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like	347					carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GTGATGTACCGAGTAGTAAAA	0.527																																						dbGAP											0													153.0	148.0	150.0					15																	66845480		2201	4299	6500	-	-	-	SO:0001583	missense	0			AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.1039C>T	15.37:g.66845480G>A	ENSP00000343490:p.Arg347Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQY0	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.R347W	ENST00000341509.5	37	c.1039	CCDS10220.1	15	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908761	0.72868	.	.	ENSG00000188501	ENST00000537670;ENST00000341509	T;T	0.34667	1.35;1.35	5.51	4.58	0.56647	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.63295	0.2499	M	0.86028	2.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.987;1.0	T	0.67110	-0.5753	10	0.39692	T	0.17	-37.0342	14.9461	0.71032	0.0:0.0:0.856:0.144	.	174;347	B3KQY0;Q6UWM7	.;LCTL_HUMAN	W	174;347	ENSP00000445419:R174W;ENSP00000343490:R347W	ENSP00000343490:R347W	R	-	1	2	LCTL	64632534	1.000000	0.71417	0.527000	0.27925	0.523000	0.34469	4.017000	0.57167	1.410000	0.46936	0.655000	0.94253	CGG	LCTL	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	ENSG00000188501		0.527	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCTL	HGNC	protein_coding	OTTHUMT00000256921.2	58	0.00	0	G	NM_207338		66845480	66845480	-1	no_errors	ENST00000341509	ensembl	human	known	69_37n	missense	54	28.00	21	SNP	0.998	A
LMBR1L	55716	genome.wustl.edu	37	12	49491488	49491488	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr12:49491488G>A	ENST00000267102.8	-	17	1779	c.1437C>T	c.(1435-1437)ttC>ttT	p.F479F	DHH_ENST00000266991.2_5'Flank|LMBR1L_ENST00000395141.4_Silent_p.F474F|LMBR1L_ENST00000547382.1_Silent_p.F459F	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like	479					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						ATGCCTGGGGGAAACCGGAGA	0.607											OREG0021783	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													83.0	78.0	80.0					12																	49491488		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.1437C>T	12.37:g.49491488G>A		Somatic	962	WXS	Illumina GAIIx	Phase_IV	Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	Missense_Mutation	SNP	pfam_LMBR1-like_membr_prot,prints_Lipcalin_1_rcpt	p.S175F	ENST00000267102.8	37	c.524	CCDS8780.2	12																																																																																			LMBR1L	-	NULL	ENSG00000139636		0.607	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBR1L	HGNC	protein_coding	OTTHUMT00000318696.1	54	0.00	0	G	NM_018113		49491488	49491488	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000553040	ensembl	human	known	69_37n	missense	133	17.39	28	SNP	0.605	A
LRP1B	53353	genome.wustl.edu	37	2	141643815	141643815	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:141643815C>T	ENST00000389484.3	-	24	4827	c.3856G>A	c.(3856-3858)Gga>Aga	p.G1286R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1286					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTTCTCAATCCAGGAACAAGT	0.343										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	dbGAP											0													82.0	84.0	83.0					2																	141643815		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3856G>A	2.37:g.141643815C>T	ENSP00000374135:p.Gly1286Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.G1286R	ENST00000389484.3	37	c.3856	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	26.9	4.780755	0.90195	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.92149	-2.98;-2.98	5.78	5.78	0.91487	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.96491	0.8855	M	0.84082	2.675	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.982	D	0.95955	0.8957	10	0.52906	T	0.07	.	20.0175	0.97485	0.0:1.0:0.0:0.0	.	469;1286	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	R	1286;1224;431	ENSP00000374135:G1286R;ENSP00000413239:G431R	ENSP00000374135:G1286R	G	-	1	0	LRP1B	141360285	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.642000	0.83385	2.730000	0.93505	0.650000	0.86243	GGA	LRP1B	-	smart_LDLR_classB_rpt	ENSG00000168702		0.343	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	75	0.00	0	C	NM_018557		141643815	141643815	-1	no_errors	ENST00000389484	ensembl	human	known	69_37n	missense	65	25.29	22	SNP	1.000	T
LRRFIP2	9209	genome.wustl.edu	37	3	37152548	37152548	+	Silent	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:37152548G>C	ENST00000336686.4	-	9	527	c.447C>G	c.(445-447)ctC>ctG	p.L149L	LRRFIP2_ENST00000440230.1_Intron|LRRFIP2_ENST00000396428.2_Intron|LRRFIP2_ENST00000421276.2_Intron|LRRFIP2_ENST00000354379.4_Intron|LRRFIP2_ENST00000421307.1_Silent_p.L149L			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	149	DVL3-binding.|Ser-rich.				Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						GGTCAAAGTAGAGGCCACTCT	0.368																																						dbGAP											1	Whole gene deletion(1)	ovary(1)											95.0	83.0	87.0					3																	37152548		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.447C>G	3.37:g.37152548G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Silent	SNP	pfam_Leu-rich_rep_flightless-int_pr,superfamily_HLH_DNA-bd,superfamily_Prefoldin	p.L149	ENST00000336686.4	37	c.447	CCDS2664.1	3																																																																																			LRRFIP2	-	NULL	ENSG00000093167		0.368	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	LRRFIP2	HGNC	protein_coding	OTTHUMT00000253335.3	65	0.00	0	G	NM_006309		37152548	37152548	-1	no_errors	ENST00000336686	ensembl	human	known	69_37n	silent	71	26.80	26	SNP	1.000	C
MACROD2	140733	genome.wustl.edu	37	20	14066298	14066298	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr20:14066298G>C	ENST00000310348.4	+	3	195	c.195G>C	c.(193-195)aaG>aaC	p.K65N	MACROD2_ENST00000217246.4_Missense_Mutation_p.K65N			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	65	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				CCCAGGTGAAGAAAAGTTTGA	0.308																																						dbGAP											0													80.0	75.0	76.0					20																	14066298		1808	4062	5870	-	-	-	SO:0001583	missense	0			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.195G>C	20.37:g.14066298G>C	ENSP00000309809:p.Lys65Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	pfam_A1pp,smart_A1pp,pfscan_A1pp	p.K65N	ENST00000310348.4	37	c.195	CCDS13120.2	20	.	.	.	.	.	.	.	.	.	.	G	10.06	1.247441	0.22880	.	.	ENSG00000172264	ENST00000217246;ENST00000310348	T;T	0.41400	1.0;1.0	5.76	4.81	0.61882	Appr-1-p processing (1);	0.333216	0.32328	N	0.006247	T	0.33527	0.0866	N	0.01631	-0.79	0.80722	D	1	D;B	0.71674	0.998;0.041	D;B	0.78314	0.991;0.022	T	0.43097	-0.9412	10	0.21014	T	0.42	-12.0217	12.3394	0.55085	0.0816:0.0:0.9184:0.0	.	65;65	A1Z1Q3;A1Z1Q3-2	MACD2_HUMAN;.	N	65	ENSP00000217246:K65N;ENSP00000309809:K65N	ENSP00000217246:K65N	K	+	3	2	MACROD2	14014298	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.491000	0.53252	1.433000	0.47394	0.585000	0.79938	AAG	MACROD2	-	pfscan_A1pp	ENSG00000172264		0.308	MACROD2-201	KNOWN	basic|CCDS	protein_coding	MACROD2	HGNC	protein_coding		58	0.00	0	G	NM_080676		14066298	14066298	+1	no_errors	ENST00000310348	ensembl	human	known	69_37n	missense	58	22.67	17	SNP	1.000	C
MANBA	4126	genome.wustl.edu	37	4	103557111	103557111	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr4:103557111G>C	ENST00000226578.4	-	15	2167	c.2068C>G	c.(2068-2070)Cca>Gca	p.P690A	MANBA_ENST00000505239.1_Missense_Mutation_p.P633A	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	690					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)			cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		GGCAACAGTGGAGCAAAGAAA	0.408																																						dbGAP											0													100.0	97.0	98.0					4																	103557111		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.2068C>G	4.37:g.103557111G>C	ENSP00000226578:p.Pro690Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BC3|Q9NYX9	Missense_Mutation	SNP	pfam_Glyco_hydro_2_N,pfam_Glyco_hydro_2_TIM,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,superfamily_Glyco_hydro_2_Ig-like	p.P690A	ENST00000226578.4	37	c.2068	CCDS3658.1	4	.	.	.	.	.	.	.	.	.	.	G	12.05	1.820575	0.32145	.	.	ENSG00000109323	ENST00000226578;ENST00000505239	D;D	0.96396	-4.0;-4.0	5.42	4.56	0.56223	Glycoside hydrolase, subgroup, catalytic domain (1);	0.153517	0.64402	N	0.000015	D	0.96128	0.8738	M	0.79926	2.475	0.50313	D	0.999867	P;B	0.34864	0.473;0.343	B;B	0.37144	0.123;0.242	D	0.95373	0.8466	10	0.56958	D	0.05	-10.9413	16.3085	0.82859	0.0:0.1422:0.8578:0.0	.	633;690	E9PFW2;O00462	.;MANBA_HUMAN	A	690;633	ENSP00000226578:P690A;ENSP00000427322:P633A	ENSP00000226578:P690A	P	-	1	0	MANBA	103776159	1.000000	0.71417	0.308000	0.25141	0.532000	0.34746	3.867000	0.56047	1.221000	0.43506	0.655000	0.94253	CCA	MANBA	-	NULL	ENSG00000109323		0.408	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MANBA	HGNC	protein_coding	OTTHUMT00000253803.2	32	0.00	0	G			103557111	103557111	-1	no_errors	ENST00000226578	ensembl	human	known	69_37n	missense	37	37.29	22	SNP	0.987	C
MAP1B	4131	genome.wustl.edu	37	5	71495716	71495716	+	Missense_Mutation	SNP	C	C	G	rs147666683		TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr5:71495716C>G	ENST00000296755.7	+	5	6832	c.6534C>G	c.(6532-6534)atC>atG	p.I2178M		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2178					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ATGCCAATATCGACTCTGAAG	0.597																																					Melanoma(17;367 822 11631 31730 47712)	dbGAP											0													117.0	106.0	110.0					5																	71495716		2203	4300	6503	-	-	-	SO:0001583	missense	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.6534C>G	5.37:g.71495716C>G	ENSP00000296755:p.Ile2178Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDK5	Missense_Mutation	SNP	pfam_MAP1B_neuraxin	p.I2178M	ENST00000296755.7	37	c.6534	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	C	7.246	0.602194	0.13939	.	.	ENSG00000131711	ENST00000296755	T	0.03413	3.94	5.82	-1.21	0.09524	.	0.000000	0.64402	D	0.000004	T	0.04861	0.0131	N	0.11427	0.14	0.33732	D	0.618322	B;D	0.89917	0.423;1.0	B;D	0.74674	0.165;0.984	T	0.38908	-0.9639	10	0.34782	T	0.22	-18.8623	8.2329	0.31608	0.1171:0.2695:0.0:0.6133	.	2052;2178	A2BDK6;P46821	.;MAP1B_HUMAN	M	2178	ENSP00000296755:I2178M	ENSP00000296755:I2178M	I	+	3	3	MAP1B	71531472	0.004000	0.15560	0.616000	0.29078	0.948000	0.59901	-1.230000	0.02942	-0.606000	0.05746	-0.742000	0.03525	ATC	MAP1B	-	NULL	ENSG00000131711		0.597	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	34	0.00	0	C	NM_005909		71495716	71495716	+1	no_errors	ENST00000296755	ensembl	human	known	69_37n	missense	67	21.18	18	SNP	0.685	G
MAP3K5	4217	genome.wustl.edu	37	6	136901490	136901490	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr6:136901490C>G	ENST00000359015.4	-	25	3826	c.3466G>C	c.(3466-3468)Gac>Cac	p.D1156H	MAP3K5_ENST00000463140.1_5'UTR|MAP3K5_ENST00000355845.4_Missense_Mutation_p.D403H	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	1156					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		ATGATACTGTCTAAGGCAAAC	0.388																																						dbGAP											0													161.0	146.0	151.0					6																	136901490		2203	4300	6503	-	-	-	SO:0001583	missense	0			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.3466G>C	6.37:g.136901490C>G	ENSP00000351908:p.Asp1156His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D1156H	ENST00000359015.4	37	c.3466	CCDS5179.1	6	.	.	.	.	.	.	.	.	.	.	C	30	5.053417	0.93793	.	.	ENSG00000197442	ENST00000359015;ENST00000355845;ENST00000367768	T;D	0.81659	-1.39;-1.52	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	D	0.89853	0.6835	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.91316	0.5078	10	0.87932	D	0	.	18.6296	0.91355	0.0:1.0:0.0:0.0	.	1237;1156	Q59GL6;Q99683	.;M3K5_HUMAN	H	1156;403;1236	ENSP00000351908:D1156H;ENSP00000348104:D403H	ENSP00000348104:D403H	D	-	1	0	MAP3K5	136943183	1.000000	0.71417	0.992000	0.48379	0.988000	0.76386	7.445000	0.80570	2.457000	0.83068	0.591000	0.81541	GAC	MAP3K5	-	NULL	ENSG00000197442		0.388	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	HGNC	protein_coding	OTTHUMT00000042383.1	99	0.00	0	C			136901490	136901490	-1	no_errors	ENST00000359015	ensembl	human	known	69_37n	missense	126	40.09	85	SNP	1.000	G
MCM4	4173	genome.wustl.edu	37	8	48888382	48888382	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr8:48888382G>T	ENST00000262105.2	+	15	2682	c.2473G>T	c.(2473-2475)Gaa>Taa	p.E825*	MCM4_ENST00000523944.1_Nonsense_Mutation_p.E825*	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	825					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				GCAACTTTTTGAAGATATTCG	0.338																																						dbGAP											0													67.0	68.0	67.0					8																	48888382		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.2473G>T	8.37:g.48888382G>T	ENSP00000262105:p.Glu825*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NEH1|Q99658	Nonsense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_4,prints_MCM_DNA-dep_ATPase	p.E825*	ENST00000262105.2	37	c.2473	CCDS6143.1	8	.	.	.	.	.	.	.	.	.	.	G	20.4	3.984867	0.74474	.	.	ENSG00000104738	ENST00000523944;ENST00000262105;ENST00000396826;ENST00000429229;ENST00000518382;ENST00000524276	.	.	.	6.03	5.16	0.70880	.	0.141947	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-24.4399	15.3304	0.74203	0.0667:0.0:0.9333:0.0	.	.	.	.	X	825;825;812;785;100;109	.	ENSP00000262105:E825X	E	+	1	0	MCM4	49050935	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.055000	0.71103	1.564000	0.49628	0.557000	0.71058	GAA	MCM4	-	NULL	ENSG00000104738		0.338	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM4	HGNC	protein_coding	OTTHUMT00000377791.1	63	0.00	0	G	NM_005914		48888382	48888382	+1	no_errors	ENST00000262105	ensembl	human	known	69_37n	nonsense	51	42.05	37	SNP	1.000	T
MFAP2	4237	genome.wustl.edu	37	1	17301448	17301448	+	Silent	SNP	C	C	T	rs2235933	byFrequency	TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:17301448C>T	ENST00000375535.3	-	9	808	c.519G>A	c.(517-519)gcG>gcA	p.A173A	MFAP2_ENST00000438542.1_Silent_p.A172A|MFAP2_ENST00000490075.1_5'UTR|MFAP2_ENST00000375534.3_Silent_p.A172A			P55001	MFAP2_HUMAN	microfibrillar-associated protein 2	173	ShKT. {ECO:0000255|PROSITE- ProRule:PRU01005}.				extracellular matrix organization (GO:0030198)|platelet formation (GO:0030220)	extracellular region (GO:0005576)|microfibril (GO:0001527)				kidney(1)|lung(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000118)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000538)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|COAD - Colon adenocarcinoma(227;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;3.04e-05)|Kidney(64;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00544)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CACAGGAGGCCGCCACGGATT	0.662													C|||	1708	0.341054	0.2057	0.389	5008	,	,		11792	0.6151		0.2833	False		,,,				2504	0.2669					dbGAP											0													3.0	4.0	4.0					1																	17301448		1911	3756	5667	-	-	-	SO:0001819	synonymous_variant	0			BC015039	CCDS174.1, CCDS44071.1	1p36.1-p35	2008-02-05			ENSG00000117122	ENSG00000117122			7033	protein-coding gene	gene with protein product		156790				7759096	Standard	NM_017459		Approved	MAGP, MAGP-1	uc001azw.3	P55001	OTTHUMG00000002290	ENST00000375535.3:c.519G>A	1.37:g.17301448C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53X60|Q5JXY0	Silent	SNP	pfam_MAGP,pfam_ShK_toxin	p.A173	ENST00000375535.3	37	c.519	CCDS174.1	1																																																																																			MFAP2	-	pfam_ShK_toxin	ENSG00000117122		0.662	MFAP2-001	KNOWN	basic|CCDS	protein_coding	MFAP2	HGNC	protein_coding	OTTHUMT00000006609.1	8	0.00	0	C	NM_002403		17301448	17301448	-1	no_errors	ENST00000375535	ensembl	human	known	69_37n	silent	9	43.75	7	SNP	0.520	T
MEAF6	64769	genome.wustl.edu	37	1	37975075	37975075	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:37975075G>A	ENST00000296214.5	-	3	302	c.275C>T	c.(274-276)tCc>tTc	p.S92F	MEAF6_ENST00000373075.2_Missense_Mutation_p.S92F|MEAF6_ENST00000373074.1_Missense_Mutation_p.S70F|MEAF6_ENST00000448519.2_Missense_Mutation_p.S92F|MEAF6_ENST00000373073.4_Missense_Mutation_p.S92F|MEAF6_ENST00000475828.1_5'UTR	NM_001270875.1	NP_001257804.1	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6	92					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(3)	7						GGTAACCGAGGATTTACTGAA	0.448																																						dbGAP											0													232.0	232.0	232.0					1																	37975075		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016328	CCDS418.1, CCDS59195.1, CCDS59196.1	1p35.3-p33	2011-08-12	2009-07-13	2009-07-13	ENSG00000163875	ENSG00000163875			25674	protein-coding gene	gene with protein product	"""Esa1p-associated factor 6 homolog (S. cerevisiae)"", ""centromere protein 28"""	611001	"""chromosome 1 open reading frame 149"""	C1orf149		8619474, 9110174, 12963728, 14966270, 16387653	Standard	NM_022756		Approved	NY-SAR-91, FLJ11730, Eaf6, CENP-28	uc001cbe.2	Q9HAF1	OTTHUMG00000004223	ENST00000296214.5:c.275C>T	1.37:g.37975075G>A	ENSP00000296214:p.Ser92Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AK64|Q4F967|Q7Z311|Q86WE3	Missense_Mutation	SNP	pfam_Hist_AcTrfase_NuA4_cplx	p.S92F	ENST00000296214.5	37	c.275	CCDS59196.1	1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.191890	0.78902	.	.	ENSG00000163875	ENST00000373075;ENST00000296214;ENST00000373074;ENST00000373073;ENST00000448519	.	.	.	4.66	4.66	0.58398	.	0.048728	0.85682	D	0.000000	D	0.83830	0.5339	M	0.93978	3.48	0.80722	D	1	P;P;D;P	0.57571	0.95;0.928;0.98;0.918	P;P;P;P	0.56700	0.648;0.683;0.804;0.601	D	0.89092	0.3483	9	0.87932	D	0	.	17.5244	0.87795	0.0:0.0:1.0:0.0	.	92;92;92;70	Q9HAF1-2;Q9HAF1;Q9HAF1-3;B1AK63	.;EAF6_HUMAN;.;.	F	92;92;70;92;92	.	ENSP00000296214:S92F	S	-	2	0	MEAF6	37747662	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	9.484000	0.97940	2.304000	0.77564	0.484000	0.47621	TCC	MEAF6	-	pfam_Hist_AcTrfase_NuA4_cplx	ENSG00000163875		0.448	MEAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEAF6	HGNC	protein_coding	OTTHUMT00000012161.1	72	0.00	0	G	NM_022756		37975075	37975075	-1	no_errors	ENST00000373075	ensembl	human	known	69_37n	missense	84	22.22	24	SNP	1.000	A
MIR30B	407030	genome.wustl.edu	37	8	135812794	135812794	+	lincRNA	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr8:135812794C>T	ENST00000568248.1	-	0	0				MIR30B_ENST00000384850.1_RNA																							ATCCACCTCCCAGCCAATCCA	0.353																																						dbGAP											0													45.0	41.0	42.0					8																	135812794		1568	3579	5147	-	-	-			0																															8.37:g.135812794C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000568248.1	37	NULL		8																																																																																			MIR30B	-	-	ENSG00000207582		0.353	AC083843.1-001	KNOWN	basic	lincRNA	MIR30B	HGNC	lincRNA	OTTHUMT00000378288.1	58	0.00	0	C			135812794	135812794	-1	no_errors	ENST00000384850	ensembl	human	known	69_37n	rna	45	50.55	46	SNP	1.000	T
KMT2B	9757	genome.wustl.edu	37	19	36220993	36220993	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:36220993C>A	ENST00000222270.7	+	23	5043	c.5043C>A	c.(5041-5043)ttC>ttA	p.F1681L	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Missense_Mutation_p.F1681L	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1681					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										AGAAAGTCTTCTGCCAGAAAC	0.587																																						dbGAP											0													54.0	58.0	57.0					19																	36220993		2092	4220	6312	-	-	-	SO:0001583	missense	0			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.5043C>A	19.37:g.36220993C>A	ENSP00000222270:p.Phe1681Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	pirsf_MeTrfase_trithorax,pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.F1681L	ENST00000222270.7	37	c.5043	CCDS46055.1	19	.	.	.	.	.	.	.	.	.	.	C	8.756	0.922534	0.17982	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	T;T	0.70869	-0.52;-0.52	5.37	-1.7	0.08159	Zinc finger, PHD-type (1);	0.000000	0.46758	D	0.000270	T	0.56688	0.2002	L	0.38692	1.165	0.46317	D	0.99898	P	0.48407	0.91	P	0.45071	0.468	T	0.55471	-0.8136	10	0.13470	T	0.59	.	11.4571	0.50189	0.0:0.5979:0.0:0.4021	.	1681	Q9UMN6	MLL4_HUMAN	L	1681	ENSP00000222270:F1681L;ENSP00000398837:F1681L	ENSP00000222270:F1681L	F	+	3	2	AD000671.1	40912833	1.000000	0.71417	0.933000	0.37362	0.031000	0.12232	1.244000	0.32778	-0.061000	0.13110	-1.105000	0.02106	TTC	MLL4	-	pirsf_MeTrfase_trithorax,smart_Znf_PHD	ENSG00000105663		0.587	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL4	Clone_based_vega_gene	protein_coding		31	0.00	0	C	NM_014727		36220993	36220993	+1	no_errors	ENST00000222270	ensembl	human	known	69_37n	missense	82	20.19	21	SNP	0.989	A
MTHFR	4524	genome.wustl.edu	37	1	11863157	11863157	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:11863157C>G	ENST00000376592.1	-	1	145	c.17G>C	c.(16-18)aGa>aCa	p.R6T	MTHFR_ENST00000376590.3_Missense_Mutation_p.R6T|MTHFR_ENST00000376585.1_Missense_Mutation_p.R47T|MTHFR_ENST00000376583.3_Missense_Mutation_p.R47T			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)	6					blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)			NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	GCTGTTTCCTCTGGCTTCGTT	0.622																																						dbGAP											0													67.0	50.0	56.0					1																	11863157		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277	ENST00000376592.1:c.17G>C	1.37:g.11863157C>G	ENSP00000365777:p.Arg6Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Missense_Mutation	SNP	pfam_Mehydrof_redctse,tigrfam_Fadh2_euk	p.R47T	ENST00000376592.1	37	c.140	CCDS137.1	1	.	.	.	.	.	.	.	.	.	.	C	6.019	0.371883	0.11409	.	.	ENSG00000177000	ENST00000376592;ENST00000376583;ENST00000376590;ENST00000376585;ENST00000418034;ENST00000413656;ENST00000423400;ENST00000431243;ENST00000376486	D;D;D;D;T	0.81908	-1.55;-1.55;-1.55;-1.55;-1.42	4.83	3.9	0.45041	.	0.794228	0.11687	N	0.539299	T	0.75982	0.3924	L	0.44542	1.39	0.09310	N	1	B;B	0.24823	0.112;0.112	B;B	0.19148	0.024;0.024	T	0.67546	-0.5643	10	0.87932	D	0	.	7.7092	0.28667	0.0:0.7355:0.1701:0.0944	.	6;47	P42898;Q5SNW6	MTHR_HUMAN;.	T	6;47;6;47;6;6;29;6;6	ENSP00000365777:R6T;ENSP00000365767:R47T;ENSP00000365775:R6T;ENSP00000365770:R47T;ENSP00000405082:R6T	ENSP00000365669:R6T	R	-	2	0	MTHFR	11785744	0.858000	0.29795	0.005000	0.12908	0.244000	0.25665	0.845000	0.27668	1.224000	0.43551	0.549000	0.68633	AGA	MTHFR	-	NULL	ENSG00000177000		0.622	MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MTHFR	HGNC	protein_coding	OTTHUMT00000006538.1	33	0.00	0	C	NM_005957		11863157	11863157	-1	no_errors	ENST00000376583	ensembl	human	known	69_37n	missense	83	15.15	15	SNP	0.008	G
MST1L	11223	genome.wustl.edu	37	1	17085485	17085485	+	RNA	SNP	G	G	A	rs3863809		TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:17085485G>A	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										ACCATTTCCAGGCTCTGGTCC	0.622																																						dbGAP											0																																										-	-	-			0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085485G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPB1|Q13209	Silent	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.A402	ENST00000455405.2	37	c.1206		1																																																																																			MST1P9	-	superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000186715		0.622	MST1L-002	KNOWN	basic	processed_transcript	MST1P9	HGNC	pseudogene	OTTHUMT00000400328.1	19	0.00	0	G	NM_001271733		17085485	17085485	-1	no_errors	ENST00000334998	ensembl	human	known	69_37n	silent	34	17.07	7	SNP	0.257	A
MYCBP	26292	genome.wustl.edu	37	1	39338782	39338782	+	Intron	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:39338782C>T	ENST00000397572.2	-	2	815				RP5-864K19.4_ENST00000443161.1_RNA|RP5-864K19.4_ENST00000433671.2_RNA|MYCBP_ENST00000489803.1_Intron|RP5-864K19.4_ENST00000456813.1_RNA|GJA9_ENST00000454994.2_Intron	NM_012333.4	NP_036465.2	Q99417	MYCBP_HUMAN	MYC binding protein						regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			large_intestine(1)|lung(1)|skin(1)	3	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)				CACCGGGGGTCAGTGGCCAGA	0.687																																					Esophageal Squamous(155;912 1855 21572 25911 44247)	dbGAP											0													18.0	16.0	17.0					1																	39338782		2147	4222	6369	-	-	-	SO:0001627	intron_variant	0			AB007191	CCDS431.1	1p33-p32.2	2013-07-09	2013-07-09		ENSG00000214114	ENSG00000214114			7554	protein-coding gene	gene with protein product	"""associate of myc-1"""	606535	"""c-myc binding protein"""			9797456	Standard	NM_012333		Approved	AMY-1	uc001ccs.3	Q99417	OTTHUMG00000000484	ENST00000397572.2:c.16-20G>A	1.37:g.39338782C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4N0|Q5TA64|Q96HE2	RNA	SNP	-	NULL	ENST00000397572.2	37	NULL	CCDS431.1	1																																																																																			MYCBP	-	-	ENSG00000214114		0.687	MYCBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYCBP	HGNC	protein_coding	OTTHUMT00000001209.1	22	0.00	0	C	NM_012333		39338782	39338782	-1	no_errors	ENST00000495043	ensembl	human	known	69_37n	rna	25	26.47	9	SNP	1.000	T
