#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AHNAK2	113146	genome.wustl.edu	37	14	105420425	105420425	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr14:105420425G>T	ENST00000333244.5	-	7	1482	c.1363C>A	c.(1363-1365)Ctg>Atg	p.L455M	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	455						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGGCTCTGCAGTCCCTCGCCT	0.607																																						dbGAP											0													49.0	53.0	52.0					14																	105420425		2034	4172	6206	-	-	-	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.1363C>A	14.37:g.105420425G>T	ENSP00000353114:p.Leu455Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L455M	ENST00000333244.5	37	c.1363	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	g	13.86	2.364289	0.41902	.	.	ENSG00000185567	ENST00000333244	T	0.03580	3.88	5.0	0.734	0.18294	.	.	.	.	.	T	0.02267	0.0070	N	0.14661	0.345	0.09310	N	1	B	0.28801	0.223	B	0.24006	0.05	T	0.47302	-0.9128	9	0.38643	T	0.18	.	5.9376	0.19175	0.0:0.518:0.3018:0.1802	.	455	Q8IVF2	AHNK2_HUMAN	M	455	ENSP00000353114:L455M	ENSP00000353114:L455M	L	-	1	2	AHNAK2	104491470	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-2.115000	0.01328	-0.071000	0.12886	-0.321000	0.08615	CTG	AHNAK2	-	NULL	ENSG00000185567		0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	58	0.00	0	G	NM_138420		105420425	105420425	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	missense	31	39.22	20	SNP	0.001	T
CDH1	999	genome.wustl.edu	37	16	68847369	68847370	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr16:68847369_68847370delAA	ENST00000261769.5	+	9	1482_1483	c.1291_1292delAA	c.(1291-1293)aacfs	p.N432fs	CDH1_ENST00000422392.2_Intron|RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	432	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.Y380_K440del(2)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		AAATCCAGTGAACAACGATGGC	0.475			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	3	Deletion - In frame(2)|Unknown(1)	breast(2)|stomach(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1291_1292delAA	16.37:g.68847369_68847370delAA	ENSP00000261769:p.Asn432fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N431fs	ENST00000261769.5	37	c.1291_1292	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000039068		0.475	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	75	0.00	0	AA	NM_004360		68847369	68847370	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_del	26	40.00	18	DEL	0.665:0.779	-
DCDC1	341019	genome.wustl.edu	37	11	30946866	30946866	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr11:30946866C>G	ENST00000597505.1	-	21	2986	c.2987G>C	c.(2986-2988)aGa>aCa	p.R996T	DCDC1_ENST00000339794.5_Missense_Mutation_p.R75T|DCDC1_ENST00000406071.2_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	231					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					CAGTTCATCTCTTTGCAGGTC	0.338																																						dbGAP											0													137.0	144.0	142.0					11																	30946866		2201	4299	6500	-	-	-	SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.2987G>C	11.37:g.30946866C>G	ENSP00000472625:p.Arg996Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	pfam_Ricin_B_lectin,superfamily_Doublecortin_dom,superfamily_Ricin_B_lectin,pfscan_Doublecortin_dom,pfscan_Ricin_B_lectin	p.R75T	ENST00000597505.1	37	c.224		11	.	.	.	.	.	.	.	.	.	.	C	13.56	2.275032	0.40194	.	.	ENSG00000170959	ENST00000339794	D	0.93547	-3.24	5.42	3.54	0.40534	Doublecortin domain (3);	0.201505	0.34291	N	0.004095	D	0.93360	0.7883	M	0.76002	2.32	0.23953	N	0.996367	D	0.54047	0.964	P	0.50314	0.637	D	0.87463	0.2409	10	0.72032	D	0.01	-14.1656	7.7427	0.28851	0.0:0.7403:0.0:0.2597	.	75	Q6ZRR9	DCDC5_HUMAN	T	75	ENSP00000341700:R75T	ENSP00000341700:R75T	R	-	2	0	DCDC5	30903442	0.998000	0.40836	0.922000	0.36590	0.871000	0.50021	1.120000	0.31271	0.768000	0.33290	0.655000	0.94253	AGA	DCDC5	-	superfamily_Doublecortin_dom,pfscan_Doublecortin_dom	ENSG00000170959		0.338	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC5	HGNC	protein_coding	OTTHUMT00000463167.1	31	0.00	0	C	NM_181807		30946866	30946866	-1	no_errors	ENST00000339794	ensembl	human	known	69_37n	missense	21	38.24	13	SNP	0.914	G
EPB41L5	57669	genome.wustl.edu	37	2	120836080	120836080	+	Silent	SNP	G	G	T			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr2:120836080G>T	ENST00000263713.5	+	10	940	c.726G>T	c.(724-726)ggG>ggT	p.G242G	EPB41L5_ENST00000452780.1_Silent_p.G242G|EPB41L5_ENST00000443902.2_Silent_p.G242G|EPB41L5_ENST00000443124.1_Silent_p.G242G|EPB41L5_ENST00000331393.4_Silent_p.G242G	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	242	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						CTAGAGATGGGAATGACTATA	0.323																																						dbGAP											0													110.0	109.0	110.0					2																	120836080		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.726G>T	2.37:g.120836080G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5S1|Q8IZ12|Q9H975	Silent	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.G242	ENST00000263713.5	37	c.726	CCDS2130.1	2																																																																																			EPB41L5	-	pfam_FERM_PH-like_C,pfscan_FERM_domain,prints_Ez/rad/moesin	ENSG00000115109		0.323	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	EPB41L5	HGNC	protein_coding	OTTHUMT00000254230.2	29	0.00	0	G	NM_020909		120836080	120836080	+1	no_errors	ENST00000263713	ensembl	human	known	69_37n	silent	29	12.12	4	SNP	0.603	T
