#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACSL4	2182	genome.wustl.edu	37	X	108926449	108926449	+	Silent	SNP	C	C	T			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chrX:108926449C>T	ENST00000469796.2	-	3	663	c.267G>A	c.(265-267)aaG>aaA	p.K89K	ACSL4_ENST00000348502.6_Silent_p.K48K|ACSL4_ENST00000340800.2_Silent_p.K89K			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	89					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	TCTTCCCAAACTTGGATACAG	0.413																																					Pancreas(188;358 2127 38547 41466 45492)	dbGAP											0													139.0	128.0	132.0					X																	108926449		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.267G>A	X.37:g.108926449C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUY2|O60848|O60849|Q5JWV8	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.K89	ENST00000469796.2	37	c.267	CCDS14548.1	X																																																																																			ACSL4	-	NULL	ENSG00000068366		0.413	ACSL4-003	KNOWN	basic|CCDS	protein_coding	ACSL4	HGNC	protein_coding	OTTHUMT00000358155.2	321	0.00	0	C	NM_004458		108926449	108926449	-1	no_errors	ENST00000340800	ensembl	human	known	69_37n	silent	319	41.58	227	SNP	1.000	T
ADAMTSL1	92949	genome.wustl.edu	37	9	18574047	18574047	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr9:18574047G>A	ENST00000380548.4	+	4	596	c.257G>A	c.(256-258)gGt>gAt	p.G86D	ADAMTSL1_ENST00000327883.7_Missense_Mutation_p.G86D|ADAMTSL1_ENST00000431052.2_Missense_Mutation_p.G86D|ADAMTSL1_ENST00000380566.4_Missense_Mutation_p.G86D|MIR3152_ENST00000579801.1_RNA|ADAMTSL1_ENST00000276935.6_Missense_Mutation_p.G86D|ADAMTSL1_ENST00000380570.4_Missense_Mutation_p.G86D	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	86						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CCAGAAGCAGGTGATTTCCGA	0.473																																						dbGAP											0													129.0	126.0	127.0					9																	18574047		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.257G>A	9.37:g.18574047G>A	ENSP00000369921:p.Gly86Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_ADAM_spacer1,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Thrombospondin_1_rpt	p.G86D	ENST00000380548.4	37	c.257	CCDS47954.1	9	.	.	.	.	.	.	.	.	.	.	G	21.8	4.202084	0.79127	.	.	ENSG00000178031	ENST00000380548;ENST00000327883;ENST00000431052;ENST00000380570;ENST00000380566;ENST00000276935	T;T;T;T;T;T	0.03413	3.94;7.43;7.43;7.43;7.43;7.43	5.55	5.55	0.83447	.	.	.	.	.	T	0.11452	0.0279	L	0.38175	1.15	0.80722	D	1	D;D	0.89917	1.0;0.982	D;P	0.91635	0.999;0.793	T	0.43294	-0.9400	9	0.12766	T	0.61	.	19.5044	0.95110	0.0:0.0:1.0:0.0	.	86;86	Q8N6G6;Q8N6G6-2	ATL1_HUMAN;.	D	86	ENSP00000369921:G86D;ENSP00000327887:G86D;ENSP00000401157:G86D;ENSP00000369944:G86D;ENSP00000369940:G86D;ENSP00000276935:G86D	ENSP00000276935:G86D	G	+	2	0	ADAMTSL1	18564047	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.703000	0.84585	2.620000	0.88729	0.643000	0.83706	GGT	ADAMTSL1	-	NULL	ENSG00000178031		0.473	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	95	0.00	0	G			18574047	18574047	+1	no_errors	ENST00000327883	ensembl	human	known	69_37n	missense	74	28.16	29	SNP	1.000	A
ADAT2	134637	genome.wustl.edu	37	6	143759817	143759817	+	Silent	SNP	G	G	A			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr6:143759817G>A	ENST00000237283.8	-	2	125	c.111C>T	c.(109-111)ctC>ctT	p.L37L	ADAT2_ENST00000606514.1_5'UTR|AL031320.1_ENST00000595616.1_Intron	NM_182503.2	NP_872309.2	Q7Z6V5	ADAT2_HUMAN	adenosine deaminase, tRNA-specific 2	37					tRNA wobble adenosine to inosine editing (GO:0002100)		tRNA-specific adenosine deaminase activity (GO:0008251)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(3)|lung(3)	8				OV - Ovarian serous cystadenocarcinoma(155;5.61e-06)|GBM - Glioblastoma multiforme(68;0.0115)		CAGTATTTTCGAGGGCTTCTT	0.393																																						dbGAP											0													150.0	134.0	139.0					6																	143759817		1867	4097	5964	-	-	-	SO:0001819	synonymous_variant	0			BC037955	CCDS43511.1, CCDS69219.1	6q24.2	2014-01-28	2011-05-19	2007-08-16	ENSG00000189007	ENSG00000189007			21172	protein-coding gene	gene with protein product	tRNA-specific adenosine deaminase 2 homolog (S. cerevisiae)	615388	"""deaminase domain containing 1"", ""adenosine deaminase, tRNA-specific 2, TAD2 homolog (S. cerevisiae)"""	DEADC1		12457566	Standard	NM_182503		Approved	dJ20N2.1, TAD2	uc003qjj.3	Q7Z6V5	OTTHUMG00000015725	ENST00000237283.8:c.111C>T	6.37:g.143759817G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL12|B3KWY3|Q7Z327|Q8IY39	Silent	SNP	pfam_CMP_dCMP_Zn-bd,superfamily_Cytidine_deaminase-like	p.L37	ENST00000237283.8	37	c.111	CCDS43511.1	6																																																																																			ADAT2	-	pfam_CMP_dCMP_Zn-bd,superfamily_Cytidine_deaminase-like	ENSG00000189007		0.393	ADAT2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ADAT2	HGNC	protein_coding	OTTHUMT00000042517.1	282	0.35	1	G	XM_059727		143759817	143759817	-1	no_errors	ENST00000237283	ensembl	human	known	69_37n	silent	297	32.96	146	SNP	0.483	A
CDH1	999	genome.wustl.edu	37	16	68845762	68845762	+	Splice_Site	SNP	G	G	A	rs267606712		TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr16:68845762G>A	ENST00000261769.5	+	7	1199	c.1008G>A	c.(1006-1008)gaG>gaA	p.E336E	RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Splice_Site_p.E336E	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	336	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.		E -> D. {ECO:0000269|PubMed:9537325}.		adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.E336E(2)|p.S337fs*19(1)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TGGACCGAGAGGTCAGGGGTC	0.502			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	4	Substitution - coding silent(2)|Unknown(1)|Deletion - Frameshift(1)	stomach(3)|breast(1)	GRCh37	CS982111	CDH1	S							70.0	67.0	68.0					16																	68845762		2198	4300	6498	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1008+1G>A	16.37:g.68845762G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E336	ENST00000261769.5	37	c.1008	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000039068		0.502	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	103	0.00	0	G	NM_004360	Silent	68845762	68845762	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	silent	24	46.67	21	SNP	1.000	A