MYH1	4619	genome.wustl.edu	37	17	10411879	10411879	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr17:10411879G>A	ENST00000226207.5	-	16	1792	c.1698C>T	c.(1696-1698)ttC>ttT	p.F566F	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	566	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TGGGCTTCTGGAAGTTATTGG	0.502																																						dbGAP											0													109.0	117.0	114.0					17																	10411879		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.1698C>T	17.37:g.10411879G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CA4|Q9Y622	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F566	ENST00000226207.5	37	c.1698	CCDS11155.1	17																																																																																			MYH1	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000109061		0.502	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	144	0.00	0	G	NM_005963		10411879	10411879	-1	no_errors	ENST00000226207	ensembl	human	known	69_37n	silent	104	19.38	25	SNP	1.000	A
MYH15	22989	genome.wustl.edu	37	3	108156543	108156543	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:108156543C>G	ENST00000273353.3	-	26	3195	c.3139G>C	c.(3139-3141)Gag>Cag	p.E1047Q		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1047						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						AGGGCACCCTCAAGCTGACAA	0.393																																						dbGAP											0													137.0	132.0	134.0					3																	108156543		1871	4113	5984	-	-	-	SO:0001583	missense	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.3139G>C	3.37:g.108156543C>G	ENSP00000273353:p.Glu1047Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.E1047Q	ENST00000273353.3	37	c.3139	CCDS43127.1	3	.	.	.	.	.	.	.	.	.	.	C	24.2	4.504895	0.85176	.	.	ENSG00000144821	ENST00000273353	D	0.99245	-5.62	5.34	4.45	0.53987	.	.	.	.	.	D	0.99396	0.9787	M	0.86953	2.85	0.58432	D	0.999997	D	0.89917	1.0	D	0.75020	0.985	D	0.98364	1.0550	9	0.87932	D	0	.	14.9106	0.70755	0.0:0.9275:0.0:0.0725	.	1047	Q9Y2K3	MYH15_HUMAN	Q	1047	ENSP00000273353:E1047Q	ENSP00000273353:E1047Q	E	-	1	0	MYH15	109639233	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	3.917000	0.56424	2.664000	0.90586	0.655000	0.94253	GAG	MYH15	-	NULL	ENSG00000144821		0.393	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	90	0.00	0	C	XM_036988		108156543	108156543	-1	no_errors	ENST00000273353	ensembl	human	known	69_37n	missense	106	35.37	58	SNP	1.000	G
MYH15	22989	genome.wustl.edu	37	3	108203971	108203971	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:108203971T>C	ENST00000273353.3	-	12	1197	c.1141A>G	c.(1141-1143)Aga>Gga	p.R381G		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	381	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TGCTCTTCTCTAGGTTTCTGT	0.413																																						dbGAP											0													136.0	126.0	129.0					3																	108203971		1871	4101	5972	-	-	-	SO:0001583	missense	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.1141A>G	3.37:g.108203971T>C	ENSP00000273353:p.Arg381Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.R381G	ENST00000273353.3	37	c.1141	CCDS43127.1	3	.	.	.	.	.	.	.	.	.	.	T	13.42	2.233017	0.39498	.	.	ENSG00000144821	ENST00000273353	D	0.87650	-2.28	6.05	0.755	0.18415	Myosin head, motor domain (2);	.	.	.	.	D	0.85305	0.5666	M	0.82193	2.58	0.48087	D	0.999581	B	0.14805	0.011	B	0.16289	0.015	T	0.79334	-0.1846	9	0.72032	D	0.01	.	6.3721	0.21487	0.0:0.1852:0.2162:0.5986	.	381	Q9Y2K3	MYH15_HUMAN	G	381	ENSP00000273353:R381G	ENSP00000273353:R381G	R	-	1	2	MYH15	109686661	1.000000	0.71417	0.923000	0.36655	0.920000	0.55202	0.445000	0.21677	0.134000	0.18681	-0.917000	0.02746	AGA	MYH15	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000144821		0.413	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	95	0.00	0	T	XM_036988		108203971	108203971	-1	no_errors	ENST00000273353	ensembl	human	known	69_37n	missense	68	32.67	33	SNP	0.962	C
MYO16	23026	genome.wustl.edu	37	13	109707855	109707855	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr13:109707855C>T	ENST00000357550.2	+	26	3222	c.3181C>T	c.(3181-3183)Cag>Tag	p.Q1061*	MYO16_ENST00000457511.2_Nonsense_Mutation_p.Q573*|MYO16_ENST00000356711.2_Nonsense_Mutation_p.Q1061*	NM_001198950.1	NP_001185879.1			myosin XVI									p.Q1061*(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CGTGTCTGCTCAGCTACAATA	0.418																																						dbGAP											1	Substitution - Nonsense(1)	lung(1)											162.0	160.0	161.0					13																	109707855		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3181C>T	13.37:g.109707855C>T	ENSP00000350160:p.Gln1061*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q1061*	ENST00000357550.2	37	c.3181	CCDS32008.1	13	.	.	.	.	.	.	.	.	.	.	C	40	8.239660	0.98722	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000375857;ENST00000457511	.	.	.	5.21	5.21	0.72293	.	0.000000	0.38720	U	0.001588	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7758	0.88506	0.0:1.0:0.0:0.0	.	.	.	.	X	1061;1061;849;573	.	.	Q	+	1	0	MYO16	108505856	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	6.792000	0.75125	2.424000	0.82194	0.561000	0.74099	CAG	MYO16	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000041515		0.418	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1	84	0.00	0	C	NM_015011		109707855	109707855	+1	no_errors	ENST00000356711	ensembl	human	known	69_37n	nonsense	91	22.22	26	SNP	1.000	T
NAALADL2	254827	genome.wustl.edu	37	3	174814752	174814752	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:174814752G>A	ENST00000454872.1	+	2	344	c.216G>A	c.(214-216)caG>caA	p.Q72Q	NAALADL2-AS3_ENST00000453180.1_RNA|NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	72						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		CTGAGAATCAGAACCTAGGGC	0.463																																						dbGAP											0													75.0	71.0	72.0					3																	174814752		1882	4115	5997	-	-	-	SO:0001819	synonymous_variant	0				CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.216G>A	3.37:g.174814752G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Silent	SNP	superfamily_TFR-like_dimer_dom	p.Q72	ENST00000454872.1	37	c.216	CCDS46960.1	3																																																																																			NAALADL2	-	NULL	ENSG00000177694		0.463	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALADL2	HGNC	protein_coding	OTTHUMT00000347390.2	31	0.00	0	G	NM_207015		174814752	174814752	+1	no_errors	ENST00000454872	ensembl	human	known	69_37n	silent	12	57.14	16	SNP	0.999	A
NAMPT	10135	genome.wustl.edu	37	7	105908931	105908931	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr7:105908931G>A	ENST00000222553.3	-	6	1029	c.722C>T	c.(721-723)tCt>tTt	p.S241F	NAMPT_ENST00000354289.4_Missense_Mutation_p.S241F|NAMPT_ENST00000484527.1_5'Flank	NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	241					cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						TGCTGGAACAGAATAGCCTGG	0.343																																						dbGAP											0													48.0	52.0	50.0					7																	105908931		2203	4300	6503	-	-	-	SO:0001583	missense	0			U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.722C>T	7.37:g.105908931G>A	ENSP00000222553:p.Ser241Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	Missense_Mutation	SNP	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nicotinamide_PRibTrfase	p.S241F	ENST00000222553.3	37	c.722	CCDS5737.1	7	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783406	0.90282	.	.	ENSG00000105835	ENST00000222553;ENST00000354289	.	.	.	5.29	5.29	0.74685	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89767	0.6810	H	0.96208	3.785	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.92754	0.6218	9	0.87932	D	0	0.0079	19.2867	0.94077	0.0:0.0:1.0:0.0	.	154;222;241	B7Z8W6;Q5SYT8;P43490	.;.;NAMPT_HUMAN	F	241	.	ENSP00000222553:S241F	S	-	2	0	NAMPT	105696167	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.420000	0.97426	2.612000	0.88384	0.655000	0.94253	TCT	NAMPT	-	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nicotinamide_PRibTrfase	ENSG00000105835		0.343	NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAMPT	HGNC	protein_coding	OTTHUMT00000277146.1	29	0.00	0	G	NM_182790		105908931	105908931	-1	no_errors	ENST00000222553	ensembl	human	known	69_37n	missense	30	30.23	13	SNP	1.000	A
NCF2	4688	genome.wustl.edu	37	1	183532637	183532637	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:183532637G>A	ENST00000367535.3	-	12	1361	c.1110C>T	c.(1108-1110)ctC>ctT	p.L370L	NCF2_ENST00000367536.1_Silent_p.L370L|NCF2_ENST00000469280.1_5'UTR|NCF2_ENST00000413720.1_Silent_p.L325L|NCF2_ENST00000418089.1_Silent_p.L289L	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	370	OPR.				aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	GGCTGTAGGGGAGCCCGGGCT	0.567																																						dbGAP											0													112.0	109.0	110.0					1																	183532637		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.1110C>T	1.37:g.183532637G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_TPR-1,pfam_OPR_PB1,superfamily_SH3_domain,smart_TPR_repeat,smart_SH3_domain,smart_OPR_PB1,pfscan_SH3_domain,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_p67phox,prints_SH3_domain	p.L370	ENST00000367535.3	37	c.1110	CCDS1356.1	1																																																																																			NCF2	-	pfam_OPR_PB1,smart_OPR_PB1	ENSG00000116701		0.567	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF2	HGNC	protein_coding	OTTHUMT00000085483.1	35	0.00	0	G	NM_000433		183532637	183532637	-1	no_errors	ENST00000367535	ensembl	human	known	69_37n	silent	104	18.11	23	SNP	0.943	A
NHLRC2	374354	genome.wustl.edu	37	10	115644027	115644027	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr10:115644027G>C	ENST00000369301.3	+	5	1139	c.927G>C	c.(925-927)gaG>gaC	p.E309D		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	309										breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		TAGAAGCTGAGAAGGTGAGCA	0.373																																						dbGAP											0													130.0	120.0	123.0					10																	115644027		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.927G>C	10.37:g.115644027G>C	ENSP00000358307:p.Glu309Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1H1|Q8N5A6	Missense_Mutation	SNP	pfam_NHL_repeat,superfamily_Thioredoxin-like_fold,pfscan_NHL_repeat_subgr	p.E309D	ENST00000369301.3	37	c.927	CCDS7585.1	10	.	.	.	.	.	.	.	.	.	.	G	9.238	1.037531	0.19669	.	.	ENSG00000196865	ENST00000369301	D	0.89939	-2.59	5.03	2.78	0.32641	Six-bladed beta-propeller, TolB-like (1);	0.121583	0.56097	D	0.000036	D	0.86079	0.5847	M	0.71036	2.16	0.28808	N	0.898398	B	0.25007	0.116	B	0.22386	0.039	T	0.80355	-0.1417	10	0.48119	T	0.1	-13.1025	9.4876	0.38940	0.2557:0.0:0.7443:0.0	.	309	Q8NBF2	NHLC2_HUMAN	D	309	ENSP00000358307:E309D	ENSP00000358307:E309D	E	+	3	2	NHLRC2	115634017	0.832000	0.29368	0.997000	0.53966	0.881000	0.50899	1.368000	0.34216	1.115000	0.41800	0.479000	0.44913	GAG	NHLRC2	-	NULL	ENSG00000196865		0.373	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC2	HGNC	protein_coding	OTTHUMT00000050446.1	79	0.00	0	G	NM_198514		115644027	115644027	+1	no_errors	ENST00000369301	ensembl	human	known	69_37n	missense	70	23.91	22	SNP	0.940	C
NLRP10	338322	genome.wustl.edu	37	11	7984895	7984895	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr11:7984895C>A	ENST00000328600.2	-	1	309	c.148G>T	c.(148-150)Gag>Tag	p.E50*		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	50	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ATCAGGCCCTCCAACTCCCCT	0.502																																						dbGAP											0													75.0	77.0	76.0					11																	7984895		2201	4296	6497	-	-	-	SO:0001587	stop_gained	0			AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.148G>T	11.37:g.7984895C>A	ENSP00000327763:p.Glu50*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3C4|Q6JGT0	Nonsense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,pfscan_NACHT_NTPase,pfscan_DAPIN	p.E50*	ENST00000328600.2	37	c.148	CCDS7784.1	11	.	.	.	.	.	.	.	.	.	.	C	14.96	2.690625	0.48097	.	.	ENSG00000182261	ENST00000328600;ENST00000526590	.	.	.	4.13	0.514	0.17007	.	0.176243	0.27531	N	0.018945	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	4.8081	0.13329	0.0:0.4322:0.4251:0.1427	.	.	.	.	X	50	.	ENSP00000327763:E50X	E	-	1	0	NLRP10	7941471	0.969000	0.33509	0.953000	0.39169	0.169000	0.22640	0.302000	0.19192	0.362000	0.24319	0.563000	0.77884	GAG	NLRP10	-	pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN	ENSG00000182261		0.502	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP10	HGNC	protein_coding	OTTHUMT00000385705.1	35	0.00	0	C	NM_176821		7984895	7984895	-1	no_errors	ENST00000328600	ensembl	human	known	69_37n	nonsense	39	29.09	16	SNP	0.814	A
NPIPB3	23117	genome.wustl.edu	37	16	21415979	21415981	+	In_Frame_Del	DEL	ATT	ATT	-			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	ATT	ATT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr16:21415979_21415981delATT	ENST00000448012.2	-	9	1182_1184	c.1143_1145delAAT	c.(1141-1146)ataatc>atc	p.381_382II>I	NPIPB3_ENST00000458643.2_In_Frame_Del_p.N243del|NPIPB3_ENST00000542817.1_Intron	NM_130464.2	NP_569731.2	Q92617	NPIB3_HUMAN	nuclear pore complex interacting protein family, member B3	560	Pro-rich.					integral component of membrane (GO:0016021)											GTGTCTTGAGATTATCATCCGCT	0.596																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0					16p12.2	2013-06-11	2013-06-11	2013-06-11	ENSG00000169246	ENSG00000169246			28989	protein-coding gene	gene with protein product			"""nuclear pore complex interacting protein-like 3"""	NPIPL3		11948212	Standard	NM_130464		Approved	KIAA0220	uc021tei.1	Q92617	OTTHUMG00000163506	ENST00000448012.2:c.1143_1145delAAT	16.37:g.21415979_21415981delATT	ENSP00000390496:p.Ile382del	Somatic		WXS	Illumina GAIIx	Phase_IV	O43332|Q504Q6|Q59F29|Q6GMR1|Q6P7T2|Q6PIE2|Q6RH21	In_Frame_Del	DEL	pfam_NPIP	p.N304in_frame_del	ENST00000448012.2	37	c.912_910		16																																																																																			NPIPL3	-	pfam_NPIP	ENSG00000169246		0.596	NPIPB3-201	KNOWN	basic|appris_principal	protein_coding	NPIPL3	HGNC	protein_coding		9	0.00	0	ATT	NM_130464		21415979	21415981	-1	no_errors	ENST00000447737	ensembl	human	known	69_37n	in_frame_del	6	33.33	3	DEL	0.025:0.029:0.033	-
NUDT9	53343	genome.wustl.edu	37	4	88356370	88356370	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr4:88356370C>T	ENST00000302174.4	+	2	669	c.345C>T	c.(343-345)atC>atT	p.I115I	NUDT9_ENST00000473942.1_Silent_p.I65I	NM_024047.4	NP_076952.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 9	115					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			endometrium(1)|large_intestine(4)|lung(6)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		ATCCTCAGATCAGGTGAGCAA	0.423																																						dbGAP											0													75.0	79.0	78.0					4																	88356370		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY026252	CCDS3620.1, CCDS3621.1	4q22.1	2008-08-29			ENSG00000170502	ENSG00000170502		"""Nudix motif containing"""	8056	protein-coding gene	gene with protein product		606022				11385575, 12427752	Standard	NM_024047		Approved	MGC3037	uc003hqq.3	Q9BW91	OTTHUMG00000130591	ENST00000302174.4:c.345C>T	4.37:g.88356370C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.I115	ENST00000302174.4	37	c.345	CCDS3620.1	4																																																																																			NUDT9	-	superfamily_NUDIX_hydrolase_dom-like	ENSG00000170502		0.423	NUDT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT9	HGNC	protein_coding	OTTHUMT00000253035.2	59	0.00	0	C			88356370	88356370	+1	no_errors	ENST00000302174	ensembl	human	known	69_37n	silent	51	28.17	20	SNP	1.000	T
NWD1	284434	genome.wustl.edu	37	19	16872911	16872911	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:16872911C>T	ENST00000552788.1	+	6	2095	c.2095C>T	c.(2095-2097)Ctg>Ttg	p.L699L	NWD1_ENST00000524140.2_Silent_p.L699L|NWD1_ENST00000379808.3_Silent_p.L699L|NWD1_ENST00000549814.1_Silent_p.L699L|NWD1_ENST00000339803.6_Silent_p.L564L|NWD1_ENST00000523826.1_Silent_p.L493L			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	699							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GCTCATCACTCTGCCACTTGT	0.597																																						dbGAP											0													84.0	63.0	70.0					19																	16872911		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.2095C>T	19.37:g.16872911C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J021|Q68CT3	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L699	ENST00000552788.1	37	c.2095		19																																																																																			NWD1	-	NULL	ENSG00000188039		0.597	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	18	0.00	0	C	NM_001007525		16872911	16872911	+1	no_errors	ENST00000379808	ensembl	human	known	69_37n	silent	34	27.66	13	SNP	1.000	T
OR10J3	441911	genome.wustl.edu	37	1	159284004	159284004	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:159284004G>A	ENST00000332217.5	-	1	445	c.446C>T	c.(445-447)tCa>tTa	p.S149L		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					AATCCCCAGTGATCCAGAGGC	0.512																																						dbGAP											0													69.0	63.0	65.0					1																	159284004		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.446C>T	1.37:g.159284004G>A	ENSP00000331789:p.Ser149Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S149L	ENST00000332217.5	37	c.446	CCDS30909.1	1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.755634	0.49362	.	.	ENSG00000196266	ENST00000332217	T	0.37752	1.18	5.03	4.09	0.47781	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.45175	0.1329	M	0.80982	2.52	0.31061	N	0.714109	P	0.43701	0.815	P	0.56127	0.792	T	0.48559	-0.9025	9	0.72032	D	0.01	.	12.9828	0.58575	0.0:0.1637:0.8363:0.0	.	149	Q5JRS4	O10J3_HUMAN	L	149	ENSP00000331789:S149L	ENSP00000331789:S149L	S	-	2	0	OR10J3	157550628	0.050000	0.20438	0.198000	0.23420	0.284000	0.27059	1.503000	0.35715	1.265000	0.44215	0.561000	0.74099	TCA	OR10J3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196266		0.512	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J3	HGNC	protein_coding	OTTHUMT00000090629.1	31	0.00	0	G			159284004	159284004	-1	no_errors	ENST00000332217	ensembl	human	known	69_37n	missense	74	13.95	12	SNP	0.560	A
OR13C3	138803	genome.wustl.edu	37	9	107298538	107298538	+	Nonsense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr9:107298538G>C	ENST00000374781.2	-	1	599	c.557C>G	c.(556-558)tCa>tGa	p.S186*		NM_001001961.1	NP_001001961.1	Q8NGS6	O13C3_HUMAN	olfactory receptor, family 13, subfamily C, member 3	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(7)|lung(7)|pancreas(1)|prostate(1)|skin(1)	19						TTGCACAGCTGAATTTATTCC	0.458																																					GBM(86;1248 1274 14222 15028 46219)	dbGAP											0													146.0	144.0	145.0					9																	107298538		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS35089.1	9q31.1	2013-09-24			ENSG00000204246	ENSG00000204246		"""GPCR / Class A : Olfactory receptors"""	14704	protein-coding gene	gene with protein product							Standard	NM_001001961		Approved		uc004bcb.1	Q8NGS6	OTTHUMG00000020406	ENST00000374781.2:c.557C>G	9.37:g.107298538G>C	ENSP00000363913:p.Ser186*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVG1|Q6IF52	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S186*	ENST00000374781.2	37	c.557	CCDS35089.1	9	.	.	.	.	.	.	.	.	.	.	G	13.54	2.269159	0.40095	.	.	ENSG00000204246	ENST00000374781	.	.	.	4.72	4.72	0.59763	.	0.207947	0.24065	N	0.041872	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.5529	0.76167	0.0:0.0:1.0:0.0	.	.	.	.	X	186	.	ENSP00000363913:S186X	S	-	2	0	OR13C3	106338359	0.000000	0.05858	0.998000	0.56505	0.078000	0.17371	0.634000	0.24614	2.610000	0.88304	0.591000	0.81541	TCA	OR13C3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000204246		0.458	OR13C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C3	HGNC	protein_coding	OTTHUMT00000053477.2	44	0.00	0	G			107298538	107298538	-1	no_errors	ENST00000374781	ensembl	human	known	69_37n	nonsense	48	25.00	16	SNP	0.985	C
OR13C8	138802	genome.wustl.edu	37	9	107332382	107332382	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr9:107332382T>C	ENST00000335040.1	+	1	934	c.934T>C	c.(934-936)Tgt>Cgt	p.C312R		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						AAACATACTGTGTAGGAAAAA	0.353																																						dbGAP											0													44.0	47.0	46.0					9																	107332382		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.934T>C	9.37:g.107332382T>C	ENSP00000334068:p.Cys312Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVG0|Q96R44	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.C312R	ENST00000335040.1	37	c.934	CCDS35090.1	9	.	.	.	.	.	.	.	.	.	.	T	0.259	-1.001225	0.02128	.	.	ENSG00000186943	ENST00000335040	T	0.37058	1.22	4.9	1.86	0.25419	.	0.473115	0.19760	N	0.106700	T	0.13500	0.0327	N	0.04669	-0.19	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.27905	-1.0060	10	0.12430	T	0.62	.	6.486	0.22089	0.0921:0.0:0.3285:0.5794	.	312	Q8NGS7	O13C8_HUMAN	R	312	ENSP00000334068:C312R	ENSP00000334068:C312R	C	+	1	0	OR13C8	106372203	0.000000	0.05858	0.843000	0.33291	0.720000	0.41350	-0.366000	0.07563	0.668000	0.31126	0.459000	0.35465	TGT	OR13C8	-	NULL	ENSG00000186943		0.353	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C8	HGNC	protein_coding	OTTHUMT00000053480.1	21	0.00	0	T			107332382	107332382	+1	no_errors	ENST00000335040	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	0.025	C
OR2Y1	134083	genome.wustl.edu	37	5	180166207	180166207	+	Silent	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr5:180166207G>C	ENST00000307832.2	-	1	892	c.852C>G	c.(850-852)ctC>ctG	p.L284L		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGAGAGGATTGAGAATGGGGG	0.433																																						dbGAP											0													87.0	98.0	94.0					5																	180166207		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.852C>G	5.37:g.180166207G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIP1|Q6IFB1|Q96R16	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L284	ENST00000307832.2	37	c.852	CCDS34323.1	5																																																																																			OR2Y1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000174339		0.433	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2Y1	HGNC	protein_coding	OTTHUMT00000368059.2	59	0.00	0	G	XM_068682		180166207	180166207	-1	no_errors	ENST00000307832	ensembl	human	known	69_37n	silent	56	22.22	16	SNP	0.055	C
Unknown	0	genome.wustl.edu	37	19	14974663	14974663	+	IGR	SNP	T	T	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:14974663T>A								OR7A10 (21974 upstream) : OR7A17 (16474 downstream)																							AGACTGTAAATGAAGGGGTTG	0.483																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															19.37:g.14974663T>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I289F		37	c.865		19	.	.	.	.	.	.	.	.	.	.	t	18.54	3.646432	0.67358	.	.	ENSG00000172148	ENST00000304105	.	.	.	2.16	2.16	0.27623	.	0.000000	0.39687	U	0.001295	T	0.55097	0.1899	.	.	.	0.25161	N	0.990355	.	.	.	.	.	.	T	0.67158	-0.5741	5	0.87932	D	0	.	7.9031	0.29746	0.0:0.0:0.0:1.0	.	.	.	.	F	289	.	ENSP00000307397:I289F	I	-	1	0	OR7A2P	14835663	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	6.473000	0.73572	1.021000	0.39600	0.165000	0.16767	ATT	OR7A2P	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172148	0	0.483					OR7A2P	HGNC			8	0.00	0	T			14974663	14974663	-1	no_start_codon	ENST00000304105	ensembl	human	known	69_37n	missense	4	71.43	10	SNP	1.000	A
PAPPA	5069	genome.wustl.edu	37	9	119106885	119106885	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr9:119106885C>T	ENST00000328252.3	+	14	4044	c.3675C>T	c.(3673-3675)ctC>ctT	p.L1225L	PAPPA_ENST00000534838.1_Silent_p.L263L	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1225	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						ATGCTTCTCTCAATTGCTCCA	0.567																																						dbGAP											0													115.0	102.0	106.0					9																	119106885		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3675C>T	9.37:g.119106885C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.L1225	ENST00000328252.3	37	c.3675	CCDS6813.1	9																																																																																			PAPPA	-	superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000182752		0.567	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	33	0.00	0	C	NM_002581		119106885	119106885	+1	no_errors	ENST00000328252	ensembl	human	known	69_37n	silent	87	16.19	17	SNP	1.000	T