F11R	50848	genome.wustl.edu	37	1	160970906	160970908	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	ACA	ACA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr1:160970906_160970908delACA	ENST00000368026.6	-	3	417_419	c.143_145delTGT	c.(142-147)ttgtcc>tcc	p.L48del	F11R_ENST00000537746.1_In_Frame_Del_p.L48del|F11R_ENST00000289779.3_3'UTR|F11R_ENST00000472573.1_5'UTR	NM_016946.4	NP_058642.1	Q9Y624	JAM1_HUMAN	F11 receptor	48	Ig-like V-type 1.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)	12	all_cancers(52;6.73e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00207)			TAGGCACAGGACAACTTCACAGC	0.527																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF111713	CCDS1213.1	1q21.2-q21.3	2013-01-29	2003-02-07	2003-02-14	ENSG00000158769	ENSG00000158769		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14685	protein-coding gene	gene with protein product		605721	"""junctional adhesion molecule 1"""	JAM1		10395639, 7646439	Standard	NM_016946		Approved	PAM-1, JCAM, JAM-1, JAM-A, JAMA, CD321	uc009wtt.3	Q9Y624	OTTHUMG00000028602	ENST00000368026.6:c.143_145delTGT	1.37:g.160970906_160970908delACA	ENSP00000357005:p.Leu48del	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z941	In_Frame_Del	DEL	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L52in_frame_del	ENST00000368026.6	37	c.157_155	CCDS1213.1	1																																																																																			F11R	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000158769		0.527	F11R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F11R	HGNC	protein_coding	OTTHUMT00000071458.3	42	0.00	0	ACA	NM_016946		160970906	160970908	-1	no_errors	ENST00000436182	ensembl	human	known	69_37n	in_frame_del	57	10.94	7	DEL	0.006:0.074:0.072	-
GPAM	57678	genome.wustl.edu	37	10	113923490	113923490	+	Silent	SNP	C	C	T	rs143066466		TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr10:113923490C>T	ENST00000348367.4	-	14	1589	c.1392G>A	c.(1390-1392)ttG>ttA	p.L464L	GPAM_ENST00000369425.1_Silent_p.L464L|GPAM_ENST00000423155.1_Silent_p.L464L			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	464					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		GATTTGCAATCAACCTCCTTC	0.383																																					Ovarian(161;1017 2606 18293 52943)	dbGAP											0													113.0	95.0	101.0					10																	113923490		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1392G>A	10.37:g.113923490C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VW51|Q86TA3	Silent	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.L464	ENST00000348367.4	37	c.1392	CCDS7570.1	10																																																																																			GPAM	-	NULL	ENSG00000119927		0.383	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAM	HGNC	protein_coding	OTTHUMT00000050377.1	79	0.00	0	C	NM_020918		113923490	113923490	-1	no_errors	ENST00000348367	ensembl	human	known	69_37n	silent	50	41.18	35	SNP	0.996	T
GRN	2896	genome.wustl.edu	37	17	42429855	42429855	+	Missense_Mutation	SNP	G	G	T	rs63751698		TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr17:42429855G>T	ENST00000053867.3	+	12	1622	c.1560G>T	c.(1558-1560)gaG>gaT	p.E520D	GRN_ENST00000589265.1_Missense_Mutation_p.E363D	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	520					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		AGGACGTGGAGTGTGGGGAAG	0.632																																						dbGAP											0													146.0	120.0	129.0					17																	42429855		2203	4300	6503	-	-	-	SO:0001583	missense	0			M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.1560G>T	17.37:g.42429855G>T	ENSP00000053867:p.Glu520Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Missense_Mutation	SNP	pfam_Granulin,smart_Granulin	p.E520D	ENST00000053867.3	37	c.1560	CCDS11483.1	17	.	.	.	.	.	.	.	.	.	.	G	12.90	2.076341	0.36662	.	.	ENSG00000030582	ENST00000053867;ENST00000393566	T	0.69926	-0.44	5.26	-10.5	0.00291	.	2.051530	0.02366	N	0.077355	T	0.61324	0.2338	L	0.43152	1.355	0.09310	N	1	P;B	0.40970	0.734;0.136	P;B	0.54706	0.759;0.08	T	0.61178	-0.7115	10	0.15066	T	0.55	-0.0966	2.9217	0.05771	0.233:0.3966:0.2106:0.1598	.	457;520	B4DJI2;P28799	.;GRN_HUMAN	D	520;340	ENSP00000053867:E520D	ENSP00000053867:E520D	E	+	3	2	GRN	39785381	0.000000	0.05858	0.003000	0.11579	0.058000	0.15608	-2.624000	0.00876	-2.261000	0.00691	-0.254000	0.11334	GAG	GRN	-	NULL	ENSG00000030582		0.632	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRN	HGNC	protein_coding	OTTHUMT00000457766.1	61	0.00	0	G	NM_002087		42429855	42429855	+1	no_errors	ENST00000053867	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.000	T
HIST1H4J	8363	genome.wustl.edu	37	6	27791945	27791945	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr6:27791945G>A	ENST00000355057.1	+	1	62	c.43G>A	c.(43-45)Ggc>Agc	p.G15S		NM_021968.3	NP_068803.1	P62805	H4_HUMAN	histone cluster 1, H4j	15					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			lung(2)|ovary(1)|pancreas(1)	4						TGGCAAAGGCGGCGCTAAGCG	0.652																																						dbGAP											0													14.0	17.0	16.0					6																	27791945		1987	4178	6165	-	-	-	SO:0001583	missense	0			J00188	CCDS4630.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197238	ENSG00000197238		"""Histones / Replication-dependent"""	4785	protein-coding gene	gene with protein product		602826	"""H4 histone family, member E"", ""histone 1, H4j"""	H4FE		6265100, 9439656, 12408966	Standard	NM_021968		Approved	H4/e, H4F2iv	uc003njp.3	P62805	OTTHUMG00000014487	ENST00000355057.1:c.43G>A	6.37:g.27791945G>A	ENSP00000347168:p.Gly15Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.G15S	ENST00000355057.1	37	c.43	CCDS4630.1	6	.	.	.	.	.	.	.	.	.	.	.	14.36	2.512369	0.44660	.	.	ENSG00000197238	ENST00000355057	.	.	.	3.77	3.77	0.43336	.	0.000000	0.64402	U	0.000001	T	0.65995	0.2745	.	.	.	0.47778	D	0.999517	.	.	.	.	.	.	T	0.70691	-0.4802	6	0.59425	D	0.04	.	13.6149	0.62101	0.0:0.0:1.0:0.0	.	.	.	.	S	15	.	ENSP00000347168:G15S	G	+	1	0	HIST1H4J	27899924	1.000000	0.71417	0.957000	0.39632	0.067000	0.16453	9.241000	0.95402	2.038000	0.60285	0.484000	0.47621	GGC	HIST1H4J	-	superfamily_Histone-fold,prints_Histone_H4	ENSG00000197238		0.652	HIST1H4J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4J	HGNC	protein_coding	OTTHUMT00000040155.1	34	0.00	0	G	NM_021968		27791945	27791945	+1	no_errors	ENST00000355057	ensembl	human	known	69_37n	missense	20	28.57	8	SNP	1.000	A
HRNR	388697	genome.wustl.edu	37	1	152186614	152186614	+	Silent	SNP	C	C	G			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr1:152186614C>G	ENST00000368801.2	-	3	7566	c.7491G>C	c.(7489-7491)tcG>tcC	p.S2497S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2497					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCCACAGCTCGATGACTGTC	0.557																																						dbGAP											0													1.0	1.0	1.0					1																	152186614		84	271	355	-	-	-	SO:0001819	synonymous_variant	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.7491G>C	1.37:g.152186614C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5DT20|Q5U1F4	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.S2497	ENST00000368801.2	37	c.7491	CCDS30859.1	1																																																																																			HRNR	-	NULL	ENSG00000197915		0.557	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	9	0.00	0	C	XM_373868		152186614	152186614	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	silent	4	55.56	5	SNP	0.000	G
