#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA3	21	genome.wustl.edu	37	16	2336827	2336827	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:2336827G>A	ENST00000301732.5	-	22	3846	c.3146C>T	c.(3145-3147)tCt>tTt	p.S1049F	ABCA3_ENST00000382381.3_Missense_Mutation_p.S991F	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1049					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	AGTGGCTGGAGAGTGGTACGC	0.627																																						dbGAP											0													115.0	112.0	113.0					16																	2336827		2198	4300	6498	-	-	-	SO:0001583	missense	0			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.3146C>T	16.37:g.2336827G>A	ENSP00000301732:p.Ser1049Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S1049F	ENST00000301732.5	37	c.3146	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	G	13.56	2.275040	0.40194	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.88201	-2.35	4.74	4.74	0.60224	.	0.222738	0.47852	D	0.000206	D	0.93752	0.8003	M	0.77486	2.375	0.80722	D	1	D;D	0.55605	0.972;0.967	P;D	0.63381	0.877;0.914	D	0.94411	0.7632	10	0.87932	D	0	.	16.8918	0.86089	0.0:0.0:1.0:0.0	.	1053;1049	Q4LE27;Q99758	.;ABCA3_HUMAN	F	1049;1053	ENSP00000301732:S1049F	ENSP00000301732:S1049F	S	-	2	0	ABCA3	2276828	1.000000	0.71417	0.988000	0.46212	0.038000	0.13279	9.084000	0.94076	2.632000	0.89209	0.650000	0.86243	TCT	ABCA3	-	NULL	ENSG00000167972		0.627	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	9	0.00	0	G	NM_001089		2336827	2336827	-1	no_errors	ENST00000301732	ensembl	human	known	69_37n	missense	83	34.65	44	SNP	1.000	A
ABCD1	215	genome.wustl.edu	37	X	153001904	153001904	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:153001904C>T	ENST00000218104.3	+	4	1729	c.1330C>T	c.(1330-1332)Cag>Tag	p.Q444*	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	444					alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGAGGACGCTCAGGCGGGGTC	0.627																																						dbGAP											0			GRCh37	CM050980	ABCD1	M							89.0	78.0	82.0					X																	153001904		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1330C>T	X.37:g.153001904C>T	ENSP00000218104:p.Gln444*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GTZ2	Nonsense_Mutation	SNP	pfam_ABC_Ald_N,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_FA_transporter	p.Q444*	ENST00000218104.3	37	c.1330	CCDS14728.1	X	.	.	.	.	.	.	.	.	.	.	c	13.59	2.283314	0.40394	.	.	ENSG00000101986	ENST00000218104	.	.	.	4.7	4.7	0.59300	.	0.755923	0.11836	N	0.524761	.	.	.	.	.	.	0.21355	N	0.999714	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-8.2443	11.7806	0.52013	0.0:0.8262:0.1738:0.0	.	.	.	.	X	444	.	ENSP00000218104:Q444X	Q	+	1	0	ABCD1	152655098	0.019000	0.18553	0.023000	0.16930	0.374000	0.29953	1.713000	0.37951	2.065000	0.61736	0.519000	0.50382	CAG	ABCD1	-	tigrfam_FA_transporter	ENSG00000101986		0.627	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD1	HGNC	protein_coding	OTTHUMT00000061041.1	33	0.00	0	C	NM_000033		153001904	153001904	+1	no_errors	ENST00000218104	ensembl	human	known	69_37n	nonsense	77	25.96	27	SNP	0.010	T
ABHD4	63874	genome.wustl.edu	37	14	23072319	23072319	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr14:23072319G>A	ENST00000428304.2	+	3	207	c.137G>A	c.(136-138)aGa>aAa	p.R46K	ABHD4_ENST00000544562.1_3'UTR	NM_022060.2	NP_071343.2	Q8TB40	ABHD4_HUMAN	abhydrolase domain containing 4	46					lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(3)|prostate(1)	14	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0153)		TTCCTGGCCAGATATGTATCC	0.517																																						dbGAP											0													47.0	44.0	45.0					14																	23072319		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK022878	CCDS9572.1	14q11.1	2006-10-06			ENSG00000100439	ENSG00000100439		"""Abhydrolase domain containing"""	20154	protein-coding gene	gene with protein product							Standard	NM_022060		Approved	FLJ12816	uc001wgm.3	Q8TB40	OTTHUMG00000028686	ENST00000428304.2:c.137G>A	14.37:g.23072319G>A	ENSP00000414558:p.Arg46Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDH7|Q9H9E0	Missense_Mutation	SNP	pfam_AB_hydrolase_1,prints_AB_hydrolase_1	p.R46K	ENST00000428304.2	37	c.137	CCDS9572.1	14	.	.	.	.	.	.	.	.	.	.	G	15.58	2.874549	0.51695	.	.	ENSG00000100439	ENST00000428304;ENST00000542041	D;T	0.84298	-1.83;3.73	5.6	5.6	0.85130	.	0.060100	0.64402	D	0.000003	T	0.71213	0.3313	N	0.16166	0.38	0.41967	D	0.990735	B;B	0.15141	0.012;0.001	B;B	0.11329	0.006;0.004	T	0.65496	-0.6154	10	0.16420	T	0.52	-8.1529	10.5338	0.44992	0.0871:0.0:0.9129:0.0	.	46;46	B4DNZ5;Q8TB40	.;ABHD4_HUMAN	K	46;22	ENSP00000414558:R46K;ENSP00000437385:R22K	ENSP00000388751:R46K	R	+	2	0	ABHD4	22142159	0.601000	0.26907	1.000000	0.80357	0.915000	0.54546	2.357000	0.44125	2.644000	0.89710	0.655000	0.94253	AGA	ABHD4	-	NULL	ENSG00000100439		0.517	ABHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD4	HGNC	protein_coding	OTTHUMT00000071623.3	34	0.00	0	G			23072319	23072319	+1	no_errors	ENST00000428304	ensembl	human	known	69_37n	missense	59	15.71	11	SNP	0.954	A
ABI3	51225	genome.wustl.edu	37	17	47299506	47299506	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:47299506G>C	ENST00000225941.1	+	7	1354	c.856G>C	c.(856-858)Gat>Cat	p.D286H	ABI3_ENST00000419580.2_Missense_Mutation_p.D280H	NM_001135186.1|NM_016428.2	NP_001128658.1|NP_057512	Q9P2A4	ABI3_HUMAN	ABI family, member 3	286	Pro-rich.				cellular component movement (GO:0006928)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|membrane (GO:0016020)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	12			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			CCTGGATGGAGATGAATTGGG	0.592										HNSCC(55;0.14)																												dbGAP											0													92.0	92.0	92.0					17																	47299506		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037886	CCDS11546.1, CCDS45725.1	17q21.3	2011-03-04	2008-09-12		ENSG00000108798	ENSG00000108798			29859	protein-coding gene	gene with protein product		606363				10978530, 11956071	Standard	NM_001135186		Approved	NESH, SSH3BP3	uc002iop.1	Q9P2A4	OTTHUMG00000161306	ENST00000225941.1:c.856G>C	17.37:g.47299506G>C	ENSP00000225941:p.Asp286His	Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZN8|Q9H0P6	Missense_Mutation	SNP	pfam_Abl-interactor_HHR_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.D286H	ENST00000225941.1	37	c.856	CCDS11546.1	17	.	.	.	.	.	.	.	.	.	.	G	14.09	2.433051	0.43224	.	.	ENSG00000108798	ENST00000225941;ENST00000419580	T;T	0.11063	2.81;2.83	4.93	3.96	0.45880	.	0.572588	0.16427	N	0.214910	T	0.10981	0.0268	N	0.04508	-0.205	0.37668	D	0.923022	D;D	0.63046	0.992;0.987	P;P	0.60473	0.875;0.753	T	0.38222	-0.9671	10	0.35671	T	0.21	-11.065	10.0297	0.42092	0.0948:0.0:0.9052:0.0	.	280;286	Q9P2A4-2;Q9P2A4	.;ABI3_HUMAN	H	286;280	ENSP00000225941:D286H;ENSP00000406651:D280H	ENSP00000225941:D286H	D	+	1	0	ABI3	44654505	0.010000	0.17322	0.085000	0.20634	0.680000	0.39746	1.358000	0.34102	1.082000	0.41137	0.456000	0.33151	GAT	ABI3	-	NULL	ENSG00000108798		0.592	ABI3-001	KNOWN	basic|CCDS	protein_coding	ABI3	HGNC	protein_coding	OTTHUMT00000364475.1	26	0.00	0	G	NM_016428		47299506	47299506	+1	no_errors	ENST00000225941	ensembl	human	known	69_37n	missense	61	24.69	20	SNP	0.776	C
ACBD5	91452	genome.wustl.edu	37	10	27486360	27486360	+	Nonstop_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:27486360C>G	ENST00000375888.1	-	13	1668	c.1604G>C	c.(1603-1605)tGa>tCa	p.*535S	ACBD5_ENST00000396271.3_Nonstop_Mutation_p.*526S|ACBD5_ENST00000375905.4_Nonstop_Mutation_p.*491S|ACBD5_ENST00000375901.1_Nonstop_Mutation_p.*417S|ACBD5_ENST00000375897.3_Nonstop_Mutation_p.*349S			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	0					peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						CCATTTTCCTCAGTTCAGTTT	0.313																																						dbGAP											0													90.0	79.0	83.0					10																	27486360		2203	4300	6503	-	-	-	SO:0001578	stop_lost	0			AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.1604G>C	10.37:g.27486360C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Nonstop_Mutation	SNP	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein,pirsf_M-assoc_diazepam-bd-inh,prints_Acyl-CoA-binding_protein	p.*535S	ENST00000375888.1	37	c.1604		10	.	.	.	.	.	.	.	.	.	.	C	15.44	2.835292	0.50951	.	.	ENSG00000107897	ENST00000375889;ENST00000396271;ENST00000375905;ENST00000375901;ENST00000375897;ENST00000375888	.	.	.	5.86	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0555	0.53533	0.0:0.9201:0.0:0.0799	.	.	.	.	S	532;526;491;417;349;535	.	.	X	-	2	2	ACBD5	27526366	1.000000	0.71417	0.998000	0.56505	0.848000	0.48234	1.801000	0.38843	1.488000	0.48433	0.650000	0.86243	TGA	ACBD5	-	NULL	ENSG00000107897		0.313	ACBD5-005	KNOWN	basic	protein_coding	ACBD5	HGNC	protein_coding	OTTHUMT00000047314.1	158	0.00	0	C	NM_145698		27486360	27486360	-1	no_errors	ENST00000375888	ensembl	human	known	69_37n	nonstop	144	16.18	28	SNP	1.000	G
ACTG2	72	genome.wustl.edu	37	2	74141897	74141897	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:74141897C>T	ENST00000409624.1	+	8	1347	c.704C>T	c.(703-705)tCc>tTc	p.S235F	ACTG2_ENST00000409731.3_Missense_Mutation_p.S192F|ACTG2_ENST00000345517.3_Missense_Mutation_p.S235F			P63267	ACTH_HUMAN	actin, gamma 2, smooth muscle, enteric	235					muscle contraction (GO:0006936)	blood microparticle (GO:0072562)|cell periphery (GO:0071944)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			large_intestine(3)|lung(14)|skin(1)	18						GCTTCCTCTTCCTCCCTGGAG	0.527																																						dbGAP											0													78.0	74.0	76.0					2																	74141897		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1930.1, CCDS56124.1	2p13.1	2008-05-20			ENSG00000163017	ENSG00000163017			145	protein-coding gene	gene with protein product		102545		ACTL3, ACTA3		1710027, 1673027	Standard	NM_001199893		Approved	ACTSG	uc002sjw.3	P63267	OTTHUMG00000129813	ENST00000409624.1:c.704C>T	2.37:g.74141897C>T	ENSP00000386857:p.Ser235Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7E7|B4E315|D6W5H8|E9PG30|P12718|Q504R1|Q6FI22	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.S235F	ENST00000409624.1	37	c.704	CCDS1930.1	2	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573209	0.65765	.	.	ENSG00000163017	ENST00000409731;ENST00000345517;ENST00000409624	D;D;D	0.97850	-4.57;-4.57;-4.57	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	D	0.99177	0.9715	H	0.96208	3.785	0.53688	D	0.999977	P;P	0.47545	0.897;0.894	D;D	0.79784	0.943;0.993	D	0.98786	1.0734	10	0.87932	D	0	.	16.6898	0.85318	0.0:1.0:0.0:0.0	.	192;235	E9PG30;P63267	.;ACTH_HUMAN	F	192;235;235	ENSP00000386929:S192F;ENSP00000295137:S235F;ENSP00000386857:S235F	ENSP00000295137:S235F	S	+	2	0	ACTG2	73995405	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.574000	0.82434	2.538000	0.85594	0.462000	0.41574	TCC	ACTG2	-	pfam_Actin-like,smart_Actin-like	ENSG00000163017		0.527	ACTG2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACTG2	HGNC	protein_coding	OTTHUMT00000328086.1	38	0.00	0	C	NM_001615		74141897	74141897	+1	no_errors	ENST00000345517	ensembl	human	known	69_37n	missense	69	19.77	17	SNP	1.000	T
ADAM33	80332	genome.wustl.edu	37	20	3655266	3655266	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr20:3655266G>C	ENST00000356518.2	-	6	726	c.485C>G	c.(484-486)tCa>tGa	p.S162*	ADAM33_ENST00000466620.1_5'Flank|ADAM33_ENST00000379861.4_Nonsense_Mutation_p.S162*|ADAM33_ENST00000350009.2_Nonsense_Mutation_p.S162*	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	162					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						CTCGTGGGTTGAGAAGTCCTT	0.607																																						dbGAP											0													84.0	96.0	92.0					20																	3655266		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.485C>G	20.37:g.3655266G>C	ENSP00000348912:p.Ser162*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Nonsense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.S162*	ENST00000356518.2	37	c.485	CCDS13058.1	20	.	.	.	.	.	.	.	.	.	.	G	35	5.595891	0.96602	.	.	ENSG00000149451	ENST00000356518;ENST00000379861;ENST00000350009;ENST00000439201	.	.	.	4.98	-0.957	0.10350	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	5.3158	0.15854	0.3677:0.1541:0.4781:0.0	.	.	.	.	X	162	.	ENSP00000322550:S162X	S	-	2	0	ADAM33	3603266	0.001000	0.12720	0.003000	0.11579	0.671000	0.39405	0.307000	0.19296	-0.172000	0.10779	0.655000	0.94253	TCA	ADAM33	-	pfam_Peptidase_M12B_N	ENSG00000149451		0.607	ADAM33-001	KNOWN	basic|CCDS	protein_coding	ADAM33	HGNC	protein_coding	OTTHUMT00000077763.2	22	0.00	0	G	NM_025220		3655266	3655266	-1	no_errors	ENST00000356518	ensembl	human	known	69_37n	nonsense	39	26.42	14	SNP	0.006	C
AGAP3	116988	genome.wustl.edu	37	7	150813883	150813883	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:150813883C>T	ENST00000397238.2	+	2	335	c.335C>T	c.(334-336)tCg>tTg	p.S112L	AGAP3_ENST00000473312.1_Missense_Mutation_p.S112L|AGAP3_ENST00000335367.3_Missense_Mutation_p.S292L|AGAP3_ENST00000476375.1_3'UTR|AGAP3_ENST00000463381.1_5'UTR|AGAP3_ENST00000479901.1_Missense_Mutation_p.S112L	NM_031946.4	NP_114152.3	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	76	Small GTPase-like.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						TCCGCAGACTCGTTTGTGAAC	0.657																																						dbGAP											0													64.0	71.0	69.0					7																	150813883		2156	4269	6425	-	-	-	SO:0001583	missense	0			AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000397238.2:c.335C>T	7.37:g.150813883C>T	ENSP00000380413:p.Ser112Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Pleckstrin_homology,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.S112L	ENST00000397238.2	37	c.335	CCDS43681.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.5|24.5	4.534294|4.534294	0.85812|0.85812	.|.	.|.	ENSG00000133612|ENSG00000133612	ENST00000469901|ENST00000473312;ENST00000479901;ENST00000397238;ENST00000335355;ENST00000335367	.|D;D;T;D	.|0.87729	.|-2.12;-2.29;-0.52;-2.12	4.07|4.07	4.07|4.07	0.47477|0.47477	.|.	.|0.087499	.|0.47852	.|N	.|0.000220	D|D	0.88411|0.88411	0.6429|0.6429	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	.|D;D;P;D	.|0.57571	.|0.98;0.977;0.876;0.973	.|B;P;B;P	.|0.50270	.|0.296;0.636;0.241;0.449	D|D	0.90315|0.90315	0.4340|0.4340	5|10	.|0.87932	.|D	.|0	.|.	15.4575|15.4575	0.75327|0.75327	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|112;292;112;112	.|C9J975;E7ESL9;Q96P47-4;E9PAL8	.|.;.;.;.	C|L	48|112;112;112;76;292	.|ENSP00000418921:S112L;ENSP00000418125:S112L;ENSP00000380413:S112L;ENSP00000335589:S292L	.|ENSP00000334157:S76L	R|S	+|+	1|2	0|0	AGAP3|AGAP3	150444816|150444816	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.976000|0.976000	0.68499|0.68499	6.941000|6.941000	0.75922|0.75922	2.123000|2.123000	0.65237|0.65237	0.400000|0.400000	0.26472|0.26472	CGT|TCG	AGAP3	-	NULL	ENSG00000133612		0.657	AGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP3	HGNC	protein_coding	OTTHUMT00000351908.3	9	0.00	0	C	NM_031946		150813883	150813883	+1	no_errors	ENST00000397238	ensembl	human	known	69_37n	missense	31	27.91	12	SNP	1.000	T
AHNAK2	113146	genome.wustl.edu	37	14	105410836	105410836	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr14:105410836G>A	ENST00000333244.5	-	7	11071	c.10952C>T	c.(10951-10953)tCg>tTg	p.S3651L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3651						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCCTGGGGCCGATACCCTGAA	0.587																																						dbGAP											0													178.0	190.0	186.0					14																	105410836		1989	4151	6140	-	-	-	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.10952C>T	14.37:g.105410836G>A	ENSP00000353114:p.Ser3651Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S3651L	ENST00000333244.5	37	c.10952	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	g	14.93	2.682338	0.47991	.	.	ENSG00000185567	ENST00000333244	T	0.00730	5.77	3.77	3.77	0.43336	.	.	.	.	.	T	0.02047	0.0064	M	0.92507	3.315	0.09310	N	1	P	0.47910	0.902	B	0.38683	0.279	T	0.40478	-0.9561	9	0.36615	T	0.2	.	11.5036	0.50451	0.0918:0.0:0.9082:0.0	.	3651	Q8IVF2	AHNK2_HUMAN	L	3651	ENSP00000353114:S3651L	ENSP00000353114:S3651L	S	-	2	0	AHNAK2	104481881	0.008000	0.16893	0.005000	0.12908	0.001000	0.01503	-1.985000	0.01485	1.946000	0.56461	0.491000	0.48974	TCG	AHNAK2	-	NULL	ENSG00000185567		0.587	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	127	0.00	0	G	NM_138420		105410836	105410836	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	missense	156	17.02	32	SNP	0.099	A
AHNAK2	113146	genome.wustl.edu	37	14	105418953	105418953	+	Silent	SNP	C	C	G	rs538798371		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr14:105418953C>G	ENST00000333244.5	-	7	2954	c.2835G>C	c.(2833-2835)ctG>ctC	p.L945L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	945						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.L945L(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGGGGCCTTTCAGGTCCAGCT	0.602																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											137.0	159.0	152.0					14																	105418953		1873	4097	5970	-	-	-	SO:0001819	synonymous_variant	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.2835G>C	14.37:g.105418953C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L945	ENST00000333244.5	37	c.2835	CCDS45177.1	14																																																																																			AHNAK2	-	NULL	ENSG00000185567		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	119	0.00	0	C	NM_138420		105418953	105418953	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	silent	157	21.50	43	SNP	0.010	G
AKR1B15	441282	genome.wustl.edu	37	7	134260625	134260625	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:134260625C>T	ENST00000457545.2	+	8	949	c.689C>T	c.(688-690)tCc>tTc	p.S230F	AKR1B15_ENST00000423958.1_Missense_Mutation_p.S202F	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	230							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						TACTGCCACTCCAAGGGCATC	0.527																																						dbGAP											0													99.0	79.0	86.0					7																	134260625		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.689C>T	7.37:g.134260625C>T	ENSP00000389289:p.Ser230Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J3V2	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.S202F	ENST00000457545.2	37	c.605	CCDS47715.2	7	.	.	.	.	.	.	.	.	.	.	C	17.68	3.449004	0.63178	.	.	ENSG00000227471	ENST00000457545;ENST00000423958	T;T	0.25414	1.8;1.8	3.87	3.87	0.44632	NADP-dependent oxidoreductase domain (3);	.	.	.	.	T	0.52108	0.1714	M	0.82630	2.6	0.58432	D	0.999999	D;D	0.63880	0.977;0.993	P;D	0.67548	0.827;0.952	T	0.61931	-0.6961	9	0.87932	D	0	.	14.5989	0.68427	0.0:1.0:0.0:0.0	.	202;230	C9JRZ8-2;C9JRZ8	.;AK1BF_HUMAN	F	230;202	ENSP00000389289:S230F;ENSP00000397009:S202F	ENSP00000397009:S202F	S	+	2	0	AKR1B15	133911165	1.000000	0.71417	0.989000	0.46669	0.696000	0.40369	7.089000	0.76909	1.981000	0.57761	0.537000	0.68136	TCC	AKR1B15	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	ENSG00000227471		0.527	AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	AKR1B15	HGNC	protein_coding	OTTHUMT00000339726.2	82	0.00	0	C			134260625	134260625	+1	no_errors	ENST00000423958	ensembl	human	known	69_37n	missense	140	17.16	29	SNP	1.000	T
ANXA3	306	genome.wustl.edu	37	4	79522719	79522719	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr4:79522719G>C	ENST00000264908.6	+	11	1165	c.786G>C	c.(784-786)ttG>ttC	p.L262F	ANXA3_ENST00000512884.1_Missense_Mutation_p.L223F|ANXA3_ENST00000503570.2_Missense_Mutation_p.L223F	NM_005139.2	NP_005130.1	P12429	ANXA3_HUMAN	annexin A3	262					defense response to bacterium (GO:0042742)|neutrophil degranulation (GO:0043312)|phagocytosis (GO:0006909)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						ATCGAGCCTTGAAGGTTGGTC	0.368																																					GBM(2;126 157 27790 28920 42492)	dbGAP											0													128.0	120.0	123.0					4																	79522719		2203	4300	6503	-	-	-	SO:0001583	missense	0			M63310	CCDS3584.1	4q21.21	2009-07-10			ENSG00000138772	ENSG00000138772	3.1.4.43	"""Annexins"""	541	protein-coding gene	gene with protein product		106490		ANX3		1830024	Standard	XM_005262973		Approved		uc003hld.3	P12429	OTTHUMG00000130198	ENST00000264908.6:c.786G>C	4.37:g.79522719G>C	ENSP00000264908:p.Leu262Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9W6|Q6LET2	Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinIII	p.L262F	ENST00000264908.6	37	c.786	CCDS3584.1	4	.	.	.	.	.	.	.	.	.	.	G	16.74	3.205944	0.58234	.	.	ENSG00000138772	ENST00000264908;ENST00000512884;ENST00000503570	T;T;T	0.13089	2.62;2.62;2.62	5.21	3.35	0.38373	.	0.059184	0.64402	D	0.000004	T	0.18841	0.0452	L	0.43554	1.36	0.44261	D	0.997115	D	0.54397	0.966	P	0.55749	0.783	T	0.01524	-1.1333	10	0.87932	D	0	.	5.3351	0.15953	0.2017:0.1633:0.635:0.0	.	262	P12429	ANXA3_HUMAN	F	262;223;223	ENSP00000264908:L262F;ENSP00000423068:L223F;ENSP00000421015:L223F	ENSP00000264908:L262F	L	+	3	2	ANXA3	79741743	1.000000	0.71417	0.998000	0.56505	0.486000	0.33341	3.285000	0.51716	0.659000	0.30945	0.585000	0.79938	TTG	ANXA3	-	pfam_Annexin_repeat,superfamily_Annexin,prints_Annexin	ENSG00000138772		0.368	ANXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA3	HGNC	protein_coding	OTTHUMT00000252516.3	211	0.00	0	G	NM_005139		79522719	79522719	+1	no_errors	ENST00000264908	ensembl	human	known	69_37n	missense	164	23.72	51	SNP	1.000	C
APOBR	55911	genome.wustl.edu	37	16	28508304	28508304	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:28508304G>A	ENST00000431282.1	+	3	1925	c.1915G>A	c.(1915-1917)Gag>Aag	p.E639K	CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000564831.1_Missense_Mutation_p.E648K|APOBR_ENST00000328423.5_Missense_Mutation_p.E639K|CLN3_ENST00000567160.1_5'Flank			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	639	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						CGAGCAGCGGGAGGAGGAGGA	0.637																																						dbGAP											0													13.0	16.0	15.0					16																	28508304		2070	4205	6275	-	-	-	SO:0001583	missense	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1915G>A	16.37:g.28508304G>A	ENSP00000416094:p.Glu639Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	NULL	p.E648K	ENST00000431282.1	37	c.1942		16	.	.	.	.	.	.	.	.	.	.	G	12.68	2.009611	0.35415	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.61040	0.14;0.14	4.99	-0.777	0.10981	.	.	.	.	.	T	0.35537	0.0935	N	0.20986	0.625	0.09310	N	1	B;B	0.27229	0.172;0.172	B;B	0.27887	0.048;0.084	T	0.22277	-1.0221	9	0.17832	T	0.49	.	5.1229	0.14869	0.3836:0.1622:0.4542:0.0	.	639;639	Q0VD83;Q9NS13	APOBR_HUMAN;.	K	639	ENSP00000327669:E639K;ENSP00000416094:E639K	ENSP00000327669:E639K	E	+	1	0	APOBR	28415805	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.247000	0.18179	-0.035000	0.13691	-0.224000	0.12420	GAG	APOBR	-	NULL	ENSG00000184730		0.637	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding		27	0.00	0	G	NM_182804		28508304	28508304	+1	no_errors	ENST00000564831	ensembl	human	known	69_37n	missense	71	12.35	10	SNP	0.006	A
APOBR	55911	genome.wustl.edu	37	16	28508563	28508563	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:28508563G>A	ENST00000431282.1	+	3	2184	c.2174G>A	c.(2173-2175)aGa>aAa	p.R725K	CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000564831.1_Missense_Mutation_p.R734K|APOBR_ENST00000328423.5_Missense_Mutation_p.R725K|CLN3_ENST00000567160.1_5'Flank			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	725	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GAGGCTGACAGAACATCCAGA	0.637																																						dbGAP											0													14.0	18.0	17.0					16																	28508563		2109	4217	6326	-	-	-	SO:0001583	missense	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.2174G>A	16.37:g.28508563G>A	ENSP00000416094:p.Arg725Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	NULL	p.R734K	ENST00000431282.1	37	c.2201		16	.	.	.	.	.	.	.	.	.	.	G	1.677	-0.507582	0.04231	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.58652	0.32;0.32	4.67	-1.75	0.08031	.	.	.	.	.	T	0.30230	0.0758	N	0.19112	0.55	0.09310	N	1	B;B	0.13145	0.007;0.003	B;B	0.12156	0.007;0.005	T	0.28839	-1.0031	9	0.02654	T	1	-0.0012	4.2938	0.10892	0.3426:0.3559:0.3015:0.0	.	725;725	Q0VD83;Q9NS13	APOBR_HUMAN;.	K	725	ENSP00000327669:R725K;ENSP00000416094:R725K	ENSP00000327669:R725K	R	+	2	0	APOBR	28416064	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.130000	0.15850	-0.087000	0.12528	0.556000	0.70494	AGA	APOBR	-	NULL	ENSG00000184730		0.637	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding		24	0.00	0	G	NM_182804		28508563	28508563	+1	no_errors	ENST00000564831	ensembl	human	known	69_37n	missense	61	12.86	9	SNP	0.000	A
ARHGAP28	79822	genome.wustl.edu	37	18	6876136	6876136	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr18:6876136G>C	ENST00000383472.4	+	10	1323	c.1219G>C	c.(1219-1221)Gag>Cag	p.E407Q	ARHGAP28_ENST00000418986.1_Missense_Mutation_p.E248Q|ARHGAP28_ENST00000531294.1_Missense_Mutation_p.E243Q|ARHGAP28_ENST00000419673.2_Missense_Mutation_p.E248Q|ARHGAP28_ENST00000532996.1_Missense_Mutation_p.E230Q|ARHGAP28_ENST00000314319.3_Missense_Mutation_p.E248Q|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.E355Q|RP11-146G7.2_ENST00000583659.1_RNA|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.E407Q			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	407	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.E407Q(1)|p.E248Q(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				CTAGTTTTTTGAGAAAGTTGA	0.338																																						dbGAP											2	Substitution - Missense(2)	urinary_tract(2)											129.0	123.0	125.0					18																	6876136		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.1219G>C	18.37:g.6876136G>C	ENSP00000372964:p.Glu407Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.E407Q	ENST00000383472.4	37	c.1219		18	.	.	.	.	.	.	.	.	.	.	G	12.36	1.913674	0.33815	.	.	ENSG00000088756	ENST00000400091;ENST00000262227;ENST00000419673;ENST00000531294;ENST00000314319;ENST00000418986;ENST00000532996;ENST00000383472	T;T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05;2.05	5.74	2.66	0.31614	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.610154	0.18743	N	0.132412	T	0.12902	0.0313	N	0.12443	0.215	0.22266	N	0.99924	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.14023	0.003;0.01;0.004;0.008	T	0.19063	-1.0317	10	0.25106	T	0.35	.	15.6566	0.77140	0.0:0.6325:0.3675:0.0	.	407;239;248;355	Q9P2N2;E9PRP2;F6VKJ9;Q9P2N2-2	RHG28_HUMAN;.;.;.	Q	407;355;248;243;248;248;239;230	ENSP00000382963:E407Q;ENSP00000262227:E355Q;ENSP00000392660:E248Q;ENSP00000437262:E243Q;ENSP00000313506:E248Q;ENSP00000406907:E248Q	ENSP00000262227:E355Q	E	+	1	0	ARHGAP28	6866136	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.171000	0.42453	0.857000	0.35407	0.561000	0.74099	GAG	ARHGAP28	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000088756		0.338	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	ARHGAP28	HGNC	protein_coding	OTTHUMT00000442123.3	273	0.00	0	G	XM_371108		6876136	6876136	+1	no_errors	ENST00000400091	ensembl	human	known	69_37n	missense	160	23.81	50	SNP	1.000	C
ARPC1B	10095	genome.wustl.edu	37	7	98983370	98983370	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:98983370C>G	ENST00000451682.1	+	4	342	c.33C>G	c.(31-33)atC>atG	p.I11M	ARPC1A_ENST00000432884.2_Missense_Mutation_p.Q327E|ARPC1B_ENST00000474880.1_3'UTR|ARPC1B_ENST00000252725.5_Missense_Mutation_p.I11M			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	11					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TGGAGCCCATCAGCTGCCACG	0.652																																						dbGAP											0													39.0	32.0	35.0					7																	98983370		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.33C>G	7.37:g.98983370C>G	ENSP00000389631:p.Ile11Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BU00	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I11M	ENST00000451682.1	37	c.33	CCDS5661.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.65|17.65	3.443073|3.443073	0.63067|0.63067	.|.	.|.	ENSG00000130429|ENSG00000241685	ENST00000443222;ENST00000414376;ENST00000252725;ENST00000455009;ENST00000418347;ENST00000429246;ENST00000417330;ENST00000431816;ENST00000427217;ENST00000458033;ENST00000451682|ENST00000432884	T;T;T;T;T;T;T;T;T;T|.	0.72725|.	-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68|.	4.52|4.52	3.64|3.64	0.41730|0.41730	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78046|0.78046	0.4222|0.4222	M|M	0.92219|0.92219	3.285|3.285	0.58432|0.58432	D|D	0.999992|0.999992	D;D|.	0.71674|.	0.998;0.998|.	D;D|.	0.70016|.	0.967;0.967|.	T|T	0.79415|0.79415	-0.1813|-0.1813	10|6	0.87932|0.87932	D|D	0|0	-26.6488|-26.6488	6.9139|6.9139	0.24349|0.24349	0.172:0.7367:0.0:0.0914|0.172:0.7367:0.0:0.0914	.|.	11;11|.	A4D275;O15143|.	.;ARC1B_HUMAN|.	M|E	11|327	ENSP00000413173:I11M;ENSP00000398620:I11M;ENSP00000252725:I11M;ENSP00000410238:I11M;ENSP00000413067:I11M;ENSP00000403324:I11M;ENSP00000398110:I11M;ENSP00000403211:I11M;ENSP00000388802:I11M;ENSP00000389631:I11M|.	ENSP00000252725:I11M|ENSP00000408578:Q327E	I|Q	+|+	3|1	3|0	ARPC1B|ARPC1A	98821306|98821306	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.449000|1.449000	0.35123|0.35123	1.039000|1.039000	0.40074|0.40074	0.555000|0.555000	0.69702|0.69702	ATC|CAG	ARPC1B	-	superfamily_WD40_repeat_dom,pirsf_ARPC2/3_su1	ENSG00000130429		0.652	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARPC1B	HGNC	protein_coding	OTTHUMT00000335894.1	11	0.00	0	C	NM_005720		98983370	98983370	+1	no_errors	ENST00000252725	ensembl	human	known	69_37n	missense	51	17.74	11	SNP	1.000	G