PCBP4	57060	genome.wustl.edu	37	3	51992953	51992953	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:51992953C>T	ENST00000461554.1	-	13	1107	c.776G>A	c.(775-777)cGc>cAc	p.R259H	PCBP4_ENST00000471622.1_Missense_Mutation_p.R259H|PCBP4_ENST00000355852.2_Missense_Mutation_p.R259H|PCBP4_ENST00000428823.2_Missense_Mutation_p.R216H|PCBP4_ENST00000395013.3_Missense_Mutation_p.R99H|PCBP4_ENST00000395014.2_Missense_Mutation_p.R280H|RP11-155D18.12_ENST00000488257.1_RNA|PCBP4_ENST00000484633.1_Missense_Mutation_p.R216H|PCBP4_ENST00000322099.7_Missense_Mutation_p.R259H	NM_001174100.1	NP_001167571.1	P57723	PCBP4_HUMAN	poly(rC) binding protein 4	259	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.					cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|large_intestine(2)|lung(2)|prostate(1)|stomach(1)	8				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GCTGCCCTGGCGCCCGATCAC	0.612																																						dbGAP											0													110.0	102.0	105.0					3																	51992953		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF176330	CCDS2839.1, CCDS2840.1, CCDS2840.2	3p21	2013-07-16	2001-11-28		ENSG00000090097	ENSG00000090097			8652	protein-coding gene	gene with protein product	"""RNA binding protein MCG10"", ""LYST-interacting protein"", ""alphaCP-4 protein"""	608503	"""poly(rC)-binding protein 4"""			10936052	Standard	NM_033008		Approved	MCG10, LIP4	uc003dch.2	P57723	OTTHUMG00000157366	ENST00000461554.1:c.776G>A	3.37:g.51992953C>T	ENSP00000417196:p.Arg259His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AH7	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.R280H	ENST00000461554.1	37	c.839	CCDS2839.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.199241	0.94997	.	.	ENSG00000090097	ENST00000355852;ENST00000322099;ENST00000461554;ENST00000484633;ENST00000395013;ENST00000428823;ENST00000395014;ENST00000471622;ENST00000294192	T;T;T;T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22	5.12	5.12	0.69794	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.62417	0.2426	M	0.74546	2.27	0.58432	D	0.999999	P;D;D;D;D;D	0.89917	0.783;1.0;0.992;1.0;1.0;1.0	P;D;D;D;D;D	0.91635	0.46;0.996;0.914;0.998;0.999;0.987	T	0.67150	-0.5743	10	0.87932	D	0	-10.7876	18.1582	0.89700	0.0:1.0:0.0:0.0	.	259;216;99;259;280;225	C9J0A4;P57723-2;B3KM64;P57723;Q9GZT1;Q9HCU2	.;.;.;PCBP4_HUMAN;.;.	H	259;259;259;216;99;216;280;259;259	ENSP00000348111:R259H;ENSP00000322341:R259H;ENSP00000417196:R259H;ENSP00000417100:R216H;ENSP00000378460:R99H;ENSP00000395030:R216H;ENSP00000378461:R280H;ENSP00000418925:R259H	ENSP00000294192:R259H	R	-	2	0	PCBP4	51967993	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.811000	0.86092	2.360000	0.80028	0.462000	0.41574	CGC	PCBP4	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000090097		0.612	PCBP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCBP4	HGNC	protein_coding	OTTHUMT00000348597.1	31	0.00	0	C	NM_020418		51992953	51992953	-1	no_errors	ENST00000395014	ensembl	human	known	69_37n	missense	62	32.61	30	SNP	0.994	T
PDE4DIP	9659	genome.wustl.edu	37	1	144903091	144903091	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:144903091A>G	ENST00000369354.3	-	21	2990	c.2801T>C	c.(2800-2802)cTg>cCg	p.L934P	PDE4DIP_ENST00000524974.1_Intron|PDE4DIP_ENST00000369349.3_Missense_Mutation_p.L934P|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.L934P|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.L1000P|PDE4DIP_ENST00000479408.2_Missense_Mutation_p.L721P|PDE4DIP_ENST00000313431.9_Missense_Mutation_p.L1097P|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.L1071P|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.L1071P|PDE4DIP_ENST00000369351.3_Missense_Mutation_p.L934P|PDE4DIP_ENST00000529945.1_Missense_Mutation_p.L1097P			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	934					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AATGGCGGCCAGGGTCTCCAG	0.557			T	PDGFRB	MPD																																	dbGAP		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													119.0	115.0	116.0					1																	144903091		2203	4296	6499	-	-	-	SO:0001583	missense	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.2801T>C	1.37:g.144903091A>G	ENSP00000358360:p.Leu934Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.L934P	ENST00000369354.3	37	c.2801	CCDS30824.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.77|18.77	3.695257|3.695257	0.68386|0.68386	.|.	.|.	ENSG00000178104|ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000369353;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000313431;ENST00000529945;ENST00000479408|ENST00000491426	T;T;T;T;T;T;T;T;T;T|.	0.13538|.	4.63;4.72;4.72;4.72;4.71;3.74;3.73;2.64;2.61;2.58|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	.|.	.|.	.|.	.|.	T|T	0.39489|0.39489	0.1080|0.1080	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	0.999;1.0;0.999;0.998;0.994|.	D;D;D;P;P|.	0.91635|.	0.952;0.999;0.974;0.862;0.771|.	T|T	0.35895|0.35895	-0.9770|-0.9770	9|5	0.28530|.	T|.	0.3|.	.|.	13.6936|13.6936	0.62564|0.62564	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1097;934;1097;1000;934|.	E9PL24;Q5VU43-7;Q5VU43-2;Q5VU43-3;Q5VU43|.	.;.;.;.;MYOME_HUMAN|.	P|R	1000;934;934;1097;1071;1071;934;934;1097;1097;721|57	ENSP00000327209:L1000P;ENSP00000358360:L934P;ENSP00000358363:L934P;ENSP00000435654:L1071P;ENSP00000358366:L1071P;ENSP00000358357:L934P;ENSP00000358355:L934P;ENSP00000316434:L1097P;ENSP00000433392:L1097P;ENSP00000436791:L721P|.	ENSP00000327209:L1000P|.	L|W	-|-	2|1	0|0	PDE4DIP|PDE4DIP	143614448|143614448	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.480000|3.480000	0.53172|0.53172	2.117000|2.117000	0.64856|0.64856	0.524000|0.524000	0.50904|0.50904	CTG|TGG	PDE4DIP	-	NULL	ENSG00000178104		0.557	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	28	0.00	0	A	NM_022359		144903091	144903091	-1	no_errors	ENST00000369356	ensembl	human	known	69_37n	missense	114	14.07	19	SNP	1.000	G
PDE4DIP	9659	genome.wustl.edu	37	1	145039866	145039866	+	5'UTR	SNP	A	A	G	rs1445033	byFrequency	TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:145039866A>G	ENST00000313382.9	-	0	136				PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000493130.2_5'Flank|PDE4DIP_ENST00000478649.2_5'Flank|PDE4DIP_ENST00000369348.3_Intron|PDE4DIP_ENST00000530740.1_Intron	NM_001198832.1	NP_001185761	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GGCTGGACTCAGAGCGGCGCG	0.662			T	PDGFRB	MPD																																	dbGAP		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000313382.9:c.-257T>C	1.37:g.145039866A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	RNA	SNP	-	NULL	ENST00000313382.9	37	NULL	CCDS55628.1	1																																																																																			PDE4DIP	-	-	ENSG00000178104		0.662	PDE4DIP-001	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038856.2	8	0.00	0	A	NM_022359		145039866	145039866	-1	no_errors	ENST00000497529	ensembl	human	known	69_37n	rna	20	23.08	6	SNP	0.000	G
PDGFRB	5159	genome.wustl.edu	37	5	149513324	149513324	+	Splice_Site	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr5:149513324C>G	ENST00000261799.4	-	6	1229		c.e6-1			NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide						adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCCGCCCACTCTGCAGCAACA	0.622			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																	dbGAP		Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	0													56.0	60.0	59.0					5																	149513324		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.760-1G>C	5.37:g.149513324C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B5A957|Q8N5L4	Splice_Site	SNP	-	e5-1	ENST00000261799.4	37	c.760-1	CCDS4303.1	5	.	.	.	.	.	.	.	.	.	.	C	16.32	3.090815	0.55968	.	.	ENSG00000113721	ENST00000261799	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4727	0.87650	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PDGFRB	149493517	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	2.719000	0.47244	2.809000	0.96659	0.557000	0.71058	.	PDGFRB	-	-	ENSG00000113721		0.622	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRB	HGNC	protein_coding	OTTHUMT00000252332.1	41	0.00	0	C	NM_002609	Intron	149513324	149513324	-1	no_errors	ENST00000261799	ensembl	human	known	69_37n	splice_site	57	18.57	13	SNP	1.000	G
PFAS	5198	genome.wustl.edu	37	17	8172309	8172309	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr17:8172309G>A	ENST00000314666.6	+	28	3877	c.3744G>A	c.(3742-3744)caG>caA	p.Q1248Q	PFAS_ENST00000545834.1_Silent_p.Q824Q	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	1248	Glutamine amidotransferase type-1.				'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	TCCAAGCTCAGATTGAGGCCA	0.597																																						dbGAP											0													84.0	86.0	85.0					17																	8172309		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.3744G>A	17.37:g.8172309G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8V8	Silent	SNP	pfam_AIR_synth_C,pfam_AIR_synth,superfamily_PurM_N-like,superfamily_AIR_synth_C,tigrfam_PRibForGlyAmidine_synth	p.Q1248	ENST00000314666.6	37	c.3744	CCDS11136.1	17																																																																																			PFAS	-	tigrfam_PRibForGlyAmidine_synth	ENSG00000178921		0.597	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFAS	HGNC	protein_coding	OTTHUMT00000226994.2	24	0.00	0	G			8172309	8172309	+1	no_errors	ENST00000314666	ensembl	human	known	69_37n	silent	22	42.11	16	SNP	0.983	A
PHLDB2	90102	genome.wustl.edu	37	3	111602931	111602931	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:111602931G>A	ENST00000431670.2	+	2	418	c.7G>A	c.(7-9)Gag>Aag	p.E3K	PHLDB2_ENST00000478922.1_Missense_Mutation_p.E3K|PHLDB2_ENST00000412622.1_Missense_Mutation_p.E3K|PHLDB2_ENST00000393925.3_Missense_Mutation_p.E3K|PHLDB2_ENST00000481953.1_Missense_Mutation_p.E3K|PHLDB2_ENST00000477695.1_Missense_Mutation_p.E3K|PHLDB2_ENST00000393923.3_Missense_Mutation_p.E30K	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	3						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						GATTATGGAAGAGCATAGCTA	0.358																																						dbGAP											0													117.0	124.0	122.0					3																	111602931		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.7G>A	3.37:g.111602931G>A	ENSP00000405405:p.Glu3Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E3K	ENST00000431670.2	37	c.7	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	G	22.9	4.351658	0.82132	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000478922;ENST00000477695;ENST00000393925;ENST00000481953	T;T;T;T;T;T	0.38240	1.15;1.23;1.18;1.19;1.23;1.18	5.35	5.35	0.76521	.	0.167635	0.51477	D	0.000087	T	0.52805	0.1757	L	0.51422	1.61	0.43574	D	0.995904	P;P;D;P;P	0.69078	0.799;0.787;0.997;0.873;0.925	B;B;D;B;P	0.64042	0.214;0.359;0.921;0.385;0.54	T	0.50154	-0.8861	10	0.66056	D	0.02	.	16.4388	0.83894	0.0:0.0:1.0:0.0	.	3;3;3;3;30	Q86SQ0;G5E9V3;E9PDY7;Q86SQ0-2;Q86SQ0-3	PHLB2_HUMAN;.;.;.;.	K	30;30;3;3;3;3;3;3;3	ENSP00000377500:E30K;ENSP00000405405:E3K;ENSP00000405292:E3K;ENSP00000418296:E3K;ENSP00000377502:E3K;ENSP00000418319:E3K	ENSP00000352764:E30K	E	+	1	0	PHLDB2	113085621	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.223000	0.72257	2.941000	0.99782	0.655000	0.94253	GAG	PHLDB2	-	NULL	ENSG00000144824		0.358	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	HGNC	protein_coding	OTTHUMT00000354337.1	47	0.00	0	G	NM_145753		111602931	111602931	+1	no_errors	ENST00000393925	ensembl	human	known	69_37n	missense	39	18.75	9	SNP	1.000	A
PIAS3	10401	genome.wustl.edu	37	1	145580380	145580380	+	Intron	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:145580380C>T	ENST00000393045.2	+	6	894				PIAS3_ENST00000369298.1_Intron|PIAS3_ENST00000369299.3_Missense_Mutation_p.P279S	NM_006099.3	NP_006090.2	Q9Y6X2	PIAS3_HUMAN	protein inhibitor of activated STAT, 3						positive regulation of gene expression (GO:0010628)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)|synapse (GO:0045202)	enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|SUMO ligase activity (GO:0019789)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)	28	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGGGAACCATCCAGTGTCCTG	0.517																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB021868	CCDS72866.1	1q21	2011-10-11			ENSG00000131788	ENSG00000131788		"""Zinc fingers, MIZ-type"""	16861	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 5"""	605987				10319586	Standard	NM_006099		Approved	FLJ14651, ZMIZ5	uc001eoc.1	Q9Y6X2	OTTHUMG00000013750	ENST00000393045.2:c.804+58C>T	1.37:g.145580380C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UFI3	Missense_Mutation	SNP	smart_SAP_DNA-bd,pfscan_SAP_DNA-bd	p.P279S	ENST00000393045.2	37	c.835	CCDS920.2	1	.	.	.	.	.	.	.	.	.	.	C	10.17	1.277850	0.23307	.	.	ENSG00000131788	ENST00000369299	T	0.45276	0.9	4.58	0.229	0.15368	.	.	.	.	.	T	0.07683	0.0193	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34750	-0.9816	7	.	.	.	.	3.0154	0.06058	0.3256:0.3957:0.0:0.2787	.	279	F8WA94	.	S	279	ENSP00000358305:P279S	.	P	+	1	0	PIAS3	144291737	0.000000	0.05858	0.000000	0.03702	0.778000	0.44026	0.064000	0.14437	0.167000	0.19631	0.561000	0.74099	CCA	PIAS3	-	NULL	ENSG00000131788		0.517	PIAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS3	HGNC	protein_coding	OTTHUMT00000038533.4	61	0.00	0	C	NM_006099		145580380	145580380	+1	no_errors	ENST00000369299	ensembl	human	known	69_37n	missense	143	17.82	31	SNP	0.000	T
PITPNA	5306	genome.wustl.edu	37	17	1456444	1456444	+	Splice_Site	SNP	C	C	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr17:1456444C>A	ENST00000313486.7	-	3	307		c.e3-1		PITPNA_ENST00000539476.1_Splice_Site	NM_006224.3	NP_006215.1	Q00169	PIPNA_HUMAN	phosphatidylinositol transfer protein, alpha						axon guidance (GO:0007411)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)|phosphatidylcholine transporter activity (GO:0008525)|phosphatidylinositol transporter activity (GO:0008526)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7				UCEC - Uterine corpus endometrioid carcinoma (25;0.0845)		CCACTTGATACTAAAGGACAG	0.517																																						dbGAP											0													91.0	90.0	90.0					17																	1456444		2048	4181	6229	-	-	-	SO:0001630	splice_region_variant	0			M73704	CCDS45563.1	17p13.3	2012-06-29	2003-05-09	2004-09-03	ENSG00000174238	ENSG00000174238			9001	protein-coding gene	gene with protein product		600174	"""phosphotidylinositol transfer protein"""	PITPN		8255295	Standard	NM_006224		Approved	VIB1A	uc021tnf.1	Q00169	OTTHUMG00000177779	ENST00000313486.7:c.52-1G>T	17.37:g.1456444C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e3-1	ENST00000313486.7	37	c.52-1	CCDS45563.1	17	.	.	.	.	.	.	.	.	.	.	C	24.3	4.518711	0.85495	.	.	ENSG00000174238	ENST00000539476;ENST00000313486	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8676	0.96824	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PITPNA	1403194	1.000000	0.71417	0.994000	0.49952	0.968000	0.65278	7.816000	0.86201	2.941000	0.99782	0.655000	0.94253	.	PITPNA	-	-	ENSG00000174238		0.517	PITPNA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNA	HGNC	protein_coding	OTTHUMT00000438927.3	58	0.00	0	C		Intron	1456444	1456444	-1	no_errors	ENST00000313486	ensembl	human	known	69_37n	splice_site	88	19.27	21	SNP	1.000	A
PKD1L1	168507	genome.wustl.edu	37	7	47917162	47917162	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr7:47917162C>T	ENST00000289672.2	-	22	3638	c.3588G>A	c.(3586-3588)atG>atA	p.M1196I		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1196	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CCTGACAGGCCATGTCCCGAG	0.542																																						dbGAP											0													122.0	109.0	113.0					7																	47917162		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.3588G>A	7.37:g.47917162C>T	ENSP00000289672:p.Met1196Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWK1	Missense_Mutation	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.M1196I	ENST00000289672.2	37	c.3588	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.521753	0.00967	.	.	ENSG00000158683	ENST00000289672	T	0.69306	-0.39	5.26	4.3	0.51218	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	0.970466	0.08385	N	0.953958	T	0.60586	0.2280	L	0.46157	1.445	0.20764	N	0.999857	B	0.22080	0.064	B	0.20767	0.031	T	0.51872	-0.8650	10	0.49607	T	0.09	-2.8838	8.4114	0.32646	0.0:0.8761:0.0:0.1239	.	1196	Q8TDX9	PK1L1_HUMAN	I	1196	ENSP00000289672:M1196I	ENSP00000289672:M1196I	M	-	3	0	PKD1L1	47883687	0.212000	0.23540	0.012000	0.15200	0.004000	0.04260	1.969000	0.40510	1.073000	0.40885	0.655000	0.94253	ATG	PKD1L1	-	pfam_PKD/REJ-like,pfscan_REJ-like	ENSG00000158683		0.542	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	33	0.00	0	C	NM_138295		47917162	47917162	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	missense	60	23.08	18	SNP	0.358	T
PKP1	5317	genome.wustl.edu	37	1	201282464	201282464	+	Silent	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:201282464C>G	ENST00000352845.3	+	3	477	c.477C>G	c.(475-477)ctC>ctG	p.L159L	PKP1_ENST00000263946.3_Silent_p.L159L|PKP1_ENST00000367324.3_Silent_p.L159L			Q13835	PKP1_HUMAN	plakophilin 1	159					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						AGCCCGACCTCTACTGTGACC	0.642																																						dbGAP											0													31.0	35.0	34.0					1																	201282464		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.477C>G	1.37:g.201282464C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O00645|Q14CA0|Q15152	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.L159	ENST00000352845.3	37	c.477	CCDS30966.1	1																																																																																			PKP1	-	NULL	ENSG00000081277		0.642	PKP1-004	KNOWN	basic|CCDS	protein_coding	PKP1	HGNC	protein_coding	OTTHUMT00000086897.1	18	0.00	0	C	NM_000299		201282464	201282464	+1	no_errors	ENST00000263946	ensembl	human	known	69_37n	silent	60	17.81	13	SNP	1.000	G
PLB1	151056	genome.wustl.edu	37	2	28865850	28865850	+	Missense_Mutation	SNP	G	G	A	rs200065370		TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:28865850G>A	ENST00000327757.5	+	58	4344	c.4300G>A	c.(4300-4302)Ggg>Agg	p.G1434R	PLB1_ENST00000422425.2_Missense_Mutation_p.G1423R|PLB1_ENST00000541605.1_Missense_Mutation_p.G399R|AC074011.2_ENST00000431376.1_RNA	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	1434	Necessary for membrane localization. {ECO:0000250}.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					GGGCATCATCGGGACAGTGGT	0.657													G|||	1	0.000199681	0.0	0.0014	5008	,	,		15543	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													55.0	45.0	48.0					2																	28865850		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.4300G>A	2.37:g.28865850G>A	ENSP00000330442:p.Gly1434Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	pfam_Lipase_GDSL,superfamily_Esterase_SGNH_hydro-type	p.G1423R	ENST00000327757.5	37	c.4267	CCDS33168.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.59|13.59	2.283137|2.283137	0.40394|0.40394	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000541605|ENST00000436775	T;T;T|.	0.11604|.	2.76;2.79;2.79|.	5.52|5.52	-8.09|-8.09	0.01090|0.01090	.|.	1.772220|.	0.02575|.	N|.	0.098186|.	T|T	0.16811|0.16811	0.0404|0.0404	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	D;P|.	0.54397|.	0.966;0.943|.	B;B|.	0.42771|.	0.397;0.302|.	T|T	0.23332|0.23332	-1.0191|-1.0191	10|5	0.40728|.	T|.	0.16|.	1.5561|1.5561	2.5536|2.5536	0.04755|0.04755	0.5089:0.1089:0.1787:0.2035|0.5089:0.1089:0.1787:0.2035	.|.	1423;1434|.	Q6P1J6-3;Q6P1J6|.	.;PLB1_HUMAN|.	R|Q	1434;1423;399|136	ENSP00000330442:G1434R;ENSP00000416440:G1423R;ENSP00000437426:G399R|.	ENSP00000330442:G1434R|.	G|R	+|+	1|2	0|0	PLB1|PLB1	28719354|28719354	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.826000|-0.826000	0.04429|0.04429	-1.284000|-1.284000	0.02390|0.02390	-0.150000|-0.150000	0.13652|0.13652	GGG|CGG	PLB1	-	NULL	ENSG00000163803		0.657	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PLB1	HGNC	protein_coding	OTTHUMT00000353348.2	32	0.00	0	G			28865850	28865850	+1	no_errors	ENST00000422425	ensembl	human	known	69_37n	missense	50	20.63	13	SNP	0.000	A
CAPZA3	93661	genome.wustl.edu	37	12	18890331	18890331	+	5'Flank	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr12:18890331C>G	ENST00000317658.3	+	0	0				PLCZ1_ENST00000266505.7_5'UTR|PLCZ1_ENST00000447925.2_5'UTR|PLCZ1_ENST00000539875.1_5'UTR|PLCZ1_ENST00000435379.1_5'UTR|RP11-361I14.2_ENST00000536931.1_RNA	NM_033328.2	NP_201585.1	Q96KX2	CAZA3_HUMAN	capping protein (actin filament) muscle Z-line, alpha 3						actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cortical cytoskeleton (GO:0030863)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|nucleus (GO:0005634)|WASH complex (GO:0071203)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)	19	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)				AGAGCCGTTTCTCCTCACTTA	0.403																																						dbGAP											0													130.0	122.0	124.0					12																	18890331		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AB053259	CCDS8681.1	12p12.3	2008-02-05			ENSG00000177938	ENSG00000177938			24205	protein-coding gene	gene with protein product		608722				12029070	Standard	NM_033328		Approved	Gsg3, CAPPA3	uc001rdy.3	Q96KX2	OTTHUMG00000169001		12.37:g.18890331C>G	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q969J0	RNA	SNP	-	NULL	ENST00000317658.3	37	NULL	CCDS8681.1	12																																																																																			PLCZ1	-	-	ENSG00000139151		0.403	CAPZA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCZ1	HGNC	protein_coding	OTTHUMT00000401902.1	64	0.00	0	C	NM_033328		18890331	18890331	-1	no_errors	ENST00000541109	ensembl	human	known	69_37n	rna	50	36.71	29	SNP	0.321	G
PLEKHM1P	440456	genome.wustl.edu	37	17	62783426	62783426	+	RNA	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr17:62783426G>C	ENST00000582986.1	-	0	2146					NR_024386.1		Q69YJ1	PKHMP_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1 pseudogene						intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)										TCCGGTGGTTGAGCCTTCAAA	0.517																																						dbGAP											0																																										-	-	-			0					17q24.1	2012-10-03			ENSG00000214176	ENSG00000214176			35411	pseudogene	pseudogene							Standard	NR_024386		Approved	LOC440456	uc002jew.4	Q69YJ1	OTTHUMG00000179296		17.37:g.62783426G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000582986.1	37	NULL		17																																																																																			PLEKHM1P	-	-	ENSG00000214176		0.517	PLEKHM1P-002	KNOWN	basic	processed_transcript	PLEKHM1P	HGNC	pseudogene	OTTHUMT00000445598.1	33	0.00	0	G	NR_024386		62783426	62783426	-1	no_errors	ENST00000578036	ensembl	human	known	69_37n	rna	17	22.73	5	SNP	0.978	C
PLIN4	729359	genome.wustl.edu	37	19	4513178	4513178	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:4513178G>A	ENST00000301286.3	-	3	751	c.752C>T	c.(751-753)aCa>aTa	p.T251I		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	251	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						CTTGGTACCTGTTAGGACAGT	0.557																																						dbGAP											0													98.0	107.0	104.0					19																	4513178		2055	4179	6234	-	-	-	SO:0001583	missense	0			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.752C>T	19.37:g.4513178G>A	ENSP00000301286:p.Thr251Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEI2	Missense_Mutation	SNP	pfam_Perilipin,superfamily_Ankyrin_rpt-contain_dom	p.T251I	ENST00000301286.3	37	c.752	CCDS45927.1	19	.	.	.	.	.	.	.	.	.	.	G	16.74	3.208079	0.58343	.	.	ENSG00000167676	ENST00000301286	T	0.10573	2.86	4.61	-0.435	0.12279	.	1.343930	0.05221	N	0.508494	T	0.23014	0.0556	M	0.77616	2.38	0.09310	N	1	D	0.62365	0.991	P	0.54629	0.757	T	0.19418	-1.0306	10	0.37606	T	0.19	-4.899	4.6915	0.12783	0.362:0.1532:0.4848:0.0	.	251	Q96Q06	PLIN4_HUMAN	I	251	ENSP00000301286:T251I	ENSP00000301286:T251I	T	-	2	0	PLIN4	4464178	0.004000	0.15560	0.001000	0.08648	0.461000	0.32589	0.386000	0.20702	0.050000	0.15949	0.561000	0.74099	ACA	PLIN4	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000167676		0.557	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLIN4	HGNC	protein_coding	OTTHUMT00000395095.1	47	0.00	0	G	XM_170901		4513178	4513178	-1	no_errors	ENST00000301286	ensembl	human	novel	69_37n	missense	58	33.33	29	SNP	0.000	A