KLHL40	131377	genome.wustl.edu	37	3	42730496	42730496	+	Silent	SNP	C	C	T			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr3:42730496C>T	ENST00000287777.4	+	4	1657	c.1557C>T	c.(1555-1557)acC>acT	p.T519T		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	519					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											CTGGGGTCACCGACACAGGGC	0.562																																						dbGAP											0													72.0	60.0	64.0					3																	42730496		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.1557C>T	3.37:g.42730496C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86SI1|Q96MR2	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.T519	ENST00000287777.4	37	c.1557	CCDS2703.1	3																																																																																			KBTBD5	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000157119		0.562	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD5	HGNC	protein_coding	OTTHUMT00000256651.1	30	0.00	0	C	NM_152393		42730496	42730496	+1	no_errors	ENST00000287777	ensembl	human	known	69_37n	silent	25	30.56	11	SNP	0.730	T
HTR3D	200909	genome.wustl.edu	37	3	183753877	183753877	+	Silent	SNP	C	C	T			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr3:183753877C>T	ENST00000382489.3	+	3	369	c.369C>T	c.(367-369)ttC>ttT	p.F123F	HTR3D_ENST00000334128.2_Intron|HTR3D_ENST00000428798.2_Silent_p.F62F|HTR3D_ENST00000453435.1_Intron	NM_001163646.1	NP_001157118.1	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine (serotonin) receptor 3D, ionotropic	123					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)	10	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Ergoloid mesylate(DB01049)	CAGATGTCTTCATCGAGGAGT	0.488																																						dbGAP											0													73.0	68.0	70.0					3																	183753877		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AY159812	CCDS3249.1, CCDS46966.1, CCDS54685.1	3q27	2012-05-22	2012-02-03		ENSG00000186090	ENSG00000186090		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24004	protein-coding gene	gene with protein product		610122	"""5-hydroxytryptamine (serotonin) receptor 3 family member D"""			12801637	Standard	NM_001145143		Approved		uc011bqv.2	Q70Z44	OTTHUMG00000156858	ENST00000382489.3:c.369C>T	3.37:g.183753877C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J2I6|J3QT78|Q495N5|Q495N6|Q7Z6B3	Silent	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd	p.F123	ENST00000382489.3	37	c.369	CCDS54685.1	3																																																																																			HTR3D	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd	ENSG00000186090		0.488	HTR3D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HTR3D	HGNC	protein_coding	OTTHUMT00000346289.1	31	0.00	0	C	NM_182537		183753877	183753877	+1	no_errors	ENST00000382489	ensembl	human	known	69_37n	silent	21	16.00	4	SNP	0.838	T
LRRC14B	389257	genome.wustl.edu	37	5	191707	191707	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr5:191707C>A	ENST00000328278.3	+	1	82	c.54C>A	c.(52-54)caC>caA	p.H18Q		NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	18										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						TGGTGTCCCACCCCCAGGTGG	0.642																																						dbGAP											0													29.0	33.0	32.0					5																	191707		2037	4190	6227	-	-	-	SO:0001583	missense	0				CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.54C>A	5.37:g.191707C>A	ENSP00000327675:p.His18Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.H18Q	ENST00000328278.3	37	c.54	CCDS47184.1	5	.	.	.	.	.	.	.	.	.	.	C	7.304	0.613593	0.14066	.	.	ENSG00000185028	ENST00000328278	T	0.01295	5.04	5.44	2.57	0.30868	.	0.552403	0.20037	N	0.100595	T	0.01592	0.0051	L	0.44542	1.39	0.09310	N	1	P	0.44241	0.829	B	0.38985	0.287	T	0.50127	-0.8864	10	0.52906	T	0.07	.	7.7625	0.28961	0.0:0.7108:0.1331:0.1561	.	18	A6NHZ5	LR14B_HUMAN	Q	18	ENSP00000327675:H18Q	ENSP00000327675:H18Q	H	+	3	2	LRRC14B	244707	0.336000	0.24757	0.876000	0.34364	0.567000	0.35839	0.190000	0.17057	0.625000	0.30304	0.561000	0.74099	CAC	LRRC14B	-	NULL	ENSG00000185028		0.642	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC14B	HGNC	protein_coding	OTTHUMT00000365393.2	58	0.00	0	C	NM_001080478		191707	191707	+1	no_errors	ENST00000328278	ensembl	human	novel	69_37n	missense	43	30.65	19	SNP	0.122	A
MALAT1	378938	genome.wustl.edu	37	11	65272285	65272285	+	lincRNA	SNP	A	A	T			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr11:65272285A>T	ENST00000534336.1	+	0	7053					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TAATTCTTACATGCAGGAACA	0.398																																						dbGAP											0													79.0	77.0	78.0					11																	65272285		874	1988	2862	-	-	-			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65272285A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.398	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	132	0.00	0	A	NR_002819		65272285	65272285	+1	no_errors	ENST00000534336	ensembl	human	known	69_37n	rna	50	37.50	30	SNP	0.454	T
MAP3K1	4214	genome.wustl.edu	37	5	56161268	56161269	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr5:56161268_56161269delTT	ENST00000399503.3	+	5	1137_1138	c.1137_1138delTT	c.(1135-1140)actttafs	p.L380fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	380					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GGAGAAAAACTTTAAAGAATTT	0.332																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.1137_1138delTT	5.37:g.56161268_56161269delTT	ENSP00000382423:p.Leu380fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.L380fs	ENST00000399503.3	37	c.1137_1138	CCDS43318.1	5																																																																																			MAP3K1	-	NULL	ENSG00000095015		0.332	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	62	0.00	0	TT	XM_042066		56161268	56161269	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_del	48	30.43	21	DEL	0.761:0.988	-