ATAD5	79915	genome.wustl.edu	37	17	29162675	29162675	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:29162675G>C	ENST00000321990.4	+	2	1954	c.1576G>C	c.(1576-1578)Gag>Cag	p.E526Q	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	526					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AAGGAAAACAGAGTTTTTCAA	0.303																																						dbGAP											0													59.0	68.0	65.0					17																	29162675		2192	4293	6485	-	-	-	SO:0001583	missense	0				CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.1576G>C	17.37:g.29162675G>C	ENSP00000313171:p.Glu526Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.E526Q	ENST00000321990.4	37	c.1576	CCDS11260.1	17	.	.	.	.	.	.	.	.	.	.	G	4.581	0.107883	0.08780	.	.	ENSG00000176208	ENST00000321990	T	0.09350	2.99	5.23	5.23	0.72850	.	2.516980	0.01225	N	0.008207	T	0.29223	0.0727	M	0.64997	1.995	0.09310	N	1	D;P	0.63880	0.993;0.791	P;B	0.56563	0.801;0.261	T	0.18304	-1.0341	10	0.62326	D	0.03	.	10.0449	0.42180	0.1354:0.0:0.8646:0.0	.	526;526	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	Q	526	ENSP00000313171:E526Q	ENSP00000313171:E526Q	E	+	1	0	ATAD5	26186801	0.046000	0.20272	0.946000	0.38457	0.635000	0.38103	1.098000	0.31000	2.720000	0.93068	0.655000	0.94253	GAG	ATAD5	-	NULL	ENSG00000176208		0.303	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD5	HGNC	protein_coding	OTTHUMT00000256206.2	89	0.00	0	G	NM_024857		29162675	29162675	+1	no_errors	ENST00000321990	ensembl	human	known	69_37n	missense	49	20.97	13	SNP	0.113	C
ATM	472	genome.wustl.edu	37	11	108170512	108170512	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:108170512G>A	ENST00000452508.2	+	35	5266	c.5077G>A	c.(5077-5079)Gat>Aat	p.D1693N	ATM_ENST00000278616.4_Missense_Mutation_p.D1693N			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1693					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ACATAGTAAAGATGCATCTTA	0.383			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													144.0	146.0	145.0					11																	108170512		2201	4298	6499	-	-	-	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.5077G>A	11.37:g.108170512G>A	ENSP00000388058:p.Asp1693Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.D1693N	ENST00000452508.2	37	c.5077	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	16.98	3.270341	0.59540	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.01474	4.85;4.85	5.29	5.29	0.74685	Armadillo-type fold (1);	0.044268	0.85682	D	0.000000	T	0.02083	0.0065	L	0.41824	1.3	0.51767	D	0.999931	B	0.19445	0.036	B	0.18561	0.022	T	0.56571	-0.7957	10	0.31617	T	0.26	.	10.167	0.42886	0.1219:0.0:0.8781:0.0	.	1693	Q13315	ATM_HUMAN	N	1693	ENSP00000278616:D1693N;ENSP00000388058:D1693N	ENSP00000278616:D1693N	D	+	1	0	ATM	107675722	1.000000	0.71417	0.895000	0.35142	0.975000	0.68041	5.709000	0.68384	2.478000	0.83669	0.650000	0.86243	GAT	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.383	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	232	0.00	0	G	NM_000051		108170512	108170512	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	missense	90	43.12	69	SNP	1.000	A
ATP10A	57194	genome.wustl.edu	37	15	25924558	25924558	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr15:25924558G>A	ENST00000356865.6	-	21	4541	c.4430C>T	c.(4429-4431)tCa>tTa	p.S1477L		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1477					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TGATCGGCCTGAGTGGGGCTG	0.532																																						dbGAP											0													55.0	58.0	57.0					15																	25924558		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.4430C>T	15.37:g.25924558G>A	ENSP00000349325:p.Ser1477Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.S1477L	ENST00000356865.6	37	c.4430	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	G	12.93	2.084837	0.36758	.	.	ENSG00000206190	ENST00000356865	T	0.10382	2.88	5.12	5.12	0.69794	.	3.337370	0.00738	N	0.000987	T	0.08358	0.0208	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09015	-1.0694	10	0.51188	T	0.08	0.866	8.7615	0.34678	0.1029:0.0:0.8971:0.0	.	1477	O60312	AT10A_HUMAN	L	1477	ENSP00000349325:S1477L	ENSP00000349325:S1477L	S	-	2	0	ATP10A	23475651	0.948000	0.32251	0.007000	0.13788	0.015000	0.08874	4.047000	0.57383	2.648000	0.89879	0.655000	0.94253	TCA	ATP10A	-	NULL	ENSG00000206190		0.532	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1	24	0.00	0	G	NM_024490		25924558	25924558	-1	no_errors	ENST00000356865	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	0.043	A
ATP4B	496	genome.wustl.edu	37	13	114303695	114303695	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr13:114303695C>T	ENST00000335288.4	-	7	911	c.870G>A	c.(868-870)gaG>gaA	p.E290E		NM_000705.3	NP_000696.1	P51164	ATP4B_HUMAN	ATPase, H+/K+ exchanging, beta polypeptide	290	immunoglobulin-like.				cell adhesion (GO:0007155)|hydrogen ion transmembrane transport (GO:1902600)|ion transmembrane transport (GO:0034220)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	hydrogen:potassium-exchanging ATPase activity (GO:0008900)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.171)			CGTTTCACTTCTCAATCTTGA	0.577																																						dbGAP											0													122.0	89.0	100.0					13																	114303695		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9539.1	13q34	2011-08-01			ENSG00000186009	ENSG00000186009	3.6.3.10	"""ATPases / P-type"""	820	protein-coding gene	gene with protein product		137217				1330887, 15057823	Standard	NM_000705		Approved	ATP6B	uc001vtz.3	P51164	OTTHUMG00000140234	ENST00000335288.4:c.870G>A	13.37:g.114303695C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1B0N8	Silent	SNP	pfam_ATPase_P-typ_cation-exchng_bsu,tigrfam_ATPase_P-typ_cation-exchng_bsu	p.E290	ENST00000335288.4	37	c.870	CCDS9539.1	13																																																																																			ATP4B	-	tigrfam_ATPase_P-typ_cation-exchng_bsu	ENSG00000186009		0.577	ATP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP4B	HGNC	protein_coding	OTTHUMT00000276703.2	72	0.00	0	C	NM_000705		114303695	114303695	-1	no_errors	ENST00000335288	ensembl	human	known	69_37n	silent	82	21.90	23	SNP	0.002	T
B2M	567	genome.wustl.edu	37	15	45003787	45003787	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr15:45003787C>T	ENST00000558401.1	+	1	113	c.43C>T	c.(43-45)Ctt>Ttt	p.L15F	B2M_ENST00000544417.1_Missense_Mutation_p.L15F|PATL2_ENST00000558573.1_5'Flank|B2M_ENST00000559916.1_Missense_Mutation_p.L15F	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	15					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.L15fs*41(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		GCTACTCTCTCTTTCTGGCCT	0.622																																						dbGAP											1	Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)											131.0	93.0	106.0					15																	45003787		2198	4298	6496	-	-	-	SO:0001583	missense	0			AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.43C>T	15.37:g.45003787C>T	ENSP00000452780:p.Leu15Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	p.L15F	ENST00000558401.1	37	c.43	CCDS10113.1	15	.	.	.	.	.	.	.	.	.	.	C	13.91	2.377686	0.42105	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.01379	4.96	5.35	1.29	0.21616	.	3.854010	0.02191	N	0.061383	T	0.03305	0.0096	M	0.80847	2.515	0.09310	N	1	B;P;B	0.35050	0.36;0.482;0.246	B;B;B	0.34385	0.181;0.145;0.088	T	0.44922	-0.9296	10	0.44086	T	0.13	.	5.1683	0.15098	0.0:0.6014:0.1492:0.2494	.	15;15;15	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	F	15	ENSP00000437604:L15F	ENSP00000340858:L15F	L	+	1	0	B2M	42791079	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.012000	0.12699	0.160000	0.19432	0.655000	0.94253	CTT	B2M	-	NULL	ENSG00000166710		0.622	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	B2M	HGNC	protein_coding	OTTHUMT00000254007.2	21	0.00	0	C	NM_004048		45003787	45003787	+1	no_errors	ENST00000544417	ensembl	human	known	69_37n	missense	43	28.33	17	SNP	0.001	T
BAI3	577	genome.wustl.edu	37	6	69349121	69349121	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:69349121G>A	ENST00000370598.1	+	3	1375	c.554G>A	c.(553-555)aGa>aAa	p.R185K		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	185					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GAAAATGGGAGAACAGAATCA	0.428																																						dbGAP											0													70.0	70.0	70.0					6																	69349121		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.554G>A	6.37:g.69349121G>A	ENSP00000359630:p.Arg185Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.R185K	ENST00000370598.1	37	c.554	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	9.531	1.110723	0.20714	.	.	ENSG00000135298	ENST00000370598	T	0.19250	2.16	5.23	5.23	0.72850	.	0.075476	0.53938	D	0.000052	T	0.05547	0.0146	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24083	-1.0170	10	0.23891	T	0.37	.	12.514	0.56021	0.0768:0.0:0.9232:0.0	.	185	O60242	BAI3_HUMAN	K	185	ENSP00000359630:R185K	ENSP00000359630:R185K	R	+	2	0	BAI3	69405842	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.069000	0.57541	2.610000	0.88304	0.655000	0.94253	AGA	BAI3	-	NULL	ENSG00000135298		0.428	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	29	0.00	0	G			69349121	69349121	+1	no_errors	ENST00000370598	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	1.000	A
BBS2	583	genome.wustl.edu	37	16	56543943	56543943	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:56543943G>C	ENST00000245157.5	-	5	958	c.538C>G	c.(538-540)Ctt>Gtt	p.L180V	BBS2_ENST00000561951.1_5'UTR|BBS2_ENST00000568104.1_Missense_Mutation_p.L180V	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	180					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						GATCCAACAAGAAGCTGAAGG	0.383									Bardet-Biedl syndrome																													dbGAP											0													109.0	101.0	104.0					16																	56543943		2198	4300	6498	-	-	-	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.538C>G	16.37:g.56543943G>C	ENSP00000245157:p.Leu180Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96CM0|Q96SN9	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,pirsf_Bardet-Biedl_syndrome_2_prot	p.L180V	ENST00000245157.5	37	c.538	CCDS32451.1	16	.	.	.	.	.	.	.	.	.	.	G	13.99	2.403327	0.42613	.	.	ENSG00000125124	ENST00000245157	D	0.85013	-1.93	5.15	4.2	0.49525	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.72095	0.3418	N	0.21448	0.665	0.80722	D	1	P;P	0.35656	0.514;0.514	B;B	0.31614	0.133;0.133	T	0.68119	-0.5493	10	0.09843	T	0.71	-12.8909	13.5778	0.61885	0.0751:0.0:0.9249:0.0	.	180;180	A8K0N9;Q9BXC9	.;BBS2_HUMAN	V	180	ENSP00000245157:L180V	ENSP00000245157:L180V	L	-	1	0	BBS2	55101444	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.446000	0.73460	1.178000	0.42870	0.655000	0.94253	CTT	BBS2	-	superfamily_WD40_repeat_dom,pirsf_Bardet-Biedl_syndrome_2_prot	ENSG00000125124		0.383	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS2	HGNC	protein_coding	OTTHUMT00000434386.2	183	0.00	0	G	NM_031885		56543943	56543943	-1	no_errors	ENST00000245157	ensembl	human	known	69_37n	missense	107	22.46	31	SNP	1.000	C
BLM	641	genome.wustl.edu	37	15	91312739	91312739	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr15:91312739G>A	ENST00000355112.3	+	12	2596	c.2478G>A	c.(2476-2478)gtG>gtA	p.V826V	BLM_ENST00000560136.1_3'UTR|BLM_ENST00000560509.1_Silent_p.V826V	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	826	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			CTGTTCCGGTGATGGCTCTTA	0.438			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																													dbGAP	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	0													83.0	74.0	77.0					15																	91312739		2198	4298	6496	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.2478G>A	15.37:g.91312739G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q52M96	Silent	SNP	pfam_RQC_domain,pfam_BDHCT,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/RNaseD_C,superfamily_HRDC-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_Helicase/RNaseD_C,pfscan_Helicase/RNaseD_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.V826	ENST00000355112.3	37	c.2478	CCDS10363.1	15																																																																																			BLM	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000197299		0.438	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLM	HGNC	protein_coding	OTTHUMT00000313495.1	51	0.00	0	G			91312739	91312739	+1	no_errors	ENST00000355112	ensembl	human	known	69_37n	silent	41	25.45	14	SNP	1.000	A
BLM	641	genome.wustl.edu	37	15	91354615	91354615	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr15:91354615C>T	ENST00000355112.3	+	21	4173	c.4055C>T	c.(4054-4056)tCc>tTc	p.S1352F	BLM_ENST00000560509.1_Missense_Mutation_p.S1221F	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	1352					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			AAAACTGCTTCCAGTGGTTCC	0.428			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																													dbGAP	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	0													87.0	82.0	83.0					15																	91354615		2198	4298	6496	-	-	-	SO:0001583	missense	0	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.4055C>T	15.37:g.91354615C>T	ENSP00000347232:p.Ser1352Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52M96	Missense_Mutation	SNP	pfam_RQC_domain,pfam_BDHCT,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/RNaseD_C,superfamily_HRDC-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_Helicase/RNaseD_C,pfscan_Helicase/RNaseD_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.S1352F	ENST00000355112.3	37	c.4055	CCDS10363.1	15	.	.	.	.	.	.	.	.	.	.	C	11.59	1.682747	0.29872	.	.	ENSG00000197299	ENST00000355112;ENST00000536925	T	0.47177	0.85	5.69	-3.05	0.05396	.	1.023540	0.07788	N	0.954468	T	0.12050	0.0293	N	0.00841	-1.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23013	-1.0200	10	0.09084	T	0.74	-0.0111	1.582	0.02636	0.2122:0.2203:0.0912:0.4764	.	1352;1352	B2RAN0;P54132	.;BLM_HUMAN	F	1352;982	ENSP00000347232:S1352F	ENSP00000347232:S1352F	S	+	2	0	BLM	89155619	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.078000	0.14761	-0.342000	0.08363	-0.976000	0.02587	TCC	BLM	-	NULL	ENSG00000197299		0.428	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLM	HGNC	protein_coding	OTTHUMT00000313495.1	89	0.00	0	C			91354615	91354615	+1	no_errors	ENST00000355112	ensembl	human	known	69_37n	missense	105	22.06	30	SNP	0.000	T
BMP2	650	genome.wustl.edu	37	20	6759581	6759581	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr20:6759581C>T	ENST00000378827.4	+	3	2255	c.1036C>T	c.(1036-1038)Cag>Tag	p.Q346*		NM_001200.2	NP_001191.1	P12643	BMP2_HUMAN	bone morphogenetic protein 2	346					activation of MAPK activity (GO:0000187)|atrioventricular valve morphogenesis (GO:0003181)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|bone mineralization (GO:0030282)|bone mineralization involved in bone maturation (GO:0035630)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiocyte differentiation (GO:0035051)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation (GO:0002062)|corticotropin hormone secreting cell differentiation (GO:0060128)|embryo development (GO:0009790)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchyme development (GO:0060485)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of calcium-independent cell-cell adhesion (GO:0051042)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|pericardium development (GO:0060039)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of odontogenesis (GO:0042482)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of Wnt signaling pathway by BMP signaling pathway (GO:0060804)|protein destabilization (GO:0031648)|protein phosphorylation (GO:0006468)|proteoglycan metabolic process (GO:0006029)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP receptor binding (GO:0070700)|phosphatase activator activity (GO:0019211)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)|retinol dehydrogenase activity (GO:0004745)|SMAD binding (GO:0046332)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	13						TGCCATTGTTCAGACGTTGGT	0.488																																						dbGAP											0													132.0	103.0	113.0					20																	6759581		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS13099.1	20p12	2014-01-30			ENSG00000125845	ENSG00000125845		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1069	protein-coding gene	gene with protein product		112261		BMP2A		2376592	Standard	NM_001200		Approved		uc002wmu.1	P12643	OTTHUMG00000031833	ENST00000378827.4:c.1036C>T	20.37:g.6759581C>T	ENSP00000368104:p.Gln346*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	p.Q346*	ENST00000378827.4	37	c.1036	CCDS13099.1	20	.	.	.	.	.	.	.	.	.	.	C	47	13.509437	0.99746	.	.	ENSG00000125845	ENST00000378827	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.6513	0.95812	0.0:1.0:0.0:0.0	.	.	.	.	X	346	.	ENSP00000368104:Q346X	Q	+	1	0	BMP2	6707581	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.772000	0.85439	2.704000	0.92352	0.650000	0.86243	CAG	BMP2	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000125845		0.488	BMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP2	HGNC	protein_coding	OTTHUMT00000077918.3	80	0.00	0	C			6759581	6759581	+1	no_errors	ENST00000378827	ensembl	human	known	69_37n	nonsense	127	22.09	36	SNP	1.000	T
BNC1	646	genome.wustl.edu	37	15	83933455	83933455	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr15:83933455A>T	ENST00000345382.2	-	4	633	c.548T>A	c.(547-549)aTg>aAg	p.M183K	BNC1_ENST00000569704.1_Missense_Mutation_p.M176K|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	183					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						TTGAATTGCCATGAGTTCAAC	0.458																																						dbGAP											0													200.0	181.0	187.0					15																	83933455		2203	4300	6503	-	-	-	SO:0001583	missense	0			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.548T>A	15.37:g.83933455A>T	ENSP00000307041:p.Met183Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15840	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M183K	ENST00000345382.2	37	c.548	CCDS10324.1	15	.	.	.	.	.	.	.	.	.	.	A	17.45	3.392723	0.62066	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.03441	3.93	5.82	5.82	0.92795	.	0.039477	0.85682	D	0.000000	T	0.16514	0.0397	M	0.62723	1.935	0.80722	D	1	P;D	0.76494	0.804;0.999	B;D	0.78314	0.382;0.991	T	0.00067	-1.2142	10	0.87932	D	0	-20.4725	16.172	0.81825	1.0:0.0:0.0:0.0	.	176;183	F5GY04;Q01954	.;BNC1_HUMAN	K	183;176	ENSP00000307041:M183K	ENSP00000307041:M183K	M	-	2	0	BNC1	81724459	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.229000	0.95273	2.224000	0.72417	0.533000	0.62120	ATG	BNC1	-	NULL	ENSG00000169594		0.458	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	HGNC	protein_coding	OTTHUMT00000304006.1	90	0.00	0	A	NM_001717		83933455	83933455	-1	no_errors	ENST00000345382	ensembl	human	known	69_37n	missense	65	39.81	43	SNP	1.000	T
BRWD3	254065	genome.wustl.edu	37	X	79932203	79932203	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:79932203C>T	ENST00000373275.4	-	41	5530	c.5314G>A	c.(5314-5316)Gag>Aag	p.E1772K	BRWD3_ENST00000473691.1_5'Flank	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1772					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						AGAGGATCCTCAGTGGACACA	0.403																																						dbGAP											0													77.0	64.0	69.0					X																	79932203		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.5314G>A	X.37:g.79932203C>T	ENSP00000362372:p.Glu1772Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.E1772K	ENST00000373275.4	37	c.5314	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	C	14.72	2.619316	0.46736	.	.	ENSG00000165288	ENST00000373275	T	0.57595	0.39	4.24	4.24	0.50183	.	0.258931	0.36740	N	0.002437	T	0.31796	0.0808	N	0.08118	0	0.47374	D	0.999408	P	0.40970	0.734	B	0.37015	0.239	T	0.16719	-1.0393	9	.	.	.	-12.464	16.32	0.82945	0.0:1.0:0.0:0.0	.	1772	Q6RI45	BRWD3_HUMAN	K	1772	ENSP00000362372:E1772K	.	E	-	1	0	BRWD3	79818859	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.693000	0.74582	2.109000	0.64355	0.513000	0.50165	GAG	BRWD3	-	NULL	ENSG00000165288		0.403	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	126	0.00	0	C	NM_153252		79932203	79932203	-1	no_errors	ENST00000373275	ensembl	human	known	69_37n	missense	50	32.43	24	SNP	1.000	T
C11orf30	56946	genome.wustl.edu	37	11	76175093	76175093	+	Nonsense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:76175093C>G	ENST00000529032.1	+	6	800	c.800C>G	c.(799-801)tCa>tGa	p.S267*	C11orf30_ENST00000524767.1_Nonsense_Mutation_p.S282*|C11orf30_ENST00000525919.1_Nonsense_Mutation_p.S268*|C11orf30_ENST00000343878.3_Nonsense_Mutation_p.S267*|C11orf30_ENST00000525038.1_Nonsense_Mutation_p.S282*|C11orf30_ENST00000533248.1_Nonsense_Mutation_p.S281*|C11orf30_ENST00000334736.3_Nonsense_Mutation_p.S267*|C11orf30_ENST00000524490.1_Nonsense_Mutation_p.S268*			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	267	Interaction with BRCA2.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						ACTAAACCATCAACACAGACA	0.433																																						dbGAP											0													126.0	103.0	111.0					11																	76175093		2200	4292	6492	-	-	-	SO:0001587	stop_gained	0			AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.800C>G	11.37:g.76175093C>G	ENSP00000432327:p.Ser267*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Nonsense_Mutation	SNP	pfam_ENT_N,pfscan_ENT_N	p.S267*	ENST00000529032.1	37	c.800	CCDS8244.1	11	.	.	.	.	.	.	.	.	.	.	C	37	6.258535	0.97421	.	.	ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000343878;ENST00000393457;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032	.	.	.	5.75	5.75	0.90469	.	0.211872	0.44097	D	0.000483	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-7.2858	19.9598	0.97242	0.0:1.0:0.0:0.0	.	.	.	.	X	268;267;267;217;282;281;268;282;267	.	ENSP00000334130:S267X	S	+	2	0	C11orf30	75852741	1.000000	0.71417	0.996000	0.52242	0.913000	0.54294	6.089000	0.71384	2.716000	0.92895	0.655000	0.94253	TCA	C11orf30	-	NULL	ENSG00000158636		0.433	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf30	HGNC	protein_coding	OTTHUMT00000383288.2	69	0.00	0	C	NM_020193		76175093	76175093	+1	no_errors	ENST00000334736	ensembl	human	known	69_37n	nonsense	74	26.73	27	SNP	1.000	G
GPATCH2L	55668	genome.wustl.edu	37	14	76621084	76621084	+	Silent	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr14:76621084C>G	ENST00000261530.7	+	2	444	c.378C>G	c.(376-378)ctC>ctG	p.L126L	GPATCH2L_ENST00000557263.1_Silent_p.L126L|GPATCH2L_ENST00000312858.5_Silent_p.L126L|GPATCH2L_ENST00000556663.1_Silent_p.L126L	NM_017926.2	NP_060396.2	Q9NWQ4	GPT2L_HUMAN	G patch domain containing 2-like	126																	GTCGACCACTCAGGCGCAGGC	0.512																																						dbGAP											0													85.0	76.0	79.0					14																	76621084		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000696	CCDS9848.1, CCDS9849.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000089916	ENSG00000089916			20210	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 118"""	C14orf118		10574461	Standard	NM_017926		Approved	FLJ20689, FLJ10033	uc001xsh.3	Q9NWQ4	OTTHUMG00000171490	ENST00000261530.7:c.378C>G	14.37:g.76621084C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN42|Q6PEJ7|Q9H3M3|Q9NWH0|Q9ULR8	Silent	SNP	NULL	p.L126	ENST00000261530.7	37	c.378	CCDS9848.1	14																																																																																			C14orf118	-	NULL	ENSG00000089916		0.512	GPATCH2L-003	KNOWN	basic|CCDS	protein_coding	C14orf118	HGNC	protein_coding	OTTHUMT00000413698.2	31	0.00	0	C	NM_017926		76621084	76621084	+1	no_errors	ENST00000261530	ensembl	human	known	69_37n	silent	64	15.58	12	SNP	0.945	G
C16orf58	64755	genome.wustl.edu	37	16	31503569	31503569	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:31503569C>T	ENST00000327237.2	-	11	1219	c.1180G>A	c.(1180-1182)Gat>Aat	p.D394N	C16orf58_ENST00000567994.1_Missense_Mutation_p.D349N|C16orf58_ENST00000570164.1_Missense_Mutation_p.D392N			Q96GQ5	RUS1_HUMAN	chromosome 16 open reading frame 58	394						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)	14						AGGGGTCCATCTCCCTGCAGG	0.612																																						dbGAP											0													43.0	43.0	43.0					16																	31503569		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK023930	CCDS10715.1	16p11.2	2013-03-04			ENSG00000140688	ENSG00000140688			25848	protein-coding gene	gene with protein product							Standard	NM_022744		Approved	FLJ13868	uc002eci.3	Q96GQ5	OTTHUMG00000132466	ENST00000327237.2:c.1180G>A	16.37:g.31503569C>T	ENSP00000317579:p.Asp394Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53GL8|Q8NAJ4|Q9BVY3|Q9H887	Missense_Mutation	SNP	pfam_DUF647	p.D394N	ENST00000327237.2	37	c.1180	CCDS10715.1	16	.	.	.	.	.	.	.	.	.	.	C	14.91	2.677789	0.47886	.	.	ENSG00000140688	ENST00000327237;ENST00000452223	T	0.45276	0.9	5.47	5.47	0.80525	.	0.682072	0.15494	N	0.259408	T	0.47673	0.1458	N	0.22421	0.69	0.80722	D	1	B;D	0.76494	0.001;0.999	B;D	0.71656	0.001;0.974	T	0.13710	-1.0499	10	0.13108	T	0.6	-4.2888	14.8152	0.70028	0.0:1.0:0.0:0.0	.	394;132	Q96GQ5;Q96GQ5-2	CP058_HUMAN;.	N	394;348	ENSP00000317579:D394N	ENSP00000317579:D394N	D	-	1	0	C16orf58	31411070	0.012000	0.17670	0.450000	0.26969	0.705000	0.40729	1.020000	0.30027	2.583000	0.87209	0.655000	0.94253	GAT	C16orf58	-	NULL	ENSG00000140688		0.612	C16orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf58	HGNC	protein_coding	OTTHUMT00000255629.2	10	0.00	0	C	NM_022744		31503569	31503569	-1	no_errors	ENST00000327237	ensembl	human	known	69_37n	missense	43	20.37	11	SNP	0.749	T
C1orf168	199920	genome.wustl.edu	37	1	57189333	57189333	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:57189333G>A	ENST00000343433.6	-	17	1982	c.1902C>T	c.(1900-1902)ttC>ttT	p.F634F	C1orf168_ENST00000484327.1_5'Flank	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168	634										NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						TCTTGGTTTTGAAGAAATTTC	0.318																																						dbGAP											0													49.0	49.0	49.0					1																	57189333		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.1902C>T	1.37:g.57189333G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q63HM3|Q6ZUY6	Silent	SNP	superfamily_SH3_domain	p.F634	ENST00000343433.6	37	c.1902	CCDS30729.1	1																																																																																			C1orf168	-	NULL	ENSG00000187889		0.318	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf168	HGNC	protein_coding	OTTHUMT00000022751.2	172	0.00	0	G	NM_001004303		57189333	57189333	-1	no_errors	ENST00000343433	ensembl	human	known	69_37n	silent	42	17.65	9	SNP	0.999	A