PNPLA3	80339	genome.wustl.edu	37	22	44328905	44328905	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr22:44328905C>G	ENST00000216180.3	+	4	807	c.634C>G	c.(634-636)Cta>Gta	p.L212V	PNPLA3_ENST00000423180.2_Missense_Mutation_p.L208V|PNPLA3_ENST00000478713.1_3'UTR	NM_025225.2	NP_079501.2	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	212					acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	diolein transacylation activity (GO:0051265)|mono-olein transacylation activity (GO:0051264)|phospholipase A2 activity (GO:0004623)|triglyceride lipase activity (GO:0004806)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|prostate(1)|skin(1)|stomach(2)	19		Ovarian(80;0.024)|all_neural(38;0.0416)				CAAGCTCAGTCTACGCCTCTG	0.542																																						dbGAP											0													199.0	170.0	180.0					22																	44328905		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14054.1	22q13.31	2014-03-14	2006-05-26	2006-05-26	ENSG00000100344	ENSG00000100344	3.1.1.3	"""Patatin-like phospholipase domain containing"""	18590	protein-coding gene	gene with protein product		609567	"""chromosome 22 open reading frame 20"", ""adiponutrin"""	C22orf20, ADPN		16799181, 19029121	Standard	NM_025225		Approved	dJ796I17.1, FLJ22012, adiponutrin, iPLA2epsilon	uc003bei.1	Q9NST1	OTTHUMG00000150555	ENST00000216180.3:c.634C>G	22.37:g.44328905C>G	ENSP00000216180:p.Leu212Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYI0|B2RCL3|B3KW00|Q6P1A1|Q96CB4	Missense_Mutation	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.L212V	ENST00000216180.3	37	c.634	CCDS14054.1	22	.	.	.	.	.	.	.	.	.	.	C	16.43	3.121499	0.56613	.	.	ENSG00000100344	ENST00000216180;ENST00000423180	T;T	0.77358	-1.09;-1.09	5.57	-8.43	0.00953	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.777035	0.11265	N	0.582168	T	0.48960	0.1529	N	0.16266	0.395	0.09310	N	1	B	0.27229	0.172	B	0.18871	0.023	T	0.36407	-0.9749	10	0.72032	D	0.01	-2.9242	1.102	0.01686	0.4325:0.1137:0.1734:0.2804	.	212	Q9NST1	PLPL3_HUMAN	V	212;208	ENSP00000216180:L212V;ENSP00000397987:L208V	ENSP00000216180:L212V	L	+	1	2	PNPLA3	42660238	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.603000	0.05674	-1.244000	0.02516	0.655000	0.94253	CTA	PNPLA3	-	superfamily_Acyl_Trfase/lysoPLipase	ENSG00000100344		0.542	PNPLA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PNPLA3	HGNC	protein_coding	OTTHUMT00000318891.1	44	0.00	0	C	NM_025225		44328905	44328905	+1	no_errors	ENST00000216180	ensembl	human	known	69_37n	missense	68	32.67	33	SNP	0.000	G
PRDM2	7799	genome.wustl.edu	37	1	14108569	14108569	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:14108569C>T	ENST00000235372.7	+	8	5135	c.4279C>T	c.(4279-4281)Cag>Tag	p.Q1427*	PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000311066.5_Nonsense_Mutation_p.Q1427*|PRDM2_ENST00000413440.1_Nonsense_Mutation_p.Q1226*|PRDM2_ENST00000343137.4_Nonsense_Mutation_p.Q1226*|PRDM2_ENST00000505823.1_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1427	Arg/Lys-rich (basic).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		GAAAAAAAATCAGCTAGTACA	0.403																																						dbGAP											0													82.0	93.0	89.0					1																	14108569		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.4279C>T	1.37:g.14108569C>T	ENSP00000235372:p.Gln1427*	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Nonsense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_RIZ_retinblastoma-bd_prot,pfscan_SET_dom,pfscan_Znf_C2H2	p.Q1427*	ENST00000235372.7	37	c.4279	CCDS150.1	1	.	.	.	.	.	.	.	.	.	.	C	43	10.056026	0.99326	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	.	.	.	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	19.2359	0.93858	0.0:1.0:0.0:0.0	.	.	.	.	X	1427;1427;1427;1226;1226	.	ENSP00000235372:Q1427X	Q	+	1	0	PRDM2	13981156	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.753000	0.68736	2.894000	0.99253	0.591000	0.81541	CAG	PRDM2	-	pirsf_RIZ_retinblastoma-bd_prot	ENSG00000116731		0.403	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM2	HGNC	protein_coding	OTTHUMT00000021792.2	27	0.00	0	C	NM_012231		14108569	14108569	+1	no_errors	ENST00000235372	ensembl	human	known	69_37n	nonsense	36	21.74	10	SNP	1.000	T
PRMT2	3275	genome.wustl.edu	37	21	48068499	48068499	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr21:48068499C>G	ENST00000397637.1	+	5	1411	c.457C>G	c.(457-459)Ctc>Gtc	p.L153V	PRMT2_ENST00000458387.2_Missense_Mutation_p.L153V|PRMT2_ENST00000491389.1_3'UTR|PRMT2_ENST00000440086.1_Missense_Mutation_p.L153V|PRMT2_ENST00000397638.2_Missense_Mutation_p.L153V|PRMT2_ENST00000397628.1_Missense_Mutation_p.L153V|PRMT2_ENST00000291705.6_Missense_Mutation_p.L153V|PRMT2_ENST00000334494.4_Missense_Mutation_p.L153V|PRMT2_ENST00000451211.2_Missense_Mutation_p.L153V|PRMT2_ENST00000355680.3_Missense_Mutation_p.L153V			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	153	Interaction with ESR1.|Interaction with RB1. {ECO:0000250}.|SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		GATCATCAGTCTCTTCTGTGC	0.567																																						dbGAP											0													172.0	152.0	159.0					21																	48068499		2203	4300	6503	-	-	-	SO:0001583	missense	0			U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.457C>G	21.37:g.48068499C>G	ENSP00000380759:p.Leu153Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Missense_Mutation	SNP	pfam_SH3_domain,pfam_Arg_MeTrfase,pfam_SH3_2,pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_tRNA_Trfase_Trm5/Tyw2,superfamily_SH3_domain,smart_SH3_domain,prints_SH3_domain,pfscan_SH3_domain	p.L153V	ENST00000397637.1	37	c.457	CCDS13737.1	21	.	.	.	.	.	.	.	.	.	.	C	14.33	2.502945	0.44558	.	.	ENSG00000160310	ENST00000355680;ENST00000397638;ENST00000458387;ENST00000451211;ENST00000291705;ENST00000397637;ENST00000334494;ENST00000397628;ENST00000440086	T;T;T;T;T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78	5.14	5.14	0.70334	.	0.072582	0.56097	D	0.000021	T	0.42381	0.1200	L	0.51914	1.62	0.47994	D	0.999568	P;D;P;D;P;P	0.63046	0.93;0.957;0.476;0.992;0.776;0.776	P;P;B;D;B;P	0.76071	0.718;0.705;0.223;0.987;0.406;0.592	T	0.25847	-1.0120	10	0.87932	D	0	-7.7984	10.0221	0.42048	0.0:0.9078:0.0:0.0922	.	153;153;153;153;39;153	B7U632;B7U630;B7U631;Q498Y5;Q49AF9;P55345	.;.;.;.;.;ANM2_HUMAN	V	153	ENSP00000347906:L153V;ENSP00000380760:L153V;ENSP00000407463:L153V;ENSP00000411984:L153V;ENSP00000291705:L153V;ENSP00000380759:L153V;ENSP00000335490:L153V;ENSP00000380752:L153V;ENSP00000397266:L153V	ENSP00000291705:L153V	L	+	1	0	PRMT2	46892927	1.000000	0.71417	1.000000	0.80357	0.320000	0.28249	1.435000	0.34969	2.579000	0.87056	0.655000	0.94253	CTC	PRMT2	-	pfam_Arg_MeTrfase,pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_tRNA_Trfase_Trm5/Tyw2	ENSG00000160310		0.567	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRMT2	HGNC	protein_coding	OTTHUMT00000207401.1	44	0.00	0	C	NM_001535		48068499	48068499	+1	no_errors	ENST00000355680	ensembl	human	known	69_37n	missense	102	24.44	33	SNP	1.000	G
PTCH1	5727	genome.wustl.edu	37	9	98278822	98278822	+	5'UTR	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr9:98278822C>G	ENST00000430669.2	-	0	517				RP11-435O5.4_ENST00000604650.1_RNA|PTCH1_ENST00000468211.2_5'UTR|PTCH1_ENST00000437951.1_5'UTR|PTCH1_ENST00000375274.2_Intron			Q13635	PTC1_HUMAN	patched 1						brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				GATTTCACATCAATTCCTTTT	0.657																																						dbGAP											0													172.0	154.0	159.0					9																	98278822		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000430669.2:c.-69G>C	9.37:g.98278822C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	RNA	SNP	-	NULL	ENST00000430669.2	37	NULL	CCDS47996.1	9																																																																																			PTCH1	-	-	ENSG00000185920		0.657	PTCH1-003	KNOWN	not_organism_supported|basic|CCDS	protein_coding	PTCH1	HGNC	protein_coding	OTTHUMT00000053231.2	47	0.00	0	C	NM_000264		98278822	98278822	-1	no_errors	ENST00000551425	ensembl	human	known	69_37n	rna	86	15.69	16	SNP	0.975	G
PTEN	5728	genome.wustl.edu	37	10	89725058	89725058	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr10:89725058C>A	ENST00000371953.3	+	9	2398	c.1041C>A	c.(1039-1041)ttC>ttA	p.F347L		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	347	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.		F -> L (in CWS1; reduced phosphatase activity towards Ins(1,3,4,5)P4). {ECO:0000269|PubMed:9399897}.		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.F347fs*13(6)|p.R55fs*1(5)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.Y346fs*1(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGCTGTACTTCACAAAAACAG	0.323		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												dbGAP	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	54	Whole gene deletion(37)|Deletion - Frameshift(16)|Deletion - In frame(1)	prostate(16)|central_nervous_system(10)|endometrium(6)|skin(5)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|cervix(1)|soft_tissue(1)											36.0	34.0	35.0					10																	89725058		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.1041C>A	10.37:g.89725058C>A	ENSP00000361021:p.Phe347Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.F347L	ENST00000371953.3	37	c.1041	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	C	13.93	2.384207	0.42308	.	.	ENSG00000171862	ENST00000371953	D	0.90004	-2.6	5.35	2.46	0.29980	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.92407	0.7590	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.90215	0.4267	9	.	.	.	-4.8796	10.0262	0.42072	0.0:0.7775:0.0:0.2225	.	347	P60484	PTEN_HUMAN	L	347	ENSP00000361021:F347L	.	F	+	3	2	PTEN	89715038	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.027000	0.30115	0.313000	0.23062	-0.229000	0.12294	TTC	PTEN	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tensin_phosphatase_C2-dom	ENSG00000171862		0.323	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	60	0.00	0	C	NM_000314		89725058	89725058	+1	no_errors	ENST00000371953	ensembl	human	known	69_37n	missense	68	16.05	13	SNP	1.000	A
PTPRU	10076	genome.wustl.edu	37	1	29644307	29644307	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:29644307C>T	ENST00000345512.3	+	26	3720	c.3591C>T	c.(3589-3591)atC>atT	p.I1197I	PTPRU_ENST00000323874.8_Silent_p.I1193I|PTPRU_ENST00000460170.2_Silent_p.I1193I|PTPRU_ENST00000428026.2_Silent_p.I1184I|PTPRU_ENST00000356870.3_Silent_p.I1193I|PTPRU_ENST00000373779.3_Silent_p.I1187I	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1197	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		AGTGCAGCATCGCCCTGTTGC	0.662																																						dbGAP											0													100.0	81.0	87.0					1																	29644307		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.3591C>T	1.37:g.29644307C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.I1197	ENST00000345512.3	37	c.3591	CCDS334.1	1																																																																																			PTPRU	-	smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000060656		0.662	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	HGNC	protein_coding	OTTHUMT00000010447.1	18	0.00	0	C			29644307	29644307	+1	no_errors	ENST00000345512	ensembl	human	known	69_37n	silent	42	23.64	13	SNP	1.000	T
RAB11FIP2	22841	genome.wustl.edu	37	10	119805431	119805431	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr10:119805431G>C	ENST00000355624.3	-	1	683	c.244C>G	c.(244-246)Ctt>Gtt	p.L82V	CASC2_ENST00000426021.1_RNA|RAB11FIP2_ENST00000369199.3_Missense_Mutation_p.L82V|CASC2_ENST00000414722.1_RNA|CASC2_ENST00000435944.1_RNA|RP11-354M20.3_ENST00000451610.2_RNA|RP11-354M20.3_ENST00000417968.4_RNA|CASC2_ENST00000454857.1_RNA|CASC2_ENST00000454781.1_RNA	NM_014904.2	NP_055719.1	Q7L804	RFIP2_HUMAN	RAB11 family interacting protein 2 (class I)	82	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Necessary for its cellular translocation to the plasma membrane.				establishment of cell polarity (GO:0030010)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(8)	19		Colorectal(252;0.235)		all cancers(201;0.0238)		ATAAGGAAAAGAATGTATTTC	0.448																																						dbGAP											0													92.0	91.0	91.0					10																	119805431		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY037299	CCDS7602.1	10q26.12	2004-07-22			ENSG00000107560	ENSG00000107560			29152	protein-coding gene	gene with protein product		608599				11994279, 10231032	Standard	NM_014904		Approved	KIAA0941, nRip11, Rab11-FIP2	uc001ldj.2	Q7L804	OTTHUMG00000019128	ENST00000355624.3:c.244C>G	10.37:g.119805431G>C	ENSP00000347839:p.Leu82Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEI4|Q3I768|Q9Y2F0	Missense_Mutation	SNP	pfam_Rab-bd_FIP-RBD,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.L82V	ENST00000355624.3	37	c.244	CCDS7602.1	10	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803090	0.70682	.	.	ENSG00000107560	ENST00000355624;ENST00000369199	D;D	0.82433	-1.61;-1.61	5.13	4.21	0.49690	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.89241	0.6659	M	0.64080	1.96	0.58432	D	0.999999	P;D	0.71674	0.944;0.998	P;D	0.73380	0.895;0.98	D	0.89692	0.3898	10	0.52906	T	0.07	-13.4152	15.8539	0.78960	0.0:0.1362:0.8638:0.0	.	82;82	Q3I768;Q7L804	.;RFIP2_HUMAN	V	82	ENSP00000347839:L82V;ENSP00000358200:L82V	ENSP00000347839:L82V	L	-	1	0	RAB11FIP2	119795421	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	5.371000	0.66150	1.275000	0.44379	0.650000	0.86243	CTT	RAB11FIP2	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000107560		0.448	RAB11FIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP2	HGNC	protein_coding	OTTHUMT00000050583.1	73	0.00	0	G	NM_014904		119805431	119805431	-1	no_errors	ENST00000369199	ensembl	human	known	69_37n	missense	47	29.41	20	SNP	1.000	C
RAD18	56852	genome.wustl.edu	37	3	8923136	8923136	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:8923136G>T	ENST00000264926.2	-	13	1509	c.1393C>A	c.(1393-1395)Ctt>Att	p.L465I		NM_020165.3	NP_064550.3	Q9NS91	RAD18_HUMAN	RAD18 E3 ubiquitin protein ligase	465					DNA repair (GO:0006281)|negative regulation of DNA recombination (GO:0045910)|protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|spermatogenesis (GO:0007283)	chromatin (GO:0000785)|nucleus (GO:0005634)|replication fork (GO:0005657)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|ligase activity (GO:0016874)|polyubiquitin binding (GO:0031593)|ubiquitin protein ligase binding (GO:0031625)|Y-form DNA binding (GO:0000403)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(3)	15				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		GTGTCTTGAAGATCGTTTCTG	0.368								Rad6 pathway																														dbGAP											0													132.0	123.0	126.0					3																	8923136		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2571.1	3p25-p24	2014-08-04	2014-08-04		ENSG00000070950	ENSG00000070950		"""RING-type (C3HC4) zinc fingers"""	18278	protein-coding gene	gene with protein product		605256	"""RAD18 homolog (S. cerevisiae)"""			10884424, 10908344	Standard	NM_020165		Approved	RNF73	uc003brd.3	Q9NS91	OTTHUMG00000090545	ENST00000264926.2:c.1393C>A	3.37:g.8923136G>T	ENSP00000264926:p.Leu465Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q58F55|Q9NRT6	Missense_Mutation	SNP	pfam_SAP_DNA-bd,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_Rad18_put,smart_SAP_DNA-bd,pfscan_Znf_RING,pfscan_SAP_DNA-bd	p.L465I	ENST00000264926.2	37	c.1393	CCDS2571.1	3	.	.	.	.	.	.	.	.	.	.	G	16.87	3.242546	0.58995	.	.	ENSG00000070950	ENST00000264926	T	0.27402	1.67	4.54	1.53	0.23141	.	0.960245	0.08565	N	0.926893	T	0.20820	0.0501	L	0.44542	1.39	0.09310	N	1	B	0.30763	0.294	B	0.25140	0.058	T	0.25950	-1.0117	10	0.16420	T	0.52	-0.3321	4.9446	0.13984	0.1003:0.0:0.5263:0.3734	.	465	Q9NS91	RAD18_HUMAN	I	465	ENSP00000264926:L465I	ENSP00000264926:L465I	L	-	1	0	RAD18	8898136	0.002000	0.14202	0.244000	0.24202	0.897000	0.52465	0.374000	0.20501	0.639000	0.30564	0.655000	0.94253	CTT	RAD18	-	NULL	ENSG00000070950		0.368	RAD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD18	HGNC	protein_coding	OTTHUMT00000207071.2	115	0.00	0	G	NM_020165		8923136	8923136	-1	no_errors	ENST00000264926	ensembl	human	known	69_37n	missense	115	34.29	60	SNP	0.007	T
RAET1K	646024	genome.wustl.edu	37	6	150322459	150322459	+	RNA	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr6:150322459C>G	ENST00000533735.1	-	0	417					NR_024045.1				retinoic acid early transcript 1K pseudogene																		TGTCTGCTCTCTGCTGTCCTG	0.433																																						dbGAP											0																																										-	-	-			0			AF425244		6q25.1	2012-01-10			ENSG00000218358	ENSG00000218358			16797	pseudogene	pseudogene						11827464	Standard	NR_024045		Approved		uc003qnq.3		OTTHUMG00000015815		6.37:g.150322459C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000533735.1	37	NULL		6																																																																																			RAET1K	-	-	ENSG00000218358		0.433	RAET1K-002	KNOWN	basic	processed_transcript	RAET1K	HGNC	pseudogene	OTTHUMT00000390882.1	8	0.00	0	C			150322459	150322459	-1	no_errors	ENST00000533735	ensembl	human	known	69_37n	rna	11	38.89	7	SNP	0.002	G
RFXANK	8625	genome.wustl.edu	37	19	19309501	19309501	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:19309501G>A	ENST00000303088.4	+	8	1074	c.600G>A	c.(598-600)ggG>ggA	p.G200G	RFXANK_ENST00000456252.3_Silent_p.G178G|RFXANK_ENST00000407360.3_Silent_p.G200G|RFXANK_ENST00000392324.4_Silent_p.G177G|RFXANK_ENST00000353145.1_Silent_p.G177G	NM_003721.2	NP_003712.1	O14593	RFXK_HUMAN	regulatory factor X-associated ankyrin-containing protein	200					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			NS(1)|breast(1)|endometrium(1)|lung(8)|ovary(2)|prostate(1)	14			Epithelial(12;0.00228)			CTGTGCGCGGGAACCACGTGA	0.612																																						dbGAP											0													95.0	85.0	88.0					19																	19309501		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF094760	CCDS12395.1, CCDS12396.1, CCDS62611.1	19p12	2014-09-17			ENSG00000064490	ENSG00000064490		"""Ankyrin repeat domain containing"""	9987	protein-coding gene	gene with protein product	"""ankyrin repeat-containing regulatory factor X-associated protein"", ""regulatory factor X subunit B"", ""RFX-Bdelta4"", ""DNA-binding protein RFXANK"""	603200				9806546, 10072068	Standard	NM_003721		Approved	BLS, RFX-B, ANKRA1, F14150_1, MGC138628	uc002nls.3	O14593	OTTHUMG00000169224	ENST00000303088.4:c.600G>A	19.37:g.19309501G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95839|Q24JQ1|Q6FGA8	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_DNA-bd_RFXANK,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G200	ENST00000303088.4	37	c.600	CCDS12395.1	19																																																																																			RFXANK	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_DNA-bd_RFXANK,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000064490		0.612	RFXANK-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	RFXANK	HGNC	protein_coding	OTTHUMT00000402923.2	30	0.00	0	G	NM_003721		19309501	19309501	+1	no_errors	ENST00000303088	ensembl	human	known	69_37n	silent	59	16.90	12	SNP	1.000	A
RGPD8	727851	genome.wustl.edu	37	2	113157342	113157342	+	Nonsense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:113157342G>C	ENST00000302558.3	-	14	2113	c.1922C>G	c.(1921-1923)tCa>tGa	p.S641*	RGPD8_ENST00000330575.5_Nonsense_Mutation_p.S641*|RGPD8_ENST00000409750.1_Nonsense_Mutation_p.S501*	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	641					protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)			endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						AACAATTTCTGATGCCTAAAC	0.289																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.1922C>G	2.37:g.113157342G>C	ENSP00000306637:p.Ser641*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5CZA8	Nonsense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.S641*	ENST00000302558.3	37	c.1922	CCDS46394.1	2	.	.	.	.	.	.	.	.	.	.	G	24.9	4.576965	0.86645	.	.	ENSG00000169629	ENST00000302558;ENST00000409750;ENST00000330575	.	.	.	2.35	1.39	0.22231	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-9.3887	8.5019	0.33163	0.0:0.2432:0.7568:0.0	.	.	.	.	X	641;501;641	.	ENSP00000306637:S641X	S	-	2	0	RGPD8	112873813	1.000000	0.71417	0.952000	0.39060	0.217000	0.24651	2.957000	0.49137	0.286000	0.22352	0.184000	0.17185	TCA	RGPD8	-	NULL	ENSG00000169629		0.289	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RGPD8	HGNC	protein_coding	OTTHUMT00000375951.1	88	0.00	0	G	XM_001722279		113157342	113157342	-1	no_errors	ENST00000302558	ensembl	human	known	69_37n	nonsense	30	31.82	14	SNP	1.000	C
RNF32	140545	genome.wustl.edu	37	7	156451274	156451274	+	Intron	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr7:156451274G>C	ENST00000405335.1	+	8	1093				RNF32_ENST00000311822.8_Intron|RNF32_ENST00000432459.2_Intron|RNF32_ENST00000343665.4_Intron|RNF32_ENST00000317955.5_Intron|RNF32_ENST00000392741.2_Intron|AC005534.8_ENST00000455709.1_RNA|RNF32_ENST00000392743.2_Intron			Q9H0A6	RNF32_HUMAN	ring finger protein 32							aggresome (GO:0016235)|endosome (GO:0005768)	zinc ion binding (GO:0008270)			cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(2)	15	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		GGTAGGTAAAGATCATTATGT	0.413																																						dbGAP											0													66.0	69.0	68.0					7																	156451274		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS5944.1	7q36	2013-08-05			ENSG00000105982	ENSG00000105982		"""RING-type (C3HC4) zinc fingers"""	17118	protein-coding gene	gene with protein product		610241				11890671	Standard	NM_001184996		Approved	FKSG33, HSD15, LMBR2	uc003wmr.3	Q9H0A6	OTTHUMG00000151440	ENST00000405335.1:c.684+10G>C	7.37:g.156451274G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FIB3|Q6X7T4|Q8N6V8|Q8TDG0|Q96BM5|Q9Y6U1	RNA	SNP	-	NULL	ENST00000405335.1	37	NULL	CCDS5944.1	7																																																																																			RNF32	-	-	ENSG00000105982		0.413	RNF32-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF32	HGNC	protein_coding	OTTHUMT00000322660.2	46	0.00	0	G	NM_030936		156451274	156451274	+1	no_errors	ENST00000463028	ensembl	human	known	69_37n	rna	54	18.18	12	SNP	0.000	C
ROCK2	9475	genome.wustl.edu	37	2	11338705	11338705	+	Nonsense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:11338705G>C	ENST00000315872.6	-	25	3459	c.3011C>G	c.(3010-3012)tCa>tGa	p.S1004*	ROCK2_ENST00000401753.1_Nonsense_Mutation_p.S761*	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	1004	RHOA binding. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TTTCAATCTTGACAGTTCTGA	0.284																																						dbGAP											0													77.0	74.0	75.0					2																	11338705		1803	4061	5864	-	-	-	SO:0001587	stop_gained	0			D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.3011C>G	2.37:g.11338705G>C	ENSP00000317985:p.Ser1004*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QZ0|Q53SJ7|Q9UQN5	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_tRNA-bd_arm,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.S1004*	ENST00000315872.6	37	c.3011	CCDS42654.1	2	.	.	.	.	.	.	.	.	.	.	G	43	10.345367	0.99388	.	.	ENSG00000134318	ENST00000315872;ENST00000401753;ENST00000399089	.	.	.	5.59	5.59	0.84812	.	0.296919	0.32093	N	0.006588	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	13.8344	0.63400	0.0729:0.0:0.9271:0.0	.	.	.	.	X	1004;761;362	.	ENSP00000317985:S1004X	S	-	2	0	ROCK2	11256156	0.400000	0.25295	0.630000	0.29268	0.678000	0.39670	3.341000	0.52151	2.639000	0.89480	0.655000	0.94253	TCA	ROCK2	-	pfam_Rho-bd,pirsf_Rho-assoc_coiled-coil_kinase	ENSG00000134318		0.284	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK2	HGNC	protein_coding	OTTHUMT00000313886.3	89	0.00	0	G			11338705	11338705	-1	no_errors	ENST00000315872	ensembl	human	known	69_37n	nonsense	62	27.91	24	SNP	0.272	C
RPL10	6134	genome.wustl.edu	37	X	153626649	153626649	+	5'UTR	SNP	A	A	C	rs915941	byFrequency	TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chrX:153626649A>C	ENST00000369817.2	+	0	467				RPL10_ENST00000424325.2_5'UTR|RPL10_ENST00000479366.1_3'UTR|SNORA70_ENST00000384436.1_RNA|RPL10_ENST00000406022.2_5'Flank			P27635	RL10_HUMAN	ribosomal protein L10						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCCGTCTTCGACAGGACTCTA	0.612											OREG0003599	type=REGULATORY REGION|Gene=RPL10|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	C|||	932	0.246887	0.4357	0.1311	3775	,	,		11720	0.0665		0.0626	False		,,,				2504	0.138					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AB007170	CCDS14746.1, CCDS76059.1	Xq28	2011-04-06			ENSG00000147403	ENSG00000147403		"""L ribosomal proteins"""	10298	protein-coding gene	gene with protein product		312173				9582194	Standard	NM_006013		Approved	NOV, QM, DXS648E, DXS648, FLJ23544, L10	uc004fkm.2	P27635	OTTHUMG00000033189	ENST00000369817.2:c.-110A>C	X.37:g.153626649A>C		Somatic	1757	WXS	Illumina GAIIx	Phase_IV	A3KQT0|D3DWW6|Q16470|Q2HXT7|Q53FH7|Q6FGN8|Q8TDA5	RNA	SNP	-	NULL	ENST00000369817.2	37	NULL	CCDS14746.1	X																																																																																			RPL10	-	-	ENSG00000147403		0.612	RPL10-008	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10	HGNC	protein_coding	OTTHUMT00000127774.5	8	0.00	0	A	NM_006013		153626649	153626649	+1	no_errors	ENST00000479366	ensembl	human	known	69_37n	rna	2	75.00	6	SNP	0.000	C