CEP44	80817	genome.wustl.edu	37	4	175224934	175224934	+	Silent	SNP	C	C	T			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr4:175224934C>T	ENST00000503780.1	+	5	732	c.318C>T	c.(316-318)atC>atT	p.I106I	CEP44_ENST00000457424.2_Silent_p.I106I|CEP44_ENST00000296519.4_Silent_p.I106I|CEP44_ENST00000426172.1_Silent_p.I106I	NM_001040157.2	NP_001035247.1	Q9C0F1	CEP44_HUMAN	centrosomal protein 44kDa	106						centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|spindle pole (GO:0000922)				endometrium(2)|large_intestine(4)|lung(5)|stomach(1)	12						AATGGAAAATCCAAATTGTTT	0.313																																						dbGAP											0													75.0	79.0	77.0					4																	175224934		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AB051499	CCDS34106.1, CCDS47163.1	4q34	2014-02-20	2011-05-06	2011-05-06	ENSG00000164118	ENSG00000164118			29356	protein-coding gene	gene with protein product			"""KIAA1712"""	KIAA1712		21399614	Standard	NM_001040157		Approved		uc010iro.2	Q9C0F1	OTTHUMG00000160752	ENST00000503780.1:c.318C>T	4.37:g.175224934C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8W9|A8MW11|B3KT53|D3DP42|Q8IXZ4	Silent	SNP	NULL	p.I106	ENST00000503780.1	37	c.318	CCDS34106.1	4																																																																																			CEP44	-	NULL	ENSG00000164118		0.313	CEP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP44	HGNC	protein_coding	OTTHUMT00000362109.2	200	0.00	0	C	NM_030633		175224934	175224934	+1	no_errors	ENST00000426172	ensembl	human	known	69_37n	silent	280	30.88	126	SNP	0.981	T
CHD2	1106	genome.wustl.edu	37	15	93527570	93527570	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr15:93527570T>G	ENST00000394196.4	+	25	4145	c.3077T>G	c.(3076-3078)tTt>tGt	p.F1026C	CHD2_ENST00000557381.1_Missense_Mutation_p.F1026C	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1026	Glu-rich.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			GTTGCCAACTTTGCAACAATG	0.393																																						dbGAP											0													66.0	66.0	66.0					15																	93527570		2197	4298	6495	-	-	-	SO:0001583	missense	0			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.3077T>G	15.37:g.93527570T>G	ENSP00000377747:p.Phe1026Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	C6G482|Q96IP5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.F1026C	ENST00000394196.4	37	c.3077	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	T	22.5	4.302991	0.81136	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	D;D	0.92348	-3.02;-3.01	5.24	5.24	0.73138	.	0.000000	0.35291	U	0.003302	D	0.96525	0.8866	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.83275	0.981;0.996	D	0.97324	0.9946	10	0.87932	D	0	-15.7052	15.1315	0.72527	0.0:0.0:0.0:1.0	.	1026;1026	O14647;O14647-2	CHD2_HUMAN;.	C	1026	ENSP00000377747:F1026C;ENSP00000451366:F1026C	ENSP00000377747:F1026C	F	+	2	0	CHD2	91328574	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.296000	0.78790	1.982000	0.57802	0.482000	0.46254	TTT	CHD2	-	NULL	ENSG00000173575		0.393	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3	116	0.00	0	T	NM_001271		93527570	93527570	+1	no_errors	ENST00000557381	ensembl	human	putative	69_37n	missense	109	25.85	38	SNP	1.000	G
CLUL1	27098	genome.wustl.edu	37	18	645027	645027	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr18:645027G>A	ENST00000400606.2	+	8	1472	c.1327G>A	c.(1327-1329)Gag>Aag	p.E443K	CLUL1_ENST00000579494.1_Missense_Mutation_p.E443K|CLUL1_ENST00000581619.1_Missense_Mutation_p.E468K|CLUL1_ENST00000540035.1_Missense_Mutation_p.E495K|CLUL1_ENST00000338387.7_Missense_Mutation_p.E443K|C18orf56_ENST00000585033.1_Intron	NM_014410.4	NP_055225.1	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal)	443					cell death (GO:0008219)	extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(5)|large_intestine(5)|liver(2)|lung(7)|ovary(2)|skin(1)	24						AGAAAGTGCTGAGAGTTCTAA	0.393																																						dbGAP											0													103.0	95.0	97.0					18																	645027		1852	4087	5939	-	-	-	SO:0001583	missense	0			D63813	CCDS42405.1, CCDS74187.1	18p11.32	2008-07-28				ENSG00000079101			2096	protein-coding gene	gene with protein product						10675623, 14507903	Standard	NM_199167		Approved		uc002kkq.3	Q15846		ENST00000400606.2:c.1327G>A	18.37:g.645027G>A	ENSP00000383449:p.Glu443Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0FDN7	Missense_Mutation	SNP	pfam_Clusterin-like,smart_Clusterin_N,smart_Clusterin_C	p.E443K	ENST00000400606.2	37	c.1327	CCDS42405.1	18	.	.	.	.	.	.	.	.	.	.	G	14.54	2.565035	0.45694	.	.	ENSG00000079101	ENST00000400606;ENST00000540035;ENST00000338387	T;T;T	0.24538	1.85;1.85;1.85	4.87	3.99	0.46301	Clusterin, C-terminal (1);	0.486738	0.23402	N	0.048562	T	0.20088	0.0483	L	0.48362	1.52	0.22171	N	0.999312	B;B	0.33318	0.408;0.094	B;B	0.31614	0.077;0.133	T	0.12889	-1.0530	10	0.35671	T	0.21	-1.3772	7.6792	0.28502	0.095:0.1686:0.7364:0.0	.	495;443	F5GWQ8;Q15846	.;CLUL1_HUMAN	K	443;495;443	ENSP00000383449:E443K;ENSP00000441726:E495K;ENSP00000341128:E443K	ENSP00000341128:E443K	E	+	1	0	CLUL1	635027	0.655000	0.27376	0.984000	0.44739	0.934000	0.57294	3.068000	0.50018	1.256000	0.44068	0.591000	0.81541	GAG	CLUL1	-	pfam_Clusterin-like,smart_Clusterin_C	ENSG00000079101		0.393	CLUL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLUL1	HGNC	protein_coding	OTTHUMT00000441183.1	117	0.00	0	G			645027	645027	+1	no_errors	ENST00000338387	ensembl	human	known	69_37n	missense	146	17.51	31	SNP	0.218	A
ENC1	8507	genome.wustl.edu	37	5	73931474	73931474	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr5:73931474A>T	ENST00000302351.4	-	2	1967	c.837T>A	c.(835-837)aaT>aaA	p.N279K	ENC1_ENST00000537006.1_Missense_Mutation_p.N279K|ENC1_ENST00000510316.1_Missense_Mutation_p.N206K	NM_003633.3	NP_003624.1	O14682	ENC1_HUMAN	ectodermal-neural cortex 1 (with BTB domain)	279					multicellular organismal development (GO:0007275)|negative regulation of translation (GO:0017148)|nervous system development (GO:0007399)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	20		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.45e-59)		CCACACCGTCATTCTGCAGGA	0.502																																						dbGAP											0													79.0	88.0	85.0					5																	73931474		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF059611	CCDS4021.1, CCDS58958.1	5q13	2013-01-30	2013-01-30		ENSG00000171617	ENSG00000171617		"""Kelch-like"", ""BTB/POZ domain containing"""	3345	protein-coding gene	gene with protein product	"""kelch-like family member 37"""	605173	"""ectodermal-neural cortex 1 (with BTB-like domain)"""	NRPB		9305847, 9566959	Standard	NM_003633		Approved	PIG10, ENC-1, TP53I10, KLHL37	uc003kdc.5	O14682	OTTHUMG00000102059	ENST00000302351.4:c.837T>A	5.37:g.73931474A>T	ENSP00000306356:p.Asn279Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHJ1|E9PFU0|O75464|Q9UPG9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.N279K	ENST00000302351.4	37	c.837	CCDS4021.1	5	.	.	.	.	.	.	.	.	.	.	A	13.44	2.236831	0.39498	.	.	ENSG00000171617	ENST00000302351;ENST00000510316;ENST00000537006	T;T;T	0.70869	-0.52;-0.52;-0.52	6.04	-3.47	0.04753	.	0.000000	0.85682	D	0.000000	T	0.54367	0.1854	L	0.28400	0.85	0.58432	D	0.999996	B	0.32203	0.36	B	0.30401	0.115	T	0.42224	-0.9464	10	0.40728	T	0.16	.	15.6892	0.77436	0.3453:0.0:0.6547:0.0	.	279	O14682	ENC1_HUMAN	K	279;206;279	ENSP00000306356:N279K;ENSP00000423804:N206K;ENSP00000446289:N279K	ENSP00000306356:N279K	N	-	3	2	ENC1	73967230	0.945000	0.32115	0.970000	0.41538	0.987000	0.75469	0.128000	0.15810	-0.518000	0.06452	-0.379000	0.06801	AAT	ENC1	-	pirsf_Kelch-like_gigaxonin	ENSG00000171617		0.502	ENC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENC1	HGNC	protein_coding	OTTHUMT00000219862.2	114	0.00	0	A	NM_003633		73931474	73931474	-1	no_errors	ENST00000302351	ensembl	human	known	69_37n	missense	63	27.59	24	SNP	0.950	T