MGME1	92667	genome.wustl.edu	37	20	17956500	17956500	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr20:17956500G>A	ENST00000377710.5	+	3	973	c.685G>A	c.(685-687)Gaa>Aaa	p.E229K	MGME1_ENST00000467391.1_Intron|MGME1_ENST00000377709.1_Missense_Mutation_p.E149K|MGME1_ENST00000377704.4_Intron	NM_052865.2	NP_443097.1			mitochondrial genome maintenance exonuclease 1																		TGTTCAACATGAAACCTTAAA	0.428																																						dbGAP											0													128.0	127.0	127.0					20																	17956500		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13131.1	20p11.23	2013-08-29	2013-01-11	2013-01-11	ENSG00000125871	ENSG00000125871			16205	protein-coding gene	gene with protein product		615076	"""chromosome 20 open reading frame 72"""	C20orf72		23313956, 23358826, 23434322	Standard	NM_052865		Approved	bA504H3.4, DDK1	uc002wqh.3	Q9BQP7	OTTHUMG00000031955	ENST00000377710.5:c.685G>A	20.37:g.17956500G>A	ENSP00000366939:p.Glu229Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Restrct_endonuc-II-like	p.E229K	ENST00000377710.5	37	c.685	CCDS13131.1	20	.	.	.	.	.	.	.	.	.	.	G	11.32	1.604533	0.28623	.	.	ENSG00000125871	ENST00000377710;ENST00000377709	T;T	0.44482	0.92;0.95	5.49	3.5	0.40072	.	0.667193	0.15805	N	0.243784	T	0.32526	0.0832	L	0.55103	1.725	0.26222	N	0.979144	P	0.39352	0.669	B	0.38106	0.265	T	0.12656	-1.0539	10	0.11794	T	0.64	-4.863	6.1838	0.20486	0.0712:0.1337:0.6565:0.1386	.	229	Q9BQP7	CT072_HUMAN	K	229;149	ENSP00000366939:E229K;ENSP00000366938:E149K	ENSP00000366938:E149K	E	+	1	0	C20orf72	17904500	0.889000	0.30405	0.034000	0.17996	0.965000	0.64279	1.132000	0.31418	0.650000	0.30769	0.655000	0.94253	GAA	C20orf72	-	NULL	ENSG00000125871		0.428	MGME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf72	HGNC	protein_coding	OTTHUMT00000078139.1	172	0.00	0	G	NM_052865		17956500	17956500	+1	no_errors	ENST00000377710	ensembl	human	known	69_37n	missense	153	18.18	34	SNP	0.419	A
C5orf42	65250	genome.wustl.edu	37	5	37180152	37180152	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:37180152C>T	ENST00000508244.1	-	27	5797	c.5704G>A	c.(5704-5706)Gag>Aag	p.E1902K	C5orf42_ENST00000274258.7_Missense_Mutation_p.E782K|C5orf42_ENST00000425232.2_Missense_Mutation_p.E1902K			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1902						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TCCATTTCCTCTTCTGTAAAT	0.249																																						dbGAP											0													62.0	68.0	66.0					5																	37180152		2186	4271	6457	-	-	-	SO:0001583	missense	0				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.5704G>A	5.37:g.37180152C>T	ENSP00000421690:p.Glu1902Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	superfamily_Quino_amine_DH_bsu	p.E1902K	ENST00000508244.1	37	c.5704	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948405	0.73787	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.27720	1.69;1.69;1.65;1.66	5.72	4.85	0.62838	.	0.213843	0.24534	N	0.037682	T	0.26557	0.0649	L	0.36672	1.1	0.24734	N	0.993077	B;B	0.32753	0.383;0.379	B;B	0.34652	0.116;0.187	T	0.17961	-1.0352	10	0.49607	T	0.09	.	11.6133	0.51074	0.0:0.9175:0.0:0.0825	.	1902;782	E9PH94;Q9H799	.;CE042_HUMAN	K	1902;1902;782;950;782	ENSP00000421690:E1902K;ENSP00000389014:E1902K;ENSP00000274258:E782K;ENSP00000424223:E950K	ENSP00000274258:E782K	E	-	1	0	C5orf42	37215909	0.890000	0.30428	0.225000	0.23894	0.543000	0.35085	1.851000	0.39338	1.429000	0.47314	0.655000	0.94253	GAG	C5orf42	-	NULL	ENSG00000197603		0.249	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	156	0.00	0	C	NM_023073		37180152	37180152	-1	no_errors	ENST00000425232	ensembl	human	known	69_37n	missense	107	11.57	14	SNP	0.738	T
CCDC180	100499483	genome.wustl.edu	37	9	100070026	100070026	+	Missense_Mutation	SNP	C	C	T	rs577188983		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr9:100070026C>T	ENST00000357054.1	+	15	1341	c.406C>T	c.(406-408)Cgg>Tgg	p.R136W	CCDC180_ENST00000529487.1_5'UTR|CCDC180_ENST00000460482.2_3'UTR|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_5'UTR|CCDC180_ENST00000395220.1_Missense_Mutation_p.R136W|CCDC180_ENST00000411667.2_5'UTR			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	136						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											AGAGTCCCTTCGGATTTGCGC	0.522																																						dbGAP											0													109.0	108.0	109.0					9																	100070026		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.406C>T	9.37:g.100070026C>T	ENSP00000349562:p.Arg136Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.R136W	ENST00000357054.1	37	c.406		9	.	.	.	.	.	.	.	.	.	.	C	14.07	2.424540	0.43020	.	.	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000541524	T;T	0.19806	3.03;2.12	3.59	-7.19	0.01500	.	2.112880	0.02899	N	0.135140	T	0.17023	0.0409	.	.	.	0.09310	N	0.999997	B;B	0.15473	0.013;0.013	B;B	0.06405	0.002;0.002	T	0.30534	-0.9975	9	0.87932	D	0	.	12.1329	0.53952	0.0:0.1557:0.6755:0.1688	.	136;136	B7ZMG3;Q9P1Z9	.;CI174_HUMAN	W	136;136;20	ENSP00000349562:R136W;ENSP00000378646:R136W	ENSP00000349562:R136W	R	+	1	2	C9orf174	99109847	0.000000	0.05858	0.000000	0.03702	0.415000	0.31203	-1.828000	0.01702	-1.915000	0.01077	-0.291000	0.09656	CGG	C9orf174	-	NULL	ENSG00000197816		0.522	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		41	0.00	0	C	NM_020893		100070026	100070026	+1	no_errors	ENST00000357054	ensembl	human	known	69_37n	missense	63	28.41	25	SNP	0.000	T
CACNA1A	773	genome.wustl.edu	37	19	13414674	13414674	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:13414674C>T	ENST00000360228.5	-	16	2010	c.2011G>A	c.(2011-2013)Gag>Aag	p.E671K	CACNA1A_ENST00000573710.2_Missense_Mutation_p.E672K	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	672					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TACATGACCTCGTTCCAGTCT	0.577																																						dbGAP											0													148.0	152.0	151.0					19																	13414674		2023	4177	6200	-	-	-	SO:0001583	missense	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2011G>A	19.37:g.13414674C>T	ENSP00000353362:p.Glu671Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.E671K	ENST00000360228.5	37	c.2011	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	C	15.33	2.800579	0.50315	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.97529	-4.42	4.58	4.58	0.56647	Ion transport (1);	0.199619	0.41605	D	0.000851	D	0.97832	0.9288	M	0.69185	2.1	0.28973	N	0.889139	P;D;D	0.76494	0.806;0.975;0.999	B;P;D	0.76575	0.245;0.477;0.988	D	0.94618	0.7810	10	0.27785	T	0.31	.	16.302	0.82825	0.0:1.0:0.0:0.0	.	672;672;671	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	K	671;672;672;672	ENSP00000353362:E671K	ENSP00000317661:E672K	E	-	1	0	CACNA1A	13275674	0.030000	0.19436	1.000000	0.80357	0.990000	0.78478	2.395000	0.44459	2.371000	0.80710	0.591000	0.81541	GAG	CACNA1A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCCAlpha1	ENSG00000141837		0.577	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2	34	0.00	0	C	NM_000068		13414674	13414674	-1	no_errors	ENST00000360228	ensembl	human	known	69_37n	missense	75	21.05	20	SNP	1.000	T
CACNA1E	777	genome.wustl.edu	37	1	181727119	181727119	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:181727119C>G	ENST00000367573.2	+	31	4366	c.4366C>G	c.(4366-4368)Ctc>Gtc	p.L1456V	CACNA1E_ENST00000357570.5_Missense_Mutation_p.L1407V|CACNA1E_ENST00000526775.1_Missense_Mutation_p.L1437V|CACNA1E_ENST00000360108.3_Missense_Mutation_p.L1437V|CACNA1E_ENST00000358338.5_Missense_Mutation_p.L1388V|CACNA1E_ENST00000367567.4_Missense_Mutation_p.L1063V|CACNA1E_ENST00000367570.1_Missense_Mutation_p.L1456V	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1456					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CGCCAAACCTCTCACCCGCTA	0.527																																						dbGAP											0													145.0	150.0	148.0					1																	181727119		2140	4236	6376	-	-	-	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4366C>G	1.37:g.181727119C>G	ENSP00000356545:p.Leu1456Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.L1456V	ENST00000367573.2	37	c.4366	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.341311	0.81911	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.96830	-4.05;-4.05;-4.14;-4.05;-4.13;-4.14;-4.14	5.27	5.27	0.74061	.	0.134172	0.52532	D	0.000074	D	0.97748	0.9261	M	0.66506	2.035	0.80722	D	1	P;P;D	0.71674	0.541;0.739;0.998	P;P;D	0.77557	0.522;0.474;0.99	D	0.98202	1.0468	10	0.56958	D	0.05	.	18.5085	0.90907	0.0:1.0:0.0:0.0	.	1437;1456;1456	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	V	1456;1437;1407;1388;1063;1437;1456	ENSP00000356542:L1456V;ENSP00000434814:L1437V;ENSP00000350183:L1407V;ENSP00000351101:L1388V;ENSP00000356539:L1063V;ENSP00000353222:L1437V;ENSP00000356545:L1456V	ENSP00000350183:L1407V	L	+	1	0	CACNA1E	179993742	0.992000	0.36948	0.964000	0.40570	0.996000	0.88848	3.020000	0.49643	2.465000	0.83290	0.655000	0.94253	CTC	CACNA1E	-	NULL	ENSG00000198216		0.527	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	42	0.00	0	C	NM_000721		181727119	181727119	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	missense	126	18.71	29	SNP	0.997	G
CAD	790	genome.wustl.edu	37	2	27460410	27460410	+	Silent	SNP	G	G	A	rs1141312		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:27460410G>A	ENST00000403525.1	+	27	4515	c.4371G>A	c.(4369-4371)caG>caA	p.Q1457Q	CAD_ENST00000264705.4_Silent_p.Q1520Q			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCTGGCCCAGAAGGTGAGCC	0.632																																						dbGAP											0													40.0	41.0	41.0					2																	27460410		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.4371G>A	2.37:g.27460410G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	pfam_Amidohydro_1,pfam_MGS-like_dom,superfamily_MGS-like_dom	p.R172K	ENST00000403525.1	37	c.515		2	.	.	.	.	.	.	.	.	.	.	G	8.303	0.820333	0.16678	.	.	ENSG00000084774	ENST00000458503	.	.	.	4.37	2.51	0.30379	.	.	.	.	.	T	0.58652	0.2137	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55016	-0.8206	4	.	.	.	.	9.5398	0.39244	0.1797:0.0:0.8203:0.0	rs1141312	.	.	.	K	172	.	.	R	+	2	0	CAD	27313914	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.333000	0.59285	1.055000	0.40461	0.555000	0.69702	AGA	CAD	-	pfam_Amidohydro_1	ENSG00000084774		0.632	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	HGNC	protein_coding	OTTHUMT00000324970.1	9	0.00	0	G			27460410	27460410	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000458503	ensembl	human	novel	69_37n	missense	40	14.89	7	SNP	1.000	A
CADPS	8618	genome.wustl.edu	37	3	62543150	62543150	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:62543150C>G	ENST00000383710.4	-	10	2032	c.1683G>C	c.(1681-1683)gaG>gaC	p.E561D	CADPS_ENST00000357948.3_Missense_Mutation_p.E561D|CADPS_ENST00000283269.9_Missense_Mutation_p.E561D	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	561	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CCGCTTTCTTCTCCCGATAAC	0.537																																						dbGAP											0													211.0	199.0	203.0					3																	62543150		2203	4300	6503	-	-	-	SO:0001583	missense	0			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.1683G>C	3.37:g.62543150C>G	ENSP00000373215:p.Glu561Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	pfam_Ca-dep_secretion_activator,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E561D	ENST00000383710.4	37	c.1683	CCDS46858.1	3	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253343	0.59212	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000542833	T;T;T;T	0.76186	0.65;0.65;0.65;-1.0	6.17	5.29	0.74685	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.055202	0.64402	D	0.000001	D	0.85358	0.5678	M	0.80616	2.505	0.80722	D	1	P;B;P;P	0.39847	0.691;0.022;0.69;0.691	P;B;P;P	0.59595	0.771;0.05;0.86;0.852	D	0.86585	0.1856	10	0.87932	D	0	.	11.7411	0.51794	0.0:0.8584:0.0:0.1416	.	561;561;561;561	Q9ULU8-2;Q9ULU8-3;Q9ULU8;Q9ULU8-4	.;.;CAPS1_HUMAN;.	D	561;561;561;561;56	ENSP00000373215:E561D;ENSP00000350632:E561D;ENSP00000283269:E561D;ENSP00000439528:E56D	ENSP00000283269:E561D	E	-	3	2	CADPS	62518190	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.655000	0.46707	1.598000	0.50083	0.655000	0.94253	GAG	CADPS	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000163618		0.537	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	HGNC	protein_coding	OTTHUMT00000351951.5	91	0.00	0	C	NM_003716, NM_183393, NM_183394		62543150	62543150	-1	no_errors	ENST00000383710	ensembl	human	known	69_37n	missense	107	23.57	33	SNP	1.000	G
CAMSAP2	23271	genome.wustl.edu	37	1	200818343	200818343	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:200818343G>A	ENST00000236925.4	+	12	2528	c.2479G>A	c.(2479-2481)Gat>Aat	p.D827N	CAMSAP2_ENST00000358823.2_Missense_Mutation_p.D816N|CAMSAP2_ENST00000413307.2_Missense_Mutation_p.D800N			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	827					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										AGTATATACTGATCGAGCAAA	0.443																																						dbGAP											0													99.0	107.0	105.0					1																	200818343		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.2479G>A	1.37:g.200818343G>A	ENSP00000236925:p.Asp827Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrell-like,superfamily_CH-domain	p.D827N	ENST00000236925.4	37	c.2479		1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.846732	0.32606	.	.	ENSG00000118200	ENST00000358823;ENST00000413307;ENST00000236925	T;T;T	0.69685	-0.42;-0.42;-0.42	5.58	5.58	0.84498	.	0.280561	0.35436	N	0.003204	T	0.49864	0.1582	N	0.08118	0	0.48236	D	0.999615	B;B;B	0.22211	0.066;0.007;0.022	B;B;B	0.20577	0.03;0.002;0.007	T	0.42068	-0.9473	10	0.27785	T	0.31	-17.3114	19.5661	0.95393	0.0:0.0:1.0:0.0	.	800;827;816	Q08AD1-2;Q08AD1;Q08AD1-3	.;CAMP2_HUMAN;.	N	816;800;827	ENSP00000351684:D816N;ENSP00000416800:D800N;ENSP00000236925:D827N	ENSP00000236925:D827N	D	+	1	0	CAMSAP1L1	199084966	0.955000	0.32602	0.310000	0.25168	0.898000	0.52572	4.380000	0.59581	2.626000	0.88956	0.484000	0.47621	GAT	CAMSAP2	-	NULL	ENSG00000118200		0.443	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CAMSAP2	HGNC	protein_coding	OTTHUMT00000086956.2	108	0.00	0	G	NM_203459		200818343	200818343	+1	no_errors	ENST00000236925	ensembl	human	known	69_37n	missense	106	13.82	17	SNP	1.000	A
CAND2	23066	genome.wustl.edu	37	3	12866971	12866971	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:12866971G>C	ENST00000456430.2	+	12	3084	c.3043G>C	c.(3043-3045)Gag>Cag	p.E1015Q	CAND2_ENST00000295989.5_Intron	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	1015					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						TCTGCCAGGAGAGTTCATGGA	0.592																																					GBM(43;676 868 1633 6395 37496)	dbGAP											0													60.0	57.0	58.0					3																	12866971		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.3043G>C	3.37:g.12866971G>C	ENSP00000387641:p.Glu1015Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGM9|E9KL24	Missense_Mutation	SNP	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.E1015Q	ENST00000456430.2	37	c.3043	CCDS54554.1	3	.	.	.	.	.	.	.	.	.	.	G	18.19	3.568662	0.65651	.	.	ENSG00000144712	ENST00000456430	T	0.64438	-0.1	5.64	5.64	0.86602	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.46946	0.1419	N	0.20685	0.6	0.80722	D	1	B	0.24618	0.107	B	0.23150	0.044	T	0.40175	-0.9577	9	0.11794	T	0.64	-5.0654	17.2105	0.86929	0.0:0.0:1.0:0.0	.	1015	O75155	CAND2_HUMAN	Q	1015	ENSP00000387641:E1015Q	ENSP00000387641:E1015Q	E	+	1	0	CAND2	12841971	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	6.661000	0.74422	2.673000	0.90976	0.650000	0.86243	GAG	CAND2	-	superfamily_ARM-type_fold	ENSG00000144712		0.592	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND2	HGNC	protein_coding	OTTHUMT00000339856.4	23	0.00	0	G	XM_371617		12866971	12866971	+1	no_errors	ENST00000456430	ensembl	human	known	69_37n	missense	48	29.41	20	SNP	1.000	C
CAPN13	92291	genome.wustl.edu	37	2	30974021	30974021	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:30974021G>C	ENST00000295055.8	-	11	1360	c.1184C>G	c.(1183-1185)tCa>tGa	p.S395*	CAPN13_ENST00000534090.2_Nonsense_Mutation_p.S395*	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	395					proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					TTTCAAATTTGATGGTGTGAC	0.453																																						dbGAP											0													73.0	72.0	72.0					2																	30974021		1956	4151	6107	-	-	-	SO:0001587	stop_gained	0				CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.1184C>G	2.37:g.30974021G>C	ENSP00000295055:p.Ser395*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RF0|Q580X1|Q8TE80	Nonsense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.S395*	ENST00000295055.8	37	c.1184	CCDS46252.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.565420	0.96527	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	.	.	.	4.01	0.0453	0.14229	.	16.984000	0.00166	N	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	5.0169	0.14341	0.167:0.0:0.4481:0.3849	.	.	.	.	X	395	.	ENSP00000295055:S395X	S	-	2	0	CAPN13	30827525	0.717000	0.27966	0.271000	0.24616	0.002000	0.02628	0.681000	0.25320	0.218000	0.20820	-0.219000	0.12488	TCA	CAPN13	-	pfam_Calpain_domain_III,superfamily_Calpain_domain_III	ENSG00000162949		0.453	CAPN13-001	KNOWN	basic|CCDS	protein_coding	CAPN13	HGNC	protein_coding	OTTHUMT00000325101.2	24	0.00	0	G	NM_144575		30974021	30974021	-1	no_errors	ENST00000295055	ensembl	human	known	69_37n	nonsense	44	27.87	17	SNP	0.229	C
CARD11	84433	genome.wustl.edu	37	7	2979488	2979488	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:2979488C>T	ENST00000396946.4	-	6	1162	c.759G>A	c.(757-759)ctG>ctA	p.L253L		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	253					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TGTCATTCTTCAGTTTTAGAG	0.478			Mis		DLBCL																																	dbGAP		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	0													172.0	161.0	165.0					7																	2979488		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.759G>A	7.37:g.2979488C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Z7|Q2NKN7|Q548H3	Silent	SNP	pfam_CARD,superfamily_DEATH-like,superfamily_PDZ,pfscan_CARD	p.L253	ENST00000396946.4	37	c.759	CCDS5336.2	7																																																																																			CARD11	-	NULL	ENSG00000198286		0.478	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD11	HGNC	protein_coding	OTTHUMT00000059344.4	245	0.00	0	C	NM_032415		2979488	2979488	-1	no_errors	ENST00000396946	ensembl	human	known	69_37n	silent	290	11.52	38	SNP	0.593	T
CBX3	11335	genome.wustl.edu	37	7	26251371	26251371	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:26251371G>A	ENST00000337620.4	+	5	848	c.420G>A	c.(418-420)atG>atA	p.M140I	CBX3_ENST00000409747.1_3'UTR|CBX3_ENST00000396386.2_Missense_Mutation_p.M140I	NM_007276.4	NP_009207.2	Q13185	CBX3_HUMAN	chromobox homolog 3	140	Chromo 2; shadow subtype. {ECO:0000255|PROSITE-ProRule:PRU00053}.				chromatin remodeling (GO:0006338)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome, centromeric region (GO:0000779)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nuclear pericentric heterochromatin (GO:0031618)|nucleus (GO:0005634)|spindle (GO:0005819)	enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)|identical protein binding (GO:0042802)|protein domain specific binding (GO:0019904)			endometrium(4)|large_intestine(2)|lung(2)|ovary(1)	9						TGTTTCTCATGAAATGGTGAG	0.358																																						dbGAP											0													71.0	69.0	70.0					7																	26251371		2203	4300	6503	-	-	-	SO:0001583	missense	0			U26312	CCDS5398.1	7p15.2	2010-07-06	2010-06-24		ENSG00000122565	ENSG00000122565			1553	protein-coding gene	gene with protein product	"""HP1 gamma homolog (Drosophila)"""	604477	"""chromobox homolog 3 (Drosophila HP1 gamma)"""			8663349	Standard	NM_016587		Approved	HP1Hs-gamma	uc003sxu.3	Q13185	OTTHUMG00000022911	ENST00000337620.4:c.420G>A	7.37:g.26251371G>A	ENSP00000336687:p.Met140Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96CD7|Q99409|Q9BVS3|Q9P0Z6	Missense_Mutation	SNP	pfam_Chromo_shadow_dom,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Chromo_shadow_dom,pfscan_Chromo_domain/shadow,prints_Chromo_dom_subgr	p.M140I	ENST00000337620.4	37	c.420	CCDS5398.1	7	.	.	.	.	.	.	.	.	.	.	G	11.63	1.695851	0.30052	.	.	ENSG00000122565	ENST00000337620;ENST00000396386	T;T	0.39229	1.09;1.09	5.4	5.4	0.78164	Chromo shadow (1);Chromo domain-like (1);Chromo domain/shadow (2);Chromo shadow, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.29556	0.0737	N	0.19112	0.55	0.80722	D	1	B	0.12013	0.005	B	0.16289	0.015	T	0.06075	-1.0847	10	0.21014	T	0.42	.	15.8494	0.78916	0.0:0.0:0.8639:0.1361	.	140	Q13185	CBX3_HUMAN	I	140	ENSP00000336687:M140I;ENSP00000379670:M140I	ENSP00000336687:M140I	M	+	3	0	CBX3	26217896	1.000000	0.71417	1.000000	0.80357	0.593000	0.36681	6.695000	0.74593	2.706000	0.92434	0.655000	0.94253	ATG	CBX3	-	pfam_Chromo_shadow_dom,superfamily_Chromodomain-like,smart_Chromo_shadow_dom,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	ENSG00000122565		0.358	CBX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX3	HGNC	protein_coding	OTTHUMT00000214117.1	120	0.00	0	G	NM_007276		26251371	26251371	+1	no_errors	ENST00000337620	ensembl	human	known	69_37n	missense	127	16.88	26	SNP	1.000	A
CCL13	6357	genome.wustl.edu	37	17	32684555	32684555	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:32684555G>A	ENST00000225844.2	+	2	213	c.138G>A	c.(136-138)caG>caA	p.Q46Q		NM_005408.2	NP_005399.1	Q99616	CCL13_HUMAN	chemokine (C-C motif) ligand 13	46					cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|immune response (GO:0006955)|inflammatory response (GO:0006954)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)			large_intestine(1)|prostate(1)	2		Ovarian(249;0.0443)|Breast(31;0.151)				TCTCCTTGCAGAGGCTGAAGA	0.478																																						dbGAP											0													163.0	156.0	158.0					17																	32684555		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ001634	CCDS11281.1	17q11.2	2013-02-25	2002-08-22	2002-08-23	ENSG00000181374	ENSG00000181374		"""Chemokine ligands"", ""Endogenous ligands"""	10611	protein-coding gene	gene with protein product		601391	"""small inducible cytokine subfamily A (Cys-Cys), member 13"""	SCYA13		8661057	Standard	NM_005408		Approved	MCP-4, NCC-1, SCYL1, CKb10, MGC17134	uc002hic.3	Q99616	OTTHUMG00000132890	ENST00000225844.2:c.138G>A	17.37:g.32684555G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95689|Q6ICQ6	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.E18K	ENST00000225844.2	37	c.52	CCDS11281.1	17																																																																																			CCL13	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	ENSG00000181374		0.478	CCL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL13	HGNC	protein_coding	OTTHUMT00000256389.1	87	0.00	0	G	NM_005408		32684555	32684555	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000577681	ensembl	human	novel	69_37n	missense	61	32.97	30	SNP	0.000	A
CDK11B	984	genome.wustl.edu	37	1	1573894	1573894	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:1573894C>G	ENST00000407249.3	-	13	1318	c.1319G>C	c.(1318-1320)gGa>gCa	p.G440A	CDK11B_ENST00000340677.5_Missense_Mutation_p.G427A|CDK11B_ENST00000317673.7_Missense_Mutation_p.G438A|CDK11B_ENST00000341832.6_Missense_Mutation_p.G393A			P21127	CD11B_HUMAN	cyclin-dependent kinase 11B	450	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(3)|lung(4)|skin(1)|stomach(2)	12						GTAGACCACTCCATAGGTGCC	0.627																																						dbGAP											0													27.0	24.0	25.0					1																	1573894		1792	4007	5799	-	-	-	SO:0001583	missense	0			AK000081	CCDS72682.1, CCDS72683.1, CCDS72684.1	1p36.33	2013-09-24	2009-12-16	2009-12-16	ENSG00000248333	ENSG00000248333		"""Cyclin-dependent kinases"""	1729	protein-coding gene	gene with protein product		176873	"""cell division cycle 2-like 1 (PITSLRE proteins)"""	CDC2L1		1774066, 14511641, 19884882	Standard	XM_006711061		Approved	CDK11-p110, CDK11-p58, CDK11-p46	uc001agv.1	P21127	OTTHUMG00000078638	ENST00000407249.3:c.1319G>C	1.37:g.1573894C>G	ENSP00000464036:p.Gly440Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O95265|Q12817|Q12818|Q12819|Q12820|Q12822|Q8N530|Q9NZS5|Q9UBJ0|Q9UBQ1|Q9UBR0|Q9UNY2|Q9UP57|Q9UP58|Q9UP59	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.G440A	ENST00000407249.3	37	c.1319		1																																																																																			CDK11B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000248333		0.627	CDK11B-204	KNOWN	basic|appris_candidate_longest	protein_coding	CDK11B	HGNC	protein_coding		65	0.00	0	C	NM_001787		1573894	1573894	-1	no_errors	ENST00000407249	ensembl	human	known	69_37n	missense	82	21.15	22	SNP	0.998	G
CELF2	10659	genome.wustl.edu	37	10	11299828	11299828	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:11299828G>A	ENST00000379261.4	+	5	602	c.510G>A	c.(508-510)ctG>ctA	p.L170L	CELF2_ENST00000608830.1_Silent_p.L146L|CELF2_ENST00000354897.3_Silent_p.L146L|CELF2_ENST00000416382.2_Silent_p.L170L|CELF2_ENST00000537122.1_Silent_p.L59L|CELF2_ENST00000542579.1_Silent_p.L177L|CELF2_ENST00000427450.1_Silent_p.L146L|CELF2_ENST00000354440.2_Silent_p.L146L|CELF2_ENST00000399850.3_Silent_p.L146L|CELF2_ENST00000315874.4_Silent_p.L146L|CELF2_ENST00000609692.1_Silent_p.L146L|CELF2_ENST00000450189.1_Silent_p.L177L|CELF2_ENST00000417956.2_Silent_p.L146L	NM_001025077.2	NP_001020248.1	O95319	CELF2_HUMAN	CUGBP, Elav-like family member 2	170	Necessary for RNA-binding, TNNT2 exon 5 and NMDA R1 exon 21 inclusion.|RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of heart contraction (GO:0008016)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	16						CTGATGGGCTGAGTCGAGGTG	0.522																																						dbGAP											0													80.0	85.0	84.0					10																	11299828		2083	4239	6322	-	-	-	SO:0001819	synonymous_variant	0			U69546	CCDS41488.1, CCDS44354.1, CCDS44355.1, CCDS44356.1	10p13	2013-02-12	2010-02-19	2010-02-19	ENSG00000048740	ENSG00000048740		"""RNA binding motif (RRM) containing"""	2550	protein-coding gene	gene with protein product		602538	"""CUG triplet repeat, RNA-binding protein 2"", ""CUG triplet repeat, RNA binding protein 2"""	CUGBP2		7869393, 9887331	Standard	NM_006561		Approved	Etr-3, NAPOR-2, BRUNOL3	uc001ikl.4	O95319	OTTHUMG00000017668	ENST00000379261.4:c.510G>A	10.37:g.11299828G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZAN9|Q7KYU4|Q8N499|Q92950|Q96NW9|Q96RQ5|Q96RQ6|Q9UL67	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA	p.L177	ENST00000379261.4	37	c.531	CCDS44354.1	10																																																																																			CELF2	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000048740		0.522	CELF2-201	KNOWN	basic|CCDS	protein_coding	CELF2	HGNC	protein_coding		71	0.00	0	G			11299828	11299828	+1	no_errors	ENST00000450189	ensembl	human	known	69_37n	silent	83	21.70	23	SNP	1.000	A
CENPJ	55835	genome.wustl.edu	37	13	25480951	25480951	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr13:25480951C>T	ENST00000381884.4	-	7	1410	c.1225G>A	c.(1225-1227)Gac>Aac	p.D409N	CENPJ_ENST00000545981.1_Missense_Mutation_p.D409N	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	409					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		AGCGGCTGGTCCTCGGAAGTG	0.403																																						dbGAP											0													83.0	82.0	82.0					13																	25480951		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.1225G>A	13.37:g.25480951C>T	ENSP00000371308:p.Asp409Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	pfam_Tcp10/CenJ_C	p.D409N	ENST00000381884.4	37	c.1225	CCDS9310.1	13	.	.	.	.	.	.	.	.	.	.	C	11.52	1.664321	0.29604	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.18502	2.21;2.21	5.75	3.91	0.45181	.	0.443118	0.24683	N	0.036457	T	0.22898	0.0553	M	0.70595	2.14	0.26059	N	0.981371	P	0.50272	0.933	B	0.42386	0.386	T	0.13737	-1.0498	10	0.33940	T	0.23	.	15.1516	0.72703	0.0:0.7335:0.2665:0.0	.	409	Q9HC77	CENPJ_HUMAN	N	409	ENSP00000371308:D409N;ENSP00000441090:D409N	ENSP00000371308:D409N	D	-	1	0	CENPJ	24378951	0.934000	0.31675	0.977000	0.42913	0.321000	0.28281	3.217000	0.51184	1.417000	0.47077	0.655000	0.94253	GAC	CENPJ	-	NULL	ENSG00000151849		0.403	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPJ	HGNC	protein_coding	OTTHUMT00000044209.1	180	0.55	1	C	NM_018451		25480951	25480951	-1	no_errors	ENST00000381884	ensembl	human	known	69_37n	missense	96	32.87	47	SNP	0.984	T