RYR2	6262	genome.wustl.edu	37	1	237632412	237632412	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:237632412C>G	ENST00000366574.2	+	17	1950	c.1633C>G	c.(1633-1635)Cgt>Ggt	p.R545G	RYR2_ENST00000360064.6_Missense_Mutation_p.R543G|MIR4428_ENST00000584884.1_RNA|RYR2_ENST00000542537.1_Missense_Mutation_p.R529G	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	545					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TAGAGGAAATCGTAAAAACTG	0.378																																						dbGAP											0													118.0	115.0	116.0					1																	237632412		1813	4084	5897	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1633C>G	1.37:g.237632412C>G	ENSP00000355533:p.Arg545Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.R543G	ENST00000366574.2	37	c.1627	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366394	0.61513	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97138	-4.26;-4.26;-4.26	4.94	3.08	0.35506	Intracellular calcium-release channel (1);	0.000000	0.56097	U	0.000032	D	0.97829	0.9287	M	0.84433	2.695	0.80722	D	1	D	0.69078	0.997	P	0.62014	0.897	D	0.97054	0.9766	10	0.72032	D	0.01	.	8.6807	0.34207	0.0:0.8183:0.0:0.1817	.	545	Q92736	RYR2_HUMAN	G	545;543;529	ENSP00000355533:R545G;ENSP00000353174:R543G;ENSP00000443798:R529G	ENSP00000353174:R543G	R	+	1	0	RYR2	235699035	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.391000	0.34475	0.505000	0.28104	-0.251000	0.11542	CGT	RYR2	-	pfam_Ca-rel_channel	ENSG00000198626		0.378	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	94	0.00	0	C	NM_001035		237632412	237632412	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	176	13.66	28	SNP	1.000	G
SASH1	23328	genome.wustl.edu	37	6	148865073	148865073	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr6:148865073G>A	ENST00000367467.3	+	18	2942	c.2467G>A	c.(2467-2469)Gag>Aag	p.E823K		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	823					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		CCGGAGCTGTGAGACCCTGGA	0.587																																						dbGAP											0													107.0	121.0	116.0					6																	148865073		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.2467G>A	6.37:g.148865073G>A	ENSP00000356437:p.Glu823Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.E823K	ENST00000367467.3	37	c.2467	CCDS5212.1	6	.	.	.	.	.	.	.	.	.	.	G	33	5.273146	0.95429	.	.	ENSG00000111961	ENST00000367467;ENST00000535767;ENST00000537769	T	0.44482	0.92	5.26	5.26	0.73747	.	0.048631	0.85682	D	0.000000	T	0.55545	0.1927	M	0.62723	1.935	0.54753	D	0.999982	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.58335	-0.7654	10	0.62326	D	0.03	-31.6281	17.0537	0.86527	0.0:0.0:1.0:0.0	.	804;823	Q6P4R9;O94885	.;SASH1_HUMAN	K	823;584;233	ENSP00000356437:E823K	ENSP00000356437:E823K	E	+	1	0	SASH1	148906766	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.471000	0.90403	2.454000	0.82982	0.650000	0.86243	GAG	SASH1	-	NULL	ENSG00000111961		0.587	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASH1	HGNC	protein_coding	OTTHUMT00000042619.1	20	0.00	0	G	NM_015278		148865073	148865073	+1	no_errors	ENST00000367467	ensembl	human	known	69_37n	missense	40	27.27	15	SNP	1.000	A
SCN2A	6326	genome.wustl.edu	37	2	166245374	166245374	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:166245374G>C	ENST00000375437.2	+	27	5348	c.5058G>C	c.(5056-5058)aaG>aaC	p.K1686N	SCN2A_ENST00000283256.6_Missense_Mutation_p.K1686N|SCN2A_ENST00000357398.3_Missense_Mutation_p.K1686N|SCN2A_ENST00000375427.2_Missense_Mutation_p.K1686N	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1686					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCTATGTTAAGAGGGAAGTTG	0.463																																						dbGAP											0													206.0	198.0	201.0					2																	166245374		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5058G>C	2.37:g.166245374G>C	ENSP00000364586:p.Lys1686Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.K1686N	ENST00000375437.2	37	c.5058	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787329	0.49997	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.97041	-4.22;-4.22;-4.22;-4.22	5.5	3.71	0.42584	Ion transport (1);	0.076223	0.56097	D	0.000032	D	0.98046	0.9356	M	0.79926	2.475	0.51767	D	0.999935	P;D	0.60575	0.937;0.988	P;D	0.69142	0.548;0.962	D	0.98166	1.0449	10	0.87932	D	0	.	12.2216	0.54437	0.1385:0.0:0.8615:0.0	.	1686;1686	Q99250-2;Q99250	.;SCN2A_HUMAN	N	1686	ENSP00000364586:K1686N;ENSP00000349973:K1686N;ENSP00000283256:K1686N;ENSP00000364576:K1686N	ENSP00000283256:K1686N	K	+	3	2	SCN2A	165953620	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.713000	0.47194	0.822000	0.34565	0.644000	0.83932	AAG	SCN2A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000136531		0.463	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	118	0.00	0	G	NM_021007		166245374	166245374	+1	no_errors	ENST00000283256	ensembl	human	known	69_37n	missense	102	32.89	50	SNP	1.000	C
SDC1	6382	genome.wustl.edu	37	2	20402587	20402587	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:20402587C>T	ENST00000254351.4	-	5	1117	c.873G>A	c.(871-873)ccG>ccA	p.P291P	SDC1_ENST00000482879.1_Intron|SDC1_ENST00000403076.1_Intron|SDC1_ENST00000381150.1_Silent_p.P291P	NM_002997.4	NP_002988	P18827	SDC1_HUMAN	syndecan 1	291					canonical Wnt signaling pathway (GO:0060070)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|myoblast development (GO:0048627)|odontogenesis (GO:0042476)|phototransduction, visible light (GO:0007603)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to toxic substance (GO:0009636)|retinoid metabolic process (GO:0001523)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|striated muscle cell development (GO:0055002)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|skin(2)	21	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)		TGGCTTGTTTCGGCTCCTCCA	0.612																																						dbGAP											0													117.0	116.0	116.0					2																	20402587		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ551176	CCDS1697.1	2p24.1	2008-02-05			ENSG00000115884	ENSG00000115884		"""CD molecules"", ""Proteoglycans / Cell Surface : Syndecans"""	10658	protein-coding gene	gene with protein product	"""syndecan proteoglycan 1"""	186355		SDC			Standard	XM_005262621		Approved	CD138, syndecan, SYND1	uc002rdo.1	P18827	OTTHUMG00000090751	ENST00000254351.4:c.873G>A	2.37:g.20402587C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W523|Q53QV0|Q546D3|Q96HB7	Silent	SNP	pfam_Syndecan,smart_Neurexin-like	p.P291	ENST00000254351.4	37	c.873	CCDS1697.1	2																																																																																			SDC1	-	pfam_Syndecan,smart_Neurexin-like	ENSG00000115884		0.612	SDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC1	HGNC	protein_coding	OTTHUMT00000207495.1	22	0.00	0	C	NM_001006946		20402587	20402587	-1	no_errors	ENST00000254351	ensembl	human	known	69_37n	silent	24	31.43	11	SNP	0.232	T
SCN7A	6332	genome.wustl.edu	37	2	167313382	167313382	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:167313382C>A	ENST00000409855.1	-	10	1414	c.1288G>T	c.(1288-1290)Gag>Tag	p.E430*		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	430					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	aTAGATACCTCATCTGTTTCA	0.269																																						dbGAP											0													72.0	60.0	64.0					2																	167313382		1634	3728	5362	-	-	-	SO:0001587	stop_gained	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1288G>T	2.37:g.167313382C>A	ENSP00000386796:p.Glu430*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.E430*	ENST00000409855.1	37	c.1288	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	C	17.20	3.329321	0.60743	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	.	.	.	4.58	1.62	0.23740	.	0.432951	0.19349	N	0.116442	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	8.0784	0.30731	0.0:0.4596:0.4491:0.0914	.	.	.	.	X	430	.	ENSP00000259060:E430X	E	-	1	0	SCN7A	167021628	0.025000	0.19082	0.563000	0.28383	0.033000	0.12548	0.184000	0.16939	0.541000	0.28827	-0.314000	0.08810	GAG	SCN7A	-	NULL	ENSG00000136546		0.269	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	56	0.00	0	C			167313382	167313382	-1	no_errors	ENST00000409855	ensembl	human	known	69_37n	nonsense	48	20.00	12	SNP	0.288	A
SDC2	6383	genome.wustl.edu	37	8	97605736	97605736	+	Missense_Mutation	SNP	T	T	C	rs370731563		TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr8:97605736T>C	ENST00000302190.4	+	2	1010	c.89T>C	c.(88-90)aTg>aCg	p.M30T	SDC2_ENST00000518385.1_Intron|SDC2_ENST00000519914.1_Start_Codon_SNP_p.M1T|SDC2_ENST00000522911.1_Start_Codon_SNP_p.M1T	NM_002998.3	NP_002989.2	P34741	SDC2_HUMAN	syndecan 2	30					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dendrite morphogenesis (GO:0048813)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|regulation of dendrite morphogenesis (GO:0048814)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|stomach(2)	16	Breast(36;3.41e-05)				Sargramostim(DB00020)	GATAAAGACATGTACCTTGAC	0.448																																						dbGAP											0													129.0	102.0	111.0					8																	97605736		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030133	CCDS6272.1	8q22-q23	2011-08-11	2007-02-15		ENSG00000169439	ENSG00000169439		"""Proteoglycans / Cell Surface : Syndecans"", ""CD molecules"""	10659	protein-coding gene	gene with protein product	"""syndecan proteoglycan 2"""	142460	"""heparan sulfate proteoglycan 1, cell surface-associated"""	HSPG, HSPG1		8187643	Standard	NM_002998		Approved	fibroglycan, SYND2, CD362	uc003yhv.1	P34741	OTTHUMG00000164689	ENST00000302190.4:c.89T>C	8.37:g.97605736T>C	ENSP00000307046:p.Met30Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQA3|Q6PIS6|Q9H6V1	Missense_Mutation	SNP	pfam_Syndecan,smart_Neurexin-like	p.M30T	ENST00000302190.4	37	c.89	CCDS6272.1	8	.	.	.	.	.	.	.	.	.	.	T	18.10	3.547563	0.65311	.	.	ENSG00000169439	ENST00000302190;ENST00000545117;ENST00000546193;ENST00000522911;ENST00000519914;ENST00000521590;ENST00000523877	T;T;T;T	0.37058	1.22;1.22;1.22;1.22	5.75	5.75	0.90469	.	0.097393	0.64402	D	0.000001	T	0.36771	0.0979	L	0.57536	1.79	0.35165	D	0.771	P	0.47191	0.891	B	0.39971	0.315	T	0.57039	-0.7879	10	0.66056	D	0.02	-32.1927	13.8671	0.63594	0.0:0.0:0.0:1.0	.	30	P34741	SDC2_HUMAN	T	30;30;20;1;1;1;1	ENSP00000307046:M30T;ENSP00000427784:M1T;ENSP00000428256:M1T;ENSP00000429121:M1T	ENSP00000307046:M30T	M	+	2	0	SDC2	97674912	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.485000	0.60279	2.320000	0.78422	0.528000	0.53228	ATG	SDC2	-	pfam_Syndecan	ENSG00000169439		0.448	SDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC2	HGNC	protein_coding	OTTHUMT00000379750.1	43	0.00	0	T	NM_002998		97605736	97605736	+1	no_errors	ENST00000302190	ensembl	human	known	69_37n	missense	58	44.23	46	SNP	1.000	C
SDCCAG3	10807	genome.wustl.edu	37	9	139301960	139301960	+	Silent	SNP	G	G	T	rs3812580	byFrequency	TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr9:139301960G>T	ENST00000357365.3	-	5	585	c.456C>A	c.(454-456)acC>acA	p.T152T	SDCCAG3_ENST00000298537.7_Silent_p.T129T|SDCCAG3_ENST00000461693.1_5'Flank|SDCCAG3_ENST00000371725.3_Silent_p.T79T	NM_001039707.1	NP_001034796.1	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	152						cytoplasm (GO:0005737)				NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	16		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		CATACCCGCCGGTTTGGGAGG	0.527																																						dbGAP											0													24.0	29.0	27.0					9																	139301960		1861	4094	5955	-	-	-	SO:0001819	synonymous_variant	0			AF039688	CCDS6999.2, CCDS43903.1, CCDS43904.1	9q34.3	2010-10-27			ENSG00000165689	ENSG00000165689			10667	protein-coding gene	gene with protein product						9610721	Standard	XM_005266050		Approved	NY-CO-3	uc004chi.3	Q96C92	OTTHUMG00000020928	ENST00000357365.3:c.456C>A	9.37:g.139301960G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCP1|O60525|Q5SXN1|Q5SXN2|Q5SXN3|Q5SXN4|Q5SXN8|Q6V704|Q9NVY5	Silent	SNP	NULL	p.T152	ENST00000357365.3	37	c.456	CCDS43904.1	9																																																																																			SDCCAG3	-	NULL	ENSG00000165689		0.527	SDCCAG3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SDCCAG3	HGNC	protein_coding	OTTHUMT00000055060.2	24	0.00	0	G	NM_006643		139301960	139301960	-1	no_errors	ENST00000357365	ensembl	human	known	69_37n	silent	40	20.00	10	SNP	0.000	T
SEL1L	6400	genome.wustl.edu	37	14	81969228	81969228	+	Splice_Site	SNP	C	C	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr14:81969228C>A	ENST00000336735.4	-	6	731		c.e6-1		SEL1L_ENST00000555824.1_Splice_Site	NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)						Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		CCGATATGCTCTTCAAATGTA	0.333																																						dbGAP											0													100.0	97.0	98.0					14																	81969228		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.615-1G>T	14.37:g.81969228C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWT6|Q9P1T9|Q9UHK7	Splice_Site	SNP	-	e6-1	ENST00000336735.4	37	c.615-1	CCDS9876.1	14	.	.	.	.	.	.	.	.	.	.	C	19.18	3.778126	0.70107	.	.	ENSG00000071537	ENST00000336735;ENST00000555824	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9525	0.97208	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SEL1L	81038981	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	5.424000	0.66464	2.719000	0.93026	0.655000	0.94253	.	SEL1L	-	-	ENSG00000071537		0.333	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEL1L	HGNC	protein_coding	OTTHUMT00000413325.1	81	0.00	0	C	NM_005065	Intron	81969228	81969228	-1	no_errors	ENST00000336735	ensembl	human	known	69_37n	splice_site	89	28.23	35	SNP	1.000	A
SLC23A2	9962	genome.wustl.edu	37	20	4843515	4843515	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr20:4843515G>A	ENST00000379333.1	-	14	1787	c.1395C>T	c.(1393-1395)ctC>ctT	p.L465L	SLC23A2_ENST00000338244.1_Silent_p.L465L|SLC23A2_ENST00000424750.2_Silent_p.L351L	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	465					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GAGCGAGCATGAGGGCTGCTC	0.582																																						dbGAP											0													56.0	52.0	54.0					20																	4843515		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1395C>T	20.37:g.4843515G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Missense_Mutation	SNP	pfam_Xant/urac/vitC	p.H222Y	ENST00000379333.1	37	c.664	CCDS13085.1	20	.	.	.	.	.	.	.	.	.	.	G	7.924	0.739223	0.15642	.	.	ENSG00000089057	ENST00000423430	.	.	.	5.61	3.56	0.40772	.	.	.	.	.	T	0.62196	0.2408	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60994	-0.7152	4	.	.	.	-24.0772	11.4456	0.50120	0.0:0.2488:0.6357:0.1155	.	.	.	.	Y	222	.	.	H	-	1	0	SLC23A2	4791515	1.000000	0.71417	1.000000	0.80357	0.616000	0.37450	2.312000	0.43726	1.506000	0.48736	0.655000	0.94253	CAT	SLC23A2	-	pfam_Xant/urac/vitC	ENSG00000089057		0.582	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC23A2	HGNC	protein_coding	OTTHUMT00000077832.1	17	0.00	0	G			4843515	4843515	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000423430	ensembl	human	known	69_37n	missense	27	37.21	16	SNP	1.000	A
SLFN5	162394	genome.wustl.edu	37	17	33591256	33591256	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr17:33591256C>T	ENST00000299977.4	+	4	1341	c.1193C>T	c.(1192-1194)tCa>tTa	p.S398L	SLFN5_ENST00000542451.1_Intron	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	398					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		GAACTCTTCTCACAACATAAA	0.398																																						dbGAP											0													51.0	52.0	52.0					17																	33591256		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.1193C>T	17.37:g.33591256C>T	ENSP00000299977:p.Ser398Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AF2|Q8WU54|Q96A82	Missense_Mutation	SNP	pfam_ATPase_AAA-4,pfam_DUF2075	p.S398L	ENST00000299977.4	37	c.1193	CCDS32619.1	17	.	.	.	.	.	.	.	.	.	.	C	16.35	3.097459	0.56075	.	.	ENSG00000166750	ENST00000299977	T	0.02345	4.33	3.5	1.47	0.22746	.	0.577326	0.13126	N	0.411809	T	0.03220	0.0094	L	0.50333	1.59	0.09310	N	0.999999	B	0.17038	0.02	B	0.12837	0.008	T	0.41592	-0.9500	10	0.33141	T	0.24	.	5.6441	0.17580	0.0:0.7408:0.0:0.2592	.	398	Q08AF3	SLFN5_HUMAN	L	398	ENSP00000299977:S398L	ENSP00000299977:S398L	S	+	2	0	SLFN5	30615369	0.000000	0.05858	0.007000	0.13788	0.990000	0.78478	0.193000	0.17116	0.300000	0.22699	-0.251000	0.11542	TCA	SLFN5	-	NULL	ENSG00000166750		0.398	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN5	HGNC	protein_coding	OTTHUMT00000448649.2	23	0.00	0	C	NM_144975		33591256	33591256	+1	no_errors	ENST00000299977	ensembl	human	known	69_37n	missense	17	48.48	16	SNP	0.025	T
SMPD4	55627	genome.wustl.edu	37	2	130911319	130911319	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:130911319C>T	ENST00000409031.1	-	17	3114	c.1966G>A	c.(1966-1968)Gaa>Aaa	p.E656K	SMPD4_ENST00000351288.6_Missense_Mutation_p.E627K|SMPD4_ENST00000431183.2_Missense_Mutation_p.E554K|SMPD4_ENST00000339679.7_Missense_Mutation_p.E514K|SMPD4_ENST00000453750.1_Missense_Mutation_p.E405K|SMPD4_ENST00000452225.2_Missense_Mutation_p.E397K|SMPD4_ENST00000473720.1_5'Flank|SMPD4_ENST00000426662.2_Missense_Mutation_p.E292K|SMPD4_ENST00000443958.2_Missense_Mutation_p.E320K	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	617					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	TCCAGGTATTCATCTGTCTTC	0.592																																						dbGAP											0													22.0	26.0	25.0					2																	130911319		2177	4264	6441	-	-	-	SO:0001583	missense	0			AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.1966G>A	2.37:g.130911319C>T	ENSP00000386531:p.Glu656Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Missense_Mutation	SNP	NULL	p.E656K	ENST00000409031.1	37	c.1966	CCDS42751.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	15.24|15.24	2.775956|2.775956	0.49786|0.49786	.|.	.|.	ENSG00000136699|ENSG00000136699	ENST00000351288;ENST00000409031;ENST00000431183;ENST00000453750;ENST00000443958;ENST00000339679;ENST00000452225;ENST00000426662;ENST00000457039;ENST00000449159|ENST00000439886	.|.	.|.	.|.	3.91|3.91	3.91|3.91	0.45181|0.45181	.|.	0.052751|.	0.64402|.	D|.	0.000001|.	T|T	0.69079|0.69079	0.3071|0.3071	L|L	0.61036|0.61036	1.89|1.89	0.53005|0.53005	D|D	0.999963|0.999963	B;B;B;B;D;B;B;P;P;B|.	0.67145|.	0.313;0.045;0.08;0.08;0.996;0.05;0.097;0.918;0.587;0.095|.	B;B;B;B;D;B;B;P;B;B|.	0.75484|.	0.156;0.039;0.045;0.045;0.986;0.02;0.061;0.638;0.225;0.058|.	T|T	0.68996|0.68996	-0.5262|-0.5262	9|5	0.41790|.	T|.	0.15|.	.|.	13.4569|13.4569	0.61204|0.61204	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	292;397;554;514;405;588;617;656;663;188|.	B4E0L6;B4DQ31;E7ESA2;B4E0T5;B4DM23;Q9NXE4-2;Q9NXE4;B1PBA3;Q9NXE4-4;Q9NXE4-5|.	.;.;.;.;.;.;NSMA3_HUMAN;.;.;.|.	K|I	627;656;554;405;320;514;397;292;253;166|530	.|.	ENSP00000339721:E514K|.	E|M	-|-	1|3	0|0	SMPD4|SMPD4	130627789|130627789	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.447000|0.447000	0.32167|0.32167	7.215000|7.215000	0.77966|0.77966	1.714000|1.714000	0.51371|0.51371	0.549000|0.549000	0.68633|0.68633	GAA|ATG	SMPD4	-	NULL	ENSG00000136699		0.592	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMPD4	HGNC	protein_coding	OTTHUMT00000254516.3	51	0.00	0	C	NM_017751		130911319	130911319	-1	no_errors	ENST00000409031	ensembl	human	known	69_37n	missense	96	21.95	27	SNP	1.000	T
SNCAIP	9627	genome.wustl.edu	37	5	121786491	121786491	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr5:121786491G>C	ENST00000261368.8	+	10	2211	c.1949G>C	c.(1948-1950)aGa>aCa	p.R650T	CTC-210G5.1_ENST00000506053.1_RNA|CTC-210G5.1_ENST00000509993.1_RNA|CTC-210G5.1_ENST00000503529.1_RNA|CTC-210G5.1_ENST00000505546.1_RNA|SNCAIP_ENST00000379538.3_Missense_Mutation_p.R284T|SNCAIP_ENST00000379533.2_Missense_Mutation_p.R697T|SNCAIP_ENST00000379536.2_Missense_Mutation_p.R590T|SNCAIP_ENST00000503116.2_3'UTR|SNCAIP_ENST00000261367.7_Missense_Mutation_p.R697T|SNCAIP_ENST00000504884.2_3'UTR|SNCAIP_ENST00000414317.2_Missense_Mutation_p.R252T|CTC-210G5.1_ENST00000510972.1_RNA|SNCAIP_ENST00000542191.1_Missense_Mutation_p.R208T	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	650					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		GCTTCCTCTAGAAATTCTAAA	0.458																																						dbGAP											0													36.0	40.0	39.0					5																	121786491		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.1949G>C	5.37:g.121786491G>C	ENSP00000261368:p.Arg650Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R697T	ENST00000261368.8	37	c.2090	CCDS4131.1	5	.	.	.	.	.	.	.	.	.	.	G	16.36	3.102321	0.56183	.	.	ENSG00000064692	ENST00000542191;ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000379538;ENST00000261367;ENST00000414317;ENST00000447854	T;T;T;T;T;T;T;T	0.13538	4.4;4.93;2.63;2.58;4.93;4.89;2.58;4.63	6.06	5.19	0.71726	.	0.097528	0.64402	D	0.000002	T	0.28499	0.0705	L	0.51422	1.61	0.35973	D	0.835431	P;P;P;P;P;P;D;B	0.63046	0.588;0.749;0.588;0.493;0.712;0.493;0.992;0.361	B;B;P;B;P;B;D;B	0.71656	0.434;0.434;0.517;0.109;0.637;0.109;0.974;0.081	T	0.27806	-1.0063	10	0.62326	D	0.03	-21.9178	9.7694	0.40580	0.1937:0.0:0.8063:0.0	.	590;278;252;590;284;284;697;650	D6R9G8;Q9NVG1;B7Z995;Q9Y6H5-4;Q9Y6H5-5;Q9Y6H5-2;Q9Y6H5-3;Q9Y6H5	.;.;.;.;.;.;.;SNCAP_HUMAN	T	208;590;650;697;590;284;697;252;290	ENSP00000441681:R208T;ENSP00000422106:R590T;ENSP00000261368:R650T;ENSP00000368848:R697T;ENSP00000368851:R590T;ENSP00000368854:R284T;ENSP00000261367:R697T;ENSP00000394392:R252T	ENSP00000261367:R697T	R	+	2	0	SNCAIP	121814390	1.000000	0.71417	0.834000	0.33040	0.820000	0.46376	4.193000	0.58385	1.576000	0.49790	0.655000	0.94253	AGA	SNCAIP	-	NULL	ENSG00000064692		0.458	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCAIP	HGNC	protein_coding	OTTHUMT00000250888.1	30	0.00	0	G			121786491	121786491	+1	no_errors	ENST00000379533	ensembl	human	known	69_37n	missense	37	28.85	15	SNP	0.986	C
PROB1	389333	genome.wustl.edu	37	5	138732323	138732325	+	5'Flank	DEL	ACA	ACA	-			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	ACA	ACA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr5:138732323_138732325delACA	ENST00000434752.2	-	0	0					NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1																		TGCCTACCAGACAACAAAGACCC	0.547																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31			5.37:g.138732326_138732328delACA	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E007	In_Frame_Del	DEL	NULL	p.C270in_frame_del	ENST00000434752.2	37	c.810_808	CCDS54909.1	5																																																																																			SPATA24	-	NULL	ENSG00000170469		0.547	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA24	HGNC	protein_coding	OTTHUMT00000470735.1	20	0.00	0	ACA	NM_001161546		138732323	138732325	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000302091	ensembl	human	putative	69_37n	in_frame_del	21	50.00	21	DEL	0.001:0.001:0.000	-
SPTBN5	51332	genome.wustl.edu	37	15	42173270	42173270	+	Silent	SNP	A	A	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr15:42173270A>G	ENST00000320955.6	-	13	2847	c.2620T>C	c.(2620-2622)Ttg>Ctg	p.L874L		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	874					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TCCTGACTCAAGTGGTCCTGT	0.557																																						dbGAP											0													49.0	53.0	52.0					15																	42173270		2014	4182	6196	-	-	-	SO:0001819	synonymous_variant	0			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.2620T>C	15.37:g.42173270A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.L874	ENST00000320955.6	37	c.2620		15																																																																																			SPTBN5	-	smart_Spectrin/alpha-actinin	ENSG00000137877		0.557	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	SPTBN5	HGNC	protein_coding	OTTHUMT00000420237.1	23	0.00	0	A	NM_016642		42173270	42173270	-1	no_errors	ENST00000320955	ensembl	human	known	69_37n	silent	56	30.00	24	SNP	0.112	G
SRGAP3	9901	genome.wustl.edu	37	3	9052010	9052010	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:9052010G>A	ENST00000383836.3	-	18	2636	c.2209C>T	c.(2209-2211)Cct>Tct	p.P737S	SRGAP3_ENST00000360413.3_Missense_Mutation_p.P713S	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	737	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		CTGGTATGAGGCTCAGTGCCA	0.587			T	RAF1	pilocytic astrocytoma																																	dbGAP		Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0													148.0	114.0	125.0					3																	9052010		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.2209C>T	3.37:g.9052010G>A	ENSP00000373347:p.Pro737Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IX13|Q8IZV8	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.P737S	ENST00000383836.3	37	c.2209	CCDS2572.1	3	.	.	.	.	.	.	.	.	.	.	G	9.610	1.131039	0.21041	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.25912	1.77;2.19	5.23	5.23	0.72850	Src homology-3 domain (1);	0.121611	0.56097	D	0.000029	T	0.16642	0.0400	N	0.11427	0.14	0.54753	D	0.999982	B;B	0.22683	0.073;0.02	B;B	0.25405	0.06;0.011	T	0.09530	-1.0670	10	0.18276	T	0.48	.	18.4084	0.90542	0.0:0.0:1.0:0.0	.	713;737	O43295-2;O43295	.;SRGP2_HUMAN	S	737;713	ENSP00000373347:P737S;ENSP00000353587:P713S	ENSP00000353587:P713S	P	-	1	0	SRGAP3	9027010	1.000000	0.71417	0.990000	0.47175	0.514000	0.34195	5.293000	0.65680	2.437000	0.82529	0.655000	0.94253	CCT	SRGAP3	-	superfamily_SH3_domain	ENSG00000196220		0.587	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3	57	0.00	0	G			9052010	9052010	-1	no_errors	ENST00000383836	ensembl	human	known	69_37n	missense	94	16.07	18	SNP	1.000	A