DDX46	9879	genome.wustl.edu	37	5	134147500	134147500	+	Missense_Mutation	SNP	C	C	A	rs192719313		TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr5:134147500C>A	ENST00000354283.4	+	18	2536	c.2401C>A	c.(2401-2403)Cta>Ata	p.L801I	DDX46_ENST00000452510.2_Missense_Mutation_p.L801I			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	801					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGCTCTTGGTCTACAAGATTC	0.378																																					Colon(13;391 453 4901 21675 24897)	dbGAP											0													127.0	130.0	129.0					5																	134147500		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.2401C>A	5.37:g.134147500C>A	ENSP00000346236:p.Leu801Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O94894|Q96EI0|Q9Y658	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.L801I	ENST00000354283.4	37	c.2401	CCDS34240.1	5	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400595	0.62177	.	.	ENSG00000145833	ENST00000452510;ENST00000354283	T;T	0.28454	1.63;1.61	5.07	3.25	0.37280	.	0.000000	0.85682	D	0.000000	T	0.31827	0.0809	L	0.49126	1.545	0.58432	D	0.999996	P	0.39044	0.656	P	0.44732	0.459	T	0.05451	-1.0884	10	0.41790	T	0.15	-8.4925	8.8353	0.35109	0.0:0.695:0.0:0.305	.	801	Q7L014	DDX46_HUMAN	I	801	ENSP00000416534:L801I;ENSP00000346236:L801I	ENSP00000346236:L801I	L	+	1	2	DDX46	134175399	0.186000	0.23225	1.000000	0.80357	0.986000	0.74619	0.567000	0.23608	1.259000	0.44117	0.491000	0.48974	CTA	DDX46	-	NULL	ENSG00000145833		0.378	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX46	HGNC	protein_coding	OTTHUMT00000371584.1	185	0.00	0	C	NM_014829		134147500	134147500	+1	no_errors	ENST00000452510	ensembl	human	known	69_37n	missense	187	42.33	138	SNP	0.996	A
FOCAD	54914	genome.wustl.edu	37	9	20912930	20912931	+	Frame_Shift_Ins	INS	-	-	A			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr9:20912930_20912931insA	ENST00000380249.1	+	25	3148_3149	c.2784_2785insA	c.(2785-2787)aaafs	p.K929fs	FOCAD_ENST00000605086.1_Frame_Shift_Ins_p.K365fs|FOCAD_ENST00000338382.6_Frame_Shift_Ins_p.K929fs	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	929						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											AGGTGCAGTACAAAAAAAGCAC	0.436																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.2791dupA	9.37:g.20912937_20912937dupA	ENSP00000369599:p.Lys929fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Frame_Shift_Ins	INS	pfam_DUF3028,pfam_DUF3730,superfamily_ARM-type_fold	p.S930fs	ENST00000380249.1	37	c.2784_2785	CCDS34993.1	9																																																																																			FOCAD	-	superfamily_ARM-type_fold	ENSG00000188352		0.436	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOCAD	HGNC	protein_coding	OTTHUMT00000143442.1	175	0.00	0	-	NM_017794		20912930	20912931	+1	no_errors	ENST00000338382	ensembl	human	known	69_37n	frame_shift_ins	156	29.09	64	INS	0.998:1.000	A
GALNT11	63917	genome.wustl.edu	37	7	151810410	151810410	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr7:151810410G>C	ENST00000434507.1	+	10	1597	c.1160G>C	c.(1159-1161)gGa>gCa	p.G387A	GALNT11_ENST00000452146.2_Missense_Mutation_p.G306A|GALNT11_ENST00000430044.2_Missense_Mutation_p.G387A|GALNT11_ENST00000320311.2_Missense_Mutation_p.G387A			Q8NCW6	GLT11_HUMAN	polypeptide N-acetylgalactosaminyltransferase 11	387					cellular protein metabolic process (GO:0044267)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via threonine (GO:0018243)|regulation of Notch signaling pathway (GO:0008593)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|Notch binding (GO:0005112)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|prostate(5)|skin(2)	27	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		CGACCATATGGATCTCCCGAA	0.478																																						dbGAP											0													176.0	165.0	169.0					7																	151810410		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC006017	CCDS5930.1	7q36.1	2014-05-09	2014-05-09		ENSG00000178234	ENSG00000178234	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19875	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 11"""	615130	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)"""			11925450	Standard	NM_022087		Approved	GalNAc-T11	uc010lqg.1	Q8NCW6	OTTHUMG00000157251	ENST00000434507.1:c.1160G>C	7.37:g.151810410G>C	ENSP00000416787:p.Gly387Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWF4|Q6PCD1|Q9H6C2|Q9H6Z5|Q9UDR8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.G387A	ENST00000434507.1	37	c.1160	CCDS5930.1	7	.	.	.	.	.	.	.	.	.	.	G	23.1	4.370446	0.82573	.	.	ENSG00000178234	ENST00000430044;ENST00000452146;ENST00000443352;ENST00000434507;ENST00000320311	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	5.59	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.59783	0.2219	L	0.58583	1.82	0.80722	D	1	D;D;D	0.61080	0.97;0.973;0.989	P;P;P	0.57620	0.77;0.629;0.824	T	0.59478	-0.7447	10	0.02654	T	1	.	10.4048	0.44249	0.0713:0.1323:0.7964:0.0	.	306;387;387	B7Z5G5;B3KWF4;Q8NCW6	.;.;GLT11_HUMAN	A	387;306;387;387;387	ENSP00000395122:G387A;ENSP00000393399:G306A;ENSP00000416787:G387A;ENSP00000315835:G387A	ENSP00000315835:G387A	G	+	2	0	GALNT11	151441343	1.000000	0.71417	0.154000	0.22540	0.968000	0.65278	9.770000	0.98971	2.622000	0.88805	0.561000	0.74099	GGA	GALNT11	-	NULL	ENSG00000178234		0.478	GALNT11-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GALNT11	HGNC	protein_coding	OTTHUMT00000348184.1	128	0.00	0	G	NM_022087		151810410	151810410	+1	no_errors	ENST00000320311	ensembl	human	known	69_37n	missense	77	39.37	50	SNP	0.986	C