CHD5	26038	genome.wustl.edu	37	1	6195315	6195315	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:6195315G>A	ENST00000262450.3	-	18	2944	c.2845C>T	c.(2845-2847)Cgg>Tgg	p.R949W	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		AGCTCCACCCGGACAATGAGC	0.622																																						dbGAP											0													79.0	75.0	77.0					1																	6195315		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.2845C>T	1.37:g.6195315G>A	ENSP00000262450:p.Arg949Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R949W	ENST00000262450.3	37	c.2845	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	G	19.17	3.775279	0.70107	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000536802;ENST00000538279	T	0.75821	-0.97	5.04	4.06	0.47325	SNF2-related (1);	0.000000	0.64402	D	0.000004	T	0.79106	0.4390	L	0.35341	1.055	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81261	-0.1013	10	0.87932	D	0	-20.456	13.9034	0.63819	0.0:0.0:0.7401:0.2599	.	949	Q8TDI0	CHD5_HUMAN	W	949;465;357;357	ENSP00000262450:R949W	ENSP00000262450:R949W	R	-	1	2	CHD5	6117902	0.982000	0.34865	0.788000	0.31933	0.913000	0.54294	0.912000	0.28597	2.509000	0.84616	0.561000	0.74099	CGG	CHD5	-	pfam_SNF2_N	ENSG00000116254		0.622	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	18	0.00	0	G	NM_015557		6195315	6195315	-1	no_errors	ENST00000262450	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	0.996	A
CHD6	84181	genome.wustl.edu	37	20	40045305	40045305	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr20:40045305G>A	ENST00000373233.3	-	33	6586	c.6409C>T	c.(6409-6411)Cga>Tga	p.R2137*	CHD6_ENST00000480022.1_5'Flank	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2137					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.R2137*(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				AGGCTGGTTCGAGAACCAGCA	0.587																																						dbGAP											1	Substitution - Nonsense(1)	lung(1)											66.0	60.0	62.0					20																	40045305		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.6409C>T	20.37:g.40045305G>A	ENSP00000362330:p.Arg2137*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_BRK_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R2137*	ENST00000373233.3	37	c.6409	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	G	46	12.880823	0.99703	.	.	ENSG00000124177	ENST00000373233	.	.	.	5.46	4.49	0.54785	.	0.000000	0.48767	D	0.000165	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.7328	10.8428	0.46726	0.0:0.123:0.6913:0.1856	.	.	.	.	X	2137	.	ENSP00000362330:R2137X	R	-	1	2	CHD6	39478719	0.995000	0.38212	0.996000	0.52242	0.568000	0.35870	1.667000	0.37471	1.392000	0.46585	0.655000	0.94253	CGA	CHD6	-	NULL	ENSG00000124177		0.587	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1	17	0.00	0	G			40045305	40045305	-1	no_errors	ENST00000373233	ensembl	human	known	69_37n	nonsense	36	30.77	16	SNP	0.950	A
CHKB	1120	genome.wustl.edu	37	22	51018232	51018232	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr22:51018232C>T	ENST00000406938.2	-	9	1172	c.955G>A	c.(955-957)Gag>Aag	p.E319K	CPT1B_ENST00000440709.1_5'Flank|CHKB-CPT1B_ENST00000452668.1_5'UTR|CHKB-CPT1B_ENST00000453634.1_5'Flank|CPT1B_ENST00000457250.1_5'Flank|CPT1B_ENST00000395650.2_5'Flank|CHKB_ENST00000463053.1_5'Flank|CPT1B_ENST00000434492.2_5'Flank|CPT1B_ENST00000360719.2_5'Flank|CPT1B_ENST00000312108.7_5'Flank|CPT1B_ENST00000405237.3_5'Flank	NM_005198.4	NP_005189.2	Q9Y259	CHKB_HUMAN	choline kinase beta	319					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline kinase activity (GO:0004103)|ethanolamine kinase activity (GO:0004305)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|ovary(3)|skin(1)|urinary_tract(1)	15		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	TTCTTTGCCTCTGCCAGGTAA	0.507																																						dbGAP											0													125.0	127.0	127.0					22																	51018232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029886	CCDS14099.1	22q13.33	2011-02-16	2004-04-19	2004-04-19	ENSG00000100288	ENSG00000100288			1938	protein-coding gene	gene with protein product		612395	"""choline kinase-like"""	CHKL		9224698, 15003397	Standard	NM_005198		Approved	CHETK	uc003bmv.3	Q9Y259	OTTHUMG00000150275	ENST00000406938.2:c.955G>A	22.37:g.51018232C>T	ENSP00000384400:p.Glu319Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJM6|Q13388	Splice_Site	SNP	-	NULL	ENST00000406938.2	37	c.NULL	CCDS14099.1	22	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770229	0.69992	.	.	ENSG00000100288	ENST00000406938	T	0.62788	-0.0	5.44	5.44	0.79542	Protein kinase-like domain (1);	0.112431	0.64402	D	0.000019	T	0.67776	0.2929	L	0.46567	1.45	0.58432	D	0.999996	D	0.61080	0.989	P	0.59171	0.853	T	0.60979	-0.7155	10	0.10636	T	0.68	-10.7475	16.7459	0.85471	0.0:1.0:0.0:0.0	.	319	Q9Y259	CHKB_HUMAN	K	319	ENSP00000384400:E319K	ENSP00000384400:E319K	E	-	1	0	CHKB	49365098	0.326000	0.24669	0.986000	0.45419	0.929000	0.56500	4.036000	0.57304	2.557000	0.86248	0.655000	0.94253	GAG	CHKB	-	-	ENSG00000100288		0.507	CHKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHKB	HGNC	protein_coding	OTTHUMT00000317267.3	124	0.00	0	C	NM_005198		51018232	51018232	-1	no_errors	ENST00000464225	ensembl	human	known	69_37n	splice_site	139	20.57	36	SNP	0.987	T
CIB4	130106	genome.wustl.edu	37	2	26805698	26805698	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:26805698G>A	ENST00000288861.4	-	6	575	c.522C>T	c.(520-522)ttC>ttT	p.F174F	CIB4_ENST00000405346.3_5'UTR	NM_001029881.1	NP_001025052.1	A0PJX0	CIB4_HUMAN	calcium and integrin binding family member 4	174	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTACTTCATGAAATCTGGAG	0.547																																						dbGAP											0													116.0	85.0	96.0					2																	26805698		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33160.1	2p23.3	2013-01-10			ENSG00000157884	ENSG00000157884		"""EF-hand domain containing"""	33703	protein-coding gene	gene with protein product		610646				15574431	Standard	NM_001029881		Approved		uc002rhm.3	A0PJX0	OTTHUMG00000151993	ENST00000288861.4:c.522C>T	2.37:g.26805698G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU18	Silent	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.F174	ENST00000288861.4	37	c.522	CCDS33160.1	2																																																																																			CIB4	-	NULL	ENSG00000157884		0.547	CIB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIB4	HGNC	protein_coding	OTTHUMT00000324709.1	46	0.00	0	G			26805698	26805698	-1	no_errors	ENST00000288861	ensembl	human	known	69_37n	silent	77	23.00	23	SNP	1.000	A
CIAO1	9391	genome.wustl.edu	37	2	96936858	96936858	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:96936858G>A	ENST00000488633.1	+	7	1008	c.789G>A	c.(787-789)ctG>ctA	p.L263L		NM_004804.2	NP_004795.1			cytosolic iron-sulfur assembly component 1											endometrium(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)	5						GGTGTCAGCTGACAGGGGCTC	0.557																																						dbGAP											0													80.0	74.0	76.0					2																	96936858		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U63810	CCDS2019.1	2q11.1-q11.2	2014-01-13	2014-01-13	2006-11-23	ENSG00000144021	ENSG00000144021		"""WD repeat domain containing"""	14280	protein-coding gene	gene with protein product		604333	"""WD repeat domain 39"", ""cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae)"", ""cytosolic iron-sulfur protein assembly 1"""	WDR39		9556563, 10493829	Standard	NM_004804		Approved	CIA1	uc002svs.3	O76071	OTTHUMG00000130452	ENST00000488633.1:c.789G>A	2.37:g.96936858G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L263	ENST00000488633.1	37	c.789	CCDS2019.1	2																																																																																			CIAO1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000144021		0.557	CIAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIAO1	HGNC	protein_coding	OTTHUMT00000252843.1	9	0.00	0	G	NM_004804		96936858	96936858	+1	no_errors	ENST00000488633	ensembl	human	known	69_37n	silent	22	29.03	9	SNP	1.000	A
CLDN2	9075	genome.wustl.edu	37	X	106171608	106171608	+	Silent	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:106171608C>G	ENST00000541806.1	+	2	669	c.150C>G	c.(148-150)ctC>ctG	p.L50L	CLDN2_ENST00000540876.1_Silent_p.L50L|CLDN2_ENST00000336803.1_Silent_p.L50L	NM_001171092.1	NP_001164563.1	P57739	CLD2_HUMAN	claudin 2	50					calcium-independent cell-cell adhesion (GO:0016338)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						CCAAGGGCCTCTGGATGGAAT	0.572																																						dbGAP											0													109.0	91.0	97.0					X																	106171608		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK075405	CCDS14524.1	Xq22.3-q23	2008-05-14			ENSG00000165376	ENSG00000165376		"""Claudins"""	2041	protein-coding gene	gene with protein product		300520				9892664	Standard	NM_020384		Approved		uc022ccc.1	P57739	OTTHUMG00000022154	ENST00000541806.1:c.150C>G	X.37:g.106171608C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6B9	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin2,prints_Claudin,prints_Claudin14	p.L50	ENST00000541806.1	37	c.150	CCDS14524.1	X																																																																																			CLDN2	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000165376		0.572	CLDN2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN2	HGNC	protein_coding	OTTHUMT00000057815.1	34	0.00	0	C			106171608	106171608	+1	no_errors	ENST00000336803	ensembl	human	known	69_37n	silent	52	23.53	16	SNP	1.000	G
CLDN2	9075	genome.wustl.edu	37	X	106171827	106171827	+	Silent	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:106171827C>G	ENST00000541806.1	+	2	888	c.369C>G	c.(367-369)gtC>gtG	p.V123V	CLDN2_ENST00000540876.1_Silent_p.V123V|CLDN2_ENST00000336803.1_Silent_p.V123V	NM_001171092.1	NP_001164563.1	P57739	CLD2_HUMAN	claudin 2	123					calcium-independent cell-cell adhesion (GO:0016338)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						CAGGTGGAGTCTTTTTCATCC	0.542																																						dbGAP											0													132.0	113.0	119.0					X																	106171827		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK075405	CCDS14524.1	Xq22.3-q23	2008-05-14			ENSG00000165376	ENSG00000165376		"""Claudins"""	2041	protein-coding gene	gene with protein product		300520				9892664	Standard	NM_020384		Approved		uc022ccc.1	P57739	OTTHUMG00000022154	ENST00000541806.1:c.369C>G	X.37:g.106171827C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6B9	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin2,prints_Claudin,prints_Claudin14	p.V123	ENST00000541806.1	37	c.369	CCDS14524.1	X																																																																																			CLDN2	-	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	ENSG00000165376		0.542	CLDN2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN2	HGNC	protein_coding	OTTHUMT00000057815.1	119	0.00	0	C			106171827	106171827	+1	no_errors	ENST00000336803	ensembl	human	known	69_37n	silent	147	23.44	45	SNP	0.939	G
CLDN8	9073	genome.wustl.edu	37	21	31587809	31587809	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr21:31587809G>A	ENST00000399899.1	-	1	582	c.435C>T	c.(433-435)atC>atT	p.I145I	CLDN8_ENST00000286809.1_Silent_p.I145I	NM_199328.2	NP_955360.1	P56748	CLD8_HUMAN	claudin 8	145					calcium-independent cell-cell adhesion (GO:0016338)	basolateral plasma membrane (GO:0016323)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|large_intestine(6)|lung(6)	15						AGAAATCTCTGATGATGGCAT	0.493																																						dbGAP											0													78.0	75.0	76.0					21																	31587809		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ250711	CCDS13587.1	21q22.1	2008-07-31			ENSG00000156284	ENSG00000156284		"""Claudins"""	2050	protein-coding gene	gene with protein product		611231				9892664	Standard	NM_199328		Approved		uc002ynu.2	P56748	OTTHUMG00000081872	ENST00000399899.1:c.435C>T	21.37:g.31587809G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSE3|Q53EX7	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin8,prints_Claudin14	p.I145	ENST00000399899.1	37	c.435	CCDS13587.1	21																																																																																			CLDN8	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000156284		0.493	CLDN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN8	HGNC	protein_coding	OTTHUMT00000182260.1	60	0.00	0	G	NM_199328		31587809	31587809	-1	no_errors	ENST00000286809	ensembl	human	known	69_37n	silent	70	27.84	27	SNP	1.000	A
CNBD1	168975	genome.wustl.edu	37	8	88249292	88249292	+	Missense_Mutation	SNP	C	C	G	rs375597027		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr8:88249292C>G	ENST00000518476.1	+	6	774	c.723C>G	c.(721-723)ttC>ttG	p.F241L	CNBD1_ENST00000522427.1_3'UTR	NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	241										breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						GTGAAGAATTCAAAAACTCTA	0.388																																						dbGAP											0													96.0	89.0	91.0					8																	88249292		1861	4099	5960	-	-	-	SO:0001583	missense	0			AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.723C>G	8.37:g.88249292C>G	ENSP00000430073:p.Phe241Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.F241L	ENST00000518476.1	37	c.723	CCDS55259.1	8	.	.	.	.	.	.	.	.	.	.	c	6.159	0.397535	0.11638	.	.	ENSG00000176571	ENST00000518476	T	0.21734	1.99	4.29	-8.58	0.00897	Cyclic nucleotide-binding-like (1);	1.769630	0.03037	N	0.152915	T	0.08980	0.0222	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24977	-1.0145	10	0.10636	T	0.68	3.1246	2.6468	0.04986	0.3449:0.1419:0.3686:0.1446	.	241	Q8NA66	CNBD1_HUMAN	L	241	ENSP00000430073:F241L	ENSP00000430073:F241L	F	+	3	2	CNBD1	88318408	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.193000	0.01244	-2.154000	0.00792	-0.807000	0.03187	TTC	CNBD1	-	superfamily_cNMP-bd-like	ENSG00000176571		0.388	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNBD1	HGNC	protein_coding	OTTHUMT00000375113.2	155	0.00	0	C	NM_173538		88249292	88249292	+1	no_errors	ENST00000518476	ensembl	human	known	69_37n	missense	108	20.59	28	SNP	0.000	G
CNGB1	1258	genome.wustl.edu	37	16	57994422	57994422	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:57994422C>T	ENST00000251102.8	-	9	607	c.547G>A	c.(547-549)Gag>Aag	p.E183K	CNGB1_ENST00000311183.4_Missense_Mutation_p.E183K|CNGB1_ENST00000564448.1_Missense_Mutation_p.E183K	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	183	Pro-rich.				cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						ACTGCAGGCTCATCTCTCCAG	0.632																																					Colon(156;1293 1853 16336 28962 38659)	dbGAP											0													41.0	45.0	44.0					16																	57994422		2023	4192	6215	-	-	-	SO:0001583	missense	0			AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.547G>A	16.37:g.57994422C>T	ENSP00000251102:p.Glu183Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	H3BN09|O43636|Q13059|Q14029|Q9UMG2	Missense_Mutation	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.E183K	ENST00000251102.8	37	c.547	CCDS42169.1	16	.	.	.	.	.	.	.	.	.	.	C	11.39	1.625095	0.28889	.	.	ENSG00000070729	ENST00000251102;ENST00000311183	D;T	0.97811	-4.55;0.62	3.14	1.17	0.20885	.	0.261257	0.20048	N	0.100380	D	0.92756	0.7697	L	0.32530	0.975	0.09310	N	1	P;B	0.36144	0.539;0.096	B;B	0.30029	0.11;0.014	D	0.87771	0.2605	10	0.87932	D	0	.	5.4488	0.16550	0.0:0.7543:0.0:0.2457	.	183;183	Q14028-3;Q14028	.;CNGB1_HUMAN	K	183	ENSP00000251102:E183K;ENSP00000311670:E183K	ENSP00000251102:E183K	E	-	1	0	CNGB1	56551923	0.001000	0.12720	0.008000	0.14137	0.017000	0.09413	0.110000	0.15437	0.352000	0.24053	0.609000	0.83330	GAG	CNGB1	-	NULL	ENSG00000070729		0.632	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGB1	HGNC	protein_coding	OTTHUMT00000337167.2	23	0.00	0	C	NM_001297		57994422	57994422	-1	no_errors	ENST00000251102	ensembl	human	known	69_37n	missense	39	32.76	19	SNP	0.010	T
CPT2	1376	genome.wustl.edu	37	1	53668050	53668050	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:53668050G>A	ENST00000371486.3	+	3	804	c.289G>A	c.(289-291)Gag>Aag	p.E97K	CPT2_ENST00000468572.1_3'UTR	NM_000098.2	NP_000089.1	P23786	CPT2_HUMAN	carnitine palmitoyltransferase 2	97					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	15					L-Carnitine(DB00583)|Perhexiline(DB01074)	AGAACTGCATGAGCAGCTGGT	0.403																																						dbGAP											0													110.0	107.0	108.0					1																	53668050		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002445	CCDS575.1	1p32.3	2014-01-09	2009-03-04		ENSG00000157184	ENSG00000157184	2.3.1.21		2330	protein-coding gene	gene with protein product		600650	"""carnitine palmitoyltransferase II"""	CPT1		1339389	Standard	NM_000098		Approved	CPTASE	uc001cvb.4	P23786	OTTHUMG00000008942	ENST00000371486.3:c.289G>A	1.37:g.53668050G>A	ENSP00000360541:p.Glu97Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6S0|Q5SW68|Q9BQ26	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.E97K	ENST00000371486.3	37	c.289	CCDS575.1	1	.	.	.	.	.	.	.	.	.	.	g	0.012	-1.687776	0.00738	.	.	ENSG00000157184	ENST00000371486	D	0.89552	-2.53	5.88	-4.3	0.03710	.	0.579505	0.19397	N	0.115271	T	0.76147	0.3947	N	0.21324	0.655	0.19300	N	0.999975	B	0.02656	0.0	B	0.15052	0.012	T	0.58624	-0.7604	10	0.02654	T	1	-22.9399	15.2868	0.73833	0.3266:0.0:0.6734:0.0	.	97	P23786	CPT2_HUMAN	K	97	ENSP00000360541:E97K	ENSP00000360541:E97K	E	+	1	0	CPT2	53440638	0.468000	0.25839	0.000000	0.03702	0.027000	0.11550	0.731000	0.26058	-1.725000	0.01371	-3.230000	0.00052	GAG	CPT2	-	pfam_Carn_acyl_trans	ENSG00000157184		0.403	CPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT2	HGNC	protein_coding	OTTHUMT00000024757.1	99	0.00	0	G	NM_000098		53668050	53668050	+1	no_errors	ENST00000371486	ensembl	human	known	69_37n	missense	82	27.43	31	SNP	0.001	A
CRISPLD1	83690	genome.wustl.edu	37	8	75898249	75898249	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr8:75898249C>T	ENST00000262207.4	+	2	495	c.27C>T	c.(25-27)ctC>ctT	p.L9L	CRISPLD1_ENST00000519798.1_3'UTR	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	9					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			GGGAGTGGCTCAGAGTAACCA	0.468																																						dbGAP											0													132.0	142.0	139.0					8																	75898249		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.27C>T	8.37:g.75898249C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA60|B7Z929	Silent	SNP	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.L9	ENST00000262207.4	37	c.27	CCDS6219.1	8																																																																																			CRISPLD1	-	NULL	ENSG00000121005		0.468	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	HGNC	protein_coding	OTTHUMT00000379117.1	74	0.00	0	C	NM_031461		75898249	75898249	+1	no_errors	ENST00000262207	ensembl	human	known	69_37n	silent	117	13.33	18	SNP	1.000	T
CTNNA2	1496	genome.wustl.edu	37	2	80097054	80097054	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:80097054G>T	ENST00000402739.4	+	4	583	c.578G>T	c.(577-579)aGa>aTa	p.R193I	CTNNA2_ENST00000541047.1_Missense_Mutation_p.R193I|CTNNA2_ENST00000496558.1_Missense_Mutation_p.R193I|CTNNA2_ENST00000361291.4_Missense_Mutation_p.R227I|CTNNA2_ENST00000540488.1_Missense_Mutation_p.R193I|CTNNA2_ENST00000466387.1_Missense_Mutation_p.R193I	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	193					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GCAGCAAGAAGACAACAGGTG	0.398																																						dbGAP											0													108.0	100.0	103.0					2																	80097054		1848	4107	5955	-	-	-	SO:0001583	missense	0				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.578G>T	2.37:g.80097054G>T	ENSP00000384638:p.Arg193Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.R227I	ENST00000402739.4	37	c.680		2	.	.	.	.	.	.	.	.	.	.	G	34	5.314420	0.95655	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	5.91	5.91	0.95273	Vinculin, conserved site (1);	0.053257	0.64402	D	0.000001	D	0.85186	0.5639	M	0.92555	3.32	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.997	D	0.87625	0.2512	10	0.87932	D	0	.	20.3052	0.98627	0.0:0.0:1.0:0.0	.	193;193;193	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	I	193;193;227;193;193;193	ENSP00000418191:R193I;ENSP00000419295:R193I;ENSP00000355398:R227I;ENSP00000384638:R193I;ENSP00000444675:R193I;ENSP00000441705:R193I	ENSP00000355398:R227I	R	+	2	0	CTNNA2	79950562	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.453000	0.97619	2.808000	0.96608	0.655000	0.94253	AGA	CTNNA2	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000066032		0.398	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	HGNC	protein_coding	OTTHUMT00000328511.4	97	0.00	0	G	NM_004389		80097054	80097054	+1	no_errors	ENST00000361291	ensembl	human	known	69_37n	missense	88	15.38	16	SNP	1.000	T
CTNND2	1501	genome.wustl.edu	37	5	11018106	11018106	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:11018106G>C	ENST00000304623.8	-	18	3253	c.3064C>G	c.(3064-3066)Ctg>Gtg	p.L1022V	CTNND2_ENST00000359640.2_Missense_Mutation_p.L964V|CTNND2_ENST00000503622.1_Missense_Mutation_p.L685V|CTNND2_ENST00000458100.2_Missense_Mutation_p.L589V|CTNND2_ENST00000511377.1_Missense_Mutation_p.L931V|CTNND2_ENST00000495388.2_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	1022					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						AGACTCCTCAGATCTCGGTAC	0.527																																						dbGAP											0													139.0	122.0	128.0					5																	11018106		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.3064C>G	5.37:g.11018106G>C	ENSP00000307134:p.Leu1022Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.L1022V	ENST00000304623.8	37	c.3064	CCDS3881.1	5	.	.	.	.	.	.	.	.	.	.	G	16.70	3.196537	0.58126	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000538638;ENST00000458100;ENST00000503622	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	6.17	5.3	0.74995	Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.46151	0.1378	M	0.62088	1.915	0.58432	D	0.999999	B;B;B	0.29531	0.083;0.247;0.06	B;B;B	0.28139	0.035;0.086;0.021	T	0.49123	-0.8972	10	0.87932	D	0	-9.022	11.8852	0.52598	0.0652:0.1238:0.811:0.0	.	685;614;1022	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	V	1022;964;931;117;589;685	ENSP00000307134:L1022V;ENSP00000352661:L964V;ENSP00000426510:L931V;ENSP00000391155:L589V;ENSP00000426887:L685V	ENSP00000307134:L1022V	L	-	1	2	CTNND2	11071106	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.716000	0.68437	1.616000	0.50265	0.655000	0.94253	CTG	CTNND2	-	superfamily_ARM-type_fold	ENSG00000169862		0.527	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	HGNC	protein_coding	OTTHUMT00000206999.1	76	0.00	0	G	NM_001332		11018106	11018106	-1	no_errors	ENST00000304623	ensembl	human	known	69_37n	missense	111	18.38	25	SNP	1.000	C
CUBN	8029	genome.wustl.edu	37	10	17087062	17087062	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:17087062C>G	ENST00000377833.4	-	25	3681	c.3616G>C	c.(3616-3618)Gaa>Caa	p.E1206Q		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1206	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCTTTGAATTCCAGTTCAAAT	0.453																																						dbGAP											0													188.0	175.0	179.0					10																	17087062		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.3616G>C	10.37:g.17087062C>G	ENSP00000367064:p.Glu1206Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.E1206Q	ENST00000377833.4	37	c.3616	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	C	2.685	-0.274375	0.05679	.	.	ENSG00000107611	ENST00000377833	T	0.17854	2.25	5.8	-1.04	0.10068	CUB (5);	0.637697	0.13821	N	0.360403	T	0.05960	0.0155	N	0.05012	-0.13	0.09310	N	1	B	0.20780	0.048	B	0.12837	0.008	T	0.43196	-0.9406	10	0.11794	T	0.64	.	6.7047	0.23244	0.0:0.2471:0.4207:0.3322	.	1206	O60494	CUBN_HUMAN	Q	1206	ENSP00000367064:E1206Q	ENSP00000367064:E1206Q	E	-	1	0	CUBN	17127068	0.976000	0.34144	0.030000	0.17652	0.336000	0.28762	0.727000	0.25999	0.107000	0.17824	-0.300000	0.09419	GAA	CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000107611		0.453	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	148	0.00	0	C	NM_001081		17087062	17087062	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	missense	141	17.54	30	SNP	0.002	G
CXorf30	645090	genome.wustl.edu	37	X	36379490	36379490	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:36379490C>T	ENST00000378657.4	+	15	1883	c.1235C>T	c.(1234-1236)tCt>tTt	p.S412F		NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	412										breast(1)|lung(2)|stomach(1)	4						CAATTTGAATCTGAAGCTATG	0.254																																						dbGAP											0													53.0	43.0	46.0					X																	36379490		690	1559	2249	-	-	-	SO:0001583	missense	0				CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.1235C>T	X.37:g.36379490C>T	ENSP00000367926:p.Ser412Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S412F	ENST00000378657.4	37	c.1235	CCDS55396.1	X	.	.	.	.	.	.	.	.	.	.	C	11.90	1.775681	0.31411	.	.	ENSG00000205081	ENST00000378653;ENST00000378657;ENST00000446478	T;T	0.26223	1.76;1.75	5.46	3.63	0.41609	.	0.171732	0.41097	D	0.000957	T	0.42607	0.1210	L	0.49778	1.585	0.27079	N	0.963149	D	0.89917	1.0	D	0.69479	0.964	T	0.32214	-0.9915	10	0.87932	D	0	-15.1511	12.7764	0.57451	0.2903:0.7097:0.0:0.0	.	412	A6PW82	CX030_HUMAN	F	697;412;17	ENSP00000367922:S697F;ENSP00000367926:S412F	ENSP00000367922:S697F	S	+	2	0	CXorf30	36289411	1.000000	0.71417	0.534000	0.28014	0.045000	0.14185	3.390000	0.52523	0.537000	0.28751	0.594000	0.82650	TCT	CXorf30	-	NULL	ENSG00000205081		0.254	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf30	HGNC	protein_coding		126	0.00	0	C	NP_001092313		36379490	36379490	+1	no_errors	ENST00000378657	ensembl	human	known	69_37n	missense	67	14.10	11	SNP	1.000	T
CYP11B1	1584	genome.wustl.edu	37	8	143957264	143957264	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr8:143957264C>T	ENST00000292427.4	-	6	1017	c.985G>A	c.(985-987)Gag>Aag	p.E329K	CYP11B1_ENST00000517471.1_Missense_Mutation_p.E329K|CYP11B1_ENST00000377675.3_Missense_Mutation_p.E400K	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	329					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CGAGCCAGCTCAAAGAGCGTC	0.647									Familial Hyperaldosteronism type I																													dbGAP											0													99.0	95.0	96.0					8																	143957264		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.985G>A	8.37:g.143957264C>T	ENSP00000292427:p.Glu329Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B,prints_Cyt_P450	p.E329K	ENST00000292427.4	37	c.985	CCDS6392.1	8	.	.	.	.	.	.	.	.	.	.	.	18.46	3.629358	0.67015	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.70399	-0.48;2.54;-0.48	4.42	4.42	0.53409	.	0.000000	0.51477	D	0.000087	D	0.83801	0.5333	M	0.83692	2.655	0.58432	D	0.999991	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.83531	0.0091	10	0.31617	T	0.26	.	14.8598	0.70372	0.0:1.0:0.0:0.0	.	400;329;329;329;45	Q4VAR0;Q8TDD0;Q4VAQ9;P15538;Q8N9P8	.;.;.;C11B1_HUMAN;.	K	329;329;400	ENSP00000292427:E329K;ENSP00000428043:E329K;ENSP00000366903:E400K	ENSP00000292427:E329K	E	-	1	0	CYP11B1	143954266	1.000000	0.71417	0.983000	0.44433	0.042000	0.13812	4.190000	0.58365	2.169000	0.68431	0.555000	0.69702	GAG	CYP11B1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	ENSG00000160882		0.647	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B1	HGNC	protein_coding	OTTHUMT00000379475.2	10	0.00	0	C			143957264	143957264	-1	no_errors	ENST00000292427	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	1.000	T
CYP4F3	4051	genome.wustl.edu	37	19	15757899	15757899	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:15757899C>T	ENST00000221307.8	+	4	428	c.381C>T	c.(379-381)ttC>ttT	p.F127F	CYP4F3_ENST00000585846.1_Silent_p.F127F|CYP4F3_ENST00000591058.1_Silent_p.F127F|CYP4F3_ENST00000586182.2_Silent_p.F127F	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	127					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)			endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						TCTACAGCTTCCTGAAGCCCT	0.582																																						dbGAP											0													93.0	84.0	87.0					19																	15757899		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.381C>T	19.37:g.15757899C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8Z3|O60634|Q5U740	Missense_Mutation	SNP	NULL	p.S79F	ENST00000221307.8	37	c.236	CCDS12332.1	19																																																																																			CYP4F3	-	NULL	ENSG00000186529		0.582	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CYP4F3	HGNC	protein_coding	OTTHUMT00000460819.3	116	0.00	0	C	NM_000896		15757899	15757899	+1	no_errors	ENST00000587360	ensembl	human	known	69_37n	missense	141	22.10	40	SNP	0.377	T