MED12	9968	genome.wustl.edu	37	X	70345260	70345260	+	Silent	SNP	G	G	A			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chrX:70345260G>A	ENST00000374080.3	+	16	2318	c.2286G>A	c.(2284-2286)aaG>aaA	p.K762K	MED12_ENST00000333646.6_Silent_p.K762K|MED12_ENST00000374102.1_Silent_p.K762K			Q93074	MED12_HUMAN	mediator complex subunit 12	762					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					GGGTGGGAAAGCAGCGAGATG	0.547			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													60.0	63.0	62.0					X																	70345260		2185	4260	6445	-	-	-	SO:0001819	synonymous_variant	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.2286G>A	X.37:g.70345260G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O15410|O75557|Q9UHV6|Q9UND7	Silent	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.K762	ENST00000374080.3	37	c.2286	CCDS43970.1	X																																																																																			MED12	-	NULL	ENSG00000184634		0.547	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	68	0.00	0	G	NM_005120		70345260	70345260	+1	no_errors	ENST00000333646	ensembl	human	known	69_37n	silent	42	46.84	37	SNP	1.000	A
OR2T4	127074	genome.wustl.edu	37	1	248524975	248524975	+	Silent	SNP	T	T	C	rs45627735	byFrequency	TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr1:248524975T>C	ENST00000366475.1	+	1	93	c.93T>C	c.(91-93)aaT>aaC	p.N31N		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	31			N -> S (in dbSNP:rs57795102).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAATGGCCAATATCACCTGGA	0.483													c|||	237	0.0473243	0.0	0.0317	5008	,	,		15433	0.1111		0.0139	False		,,,				2504	0.091					dbGAP											0													112.0	96.0	102.0					1																	248524975		2200	4221	6421	-	-	-	SO:0001819	synonymous_variant	0			BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.93T>C	1.37:g.248524975T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEZ8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.N31	ENST00000366475.1	37	c.93	CCDS31113.1	1																																																																																			OR2T4	-	NULL	ENSG00000196944		0.483	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T4	HGNC	protein_coding	OTTHUMT00000097349.2	65	0.00	0	T	NM_001004696		248524975	248524975	+1	no_errors	ENST00000366475	ensembl	human	known	69_37n	silent	65	17.72	14	SNP	0.074	C
PCDHGA8	9708	genome.wustl.edu	37	5	140773952	140773952	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr5:140773952G>T	ENST00000398604.2	+	1	1572	c.1572G>T	c.(1570-1572)caG>caT	p.Q524H	PCDHGA7_ENST00000518325.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	524	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTATGAGCAGATCCGAGACC	0.587																																						dbGAP											0													82.0	95.0	90.0					5																	140773952		2200	4300	6500	-	-	-	SO:0001583	missense	0			AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1572G>T	5.37:g.140773952G>T	ENSP00000381605:p.Gln524His	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MCZ4|O15039	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q524H	ENST00000398604.2	37	c.1572	CCDS47291.1	5	.	.	.	.	.	.	.	.	.	.	.	5.170	0.216963	0.09810	.	.	ENSG00000253767	ENST00000398604	T	0.54071	0.59	5.06	2.25	0.28309	Cadherin (5);Cadherin-like (1);	0.297541	0.17774	U	0.162461	T	0.56819	0.2011	M	0.82630	2.6	0.24548	N	0.994037	B;B	0.28880	0.226;0.088	B;B	0.34418	0.182;0.093	T	0.54906	-0.8223	10	0.66056	D	0.02	.	9.8669	0.41150	0.0735:0.278:0.6484:0.0	.	524;524	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	H	524	ENSP00000381605:Q524H	ENSP00000381605:Q524H	Q	+	3	2	PCDHGA8	140754136	0.002000	0.14202	0.241000	0.24154	0.025000	0.11179	0.601000	0.24119	0.159000	0.19401	0.655000	0.94253	CAG	PCDHGA8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000253767		0.587	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA8	HGNC	protein_coding	OTTHUMT00000376972.1	39	0.00	0	G	NM_032088		140773952	140773952	+1	no_errors	ENST00000398604	ensembl	human	known	69_37n	missense	31	39.22	20	SNP	0.964	T
PHLDB1	23187	genome.wustl.edu	37	11	118499208	118499208	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr11:118499208T>C	ENST00000361417.2	+	7	2080	c.1669T>C	c.(1669-1671)Tgt>Cgt	p.C557R	PHLDB1_ENST00000356063.5_Missense_Mutation_p.C557R	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	557										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCAGAGTCCCTGTGTCCAGAG	0.597																																						dbGAP											0													21.0	22.0	22.0					11																	118499208		2195	4293	6488	-	-	-	SO:0001583	missense	0				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.1669T>C	11.37:g.118499208T>C	ENSP00000354498:p.Cys557Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.C557R	ENST00000361417.2	37	c.1669	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	T	0.523	-0.861139	0.02610	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000356063	T;T	0.24151	1.87;1.88	5.7	4.77	0.60923	.	0.531710	0.20719	N	0.086959	T	0.06234	0.0161	N	0.00483	-1.445	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.16158	-1.0412	10	0.08381	T	0.77	0.3516	7.4393	0.27174	0.1665:0.7464:0.0:0.0871	.	557;557;557	Q86UU1-3;Q86UU1-2;Q86UU1	.;.;PHLB1_HUMAN	R	557;316;557	ENSP00000354498:C557R;ENSP00000348359:C557R	ENSP00000348359:C557R	C	+	1	0	PHLDB1	118004418	0.897000	0.30589	0.979000	0.43373	0.746000	0.42486	1.230000	0.32612	1.329000	0.45376	0.533000	0.62120	TGT	PHLDB1	-	NULL	ENSG00000019144		0.597	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1	52	0.00	0	T	NM_015157		118499208	118499208	+1	no_errors	ENST00000361417	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	0.996	C
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	21	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	11	38.89	7	SNP	1.000	G