SRRM2	23524	genome.wustl.edu	37	16	2815374	2815374	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr16:2815374G>A	ENST00000301740.8	+	11	5394	c.4845G>A	c.(4843-4845)caG>caA	p.Q1615Q		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1615	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CCAGGGCACAGAGTGGTTCTG	0.562																																						dbGAP											0													89.0	85.0	86.0					16																	2815374		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.4845G>A	16.37:g.2815374G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	pfam_mRNA_splic_Cwf21	p.Q1615	ENST00000301740.8	37	c.4845	CCDS32373.1	16																																																																																			SRRM2	-	NULL	ENSG00000167978		0.562	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	21	0.00	0	G			2815374	2815374	+1	no_errors	ENST00000301740	ensembl	human	known	69_37n	silent	43	27.12	16	SNP	0.999	A
SSR2	6746	genome.wustl.edu	37	1	155984806	155984806	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:155984806G>C	ENST00000295702.4	-	4	380	c.309C>G	c.(307-309)ttC>ttG	p.F103L	SSR2_ENST00000529008.1_Intron|SSR2_ENST00000496742.1_Intron|SSR2_ENST00000480567.1_Missense_Mutation_p.F103L	NM_003145.3	NP_003136.1	P43308	SSRB_HUMAN	signal sequence receptor, beta (translocon-associated protein beta)	103					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|stomach(1)	10	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					AGGTGAAGTTGAAATAACCAG	0.507																																						dbGAP											0													114.0	102.0	106.0					1																	155984806		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000341	CCDS1126.1	1q21-q23	2008-02-05			ENSG00000163479	ENSG00000163479			11324	protein-coding gene	gene with protein product		600867				7789174	Standard	NM_003145		Approved	TLAP, TRAPB	uc001fmx.3	P43308	OTTHUMG00000017456	ENST00000295702.4:c.309C>G	1.37:g.155984806G>C	ENSP00000295702:p.Phe103Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9K9|D3DVA7|Q53HI0|Q5VY95|Q5VY96|Q6IB31|Q9BWE4	Missense_Mutation	SNP	pfam_TRAP_beta,pirsf_TRAP_beta	p.F103L	ENST00000295702.4	37	c.309	CCDS1126.1	1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.594400	0.66219	.	.	ENSG00000163479	ENST00000295702;ENST00000480567;ENST00000531917	.	.	.	5.09	3.06	0.35304	.	0.000000	0.85682	D	0.000000	T	0.45994	0.1370	M	0.72576	2.205	0.58432	D	0.999998	P;P	0.40909	0.732;0.732	P;P	0.46510	0.519;0.519	T	0.51124	-0.8745	9	0.46703	T	0.11	-17.9961	5.5449	0.17059	0.3102:0.0:0.6898:0.0	.	124;103	Q6MZE4;P43308	.;SSRB_HUMAN	L	103	.	ENSP00000295702:F103L	F	-	3	2	SSR2	154251430	1.000000	0.71417	0.997000	0.53966	0.700000	0.40528	2.621000	0.46418	1.369000	0.46134	0.313000	0.20887	TTC	SSR2	-	pfam_TRAP_beta,pirsf_TRAP_beta	ENSG00000163479		0.507	SSR2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SSR2	HGNC	protein_coding	OTTHUMT00000046172.2	80	0.00	0	G	NM_003145		155984806	155984806	-1	no_errors	ENST00000295702	ensembl	human	known	69_37n	missense	170	11.46	22	SNP	1.000	C
STIM1	6786	genome.wustl.edu	37	11	4112909	4112909	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr11:4112909C>T	ENST00000300737.4	+	12	2508	c.1939C>T	c.(1939-1941)Ctg>Ttg	p.L647L	STIM1_ENST00000527651.1_3'UTR|STIM1_ENST00000533977.1_Silent_p.L474L	NM_003156.3	NP_003147.2	Q13586	STIM1_HUMAN	stromal interaction molecule 1	647					activation of store-operated calcium channel activity (GO:0032237)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|regulation of calcium ion transport (GO:0051924)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)|microtubule (GO:0005874)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|microtubule plus-end binding (GO:0051010)|store-operated calcium channel activity (GO:0015279)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|liver(1)|lung(14)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		CATTCCCCACCTGGCTGGCAA	0.577																																						dbGAP											0													72.0	74.0	73.0					11																	4112909		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			BC021300, U52426	CCDS7749.1, CCDS60706.1, CCDS73247.1	11p15.5	2014-09-17			ENSG00000167323	ENSG00000167323		"""Sterile alpha motif (SAM) domain containing"""	11386	protein-coding gene	gene with protein product		605921				8921403, 11463338, 11983428	Standard	NM_003156		Approved	GOK, D11S4896E	uc021qco.1	Q13586	OTTHUMG00000133360	ENST00000300737.4:c.1939C>T	11.37:g.4112909C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PQJ4|Q8N382	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.L647	ENST00000300737.4	37	c.1939	CCDS7749.1	11																																																																																			STIM1	-	NULL	ENSG00000167323		0.577	STIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STIM1	HGNC	protein_coding	OTTHUMT00000257196.1	25	0.00	0	C	NM_003156		4112909	4112909	+1	no_errors	ENST00000300737	ensembl	human	known	69_37n	silent	59	26.25	21	SNP	1.000	T
SULT4A1	25830	genome.wustl.edu	37	22	44235893	44235893	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr22:44235893G>A	ENST00000330884.4	-	3	433	c.313C>T	c.(313-315)Ccc>Tcc	p.P105S	SULT4A1_ENST00000540422.1_Intron|SULT4A1_ENST00000249130.5_Missense_Mutation_p.P105S	NM_014351.3	NP_055166.1	Q9BR01	ST4A1_HUMAN	sulfotransferase family 4A, member 1	105					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			kidney(1)|large_intestine(3)|lung(4)|ovary(1)	9		Ovarian(80;0.024)|all_neural(38;0.0416)		Colorectal(1;0.00242)|READ - Rectum adenocarcinoma(1;0.0419)		ATGAGGCGGGGAGAGGTCAGT	0.627																																						dbGAP											0													104.0	72.0	83.0					22																	44235893		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF188698	CCDS14051.1	22q13.2	2012-11-05			ENSG00000130540	ENSG00000130540		"""Sulfotransferases, cytosolic"""	14903	protein-coding gene	gene with protein product		608359				10698717	Standard	NM_014351		Approved	SULTX3, hBR-STL-1	uc003bee.1	Q9BR01	OTTHUMG00000141314	ENST00000330884.4:c.313C>T	22.37:g.44235893G>A	ENSP00000332565:p.Pro105Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7N3|O43728	Missense_Mutation	SNP	pfam_Sulfotransferase_dom	p.P105S	ENST00000330884.4	37	c.313	CCDS14051.1	22	.	.	.	.	.	.	.	.	.	.	G	13.37	2.216950	0.39201	.	.	ENSG00000130540	ENST00000330884;ENST00000249130	T;T	0.02916	4.11;4.11	4.34	4.34	0.51931	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.19805	0.0476	M	0.89785	3.06	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.06197	-1.0840	10	0.72032	D	0.01	.	15.8247	0.78690	0.0:0.0:1.0:0.0	.	105	Q9BR01	ST4A1_HUMAN	S	105	ENSP00000332565:P105S;ENSP00000249130:P105S	ENSP00000249130:P105S	P	-	1	0	SULT4A1	42567226	1.000000	0.71417	0.905000	0.35620	0.851000	0.48451	6.841000	0.75374	1.957000	0.56846	0.563000	0.77884	CCC	SULT4A1	-	pfam_Sulfotransferase_dom	ENSG00000130540		0.627	SULT4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT4A1	HGNC	protein_coding	OTTHUMT00000280660.2	69	0.00	0	G	NM_014351		44235893	44235893	-1	no_errors	ENST00000330884	ensembl	human	known	69_37n	missense	172	27.43	65	SNP	1.000	A
T	6862	genome.wustl.edu	37	6	166575969	166575969	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr6:166575969G>A	ENST00000296946.2	-	7	1338	c.870C>T	c.(868-870)taC>taT	p.Y290Y	T_ENST00000366871.3_Intron	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	290					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		AGGGGCTGGGGTAGGGTGAGG	0.587									Chordoma, Familial Clustering of																													dbGAP											0													106.0	104.0	105.0					6																	166575969		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database		AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.870C>T	6.37:g.166575969G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E7ERD6|Q4KMP4	Silent	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_Brachyury,prints_TF_T-box	p.Y290	ENST00000296946.2	37	c.870	CCDS5290.1	6																																																																																			T	-	prints_TF_Brachyury	ENSG00000164458		0.587	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	T	HGNC	protein_coding	OTTHUMT00000043037.2	38	0.00	0	G	NM_003181		166575969	166575969	-1	no_errors	ENST00000296946	ensembl	human	known	69_37n	silent	55	40.86	38	SNP	1.000	A
TBC1D9B	23061	genome.wustl.edu	37	5	179294845	179294845	+	Silent	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr5:179294845C>G	ENST00000356834.3	-	18	2833	c.2796G>C	c.(2794-2796)ctG>ctC	p.L932L	TBC1D9B_ENST00000444477.2_Silent_p.L90L|TBC1D9B_ENST00000518085.1_5'Flank|TBC1D9B_ENST00000355235.3_Silent_p.L932L|TBC1D9B_ENST00000519746.1_Silent_p.L108L	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	932						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCTCTGGGCTCAGAGCTGTGC	0.597																																						dbGAP											0													46.0	43.0	44.0					5																	179294845		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.2796G>C	5.37:g.179294845C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Silent	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_HAND_2,pfscan_Rab-GTPase-TBC_dom	p.L932	ENST00000356834.3	37	c.2796	CCDS43408.1	5																																																																																			TBC1D9B	-	NULL	ENSG00000197226		0.597	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D9B	HGNC	protein_coding	OTTHUMT00000253501.3	34	0.00	0	C	NM_015043		179294845	179294845	-1	no_errors	ENST00000356834	ensembl	human	known	69_37n	silent	84	21.50	23	SNP	1.000	G
TBL1XR1	79718	genome.wustl.edu	37	3	176782763	176782763	+	Start_Codon_SNP	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:176782763C>G	ENST00000430069.1	-	3	262	c.3G>C	c.(1-3)atG>atC	p.M1I	TBL1XR1_ENST00000457928.2_Start_Codon_SNP_p.M1I			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	1					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			TGCTTATACTCATCTTTATTC	0.289																																						dbGAP											0													38.0	34.0	35.0					3																	176782763		1793	4028	5821	-	-	-	SO:0001582	initiator_codon_variant	0			AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.3G>C	3.37:g.176782763C>G	ENSP00000405574:p.Met1Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M1I	ENST00000430069.1	37	c.3	CCDS46961.1	3	.	.	.	.	.	.	.	.	.	.	C	23.2	4.384079	0.82792	.	.	ENSG00000177565	ENST00000430069;ENST00000457928;ENST00000352800;ENST00000437738;ENST00000450267;ENST00000431674;ENST00000422066;ENST00000443315;ENST00000422442;ENST00000427349;ENST00000413084	T;T	0.65549	-0.16;-0.16	6.0	6.0	0.97389	.	0.000000	0.85682	D	0.000000	T	0.76385	0.3980	.	.	.	0.80722	D	1	P	0.51537	0.946	P	0.57620	0.824	T	0.74942	-0.3492	9	0.48119	T	0.1	-6.2563	19.5351	0.95247	0.0:1.0:0.0:0.0	.	1	Q9BZK7	TBL1R_HUMAN	I	1	ENSP00000405574:M1I;ENSP00000413251:M1I	ENSP00000263964:M1I	M	-	3	0	TBL1XR1	178265457	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.850000	0.98022	0.650000	0.86243	ATG	TBL1XR1	-	NULL	ENSG00000177565		0.289	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL1XR1	HGNC	protein_coding	OTTHUMT00000347587.3	59	0.00	0	C	NM_024665	Missense_Mutation	176782763	176782763	-1	no_errors	ENST00000430069	ensembl	human	known	69_37n	missense	37	32.73	18	SNP	1.000	G
TCF12	6938	genome.wustl.edu	37	15	57524926	57524926	+	Nonsense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr15:57524926C>G	ENST00000267811.5	+	11	1146	c.842C>G	c.(841-843)tCa>tGa	p.S281*	TCF12_ENST00000333725.5_Nonsense_Mutation_p.S281*|TCF12_ENST00000343827.3_Nonsense_Mutation_p.S111*|TCF12_ENST00000452095.2_Nonsense_Mutation_p.S277*|TCF12_ENST00000438423.2_Nonsense_Mutation_p.S281*|TCF12_ENST00000543579.1_Nonsense_Mutation_p.S111*|TCF12_ENST00000537840.1_Nonsense_Mutation_p.S45*|TCF12_ENST00000560764.1_3'UTR|TCF12_ENST00000557843.1_Nonsense_Mutation_p.S281*	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	281					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		CCTCCACACTCAGTTTCACCA	0.393			T	TEC	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	0													151.0	119.0	129.0					15																	57524926		2192	4292	6484	-	-	-	SO:0001587	stop_gained	0			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.842C>G	15.37:g.57524926C>G	ENSP00000267811:p.Ser281*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3D9|Q86TC1|Q86VM2	Nonsense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.S281*	ENST00000267811.5	37	c.842	CCDS10159.1	15	.	.	.	.	.	.	.	.	.	.	C	37	6.160449	0.97334	.	.	ENSG00000140262	ENST00000543236;ENST00000267811;ENST00000438423;ENST00000452095;ENST00000333725;ENST00000543579;ENST00000537840;ENST00000343827	.	.	.	5.62	5.62	0.85841	.	0.396329	0.28641	N	0.014640	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-18.2576	19.6555	0.95837	0.0:1.0:0.0:0.0	.	.	.	.	X	333;281;281;277;281;111;45;111	.	ENSP00000267811:S281X	S	+	2	0	TCF12	55312218	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.779000	0.85648	2.653000	0.90120	0.557000	0.71058	TCA	TCF12	-	NULL	ENSG00000140262		0.393	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	HGNC	protein_coding	OTTHUMT00000255069.3	79	0.00	0	C	NM_003205		57524926	57524926	+1	no_errors	ENST00000438423	ensembl	human	known	69_37n	nonsense	121	20.92	32	SNP	1.000	G
TCOF1	6949	genome.wustl.edu	37	5	149755376	149755376	+	Silent	SNP	C	C	G	rs542011467	byFrequency	TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr5:149755376C>G	ENST00000504761.2	+	12	1797	c.1797C>G	c.(1795-1797)gtC>gtG	p.V599V	TCOF1_ENST00000323668.7_Silent_p.V522V|TCOF1_ENST00000451292.1_Silent_p.V599V|TCOF1_ENST00000439160.2_Silent_p.V599V|TCOF1_ENST00000377797.3_Silent_p.V599V|TCOF1_ENST00000394269.3_Silent_p.V599V|TCOF1_ENST00000445265.2_Silent_p.V522V|TCOF1_ENST00000513346.1_Silent_p.V599V			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	599					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCGTCCAGGTCAAGGCTGAAA	0.612																																						dbGAP											0													76.0	82.0	80.0					5																	149755376		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.1797C>G	5.37:g.149755376C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Silent	SNP	pfam_TCS_treacle,smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_Treacle-like_TCS	p.V599	ENST00000504761.2	37	c.1797	CCDS54936.1	5																																																																																			TCOF1	-	pfam_TCS_treacle,prints_Treacle-like_TCS	ENSG00000070814		0.612	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCOF1	HGNC	protein_coding	OTTHUMT00000380552.1	29	0.00	0	C	NM_001008656		149755376	149755376	+1	no_errors	ENST00000451292	ensembl	human	known	69_37n	silent	48	18.64	11	SNP	0.132	G
TFEC	22797	genome.wustl.edu	37	7	115614246	115614246	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr7:115614246G>C	ENST00000265440.7	-	3	425	c.245C>G	c.(244-246)tCt>tGt	p.S82C	TFEC_ENST00000484212.1_Missense_Mutation_p.S172C|TFEC_ENST00000393485.1_Intron|TFEC_ENST00000320239.7_Intron	NM_012252.3	NP_036384.1	O14948	TFEC_HUMAN	transcription factor EC	82	Necessary for transcriptional transactivation.				cellular response to heat (GO:0034605)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|kidney(1)|large_intestine(5)|lung(13)|prostate(2)|skin(1)|urinary_tract(2)	25			STAD - Stomach adenocarcinoma(10;0.00878)			TAGCAGAGGAGAGTCTGCTCC	0.333																																						dbGAP											0													99.0	92.0	94.0					7																	115614246		2203	4299	6502	-	-	-	SO:0001583	missense	0			D43945	CCDS5762.1, CCDS34738.1, CCDS59076.1	7q31.2	2013-05-21			ENSG00000105967	ENSG00000105967		"""Basic helix-loop-helix proteins"""	11754	protein-coding gene	gene with protein product		604732				9256061	Standard	NM_012252		Approved	TCFEC, TFECL, bHLHe34	uc003vhj.2	O14948	OTTHUMG00000023518	ENST00000265440.7:c.245C>G	7.37:g.115614246G>C	ENSP00000265440:p.Ser82Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8X5|Q5H9U8|Q709A4|Q8N6J9	Missense_Mutation	SNP	pfam_bHLH_ZIP_TF_MiT/TFE,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.S82C	ENST00000265440.7	37	c.245	CCDS5762.1	7	.	.	.	.	.	.	.	.	.	.	G	15.82	2.946256	0.53079	.	.	ENSG00000105967	ENST00000265440;ENST00000484212	T;T	0.18502	2.21;2.49	4.77	2.72	0.32119	.	0.482992	0.19790	U	0.106013	T	0.08582	0.0213	N	0.00841	-1.15	0.80722	D	1	D;P	0.56521	0.976;0.875	P;B	0.52856	0.711;0.338	T	0.40608	-0.9554	10	0.28530	T	0.3	-6.868	10.7109	0.45982	0.0:0.1474:0.7125:0.1402	.	172;82	B7Z757;O14948	.;TFEC_HUMAN	C	82;172	ENSP00000265440:S82C;ENSP00000417432:S172C	ENSP00000265440:S82C	S	-	2	0	TFEC	115401482	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	1.878000	0.39608	0.937000	0.37394	0.650000	0.86243	TCT	TFEC	-	NULL	ENSG00000105967		0.333	TFEC-001	KNOWN	basic|CCDS	protein_coding	TFEC	HGNC	protein_coding	OTTHUMT00000059839.4	50	0.00	0	G	NM_012252		115614246	115614246	-1	no_errors	ENST00000265440	ensembl	human	known	69_37n	missense	57	18.57	13	SNP	0.995	C
TFRC	7037	genome.wustl.edu	37	3	195802123	195802123	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:195802123C>A	ENST00000360110.4	-	3	314	c.145G>T	c.(145-147)Gac>Tac	p.D49Y	TFRC_ENST00000420415.1_Intron|TFRC_ENST00000540528.1_Intron|TFRC_ENST00000535031.1_Intron|RNU7-18P_ENST00000516365.1_RNA|TFRC_ENST00000392396.3_Missense_Mutation_p.D49Y	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	49	Mediates interaction with SH3BP4.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	GTGTTATTGTCAGCATTTTCT	0.423			T	BCL6	NHL																																	dbGAP		Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	0													288.0	261.0	271.0					3																	195802123		2203	4300	6503	-	-	-	SO:0001583	missense	0			X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.145G>T	3.37:g.195802123C>A	ENSP00000353224:p.Asp49Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.D49Y	ENST00000360110.4	37	c.145	CCDS3312.1	3	.	.	.	.	.	.	.	.	.	.	C	17.72	3.460049	0.63401	.	.	ENSG00000072274	ENST00000360110;ENST00000392396	T;T	0.35421	1.31;1.31	5.96	5.96	0.96718	.	0.338302	0.34411	N	0.003988	T	0.52533	0.1740	L	0.56769	1.78	0.80722	D	1	D	0.69078	0.997	P	0.57371	0.819	T	0.42949	-0.9421	10	0.44086	T	0.13	-12.2587	17.8946	0.88883	0.0:1.0:0.0:0.0	.	49	P02786	TFR1_HUMAN	Y	49	ENSP00000353224:D49Y;ENSP00000376197:D49Y	ENSP00000353224:D49Y	D	-	1	0	TFRC	197286520	0.997000	0.39634	0.247000	0.24249	0.326000	0.28443	6.887000	0.75616	2.826000	0.97356	0.655000	0.94253	GAC	TFRC	-	NULL	ENSG00000072274		0.423	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFRC	HGNC	protein_coding	OTTHUMT00000341346.1	137	0.00	0	C			195802123	195802123	-1	no_errors	ENST00000360110	ensembl	human	known	69_37n	missense	155	27.23	58	SNP	0.957	A
TG	7038	genome.wustl.edu	37	8	133911059	133911059	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr8:133911059G>C	ENST00000220616.4	+	14	3274	c.3234G>C	c.(3232-3234)gaG>gaC	p.E1078D	TG_ENST00000377869.1_Missense_Mutation_p.E1078D	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1078	Thyroglobulin type-1 9. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CAACCTGCGAGAAATCTCGAA	0.542																																						dbGAP											0													67.0	60.0	63.0					8																	133911059		2203	4300	6503	-	-	-	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.3234G>C	8.37:g.133911059G>C	ENSP00000220616:p.Glu1078Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.E1078D	ENST00000220616.4	37	c.3234	CCDS34944.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.55|14.55	2.569088|2.569088	0.45798|0.45798	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000220616|ENST00000518505	T;T|.	0.66099|.	-0.19;-0.19|.	5.74|5.74	3.96|3.96	0.45880|0.45880	Thyroglobulin type-1 (2);|.	0.089576|.	0.48767|.	D|.	0.000174|.	T|T	0.54822|0.54822	0.1882|0.1882	M|M	0.71581|0.71581	2.175|2.175	0.26469|0.26469	N|N	0.975306|0.975306	D|.	0.57257|.	0.979|.	P|.	0.49085|.	0.6|.	T|T	0.47195|0.47195	-0.9136|-0.9136	10|5	0.72032|.	D|.	0.01|.	.|.	9.6034|9.6034	0.39619|0.39619	0.1619:0.0:0.8381:0.0|0.1619:0.0:0.8381:0.0	.|.	1078|.	P01266|.	THYG_HUMAN|.	D|T	1078|45	ENSP00000367100:E1078D;ENSP00000220616:E1078D|.	ENSP00000220616:E1078D|.	E|R	+|+	3|2	2|0	TG|TG	133980241|133980241	1.000000|1.000000	0.71417|0.71417	0.537000|0.537000	0.28052|0.28052	0.005000|0.005000	0.04900|0.04900	5.517000|5.517000	0.67061|0.67061	0.779000|0.779000	0.33543|0.33543	0.655000|0.655000	0.94253|0.94253	GAG|AGA	TG	-	superfamily_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	ENSG00000042832		0.542	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	28	0.00	0	G	NM_003235		133911059	133911059	+1	no_errors	ENST00000220616	ensembl	human	known	69_37n	missense	66	17.50	14	SNP	0.887	C
TMEM175	84286	genome.wustl.edu	37	4	952146	952146	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr4:952146C>T	ENST00000264771.4	+	11	1562	c.1377C>T	c.(1375-1377)ttC>ttT	p.F459F	TMEM175_ENST00000508204.1_Silent_p.F377F|TMEM175_ENST00000515740.1_Silent_p.F343F	NM_032326.2	NP_115702.1	Q9BSA9	TM175_HUMAN	transmembrane protein 175	459						integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(1)|large_intestine(2)|lung(6)|pancreas(1)|upper_aerodigestive_tract(3)	14			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CCTGCGCCTTCCTGTTGCTGC	0.726																																						dbGAP											0													42.0	41.0	41.0					4																	952146		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC005158	CCDS3341.1, CCDS75087.1, CCDS75088.1	4p16.3	2008-02-05			ENSG00000127419	ENSG00000127419			28709	protein-coding gene	gene with protein product						12477932	Standard	XM_005272301		Approved	MGC4618	uc003gbq.3	Q9BSA9	OTTHUMG00000118996	ENST00000264771.4:c.1377C>T	4.37:g.952146C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVN4|Q8ND13	Missense_Mutation	SNP	pfam_DUF1211_TMEM175	p.P296S	ENST00000264771.4	37	c.886	CCDS3341.1	4	.	.	.	.	.	.	.	.	.	.	C	1.589	-0.529600	0.04112	.	.	ENSG00000127419	ENST00000505148	.	.	.	5.05	3.27	0.37495	.	.	.	.	.	T	0.58438	0.2122	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55192	-0.8179	4	.	.	.	-13.5191	9.5259	0.39165	0.0:0.8417:0.0:0.1583	.	.	.	.	S	296	.	.	P	+	1	0	TMEM175	942146	0.552000	0.26505	1.000000	0.80357	0.136000	0.21042	-0.109000	0.10840	2.342000	0.79632	0.491000	0.48974	CCT	TMEM175	-	NULL	ENSG00000127419		0.726	TMEM175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM175	HGNC	protein_coding	OTTHUMT00000239193.2	18	0.00	0	C	NM_032326		952146	952146	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000505148	ensembl	human	novel	69_37n	missense	45	25.00	15	SNP	1.000	T
TMEM179B	374395	genome.wustl.edu	37	11	62556503	62556503	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr11:62556503C>G	ENST00000333449.4	+	2	110	c.105C>G	c.(103-105)ttC>ttG	p.F35L	TMEM223_ENST00000527073.1_Intron|TMEM223_ENST00000525631.1_Intron|RP11-727F15.12_ENST00000601484.1_RNA|TMEM179B_ENST00000533861.1_Missense_Mutation_p.F35L	NM_199337.2	NP_955369.1	Q7Z7N9	T179B_HUMAN	transmembrane protein 179B	35						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|liver(1)|lung(1)	4						AGGGCTCCTTCAGTGGTAGAT	0.522																																						dbGAP											0													131.0	124.0	126.0					11																	62556503		2201	4299	6500	-	-	-	SO:0001583	missense	0			BC051355	CCDS8036.1	11q12.3	2007-11-26			ENSG00000185475	ENSG00000185475			33744	protein-coding gene	gene with protein product							Standard	NM_199337		Approved		uc001nvd.4	Q7Z7N9	OTTHUMG00000167611	ENST00000333449.4:c.105C>G	11.37:g.62556503C>G	ENSP00000333697:p.Phe35Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.F35L	ENST00000333449.4	37	c.105	CCDS8036.1	11	.	.	.	.	.	.	.	.	.	.	C	17.83	3.484908	0.63962	.	.	ENSG00000185475	ENST00000533861;ENST00000333449	.	.	.	5.87	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.70771	0.3262	M	0.68952	2.095	0.40645	D	0.981988	D	0.67145	0.996	D	0.77557	0.99	T	0.73987	-0.3809	9	0.72032	D	0.01	.	9.9064	0.41379	0.0:0.8357:0.0:0.1643	.	35	Q7Z7N9	T179B_HUMAN	L	35	.	ENSP00000333697:F35L	F	+	3	2	TMEM179B	62313079	0.915000	0.31059	0.949000	0.38748	0.461000	0.32589	1.076000	0.30729	1.475000	0.48197	0.456000	0.33151	TTC	TMEM179B	-	NULL	ENSG00000185475		0.522	TMEM179B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM179B	HGNC	protein_coding	OTTHUMT00000395362.2	48	0.00	0	C	NM_199337		62556503	62556503	+1	no_errors	ENST00000333449	ensembl	human	known	69_37n	missense	64	28.89	26	SNP	0.892	G