CYTIP	9595	genome.wustl.edu	37	2	158272514	158272514	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:158272514G>A	ENST00000264192.3	-	8	876	c.755C>T	c.(754-756)tCc>tTc	p.S252F	CYTIP_ENST00000540637.1_Missense_Mutation_p.S146F	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	252	Ser-rich.				regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						CATCGTCATGGAGCTCAGCCA	0.552																																						dbGAP											0													70.0	65.0	67.0					2																	158272514		2203	4300	6503	-	-	-	SO:0001583	missense	0			L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.755C>T	2.37:g.158272514G>A	ENSP00000264192:p.Ser252Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWH9|Q15630|Q8NE32	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S252F	ENST00000264192.3	37	c.755	CCDS2204.1	2	.	.	.	.	.	.	.	.	.	.	G	17.24	3.340535	0.60963	.	.	ENSG00000115165	ENST00000264192;ENST00000540637	T;T	0.47177	2.15;0.85	5.6	5.6	0.85130	.	0.349867	0.33875	N	0.004475	T	0.46405	0.1391	M	0.65975	2.015	0.44627	D	0.997604	B	0.25609	0.13	B	0.21917	0.037	T	0.41034	-0.9531	10	0.42905	T	0.14	-7.7978	12.5541	0.56244	0.0769:0.0:0.9231:0.0	.	252	O60759	CYTIP_HUMAN	F	252;146	ENSP00000264192:S252F;ENSP00000440801:S146F	ENSP00000264192:S252F	S	-	2	0	CYTIP	157980760	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.043000	0.49823	2.640000	0.89533	0.655000	0.94253	TCC	CYTIP	-	NULL	ENSG00000115165		0.552	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTIP	HGNC	protein_coding	OTTHUMT00000254926.1	23	0.00	0	G	NM_004288		158272514	158272514	-1	no_errors	ENST00000264192	ensembl	human	known	69_37n	missense	48	14.29	8	SNP	1.000	A
DAB2	1601	genome.wustl.edu	37	5	39375157	39375157	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:39375157C>G	ENST00000320816.6	-	14	2744	c.2277G>C	c.(2275-2277)gaG>gaC	p.E759D	DAB2_ENST00000509337.1_Missense_Mutation_p.E738D|DAB2_ENST00000545653.1_Missense_Mutation_p.E738D|DAB2_ENST00000339788.6_Missense_Mutation_p.E541D	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	759	Required for interaction with MYO6. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			CCCTATACATCTCAGAAGATA	0.368																																						dbGAP											0													90.0	96.0	94.0					5																	39375157		2203	4300	6503	-	-	-	SO:0001583	missense	0			U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.2277G>C	5.37:g.39375157C>G	ENSP00000313391:p.Glu759Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	p.E759D	ENST00000320816.6	37	c.2277	CCDS34149.1	5	.	.	.	.	.	.	.	.	.	.	C	0.311	-0.967872	0.02232	.	.	ENSG00000153071	ENST00000320816;ENST00000339788;ENST00000545653;ENST00000509337	T;T;T;T	0.34667	1.35;1.39;1.4;1.4	5.76	3.4	0.38934	.	2.092560	0.01403	N	0.013687	T	0.11623	0.0283	N	0.00483	-1.445	0.22552	N	0.998999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45071	-0.9286	10	0.02654	T	1	-4.0106	6.8454	0.23984	0.7616:0.1593:0.0791:0.0	.	759;738	P98082;P98082-3	DAB2_HUMAN;.	D	759;541;738;738	ENSP00000313391:E759D;ENSP00000345508:E541D;ENSP00000439919:E738D;ENSP00000426245:E738D	ENSP00000313391:E759D	E	-	3	2	DAB2	39410914	0.991000	0.36638	0.113000	0.21522	0.477000	0.33069	2.153000	0.42282	0.476000	0.27440	-0.271000	0.10264	GAG	DAB2	-	NULL	ENSG00000153071		0.368	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAB2	HGNC	protein_coding	OTTHUMT00000367014.1	187	0.00	0	C	NM_001343		39375157	39375157	-1	no_errors	ENST00000320816	ensembl	human	known	69_37n	missense	107	21.90	30	SNP	0.963	G
DCAF4L2	138009	genome.wustl.edu	37	8	88886087	88886087	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr8:88886087C>T	ENST00000319675.3	-	1	209	c.113G>A	c.(112-114)aGa>aAa	p.R38K		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	38										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GTTGGCGAATCTGAGGAAACC	0.517																																						dbGAP											0													89.0	81.0	84.0					8																	88886087		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.113G>A	8.37:g.88886087C>T	ENSP00000316496:p.Arg38Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R38K	ENST00000319675.3	37	c.113	CCDS6245.1	8	.	.	.	.	.	.	.	.	.	.	C	8.505	0.865178	0.17250	.	.	ENSG00000176566	ENST00000319675	T	0.60424	0.19	2.23	-3.56	0.04626	WD40 repeat-like-containing domain (1);	0.501385	0.21885	N	0.067669	T	0.25827	0.0629	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04078	-1.0979	10	0.36615	T	0.2	.	2.7322	0.05230	0.222:0.4142:0.0:0.3638	.	38	Q8NA75	DC4L2_HUMAN	K	38	ENSP00000316496:R38K	ENSP00000316496:R38K	R	-	2	0	DCAF4L2	88955203	0.074000	0.21230	0.001000	0.08648	0.034000	0.12701	0.545000	0.23268	-0.951000	0.03654	0.467000	0.42956	AGA	DCAF4L2	-	superfamily_WD40_repeat_dom	ENSG00000176566		0.517	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L2	HGNC	protein_coding	OTTHUMT00000375302.1	45	0.00	0	C	NM_152418		88886087	88886087	-1	no_errors	ENST00000319675	ensembl	human	known	69_37n	missense	75	12.79	11	SNP	0.000	T
DCTN1	1639	genome.wustl.edu	37	2	74594520	74594520	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:74594520G>A	ENST00000361874.3	-	19	2529	c.2212C>T	c.(2212-2214)Cag>Tag	p.Q738*	DCTN1_ENST00000409438.1_Nonsense_Mutation_p.Q604*|DCTN1_ENST00000409567.3_Nonsense_Mutation_p.Q718*|DCTN1_ENST00000407639.2_Nonsense_Mutation_p.Q604*|DCTN1_ENST00000409240.1_Nonsense_Mutation_p.Q701*|DCTN1_ENST00000409868.1_Nonsense_Mutation_p.Q721*|DCTN1_ENST00000394003.3_Nonsense_Mutation_p.Q731*|DCTN1_ENST00000495643.1_5'UTR	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	738					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						TCCTCAGGCTGTTCGGCAAGG	0.527																																						dbGAP											0													88.0	79.0	82.0					2																	74594520		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.2212C>T	2.37:g.74594520G>A	ENSP00000354791:p.Gln738*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Nonsense_Mutation	SNP	pfam_Dynactin,pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_Polyketide_synth_docking,pfscan_CAP-Gly_domain	p.Q738*	ENST00000361874.3	37	c.2212	CCDS1939.1	2	.	.	.	.	.	.	.	.	.	.	G	41	8.787845	0.98954	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	.	.	.	5.96	5.03	0.67393	.	0.000000	0.40818	N	0.001012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-12.4883	15.6086	0.76696	0.0:0.138:0.862:0.0	.	.	.	.	X	738;731;721;604;604;701;721;718	.	ENSP00000354791:Q738X	Q	-	1	0	DCTN1	74448028	1.000000	0.71417	0.964000	0.40570	0.995000	0.86356	5.328000	0.65887	2.833000	0.97629	0.650000	0.86243	CAG	DCTN1	-	pfam_Dynactin	ENSG00000204843		0.527	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCTN1	HGNC	protein_coding	OTTHUMT00000252227.3	70	0.00	0	G	NM_004082		74594520	74594520	-1	no_errors	ENST00000361874	ensembl	human	known	69_37n	nonsense	135	20.12	34	SNP	0.998	A
DDX26B	203522	genome.wustl.edu	37	X	134715540	134715540	+	Silent	SNP	C	C	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:134715540C>A	ENST00000370752.4	+	17	2899	c.2565C>A	c.(2563-2565)atC>atA	p.I855I	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	855										large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					TTAGTCACATCAACAGCAGAT	0.373																																						dbGAP											0													109.0	94.0	99.0					X																	134715540		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.2565C>A	X.37:g.134715540C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Silent	SNP	pfscan_VWF_A	p.I855	ENST00000370752.4	37	c.2565	CCDS35401.1	X																																																																																			DDX26B	-	NULL	ENSG00000165359		0.373	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX26B	HGNC	protein_coding	OTTHUMT00000058420.1	169	0.00	0	C	NM_182540		134715540	134715540	+1	no_errors	ENST00000370752	ensembl	human	known	69_37n	silent	140	18.60	32	SNP	1.000	A
DDX52	11056	genome.wustl.edu	37	17	35981176	35981176	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:35981176C>T	ENST00000349699.2	-	11	1540	c.1497G>A	c.(1495-1497)agG>agA	p.R499R	DDX52_ENST00000394367.3_Silent_p.R391R	NM_007010.3	NP_008941.2	Q9Y2R4	DDX52_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 52	499	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|ovary(1)|skin(3)	17		Breast(25;0.00637)|Ovarian(249;0.15)				ACTCACCTATCCTGTGGATAT	0.438																																						dbGAP											0													106.0	103.0	104.0					17																	35981176		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF077033	CCDS11323.1	17q21.1	2014-05-06			ENSG00000141141	ENSG00000278053		"""DEAD-boxes"""	20038	protein-coding gene	gene with protein product		612500				11124703	Standard	XM_006721650		Approved	ROK1	uc002hoi.2	Q9Y2R4	OTTHUMG00000188475	ENST00000349699.2:c.1497G>A	17.37:g.35981176C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YG1|Q8N213|Q9NVE0|Q9Y482	Missense_Mutation	SNP	pfam_Helicase_C,pfscan_Helicase_C	p.D15N	ENST00000349699.2	37	c.43	CCDS11323.1	17																																																																																			DDX52	-	pfam_Helicase_C,pfscan_Helicase_C	ENSG00000141141		0.438	DDX52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX52	HGNC	protein_coding	OTTHUMT00000256795.1	153	0.00	0	C	NM_152300		35981176	35981176	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000591354	ensembl	human	known	69_37n	missense	133	19.39	32	SNP	1.000	T
DDX55	57696	genome.wustl.edu	37	12	124101077	124101077	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:124101077G>A	ENST00000238146.4	+	10	1026	c.976G>A	c.(976-978)Gat>Aat	p.D326N	DDX55_ENST00000421670.3_5'Flank|DDX55_ENST00000541259.1_3'UTR|SNORA9_ENST00000384170.1_RNA|DDX55_ENST00000538744.1_Intron	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	326	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		AGTGTGCACTGATGTGATGGC	0.478																																						dbGAP											0													218.0	209.0	212.0					12																	124101077		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.976G>A	12.37:g.124101077G>A	ENSP00000238146:p.Asp326Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q658L6|Q8IYH0|Q9HCH7	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.D326N	ENST00000238146.4	37	c.976	CCDS9251.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.355360	0.95854	.	.	ENSG00000111364	ENST00000238146;ENST00000538449	T	0.05925	3.37	5.45	5.45	0.79879	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.28830	0.0715	M	0.78344	2.41	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.994	T	0.01252	-1.1405	10	0.87932	D	0	-19.5879	19.3482	0.94373	0.0:0.0:1.0:0.0	.	326;326	B4DVE4;Q8NHQ9	.;DDX55_HUMAN	N	326	ENSP00000238146:D326N	ENSP00000238146:D326N	D	+	1	0	DDX55	122667030	1.000000	0.71417	0.396000	0.26296	0.981000	0.71138	9.379000	0.97198	2.578000	0.87016	0.650000	0.86243	GAT	DDX55	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000111364		0.478	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX55	HGNC	protein_coding	OTTHUMT00000400616.2	147	0.00	0	G			124101077	124101077	+1	no_errors	ENST00000238146	ensembl	human	known	69_37n	missense	170	22.27	49	SNP	1.000	A
DDX60	55601	genome.wustl.edu	37	4	169183193	169183193	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr4:169183193C>G	ENST00000393743.3	-	24	3522	c.3231G>C	c.(3229-3231)aaG>aaC	p.K1077N	DDX60_ENST00000505393.1_5'UTR	NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1077					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TTAATTCTGCCTTTAGACTCT	0.308																																						dbGAP											0													137.0	129.0	132.0					4																	169183193		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.3231G>C	4.37:g.169183193C>G	ENSP00000377344:p.Lys1077Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PK35|Q9NVE3	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K1077N	ENST00000393743.3	37	c.3231	CCDS34097.1	4	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725088	0.48833	.	.	ENSG00000137628	ENST00000393743;ENST00000537338	T	0.34667	1.35	5.12	3.35	0.38373	.	0.000000	0.64402	D	0.000006	T	0.58004	0.2092	M	0.83953	2.67	0.35187	D	0.773062	D	0.89917	1.0	D	0.97110	1.0	T	0.69335	-0.5172	10	0.72032	D	0.01	.	7.7293	0.28777	0.0:0.7326:0.0:0.2674	.	1077	Q8IY21	DDX60_HUMAN	N	1077;169	ENSP00000377344:K1077N	ENSP00000377344:K1077N	K	-	3	2	DDX60	169419768	0.997000	0.39634	0.922000	0.36590	0.566000	0.35808	1.491000	0.35583	1.301000	0.44836	0.460000	0.39030	AAG	DDX60	-	NULL	ENSG00000137628		0.308	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX60	HGNC	protein_coding	OTTHUMT00000364622.1	391	0.00	0	C	NM_017631		169183193	169183193	-1	no_errors	ENST00000393743	ensembl	human	known	69_37n	missense	140	21.79	39	SNP	0.786	G
DENND2D	79961	genome.wustl.edu	37	1	111737258	111737258	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:111737258G>C	ENST00000357640.4	-	7	965	c.736C>G	c.(736-738)Cag>Gag	p.Q246E	DENND2D_ENST00000473682.1_5'Flank|DENND2D_ENST00000369752.5_Missense_Mutation_p.Q243E	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	246	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		GCAAAGATCTGAAGTATCTGT	0.522																																						dbGAP											0													68.0	72.0	71.0					1																	111737258		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.736C>G	1.37:g.111737258G>C	ENSP00000350266:p.Gln246Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T5V6|Q9BSU0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.Q246E	ENST00000357640.4	37	c.736	CCDS831.1	1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.300927	0.40694	.	.	ENSG00000162777	ENST00000357640;ENST00000369752	T;T	0.11169	2.8;2.8	5.79	5.79	0.91817	DENN (3);	0.219316	0.41097	D	0.000949	T	0.02649	0.0080	L	0.28115	0.83	0.28447	N	0.916539	B;B	0.18310	0.013;0.027	B;B	0.16722	0.009;0.016	T	0.37865	-0.9687	10	0.02654	T	1	-21.6466	17.5313	0.87815	0.0:0.0:1.0:0.0	.	243;246	Q9H6A0-2;Q9H6A0	.;DEN2D_HUMAN	E	246;243	ENSP00000350266:Q246E;ENSP00000358767:Q243E	ENSP00000350266:Q246E	Q	-	1	0	DENND2D	111538781	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.920000	0.56446	2.739000	0.93911	0.655000	0.94253	CAG	DENND2D	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom	ENSG00000162777		0.522	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DENND2D	HGNC	protein_coding	OTTHUMT00000034456.1	36	0.00	0	G	NM_024901		111737258	111737258	-1	no_errors	ENST00000357640	ensembl	human	known	69_37n	missense	49	23.44	15	SNP	1.000	C
DEXI	28955	genome.wustl.edu	37	16	11035707	11035707	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:11035707G>A	ENST00000331808.4	-	1	610	c.156C>T	c.(154-156)ctC>ctT	p.L52L	CLEC16A_ENST00000409790.1_5'Flank|RP11-876N24.4_ENST00000573379.1_RNA|DEXI_ENST00000469379.1_5'UTR|CLEC16A_ENST00000409552.3_5'Flank|RP11-876N24.5_ENST00000570440.1_RNA	NM_014015.3	NP_054734.2	O95424	DEXI_HUMAN	Dexi homolog (mouse)	52										endometrium(2)|lung(1)	3						GGCCCACGTTGAGGACGATGT	0.627																																						dbGAP											0													50.0	47.0	48.0					16																	11035707		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF108145	CCDS10545.1	16p13.13	2010-02-17			ENSG00000182108	ENSG00000182108			13267	protein-coding gene	gene with protein product	"""dexamethasone-induced transcript"""					11306815, 11472984	Standard	NM_014015		Approved	MYLE	uc002dal.3	O95424	OTTHUMG00000129785	ENST00000331808.4:c.156C>T	16.37:g.11035707G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAA7	Silent	SNP	prints_Dexamethasone-induced	p.L52	ENST00000331808.4	37	c.156	CCDS10545.1	16																																																																																			DEXI	-	prints_Dexamethasone-induced	ENSG00000182108		0.627	DEXI-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	DEXI	HGNC	protein_coding	OTTHUMT00000252009.1	16	0.00	0	G	NM_014015		11035707	11035707	-1	no_errors	ENST00000331808	ensembl	human	known	69_37n	silent	97	14.91	17	SNP	0.997	A
DFNA5	1687	genome.wustl.edu	37	7	24749906	24749906	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:24749906C>G	ENST00000342947.3	-	6	1224	c.799G>C	c.(799-801)Gac>Cac	p.D267H	DFNA5_ENST00000559637.1_5'UTR|DFNA5_ENST00000409970.1_Missense_Mutation_p.D103H|DFNA5_ENST00000409775.3_Missense_Mutation_p.D267H|DFNA5_ENST00000545231.1_Missense_Mutation_p.D103H|DFNA5_ENST00000419307.1_Missense_Mutation_p.D103H	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	267					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						TCTGGCATGTCTATGAATGCA	0.507																																					GBM(78;184 1250 20134 20900 23600)	dbGAP											0													136.0	130.0	132.0					7																	24749906		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.799G>C	7.37:g.24749906C>G	ENSP00000339587:p.Asp267His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	pfam_Gasdermin	p.D267H	ENST00000342947.3	37	c.799	CCDS5389.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.38|10.38	1.333874|1.333874	0.24253|0.24253	.|.	.|.	ENSG00000105928|ENSG00000105928	ENST00000342947;ENST00000419307;ENST00000545231;ENST00000409970;ENST00000409775|ENST00000415480;ENST00000446822	T;T;T;T;T|.	0.24350|.	1.86;1.86;1.86;1.86;1.86|.	5.47|5.47	4.52|4.52	0.55395|0.55395	.|.	0.198263|.	0.42294|.	D|.	0.000727|.	T|.	0.49440|.	0.1557|.	M|M	0.70595|0.70595	2.14|2.14	0.09310|0.09310	N|N	1|1	B|.	0.34349|.	0.45|.	B|.	0.36244|.	0.22|.	T|.	0.44967|.	-0.9293|.	10|.	0.23302|.	T|.	0.38|.	-30.1723|-30.1723	7.3546|7.3546	0.26711|0.26711	0.2366:0.6127:0.1507:0.0|0.2366:0.6127:0.1507:0.0	.|.	267|.	O60443|.	DFNA5_HUMAN|.	H|Y	267;103;103;103;267|55;91	ENSP00000339587:D267H;ENSP00000401332:D103H;ENSP00000442661:D103H;ENSP00000387119:D103H;ENSP00000386670:D267H|.	ENSP00000339587:D267H|.	D|X	-|-	1|3	0|2	DFNA5|DFNA5	24716431|24716431	0.219000|0.219000	0.23619|0.23619	0.223000|0.223000	0.23860|0.23860	0.179000|0.179000	0.23085|0.23085	1.388000|1.388000	0.34442|0.34442	2.547000|2.547000	0.85894|0.85894	0.563000|0.563000	0.77884|0.77884	GAC|TAG	DFNA5	-	pfam_Gasdermin	ENSG00000105928		0.507	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNA5	HGNC	protein_coding	OTTHUMT00000214060.2	41	0.00	0	C	NM_004403		24749906	24749906	-1	no_errors	ENST00000342947	ensembl	human	known	69_37n	missense	83	22.43	24	SNP	0.016	G
DFNB31	25861	genome.wustl.edu	37	9	117188600	117188600	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr9:117188600T>A	ENST00000362057.3	-	4	1225	c.1057A>T	c.(1057-1059)Atc>Ttc	p.I353F	DFNB31_ENST00000374059.3_5'Flank|DFNB31_ENST00000265134.6_5'UTR	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	353	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ACTGTCAGGATGAGGTGCCGA	0.587																																						dbGAP											0													96.0	82.0	87.0					9																	117188600		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.1057A>T	9.37:g.117188600T>A	ENSP00000354623:p.Ile353Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.I353F	ENST00000362057.3	37	c.1057	CCDS6806.1	9	.	.	.	.	.	.	.	.	.	.	T	20.2	3.954717	0.73902	.	.	ENSG00000095397	ENST00000362057	T	0.26957	1.7	5.05	5.05	0.67936	PDZ/DHR/GLGF (3);	0.212785	0.47093	D	0.000244	T	0.27027	0.0662	N	0.16166	0.38	0.80722	D	1	P;P	0.46578	0.676;0.88	P;P	0.54815	0.659;0.761	T	0.06058	-1.0848	10	0.26408	T	0.33	-15.39	14.7867	0.69808	0.0:0.0:0.0:1.0	.	353;353	B9EGE6;Q9P202	.;WHRN_HUMAN	F	353	ENSP00000354623:I353F	ENSP00000354623:I353F	I	-	1	0	DFNB31	116228421	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.672000	0.54583	1.913000	0.55393	0.459000	0.35465	ATC	DFNB31	-	pfam_PDZ,superfamily_PDZ,smart_PDZ	ENSG00000095397		0.587	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNB31	HGNC	protein_coding	OTTHUMT00000053776.2	17	0.00	0	T	NM_015404		117188600	117188600	-1	no_errors	ENST00000362057	ensembl	human	known	69_37n	missense	48	21.31	13	SNP	1.000	A
DHX38	9785	genome.wustl.edu	37	16	72133171	72133171	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:72133171G>A	ENST00000268482.3	+	7	1461	c.952G>A	c.(952-954)Gac>Aac	p.D318N	DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	318					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				GTGGGAAGATGACCAGAGGGT	0.562																																					Melanoma(97;711 1442 7855 13832 28836)	dbGAP											0													51.0	38.0	43.0					16																	72133171		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.952G>A	16.37:g.72133171G>A	ENSP00000268482:p.Asp318Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVG8|D3DWS7|O75212|Q96HN7	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D318N	ENST00000268482.3	37	c.952	CCDS10907.1	16	.	.	.	.	.	.	.	.	.	.	G	21.4	4.145398	0.77888	.	.	ENSG00000140829	ENST00000268482	T	0.02916	4.11	4.27	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.04048	0.0113	L	0.56124	1.755	0.80722	D	1	P	0.40638	0.725	B	0.32211	0.142	T	0.52343	-0.8588	10	0.41790	T	0.15	.	17.066	0.86559	0.0:0.0:1.0:0.0	.	318	Q92620	PRP16_HUMAN	N	318	ENSP00000268482:D318N	ENSP00000268482:D318N	D	+	1	0	DHX38	70690672	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.178000	0.94855	2.093000	0.63338	0.557000	0.71058	GAC	DHX38	-	NULL	ENSG00000140829		0.562	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX38	HGNC	protein_coding	OTTHUMT00000269004.3	27	0.00	0	G	NM_014003		72133171	72133171	+1	no_errors	ENST00000268482	ensembl	human	known	69_37n	missense	22	46.34	19	SNP	1.000	A
DHX57	90957	genome.wustl.edu	37	2	39050344	39050344	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:39050344G>C	ENST00000295373.6	-	17	3208	c.3082C>G	c.(3082-3084)Cca>Gca	p.P1028A		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	1028							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				TCGGTGTGTGGAGGTTCAATG	0.383																																					Melanoma(191;1090 2095 4375 23729 47341)	dbGAP											0													81.0	83.0	82.0					2																	39050344		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.3082C>G	2.37:g.39050344G>C	ENSP00000295373:p.Pro1028Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	pfam_RWD-domain,pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Znf_CCCH,superfamily_UBA-like,superfamily_UBQ-conjugating_enzyme/RWD,smart_Znf_CCCH,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P1028A	ENST00000295373.6	37	c.3082	CCDS1800.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.9|24.9	4.577473|4.577473	0.86645|0.86645	.|.	.|.	ENSG00000163214|ENSG00000163214	ENST00000295373|ENST00000452978	T|.	0.03212|.	4.01|.	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	0.000000|.	0.52532|.	D|.	0.000078|.	D|D	0.88070|0.88070	0.6338|0.6338	H|H	0.95679|0.95679	3.705|3.705	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.91124|0.91124	0.4932|0.4932	10|5	0.87932|.	D|.	0|.	.|.	19.6758|19.6758	0.95932|0.95932	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1028;420|.	Q6P158;Q59G60|.	DHX57_HUMAN;.|.	A|C	1028|351	ENSP00000295373:P1028A|.	ENSP00000295373:P1028A|.	P|S	-|-	1|2	0|0	DHX57|DHX57	38903848|38903848	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.785000|0.785000	0.44390|0.44390	9.731000|9.731000	0.98807|0.98807	2.644000|2.644000	0.89710|0.89710	0.561000|0.561000	0.74099|0.74099	CCA|TCC	DHX57	-	NULL	ENSG00000163214		0.383	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX57	HGNC	protein_coding	OTTHUMT00000219940.2	60	0.00	0	G	NM_145646		39050344	39050344	-1	no_errors	ENST00000295373	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	1.000	C
DIP2B	57609	genome.wustl.edu	37	12	51076995	51076995	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:51076995G>A	ENST00000301180.5	+	10	1315	c.1281G>A	c.(1279-1281)gtG>gtA	p.V427V		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	427						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						TGGCAGAAGTGATTCCAGTGC	0.423																																						dbGAP											0													184.0	173.0	177.0					12																	51076995		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.1281G>A	12.37:g.51076995G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6B011|Q8N1L5|Q8NB38	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.V427	ENST00000301180.5	37	c.1281	CCDS31799.1	12																																																																																			DIP2B	-	pfam_AMP-dep_Synth/Lig	ENSG00000066084		0.423	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	HGNC	protein_coding	OTTHUMT00000404243.1	223	0.00	0	G	NM_173602		51076995	51076995	+1	no_errors	ENST00000301180	ensembl	human	known	69_37n	silent	226	16.54	45	SNP	1.000	A
DNAH2	146754	genome.wustl.edu	37	17	7691442	7691442	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:7691442C>T	ENST00000572933.1	+	44	8240	c.6780C>T	c.(6778-6780)ctC>ctT	p.L2260L	DNAH2_ENST00000389173.2_Silent_p.L2260L			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2260	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TCGAAAAGCTCATCAACAAGA	0.547																																						dbGAP											0													70.0	63.0	66.0					17																	7691442		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.6780C>T	17.37:g.7691442C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.L2260	ENST00000572933.1	37	c.6780	CCDS32551.1	17																																																																																			DNAH2	-	NULL	ENSG00000183914		0.547	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	36	0.00	0	C	NM_020877		7691442	7691442	+1	no_errors	ENST00000389173	ensembl	human	known	69_37n	silent	47	31.43	22	SNP	1.000	T
DNAH7	56171	genome.wustl.edu	37	2	196699060	196699060	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:196699060C>G	ENST00000312428.6	-	48	9070	c.8970G>C	c.(8968-8970)atG>atC	p.M2990I		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2990	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GAGGATCTATCATCAGAGGCC	0.398																																						dbGAP											0													122.0	110.0	114.0					2																	196699060		1879	4124	6003	-	-	-	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.8970G>C	2.37:g.196699060C>G	ENSP00000311273:p.Met2990Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.M2990I	ENST00000312428.6	37	c.8970	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811675	0.90707	.	.	ENSG00000118997	ENST00000312428	T	0.20598	2.06	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.35711	0.0941	L	0.54323	1.7	0.80722	D	1	P	0.36110	0.537	P	0.46917	0.531	T	0.02208	-1.1195	10	0.52906	T	0.07	.	19.6745	0.95926	0.0:1.0:0.0:0.0	.	2990	Q8WXX0	DYH7_HUMAN	I	2990	ENSP00000311273:M2990I	ENSP00000311273:M2990I	M	-	3	0	DNAH7	196407305	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.651000	0.83577	2.880000	0.98712	0.650000	0.86243	ATG	DNAH7	-	NULL	ENSG00000118997		0.398	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	180	0.00	0	C	NM_018897		196699060	196699060	-1	no_errors	ENST00000312428	ensembl	human	known	69_37n	missense	132	17.50	28	SNP	1.000	G
DNAH7	56171	genome.wustl.edu	37	2	196825113	196825113	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:196825113G>C	ENST00000312428.6	-	18	2862	c.2762C>G	c.(2761-2763)tCt>tGt	p.S921C		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	921	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TTCTCTATAAGAATGGATGAC	0.368																																						dbGAP											0													125.0	123.0	124.0					2																	196825113		1867	4105	5972	-	-	-	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.2762C>G	2.37:g.196825113G>C	ENSP00000311273:p.Ser921Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.S921C	ENST00000312428.6	37	c.2762	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	G	16.55	3.154046	0.57259	.	.	ENSG00000118997	ENST00000312428	T	0.62105	0.05	5.64	5.64	0.86602	Dynein heavy chain, domain-2 (1);	0.490984	0.21880	N	0.067760	T	0.67505	0.2900	L	0.61036	1.89	0.46774	D	0.999194	P	0.42993	0.797	P	0.45829	0.494	T	0.71377	-0.4611	10	0.87932	D	0	.	16.6861	0.85306	0.0:0.1293:0.8707:0.0	.	921	Q8WXX0	DYH7_HUMAN	C	921	ENSP00000311273:S921C	ENSP00000311273:S921C	S	-	2	0	DNAH7	196533358	0.242000	0.23868	0.925000	0.36789	0.967000	0.64934	2.840000	0.48215	2.661000	0.90470	0.585000	0.79938	TCT	DNAH7	-	pfam_Dynein_heavy_dom-2	ENSG00000118997		0.368	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	95	0.00	0	G	NM_018897		196825113	196825113	-1	no_errors	ENST00000312428	ensembl	human	known	69_37n	missense	77	14.44	13	SNP	0.224	C