RASSF7	8045	genome.wustl.edu	37	11	563307	563307	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr11:563307C>G	ENST00000397583.3	+	4	1374	c.941C>G	c.(940-942)cCt>cGt	p.P314R	MIR210HG_ENST00000500447.1_lincRNA|RASSF7_ENST00000454668.2_Missense_Mutation_p.P314R|RASSF7_ENST00000397582.3_Missense_Mutation_p.P314R|RASSF7_ENST00000431809.1_Missense_Mutation_p.P314R|C11orf35_ENST00000329451.3_5'Flank|RASSF7_ENST00000344375.4_Missense_Mutation_p.P314R	NM_003475.3	NP_003466.1	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 7	314	Pro-rich.				apoptotic process (GO:0006915)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(3)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGGGGCCCTCCTGGCACTCAG	0.682																																					Pancreas(184;1170 3913 7268)	dbGAP											0													14.0	16.0	16.0					11																	563307		2198	4298	6496	-	-	-	SO:0001583	missense	0			M91083	CCDS7702.1, CCDS44505.1, CCDS44506.1	11p15.5	2008-02-22	2008-02-22	2005-09-14	ENSG00000099849	ENSG00000099849			1166	protein-coding gene	gene with protein product		143023	"""chromosome 11 open reading frame 13"""	C11orf13		1339391	Standard	NM_001143993		Approved	HRC1, HRAS1	uc001lqc.3	Q02833	OTTHUMG00000132004	ENST00000397583.3:c.941C>G	11.37:g.563307C>G	ENSP00000380713:p.Pro314Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9N9|Q3KP41|Q3KP42	Missense_Mutation	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	p.P314R	ENST00000397583.3	37	c.941	CCDS7702.1	11	.	.	.	.	.	.	.	.	.	.	C	12.89	2.073959	0.36566	.	.	ENSG00000099849	ENST00000431809;ENST00000397582;ENST00000344375;ENST00000397583;ENST00000454668	T;T;T;T;T	0.45668	0.89;0.89;1.44;1.44;1.0	3.12	2.12	0.27331	.	0.321593	0.28784	N	0.014157	T	0.31327	0.0793	L	0.44542	1.39	0.09310	N	1	B;B;B	0.14012	0.007;0.009;0.007	B;B;B	0.09377	0.002;0.004;0.004	T	0.19289	-1.0310	10	0.38643	T	0.18	1.2057	9.166	0.37052	0.2161:0.7839:0.0:0.0	.	314;314;314	G5E9N9;Q02833;Q02833-2	.;RASF7_HUMAN;.	R	314	ENSP00000403068:P314R;ENSP00000380712:P314R;ENSP00000344226:P314R;ENSP00000380713:P314R;ENSP00000405606:P314R	ENSP00000344226:P314R	P	+	2	0	RASSF7	553307	0.000000	0.05858	0.008000	0.14137	0.023000	0.10783	0.616000	0.24344	1.595000	0.50050	0.313000	0.20887	CCT	RASSF7	-	NULL	ENSG00000099849		0.682	RASSF7-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASSF7	HGNC	protein_coding	OTTHUMT00000254972.2	38	0.00	0	C	NM_003475		563307	563307	+1	no_errors	ENST00000344375	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	0.000	G
RNF31	55072	genome.wustl.edu	37	14	24620062	24620062	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr14:24620062C>T	ENST00000324103.6	+	8	1773	c.1453C>T	c.(1453-1455)Cgg>Tgg	p.R485W	RNF31_ENST00000559275.1_Missense_Mutation_p.R334W|RP11-468E2.4_ENST00000558468.1_5'Flank|RNF31_ENST00000382687.3_Missense_Mutation_p.R334W	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	485	Polyubiquitin-binding.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		AGACAAGATGCGGGAAGAAGG	0.612																																						dbGAP											0													30.0	33.0	32.0					14																	24620062		2051	4188	6239	-	-	-	SO:0001583	missense	0			AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.1453C>T	14.37:g.24620062C>T	ENSP00000315112:p.Arg485Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	pfam_PUB_domain,pfam_Znf_C6HC,superfamily_UBA-like,superfamily_DEATH-like,superfamily_Znf_FYVE_PHD,smart_Znf_RanBP2,smart_Znf_C6HC,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RanBP2	p.R485W	ENST00000324103.6	37	c.1453	CCDS41931.1	14	.	.	.	.	.	.	.	.	.	.	C	17.32	3.360079	0.61403	.	.	ENSG00000092098	ENST00000324103;ENST00000382687	T;T	0.48522	0.82;0.81	5.56	4.67	0.58626	.	0.438171	0.23300	N	0.049700	T	0.61476	0.2350	M	0.64997	1.995	0.46954	D	0.999264	D;D;D	0.76494	0.998;0.997;0.999	P;P;P	0.60173	0.77;0.745;0.87	T	0.65344	-0.6191	10	0.87932	D	0	-15.982	13.0644	0.59025	0.1612:0.8388:0.0:0.0	.	300;485;334	B3KV71;Q96EP0;Q96EP0-3	.;RNF31_HUMAN;.	W	485;334	ENSP00000315112:R485W;ENSP00000372134:R334W	ENSP00000315112:R485W	R	+	1	2	RNF31	23689902	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	1.474000	0.35398	1.351000	0.45789	0.655000	0.94253	CGG	RNF31	-	NULL	ENSG00000092098		0.612	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF31	HGNC	protein_coding	OTTHUMT00000071921.3	63	0.00	0	C	NM_017999		24620062	24620062	+1	no_errors	ENST00000324103	ensembl	human	known	69_37n	missense	40	40.30	27	SNP	1.000	T
SAFB2	9667	genome.wustl.edu	37	19	5621340	5621340	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr19:5621340G>A	ENST00000252542.4	-	2	518	c.254C>T	c.(253-255)tCa>tTa	p.S85L	SAFB_ENST00000292123.5_5'Flank|SAFB_ENST00000433404.1_5'Flank|SAFB_ENST00000592224.1_5'Flank|SAFB_ENST00000588852.1_5'Flank|SAFB_ENST00000454510.1_5'Flank|SAFB_ENST00000538656.1_5'Flank	NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	85					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		TCTCTTGGCTGACTTCTTGCT	0.438																																					Ovarian(127;888 1728 23957 44128 52668)	dbGAP											0													374.0	346.0	356.0					19																	5621340		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.254C>T	19.37:g.5621340G>A	ENSP00000252542:p.Ser85Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKG3|Q8TB13	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_DNA-bd,smart_SAP_DNA-bd,smart_RRM_dom,pfscan_SAP_DNA-bd,pfscan_RRM_dom	p.S85L	ENST00000252542.4	37	c.254	CCDS32879.1	19	.	.	.	.	.	.	.	.	.	.	G	11.70	1.717582	0.30413	.	.	ENSG00000130254	ENST00000434962;ENST00000415313;ENST00000394625;ENST00000252542;ENST00000536849	T	0.08458	3.09	4.44	1.87	0.25490	.	0.820623	0.10344	N	0.685893	T	0.04272	0.0118	N	0.03608	-0.345	0.09310	N	1	B;B	0.11235	0.0;0.004	B;B	0.06405	0.001;0.002	T	0.41395	-0.9511	10	0.33141	T	0.24	-0.3196	11.3933	0.49827	0.2417:0.0:0.7583:0.0	.	85;85	A0PJ47;Q14151	.;SAFB2_HUMAN	L	85;85;85;85;64	ENSP00000252542:S85L	ENSP00000252542:S85L	S	-	2	0	SAFB2	5572340	0.248000	0.23930	0.009000	0.14445	0.090000	0.18270	1.507000	0.35758	0.867000	0.35654	0.462000	0.41574	TCA	SAFB2	-	NULL	ENSG00000130254		0.438	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAFB2	HGNC	protein_coding	OTTHUMT00000451016.1	48	0.00	0	G	NM_014649		5621340	5621340	-1	no_errors	ENST00000252542	ensembl	human	known	69_37n	missense	35	28.57	14	SNP	0.041	A
SCYL2	55681	genome.wustl.edu	37	12	100711639	100711639	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr12:100711639A>G	ENST00000360820.2	+	10	1768	c.1331A>G	c.(1330-1332)gAg>gGg	p.E444G		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	444					endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						CCTCCTGATGAGATAAAGAAC	0.343																																						dbGAP											0													89.0	85.0	86.0					12																	100711639		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.1331A>G	12.37:g.100711639A>G	ENSP00000354061:p.Glu444Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.E444G	ENST00000360820.2	37	c.1331	CCDS9076.1	12	.	.	.	.	.	.	.	.	.	.	A	20.3	3.958602	0.74016	.	.	ENSG00000136021	ENST00000549687;ENST00000258506;ENST00000360820	T;T	0.36340	1.26;1.26	5.23	5.23	0.72850	Armadillo-like helical (1);Armadillo-type fold (1);	0.133886	0.64402	D	0.000002	T	0.36276	0.0961	L	0.55990	1.75	0.80722	D	1	P	0.38020	0.615	B	0.38264	0.269	T	0.11665	-1.0578	10	0.26408	T	0.33	.	15.4116	0.74929	1.0:0.0:0.0:0.0	.	444	Q6P3W7	SCYL2_HUMAN	G	444;271;444	ENSP00000448366:E444G;ENSP00000354061:E444G	ENSP00000258506:E271G	E	+	2	0	SCYL2	99235770	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.338000	0.79269	2.099000	0.63709	0.528000	0.53228	GAG	SCYL2	-	superfamily_ARM-type_fold	ENSG00000136021		0.343	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL2	HGNC	protein_coding	OTTHUMT00000408493.2	40	0.00	0	A	NM_017988		100711639	100711639	+1	no_errors	ENST00000360820	ensembl	human	known	69_37n	missense	26	42.22	19	SNP	1.000	G