TMEM209	84928	genome.wustl.edu	37	7	129825043	129825043	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr7:129825043C>A	ENST00000397622.2	-	7	1062	c.940G>T	c.(940-942)Gcc>Tcc	p.A314S	TMEM209_ENST00000462753.1_Missense_Mutation_p.A313S|TMEM209_ENST00000473456.1_Missense_Mutation_p.A314S|RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000336804.8_Missense_Mutation_p.A313S	NM_032842.3	NP_116231.2	Q96SK2	TM209_HUMAN	transmembrane protein 209	314						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	12	Melanoma(18;0.0435)					TCTTCTGCGGCTTGTTTAGAG	0.373																																						dbGAP											0													83.0	78.0	80.0					7																	129825043		1844	4087	5931	-	-	-	SO:0001583	missense	0				CCDS47712.1, CCDS75661.1	7q32.2	2008-02-26			ENSG00000146842	ENSG00000146842			21898	protein-coding gene	gene with protein product						12958361	Standard	NM_032842		Approved	FLJ14803, NET31	uc003vpn.2	Q96SK2	OTTHUMG00000157653	ENST00000397622.2:c.940G>T	7.37:g.129825043C>A	ENSP00000380747:p.Ala314Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1L1|Q49A50|Q6PF00|Q8NCH3|Q96SL6	Missense_Mutation	SNP	pfam_Cytochrome_B561-rel	p.A314S	ENST00000397622.2	37	c.940	CCDS47712.1	7	.	.	.	.	.	.	.	.	.	.	C	17.49	3.403852	0.62288	.	.	ENSG00000146842	ENST00000397622;ENST00000462753;ENST00000473456;ENST00000336804	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.38374	0.1038	L	0.47716	1.5	0.80722	D	1	B;P	0.34934	0.42;0.476	B;B	0.43386	0.294;0.418	T	0.02885	-1.1098	10	0.27082	T	0.32	-24.0233	19.1431	0.93452	0.0:1.0:0.0:0.0	.	314;314	Q96SK2-3;Q96SK2	.;TM209_HUMAN	S	314;313;314;313	ENSP00000380747:A314S;ENSP00000419697:A313S;ENSP00000417258:A314S;ENSP00000338388:A313S	ENSP00000338388:A313S	A	-	1	0	TMEM209	129612279	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.413000	0.80104	2.838000	0.97847	0.591000	0.81541	GCC	TMEM209	-	pfam_Cytochrome_B561-rel	ENSG00000146842		0.373	TMEM209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM209	HGNC	protein_coding	OTTHUMT00000349339.1	78	0.00	0	C	NM_032842		129825043	129825043	-1	no_errors	ENST00000397622	ensembl	human	known	69_37n	missense	94	24.00	30	SNP	1.000	A
TMEM209	84928	genome.wustl.edu	37	7	129825045	129825045	+	Missense_Mutation	SNP	T	T	G	rs535464239		TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr7:129825045T>G	ENST00000397622.2	-	7	1060	c.938A>C	c.(937-939)cAa>cCa	p.Q313P	TMEM209_ENST00000462753.1_Missense_Mutation_p.Q312P|TMEM209_ENST00000473456.1_Missense_Mutation_p.Q313P|RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000336804.8_Missense_Mutation_p.Q312P	NM_032842.3	NP_116231.2	Q96SK2	TM209_HUMAN	transmembrane protein 209	313						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	12	Melanoma(18;0.0435)					TTCTGCGGCTTGTTTAGAGCT	0.378																																						dbGAP											0													82.0	78.0	79.0					7																	129825045		1843	4087	5930	-	-	-	SO:0001583	missense	0				CCDS47712.1, CCDS75661.1	7q32.2	2008-02-26			ENSG00000146842	ENSG00000146842			21898	protein-coding gene	gene with protein product						12958361	Standard	NM_032842		Approved	FLJ14803, NET31	uc003vpn.2	Q96SK2	OTTHUMG00000157653	ENST00000397622.2:c.938A>C	7.37:g.129825045T>G	ENSP00000380747:p.Gln313Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1L1|Q49A50|Q6PF00|Q8NCH3|Q96SL6	Missense_Mutation	SNP	pfam_Cytochrome_B561-rel	p.Q313P	ENST00000397622.2	37	c.938	CCDS47712.1	7	.	.	.	.	.	.	.	.	.	.	T	17.59	3.426427	0.62733	.	.	ENSG00000146842	ENST00000397622;ENST00000462753;ENST00000473456;ENST00000336804	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.68	5.68	0.88126	.	0.051691	0.85682	D	0.000000	T	0.36771	0.0979	M	0.62723	1.935	0.58432	D	0.999998	P;P	0.48911	0.898;0.917	B;P	0.44447	0.321;0.45	T	0.13415	-1.0510	10	0.36615	T	0.2	-13.1066	15.4043	0.74866	0.0:0.0:0.0:1.0	.	313;313	Q96SK2-3;Q96SK2	.;TM209_HUMAN	P	313;312;313;312	ENSP00000380747:Q313P;ENSP00000419697:Q312P;ENSP00000417258:Q313P;ENSP00000338388:Q312P	ENSP00000338388:Q312P	Q	-	2	0	TMEM209	129612281	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.622000	0.83099	2.289000	0.77006	0.482000	0.46254	CAA	TMEM209	-	pfam_Cytochrome_B561-rel	ENSG00000146842		0.378	TMEM209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM209	HGNC	protein_coding	OTTHUMT00000349339.1	79	0.00	0	T	NM_032842		129825045	129825045	-1	no_errors	ENST00000397622	ensembl	human	known	69_37n	missense	95	25.78	33	SNP	1.000	G
TMEM63B	55362	genome.wustl.edu	37	6	44107235	44107235	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr6:44107235G>A	ENST00000259746.9	+	7	622	c.439G>A	c.(439-441)Gat>Aat	p.D147N	TMEM63B_ENST00000323267.6_Missense_Mutation_p.D147N|TMEM63B_ENST00000527188.1_3'UTR			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	147					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			ATGTGGGGGCGATGCCGTGCA	0.582																																						dbGAP											0													141.0	114.0	123.0					6																	44107235		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.439G>A	6.37:g.44107235G>A	ENSP00000259746:p.Asp147Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Missense_Mutation	SNP	pfam_DUF221	p.D147N	ENST00000259746.9	37	c.439	CCDS34461.1	6	.	.	.	.	.	.	.	.	.	.	G	16.26	3.074141	0.55646	.	.	ENSG00000137216	ENST00000259746;ENST00000532634;ENST00000323267	D;D;D	0.90133	-2.62;-2.62;-2.62	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	D	0.94118	0.8114	M	0.77486	2.375	0.58432	D	0.999995	D;D;P	0.69078	0.997;0.994;0.921	D;P;B	0.67382	0.951;0.891;0.387	D	0.94822	0.7988	10	0.87932	D	0	.	16.4147	0.83730	0.0:0.0:1.0:0.0	.	147;147;147	Q5T3F8-3;Q5T3F8;Q5T3F8-2	.;TM63B_HUMAN;.	N	147	ENSP00000259746:D147N;ENSP00000437163:D147N;ENSP00000327154:D147N	ENSP00000259746:D147N	D	+	1	0	TMEM63B	44215213	1.000000	0.71417	0.808000	0.32385	0.141000	0.21300	9.583000	0.98217	2.356000	0.79943	0.561000	0.74099	GAT	TMEM63B	-	NULL	ENSG00000137216		0.582	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63B	HGNC	protein_coding	OTTHUMT00000040712.2	42	0.00	0	G	XM_166410		44107235	44107235	+1	no_errors	ENST00000259746	ensembl	human	known	69_37n	missense	144	19.55	35	SNP	1.000	A
TNIP1	10318	genome.wustl.edu	37	5	150425460	150425460	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr5:150425460C>T	ENST00000389378.2	-	9	1486	c.898G>A	c.(898-900)Gag>Aag	p.E300K	TNIP1_ENST00000518977.1_Missense_Mutation_p.E300K|TNIP1_ENST00000520931.1_Missense_Mutation_p.E247K|TNIP1_ENST00000521423.1_Intron|TNIP1_ENST00000524280.1_Missense_Mutation_p.E300K|TNIP1_ENST00000315050.7_Missense_Mutation_p.E300K|TNIP1_ENST00000523200.1_Missense_Mutation_p.E300K|TNIP1_ENST00000521591.1_Missense_Mutation_p.E300K|TNIP1_ENST00000523338.1_Missense_Mutation_p.E300K|TNIP1_ENST00000522226.1_Missense_Mutation_p.E300K	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	300	Interacts with Nef.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)	p.E300K(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACCTTCTTCTCGGCTGCGCCC	0.582																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											118.0	101.0	107.0					5																	150425460		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.898G>A	5.37:g.150425460C>T	ENSP00000374029:p.Glu300Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E300K	ENST00000389378.2	37	c.898	CCDS34280.1	5	.	.	.	.	.	.	.	.	.	.	C	29.8	5.035357	0.93630	.	.	ENSG00000145901	ENST00000520931;ENST00000389378;ENST00000315050;ENST00000523338;ENST00000544828;ENST00000417127;ENST00000539213;ENST00000522226;ENST00000521591;ENST00000518977;ENST00000524280;ENST00000523200;ENST00000545840;ENST00000522100	T;T;T;T;T;T;T;T;T;T	0.17528	2.44;2.47;2.47;2.47;2.47;2.47;2.47;2.5;2.51;2.27	4.61	4.61	0.57282	.	0.109676	0.64402	D	0.000010	T	0.33818	0.0876	M	0.81802	2.56	0.45330	D	0.998326	D;D;D;D;D;P;D	0.63880	0.98;0.959;0.975;0.959;0.993;0.845;0.984	P;P;P;P;P;B;P	0.52793	0.559;0.581;0.533;0.581;0.709;0.139;0.662	T	0.16364	-1.0405	10	0.33940	T	0.23	-9.9445	14.3383	0.66606	0.0:1.0:0.0:0.0	.	300;254;254;300;300;300;300	B7Z8K2;A4F1X9;A4F1X7;E7EPY1;E7ET96;A4F1W9;Q15025	.;.;.;.;.;.;TNIP1_HUMAN	K	247;300;300;300;257;257;262;300;300;300;300;300;257;247	ENSP00000429891:E247K;ENSP00000374029:E300K;ENSP00000317891:E300K;ENSP00000428243:E300K;ENSP00000428187:E300K;ENSP00000430760:E300K;ENSP00000430971:E300K;ENSP00000429912:E300K;ENSP00000431105:E300K;ENSP00000428487:E247K	ENSP00000317891:E300K	E	-	1	0	TNIP1	150405653	0.998000	0.40836	0.996000	0.52242	0.874000	0.50279	4.992000	0.63889	2.095000	0.63458	0.491000	0.48974	GAG	TNIP1	-	NULL	ENSG00000145901		0.582	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TNIP1	HGNC	protein_coding	OTTHUMT00000374914.1	31	0.00	0	C	NM_006058		150425460	150425460	-1	no_errors	ENST00000315050	ensembl	human	known	69_37n	missense	110	28.10	43	SNP	0.994	T
TNN	63923	genome.wustl.edu	37	1	175086256	175086256	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr1:175086256G>A	ENST00000239462.4	+	10	2414	c.2301G>A	c.(2299-2301)ctG>ctA	p.L767L		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	767	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TGACGGGCCTGAGGCCGGGTG	0.617																																						dbGAP											0													90.0	83.0	86.0					1																	175086256		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2301G>A	1.37:g.175086256G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGP3|Q5R360	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_Fibronectin_type3	p.L767	ENST00000239462.4	37	c.2301	CCDS30943.1	1																																																																																			TNN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000120332		0.617	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNN	HGNC	protein_coding	OTTHUMT00000084422.1	31	0.00	0	G	XM_040527		175086256	175086256	+1	no_errors	ENST00000239462	ensembl	human	known	69_37n	silent	65	16.67	13	SNP	1.000	A
TRBV24-1	28563	genome.wustl.edu	37	7	142364507	142364507	+	RNA	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr7:142364507C>T	ENST00000390397.2	+	0	178									T cell receptor beta variable 24-1																		GACTAAGGGTCATGATAGAAT	0.448																																						dbGAP											0													64.0	61.0	61.0					7																	142364507		1868	4115	5983	-	-	-			0			M11951		7q34	2012-02-07			ENSG00000211750	ENSG00000211750		"""T cell receptors / TRB locus"""	12203	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV241, TCRBV15S1, TCRBV24S1			OTTHUMG00000158889		7.37:g.142364507C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.H48Y	ENST00000390397.2	37	c.142		7																																																																																			TRBV24-1	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211750		0.448	TRBV24-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV24-1	HGNC	TR_V_gene	OTTHUMT00000352499.1	53	0.00	0	C	NG_001333		142364507	142364507	+1	no_stop_codon	ENST00000390397	ensembl	human	known	69_37n	missense	49	14.04	8	SNP	0.001	T
TRPA1	8989	genome.wustl.edu	37	8	72967687	72967687	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr8:72967687C>T	ENST00000262209.4	-	12	1720	c.1513G>A	c.(1513-1515)Ggt>Agt	p.G505S	RP11-383H13.1_ENST00000457356.4_3'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	505					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	AACAATGCACCTTTTTTCAGA	0.348																																						dbGAP											0													51.0	52.0	52.0					8																	72967687		2203	4299	6502	-	-	-	SO:0001583	missense	0			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1513G>A	8.37:g.72967687C>T	ENSP00000262209:p.Gly505Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIN6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.G505S	ENST00000262209.4	37	c.1513	CCDS34908.1	8	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022448	0.93462	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.79033	-1.23;-1.23	5.72	5.72	0.89469	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.88983	0.6586	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89487	0.3754	10	0.87932	D	0	-17.8832	19.8769	0.96880	0.0:1.0:0.0:0.0	.	505	O75762	TRPA1_HUMAN	S	357;505	ENSP00000428151:G357S;ENSP00000262209:G505S	ENSP00000262209:G505S	G	-	1	0	TRPA1	73130241	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.187000	0.77730	2.697000	0.92050	0.650000	0.86243	GGT	TRPA1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000104321		0.348	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	HGNC	protein_coding	OTTHUMT00000379079.2	44	0.00	0	C	NM_007332		72967687	72967687	-1	no_errors	ENST00000262209	ensembl	human	known	69_37n	missense	41	51.19	43	SNP	1.000	T
TRPM6	140803	genome.wustl.edu	37	9	77357501	77357501	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr9:77357501G>T	ENST00000360774.1	-	33	5413	c.5176C>A	c.(5176-5178)Cca>Aca	p.P1726T	TRPM6_ENST00000376864.4_Missense_Mutation_p.P1730T|TRPM6_ENST00000376872.3_Missense_Mutation_p.P681T|TRPM6_ENST00000361255.3_Missense_Mutation_p.P1721T|TRPM6_ENST00000449912.2_Missense_Mutation_p.P1721T|TRPM6_ENST00000451710.3_Missense_Mutation_p.P1730T|TRPM6_ENST00000376871.3_Missense_Mutation_p.P563T	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1726					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GGTGTAAATGGTATGGTCTGA	0.368																																						dbGAP											0													123.0	116.0	119.0					9																	77357501		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.5176C>A	9.37:g.77357501G>T	ENSP00000354006:p.Pro1726Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.P1730T	ENST00000360774.1	37	c.5188	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	G	23.6	4.429792	0.83776	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376864	T;T;T;T;T;T;T	0.05996	3.36;3.36;3.36;3.36;3.36;3.36;3.36	5.74	5.74	0.90152	Protein kinase-like domain (1);	0.102804	0.64402	D	0.000002	T	0.20170	0.0485	L	0.39245	1.2	0.80722	D	1	D;D;P;P;P	0.89917	0.998;1.0;0.856;0.911;0.911	D;D;B;P;P	0.79784	0.982;0.993;0.395;0.522;0.599	T	0.00113	-1.2042	10	0.87932	D	0	.	19.9214	0.97087	0.0:0.0:1.0:0.0	.	559;677;1726;1721;1721	Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;.;TRPM6_HUMAN;.;.	T	1726;1730;681;563;1721;1721;1730	ENSP00000354006:P1726T;ENSP00000407341:P1730T;ENSP00000366068:P681T;ENSP00000366067:P563T;ENSP00000396672:P1721T;ENSP00000354962:P1721T;ENSP00000366060:P1730T	ENSP00000354006:P1726T	P	-	1	0	TRPM6	76547321	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.378000	0.97191	2.716000	0.92895	0.563000	0.77884	CCA	TRPM6	-	superfamily_Kinase-like_dom	ENSG00000119121		0.368	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	67	0.00	0	G	NM_017662		77357501	77357501	-1	no_errors	ENST00000451710	ensembl	human	known	69_37n	missense	84	16.00	16	SNP	1.000	T
TSPAN31	6302	genome.wustl.edu	37	12	58139003	58139003	+	Intron	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr12:58139003G>A	ENST00000257910.3	+	1	337				TSPAN31_ENST00000547472.1_Intron|TSPAN31_ENST00000553221.1_Intron|TSPAN31_ENST00000547992.1_Intron	NM_005981.3	NP_005972.1	Q12999	TSN31_HUMAN	tetraspanin 31						positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(1)|kidney(1)|lung(5)	7	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			TCTACATGGTGAGGTTTTGGA	0.597																																						dbGAP											0													41.0	40.0	40.0					12																	58139003		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0				CCDS8952.1	12q13-q14	2013-02-14	2005-08-16	2005-08-16		ENSG00000135452		"""Tetraspanins"""	10539	protein-coding gene	gene with protein product		181035	"""sarcoma amplified sequence"""	SAS			Standard	NM_005981		Approved		uc001spt.3	Q12999		ENST00000257910.3:c.63+3G>A	12.37:g.58139003G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O00577|Q53X76	RNA	SNP	-	NULL	ENST00000257910.3	37	NULL	CCDS8952.1	12																																																																																			TSPAN31	-	-	ENSG00000135452		0.597	TSPAN31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN31	HGNC	protein_coding	OTTHUMT00000408778.1	66	0.00	0	G			58139003	58139003	+1	no_errors	ENST00000548093	ensembl	human	known	69_37n	rna	83	23.15	25	SNP	1.000	A
CFAP46	54777	genome.wustl.edu	37	10	134621931	134621931	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr10:134621931C>G	ENST00000368586.5	-	58	8242	c.8142G>C	c.(8140-8142)ttG>ttC	p.L2714F	TTC40_ENST00000263170.5_Missense_Mutation_p.L875F	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						ACACTCAAATCAAAAACAGGC	0.572																																						dbGAP											0													90.0	104.0	99.0					10																	134621931		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000368586.5:c.8142G>C	10.37:g.134621931C>G	ENSP00000357575:p.Leu2714Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.L875F	ENST00000368586.5	37	c.2625	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	C	12.95	2.090327	0.36855	.	.	ENSG00000171811	ENST00000368586;ENST00000263170	T;T	0.17054	2.66;2.3	1.08	1.08	0.20341	.	.	.	.	.	T	0.17408	0.0418	N	0.08118	0	0.20764	N	0.999852	D	0.69078	0.997	D	0.70487	0.969	T	0.13229	-1.0517	9	0.87932	D	0	.	5.505	0.16848	0.0:1.0:0.0:0.0	.	875	Q8IYW2	CJ092_HUMAN	F	2714;875	ENSP00000357575:L2714F;ENSP00000263170:L875F	ENSP00000263170:L875F	L	-	3	2	C10orf93	134471921	0.000000	0.05858	0.177000	0.23020	0.080000	0.17528	0.074000	0.14662	0.915000	0.36847	0.436000	0.28706	TTG	TTC40	-	NULL	ENSG00000171811		0.572	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	13	0.00	0	C			134621931	134621931	-1	no_errors	ENST00000263170	ensembl	human	known	69_37n	missense	16	40.74	11	SNP	0.182	G
TTN	7273	genome.wustl.edu	37	2	179567268	179567268	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:179567268C>T	ENST00000591111.1	-	105	29619	c.29395G>A	c.(29395-29397)Gaa>Aaa	p.E9799K	TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E10116K|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E8872K|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	13877	Ig-like 79.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGTCAGTTCTGTTGGTCCT	0.463																																						dbGAP											0													249.0	246.0	247.0					2																	179567268		2007	4167	6174	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.29395G>A	2.37:g.179567268C>T	ENSP00000465570:p.Glu9799Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E8872K	ENST00000591111.1	37	c.26614		2	.	.	.	.	.	.	.	.	.	.	C	20.5	4.009113	0.75046	.	.	ENSG00000155657	ENST00000342992	T	0.66995	-0.24	5.72	5.72	0.89469	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.80859	0.4704	L	0.58510	1.815	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.81491	-0.0909	9	0.87932	D	0	.	19.8805	0.96895	0.0:1.0:0.0:0.0	.	9799	Q8WZ42	TITIN_HUMAN	K	8872	ENSP00000343764:E8872K	ENSP00000343764:E8872K	E	-	1	0	TTN	179275513	1.000000	0.71417	0.974000	0.42286	0.969000	0.65631	7.818000	0.86416	2.704000	0.92352	0.655000	0.94253	GAA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.463	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	64	0.00	0	C	NM_133378		179567268	179567268	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	130	26.97	48	SNP	1.000	T
UNC13A	23025	genome.wustl.edu	37	19	17760359	17760359	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:17760359C>G	ENST00000519716.2	-	13	1476	c.1477G>C	c.(1477-1479)Gac>Cac	p.D493H	UNC13A_ENST00000252773.7_Missense_Mutation_p.D493H|UNC13A_ENST00000551649.1_Missense_Mutation_p.D493H|UNC13A_ENST00000552293.1_Missense_Mutation_p.D493H|UNC13A_ENST00000428389.2_Missense_Mutation_p.D581H|UNC13A_ENST00000550896.1_Missense_Mutation_p.D493H	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	493					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						TTGCGGATGTCTGGCATGCTG	0.572																																						dbGAP											0													159.0	163.0	162.0					19																	17760359		2117	4231	6348	-	-	-	SO:0001583	missense	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.1477G>C	19.37:g.17760359C>G	ENSP00000429562:p.Asp493His	Somatic		WXS	Illumina GAIIx	Phase_IV	E5RHY9	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_Ca-dep,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.D581H	ENST00000519716.2	37	c.1741	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488641	0.84854	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	4.25	4.25	0.50352	.	0.000000	0.85682	U	0.000000	T	0.78438	0.4283	M	0.77820	2.39	0.58432	D	0.999997	D	0.89917	1.0	D	0.77557	0.99	T	0.82141	-0.0604	10	0.87932	D	0	-27.3028	14.4629	0.67465	0.0:1.0:0.0:0.0	.	493	Q9UPW8	UN13A_HUMAN	H	493;581;493;493;493;493	ENSP00000429562:D493H;ENSP00000400409:D581H;ENSP00000252773:D493H;ENSP00000447236:D493H;ENSP00000447572:D493H;ENSP00000446831:D493H	ENSP00000252773:D493H	D	-	1	0	UNC13A	17621359	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	7.565000	0.82337	2.067000	0.61834	0.561000	0.74099	GAC	UNC13A	-	NULL	ENSG00000130477		0.572	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	61	0.00	0	C	XM_038604		17760359	17760359	-1	no_errors	ENST00000428389	ensembl	human	known	69_37n	missense	166	18.23	37	SNP	1.000	G
USP34	9736	genome.wustl.edu	37	2	61492568	61492568	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:61492568C>T	ENST00000398571.2	-	43	5818	c.5742G>A	c.(5740-5742)atG>atA	p.M1914I		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1914	USP.				positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CCTCAGGTATCATATAAAGTT	0.358																																						dbGAP											0													111.0	102.0	105.0					2																	61492568		1855	4088	5943	-	-	-	SO:0001583	missense	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.5742G>A	2.37:g.61492568C>T	ENSP00000381577:p.Met1914Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.M1914I	ENST00000398571.2	37	c.5742	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.303145	0.95601	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.05447	3.44;3.44	5.24	5.24	0.73138	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);Armadillo-type fold (1);	0.039579	0.85682	N	0.000000	T	0.32376	0.0827	M	0.90705	3.14	0.58432	D	0.999997	P	0.49307	0.922	D	0.63381	0.914	T	0.23691	-1.0181	10	0.72032	D	0.01	.	18.8847	0.92372	0.0:1.0:0.0:0.0	.	1914	Q70CQ2	UBP34_HUMAN	I	1762;1762;1914;192	ENSP00000381577:M1914I;ENSP00000410559:M192I	ENSP00000263989:M1762I	M	-	3	0	USP34	61346072	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.469000	0.83416	0.650000	0.86243	ATG	USP34	-	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	ENSG00000115464		0.358	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	47	0.00	0	C			61492568	61492568	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	missense	47	25.40	16	SNP	1.000	T
UTP3	57050	genome.wustl.edu	37	4	71554953	71554953	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr4:71554953G>A	ENST00000254803.2	+	1	758	c.559G>A	c.(559-561)Gag>Aag	p.E187K		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	187					brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			CGCCTGGGTTGAGGCCTTTGC	0.537																																						dbGAP											0													55.0	53.0	54.0					4																	71554953		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.559G>A	4.37:g.71554953G>A	ENSP00000254803:p.Glu187Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FI82	Missense_Mutation	SNP	pfam_Sas10_C,pfam_Sas10/Utp3/C1D	p.E187K	ENST00000254803.2	37	c.559	CCDS3546.1	4	.	.	.	.	.	.	.	.	.	.	G	11.21	1.570694	0.28003	.	.	ENSG00000132467	ENST00000254803	T	0.33654	1.4	5.5	4.63	0.57726	.	0.258711	0.38837	N	0.001550	T	0.33556	0.0867	L	0.52759	1.655	0.46586	D	0.999114	B	0.09022	0.002	B	0.06405	0.002	T	0.08411	-1.0723	10	0.35671	T	0.21	-14.8055	14.4329	0.67264	0.0:0.2769:0.7231:0.0	.	187	Q9NQZ2	SAS10_HUMAN	K	187	ENSP00000254803:E187K	ENSP00000254803:E187K	E	+	1	0	UTP3	71773817	1.000000	0.71417	0.999000	0.59377	0.438000	0.31896	1.754000	0.38369	2.576000	0.86940	0.650000	0.86243	GAG	UTP3	-	NULL	ENSG00000132467		0.537	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP3	HGNC	protein_coding	OTTHUMT00000252163.2	26	0.00	0	G	NM_020368		71554953	71554953	+1	no_errors	ENST00000254803	ensembl	human	known	69_37n	missense	18	35.71	10	SNP	0.988	A
VCX3B	425054	genome.wustl.edu	37	X	8434064	8434064	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chrX:8434064G>A	ENST00000381032.1	+	3	688	c.381G>A	c.(379-381)gaG>gaA	p.E127E	VCX3B_ENST00000444481.1_Silent_p.E127E|VCX3B_ENST00000453306.1_Silent_p.E127E|VCX3B_ENST00000381029.4_Silent_p.E105E|VCX3B_ENST00000440654.2_Intron	NM_001001888.3	NP_001001888.3	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	127	14 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.					nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|urinary_tract(3)	11						TGAGTCAGGAGAGCCAGGTGG	0.612																																						dbGAP											0													3.0	7.0	6.0					X																	8434064		407	2281	2688	-	-	-	SO:0001819	synonymous_variant	0				CCDS48077.1, CCDS48077.2	Xp22.31	2009-01-14			ENSG00000205642	ENSG00000205642			31838	protein-coding gene	gene with protein product							Standard	NM_001001888		Approved	VCX-C	uc011mht.2	Q9H321	OTTHUMG00000021106	ENST00000381032.1:c.381G>A	X.37:g.8434064G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JS46|Q4KN12	Silent	SNP	NULL	p.E127	ENST00000381032.1	37	c.381	CCDS48077.2	X																																																																																			VCX3B	-	NULL	ENSG00000205642		0.612	VCX3B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	VCX3B	HGNC	protein_coding	OTTHUMT00000055691.1	21	0.00	0	G			8434064	8434064	+1	no_errors	ENST00000444481	ensembl	human	known	69_37n	silent	11	31.25	5	SNP	0.001	A