DROSHA	29102	genome.wustl.edu	37	5	31409170	31409170	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:31409170G>C	ENST00000511367.2	-	32	4091	c.3847C>G	c.(3847-3849)Ctg>Gtg	p.L1283V	DROSHA_ENST00000513349.1_Missense_Mutation_p.L1246V|DROSHA_ENST00000344624.3_Missense_Mutation_p.L1283V|DROSHA_ENST00000442743.1_Missense_Mutation_p.L1246V	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	1283	DRBM.|Necessary for interaction with DGCR8 and pri-miRNA processing activity.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						TACTTGTACAGAGGAATGTCT	0.453																																						dbGAP											0													67.0	65.0	66.0					5																	31409170		1912	4150	6062	-	-	-	SO:0001583	missense	0			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.3847C>G	5.37:g.31409170G>C	ENSP00000425979:p.Leu1283Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_Ds-RNA-bd,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd,pfscan_RNase_III_dom	p.L1283V	ENST00000511367.2	37	c.3847	CCDS47195.1	5	.	.	.	.	.	.	.	.	.	.	G	9.149	1.015840	0.19355	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	5.52	3.73	0.42828	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.000000	0.64402	D	0.000001	T	0.48484	0.1502	N	0.01202	-0.96	0.80722	D	1	B;B	0.18310	0.027;0.024	B;B	0.24701	0.055;0.055	T	0.34800	-0.9814	10	0.10377	T	0.69	-12.0059	11.1522	0.48466	0.1497:0.0:0.8503:0.0	.	1246;1283	E7EMP9;Q9NRR4	.;RNC_HUMAN	V	1283;1283;1246;1246;1208	ENSP00000425979:L1283V;ENSP00000339845:L1283V;ENSP00000409335:L1246V;ENSP00000424161:L1246V	ENSP00000265075:L1208V	L	-	1	2	DROSHA	31444927	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.047000	0.49854	0.699000	0.31761	-0.136000	0.14681	CTG	DROSHA	-	pfam_Ds-RNA-bd,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	ENSG00000113360		0.453	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	HGNC	protein_coding	OTTHUMT00000366561.3	59	0.00	0	G	NM_013235		31409170	31409170	-1	no_errors	ENST00000344624	ensembl	human	known	69_37n	missense	50	21.88	14	SNP	1.000	C
DSE	29940	genome.wustl.edu	37	6	116757151	116757151	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:116757151C>T	ENST00000331677.3	+	7	1964	c.1520C>T	c.(1519-1521)tCa>tTa	p.S507L	DSE_ENST00000537543.1_Missense_Mutation_p.S526L|DSE_ENST00000359564.2_Missense_Mutation_p.S507L|DSE_ENST00000452085.3_Missense_Mutation_p.S507L			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	507					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		GAAGACTGCTCATCAAAATGG	0.488																																						dbGAP											0													67.0	64.0	65.0					6																	116757151		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.1520C>T	6.37:g.116757151C>T	ENSP00000332151:p.Ser507Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R3K6	Missense_Mutation	SNP	superfamily_Chondroitin_lyas	p.S526L	ENST00000331677.3	37	c.1577	CCDS5107.1	6	.	.	.	.	.	.	.	.	.	.	C	13.38	2.219123	0.39201	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	5.79	5.79	0.91817	.	0.181804	0.49916	D	0.000140	T	0.11922	0.0290	L	0.36672	1.1	0.43203	D	0.995059	B;B	0.24426	0.103;0.103	B;B	0.25140	0.058;0.039	T	0.04678	-1.0934	10	0.33141	T	0.24	-9.9321	20.0384	0.97572	0.0:1.0:0.0:0.0	.	526;507	B7Z765;Q9UL01	.;DSE_HUMAN	L	507;526;507;507	ENSP00000404049:S507L;ENSP00000441152:S526L;ENSP00000332151:S507L;ENSP00000352567:S507L	ENSP00000332151:S507L	S	+	2	0	DSE	116863844	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.023000	0.64084	2.748000	0.94277	0.650000	0.86243	TCA	DSE	-	NULL	ENSG00000111817		0.488	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DSE	HGNC	protein_coding	OTTHUMT00000041940.2	33	0.00	0	C	NM_013352		116757151	116757151	+1	no_errors	ENST00000537543	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	0.997	T
DZIP3	9666	genome.wustl.edu	37	3	108407718	108407718	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:108407718C>T	ENST00000361582.3	+	31	3693	c.3463C>T	c.(3463-3465)Ctg>Ttg	p.L1155L	DZIP3_ENST00000463306.1_Silent_p.L1155L	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	1155					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						TCATGAGAATCTGTCTCCAGA	0.368																																						dbGAP											0													112.0	106.0	108.0					3																	108407718		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.3463C>T	3.37:g.108407718C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L1155	ENST00000361582.3	37	c.3463	CCDS2952.1	3																																																																																			DZIP3	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000198919		0.368	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DZIP3	HGNC	protein_coding	OTTHUMT00000353968.1	152	0.00	0	C	NM_014648		108407718	108407718	+1	no_errors	ENST00000361582	ensembl	human	known	69_37n	silent	139	20.11	35	SNP	0.997	T
EDN3	1908	genome.wustl.edu	37	20	57876668	57876668	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr20:57876668G>A	ENST00000337938.2	+	2	642	c.256G>A	c.(256-258)Gag>Aag	p.E86K	EDN3_ENST00000371028.2_Missense_Mutation_p.E86K|EDN3_ENST00000395654.3_Missense_Mutation_p.E86K|EDN3_ENST00000311585.7_Missense_Mutation_p.E86K|EDN3_ENST00000371025.3_Missense_Mutation_p.E86K	NM_207034.1	NP_996917.1	P14138	EDN3_HUMAN	endothelin 3	86					blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inositol phosphate-mediated signaling (GO:0048016)|melanocyte differentiation (GO:0030318)|multicellular organismal development (GO:0007275)|neural crest cell migration (GO:0001755)|neuron differentiation (GO:0030182)|neutrophil chemotaxis (GO:0030593)|peptide hormone secretion (GO:0030072)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|regulation of developmental pigmentation (GO:0048070)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|signal transduction (GO:0007165)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	19	all_lung(29;0.0115)					GCAGGCGGCCGAGGGGGCCCC	0.647																																						dbGAP											0													77.0	73.0	74.0					20																	57876668		2203	4299	6502	-	-	-	SO:0001583	missense	0			X52001	CCDS13477.1, CCDS13478.1, CCDS13479.1	20q13.2-q13.3	2013-02-26			ENSG00000124205	ENSG00000124205		"""Endogenous ligands"""	3178	protein-coding gene	gene with protein product		131242					Standard	NM_000114		Approved	ET3	uc002yaq.3	P14138	OTTHUMG00000032867	ENST00000337938.2:c.256G>A	20.37:g.57876668G>A	ENSP00000337128:p.Glu86Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5I5|Q03229|Q7Z6D2|Q9UGT7	Missense_Mutation	SNP	pfam_Endothln-like_toxin,smart_Endothln-like_toxin,prints_Bibrotoxin/Sarafotoxin-D	p.E86K	ENST00000337938.2	37	c.256	CCDS13477.1	20	.	.	.	.	.	.	.	.	.	.	G	1.272	-0.612813	0.03690	.	.	ENSG00000124205	ENST00000337938;ENST00000311585;ENST00000371028;ENST00000371025;ENST00000395654	D;D;D;D;D	0.87103	-2.21;-2.21;-2.21;-2.21;-2.21	4.0	-8.0	0.01126	.	0.951130	0.08591	N	0.923062	T	0.58595	0.2133	N	0.01874	-0.695	0.09310	N	1	B;B;B;B	0.10296	0.001;0.003;0.0;0.001	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.57791	-0.7750	10	0.07325	T	0.83	-5.7784	6.8432	0.23975	0.3969:0.2672:0.3359:0.0	.	86;86;86;86	P14138-2;Q7Z6D2;P14138;Q4FAT2	.;.;EDN3_HUMAN;.	K	86	ENSP00000337128:E86K;ENSP00000311854:E86K;ENSP00000360067:E86K;ENSP00000360064:E86K;ENSP00000379015:E86K	ENSP00000311854:E86K	E	+	1	0	EDN3	57310063	0.007000	0.16637	0.000000	0.03702	0.003000	0.03518	1.277000	0.33167	-1.621000	0.01562	-0.448000	0.05591	GAG	EDN3	-	NULL	ENSG00000124205		0.647	EDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EDN3	HGNC	protein_coding	OTTHUMT00000079919.2	11	0.00	0	G	NM_000114		57876668	57876668	+1	no_errors	ENST00000337938	ensembl	human	known	69_37n	missense	38	18.75	9	SNP	0.000	A
EME1	146956	genome.wustl.edu	37	17	48456488	48456488	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:48456488G>A	ENST00000338165.4	+	6	1215	c.1133G>A	c.(1132-1134)aGa>aAa	p.R378K	EME1_ENST00000511648.2_Missense_Mutation_p.R391K|EME1_ENST00000393271.2_Missense_Mutation_p.R391K	NM_152463.2	NP_689676.2	Q96AY2	EME1_HUMAN	essential meiotic structure-specific endonuclease 1	378					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	19	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			CCTCCAAGAAGAGGGAAACAG	0.517								Direct reversal of damage;Homologous recombination																														dbGAP											0													104.0	106.0	105.0					17																	48456488		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016470	CCDS11565.1, CCDS54141.1	17q21.33	2013-07-03	2013-07-03			ENSG00000154920			24965	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog A (S. cerevisiae)"""	610885	"""essential meiotic endonuclease 1 homolog 1 (S. pombe)"""			12721304	Standard	NM_001166131		Approved	FLJ31364, MMS4L, SLX2A	uc010dbp.2	Q96AY2		ENST00000338165.4:c.1133G>A	17.37:g.48456488G>A	ENSP00000339897:p.Arg378Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96N62	Missense_Mutation	SNP	pfam_ERCC4_domain,smart_ERCC4_domain	p.R391K	ENST00000338165.4	37	c.1172	CCDS11565.1	17	.	.	.	.	.	.	.	.	.	.	G	3.095	-0.185934	0.06340	.	.	ENSG00000154920	ENST00000338165;ENST00000393271;ENST00000511648	T;T;T	0.26067	1.76;2.95;2.95	4.76	1.7	0.24286	ERCC4 domain (2);	0.642524	0.16371	N	0.217314	T	0.17831	0.0428	L	0.48362	1.52	0.34054	D	0.656517	B;B	0.12013	0.005;0.001	B;B	0.09377	0.004;0.004	T	0.17137	-1.0379	10	0.16896	T	0.51	10.4697	5.9531	0.19259	0.3694:0.0:0.6306:0.0	.	391;378	Q96AY2-2;Q96AY2	.;EME1_HUMAN	K	378;391;391	ENSP00000339897:R378K;ENSP00000376952:R391K;ENSP00000421700:R391K	ENSP00000339897:R378K	R	+	2	0	EME1	45811487	0.959000	0.32827	0.917000	0.36280	0.010000	0.07245	0.102000	0.15272	0.727000	0.32360	-0.143000	0.13931	AGA	EME1	-	pfam_ERCC4_domain,smart_ERCC4_domain	ENSG00000154920		0.517	EME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EME1	HGNC	protein_coding	OTTHUMT00000367118.3	89	0.00	0	G	NM_152463		48456488	48456488	+1	no_errors	ENST00000393271	ensembl	human	known	69_37n	missense	154	13.41	24	SNP	0.420	A
EML6	400954	genome.wustl.edu	37	2	55126862	55126862	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:55126862C>A	ENST00000356458.6	+	21	3587	c.3067C>A	c.(3067-3069)Cgc>Agc	p.R1023S		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	1023						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						TAAAACACTTCGCATCTGGGA	0.498																																						dbGAP											0													97.0	90.0	92.0					2																	55126862		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.3067C>A	2.37:g.55126862C>A	ENSP00000348842:p.Arg1023Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUB5|B6ZDG7	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1023S	ENST00000356458.6	37	c.3067	CCDS46286.1	2	.	.	.	.	.	.	.	.	.	.	C	23.5	4.423750	0.83667	.	.	ENSG00000214595	ENST00000356458	T	0.67345	-0.26	6.03	6.03	0.97812	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.44483	U	0.000454	D	0.87176	0.6112	M	0.92459	3.31	0.51482	D	0.999928	D	0.89917	1.0	D	0.97110	1.0	D	0.88748	0.3248	10	0.72032	D	0.01	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	1023	Q6ZMW3	EMAL6_HUMAN	S	1023	ENSP00000348842:R1023S	ENSP00000348842:R1023S	R	+	1	0	EML6	54980366	0.941000	0.31946	0.957000	0.39632	0.821000	0.46438	1.601000	0.36773	2.861000	0.98227	0.655000	0.94253	CGC	EML6	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000214595		0.498	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EML6	HGNC	protein_coding	OTTHUMT00000324997.3	31	0.00	0	C	XM_001725002		55126862	55126862	+1	no_errors	ENST00000356458	ensembl	human	novel	69_37n	missense	32	30.43	14	SNP	0.997	A
ZBTB8B	728116	genome.wustl.edu	37	1	32950879	32950879	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:32950879G>C	ENST00000609129.1	+	4	1426	c.1348G>C	c.(1348-1350)Gaa>Caa	p.E450Q	RP1-27O5.3_ENST00000480336.1_Missense_Mutation_p.E450Q	NM_001145720.1	NP_001139192.1	Q8NAP8	ZBT8B_HUMAN	zinc finger and BTB domain containing 8B	450					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)	1						GGCTTCATCTGAAAGCCAAGA	0.502																																						dbGAP											0													90.0	78.0	82.0					1																	32950879		692	1591	2283	-	-	-	SO:0001583	missense	0			AL442095	CCDS44104.1	1p35.1	2013-01-08			ENSG00000215897	ENSG00000273274		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	37057	protein-coding gene	gene with protein product							Standard	NM_001145720		Approved	RP1-27O5.1, DKFZp547H154, ZNF916B	uc001bvl.4	Q8NAP8	OTTHUMG00000167087	ENST00000609129.1:c.1348G>C	1.37:g.32950879G>C	ENSP00000476499:p.Glu450Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15DG5|Q5VXR5|Q69YT7	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E450Q	ENST00000609129.1	37	c.1348	CCDS44104.1	1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.164012	0.57476	.	.	ENSG00000215897	ENST00000415091	T	0.12984	2.63	5.24	4.32	0.51571	.	0.110677	0.64402	D	0.000014	T	0.18002	0.0432	L	0.36672	1.1	0.43175	D	0.994989	D	0.63046	0.992	P	0.52793	0.709	T	0.05582	-1.0876	10	0.14656	T	0.56	.	15.2068	0.73186	0.0:0.0:0.8581:0.1419	.	450	Q8NAP8	ZBT8B_HUMAN	Q	450	ENSP00000400836:E450Q	ENSP00000435749:E450Q	E	+	1	0	ZBTB8B	32723466	1.000000	0.71417	0.245000	0.24217	0.210000	0.24377	6.929000	0.75852	1.529000	0.49120	0.655000	0.94253	GAA	RP1-27O5.3	-	NULL	ENSG00000254553		0.502	ZBTB8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254553	Clone_based_vega_gene	protein_coding	OTTHUMT00000392986.2	58	0.00	0	G	NM_001145720		32950879	32950879	+1	no_errors	ENST00000480336	ensembl	human	known	69_37n	missense	39	38.10	24	SNP	0.981	C
EPGN	255324	genome.wustl.edu	37	4	75174841	75174841	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr4:75174841G>A	ENST00000413830.1	+	2	136	c.75G>A	c.(73-75)gtG>gtA	p.V25V	EPGN_ENST00000505212.1_Silent_p.V25V|EPGN_ENST00000503098.1_Silent_p.V25V|EPGN_ENST00000509145.1_Intron|EPGN_ENST00000514968.1_Silent_p.V25V|EPGN_ENST00000502358.1_Silent_p.V25V|EPGN_ENST00000332112.4_Silent_p.V25V	NM_001270989.1	NP_001257918.1	Q6UW88	EPGN_HUMAN	epithelial mitogen	25					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|MAP kinase kinase activity (GO:0004708)			breast(3)|liver(1)|lung(1)|skin(1)	6			Lung(101;0.196)			AGGCAGCCGTGACTGTAACAC	0.423																																						dbGAP											0													130.0	127.0	128.0					4																	75174841		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS59475.1, CCDS59476.1, CCDS59477.1, CCDS59478.1, CCDS59479.1	4q13.3	2012-12-07	2012-12-07						17470	protein-coding gene	gene with protein product			"""epithelial mitogen homolog (mouse)"""				Standard	NM_001270989		Approved	epigen, EPG, PRO9904, ALGV3072	uc003hic.2	Q6UW88		ENST00000413830.1:c.75G>A	4.37:g.75174841G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1BMM3|A1BMM4|A1BMM5|A1BMM6|A1BMM7|A1BMM8|A8K090	Missense_Mutation	SNP	pfscan_EG-like_dom	p.D10N	ENST00000413830.1	37	c.28	CCDS59478.1	4	.	.	.	.	.	.	.	.	.	.	G	6.201	0.405158	0.11754	.	.	ENSG00000182585	ENST00000446430	.	.	.	5.64	1.97	0.26223	.	.	.	.	.	T	0.36717	0.0977	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23691	-1.0181	4	.	.	.	0.3666	10.2592	0.43416	0.0915:0.6109:0.2977:0.0	.	.	.	.	N	10	.	.	D	+	1	0	EPGN	75393705	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	0.114000	0.15520	0.115000	0.18071	-0.262000	0.10625	GAC	EPGN	-	NULL	ENSG00000182585		0.423	EPGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPGN	HGNC	protein_coding	OTTHUMT00000362738.1	42	0.00	0	G	NM_001013442		75174841	75174841	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000446430	ensembl	human	novel	69_37n	missense	58	13.24	9	SNP	0.000	A
ERCC6	2074	genome.wustl.edu	37	10	50678496	50678496	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:50678496C>T	ENST00000355832.5	-	18	3588	c.3510G>A	c.(3508-3510)gaG>gaA	p.E1170E	ERCC6_ENST00000542458.1_Silent_p.E540E|ERCC6_ENST00000465653.1_5'Flank|RP11-123B3.2_ENST00000423283.1_RNA	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	1170					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TTTGTTTATTCTCCCAAAAAG	0.373								Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													94.0	96.0	95.0					10																	50678496		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.3510G>A	10.37:g.50678496C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX94|Q5W0L9	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E1170	ENST00000355832.5	37	c.3510	CCDS7229.1	10																																																																																			ERCC6	-	NULL	ENSG00000225830		0.373	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6	HGNC	protein_coding	OTTHUMT00000047990.1	155	0.00	0	C	NM_000124		50678496	50678496	-1	no_errors	ENST00000355832	ensembl	human	known	69_37n	silent	151	12.72	22	SNP	0.017	T
ERCC6	2074	genome.wustl.edu	37	10	50736490	50736490	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:50736490C>G	ENST00000355832.5	-	4	703	c.625G>C	c.(625-627)Gat>Cat	p.D209H	PGBD3_ENST00000603152.1_Missense_Mutation_p.D209H|ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.D209H|ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.D209H	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	209					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CTGGCGTGATCTAGTTCAATT	0.458								Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													233.0	195.0	208.0					10																	50736490		2203	4300	6503	-	-	-	SO:0001583	missense	0			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.625G>C	10.37:g.50736490C>G	ENSP00000348089:p.Asp209His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX94|Q5W0L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D209H	ENST00000355832.5	37	c.625	CCDS7229.1	10	.	.	.	.	.	.	.	.	.	.	C	19.14	3.769988	0.69992	.	.	ENSG00000225830;ENSG00000258838;ENSG00000258838	ENST00000355832;ENST00000515869;ENST00000447839	D;T;T	0.83914	-1.78;3.22;3.22	5.51	4.51	0.55191	.	.	.	.	.	D	0.85191	0.5640	L	0.54323	1.7	0.27811	N	0.942125	D;P	0.67145	0.996;0.877	P;P	0.56700	0.804;0.46	T	0.77324	-0.2630	9	0.45353	T	0.12	-11.6858	10.3247	0.43785	0.0:0.8479:0.0:0.1521	.	209;209	E7EV46;Q03468	.;ERCC6_HUMAN	H	209	ENSP00000348089:D209H;ENSP00000423550:D209H;ENSP00000387966:D209H	ENSP00000348089:D209H	D	-	1	0	ERCC6;RP11-123B3.6	50406496	0.762000	0.28451	0.026000	0.17262	0.489000	0.33432	2.634000	0.46528	2.575000	0.86900	0.655000	0.94253	GAT	ERCC6	-	NULL	ENSG00000225830		0.458	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6	HGNC	protein_coding	OTTHUMT00000047990.1	183	0.00	0	C	NM_000124		50736490	50736490	-1	no_errors	ENST00000355832	ensembl	human	known	69_37n	missense	404	13.30	62	SNP	0.065	G
ESX1	80712	genome.wustl.edu	37	X	103499124	103499124	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:103499124C>T	ENST00000372588.4	-	2	300	c.217G>A	c.(217-219)Gac>Aac	p.D73N		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	73					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						CCCTCACGGTCTTGGTCGTCC	0.652																																					Pancreas(200;1705 2227 25194 28471 45274)	dbGAP											0													95.0	98.0	97.0					X																	103499124		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.217G>A	X.37:g.103499124C>T	ENSP00000361669:p.Asp73Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYU3|Q7Z6K7	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_POU,pfscan_Homeodomain	p.D73N	ENST00000372588.4	37	c.217	CCDS14516.1	X	.	.	.	.	.	.	.	.	.	.	c	3.254	-0.152654	0.06585	.	.	ENSG00000123576	ENST00000372588	D	0.91124	-2.79	4.04	-6.18	0.02085	.	.	.	.	.	T	0.67664	0.2917	N	0.01576	-0.805	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.63152	-0.6701	9	0.09338	T	0.73	7.655	7.107	0.25368	0.1963:0.5844:0.0:0.2193	.	73	Q8N693	ESX1_HUMAN	N	73	ENSP00000361669:D73N	ENSP00000361669:D73N	D	-	1	0	ESX1	103385780	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.771000	0.04699	-1.345000	0.02214	-0.775000	0.03384	GAC	ESX1	-	NULL	ENSG00000123576		0.652	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESX1	HGNC	protein_coding	OTTHUMT00000057763.2	13	0.00	0	C	NM_153448		103499124	103499124	-1	no_errors	ENST00000372588	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	0.000	T
EXOSC10	5394	genome.wustl.edu	37	1	11137494	11137494	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:11137494C>G	ENST00000376936.4	-	16	1856	c.1807G>C	c.(1807-1809)Gag>Cag	p.E603Q	EXOSC10_ENST00000304457.7_Missense_Mutation_p.E603Q|EXOSC10_ENST00000544779.1_Missense_Mutation_p.G655A	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10	603					CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		AGAACATTCTCCAATCTCTGC	0.542																																					Colon(179;105 1987 14326 27364 29542)	dbGAP											0													79.0	81.0	80.0					1																	11137494		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.1807G>C	1.37:g.11137494C>G	ENSP00000366135:p.Glu603Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKQ0|B1AKQ1|Q15158	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,pfam_Exosome-assoc_fac_Rrp6_N,pfam_Helicase/RNaseD_C,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase/RNaseD_C,pfscan_Helicase/RNaseD_C	p.E603Q	ENST00000376936.4	37	c.1807	CCDS30584.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.96|17.96	3.516585|3.516585	0.64634|0.64634	.|.	.|.	ENSG00000171824|ENSG00000171824	ENST00000376936;ENST00000304457|ENST00000544779	.|.	.|.	.|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	0.097801|.	0.64402|.	D|.	0.000002|.	T|T	0.48857|0.48857	0.1523|0.1523	L|L	0.54323|0.54323	1.7|1.7	0.28160|0.28160	N|N	0.92904|0.92904	B;B|.	0.24186|.	0.099;0.06|.	B;B|.	0.31101|.	0.124;0.058|.	T|T	0.49551|0.49551	-0.8928|-0.8928	9|6	0.33940|0.02654	T|T	0.23|1	-38.5951|-38.5951	18.6206|18.6206	0.91319|0.91319	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	603;603|.	Q01780-2;Q01780|.	.;EXOSX_HUMAN|.	Q|A	603|655	.|.	ENSP00000307307:E603Q|ENSP00000439473:G655A	E|G	-|-	1|2	0|0	EXOSC10|EXOSC10	11060081|11060081	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	5.100000|5.100000	0.64560|0.64560	2.695000|2.695000	0.91970|0.91970	0.655000|0.655000	0.94253|0.94253	GAG|GGA	EXOSC10	-	NULL	ENSG00000171824		0.542	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXOSC10	HGNC	protein_coding	OTTHUMT00000006078.1	27	0.00	0	C	NM_001001998		11137494	11137494	-1	no_errors	ENST00000376936	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	1.000	G
FAM120A	23196	genome.wustl.edu	37	9	96326563	96326563	+	Nonsense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr9:96326563C>G	ENST00000277165.6	+	18	3292	c.3098C>G	c.(3097-3099)tCa>tGa	p.S1033*	FAM120A_ENST00000333936.5_Nonsense_Mutation_p.S1061*|AL353629.1_ENST00000582353.1_RNA|FAM120A_ENST00000340893.4_Nonsense_Mutation_p.S987*	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	1033	RNA binding.					cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GAACTTAAGTCAAAATCTGGG	0.493																																						dbGAP											0													80.0	93.0	88.0					9																	96326563		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.3098C>G	9.37:g.96326563C>G	ENSP00000277165:p.Ser1033*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Nonsense_Mutation	SNP	NULL	p.S1061*	ENST00000277165.6	37	c.3182	CCDS6706.1	9	.	.	.	.	.	.	.	.	.	.	C	14.69	2.611001	0.46631	.	.	ENSG00000048828	ENST00000277165;ENST00000333936;ENST00000340893;ENST00000427765	.	.	.	5.45	5.45	0.79879	.	0.207041	0.34362	N	0.004025	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-3.7699	19.2746	0.94026	0.0:1.0:0.0:0.0	.	.	.	.	X	1033;1061;987;409	.	ENSP00000277165:S1033X	S	+	2	0	FAM120A	95366384	1.000000	0.71417	0.966000	0.40874	0.699000	0.40488	6.496000	0.73670	2.560000	0.86352	0.591000	0.81541	TCA	FAM120A	-	NULL	ENSG00000048828		0.493	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM120A	HGNC	protein_coding	OTTHUMT00000053160.2	27	0.00	0	C	NM_014612		96326563	96326563	+1	no_errors	ENST00000333936	ensembl	human	known	69_37n	nonsense	28	29.27	12	SNP	1.000	G
AMER1	139285	genome.wustl.edu	37	X	63410170	63410170	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:63410170C>T	ENST00000330258.3	-	2	3269	c.2997G>A	c.(2995-2997)atG>atA	p.M999I	AMER1_ENST00000374869.3_Intron|AMER1_ENST00000403336.1_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	999	Pro-rich.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									TTGACATGGTCATAGGAGGTA	0.567																																						dbGAP											67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)											49.0	52.0	51.0					X																	63410170		2084	4185	6269	-	-	-	SO:0001583	missense	0			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2997G>A	X.37:g.63410170C>T	ENSP00000329117:p.Met999Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A2IB86|Q8N885	Missense_Mutation	SNP	pfam_Uncharacterised_FAM123	p.M999I	ENST00000330258.3	37	c.2997	CCDS14377.2	X	.	.	.	.	.	.	.	.	.	.	C	1.871	-0.460207	0.04508	.	.	ENSG00000184675	ENST00000330258	T	0.38722	1.12	4.51	-0.537	0.11872	.	.	.	.	.	T	0.17450	0.0419	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23048	-1.0199	8	.	.	.	-0.7991	3.5873	0.07975	0.5362:0.2343:0.14:0.0894	.	999	Q5JTC6	F123B_HUMAN	I	999	ENSP00000329117:M999I	.	M	-	3	0	FAM123B	63326895	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.822000	0.04448	-0.251000	0.09542	-0.344000	0.07964	ATG	FAM123B	-	NULL	ENSG00000184675		0.567	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM123B	HGNC	protein_coding	OTTHUMT00000316584.1	43	0.00	0	C	NM_152424		63410170	63410170	-1	no_errors	ENST00000330258	ensembl	human	known	69_37n	missense	65	19.75	16	SNP	0.000	T
FAM186A	121006	genome.wustl.edu	37	12	50724375	50724375	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:50724375G>C	ENST00000327337.5	-	7	7014	c.7015C>G	c.(7015-7017)Ctt>Gtt	p.L2339V	FAM186A_ENST00000543111.1_Missense_Mutation_p.L2339V|FAM186A_ENST00000543096.1_Missense_Mutation_p.L350V	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	2339																	AGGGATGCAAGAGATTTTCGG	0.473																																					NSCLC(138;1796 1887 12511 19463 37884)	dbGAP											0													87.0	70.0	75.0					12																	50724375		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.7015C>G	12.37:g.50724375G>C	ENSP00000329995:p.Leu2339Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.L2339V	ENST00000327337.5	37	c.7015	CCDS44878.1	12	.	.	.	.	.	.	.	.	.	.	G	14.35	2.507863	0.44558	.	.	ENSG00000185958	ENST00000543111;ENST00000543096;ENST00000327337	T;T;T	0.26067	2.23;1.76;2.23	4.15	4.15	0.48705	.	0.000000	0.46442	D	0.000295	T	0.38983	0.1061	L	0.38175	1.15	0.26534	N	0.974205	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	T	0.07966	-1.0745	10	0.87932	D	0	.	12.238	0.54526	0.0:0.0:1.0:0.0	.	2339;2339	F5GYN0;A6NE01	.;F186A_HUMAN	V	2339;350;2339	ENSP00000441337:L2339V;ENSP00000443703:L350V;ENSP00000329995:L2339V	ENSP00000329995:L2339V	L	-	1	0	FAM186A	49010642	1.000000	0.71417	1.000000	0.80357	0.502000	0.33828	3.094000	0.50227	2.613000	0.88420	0.591000	0.81541	CTT	FAM186A	-	NULL	ENSG00000185958		0.473	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM186A	HGNC	protein_coding	OTTHUMT00000396838.1	45	0.00	0	G	XM_001718353		50724375	50724375	-1	no_errors	ENST00000327337	ensembl	human	known	69_37n	missense	82	16.33	16	SNP	1.000	C
FAM198A	729085	genome.wustl.edu	37	3	43095055	43095055	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:43095055G>C	ENST00000430121.2	+	3	1428	c.1333G>C	c.(1333-1335)Gag>Cag	p.E445Q	KRBOX1_ENST00000443313.1_Nonstop_Mutation_p.*107S	NM_001129908.2	NP_001123380.2	Q9UFP1	F198A_HUMAN	family with sequence similarity 198, member A	445						extracellular region (GO:0005576)				endometrium(1)	1						CTTCGAGCCTGAGCCCTCAGA	0.642																																						dbGAP											0													40.0	47.0	45.0					3																	43095055		692	1591	2283	-	-	-	SO:0001583	missense	0			AL117530	CCDS46808.1	3p22.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000144649	ENSG00000144649			24485	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 41"""	C3orf41			Standard	NM_001129908		Approved	DKFZP434B172	uc003cmp.4	Q9UFP1	OTTHUMG00000156449	ENST00000430121.2:c.1333G>C	3.37:g.43095055G>C	ENSP00000407301:p.Glu445Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR48	Missense_Mutation	SNP	NULL	p.E445Q	ENST00000430121.2	37	c.1333	CCDS46808.1	3	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525685	0.85600	.	.	ENSG00000144649	ENST00000488863;ENST00000430121	T;T	0.30981	1.51;1.51	5.62	4.74	0.60224	.	0.112170	0.56097	D	0.000021	T	0.51719	0.1691	M	0.72479	2.2	0.36073	D	0.842243	D;D	0.76494	0.996;0.999	D;D	0.68943	0.918;0.961	T	0.62334	-0.6876	10	0.42905	T	0.14	-6.8753	12.8286	0.57735	0.0788:0.0:0.9212:0.0	.	16;445	F5H4W4;Q9UFP1	.;F198A_HUMAN	Q	16;445	ENSP00000439905:E16Q;ENSP00000407301:E445Q	ENSP00000273146:E445Q	E	+	1	0	FAM198A	43070059	1.000000	0.71417	0.931000	0.37212	0.996000	0.88848	6.554000	0.73923	1.379000	0.46325	0.561000	0.74099	GAG	FAM198A	-	NULL	ENSG00000144649		0.642	FAM198A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM198A	HGNC	protein_coding	OTTHUMT00000344240.3	10	0.00	0	G	NM_001129908		43095055	43095055	+1	no_errors	ENST00000273146	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	0.995	C