SHISA9	729993	genome.wustl.edu	37	16	13329127	13329127	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr16:13329127G>A	ENST00000424107.3	+	5	1581	c.1136G>A	c.(1135-1137)cGg>cAg	p.R379Q	SHISA9_ENST00000558583.1_Missense_Mutation_p.R420Q			B4DS77	SHSA9_HUMAN	shisa family member 9	379					regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)				breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						CAGTCCCTCCGGCGGCAGGCT	0.632																																						dbGAP											0													104.0	127.0	120.0					16																	13329127		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.1136G>A	16.37:g.13329127G>A	ENSP00000407958:p.Arg379Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J314|C9JCE9	Missense_Mutation	SNP	NULL	p.R420Q	ENST00000424107.3	37	c.1259	CCDS45417.2	16	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284573	0.80803	.	.	ENSG00000237515	ENST00000424107	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	T	0.67822	0.2934	L	0.61218	1.895	0.80722	D	1	D	0.71674	0.998	P	0.54346	0.749	T	0.70288	-0.4913	8	0.51188	T	0.08	.	17.1476	0.86770	0.0:0.0:1.0:0.0	.	379	B4DS77	SHSA9_HUMAN	Q	420	.	ENSP00000407958:R420Q	R	+	2	0	SHISA9	13236628	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.625000	0.61262	2.394000	0.81467	0.650000	0.86243	CGG	SHISA9	-	NULL	ENSG00000237515		0.632	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SHISA9	HGNC	protein_coding	OTTHUMT00000334564.5	72	0.00	0	G	NM_001145204		13329127	13329127	+1	no_errors	ENST00000558583	ensembl	human	known	69_37n	missense	42	48.78	40	SNP	1.000	A
ST5	6764	genome.wustl.edu	37	11	8752457	8752457	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr11:8752457C>T	ENST00000534127.1	-	6	765	c.380G>A	c.(379-381)gGg>gAg	p.G127E	ST5_ENST00000357665.1_Missense_Mutation_p.G127E|ST5_ENST00000530438.1_Intron|ST5_ENST00000526757.1_Intron|ST5_ENST00000313726.6_Missense_Mutation_p.G127E	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	127					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		GGCAGCGACCCCTGCTACATC	0.657																																						dbGAP											0													49.0	57.0	55.0					11																	8752457		2201	4296	6497	-	-	-	SO:0001583	missense	0			U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.380G>A	11.37:g.8752457C>T	ENSP00000433528:p.Gly127Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.G127E	ENST00000534127.1	37	c.380	CCDS7791.1	11	.	.	.	.	.	.	.	.	.	.	C	4.339	0.062358	0.08388	.	.	ENSG00000166444	ENST00000534127;ENST00000313726;ENST00000357665;ENST00000528523;ENST00000527930;ENST00000533681;ENST00000526241;ENST00000530959;ENST00000533580	T;T;T	0.05580	3.42;3.42;3.42	5.87	1.51	0.23008	.	0.371334	0.28665	N	0.014542	T	0.04318	0.0119	L	0.40543	1.245	0.38403	D	0.945713	B	0.02656	0.0	B	0.04013	0.001	T	0.37619	-0.9698	10	0.21540	T	0.41	-3.9847	2.583	0.04823	0.1119:0.4656:0.1848:0.2378	.	127	P78524	ST5_HUMAN	E	127;127;127;127;157;127;127;127;144	ENSP00000433528:G127E;ENSP00000319678:G127E;ENSP00000350294:G127E	ENSP00000319678:G127E	G	-	2	0	ST5	8709033	0.004000	0.15560	0.698000	0.30274	0.001000	0.01503	0.243000	0.18106	0.839000	0.34971	-0.140000	0.14226	GGG	ST5	-	NULL	ENSG00000166444		0.657	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ST5	HGNC	protein_coding	OTTHUMT00000386518.1	44	0.00	0	C	NM_005418		8752457	8752457	-1	no_errors	ENST00000313726	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	0.339	T
SLC43A3	29015	genome.wustl.edu	37	11	57182167	57182167	+	Silent	SNP	G	G	A	rs141024414	byFrequency	TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr11:57182167G>A	ENST00000395123.2	-	11	1285	c.981C>T	c.(979-981)ttC>ttT	p.F327F	SLC43A3_ENST00000533524.1_Silent_p.F340F|SLC43A3_ENST00000529554.1_Silent_p.F327F|SLC43A3_ENST00000395124.1_Silent_p.F327F|SLC43A3_ENST00000352187.1_Silent_p.F327F|SLC43A3_ENST00000528098.1_5'Flank	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	327					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						ACAGCACTCCGAACTGAGTGA	0.537																																						dbGAP											0													213.0	210.0	211.0					11																	57182167		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.981C>T	11.37:g.57182167G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNR8|E7EQD2|Q9NSS4	Missense_Mutation	SNP	superfamily_MFS_dom_general_subst_transpt	p.S98L	ENST00000395123.2	37	c.293	CCDS7956.1	11																																																																																			SLC43A3	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000134802		0.537	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC43A3	HGNC	protein_coding	OTTHUMT00000393057.1	47	0.00	0	G	NM_017611		57182167	57182167	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000525205	ensembl	human	known	69_37n	missense	33	28.26	13	SNP	0.998	A