MTX1	4580	genome.wustl.edu	37	1	155184057	155184057	+	IGR	SNP	G	G	A	rs114312440	byFrequency	TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr1:155184057G>A	ENST00000368376.3	+	0	1632				GBAP1_ENST00000486869.1_RNA|RP11-263K19.6_ENST00000455788.1_RNA	NM_002455.3	NP_002446.2	Q13505	MTX1_HUMAN	metaxin 1						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTAAGCTCACGCTGGCCCTGT	0.572													G|||	1875	0.374401	0.1286	0.5259	5008	,	,		17617	0.6806		0.3012	False		,,,				2504	0.3589					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0				CCDS1100.1, CCDS1101.1	1q21	2008-07-18			ENSG00000173171	ENSG00000173171			7504	protein-coding gene	gene with protein product		600605		MTX		7753840	Standard	XM_006711338		Approved	MTXN	uc001fjb.3	Q13505	OTTHUMG00000035708		1.37:g.155184057G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AVR9|B1AVS0|B2R9P4|Q9BUU3	RNA	SNP	-	NULL	ENST00000368376.3	37	NULL	CCDS1100.1	1																																																																																			GBAP1	-	-	ENSG00000160766		0.572	MTX1-001	KNOWN	basic|CCDS	protein_coding	GBAP1	HGNC	protein_coding	OTTHUMT00000086844.1	22	0.00	0	G	NM_198883		155184057	155184057	-1	no_errors	ENST00000368374	ensembl	human	known	69_37n	rna	11	26.67	4	SNP	0.011	A
GLIPR1	11010	genome.wustl.edu	37	12	75892695	75892695	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr12:75892695A>G	ENST00000266659.3	+	6	939	c.738A>G	c.(736-738)atA>atG	p.I246M	KRR1_ENST00000229214.4_3'UTR	NM_006851.2	NP_006842.2	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1	246					cellular lipid metabolic process (GO:0044255)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	14						TAATTCTAATACTGTCTGTTA	0.353																																						dbGAP											0													138.0	125.0	129.0					12																	75892695		2203	4299	6502	-	-	-	SO:0001583	missense	0			U16307	CCDS9011.1	12q14.1	2008-08-15	2008-08-15			ENSG00000139278			17001	protein-coding gene	gene with protein product		602692	"""GLI pathogenesis-related 1 (glioma)"""			7607567, 8973356	Standard	NM_006851		Approved	RTVP1, GliPR	uc001sxs.3	P48060	OTTHUMG00000169757	ENST00000266659.3:c.738A>G	12.37:g.75892695A>G	ENSP00000266659:p.Ile246Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A7YET6|F8VUC2|Q15409|Q969K2	Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1,prints_V5_allergen	p.I246M	ENST00000266659.3	37	c.738	CCDS9011.1	12	.	.	.	.	.	.	.	.	.	.	A	5.255	0.232590	0.09969	.	.	ENSG00000139278	ENST00000266659	T	0.08193	3.12	5.27	0.117	0.14652	.	0.443182	0.23752	N	0.044908	T	0.05135	0.0137	L	0.37630	1.12	0.09310	N	0.999999	B	0.19583	0.037	B	0.18263	0.021	T	0.31420	-0.9944	10	0.48119	T	0.1	.	0.7965	0.01067	0.4926:0.168:0.1782:0.1612	.	246	P48060	GLIP1_HUMAN	M	246	ENSP00000266659:I246M	ENSP00000266659:I246M	I	+	3	3	GLIPR1	74178962	0.008000	0.16893	0.009000	0.14445	0.006000	0.05464	0.009000	0.13219	0.438000	0.26450	-0.411000	0.06167	ATA	GLIPR1	-	NULL	ENSG00000139278		0.353	GLIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIPR1	HGNC	protein_coding	OTTHUMT00000405722.1	271	0.36	1	A	NM_006851		75892695	75892695	+1	no_errors	ENST00000266659	ensembl	human	known	69_37n	missense	376	35.16	205	SNP	0.002	G
GPRASP2	114928	genome.wustl.edu	37	X	101971061	101971061	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chrX:101971061G>A	ENST00000535209.1	+	4	2095	c.1264G>A	c.(1264-1266)Gcg>Acg	p.A422T	GPRASP2_ENST00000543253.1_Missense_Mutation_p.A422T|GPRASP2_ENST00000332262.5_Missense_Mutation_p.A422T			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	422						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						TGGCGGATCCGCGTACTGGGC	0.572																																						dbGAP											0													67.0	69.0	68.0					X																	101971061		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1264G>A	X.37:g.101971061G>A	ENSP00000437394:p.Ala422Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DXA0|Q8NAB4	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.A422T	ENST00000535209.1	37	c.1264	CCDS14501.1	X	.	.	.	.	.	.	.	.	.	.	G	0.054	-1.242172	0.01481	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.06528	3.29;3.29;3.29	4.44	-2.38	0.06622	.	1.039220	0.07713	N	0.942441	T	0.02455	0.0075	N	0.08118	0	0.09310	N	1	B	0.15141	0.012	B	0.01281	0.0	T	0.47407	-0.9120	10	0.13470	T	0.59	.	2.0911	0.03657	0.1417:0.1887:0.4331:0.2364	.	422	Q96D09	GASP2_HUMAN	T	422	ENSP00000437872:A422T;ENSP00000437394:A422T;ENSP00000339057:A422T	ENSP00000339057:A422T	A	+	1	0	GPRASP2	101857717	0.225000	0.23685	0.058000	0.19502	0.625000	0.37756	-0.076000	0.11412	-0.551000	0.06175	-1.251000	0.01509	GCG	GPRASP2	-	NULL	ENSG00000158301		0.572	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP2	HGNC	protein_coding	OTTHUMT00000057626.2	82	0.00	0	G	NM_138437		101971061	101971061	+1	no_errors	ENST00000332262	ensembl	human	known	69_37n	missense	51	41.38	36	SNP	0.033	A
HMGCS1	3157	genome.wustl.edu	37	5	43295926	43295926	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr5:43295926A>G	ENST00000325110.6	-	6	1039	c.833T>C	c.(832-834)aTg>aCg	p.M278T	HMGCS1_ENST00000433297.2_Missense_Mutation_p.M278T	NM_001098272.2	NP_001091742.1	Q01581	HMCS1_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)	278					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|lipid metabolic process (GO:0006629)|liver development (GO:0001889)|male gonad development (GO:0008584)|response to acid chemical (GO:0001101)|response to drug (GO:0042493)|response to lipoprotein particle (GO:0055094)|response to low light intensity stimulus (GO:0009645)|response to purine-containing compound (GO:0014074)|response to tellurium ion (GO:0046690)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hydroxymethylglutaryl-CoA synthase activity (GO:0004421)|isomerase activity (GO:0016853)|organic acid binding (GO:0043177)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|stomach(1)|urinary_tract(1)	15						ATTCAGCAACATCCGAGCTAG	0.368																																						dbGAP											0													86.0	89.0	88.0					5																	43295926		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34154.1	5p14-p13	2012-10-02	2010-04-30			ENSG00000112972	2.3.3.10		5007	protein-coding gene	gene with protein product	"""3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase"""	142940	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)"""	HMGCS			Standard	NM_001098272		Approved		uc003jnq.5	Q01581		ENST00000325110.6:c.833T>C	5.37:g.43295926A>G	ENSP00000322706:p.Met278Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDL8	Missense_Mutation	SNP	pfam_HMG_CoA_synt_C,pfam_HMG_CoA_synth_N,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	p.M278T	ENST00000325110.6	37	c.833	CCDS34154.1	5	.	.	.	.	.	.	.	.	.	.	A	17.62	3.435029	0.62955	.	.	ENSG00000112972	ENST00000325110;ENST00000433297;ENST00000545275	T;T	0.78126	-1.15;-1.15	5.66	5.66	0.87406	Hydroxymethylglutaryl-coenzyme A synthase C-terminal (1);Thiolase-like (1);	0.047237	0.85682	D	0.000000	T	0.78559	0.4302	L	0.53671	1.685	0.58432	D	0.999993	B	0.21071	0.051	B	0.34536	0.185	T	0.76860	-0.2803	10	0.87932	D	0	-3.6655	15.8804	0.79201	1.0:0.0:0.0:0.0	.	278	Q01581	HMCS1_HUMAN	T	278;278;267	ENSP00000322706:M278T;ENSP00000399402:M278T	ENSP00000322706:M278T	M	-	2	0	HMGCS1	43331683	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	2.160000	0.67779	0.477000	0.44152	ATG	HMGCS1	-	pfam_HMG_CoA_synt_C,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	ENSG00000112972		0.368	HMGCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCS1	HGNC	protein_coding	OTTHUMT00000368022.1	182	0.00	0	A			43295926	43295926	-1	no_errors	ENST00000325110	ensembl	human	known	69_37n	missense	236	25.08	79	SNP	1.000	G