FAM210B	116151	genome.wustl.edu	37	20	54941255	54941255	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr20:54941255G>C	ENST00000371384.3	+	3	582	c.491G>C	c.(490-492)aGa>aCa	p.R164T		NM_080821.2	NP_543011.2	Q96KR6	F210B_HUMAN	family with sequence similarity 210, member B	164	DUF1279.					integral component of membrane (GO:0016021)											GCGCCAGTGAGAATCAGCATT	0.443																																						dbGAP											0													139.0	130.0	133.0					20																	54941255		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL121914	CCDS13450.1	20q13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000124098	ENSG00000124098			16102	protein-coding gene	gene with protein product	"""hypothetical protein LOC116151"""		"""chromosome 20 open reading frame 108"""	C20orf108		11780052	Standard	NM_080821		Approved	dJ1167H4.1, DKFZP434A1114	uc002xxc.3	Q96KR6	OTTHUMG00000032793	ENST00000371384.3:c.491G>C	20.37:g.54941255G>C	ENSP00000360437:p.Arg164Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBQ9|E1P5Y7|Q8WVN2|Q9BYL6|Q9H418	Missense_Mutation	SNP	pfam_DUF1279	p.R164T	ENST00000371384.3	37	c.491	CCDS13450.1	20	.	.	.	.	.	.	.	.	.	.	G	26.6	4.751212	0.89753	.	.	ENSG00000124098	ENST00000371384	T	0.60797	0.16	5.56	5.56	0.83823	Domain of unknown function DUF1279 (1);	0.000000	0.85682	D	0.000000	D	0.83216	0.5206	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87352	0.2338	10	0.87932	D	0	-11.7903	19.5255	0.95203	0.0:0.0:1.0:0.0	.	164	Q96KR6	CT108_HUMAN	T	164	ENSP00000360437:R164T	ENSP00000360437:R164T	R	+	2	0	C20orf108	54374662	1.000000	0.71417	0.089000	0.20774	0.859000	0.49053	9.396000	0.97270	2.595000	0.87683	0.650000	0.86243	AGA	FAM210B	-	pfam_DUF1279	ENSG00000124098		0.443	FAM210B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM210B	HGNC	protein_coding	OTTHUMT00000079800.2	129	0.00	0	G	NM_080821		54941255	54941255	+1	no_errors	ENST00000371384	ensembl	human	known	69_37n	missense	223	16.17	43	SNP	0.976	C
FANCD2	2177	genome.wustl.edu	37	3	10107574	10107574	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:10107574G>T	ENST00000419585.1	+	25	2457	c.2296G>T	c.(2296-2298)Gag>Tag	p.E766*	FANCD2_ENST00000383807.1_Nonsense_Mutation_p.E766*|FANCD2_ENST00000287647.3_Nonsense_Mutation_p.E766*|FANCD2_ENST00000383806.1_Nonsense_Mutation_p.E766*			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	766					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		AACTGACCTGGAGCCTGGAGA	0.453			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	0													136.0	112.0	120.0					3																	10107574		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2296G>T	3.37:g.10107574G>T	ENSP00000398754:p.Glu766*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.E766*	ENST00000419585.1	37	c.2296	CCDS33696.1	3	.	.	.	.	.	.	.	.	.	.	G	42	9.551141	0.99202	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	.	.	.	5.68	5.68	0.88126	.	0.194503	0.53938	D	0.000049	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	17.3494	0.87318	0.0:0.0:1.0:0.0	.	.	.	.	X	766	.	ENSP00000287647:E766X	E	+	1	0	FANCD2	10082574	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.532000	0.98057	2.694000	0.91930	0.585000	0.79938	GAG	FANCD2	-	NULL	ENSG00000144554		0.453	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	HGNC	protein_coding	OTTHUMT00000339873.1	162	0.00	0	G			10107574	10107574	+1	no_errors	ENST00000287647	ensembl	human	known	69_37n	nonsense	145	21.08	39	SNP	1.000	T
FBXL18	80028	genome.wustl.edu	37	7	5541259	5541259	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:5541259G>A	ENST00000382368.3	-	3	764	c.641C>T	c.(640-642)tCg>tTg	p.S214L	FBXL18_ENST00000453700.3_Missense_Mutation_p.S214L	NM_024963.4	NP_079239.3	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	214									FBXL18/RNF216(2)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		AAGCTGGCCCGAGAGGATGGC	0.642																																						dbGAP											0													26.0	32.0	30.0					7																	5541259		2044	4189	6233	-	-	-	SO:0001583	missense	0			AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034		"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084					Standard	NM_024963		Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000382368.3:c.641C>T	7.37:g.5541259G>A	ENSP00000371805:p.Ser214Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BR90|Q9BTC7|Q9HAK7	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.S214L	ENST00000382368.3	37	c.641	CCDS43546.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.6|20.6	4.012500|4.012500	0.75161|0.75161	.|.	.|.	ENSG00000155034|ENSG00000155034	ENST00000458142|ENST00000382368;ENST00000312577;ENST00000453700	.|T;T	.|0.56941	.|0.48;0.43	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	.|0.166079	.|0.53938	.|D	.|0.000049	T|T	0.56202|0.56202	0.1969|0.1969	N|N	0.24115|0.24115	0.695|0.695	0.45284|0.45284	D|D	0.998283|0.998283	.|D;D	.|0.71674	.|0.998;0.996	.|P;P	.|0.56788	.|0.806;0.806	T|T	0.60964|0.60964	-0.7158|-0.7158	5|10	.|0.66056	.|D	.|0.02	.|.	18.1629|18.1629	0.89716|0.89716	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|214;214	.|F5H4Z4;Q96ME1-4	.|.;.	W|L	98|214	.|ENSP00000371805:S214L;ENSP00000444797:S214L	.|ENSP00000311990:S214L	R|S	-|-	1|2	2|0	FBXL18|FBXL18	5507785|5507785	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.991000|0.991000	0.79684|0.79684	6.082000|6.082000	0.71318|0.71318	2.528000|2.528000	0.85240|0.85240	0.655000|0.655000	0.94253|0.94253	CGG|TCG	FBXL18	-	NULL	ENSG00000155034		0.642	FBXL18-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL18	HGNC	protein_coding	OTTHUMT00000324093.1	9	0.00	0	G	NM_024963		5541259	5541259	-1	no_errors	ENST00000453700	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	0.995	A
FBXO30	84085	genome.wustl.edu	37	6	146126650	146126650	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:146126650C>T	ENST00000237281.4	-	2	1058	c.892G>A	c.(892-894)Gac>Aac	p.D298N		NM_032145.4	NP_115521.3	Q8TB52	FBX30_HUMAN	F-box protein 30	298							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		TGATTCTGGTCTATGACCTGG	0.368																																						dbGAP											0													122.0	120.0	120.0					6																	146126650		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF248640	CCDS5208.1	6q24	2008-02-05	2004-06-15		ENSG00000118496	ENSG00000118496		"""F-boxes /  ""other"""""	15600	protein-coding gene	gene with protein product		609101	"""F-box only protein, helicase, 18"""				Standard	XM_005267159		Approved	MGC21674, Fbx30	uc003qla.3	Q8TB52	OTTHUMG00000015749	ENST00000237281.4:c.892G>A	6.37:g.146126650C>T	ENSP00000237281:p.Asp298Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BXZ7	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,superfamily_TRAF-like,pfscan_F-box_dom_cyclin-like,pfscan_Znf_TRAF	p.D298N	ENST00000237281.4	37	c.892	CCDS5208.1	6	.	.	.	.	.	.	.	.	.	.	C	4.626	0.116400	0.08881	.	.	ENSG00000118496	ENST00000237281	T	0.18657	2.2	4.95	4.95	0.65309	.	0.467132	0.24557	N	0.037520	T	0.06781	0.0173	L	0.35414	1.06	0.20307	N	0.999913	B	0.02656	0.0	B	0.01281	0.0	T	0.16012	-1.0417	10	0.16420	T	0.52	-1.375	14.9798	0.71303	0.0:0.8568:0.1432:0.0	.	298	Q8TB52	FBX30_HUMAN	N	298	ENSP00000237281:D298N	ENSP00000237281:D298N	D	-	1	0	FBXO30	146168343	1.000000	0.71417	0.905000	0.35620	0.967000	0.64934	3.147000	0.50639	2.474000	0.83562	0.655000	0.94253	GAC	FBXO30	-	NULL	ENSG00000118496		0.368	FBXO30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO30	HGNC	protein_coding	OTTHUMT00000042570.2	129	0.00	0	C			146126650	146126650	-1	no_errors	ENST00000237281	ensembl	human	known	69_37n	missense	109	13.49	17	SNP	0.600	T
FCHO1	23149	genome.wustl.edu	37	19	17888953	17888953	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:17888953G>C	ENST00000596536.1	+	19	1550	c.1267G>C	c.(1267-1269)Gag>Cag	p.E423Q	FCHO1_ENST00000596951.1_Missense_Mutation_p.E423Q|FCHO1_ENST00000539407.1_Missense_Mutation_p.E423Q|FCHO1_ENST00000594202.1_Missense_Mutation_p.E423Q|FCHO1_ENST00000252771.7_Missense_Mutation_p.E423Q|FCHO1_ENST00000389133.4_Missense_Mutation_p.E423Q|FCHO1_ENST00000597512.1_Missense_Mutation_p.E430Q|FCHO1_ENST00000595033.1_Missense_Mutation_p.E373Q|FCHO1_ENST00000600676.1_Missense_Mutation_p.E423Q	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	423	Mediates interaction with the adaptor protein complex AP-2.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						TAGCTGTGCAGAGAGATTGCA	0.537																																						dbGAP											0													58.0	56.0	56.0					19																	17888953		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.1267G>C	19.37:g.17888953G>C	ENSP00000470731:p.Glu423Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH,superfamily_Clathrin_mu_C,smart_FCH,pfscan_FCH	p.E423Q	ENST00000596536.1	37	c.1267	CCDS32955.1	19	.	.	.	.	.	.	.	.	.	.	G	9.505	1.104287	0.20632	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.33865	1.39;1.39;1.39	4.82	4.82	0.62117	.	1.083200	0.07022	N	0.826988	T	0.34542	0.0901	L	0.36672	1.1	0.36507	D	0.869383	P;P	0.37864	0.475;0.61	B;B	0.37888	0.133;0.26	T	0.16129	-1.0413	10	0.21014	T	0.42	-17.0042	15.3701	0.74557	0.0:0.0:1.0:0.0	.	423;423	O14526;O14526-2	FCHO1_HUMAN;.	Q	423	ENSP00000252771:E423Q;ENSP00000373785:E423Q;ENSP00000437978:E423Q	ENSP00000252771:E423Q	E	+	1	0	FCHO1	17749953	1.000000	0.71417	0.319000	0.25293	0.048000	0.14542	4.300000	0.59079	2.217000	0.71921	0.555000	0.69702	GAG	FCHO1	-	NULL	ENSG00000130475		0.537	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FCHO1	HGNC	protein_coding	OTTHUMT00000466946.2	53	0.00	0	G	NM_015122		17888953	17888953	+1	no_errors	ENST00000252771	ensembl	human	known	69_37n	missense	82	16.33	16	SNP	0.888	C
FDPS	2224	genome.wustl.edu	37	1	155282164	155282164	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:155282164C>A	ENST00000356657.6	+	4	620	c.458C>A	c.(457-459)aCt>aAt	p.T153N	FDPS_ENST00000368356.4_Missense_Mutation_p.T153N|FDPS_ENST00000447866.1_Missense_Mutation_p.T87N|FDPS_ENST00000487002.1_3'UTR	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase	153					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	CGGGCCTGGACTGTGGGCTGG	0.577																																						dbGAP											0													59.0	50.0	53.0					1																	155282164		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.458C>A	1.37:g.155282164C>A	ENSP00000349078:p.Thr153Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV91|E9PCI9|Q96G29	Missense_Mutation	SNP	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	p.T153N	ENST00000356657.6	37	c.458	CCDS1110.1	1	.	.	.	.	.	.	.	.	.	.	C	16.44	3.125203	0.56721	.	.	ENSG00000160752	ENST00000447866;ENST00000368356;ENST00000356657	T;T;T	0.64260	-0.09;-0.09;-0.09	4.79	3.88	0.44766	Terpenoid synthase (2);	0.137128	0.33834	N	0.004518	T	0.44993	0.1320	M	0.66439	2.03	0.09310	N	0.999998	B	0.29508	0.246	B	0.36504	0.226	T	0.48768	-0.9006	10	0.72032	D	0.01	-4.0617	7.5679	0.27890	0.0:0.809:0.0:0.191	.	153	P14324	FPPS_HUMAN	N	87;153;153	ENSP00000391755:T87N;ENSP00000357340:T153N;ENSP00000349078:T153N	ENSP00000349078:T153N	T	+	2	0	FDPS	153548788	0.994000	0.37717	0.180000	0.23079	0.820000	0.46376	3.320000	0.51991	1.376000	0.46267	0.561000	0.74099	ACT	FDPS	-	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	ENSG00000160752		0.577	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FDPS	HGNC	protein_coding	OTTHUMT00000039053.1	53	0.00	0	C	NM_002004		155282164	155282164	+1	no_errors	ENST00000356657	ensembl	human	known	69_37n	missense	127	15.89	24	SNP	0.172	A
FGD6	55785	genome.wustl.edu	37	12	95498801	95498801	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:95498801G>A	ENST00000343958.4	-	14	3702	c.3479C>T	c.(3478-3480)tCc>tTc	p.S1160F	FGD6_ENST00000549499.1_Missense_Mutation_p.S1160F|FGD6_ENST00000546711.1_Missense_Mutation_p.S1160F	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	1160	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						GAGAATGAAGGAACGTTCTAC	0.363																																						dbGAP											0													126.0	129.0	128.0					12																	95498801		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.3479C>T	12.37:g.95498801G>A	ENSP00000344446:p.Ser1160Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.S1160F	ENST00000343958.4	37	c.3479	CCDS31878.1	12	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552800	0.86127	.	.	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000551521;ENST00000549499	T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26	5.89	5.89	0.94794	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.47455	D	0.000233	D	0.90363	0.6984	M	0.87381	2.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.91006	0.4846	10	0.87932	D	0	-5.7411	20.2576	0.98430	0.0:0.0:1.0:0.0	.	1160;1160	Q6ZV73-2;Q6ZV73	.;FGD6_HUMAN	F	1160;1160;156;1160	ENSP00000344446:S1160F;ENSP00000450342:S1160F;ENSP00000450240:S156F;ENSP00000449005:S1160F	ENSP00000344446:S1160F	S	-	2	0	FGD6	94022932	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.444000	0.97578	2.783000	0.95769	0.655000	0.94253	TCC	FGD6	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000180263		0.363	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD6	HGNC	protein_coding	OTTHUMT00000407600.1	193	0.00	0	G	NM_018351		95498801	95498801	-1	no_errors	ENST00000343958	ensembl	human	known	69_37n	missense	84	16.83	17	SNP	1.000	A
FOLR4	390243	genome.wustl.edu	37	11	94038866	94038866	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:94038866G>A	ENST00000440961.2	+	1	108	c.64G>A	c.(64-66)Gag>Aag	p.E22K		NM_001199206.1	NP_001186135.1	A6ND01	JUNO_HUMAN	folate receptor 4, delta (putative)	22					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14						GGCTGGGGACGAGCTGCTCAA	0.582																																						dbGAP											0													78.0	83.0	81.0					11																	94038866		2099	4217	6316	-	-	-	SO:0001583	missense	0					11q14	2014-07-23	2012-12-07		ENSG00000183560	ENSG00000183560			32565	protein-coding gene	gene with protein product		615737	"""folate receptor 4 (delta) homolog (mouse)"""			11111049, 24739963	Standard	NM_001199206		Approved	Folbp3, JUNO	uc021qou.1	A6ND01		ENST00000440961.2:c.64G>A	11.37:g.94038866G>A	ENSP00000416935:p.Glu22Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Folate_rcpt-like	p.E22K	ENST00000440961.2	37	c.64		11	.	.	.	.	.	.	.	.	.	.	G	4.485	0.089872	0.08632	.	.	ENSG00000183560	ENST00000440961	T	0.73897	-0.79	4.55	-2.2	0.06994	.	0.722455	0.13160	N	0.409163	T	0.56934	0.2019	L	0.28608	0.87	0.09310	N	1	B	0.16396	0.017	B	0.15052	0.012	T	0.38672	-0.9650	10	0.25751	T	0.34	-7.0705	9.4338	0.38626	0.6402:0.0:0.3598:0.0	.	22	A6ND01-2	.	K	22	ENSP00000416935:E22K	ENSP00000416935:E22K	E	+	1	0	FOLR4	93678514	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	0.034000	0.13776	-0.501000	0.06605	0.561000	0.74099	GAG	FOLR4	-	pfam_Folate_rcpt-like	ENSG00000183560		0.582	FOLR4-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	FOLR4	HGNC	protein_coding	OTTHUMT00000396420.1	9	0.00	0	G	NM_001080486		94038866	94038866	+1	no_errors	ENST00000440961	ensembl	human	novel	69_37n	missense	30	18.92	7	SNP	0.037	A
FLI1	2313	genome.wustl.edu	37	11	128651915	128651915	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:128651915G>C	ENST00000527786.2	+	5	1141	c.652G>C	c.(652-654)Gaa>Caa	p.E218Q	FLI1_ENST00000344954.6_Missense_Mutation_p.E185Q|FLI1_ENST00000525560.1_Missense_Mutation_p.E25Q|FLI1_ENST00000534087.2_Missense_Mutation_p.E185Q|FLI1_ENST00000281428.8_Missense_Mutation_p.E152Q	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	218					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		GAGTGTCAAAGAAGGTAAGTT	0.423			T	EWSR1	Ewing sarcoma																																	dbGAP		Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	0													148.0	140.0	142.0					11																	128651915		1901	4128	6029	-	-	-	SO:0001583	missense	0			M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.652G>C	11.37:g.128651915G>C	ENSP00000433488:p.Glu218Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pfscan_Ets,prints_Ets	p.E218Q	ENST00000527786.2	37	c.652	CCDS44768.1	11	.	.	.	.	.	.	.	.	.	.	G	14.68	2.609117	0.46527	.	.	ENSG00000151702	ENST00000525560;ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	T;T;T;T;T	0.22945	1.93;2.52;2.52;2.52;2.51	6.07	6.07	0.98685	.	0.586776	0.17200	N	0.183155	T	0.22513	0.0543	L	0.34521	1.04	0.58432	D	0.999995	B;B;B	0.34214	0.001;0.442;0.001	B;B;B	0.28784	0.002;0.094;0.003	T	0.04333	-1.0959	10	0.23891	T	0.37	.	20.239	0.98366	0.0:0.0:1.0:0.0	.	218;25;152	Q01543;B4DFV4;Q01543-2	FLI1_HUMAN;.;.	Q	25;185;218;185;152	ENSP00000437124:E25Q;ENSP00000339627:E185Q;ENSP00000399985:E218Q;ENSP00000432950:E185Q;ENSP00000281428:E152Q	ENSP00000281428:E152Q	E	+	1	0	FLI1	128157125	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.790000	0.85794	2.884000	0.98904	0.655000	0.94253	GAA	FLI1	-	NULL	ENSG00000151702		0.423	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLI1	HGNC	protein_coding	OTTHUMT00000386226.2	139	0.00	0	G	NM_002017		128651915	128651915	+1	no_errors	ENST00000429175	ensembl	human	known	69_37n	missense	160	18.37	36	SNP	1.000	C
FOXJ2	55810	genome.wustl.edu	37	12	8200740	8200740	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:8200740C>T	ENST00000162391.3	+	7	2225	c.1080C>T	c.(1078-1080)ccC>ccT	p.P360P	FOXJ2_ENST00000428177.2_Silent_p.P360P	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	360					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		ATGGGCCTCCCCCTGTAATGG	0.647													C|||	1	0.000199681	0.0	0.0014	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													57.0	50.0	52.0					12																	8200740		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.1080C>T	12.37:g.8200740C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVK4|B2RMP3|Q96PS9|Q9NSN5	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.P360	ENST00000162391.3	37	c.1080	CCDS8587.1	12																																																																																			FOXJ2	-	NULL	ENSG00000065970		0.647	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXJ2	HGNC	protein_coding	OTTHUMT00000400088.1	9	0.00	0	C	NM_018416		8200740	8200740	+1	no_errors	ENST00000162391	ensembl	human	known	69_37n	silent	43	18.52	10	SNP	0.761	T
FRMPD2	143162	genome.wustl.edu	37	10	49414927	49414927	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:49414927G>A	ENST00000374201.3	-	14	1963	c.1661C>T	c.(1660-1662)tCa>tTa	p.S554L	FRMPD2_ENST00000305531.3_Missense_Mutation_p.S529L|FRMPD2_ENST00000407470.4_Missense_Mutation_p.S522L	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	554	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CCTCTTCTCTGAGAATACTTG	0.473																																						dbGAP											0													99.0	88.0	92.0					10																	49414927		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.1661C>T	10.37:g.49414927G>A	ENSP00000363317:p.Ser554Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.S554L	ENST00000374201.3	37	c.1661	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	G	13.09	2.132945	0.37630	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.64438	-0.04;-0.1;-0.1	5.55	4.58	0.56647	FERM domain (1);Pleckstrin homology-type (1);	.	.	.	.	T	0.47358	0.1441	N	0.17082	0.46	0.28604	N	0.909012	B;B;B	0.29805	0.257;0.013;0.257	B;B;B	0.29077	0.098;0.017;0.098	T	0.47249	-0.9132	9	0.51188	T	0.08	.	12.9018	0.58128	0.0:0.0:0.7767:0.2232	.	529;554;522	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	L	554;529;522	ENSP00000363317:S554L;ENSP00000307079:S529L;ENSP00000384339:S522L	ENSP00000307079:S529L	S	-	2	0	FRMPD2	49084933	1.000000	0.71417	1.000000	0.80357	0.457000	0.32468	3.759000	0.55227	2.634000	0.89283	0.563000	0.77884	TCA	FRMPD2	-	pfscan_FERM_domain	ENSG00000170324		0.473	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	85	0.00	0	G	NM_152428		49414927	49414927	-1	no_errors	ENST00000374201	ensembl	human	known	69_37n	missense	215	11.16	27	SNP	1.000	A
GALNT9	50614	genome.wustl.edu	37	12	132862887	132862887	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:132862887A>G	ENST00000328957.8	-	2	367	c.368T>C	c.(367-369)cTc>cCc	p.L123P		NM_001122636.1	NP_001116108.1	Q9HCQ5	GALT9_HUMAN	polypeptide N-acetylgalactosaminyltransferase 9	123					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		GCGGTCGCTGAGCTGAGCGTT	0.672																																					Colon(186;2147 2752 13553 41466)	dbGAP											0													55.0	63.0	61.0					12																	132862887		692	1591	2283	-	-	-	SO:0001583	missense	0			AB040672	CCDS41866.1	12q24.33	2014-03-13	2014-03-13		ENSG00000182870	ENSG00000182870	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4131	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 9"""	606251	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)"""			10978536, 12407114	Standard	NM_021808		Approved	GALNAC-T9	uc001ukc.4	Q9HCQ5	OTTHUMG00000168256	ENST00000328957.8:c.368T>C	12.37:g.132862887A>G	ENSP00000329846:p.Leu123Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LR8|Q6NT54|Q8NFR1	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.L123P	ENST00000328957.8	37	c.368		12	.	.	.	.	.	.	.	.	.	.	A	17.19	3.325241	0.60743	.	.	ENSG00000182870	ENST00000328957	T	0.58210	0.35	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.77585	0.4152	M	0.91972	3.26	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.83328	-0.0014	10	0.72032	D	0.01	.	14.2862	0.66247	1.0:0.0:0.0:0.0	.	123;123	B2RXG6;Q9HCQ5	.;GALT9_HUMAN	P	123	ENSP00000329846:L123P	ENSP00000329846:L123P	L	-	2	0	GALNT9	131372960	1.000000	0.71417	0.997000	0.53966	0.235000	0.25334	8.562000	0.90719	1.769000	0.52152	0.379000	0.24179	CTC	GALNT9	-	NULL	ENSG00000182870		0.672	GALNT9-009	KNOWN	basic|appris_principal	protein_coding	GALNT9	HGNC	protein_coding	OTTHUMT00000402967.1	8	0.00	0	A	NM_001122636		132862887	132862887	-1	no_errors	ENST00000328957	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	1.000	G
GDPD2	54857	genome.wustl.edu	37	X	69650936	69650936	+	Intron	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:69650936C>T	ENST00000374382.3	+	12	1558				GDPD2_ENST00000536730.1_Intron|GDPD2_ENST00000453994.2_Nonsense_Mutation_p.Q474*|GDPD2_ENST00000538649.1_Intron|GDPD2_ENST00000472623.1_Intron	NM_017711.3	NP_060181.2	Q9HCC8	GDPD2_HUMAN	glycerophosphodiester phosphodiesterase domain containing 2						glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol inositolphosphodiesterase activity (GO:0047394)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(6)|large_intestine(8)|lung(3)|ovary(2)	22	Renal(35;0.156)					ctgcccccCTCAGCCTCCCGG	0.517																																						dbGAP											0													120.0	96.0	103.0					X																	69650936		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AK000214	CCDS14402.1, CCDS55437.1, CCDS55438.1	Xq13.1	2011-01-25			ENSG00000130055	ENSG00000130055			25974	protein-coding gene	gene with protein product	"""osteoblast differentiation promoting factor"""					12975309	Standard	NM_017711		Approved	OBDPF, FLJ20207, GDE3	uc011mpk.2	Q9HCC8	OTTHUMG00000021776	ENST00000374382.3:c.1307+1023C>T	X.37:g.69650936C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRH4|B4DVC9|Q9NXJ6	Nonsense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.Q474*	ENST00000374382.3	37	c.1420	CCDS14402.1	X	.	.	.	.	.	.	.	.	.	.	C	23.4	4.411804	0.83340	.	.	ENSG00000130055	ENST00000453994	.	.	.	0.554	-0.466	0.12153	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	X	474	.	.	Q	+	1	0	GDPD2	69567661	0.001000	0.12720	0.006000	0.13384	0.013000	0.08279	-0.564000	0.05936	-0.346000	0.08312	0.292000	0.19580	CAG	GDPD2	-	superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000130055		0.517	GDPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPD2	HGNC	protein_coding	OTTHUMT00000057070.1	94	0.00	0	C	NM_017711		69650936	69650936	+1	no_errors	ENST00000453994	ensembl	human	known	69_37n	nonsense	96	20.66	25	SNP	0.006	T
GIMAP2	26157	genome.wustl.edu	37	7	150389612	150389612	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:150389612G>C	ENST00000223293.5	+	3	332	c.238G>C	c.(238-240)Gat>Cat	p.D80H		NM_015660.2	NP_056475.1	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	80	AIG1-type G.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	GTP binding (GO:0005525)			kidney(1)|large_intestine(1)|lung(8)|skin(2)|urinary_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGACACACCAGATATGTTTTC	0.488																																						dbGAP											0													87.0	81.0	83.0					7																	150389612		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL110151	CCDS5905.1	7q36.1	2014-04-04			ENSG00000106560	ENSG00000106560		"""GTPases, IMAP"""	21789	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 12"""	608085				15474311	Standard	NM_015660		Approved	DKFZp586D0824, HIMAP2, IMAP2, IAN12	uc003who.3	Q9UG22	OTTHUMG00000157488	ENST00000223293.5:c.238G>C	7.37:g.150389612G>C	ENSP00000223293:p.Asp80His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96L25	Missense_Mutation	SNP	pfam_AIG1	p.D80H	ENST00000223293.5	37	c.238	CCDS5905.1	7	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494205	0.64186	.	.	ENSG00000106560	ENST00000223293	T	0.61158	0.13	3.21	3.21	0.36854	AIG1 (1);	0.218027	0.39274	N	0.001405	T	0.74351	0.3705	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77542	-0.2549	10	0.72032	D	0.01	.	10.1833	0.42982	0.0:0.0:1.0:0.0	.	80	Q9UG22	GIMA2_HUMAN	H	80	ENSP00000223293:D80H	ENSP00000223293:D80H	D	+	1	0	GIMAP2	150020545	0.002000	0.14202	0.245000	0.24217	0.175000	0.22909	1.148000	0.31614	2.137000	0.66172	0.609000	0.83330	GAT	GIMAP2	-	pfam_AIG1	ENSG00000106560		0.488	GIMAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP2	HGNC	protein_coding	OTTHUMT00000348948.1	67	0.00	0	G	NM_015660		150389612	150389612	+1	no_errors	ENST00000223293	ensembl	human	known	69_37n	missense	79	19.39	19	SNP	0.850	C
GLP2R	9340	genome.wustl.edu	37	17	9757871	9757871	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:9757871C>T	ENST00000262441.5	+	5	1077	c.564C>T	c.(562-564)ttC>ttT	p.F188F	GLP2R_ENST00000574745.1_Silent_p.F8F	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	188					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	GATACTCCTTCTCTCTTATCT	0.517																																						dbGAP											0													630.0	494.0	540.0					17																	9757871		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.564C>T	17.37:g.9757871C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAT3	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.S41F	ENST00000262441.5	37	c.122	CCDS11150.1	17	.	.	.	.	.	.	.	.	.	.	C	2.885	-0.231023	0.05983	.	.	ENSG00000065325	ENST00000458005	.	.	.	5.03	-0.757	0.11054	.	.	.	.	.	T	0.43055	0.1230	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24368	-1.0162	4	.	.	.	.	3.371	0.07220	0.1085:0.3375:0.3835:0.1705	.	.	.	.	F	41	.	.	S	+	2	0	GLP2R	9698596	0.903000	0.30736	0.089000	0.20774	0.312000	0.27988	-0.187000	0.09656	-0.131000	0.11578	0.655000	0.94253	TCT	GLP2R	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000065325		0.517	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLP2R	HGNC	protein_coding	OTTHUMT00000252601.4	224	0.00	0	C			9757871	9757871	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000458005	ensembl	human	putative	69_37n	missense	265	21.13	71	SNP	0.645	T