TERT	7015	genome.wustl.edu	37	5	1266600	1266600	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr5:1266600G>T	ENST00000310581.5	-	10	2690	c.2633C>A	c.(2632-2634)aCc>aAc	p.T878N	TERT_ENST00000334602.6_Missense_Mutation_p.T878N|TERT_ENST00000296820.5_3'UTR|TERT_ENST00000508104.2_3'UTR	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	878	Reverse transcriptase. {ECO:0000255|PROSITE-ProRule:PRU00405}.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	TTTCGCGTGGGTGAGGTGAGG	0.537									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																													dbGAP											0													123.0	87.0	99.0					5																	1266600		2202	4298	6500	-	-	-	SO:0001583	missense	0	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.2633C>A	5.37:g.1266600G>T	ENSP00000309572:p.Thr878Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Missense_Mutation	SNP	pfam_Telomerase_RBD,pfam_RVT,smart_Telomerase_RBD,prints_Telomerase_RT,pfscan_RVT	p.T878N	ENST00000310581.5	37	c.2633	CCDS3861.2	5	.	.	.	.	.	.	.	.	.	.	G	0.469	-0.885213	0.02511	.	.	ENSG00000164362	ENST00000310581;ENST00000334602	D;D	0.97811	-4.55;-4.55	3.99	1.1	0.20463	Reverse transcriptase (2);	1.210170	0.05676	N	0.589423	D	0.92848	0.7725	N	0.19112	0.55	0.09310	N	1	B;P	0.36633	0.009;0.562	B;B	0.34242	0.01;0.178	D	0.86544	0.1830	10	0.10377	T	0.69	0.282	7.7647	0.28972	0.0:0.2911:0.4102:0.2987	.	878;878	O14746-3;O14746	.;TERT_HUMAN	N	878	ENSP00000309572:T878N;ENSP00000334346:T878N	ENSP00000309572:T878N	T	-	2	0	TERT	1319600	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.097000	0.11042	0.013000	0.14918	-0.150000	0.13652	ACC	TERT	-	pfam_RVT,pfscan_RVT	ENSG00000164362		0.537	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TERT	HGNC	protein_coding	OTTHUMT00000206729.2	48	0.00	0	G			1266600	1266600	-1	no_errors	ENST00000310581	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.000	T
NELFCD	51497	genome.wustl.edu	37	20	57561249	57561249	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr20:57561249delC	ENST00000344018.3	+	2	216	c.189delC	c.(187-189)ttcfs	p.F63fs	NELFCD_ENST00000602795.1_Frame_Shift_Del_p.F72fs			Q8IXH7	NELFD_HUMAN	negative elongation factor complex member C/D	63					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	membrane (GO:0016020)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)											CCTCCATCTTCAACACTCTGA	0.448																																						dbGAP											0													77.0	79.0	78.0					20																	57561249		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF161479	CCDS13473.1, CCDS13473.2	20q13	2013-01-31	2013-01-31	2013-01-31	ENSG00000101158	ENSG00000101158			15934	protein-coding gene	gene with protein product	"""trihydrophobin 1"""	605297	"""TH1-like (Drosophila homolog)"", ""TH1-like (Drosophila)"""	TH1L		11030415, 11042152	Standard	NM_198976		Approved	HSPC130, TH1, NELF-C, NELF-D	uc002yag.4	Q8IXH7	OTTHUMG00000032861	ENST00000344018.3:c.189delC	20.37:g.57561249delC	ENSP00000342300:p.Phe63fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DE06|Q9BYL2|Q9H405|Q9H888|Q9H8T3|Q9NVX5|Q9P029|Q9UGN1|Q9UGN2|Q9UGN3	Frame_Shift_Del	DEL	pfam_TH1	p.F63fs	ENST00000344018.3	37	c.189		20																																																																																			TH1L	-	pfam_TH1	ENSG00000101158		0.448	NELFCD-201	KNOWN	basic|appris_principal	protein_coding	TH1L	HGNC	protein_coding		72	0.00	0	C	NM_198976		57561249	57561249	+1	no_errors	ENST00000344018	ensembl	human	known	69_37n	frame_shift_del	45	11.54	6	DEL	0.996	-
TIMMDC1	51300	genome.wustl.edu	37	3	119217721	119217721	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr3:119217721G>T	ENST00000494664.1	+	1	343	c.141G>T	c.(139-141)gaG>gaT	p.E47D	TIMMDC1_ENST00000493694.1_Missense_Mutation_p.E47D|RP11-190C22.8_ENST00000609598.1_lincRNA	NM_016589.3	NP_057673.2	Q9NPL8	TIDC1_HUMAN	translocase of inner mitochondrial membrane domain containing 1	47						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	15						ACGTCCCAGAGCCCTATTACC	0.587																																						dbGAP											0													94.0	103.0	100.0					3																	119217721		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF210057	CCDS33831.1	3q13.33	2013-12-05	2011-07-05	2011-07-05	ENSG00000113845	ENSG00000113845			1321	protein-coding gene	gene with protein product		615534	"""chromosome 3 open reading frame 1"""	C3orf1		11092749	Standard	NM_016589		Approved	FLJ22597	uc003ecn.3	Q9NPL8	OTTHUMG00000159388	ENST00000494664.1:c.141G>T	3.37:g.119217721G>T	ENSP00000418803:p.Glu47Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN81|Q6IAJ7|Q6UWU6|Q9NPR3|Q9NPS5|Q9P0Y6	Missense_Mutation	SNP	pfam_Tim17/Tim22/Tim23/PMP24	p.E47D	ENST00000494664.1	37	c.141	CCDS33831.1	3	.	.	.	.	.	.	.	.	.	.	G	14.36	2.511697	0.44660	.	.	ENSG00000113845	ENST00000494664;ENST00000493694;ENST00000466984	T;T;T	0.44482	1.49;0.92;0.93	5.12	-6.7	0.01766	.	0.631155	0.17020	N	0.190156	T	0.18841	0.0452	L	0.31294	0.92	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.11324	-1.0592	10	0.23302	T	0.38	-1.7958	2.8154	0.05454	0.1843:0.1307:0.4418:0.2432	.	47	Q9NPL8	TIDC1_HUMAN	D	47	ENSP00000418803:E47D;ENSP00000419510:E47D;ENSP00000420122:E47D	ENSP00000264244:E47D	E	+	3	2	TIMMDC1	120700411	0.000000	0.05858	0.004000	0.12327	0.156000	0.22039	-1.847000	0.01675	-0.932000	0.03742	-0.312000	0.09012	GAG	TIMMDC1	-	NULL	ENSG00000113845		0.587	TIMMDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMMDC1	HGNC	protein_coding	OTTHUMT00000355077.3	35	0.00	0	G	NM_016589		119217721	119217721	+1	no_errors	ENST00000494664	ensembl	human	known	69_37n	missense	35	10.00	4	SNP	0.000	T
TSHZ1	10194	genome.wustl.edu	37	18	72999964	72999964	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr18:72999964G>A	ENST00000580243.1	+	2	2950	c.2602G>A	c.(2602-2604)Gat>Aat	p.D868N	TSHZ1_ENST00000322038.5_Missense_Mutation_p.D823N			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	868					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		GTCCGATGCTGATGGCAGCAG	0.597																																						dbGAP											0													63.0	57.0	59.0					18																	72999964		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.2602G>A	18.37:g.72999964G>A	ENSP00000464391:p.Asp868Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O60534|Q4LE29|Q53EU4	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.D868N	ENST00000580243.1	37	c.2602		18	.	.	.	.	.	.	.	.	.	.	G	4.789	0.146792	0.09134	.	.	ENSG00000179981	ENST00000322038	T	0.18502	2.21	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.37019	0.0988	M	0.64997	1.995	0.43603	D	0.995966	D	0.67145	0.996	P	0.58331	0.837	T	0.26608	-1.0098	10	0.87932	D	0	-33.4825	18.5761	0.91155	0.0:0.0:1.0:0.0	.	868	Q6ZSZ6	TSH1_HUMAN	N	823	ENSP00000323584:D823N	ENSP00000323584:D823N	D	+	1	0	TSHZ1	71128952	1.000000	0.71417	0.310000	0.25168	0.131000	0.20780	9.420000	0.97426	1.996000	0.58369	0.459000	0.35465	GAT	TSHZ1	-	NULL	ENSG00000179981		0.597	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	TSHZ1	HGNC	protein_coding	OTTHUMT00000444913.1	28	0.00	0	G	NM_005786		72999964	72999964	+1	no_errors	ENST00000580243	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	0.998	A