VPS53	55275	genome.wustl.edu	37	17	422463	422463	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr17:422463C>T	ENST00000437048.2	-	22	2550	c.2404G>A	c.(2404-2406)Gaa>Aaa	p.E802K	VPS53_ENST00000576149.1_5'UTR|VPS53_ENST00000574029.1_Intron	NM_001128159.2	NP_001121631.1	Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	522					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		CCGGAGCTTTCTGCCCCCGAG	0.597																																						dbGAP											0													35.0	37.0	36.0					17																	422463		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000437048.2:c.2404G>A	17.37:g.422463C>T	ENSP00000401435:p.Glu802Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Missense_Mutation	SNP	pfam_Vps53_N,pfam_Vacuolar_sorting-assoc_54	p.E802K	ENST00000437048.2	37	c.2404	CCDS45558.1	17	.	.	.	.	.	.	.	.	.	.	C	13.67	2.306713	0.40795	.	.	ENSG00000141252	ENST00000437048;ENST00000541903	T	0.33438	1.41	5.67	5.67	0.87782	.	0.260222	0.43747	D	0.000526	T	0.30978	0.0782	L	0.57536	1.79	0.80722	D	1	B	0.34290	0.447	B	0.30572	0.117	T	0.07481	-1.0770	10	0.14656	T	0.56	-13.4488	18.7588	0.91842	0.0:1.0:0.0:0.0	.	802	Q5VIR6-4	.	K	802;98	ENSP00000401435:E802K	ENSP00000401435:E802K	E	-	1	0	VPS53	369213	1.000000	0.71417	0.948000	0.38648	0.007000	0.05969	7.331000	0.79192	2.697000	0.92050	0.655000	0.94253	GAA	VPS53	-	NULL	ENSG00000141252		0.597	VPS53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS53	HGNC	protein_coding	OTTHUMT00000436930.5	27	0.00	0	C	NM_018289		422463	422463	-1	no_errors	ENST00000437048	ensembl	human	known	69_37n	missense	47	22.95	14	SNP	1.000	T
XIRP2	129446	genome.wustl.edu	37	2	168103371	168103371	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:168103371G>A	ENST00000409195.1	+	9	5558	c.5469G>A	c.(5467-5469)gaG>gaA	p.E1823E	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Silent_p.E1823E|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Silent_p.E1601E|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1648					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TTATGACCGAGCCTCAGAGTA	0.403																																						dbGAP											0													110.0	100.0	103.0					2																	168103371		1881	4112	5993	-	-	-	SO:0001819	synonymous_variant	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5469G>A	2.37:g.168103371G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.E1823	ENST00000409195.1	37	c.5469	CCDS42769.1	2																																																																																			XIRP2	-	NULL	ENSG00000163092		0.403	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	32	0.00	0	G	NM_152381		168103371	168103371	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	silent	29	29.27	12	SNP	1.000	A
XIRP2	129446	genome.wustl.edu	37	2	168103377	168103377	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:168103377G>A	ENST00000409195.1	+	9	5564	c.5475G>A	c.(5473-5475)caG>caA	p.Q1825Q	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Silent_p.Q1825Q|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Silent_p.Q1603Q|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1650					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CCGAGCCTCAGAGTACATTTG	0.408																																						dbGAP											0													104.0	94.0	97.0					2																	168103377		1870	4110	5980	-	-	-	SO:0001819	synonymous_variant	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5475G>A	2.37:g.168103377G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.Q1825	ENST00000409195.1	37	c.5475	CCDS42769.1	2																																																																																			XIRP2	-	NULL	ENSG00000163092		0.408	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	32	0.00	0	G	NM_152381		168103377	168103377	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	silent	27	28.21	11	SNP	0.001	A
XYLT1	64131	genome.wustl.edu	37	16	17211800	17211800	+	Missense_Mutation	SNP	G	G	A	rs374020411		TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr16:17211800G>A	ENST00000261381.6	-	11	2344	c.2260C>T	c.(2260-2262)Cgc>Tgc	p.R754C		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	754					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.R754C(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CCAAAGTTGCGGAATAGCCTC	0.572																																						dbGAP											2	Substitution - Missense(2)	kidney(1)|endometrium(1)											84.0	74.0	77.0					16																	17211800		2197	4300	6497	-	-	-	SO:0001583	missense	0			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2260C>T	16.37:g.17211800G>A	ENSP00000261381:p.Arg754Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H1B6	Missense_Mutation	SNP	pfam_XylT_met,pfam_Glyco_trans_14	p.R754C	ENST00000261381.6	37	c.2260	CCDS10569.1	16	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918891	0.73098	.	.	ENSG00000103489	ENST00000261381	T	0.61859	0.07	5.08	4.1	0.47936	.	0.000000	0.85682	D	0.000000	T	0.76033	0.3931	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79438	-0.1803	10	0.87932	D	0	-38.4378	12.032	0.53403	0.0:0.0:0.6862:0.3138	.	754	Q86Y38	XYLT1_HUMAN	C	754	ENSP00000261381:R754C	ENSP00000261381:R754C	R	-	1	0	XYLT1	17119301	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	2.510000	0.45468	1.212000	0.43366	0.462000	0.41574	CGC	XYLT1	-	pfam_XylT_met	ENSG00000103489		0.572	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT1	HGNC	protein_coding	OTTHUMT00000252241.2	28	0.00	0	G	NM_022166		17211800	17211800	-1	no_errors	ENST00000261381	ensembl	human	known	69_37n	missense	69	24.18	22	SNP	1.000	A
ZC3H6	376940	genome.wustl.edu	37	2	113089859	113089859	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr2:113089859G>A	ENST00000409871.1	+	12	3765	c.3364G>A	c.(3364-3366)Ggt>Agt	p.G1122S	ZC3H6_ENST00000343936.4_Missense_Mutation_p.G1122S|AC115115.2_ENST00000607612.1_RNA	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	1122							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						CAGGAGTTCTGGTAAGGTTCA	0.557																																						dbGAP											0													40.0	43.0	42.0					2																	113089859		1990	4156	6146	-	-	-	SO:0001583	missense	0			AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.3364G>A	2.37:g.113089859G>A	ENSP00000386764:p.Gly1122Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A9JR71|Q6ZW96	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.G1122S	ENST00000409871.1	37	c.3364	CCDS46393.1	2	.	.	.	.	.	.	.	.	.	.	G	7.074	0.568983	0.13560	.	.	ENSG00000188177	ENST00000409871;ENST00000343936	T;T	0.13307	2.6;2.6	5.16	3.23	0.37069	.	0.756975	0.12888	N	0.430895	T	0.09598	0.0236	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42050	-0.9474	10	0.16420	T	0.52	-2.5422	3.7598	0.08599	0.338:0.1858:0.4761:0.0	.	1122	P61129	ZC3H6_HUMAN	S	1122	ENSP00000386764:G1122S;ENSP00000340298:G1122S	ENSP00000340298:G1122S	G	+	1	0	ZC3H6	112806330	0.000000	0.05858	0.001000	0.08648	0.979000	0.70002	-0.247000	0.08866	0.460000	0.27045	0.655000	0.94253	GGT	ZC3H6	-	NULL	ENSG00000188177		0.557	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H6	HGNC	protein_coding	OTTHUMT00000330551.1	20	0.00	0	G	NM_198581		113089859	113089859	+1	no_errors	ENST00000343936	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	0.001	A
ZKSCAN2	342357	genome.wustl.edu	37	16	25255208	25255208	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr16:25255208C>T	ENST00000328086.7	-	6	2682	c.1879G>A	c.(1879-1881)Gag>Aag	p.E627K		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	627					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		ATTACTGCCTCCTGTGAGGTC	0.532																																						dbGAP											0													137.0	128.0	131.0					16																	25255208		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.1879G>A	16.37:g.25255208C>T	ENSP00000331626:p.Glu627Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3B4|Q6ZN77	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.E627K	ENST00000328086.7	37	c.1879	CCDS32410.1	16	.	.	.	.	.	.	.	.	.	.	C	22.1	4.245520	0.80024	.	.	ENSG00000155592	ENST00000328086;ENST00000536768	T	0.08193	3.12	5.69	5.69	0.88448	.	0.443229	0.21920	N	0.067180	T	0.13798	0.0334	M	0.75777	2.31	0.40030	D	0.975512	P;P	0.43750	0.816;0.816	B;B	0.41440	0.357;0.357	T	0.10268	-1.0637	10	0.15952	T	0.53	-17.183	15.6714	0.77279	0.0:1.0:0.0:0.0	.	423;627	B4DYF0;Q63HK3	.;ZKSC2_HUMAN	K	627	ENSP00000331626:E627K	ENSP00000331626:E627K	E	-	1	0	ZKSCAN2	25162709	0.884000	0.30299	0.976000	0.42696	0.972000	0.66771	2.786000	0.47790	2.840000	0.97914	0.655000	0.94253	GAG	ZKSCAN2	-	NULL	ENSG00000155592		0.532	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN2	HGNC	protein_coding	OTTHUMT00000435739.1	50	0.00	0	C	NM_001012981		25255208	25255208	-1	no_errors	ENST00000328086	ensembl	human	known	69_37n	missense	82	21.90	23	SNP	0.996	T
ZMYND10	51364	genome.wustl.edu	37	3	50381203	50381203	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr3:50381203C>T	ENST00000231749.3	-	3	1552	c.280G>A	c.(280-282)Gac>Aac	p.D94N	RASSF1_ENST00000488024.1_5'Flank|ZMYND10_ENST00000490675.1_5'Flank|RASSF1_ENST00000357043.2_5'Flank|ZMYND10_ENST00000360165.3_Missense_Mutation_p.D94N|ZMYND10-AS1_ENST00000440013.1_RNA|RASSF1_ENST00000359365.4_5'Flank	NM_015896.2	NP_056980.2	O75800	ZMY10_HUMAN	zinc finger, MYND-type containing 10	94					inner dynein arm assembly (GO:0036159)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)	centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|urinary_tract(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GGCTTGAAGTCCTCCACCCTG	0.572										TSP Lung(30;0.18)																												dbGAP											0													153.0	123.0	133.0					3																	50381203		2203	4300	6503	-	-	-	SO:0001583	missense	0			U70824	CCDS2825.1	3p21.3	2014-02-03			ENSG00000004838	ENSG00000004838		"""Zinc fingers, MYND-type"""	19412	protein-coding gene	gene with protein product		607070				12629521, 23891469	Standard	NM_015896		Approved	BLU, CILD22	uc003dag.1	O75800	OTTHUMG00000156874	ENST00000231749.3:c.280G>A	3.37:g.50381203C>T	ENSP00000231749:p.Asp94Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK41|B3KU54|O14570|O75801|Q53FE6|Q8N4R6|Q8NDN6	Missense_Mutation	SNP	pfam_Znf_MYND,pirsf_UCP037948_Znf-MYND,pfscan_Znf_MYND	p.D94N	ENST00000231749.3	37	c.280	CCDS2825.1	3	.	.	.	.	.	.	.	.	.	.	C	24.9	4.576634	0.86645	.	.	ENSG00000004838	ENST00000231749;ENST00000360165;ENST00000442887	T;T;T	0.30714	1.52;1.52;1.52	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.49047	0.1534	M	0.76574	2.34	0.80722	D	1	P;P	0.50272	0.933;0.89	P;B	0.52217	0.693;0.349	T	0.43065	-0.9414	10	0.35671	T	0.21	-27.1915	19.2064	0.93732	0.0:1.0:0.0:0.0	.	94;94	O75800-2;O75800	.;ZMY10_HUMAN	N	94;94;51	ENSP00000231749:D94N;ENSP00000353289:D94N;ENSP00000393687:D51N	ENSP00000231749:D94N	D	-	1	0	ZMYND10	50356207	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.779000	0.68948	2.542000	0.85734	0.555000	0.69702	GAC	ZMYND10	-	pirsf_UCP037948_Znf-MYND	ENSG00000004838		0.572	ZMYND10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZMYND10	HGNC	protein_coding	OTTHUMT00000346376.1	26	0.00	0	C	NM_015896		50381203	50381203	-1	no_errors	ENST00000231749	ensembl	human	known	69_37n	missense	45	26.23	16	SNP	1.000	T
ZNF254	9534	genome.wustl.edu	37	19	24310394	24310394	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:24310394C>T	ENST00000357002.4	+	4	1707	c.1592C>T	c.(1591-1593)tCa>tTa	p.S531L	ZNF254_ENST00000342944.6_Missense_Mutation_p.S446L	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	531					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				AACTGGTCCTCAACTCTTACT	0.363																																						dbGAP											0													45.0	48.0	47.0					19																	24310394		2186	4291	6477	-	-	-	SO:0001583	missense	0			AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.1592C>T	19.37:g.24310394C>T	ENSP00000349494:p.Ser531Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPC0|Q86XL7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S531L	ENST00000357002.4	37	c.1592	CCDS32983.1	19	.	.	.	.	.	.	.	.	.	.	C	1.992	-0.431545	0.04669	.	.	ENSG00000213096	ENST00000342944;ENST00000357002	T;T	0.07444	3.19;3.19	1.11	1.11	0.20524	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19327	0.0464	M	0.72118	2.19	0.09310	N	1	P	0.52316	0.952	P	0.57548	0.823	T	0.05582	-1.0876	9	0.56958	D	0.05	.	7.6282	0.28224	0.0:1.0:0.0:0.0	.	531	O75437	ZN254_HUMAN	L	446;531	ENSP00000445527:S446L;ENSP00000349494:S531L	ENSP00000445527:S446L	S	+	2	0	ZNF254	24102234	0.000000	0.05858	0.043000	0.18650	0.596000	0.36781	-0.914000	0.04038	0.530000	0.28619	0.305000	0.20034	TCA	ZNF254	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213096		0.363	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF254	HGNC	protein_coding	OTTHUMT00000466453.1	31	0.00	0	C	NM_004876		24310394	24310394	+1	no_errors	ENST00000357002	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	0.001	T
ZNF114	163071	genome.wustl.edu	37	19	48785718	48785718	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:48785718G>A	ENST00000595607.1	+	5	594	c.100G>A	c.(100-102)Gtg>Atg	p.V34M	ZNF114_ENST00000315849.1_Missense_Mutation_p.V34M|ZNF114_ENST00000600687.1_Missense_Mutation_p.V34M|ZNF114_ENST00000597695.1_5'UTR			Q8NC26	ZN114_HUMAN	zinc finger protein 114	34	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(6)|lung(11)	18		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)		CTACAGAGACGTGATGCTGGA	0.522																																						dbGAP											0													119.0	122.0	121.0					19																	48785718		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014935	CCDS12713.1, CCDS74412.1	19q13.32	2013-01-08			ENSG00000178150	ENSG00000178150		"""Zinc fingers, C2H2-type"", ""-"""	12894	protein-coding gene	gene with protein product		603996					Standard	XM_005258580		Approved	MGC17986	uc002pim.1	Q8NC26		ENST00000595607.1:c.100G>A	19.37:g.48785718G>A	ENSP00000469998:p.Val34Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6B0|Q08AQ6	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V34M	ENST00000595607.1	37	c.100	CCDS12713.1	19	.	.	.	.	.	.	.	.	.	.	G	14.28	2.487423	0.44249	.	.	ENSG00000178150	ENST00000315849	T	0.04015	3.73	2.26	1.21	0.21127	Krueppel-associated box (4);	.	.	.	.	T	0.16685	0.0401	M	0.83774	2.66	0.22489	N	0.999054	D	0.76494	0.999	P	0.61800	0.894	T	0.04467	-1.0949	9	0.66056	D	0.02	.	6.9104	0.24333	0.1539:0.0:0.8461:0.0	.	34	Q8NC26	ZN114_HUMAN	M	34	ENSP00000318898:V34M	ENSP00000318898:V34M	V	+	1	0	ZNF114	53477530	0.613000	0.27009	0.242000	0.24170	0.202000	0.24057	0.693000	0.25497	0.524000	0.28502	0.205000	0.17691	GTG	ZNF114	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000178150		0.522	ZNF114-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF114	HGNC	protein_coding	OTTHUMT00000465601.1	25	0.00	0	G	NM_153608		48785718	48785718	+1	no_errors	ENST00000315849	ensembl	human	known	69_37n	missense	59	24.36	19	SNP	0.670	A
ZNF407	55628	genome.wustl.edu	37	18	72775896	72775896	+	Silent	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr18:72775896G>A	ENST00000299687.5	+	8	6219	c.6219G>A	c.(6217-6219)caG>caA	p.Q2073Q		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	2073					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		AGCGGGCACAGGTGGCCTTCA	0.662																																						dbGAP											0													40.0	48.0	45.0					18																	72775896		2120	4233	6353	-	-	-	SO:0001819	synonymous_variant	0			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.6219G>A	18.37:g.72775896G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.Q2073	ENST00000299687.5	37	c.6219	CCDS45885.1	18																																																																																			ZNF407	-	NULL	ENSG00000215421		0.662	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1	27	0.00	0	G	NM_017757		72775896	72775896	+1	no_errors	ENST00000299687	ensembl	human	known	69_37n	silent	42	14.29	7	SNP	0.625	A
ZNF429	353088	genome.wustl.edu	37	19	21719580	21719580	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:21719580C>T	ENST00000358491.4	+	4	933	c.725C>T	c.(724-726)tCa>tTa	p.S242L	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	242					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						AACCACTACTCAACCCTTACT	0.398																																						dbGAP											0													46.0	50.0	49.0					19																	21719580		2158	4279	6437	-	-	-	SO:0001583	missense	0			AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.725C>T	19.37:g.21719580C>T	ENSP00000351280:p.Ser242Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLV7|Q9BZE6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S242L	ENST00000358491.4	37	c.725	CCDS42537.1	19	.	.	.	.	.	.	.	.	.	.	.	15.57	2.871475	0.51695	.	.	ENSG00000197013	ENST00000358491	T	0.07444	3.19	0.876	0.876	0.19138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16769	0.0403	M	0.84326	2.69	0.09310	N	1	D	0.53885	0.963	P	0.47603	0.551	T	0.10132	-1.0643	9	0.87932	D	0	.	8.5632	0.33523	0.0:1.0:0.0:0.0	.	242	Q86V71	ZN429_HUMAN	L	242	ENSP00000351280:S242L	ENSP00000351280:S242L	S	+	2	0	ZNF429	21511420	0.000000	0.05858	0.502000	0.27614	0.501000	0.33797	-0.081000	0.11321	0.293000	0.22520	0.298000	0.19748	TCA	ZNF429	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197013		0.398	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF429	HGNC	protein_coding	OTTHUMT00000463981.1	27	0.00	0	C	NM_001001415		21719580	21719580	+1	no_errors	ENST00000358491	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	0.001	T
ZNF536	9745	genome.wustl.edu	37	19	31039782	31039782	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:31039782G>C	ENST00000355537.3	+	4	3403	c.3256G>C	c.(3256-3258)Gag>Cag	p.E1086Q		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1086					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TCAGCTCAAGGAGACTCTGGG	0.522																																						dbGAP											0													68.0	76.0	74.0					19																	31039782		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3256G>C	19.37:g.31039782G>C	ENSP00000347730:p.Glu1086Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E1086Q	ENST00000355537.3	37	c.3256	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	G	10.54	1.379088	0.24944	.	.	ENSG00000198597	ENST00000355537	T	0.11712	2.75	5.74	5.74	0.90152	.	0.152669	0.64402	D	0.000016	T	0.12008	0.0292	N	0.24115	0.695	0.48762	D	0.999709	P;P	0.47409	0.895;0.895	B;B	0.43508	0.422;0.422	T	0.01940	-1.1243	10	0.56958	D	0.05	-44.5814	19.9212	0.97085	0.0:0.0:1.0:0.0	.	1086;1086	A7E228;O15090	.;ZN536_HUMAN	Q	1086	ENSP00000347730:E1086Q	ENSP00000347730:E1086Q	E	+	1	0	ZNF536	35731622	1.000000	0.71417	0.981000	0.43875	0.008000	0.06430	5.883000	0.69721	2.697000	0.92050	0.655000	0.94253	GAG	ZNF536	-	NULL	ENSG00000198597		0.522	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	39	0.00	0	G	NM_014717		31039782	31039782	+1	no_errors	ENST00000355537	ensembl	human	known	69_37n	missense	53	34.57	28	SNP	1.000	C
ZNF541	84215	genome.wustl.edu	37	19	48025230	48025230	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:48025230G>A	ENST00000391901.3	-	13	3591	c.3592C>T	c.(3592-3594)Cag>Tag	p.Q1198*	ZNF541_ENST00000448976.1_Nonsense_Mutation_p.Q940*|ZNF541_ENST00000314121.4_Nonsense_Mutation_p.Q1217*			Q9H0D2	ZN541_HUMAN	zinc finger protein 541	1198	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|lung(2)|prostate(1)|skin(1)	9						TCAACGCACTGAGCTACCGTC	0.537																																						dbGAP											0													83.0	71.0	75.0					19																	48025230		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AL136846	CCDS46133.1, CCDS46133.2	19q13.33	2013-01-08			ENSG00000118156	ENSG00000118156		"""Zinc fingers, C2H2-type"""	25294	protein-coding gene	gene with protein product						11230166	Standard	NM_001277075		Approved	DKFZp434I1930	uc002phg.5	Q9H0D2	OTTHUMG00000141262	ENST00000391901.3:c.3592C>T	19.37:g.48025230G>A	ENSP00000375770:p.Gln1198*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDK8	Nonsense_Mutation	SNP	pfam_ELM2_dom,pfam_Znf_C2H2,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.Q1217*	ENST00000391901.3	37	c.3649		19	.	.	.	.	.	.	.	.	.	.	G	40	8.453912	0.98817	.	.	ENSG00000118156	ENST00000391901;ENST00000314121;ENST00000448976	.	.	.	5.07	5.07	0.68467	.	0.000000	0.50627	D	0.000106	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-35.2023	15.8317	0.78757	0.0:0.0:1.0:0.0	.	.	.	.	X	1198;1217;940	.	ENSP00000313258:Q1217X	Q	-	1	0	ZNF541	52717042	1.000000	0.71417	0.997000	0.53966	0.872000	0.50106	5.532000	0.67154	2.793000	0.96121	0.563000	0.77884	CAG	ZNF541	-	superfamily_Homeodomain-like,smart_SANT/Myb	ENSG00000118156		0.537	ZNF541-001	KNOWN	basic|appris_candidate|exp_conf	protein_coding	ZNF541	HGNC	protein_coding	OTTHUMT00000280415.1	41	0.00	0	G	NM_032255		48025230	48025230	-1	no_errors	ENST00000314121	ensembl	human	known	69_37n	nonsense	91	12.50	13	SNP	1.000	A
ZNF681	148213	genome.wustl.edu	37	19	23928058	23928058	+	Silent	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:23928058C>T	ENST00000402377.3	-	4	435	c.294G>A	c.(292-294)gtG>gtA	p.V98V	ZNF681_ENST00000395385.3_Silent_p.V29V	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	98				V -> A (in Ref. 1; BAG53769). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTCTTGGTGTCACTTTTTGGA	0.333																																						dbGAP											0													41.0	39.0	39.0					19																	23928058		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.294G>A	19.37:g.23928058C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVF7	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V98	ENST00000402377.3	37	c.294	CCDS12414.2	19																																																																																			ZNF681	-	NULL	ENSG00000196172		0.333	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF681	HGNC	protein_coding	OTTHUMT00000320248.2	67	0.00	0	C	NM_138286		23928058	23928058	-1	no_errors	ENST00000402377	ensembl	human	known	69_37n	silent	66	18.52	15	SNP	0.000	T
ZNF583	147949	genome.wustl.edu	37	19	56925397	56925397	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr19:56925397C>T	ENST00000333201.9	+	3	289	c.79C>T	c.(79-81)Cag>Tag	p.Q27*	ZNF583_ENST00000291598.7_Nonsense_Mutation_p.Q27*	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	27	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		GAACCCTGCTCAGAGGAATTT	0.433																																						dbGAP											0													135.0	130.0	132.0					19																	56925397		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.79C>T	19.37:g.56925397C>T	ENSP00000388502:p.Gln27*	Somatic		WXS	Illumina GAIIx	Phase_IV	O14850|Q2NKK3	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q27*	ENST00000333201.9	37	c.79	CCDS12943.1	19	.	.	.	.	.	.	.	.	.	.	C	28.0	4.881403	0.91740	.	.	ENSG00000198440	ENST00000537943;ENST00000291598;ENST00000333201;ENST00000391778;ENST00000436972	.	.	.	4.58	4.58	0.56647	.	0.000000	0.41001	D	0.000972	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.3339	0.43839	0.1962:0.8038:0.0:0.0	.	.	.	.	X	27	.	ENSP00000291598:Q27X	Q	+	1	0	ZNF583	61617209	0.994000	0.37717	0.912000	0.35992	0.845000	0.48019	3.505000	0.53356	2.553000	0.86117	0.467000	0.42956	CAG	ZNF583	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000198440		0.433	ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF583	HGNC	protein_coding	OTTHUMT00000401453.1	78	0.00	0	C	NM_152478		56925397	56925397	+1	no_errors	ENST00000291598	ensembl	human	known	69_37n	nonsense	105	23.36	32	SNP	0.919	T
ZNF853	54753	genome.wustl.edu	37	7	6656883	6656883	+	Silent	SNP	C	C	T	rs368198120		TCGA-D8-A27V-01A-12D-A17D-09	TCGA-D8-A27V-10A-01D-A17D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43c3976e-2cda-446a-b2fc-06fe4a479670	60f8560f-d97c-4ed2-a52a-161dba0d07d2	g.chr7:6656883C>T	ENST00000457543.3	+	2	633	c.75C>T	c.(73-75)ttC>ttT	p.F25F		NM_017560.1	NP_060030.1	P0CG23	ZN853_HUMAN	zinc finger protein 853	25							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						CCGAGACCTTCGTGCTGGAAC	0.627																																						dbGAP											0													41.0	48.0	46.0					7																	6656883		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AL133055	CCDS59048.1	7p22.1	2013-01-08				ENSG00000236609		"""Zinc fingers, C2H2-type"""	21767	protein-coding gene	gene with protein product							Standard	NM_017560		Approved	DKFZp434J1015	uc011jwz.2	P0CG23		ENST00000457543.3:c.75C>T	7.37:g.6656883C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F25	ENST00000457543.3	37	c.75	CCDS59048.1	7																																																																																			ZNF853	-	NULL	ENSG00000236609		0.627	ZNF853-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF853	HGNC	protein_coding	OTTHUMT00000324169.2	15	0.00	0	C	NM_017560		6656883	6656883	+1	no_errors	ENST00000457543	ensembl	human	known	69_37n	silent	14	41.67	10	SNP	0.632	T