GLTSCR1L	23506	genome.wustl.edu	37	6	42797341	42797342	+	Frame_Shift_Ins	INS	-	-	T			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr6:42797341_42797342insT	ENST00000314073.5	+	6	1446_1447	c.1270_1271insT	c.(1270-1272)cttfs	p.L424fs	GLTSCR1L_ENST00000394168.1_Frame_Shift_Ins_p.L424fs			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	424																	AAATGGGCAACTTCTTCAAACT	0.49																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.1272dupT	6.37:g.42797343_42797343dupT	ENSP00000313933:p.Leu424fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3W2|Q5TFZ3|Q92514	Frame_Shift_Ins	INS	NULL	p.L425fs	ENST00000314073.5	37	c.1270_1271	CCDS34451.1	6																																																																																			KIAA0240	-	NULL	ENSG00000112624		0.490	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0240	HGNC	protein_coding	OTTHUMT00000040562.3	93	0.00	0	-	NM_015349		42797341	42797342	+1	no_errors	ENST00000314073	ensembl	human	known	69_37n	frame_shift_ins	85	20.56	22	INS	1.000:1.000	T
KIF14	9928	genome.wustl.edu	37	1	200567540	200567540	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr1:200567540T>A	ENST00000367350.4	-	14	2812	c.2374A>T	c.(2374-2376)Att>Ttt	p.I792F		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	792					ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						TGAAACATAATTCCTGCTTTC	0.289																																						dbGAP											0													99.0	100.0	99.0					1																	200567540		2203	4299	6502	-	-	-	SO:0001583	missense	0			D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.2374A>T	1.37:g.200567540T>A	ENSP00000356319:p.Ile792Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I792F	ENST00000367350.4	37	c.2374	CCDS30963.1	1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.007010	0.74932	.	.	ENSG00000118193	ENST00000367350	T	0.77358	-1.09	5.26	1.67	0.24075	.	0.279835	0.34628	N	0.003817	D	0.85579	0.5729	M	0.90082	3.085	0.34617	D	0.718212	P	0.49358	0.923	P	0.55871	0.786	D	0.87573	0.2479	10	0.87932	D	0	.	8.582	0.33634	0.0:0.2268:0.0:0.7732	.	792	Q15058	KIF14_HUMAN	F	792	ENSP00000356319:I792F	ENSP00000356319:I792F	I	-	1	0	KIF14	198834163	0.952000	0.32445	0.994000	0.49952	0.992000	0.81027	1.515000	0.35845	0.031000	0.15407	0.460000	0.39030	ATT	KIF14	-	NULL	ENSG00000118193		0.289	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF14	HGNC	protein_coding	OTTHUMT00000086878.1	273	0.00	0	T	NM_014875		200567540	200567540	-1	no_errors	ENST00000367350	ensembl	human	known	69_37n	missense	360	43.59	279	SNP	0.995	A
LINC00442	348021	genome.wustl.edu	37	13	19585867	19585867	+	RNA	SNP	T	T	C	rs4769320	byFrequency	TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr13:19585867T>C	ENST00000456737.1	+	0	1231				LINC00442_ENST00000542070.1_RNA|LINC00442_ENST00000428086.2_RNA	NR_026852.1				long intergenic non-protein coding RNA 442																		TGCCATTGCCTAGAGTTGGCA	0.577													T|||	3644	0.727636	0.7526	0.7637	5008	,	,		18982	0.9018		0.5855	False		,,,				2504	0.635					dbGAP											0																																										-	-	-			0					13q12.11	2012-10-12			ENSG00000232685	ENSG00000232685		"""Long non-coding RNAs"""	42779	non-coding RNA	RNA, long non-coding							Standard	NR_026852		Approved		uc001uma.1		OTTHUMG00000016475		13.37:g.19585867T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000456737.1	37	NULL		13																																																																																			LINC00442	-	-	ENSG00000232685		0.577	LINC00442-003	KNOWN	basic	antisense	LINC00442	HGNC	antisense	OTTHUMT00000106498.1	8	0.00	0	T			19585867	19585867	+1	no_errors	ENST00000428086	ensembl	human	known	69_37n	rna	8	46.67	7	SNP	0.004	C
MAPK8IP3	23162	genome.wustl.edu	37	16	1812950	1812950	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr16:1812950A>G	ENST00000250894.4	+	16	1995	c.1838A>G	c.(1837-1839)aAc>aGc	p.N613S	MAPK8IP3_ENST00000356010.5_Missense_Mutation_p.N607S	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	613					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						CAGCGCCGCAACCATGCCATG	0.647																																						dbGAP											0													58.0	71.0	67.0					16																	1812950		2009	4178	6187	-	-	-	SO:0001583	missense	0			AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.1838A>G	16.37:g.1812950A>G	ENSP00000250894:p.Asn613Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Missense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.N613S	ENST00000250894.4	37	c.1838	CCDS10442.2	16	.	.	.	.	.	.	.	.	.	.	a	0.253	-1.005239	0.02112	.	.	ENSG00000138834	ENST00000250894;ENST00000356010	T;T	0.24908	1.83;1.83	5.37	1.14	0.20703	.	0.650707	0.17480	N	0.172757	T	0.05410	0.0143	N	0.00403	-1.54	0.25931	N	0.982997	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.41431	-0.9509	10	0.02654	T	1	-5.0744	10.0657	0.42301	0.2821:0.0:0.7179:0.0	.	614;607;613	B7ZMF3;E9PFH7;Q9UPT6	.;.;JIP3_HUMAN	S	613;607	ENSP00000250894:N613S;ENSP00000348290:N607S	ENSP00000250894:N613S	N	+	2	0	MAPK8IP3	1752951	1.000000	0.71417	0.792000	0.32020	0.944000	0.59088	2.404000	0.44539	-0.000000	0.14550	-0.232000	0.12228	AAC	MAPK8IP3	-	NULL	ENSG00000138834		0.647	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP3	HGNC	protein_coding	OTTHUMT00000250508.2	48	0.00	0	A	NM_001040439		1812950	1812950	+1	no_errors	ENST00000250894	ensembl	human	known	69_37n	missense	24	46.67	21	SNP	1.000	G