TXNDC11	51061	genome.wustl.edu	37	16	11792024	11792024	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr16:11792024A>C	ENST00000356957.3	-	8	1252	c.1145T>G	c.(1144-1146)aTa>aGa	p.I382R	TXNDC11_ENST00000283033.5_Missense_Mutation_p.I355R			Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	382					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						ATTAAAAGGTATGAACAGAAA	0.502																																						dbGAP											0													127.0	127.0	127.0					16																	11792024		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC013727	CCDS32387.1	16p13.13	2008-09-29				ENSG00000153066			28030	protein-coding gene	gene with protein product	"""EF-hand binding protein 1"""					8619474, 9110174	Standard	XM_005255346		Approved	EFP1	uc002dbg.1	Q6PKC3		ENST00000356957.3:c.1145T>G	16.37:g.11792024A>C	ENSP00000349439:p.Ile382Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O95887|Q6PJA6|Q8N2Q4|Q96K45|Q96K53	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.I382R	ENST00000356957.3	37	c.1145		16	.	.	.	.	.	.	.	.	.	.	A	19.64	3.866005	0.71949	.	.	ENSG00000153066	ENST00000356957;ENST00000283033	T;T	0.15952	2.64;2.38	5.72	5.72	0.89469	.	0.224065	0.46145	D	0.000301	T	0.31167	0.0788	L	0.51422	1.61	0.58432	D	0.999996	P;P	0.52061	0.833;0.95	B;P	0.56216	0.352;0.794	T	0.01133	-1.1441	10	0.54805	T	0.06	-29.3071	15.1968	0.73096	1.0:0.0:0.0:0.0	.	382;355	Q6PKC3;Q6PKC3-2	TXD11_HUMAN;.	R	382;355	ENSP00000349439:I382R;ENSP00000283033:I355R	ENSP00000283033:I355R	I	-	2	0	TXNDC11	11699525	1.000000	0.71417	0.498000	0.27564	0.989000	0.77384	8.355000	0.90083	2.189000	0.69895	0.533000	0.62120	ATA	TXNDC11	-	NULL	ENSG00000153066		0.502	TXNDC11-002	KNOWN	basic|appris_candidate_longest	protein_coding	TXNDC11	HGNC	protein_coding	OTTHUMT00000437057.1	36	0.00	0	A	NM_015914		11792024	11792024	-1	no_errors	ENST00000356957	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	C
WASH6P	653440	genome.wustl.edu	37	X	155251726	155251726	+	RNA	SNP	G	G	C			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chrX:155251726G>C	ENST00000461007.1	+	0	734				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										CCATCTTCACGGGCGCCCAGG	0.662																																						dbGAP											0																																										-	-	-			0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155251726G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGF1|Q8N305	Silent	SNP	pfam_WASH_WASD	p.T121	ENST00000461007.1	37	c.363		X																																																																																			WASH6P	-	NULL	ENSG00000182484		0.662	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	9	0.00	0	G	NG_008380		155251726	155251726	+1	no_errors	ENST00000359512	ensembl	human	known	69_37n	silent	4	50.00	4	SNP	0.993	C
YTHDF1	54915	genome.wustl.edu	37	20	61834861	61834861	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr20:61834861C>T	ENST00000370339.3	-	4	772	c.431G>A	c.(430-432)aGc>aAc	p.S144N	YTHDF1_ENST00000370333.4_Missense_Mutation_p.S94N|YTHDF1_ENST00000370334.4_Intron	NM_017798.3	NP_060268.2	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	144							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)	24						ATACGCGGAGCTCTGGGTCTG	0.587																																						dbGAP											0													47.0	43.0	44.0					20																	61834861		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000398	CCDS13511.1	20q13.33	2010-03-15	2004-11-16	2004-06-04	ENSG00000149658	ENSG00000149658			15867	protein-coding gene	gene with protein product			"""YTH domain family 1"""	C20orf21			Standard	NM_017798		Approved	FLJ20391	uc002yeh.3	Q9BYJ9	OTTHUMG00000032955	ENST00000370339.3:c.431G>A	20.37:g.61834861C>T	ENSP00000359364:p.Ser144Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N3G5|Q8TBT1|Q96AN4|Q96S57|Q9BTI7|Q9NX79	Missense_Mutation	SNP	pfam_YTH_domain,pfscan_YTH_domain	p.S144N	ENST00000370339.3	37	c.431	CCDS13511.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.37|12.37	1.918867|1.918867	0.33908|0.33908	.|.	.|.	ENSG00000149658|ENSG00000149658	ENST00000342761|ENST00000370339;ENST00000370333	.|T;T	.|0.52983	.|0.64;0.64	5.15|5.15	3.19|3.19	0.36642|0.36642	.|.	.|0.227351	.|0.64402	.|D	.|0.000012	T|T	0.33990|0.33990	0.0882|0.0882	L|L	0.41027|0.41027	1.25|1.25	0.40303|0.40303	D|D	0.978632|0.978632	.|B	.|0.12630	.|0.006	.|B	.|0.14578	.|0.011	T|T	0.11842|0.11842	-1.0571|-1.0571	6|10	0.51188|0.19590	T|T	0.08|0.45	-9.5428|-9.5428	8.5651|8.5651	0.33534|0.33534	0.0:0.7017:0.0:0.2983|0.0:0.7017:0.0:0.2983	.|.	.|144	.|Q9BYJ9	.|YTHD1_HUMAN	T|N	43|144;94	.|ENSP00000359364:S144N;ENSP00000359358:S94N	ENSP00000339489:A43T|ENSP00000359358:S94N	A|S	-|-	1|2	0|0	YTHDF1|YTHDF1	61305306|61305306	1.000000|1.000000	0.71417|0.71417	0.981000|0.981000	0.43875|0.43875	0.902000|0.902000	0.53008|0.53008	3.272000|3.272000	0.51616|0.51616	1.170000|1.170000	0.42753|0.42753	0.491000|0.491000	0.48974|0.48974	GCT|AGC	YTHDF1	-	NULL	ENSG00000149658		0.587	YTHDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDF1	HGNC	protein_coding	OTTHUMT00000080110.2	51	0.00	0	C	NM_017798		61834861	61834861	-1	no_errors	ENST00000370339	ensembl	human	known	69_37n	missense	53	18.18	12	SNP	1.000	T
ZNF439	90594	genome.wustl.edu	37	19	11959677	11959677	+	5'UTR	SNP	T	T	C			TCGA-D8-A3Z6-01A-11D-A23C-09	TCGA-D8-A3Z6-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	67a233d6-6e32-4224-a9af-c5579672d155	0ca11874-f9f6-4631-9a0a-1814a35f238c	g.chr19:11959677T>C	ENST00000455282.1	+	0	102				ZNF439_ENST00000592534.1_3'UTR			Q8NDP4	ZN439_HUMAN	zinc finger protein 439						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(7)|pancreas(1)|skin(2)	27						CTCTGTCACCTGCGCTATGCC	0.617																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AL833935	CCDS12268.1	19p13.13	2013-01-08			ENSG00000171291	ENSG00000171291		"""Zinc fingers, C2H2-type"", ""-"""	20873	protein-coding gene	gene with protein product							Standard	NM_152262		Approved	DKFZp571K0837	uc002mss.3	Q8NDP4	OTTHUMG00000156527	ENST00000455282.1:c.-302T>C	19.37:g.11959677T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYZ7|Q96SU1	RNA	SNP	-	NULL	ENST00000455282.1	37	NULL		19																																																																																			ZNF439	-	-	ENSG00000171291		0.617	ZNF439-001	PUTATIVE	basic	protein_coding	ZNF439	HGNC	protein_coding	OTTHUMT00000344512.1	25	0.00	0	T			11959677	11959677	+1	no_errors	ENST00000592534	ensembl	human	putative	69_37n	rna	7	41.67	5	SNP	0.011	C