MSL2	55167	genome.wustl.edu	37	3	135871094	135871094	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr3:135871094delG	ENST00000309993.2	-	2	1361	c.629delC	c.(628-630)cctfs	p.P210fs	MSL2_ENST00000434835.2_Frame_Shift_Del_p.P136fs	NM_018133.3	NP_060603.2	Q9HCI7	MSL2_HUMAN	male-specific lethal 2 homolog (Drosophila)	210					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	18						TTCAGGTGAAGGAATATTTAT	0.398																																						dbGAP											0													66.0	69.0	68.0					3																	135871094		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK001408	CCDS33861.1, CCDS46922.1	3q22.2	2008-10-29	2008-10-29	2008-10-29	ENSG00000174579	ENSG00000174579		"""RING-type (C3HC4) zinc fingers"""	25544	protein-coding gene	gene with protein product	"""male-specific lethal-2 homolog (Drosophila)"""	614802	"""ring finger protein 184"", ""male-specific lethal 2-like 1 (Drosophila)"""	RNF184, MSL2L1		16227571, 16543150	Standard	NM_018133		Approved	FLJ10546, KIAA1585, msl-2	uc003eqx.1	Q9HCI7	OTTHUMG00000159793	ENST00000309993.2:c.629delC	3.37:g.135871094delG	ENSP00000311827:p.Pro210fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYL4|G5E9I1|Q0D2P1|Q8NDB4|Q9NVS4	Frame_Shift_Del	DEL	pfscan_Znf_RING	p.P210fs	ENST00000309993.2	37	c.629	CCDS33861.1	3																																																																																			MSL2	-	NULL	ENSG00000174579		0.398	MSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSL2	HGNC	protein_coding	OTTHUMT00000357347.1	119	0.00	0	G	NM_018133		135871094	135871094	-1	no_errors	ENST00000309993	ensembl	human	known	69_37n	frame_shift_del	113	27.22	43	DEL	1.000	-
OR14A2	388761	genome.wustl.edu	37	1	247886949	247886949	+	Missense_Mutation	SNP	T	T	C	rs36075193	byFrequency	TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr1:247886949T>C	ENST00000366485.1	-	1	396	c.397A>G	c.(397-399)Atc>Gtc	p.I133V	RP11-634B7.4_ENST00000449298.1_RNA|RP11-634B7.5_ENST00000426444.1_RNA			Q96R54	O14A2_HUMAN	olfactory receptor, family 14, subfamily A, member 2	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										GTATTCATGATTACCTCGTAG	0.468													T|||	189	0.0377396	0.0053	0.0476	5008	,	,		21772	0.001		0.1272	False		,,,				2504	0.0204					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB065620		1q44	2013-01-16	2008-04-02	2008-04-02	ENSG00000241128	ENSG00000241128		"""GPCR / Class A : Olfactory receptors"""	15024	other	unknown			"""olfactory receptor, family 5, subfamily AX, member 1 pseudogene"", ""olfactory receptor, family 5, subfamily AX, member 1"""	OR5AX1P, OR5AX1			Standard	NG_002409		Approved			Q96R54	OTTHUMG00000040207	ENST00000366485.1:c.397A>G	1.37:g.247886949T>C	ENSP00000355441:p.Ile133Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I133V	ENST00000366485.1	37	c.397		1	111	0.050824175824175824	4	0.008130081300813009	21	0.058011049723756904	1	0.0017482517482517483	85	0.11213720316622691	T	1.446	-0.566297	0.03910	.	.	ENSG00000241128	ENST00000366485	T	0.19669	2.13	3.18	0.633	0.17712	.	0.314707	0.23017	N	0.052889	T	0.00271	0.0008	.	.	.	0.09310	N	0.999992	.	.	.	.	.	.	T	0.24476	-1.0159	7	0.27785	T	0.31	.	5.1576	0.15044	0.1374:0.1898:0.0:0.6729	rs36075193	.	.	.	V	133	ENSP00000355441:I133V	ENSP00000355441:I133V	I	-	1	0	OR14A2	245953572	0.000000	0.05858	0.027000	0.17364	0.150000	0.21749	-0.517000	0.06275	-0.322000	0.08615	-1.139000	0.01908	ATC	OR14A2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000241128		0.468	OR14A2-001	KNOWN	basic|appris_principal	protein_coding	OR14A2	HGNC	protein_coding	OTTHUMT00000096864.1	11	0.00	0	T	NG_002409		247886949	247886949	-1	no_errors	ENST00000366485	ensembl	human	known	69_37n	missense	6	50.00	6	SNP	0.348	C
PAIP2	51247	genome.wustl.edu	37	5	138699536	138699536	+	Silent	SNP	C	C	T			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr5:138699536C>T	ENST00000394795.2	+	2	1054	c.63C>T	c.(61-63)aaC>aaT	p.N21N	PAIP2_ENST00000511381.1_Intron|PAIP2_ENST00000265192.4_Silent_p.N21N|PAIP2_ENST00000510080.1_Silent_p.N21N|CTB-43P18.1_ENST00000503553.3_RNA|PAIP2_ENST00000511706.1_Silent_p.N21N			Q9BPZ3	PAIP2_HUMAN	poly(A) binding protein interacting protein 2	21					memory (GO:0007613)|negative regulation of translational initiation (GO:0045947)|regulation of long-term synaptic potentiation (GO:1900271)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mRNA binding (GO:0003729)|translation repressor activity (GO:0030371)			kidney(1)|large_intestine(2)|lung(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TGATTATTAACGGTCATTCTC	0.363																																						dbGAP											0													136.0	118.0	124.0					5																	138699536		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF151052	CCDS4211.1	5q32	2008-02-05			ENSG00000120727	ENSG00000120727			17970	protein-coding gene	gene with protein product		605604				11172725, 16804161	Standard	NM_016480		Approved	PAIP2A	uc003led.3	Q9BPZ3	OTTHUMG00000129227	ENST00000394795.2:c.63C>T	5.37:g.138699536C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBI1|D3DQC6|Q49A06|Q9H0Y5|Q9P0Q8	Silent	SNP	pfam_Ataxin-2_C	p.N21	ENST00000394795.2	37	c.63	CCDS4211.1	5																																																																																			PAIP2	-	NULL	ENSG00000120727		0.363	PAIP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAIP2	HGNC	protein_coding	OTTHUMT00000373002.1	160	0.00	0	C	NM_016480		138699536	138699536	+1	no_errors	ENST00000265192	ensembl	human	known	69_37n	silent	190	31.29	87	SNP	0.996	T
PCDHB6	56130	genome.wustl.edu	37	5	140531214	140531214	+	Missense_Mutation	SNP	G	G	A	rs199646293		TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr5:140531214G>A	ENST00000231136.1	+	1	1376	c.1376G>A	c.(1375-1377)cGc>cAc	p.R459H	PCDHB6_ENST00000543635.1_Missense_Mutation_p.R323H	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	459	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGTTCGTCCGCGAGAACAAC	0.612																																						dbGAP											0													75.0	85.0	82.0					5																	140531214		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1376G>A	5.37:g.140531214G>A	ENSP00000231136:p.Arg459His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8R9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R459H	ENST00000231136.1	37	c.1376	CCDS4248.1	5	.	.	.	.	.	.	.	.	.	.	G	10.51	1.369532	0.24771	.	.	ENSG00000113211	ENST00000543635;ENST00000231136;ENST00000542861	T;T	0.01767	4.65;4.65	4.18	-1.53	0.08611	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01765	0.0056	L	0.48218	1.51	0.09310	N	1	B	0.24368	0.102	B	0.20767	0.031	T	0.46735	-0.9170	9	0.87932	D	0	.	1.468	0.02410	0.3071:0.237:0.3356:0.1202	.	459	Q9Y5E3	PCDB6_HUMAN	H	323;459;244	ENSP00000438466:R323H;ENSP00000231136:R459H	ENSP00000231136:R459H	R	+	2	0	PCDHB6	140511398	0.000000	0.05858	0.100000	0.21137	0.992000	0.81027	-1.965000	0.01511	-0.285000	0.09089	0.485000	0.47835	CGC	PCDHB6	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000113211		0.612	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	HGNC	protein_coding	OTTHUMT00000251818.2	68	0.00	0	G	NM_018939		140531214	140531214	+1	no_errors	ENST00000231136	ensembl	human	known	69_37n	missense	55	26.67	20	SNP	0.000	A
PIWIL1	9271	genome.wustl.edu	37	12	130833916	130833916	+	Silent	SNP	G	G	A			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr12:130833916G>A	ENST00000245255.3	+	8	1139	c.867G>A	c.(865-867)caG>caA	p.Q289Q		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	289	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TTTATCATCAGACAGAAGAAC	0.338																																						dbGAP											0													86.0	79.0	82.0					12																	130833916		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.867G>A	12.37:g.130833916G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Silent	SNP	pfam_Piwi,pfam_PAZ,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.Q289	ENST00000245255.3	37	c.867	CCDS9268.1	12																																																																																			PIWIL1	-	pfam_PAZ,superfamily_PAZ,smart_PAZ,pfscan_PAZ	ENSG00000125207		0.338	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	HGNC	protein_coding	OTTHUMT00000399510.1	187	0.00	0	G			130833916	130833916	+1	no_errors	ENST00000245255	ensembl	human	known	69_37n	silent	296	15.19	53	SNP	0.201	A
RPGR	6103	genome.wustl.edu	37	X	38182684	38182684	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chrX:38182684G>A	ENST00000339363.3	-	2	289	c.122C>T	c.(121-123)tCa>tTa	p.S41L	RPGR_ENST00000318842.7_Missense_Mutation_p.S41L|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000309513.3_Missense_Mutation_p.S41L|RPGR_ENST00000338898.3_Missense_Mutation_p.S41L|RPGR_ENST00000378505.2_Missense_Mutation_p.S41L|RPGR_ENST00000342811.3_Missense_Mutation_p.S41L			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	41					cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						ATCTCCACATGAAAGATGTAC	0.328																																						dbGAP											0			GRCh37	CM070257	RPGR	M							52.0	46.0	48.0					X																	38182684		2202	4298	6500	-	-	-	SO:0001583	missense	0			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.122C>T	X.37:g.38182684G>A	ENSP00000343671:p.Ser41Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.S41L	ENST00000339363.3	37	c.122		X	.	.	.	.	.	.	.	.	.	.	G	23.7	4.443109	0.83993	.	.	ENSG00000156313	ENST00000339363;ENST00000309513;ENST00000338898;ENST00000318842;ENST00000342811;ENST00000378505	D;D;D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52;-1.52;-1.52	5.6	5.6	0.85130	.	0.533184	0.18731	U	0.132740	D	0.90109	0.6910	M	0.80982	2.52	0.47183	D	0.999343	D;D	0.71674	0.998;0.969	D;P	0.67900	0.954;0.757	D	0.91059	0.4884	10	0.87932	D	0	.	18.2261	0.89917	0.0:0.0:1.0:0.0	.	41;41	E9PE28;Q92834-2	.;.	L	41	ENSP00000343671:S41L;ENSP00000308783:S41L;ENSP00000340208:S41L;ENSP00000322219:S41L;ENSP00000339531:S41L;ENSP00000367766:S41L	ENSP00000308783:S41L	S	-	2	0	RPGR	38067628	1.000000	0.71417	0.974000	0.42286	0.651000	0.38670	6.121000	0.71602	2.342000	0.79632	0.513000	0.50165	TCA	RPGR	-	superfamily_Reg_csome_cond/b-lactamase_inh	ENSG00000156313		0.328	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	HGNC	protein_coding		146	0.00	0	G	NM_000328		38182684	38182684	-1	no_errors	ENST00000378505	ensembl	human	known	69_37n	missense	206	31.00	93	SNP	1.000	A
SLC9A4	389015	genome.wustl.edu	37	2	103120013	103120013	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr2:103120013G>T	ENST00000295269.4	+	3	1284	c.827G>T	c.(826-828)gGa>gTa	p.G276V		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	276					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GTGGGGCTTGGAGGGGTATTG	0.393																																						dbGAP											0													340.0	320.0	327.0					2																	103120013		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.827G>T	2.37:g.103120013G>T	ENSP00000295269:p.Gly276Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YK0	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_NaH_exchanger,prints_Na/H_exchanger_2,tigrfam_NaH_exchanger	p.G276V	ENST00000295269.4	37	c.827	CCDS33264.1	2	.	.	.	.	.	.	.	.	.	.	G	17.86	3.493358	0.64186	.	.	ENSG00000180251	ENST00000295269	T	0.17854	2.25	5.48	5.48	0.80851	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.49490	0.1560	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.54503	-0.8284	10	0.87932	D	0	.	19.7173	0.96127	0.0:0.0:1.0:0.0	.	276	Q6AI14	SL9A4_HUMAN	V	276	ENSP00000295269:G276V	ENSP00000295269:G276V	G	+	2	0	SLC9A4	102486445	1.000000	0.71417	0.987000	0.45799	0.043000	0.13939	9.813000	0.99286	2.724000	0.93272	0.563000	0.77884	GGA	SLC9A4	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000180251		0.393	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A4	HGNC	protein_coding	OTTHUMT00000329498.1	613	0.00	0	G	NM_001011552.3		103120013	103120013	+1	no_errors	ENST00000295269	ensembl	human	known	69_37n	missense	616	11.11	77	SNP	1.000	T
TADA1	117143	genome.wustl.edu	37	1	166839061	166839061	+	Silent	SNP	C	C	T			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr1:166839061C>T	ENST00000367874.4	-	2	198	c.105G>A	c.(103-105)aaG>aaA	p.K35K		NM_053053.3	NP_444281.1	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1	35					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	11						TGATCTTCTGCTTGAACCACA	0.368																																						dbGAP											0													120.0	122.0	121.0					1																	166839061		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC015401	CCDS1255.1	1q24.1	2009-10-02	2009-10-02	2009-10-02	ENSG00000152382	ENSG00000152382			30631	protein-coding gene	gene with protein product		612763	"""transcriptional adaptor 1 (HFI1 homolog, yeast)-like"", ""transcriptional adaptor 1 (HFI1 homolog, yeast)"""	TADA1L		11564863	Standard	NM_053053		Approved	STAF42, ADA1, hADA1, HFI1	uc001gdw.3	Q96BN2	OTTHUMG00000034321	ENST00000367874.4:c.105G>A	1.37:g.166839061C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4J9	Silent	SNP	superfamily_Histone-fold	p.K35	ENST00000367874.4	37	c.105	CCDS1255.1	1																																																																																			TADA1	-	NULL	ENSG00000152382		0.368	TADA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA1	HGNC	protein_coding	OTTHUMT00000082881.1	165	0.00	0	C	NM_053053		166839061	166839061	-1	no_errors	ENST00000367874	ensembl	human	known	69_37n	silent	351	18.75	81	SNP	1.000	T
TBC1D3B	414059	genome.wustl.edu	37	17	34497337	34497337	+	Silent	SNP	G	G	A	rs544067162	byFrequency	TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr17:34497337G>A	ENST00000454519.3	-	9	728	c.579C>T	c.(577-579)atC>atT	p.I193I	TBC1D3B_ENST00000398801.3_Silent_p.I193I|CTB-91J4.1_ENST00000592460.1_RNA	NM_001001417.5	NP_001001417.5	A6NDS4	TBC3B_HUMAN	TBC1 domain family, member 3B	193	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|lung(3)|pancreas(1)	6		Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACAAGGCGGCGATGTGGCTCA	0.592													g|||	13	0.00259585	0.0	0.0	5008	,	,		18086	0.0		0.003	False		,,,				2504	0.0102					dbGAP											0													13.0	10.0	11.0					17																	34497337		1147	2360	3507	-	-	-	SO:0001819	synonymous_variant	0			AF540953	CCDS42300.1	17q12	2014-09-16				ENSG00000274226			27011	protein-coding gene	gene with protein product		610144	"""TBC1 domain family, member 3I"""	TBC1D3I		12359748, 16863688	Standard	XM_005257980		Approved	PRC17	uc002hky.2	A6NDS4	OTTHUMG00000188417	ENST00000454519.3:c.579C>T	17.37:g.34497337G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K892	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.I193	ENST00000454519.3	37	c.579	CCDS42300.1	17																																																																																			TBC1D3B	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000224226		0.592	TBC1D3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D3B	HGNC	protein_coding	OTTHUMT00000256087.3	61	0.00	0	G	NM_001001417		34497337	34497337	-1	no_errors	ENST00000398801	ensembl	human	known	69_37n	silent	31	35.42	17	SNP	1.000	A
WNK3	65267	genome.wustl.edu	37	X	54337552	54337552	+	Splice_Site	SNP	G	G	A			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chrX:54337552G>A	ENST00000375159.2	-	2	709	c.710C>T	c.(709-711)aCg>aTg	p.T237M	WNK3_ENST00000375169.3_Splice_Site_p.T237M|WNK3_ENST00000354646.2_Splice_Site_p.T237M			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	237	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						GTCAACTTACGTCTTTAAGGT	0.294																																						dbGAP											0													80.0	70.0	73.0					X																	54337552		2202	4300	6502	-	-	-	SO:0001630	splice_region_variant	0			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.710+1C>T	X.37:g.54337552G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T237M	ENST00000375159.2	37	c.710	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	G	24.3	4.520887	0.85495	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.25579	1.79;1.79;1.79	5.56	5.56	0.83823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000007	T	0.40222	0.1108	L	0.34521	1.04	0.58432	D	0.999995	D;D	0.76494	0.997;0.999	D;D	0.70716	0.93;0.97	T	0.06409	-1.0828	9	.	.	.	-4.9838	17.3869	0.87418	0.0:0.0:1.0:0.0	.	237;237	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	M	237	ENSP00000364312:T237M;ENSP00000346667:T237M;ENSP00000364301:T237M	.	T	-	2	0	WNK3	54354277	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.756000	0.98918	2.461000	0.83175	0.594000	0.82650	ACG	WNK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000196632		0.294	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	253	0.00	0	G	NM_020922	Missense_Mutation	54337552	54337552	-1	no_errors	ENST00000354646	ensembl	human	known	69_37n	missense	282	40.76	194	SNP	1.000	A
ZDHHC15	158866	genome.wustl.edu	37	X	74637024	74637024	+	Splice_Site	SNP	G	G	T			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chrX:74637024G>T	ENST00000373367.3	-	10	1095	c.865C>A	c.(865-867)Cct>Act	p.P289T	ZDHHC15_ENST00000373361.3_3'UTR|ZDHHC15_ENST00000541184.1_Splice_Site_p.P280T	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15	289					establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						CCATCACCAGGGCTGATGGGA	0.448																																						dbGAP											0													164.0	136.0	146.0					X																	74637024		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.864-1C>A	X.37:g.74637024G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVG7|Q3SY30|Q6UWH3	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.P289T	ENST00000373367.3	37	c.865	CCDS14430.1	X	.	.	.	.	.	.	.	.	.	.	G	11.74	1.729386	0.30684	.	.	ENSG00000102383	ENST00000373367;ENST00000541184	T;T	0.47528	0.84;1.06	5.43	5.43	0.79202	.	0.420915	0.24474	N	0.038216	T	0.32496	0.0831	N	0.16708	0.43	0.80722	D	1	B;B	0.32051	0.133;0.354	B;B	0.30716	0.119;0.119	T	0.12451	-1.0547	10	0.15499	T	0.54	-2.3873	16.7653	0.85522	0.0:0.0:1.0:0.0	.	280;289	B3KVG7;Q96MV8	.;ZDH15_HUMAN	T	289;280	ENSP00000362465:P289T;ENSP00000445420:P280T	ENSP00000362465:P289T	P	-	1	0	ZDHHC15	74553749	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	5.173000	0.65010	2.268000	0.75426	0.513000	0.50165	CCT	ZDHHC15	-	NULL	ENSG00000102383		0.448	ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC15	HGNC	protein_coding	OTTHUMT00000057283.1	314	0.00	0	G	NM_144969	Missense_Mutation	74637024	74637024	-1	no_errors	ENST00000373367	ensembl	human	known	69_37n	missense	349	29.23	145	SNP	1.000	T
ZHX1	11244	genome.wustl.edu	37	8	124265786	124265786	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A107-01A-11D-A10M-09	TCGA-E2-A107-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5804fc1c-063b-429d-a652-22b0de416bd6	1a964b4a-8d09-4ea3-8d10-65e252cf0ab2	g.chr8:124265786C>T	ENST00000522655.1	-	3	2941	c.2401G>A	c.(2401-2403)Gat>Aat	p.D801N	ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000395571.3_Missense_Mutation_p.D801N|ZHX1_ENST00000522595.1_5'Flank|ZHX1_ENST00000297857.2_Missense_Mutation_p.D801N			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	801					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			ACAAGTTCATCAAGGTCTTGC	0.378																																						dbGAP											0													185.0	185.0	185.0					8																	124265786		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.2401G>A	8.37:g.124265786C>T	ENSP00000428821:p.Asp801Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWD8	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.D801N	ENST00000522655.1	37	c.2401	CCDS6342.1	8	.	.	.	.	.	.	.	.	.	.	C	28.0	4.878197	0.91664	.	.	ENSG00000165156	ENST00000297857;ENST00000395571;ENST00000522655	T;T;T	0.25250	1.81;1.81;1.81	6.04	6.04	0.98038	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.56514	0.1990	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.55535	-0.8126	9	0.66056	D	0.02	-23.6795	20.5792	0.99380	0.0:1.0:0.0:0.0	.	801	Q9UKY1	ZHX1_HUMAN	N	801	ENSP00000297857:D801N;ENSP00000378938:D801N;ENSP00000428821:D801N	ENSP00000297857:D801N	D	-	1	0	ZHX1	124334967	1.000000	0.71417	0.990000	0.47175	0.985000	0.73830	7.294000	0.78760	2.873000	0.98535	0.561000	0.74099	GAT	ZHX1	-	superfamily_Homeodomain-like,smart_Homeodomain	ENSG00000165156		0.378	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZHX1	HGNC	protein_coding	OTTHUMT00000381759.1	225	0.00	0	C			124265786	124265786	-1	no_errors	ENST00000297857	ensembl	human	known	69_37n	missense	317	12.33	45	SNP	1.000	T