GMIP	51291	genome.wustl.edu	37	19	19750962	19750962	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:19750962C>T	ENST00000203556.4	-	7	606	c.469G>A	c.(469-471)Gag>Aag	p.E157K	GMIP_ENST00000445806.2_Missense_Mutation_p.E157K|GMIP_ENST00000587238.1_Missense_Mutation_p.E157K	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	157					intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						AGATCGTGCTCCAGAAACAGG	0.557																																						dbGAP											0													90.0	79.0	83.0					19																	19750962		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.469G>A	19.37:g.19750962C>T	ENSP00000203556:p.Glu157Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVN9|B7ZLZ0	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.E157K	ENST00000203556.4	37	c.469	CCDS12408.1	19	.	.	.	.	.	.	.	.	.	.	C	15.04	2.714179	0.48622	.	.	ENSG00000089639	ENST00000203556;ENST00000445806	T;T	0.44482	0.92;0.92	4.98	4.98	0.66077	.	0.000000	0.44902	D	0.000402	T	0.56470	0.1987	L	0.52206	1.635	0.52501	D	0.999951	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.70487	0.969;0.969;0.969	T	0.50224	-0.8853	10	0.25751	T	0.34	-24.3132	15.7719	0.78176	0.0:1.0:0.0:0.0	.	157;157;157	E7ERB7;B7ZLZ0;Q9P107	.;.;GMIP_HUMAN	K	157	ENSP00000203556:E157K;ENSP00000397075:E157K	ENSP00000203556:E157K	E	-	1	0	GMIP	19611962	1.000000	0.71417	1.000000	0.80357	0.560000	0.35617	4.186000	0.58337	2.307000	0.77673	0.561000	0.74099	GAG	GMIP	-	NULL	ENSG00000089639		0.557	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMIP	HGNC	protein_coding	OTTHUMT00000460551.1	68	0.00	0	C	NM_016573		19750962	19750962	-1	no_errors	ENST00000203556	ensembl	human	known	69_37n	missense	203	14.29	34	SNP	1.000	T
GPR101	83550	genome.wustl.edu	37	X	136112924	136112924	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:136112924C>T	ENST00000298110.1	-	1	909	c.910G>A	c.(910-912)Gag>Aag	p.E304K		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					CTGACCTCCTCGCTGCCCCTG	0.607													C|||	1	0.000264901	0.0	0.0	3775	,	,		16441	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													264.0	186.0	213.0					X																	136112924		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.910G>A	X.37:g.136112924C>T	ENSP00000298110:p.Glu304Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSM8|Q8NG93	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.E304K	ENST00000298110.1	37	c.910	CCDS14662.1	X	.	.	.	.	.	.	.	.	.	.	C	0.030	-1.341345	0.01277	.	.	ENSG00000165370	ENST00000298110	T	0.62941	-0.01	3.33	-2.93	0.05598	GPCR, rhodopsin-like superfamily (1);	0.815634	0.10044	N	0.723128	T	0.39655	0.1086	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.35201	-0.9798	10	0.06757	T	0.87	-0.6103	10.1855	0.42995	0.0:0.2929:0.0:0.7071	.	304	Q96P66	GP101_HUMAN	K	304	ENSP00000298110:E304K	ENSP00000298110:E304K	E	-	1	0	GPR101	135940590	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.633000	0.05483	-0.943000	0.03691	-1.144000	0.01866	GAG	GPR101	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000165370		0.607	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR101	HGNC	protein_coding	OTTHUMT00000058519.1	74	0.00	0	C			136112924	136112924	-1	no_errors	ENST00000298110	ensembl	human	known	69_37n	missense	160	21.95	45	SNP	0.000	T
GRHL3	57822	genome.wustl.edu	37	1	24664133	24664133	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:24664133G>C	ENST00000350501.5	+	6	821	c.694G>C	c.(694-696)Gaa>Caa	p.E232Q	GRHL3_ENST00000342072.4_Missense_Mutation_p.E139Q|GRHL3_ENST00000356046.2_Missense_Mutation_p.E186Q|GRHL3_ENST00000236255.4_Missense_Mutation_p.E237Q|GRHL3_ENST00000361548.4_Missense_Mutation_p.E232Q	NM_198174.2	NP_937817.3	Q8TE85	GRHL3_HUMAN	grainyhead-like 3 (Drosophila)	232					central nervous system development (GO:0007417)|cochlea morphogenesis (GO:0090103)|ectoderm development (GO:0007398)|epidermis development (GO:0008544)|establishment of planar polarity (GO:0001736)|eyelid development in camera-type eye (GO:0061029)|pattern specification process (GO:0007389)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		CAGTGACTTTGAATACACCCT	0.597																																						dbGAP											0													70.0	63.0	66.0					1																	24664133		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY231161	CCDS251.1, CCDS252.1, CCDS44088.1, CCDS252.2, CCDS53284.1	1p36	2008-02-05	2005-07-11	2005-07-11	ENSG00000158055	ENSG00000158055			25839	protein-coding gene	gene with protein product		608317	"""transcription factor CP2-like 4"""	TFCP2L4		12549979	Standard	NM_021180		Approved	SOM	uc021oiw.1	Q8TE85	OTTHUMG00000003040	ENST00000350501.5:c.694G>C	1.37:g.24664133G>C	ENSP00000288955:p.Glu232Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A297|B2RCL1|G3XAF0|Q5TH78|Q86Y06|Q8N407	Missense_Mutation	SNP	pfam_CP2,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.E232Q	ENST00000350501.5	37	c.694	CCDS252.2	1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.385849	0.42308	.	.	ENSG00000158055	ENST00000361548;ENST00000342072;ENST00000350501;ENST00000356046;ENST00000236255	T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35	5.97	5.97	0.96955	.	0.053892	0.64402	D	0.000001	T	0.08492	0.0211	N	0.03891	-0.335	0.46298	D	0.998976	P;P;P	0.42296	0.775;0.734;0.734	B;B;B	0.39660	0.306;0.203;0.203	T	0.15292	-1.0442	10	0.02654	T	1	-40.2914	19.412	0.94677	0.0:0.0:1.0:0.0	.	186;237;232	A2A297;Q8TE85-2;G3XAF0	.;.;.	Q	232;139;232;186;237	ENSP00000354943:E232Q;ENSP00000340543:E139Q;ENSP00000288955:E232Q;ENSP00000348333:E186Q;ENSP00000236255:E237Q	ENSP00000236255:E237Q	E	+	1	0	GRHL3	24536720	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.988000	0.49386	2.828000	0.97474	0.655000	0.94253	GAA	GRHL3	-	pfam_CP2	ENSG00000158055		0.597	GRHL3-002	KNOWN	basic|CCDS	protein_coding	GRHL3	HGNC	protein_coding	OTTHUMT00000009047.2	36	0.00	0	G	NM_021180		24664133	24664133	+1	no_errors	ENST00000350501	ensembl	human	known	69_37n	missense	49	30.00	21	SNP	1.000	C
GRIPAP1	56850	genome.wustl.edu	37	X	48841752	48841752	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:48841752C>T	ENST00000376441.1	-	14	1139	c.1105G>A	c.(1105-1107)Gag>Aag	p.E369K	GRIPAP1_ENST00000473581.1_5'UTR|GRIPAP1_ENST00000376444.3_Missense_Mutation_p.E324K|GRIPAP1_ENST00000376423.4_Missense_Mutation_p.E316K|GRIPAP1_ENST00000376425.3_Missense_Mutation_p.E338K	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	369						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						TGCTGCAACTCAGCTGCCAGC	0.517																																						dbGAP											0													133.0	91.0	105.0					X																	48841752		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.1105G>A	X.37:g.48841752C>T	ENSP00000365624:p.Glu369Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	superfamily_Prefoldin	p.E369K	ENST00000376441.1	37	c.1105	CCDS35248.1	X	.	.	.	.	.	.	.	.	.	.	c	27.6	4.842332	0.91197	.	.	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291;ENST00000376423	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	4.31	4.31	0.51392	.	0.079299	0.48767	D	0.000169	T	0.33206	0.0855	L	0.55481	1.735	0.45979	D	0.998794	P;P;P	0.43231	0.755;0.61;0.801	P;B;B	0.48334	0.574;0.271;0.247	T	0.04767	-1.0928	10	0.25106	T	0.35	-9.0979	14.87	0.70450	0.0:1.0:0.0:0.0	.	316;259;369	Q4V328-2;Q4V328-3;Q4V328	.;.;GRAP1_HUMAN	K	338;324;369;338;316	ENSP00000365608:E338K;ENSP00000365627:E324K;ENSP00000365624:E369K;ENSP00000365606:E316K	ENSP00000365606:E316K	E	-	1	0	GRIPAP1	48726696	1.000000	0.71417	0.969000	0.41365	0.988000	0.76386	6.875000	0.75551	1.735000	0.51646	0.458000	0.33432	GAG	GRIPAP1	-	NULL	ENSG00000068400		0.517	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIPAP1	HGNC	protein_coding	OTTHUMT00000080970.2	83	0.00	0	C	NM_207672		48841752	48841752	-1	no_errors	ENST00000376441	ensembl	human	known	69_37n	missense	212	18.70	49	SNP	1.000	T
GTF3C5	9328	genome.wustl.edu	37	9	135933239	135933239	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr9:135933239G>C	ENST00000372097.5	+	11	1755	c.1432G>C	c.(1432-1434)Gag>Cag	p.E478Q	GTF3C5_ENST00000372099.6_Missense_Mutation_p.E469Q|GTF3C5_ENST00000372108.5_Missense_Mutation_p.E485Q|GTF3C5_ENST00000342018.8_Missense_Mutation_p.E416Q	NM_012087.3	NP_036219.2	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5, 63kDa	478	Glu-rich.				5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		TGGCGGAAAAGAGCAGCTGAC	0.597																																						dbGAP											0													49.0	41.0	44.0					9																	135933239		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF133124	CCDS6958.1, CCDS48050.1, CCDS75927.1	9q34.13	2010-03-23	2002-08-29		ENSG00000148308	ENSG00000148308		"""General transcription factors"""	4668	protein-coding gene	gene with protein product	"""transcription factor IIIC, 63 kD"""	604890	"""general transcription factor IIIC, polypeptide 5 (63kD)"""			10373544	Standard	NM_012087		Approved	TFiiiC2-63, TFIIIC63, TFIIICepsilon	uc004ccj.4	Q9Y5Q8	OTTHUMG00000020856	ENST00000372097.5:c.1432G>C	9.37:g.135933239G>C	ENSP00000361169:p.Glu478Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI44|A6NJB9|Q5T7U2|Q5T7U3|Q8N2U7|Q8N857|Q96GD9|Q9H4P2	Missense_Mutation	SNP	pfam_TF_IIIC_su-5	p.E485Q	ENST00000372097.5	37	c.1453	CCDS6958.1	9	.	.	.	.	.	.	.	.	.	.	G	8.236	0.805774	0.16467	.	.	ENSG00000148308	ENST00000372097;ENST00000372099;ENST00000372108;ENST00000342018	T;T;T;T	0.47177	0.86;0.86;0.85;0.85	5.13	4.21	0.49690	.	0.632795	0.17652	N	0.166649	T	0.50240	0.1604	M	0.73598	2.24	0.80722	D	1	B;B	0.27166	0.17;0.017	B;B	0.26202	0.067;0.005	T	0.50533	-0.8817	10	0.46703	T	0.11	-19.2232	14.4812	0.67585	0.0:0.1481:0.8519:0.0	.	485;478	Q9Y5Q8-3;Q9Y5Q8	.;TF3C5_HUMAN	Q	478;469;485;416	ENSP00000361169:E478Q;ENSP00000361171:E469Q;ENSP00000361180:E485Q;ENSP00000339530:E416Q	ENSP00000339530:E416Q	E	+	1	0	GTF3C5	134923060	1.000000	0.71417	0.601000	0.28877	0.077000	0.17291	2.270000	0.43355	1.106000	0.41623	0.491000	0.48974	GAG	GTF3C5	-	NULL	ENSG00000148308		0.597	GTF3C5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C5	HGNC	protein_coding	OTTHUMT00000054826.1	14	0.00	0	G	NM_001122823		135933239	135933239	+1	no_errors	ENST00000372108	ensembl	human	known	69_37n	missense	24	31.43	11	SNP	0.998	C
MROH7	374977	genome.wustl.edu	37	1	55145599	55145599	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:55145599G>A	ENST00000421030.2	+	13	2547	c.2262G>A	c.(2260-2262)ctG>ctA	p.L754L	MROH7_ENST00000545244.1_Silent_p.L322L|MROH7-TTC4_ENST00000414150.2_Silent_p.L754L|MROH7_ENST00000395690.2_Silent_p.L754L|MROH7_ENST00000409996.1_Silent_p.L322L|MROH7_ENST00000454855.2_Silent_p.L272L|MROH7_ENST00000339553.5_Silent_p.L754L	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	754						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											ACATGCAGCTGAGCCACATCC	0.642																																						dbGAP											0													95.0	106.0	102.0					1																	55145599		2007	4171	6178	-	-	-	SO:0001819	synonymous_variant	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.2262G>A	1.37:g.55145599G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Silent	SNP	superfamily_ARM-type_fold	p.L754	ENST00000421030.2	37	c.2262	CCDS41342.2	1																																																																																			HEATR8	-	superfamily_ARM-type_fold	ENSG00000184313		0.642	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR8	HGNC	protein_coding	OTTHUMT00000346978.1	13	0.00	0	G	NM_198547		55145599	55145599	+1	no_errors	ENST00000421030	ensembl	human	known	69_37n	silent	24	27.27	9	SNP	0.850	A
HHIPL2	79802	genome.wustl.edu	37	1	222721350	222721350	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:222721350G>A	ENST00000343410.6	-	1	95	c.37C>T	c.(37-39)Ctg>Ttg	p.L13L		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	13					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		CGGCAATGCAGACCACCACAC	0.592																																						dbGAP											0													56.0	66.0	63.0					1																	222721350		2016	4164	6180	-	-	-	SO:0001819	synonymous_variant	0			BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.37C>T	1.37:g.222721350G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Silent	SNP	pfam_Folate_rcpt-like,pfam_Glc/Sorbosone_DH,superfamily_Quinoprot_gluc/sorb_DH,superfamily_Saposin-like	p.L13	ENST00000343410.6	37	c.37	CCDS1530.2	1																																																																																			HHIPL2	-	NULL	ENSG00000143512		0.592	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIPL2	HGNC	protein_coding	OTTHUMT00000091499.2	22	0.00	0	G	NM_024746		222721350	222721350	-1	no_errors	ENST00000343410	ensembl	human	known	69_37n	silent	74	15.73	14	SNP	0.021	A
HIF1A	3091	genome.wustl.edu	37	14	62193473	62193473	+	Silent	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr14:62193473C>G	ENST00000337138.4	+	5	772	c.507C>G	c.(505-507)ctC>ctG	p.L169L	HIF1A_ENST00000539097.1_Silent_p.L193L|HIF1A-AS2_ENST00000554254.1_lincRNA|HIF1A_ENST00000557538.1_Silent_p.L110L|HIF1A_ENST00000323441.6_Silent_p.L169L|HIF1A_ENST00000394997.1_Silent_p.L170L|HIF1A_ENST00000557206.1_3'UTR	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	169	Interaction with TSGA10. {ECO:0000250}.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	GCTTTTTTCTCAGAATGAAGT	0.323																																						dbGAP											0													90.0	87.0	88.0					14																	62193473		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.507C>G	14.37:g.62193473C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Silent	SNP	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_DNA-bd,prints_HIF-1_alpha,tigrfam_PAS	p.L193	ENST00000337138.4	37	c.579	CCDS9753.1	14																																																																																			HIF1A	-	NULL	ENSG00000100644		0.323	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HIF1A	HGNC	protein_coding	OTTHUMT00000276977.2	192	0.00	0	C	NM_001530		62193473	62193473	+1	no_errors	ENST00000539097	ensembl	human	known	69_37n	silent	189	19.83	47	SNP	0.997	G
HIST1H3B	8358	genome.wustl.edu	37	6	26032049	26032049	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:26032049C>G	ENST00000244661.2	-	1	239	c.240G>C	c.(238-240)aaG>aaC	p.K80N		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	80					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						GAAGATCGGTCTTGAAGTCTT	0.587																																						dbGAP											0													75.0	78.0	77.0					6																	26032049		2203	4300	6503	-	-	-	SO:0001583	missense	0			X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.240G>C	6.37:g.26032049C>G	ENSP00000244661:p.Lys80Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.K80N	ENST00000244661.2	37	c.240	CCDS4573.1	6	.	.	.	.	.	.	.	.	.	.	c	15.42	2.826937	0.50739	.	.	ENSG00000124693	ENST00000244661	T	0.68765	-0.35	5.24	4.38	0.52667	.	.	.	.	.	T	0.69214	0.3086	.	.	.	0.43137	D	0.994884	.	.	.	.	.	.	T	0.74396	-0.3679	6	0.66056	D	0.02	.	13.48	0.61330	0.0:0.9241:0.0:0.0759	.	.	.	.	N	80	ENSP00000244661:K80N	ENSP00000244661:K80N	K	-	3	2	HIST1H3B	26140028	1.000000	0.71417	1.000000	0.80357	0.337000	0.28794	2.435000	0.44811	1.349000	0.45751	-0.215000	0.12644	AAG	HIST1H3B	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000124693		0.587	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3B	HGNC	protein_coding	OTTHUMT00000040077.1	31	0.00	0	C	NM_003537		26032049	26032049	-1	no_errors	ENST00000244661	ensembl	human	known	69_37n	missense	42	31.15	19	SNP	1.000	G
HIST1H2AB	8335	genome.wustl.edu	37	6	26033433	26033433	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:26033433C>G	ENST00000259791.2	-	1	363	c.364G>C	c.(364-366)Gag>Cag	p.E122Q	HIST1H3B_ENST00000244661.2_5'Flank	NM_003513.2	NP_003504.2	P04908	H2A1B_HUMAN	histone cluster 1, H2ab	122						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						TGATGGCTCTCAGTTTTCTTA	0.488																																						dbGAP											0													59.0	61.0	60.0					6																	26033433		2203	4300	6503	-	-	-	SO:0001583	missense	0			X00089	CCDS4574.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000137259	ENSG00000278463		"""Histones / Replication-dependent"""	4734	protein-coding gene	gene with protein product		602795	"""H2A histone family, member M"", ""histone 1, H2ab"""	H2AFM		9439656, 9119399, 12408966	Standard	NM_003513		Approved	H2A/m	uc003nft.1	P04908	OTTHUMG00000014420	ENST00000259791.2:c.364G>C	6.37:g.26033433C>G	ENSP00000259791:p.Glu122Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	P28001|Q76P63	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.E122Q	ENST00000259791.2	37	c.364	CCDS4574.1	6	.	.	.	.	.	.	.	.	.	.	c	13.19	2.163028	0.38217	.	.	ENSG00000137259	ENST00000259791	T	0.42513	0.97	5.35	5.35	0.76521	Histone-fold (2);Histone H2A (1);	0.000000	0.35646	U	0.003064	T	0.23492	0.0568	.	.	.	0.36665	D	0.878145	B	0.02656	0.0	B	0.01281	0.0	T	0.03086	-1.1074	9	0.38643	T	0.18	.	18.4224	0.90595	0.0:1.0:0.0:0.0	.	122	P04908	H2A1B_HUMAN	Q	122	ENSP00000259791:E122Q	ENSP00000259791:E122Q	E	-	1	0	HIST1H2AB	26141412	1.000000	0.71417	1.000000	0.80357	0.513000	0.34164	5.660000	0.68018	2.648000	0.89879	0.561000	0.74099	GAG	HIST1H2AB	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000137259		0.488	HIST1H2AB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AB	HGNC	protein_coding	OTTHUMT00000040082.1	26	0.00	0	C	NM_003513		26033433	26033433	-1	no_errors	ENST00000259791	ensembl	human	known	69_37n	missense	68	17.07	14	SNP	1.000	G
HIST2H2BE	8349	genome.wustl.edu	37	1	149858071	149858071	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:149858071G>C	ENST00000369155.2	-	1	161	c.120C>G	c.(118-120)atC>atG	p.I40M	BOLA1_ENST00000369153.2_5'Flank|HIST2H2AC_ENST00000331380.2_5'Flank	NM_003528.2	NP_003519.1	Q16778	H2B2E_HUMAN	histone cluster 2, H2be	40					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	14	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			TGTACACGTAGATGGAGTAGC	0.577																																						dbGAP											0													218.0	201.0	206.0					1																	149858071		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY131979	CCDS936.1	1q21.2	2011-01-27	2006-10-11	2003-03-07	ENSG00000184678	ENSG00000184678		"""Histones / Replication-dependent"""	4760	protein-coding gene	gene with protein product		601831	"""H2B histone family, member Q"", ""histone 2, H2be"""	H2B, H2BFQ		1469070, 12408966	Standard	NM_003528		Approved	H2B/q, H2B.1	uc001etc.3	Q16778	OTTHUMG00000012095	ENST00000369155.2:c.120C>G	1.37:g.149858071G>C	ENSP00000358151:p.Ile40Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KMC7|A8K110|Q4KMY1|Q5QNX0|Q9UE88	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.I40M	ENST00000369155.2	37	c.120	CCDS936.1	1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.140775	0.37825	.	.	ENSG00000184678	ENST00000369155	T	0.23754	1.89	5.99	4.07	0.47477	Histone-fold (2);Histone core (1);	0.000000	0.85682	D	0.000000	T	0.04907	0.0132	N	0.17248	0.465	0.27085	N	0.962994	B	0.13145	0.007	B	0.12156	0.007	T	0.33675	-0.9859	10	0.31617	T	0.26	.	7.1293	0.25490	0.1492:0.1425:0.7083:0.0	.	40	Q16778	H2B2E_HUMAN	M	40	ENSP00000358151:I40M	ENSP00000358151:I40M	I	-	3	3	HIST2H2BE	148124695	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.807000	0.47955	0.828000	0.34709	0.650000	0.86243	ATC	HIST2H2BE	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000184678		0.577	HIST2H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2BE	HGNC	protein_coding	OTTHUMT00000033455.1	112	0.00	0	G	NM_003528		149858071	149858071	-1	no_errors	ENST00000369155	ensembl	human	known	69_37n	missense	218	23.24	66	SNP	1.000	C
HLA-DMB	3109	genome.wustl.edu	37	6	32904950	32904950	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:32904950C>G	ENST00000416244.2	-	3	815	c.621G>C	c.(619-621)tgG>tgC	p.W207C	AL645941.1_ENST00000390777.1_RNA|HLA-DMB_ENST00000418107.2_Splice_Site_p.W207C			P28068	DMB_HUMAN	major histocompatibility complex, class II, DM beta	207	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|MHC class II protein complex assembly (GO:0002399)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001190)|positive regulation of T cell proliferation (GO:0042102)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)			breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						TACACTTACTCCAGTCCCGAA	0.507																																						dbGAP											0													78.0	79.0	79.0					6																	32904950		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4760.1	6p21.3	2014-05-16			ENSG00000242574	ENSG00000242574		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4935	protein-coding gene	gene with protein product		142856				1922365	Standard	NM_002118		Approved	D6S221E, RING7	uc003ocl.2	P28068	OTTHUMG00000031176	ENST00000416244.2:c.621G>C	6.37:g.32904950C>G	ENSP00000391010:p.Trp207Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O77936|Q13012|Q29751|Q58ZE2|Q5SNZ8|Q5STC4|Q9XRX2	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_MHC_II_b_N,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.W207C	ENST00000416244.2	37	c.621		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.24|15.24	2.774315|2.774315	0.49786|0.49786	.|.	.|.	ENSG00000242574|ENSG00000242574	ENST00000414017|ENST00000438510;ENST00000446948;ENST00000418107;ENST00000416244	.|T;T;T	.|0.16324	.|2.35;6.14;6.14	4.56|4.56	4.56|4.56	0.56223|0.56223	.|Immunoglobulin-like fold (1);	.|0.000000	.|0.53938	.|D	.|0.000054	T|T	0.48447|0.48447	0.1500|0.1500	H|H	0.96916|0.96916	3.905|3.905	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;0.998;0.999;0.999	.|D;D;D;D;D	.|0.97110	.|1.0;0.955;0.966;0.975;0.955	T|T	0.64364|0.64364	-0.6425|-0.6425	5|10	.|0.87932	.|D	.|0	.|.	13.0126|13.0126	0.58739|0.58739	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|207;207;89;96;207	.|E9PD01;A2AAT3;B0V061;B0V062;P28068	.|.;.;.;.;DMB_HUMAN	H|C	97|89;207;207;207	.|ENSP00000390848:W89C;ENSP00000398890:W207C;ENSP00000391010:W207C	.|ENSP00000391010:W207C	D|W	-|-	1|3	0|0	HLA-DMB|HLA-DMB	33012928|33012928	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.644000|0.644000	0.38419|0.38419	4.041000|4.041000	0.57339|0.57339	2.524000|2.524000	0.85096|0.85096	0.494000|0.494000	0.49563|0.49563	GAC|TGG	HLA-DMB	-	NULL	ENSG00000242574		0.507	HLA-DMB-213	KNOWN	basic	protein_coding	HLA-DMB	HGNC	protein_coding		29	0.00	0	C	NM_002118		32904950	32904950	-1	no_errors	ENST00000418107	ensembl	human	known	69_37n	missense	55	12.70	8	SNP	1.000	G
HNRNPM	4670	genome.wustl.edu	37	19	8533661	8533661	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:8533661G>A	ENST00000325495.4	+	9	879	c.838G>A	c.(838-840)Gag>Aag	p.E280K	HNRNPM_ENST00000348943.3_Missense_Mutation_p.E241K	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	280	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						CTTTCAGGATGAGAGGGCCTT	0.463																																						dbGAP											0													78.0	68.0	71.0					19																	8533661		2203	4300	6503	-	-	-	SO:0001583	missense	0			L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.838G>A	19.37:g.8533661G>A	ENSP00000325376:p.Glu280Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	pfam_RRM_dom,pfam_HnRNP_M_PY-NLS,smart_RRM_dom,pfscan_RRM_dom	p.E280K	ENST00000325495.4	37	c.838	CCDS12203.1	19	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152717	0.78001	.	.	ENSG00000099783	ENST00000325495;ENST00000348943;ENST00000544159	T;T	0.31769	1.48;2.78	5.61	5.61	0.85477	RNA recognition motif domain (1);	0.095738	0.64402	D	0.000001	T	0.26557	0.0649	N	0.05078	-0.115	0.80722	D	1	B;B;P;B;B	0.48911	0.0;0.001;0.917;0.002;0.0	B;B;P;B;B	0.50405	0.004;0.004;0.64;0.006;0.007	T	0.13124	-1.0521	10	0.37606	T	0.19	.	18.2598	0.90031	0.0:0.0:1.0:0.0	.	120;280;241;241;180	Q7KYM9;P52272;P52272-2;B4DEG4;Q59ES8	.;HNRPM_HUMAN;.;.;.	K	280;241;180	ENSP00000325376:E280K;ENSP00000325732:E241K	ENSP00000325376:E280K	E	+	1	0	HNRNPM	8439661	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.902000	0.92568	2.654000	0.90174	0.650000	0.86243	GAG	HNRNPM	-	pfscan_RRM_dom	ENSG00000099783		0.463	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPM	HGNC	protein_coding	OTTHUMT00000460894.1	104	0.00	0	G			8533661	8533661	+1	no_errors	ENST00000325495	ensembl	human	known	69_37n	missense	90	17.43	19	SNP	1.000	A
HOXA13	3209	genome.wustl.edu	37	7	27237824	27237824	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:27237824G>C	ENST00000222753.4	-	2	1188	c.1160C>G	c.(1159-1161)aCt>aGt	p.T387S	HOTTIP_ENST00000521028.2_RNA|HOTTIP_ENST00000472494.1_RNA|HOTTIP_ENST00000605136.1_RNA|HOXA13_ENST00000518136.3_5'Flank|HOTTIP_ENST00000421733.1_RNA	NM_000522.4	NP_000513.2	P31271	HXA13_HUMAN	homeobox A13	387					artery morphogenesis (GO:0048844)|branching involved in prostate gland morphogenesis (GO:0060442)|embryonic forelimb morphogenesis (GO:0035115)|endothelial cell fate specification (GO:0060847)|endothelial cell morphogenesis (GO:0001886)|inner ear development (GO:0048839)|male genitalia development (GO:0030539)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of BMP signaling pathway (GO:0030510)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|ventricular septum development (GO:0003281)	intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	6						CCATTAACTAGTGGTTTTCAG	0.393			T	NUP98	AML																																	dbGAP		Dom	yes		7	7p15-p14.2	3209	homeo box A13		L	0													184.0	194.0	190.0					7																	27237824		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5412.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106031	ENSG00000106031		"""Homeoboxes / ANTP class : HOXL subclass"""	5102	protein-coding gene	gene with protein product		142959	"""homeo box A13"""	HOX1J, HOX1		1973146, 1358459	Standard	NM_000522		Approved		uc003szb.1	P31271	OTTHUMG00000023438	ENST00000222753.4:c.1160C>G	7.37:g.27237824G>C	ENSP00000222753:p.Thr387Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D188|O43371	Missense_Mutation	SNP	pfam_HoxA13_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Antifreeze_1	p.T387S	ENST00000222753.4	37	c.1160	CCDS5412.1	7	.	.	.	.	.	.	.	.	.	.	G	1.655	-0.513004	0.04200	.	.	ENSG00000106031	ENST00000222753	D	0.94613	-3.47	5.79	5.79	0.91817	.	0.172684	0.49916	D	0.000132	D	0.83594	0.5288	N	0.01250	-0.93	0.36458	D	0.866509	B	0.17465	0.022	B	0.17433	0.018	T	0.80591	-0.1314	10	0.06236	T	0.91	.	19.6339	0.95722	0.0:0.0:1.0:0.0	.	387	P31271	HXA13_HUMAN	S	387	ENSP00000222753:T387S	ENSP00000222753:T387S	T	-	2	0	HOXA13	27204349	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.745000	0.68672	2.727000	0.93392	0.563000	0.77884	ACT	HOXA13	-	NULL	ENSG00000106031		0.393	HOXA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA13	HGNC	protein_coding	OTTHUMT00000358752.3	382	0.00	0	G			27237824	27237824	-1	no_errors	ENST00000222753	ensembl	human	known	69_37n	missense	387	16.05	74	SNP	1.000	C
HP	3240	genome.wustl.edu	37	16	72094180	72094180	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:72094180C>T	ENST00000355906.5	+	7	670	c.612C>T	c.(610-612)ctC>ctT	p.L204L	HP_ENST00000357763.4_Silent_p.L240L|HPR_ENST00000540303.2_5'Flank|HP_ENST00000398131.2_Silent_p.L145L|HP_ENST00000570083.1_Silent_p.L145L|HP_ENST00000562526.1_Intron|HPR_ENST00000356967.5_Intron|HPR_ENST00000561690.1_5'Flank|HP_ENST00000565574.1_Silent_p.L145L	NM_005143.3	NP_005134.1	P00738	HPT_HUMAN	haptoglobin	204	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute-phase response (GO:0006953)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|immune system process (GO:0002376)|negative regulation of hydrogen peroxide catabolic process (GO:2000296)|negative regulation of oxidoreductase activity (GO:0051354)|positive regulation of cell death (GO:0010942)|response to hydrogen peroxide (GO:0042542)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)	antioxidant activity (GO:0016209)|hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7		Renal(780;9.67e-05)|Ovarian(137;0.00327)|Hepatocellular(780;0.114)		BRCA - Breast invasive adenocarcinoma(221;0.00015)|Kidney(780;0.000529)		CTAAAAATCTCTTCCTGAACC	0.468																																						dbGAP											0													43.0	45.0	44.0					16																	72094180		1958	4162	6120	-	-	-	SO:0001819	synonymous_variant	0				CCDS45524.1, CCDS45525.1	16q22.2	2012-10-02			ENSG00000257017	ENSG00000257017			5141	protein-coding gene	gene with protein product		140100				11109501, 9352226	Standard	NM_005143		Approved		uc002fbr.4	P00738		ENST00000355906.5:c.612C>T	16.37:g.72094180C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0AZL5|P00737|Q0VAC4|Q0VAC5|Q2PP15|Q3B7J0|Q6LBY9|Q9UC67	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.L202F	ENST00000355906.5	37	c.604	CCDS45524.1	16																																																																																			HP	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000257017		0.468	HP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HP	HGNC	protein_coding	OTTHUMT00000421680.1	68	0.00	0	C	NM_005143		72094180	72094180	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000567185	ensembl	human	novel	69_37n	missense	57	22.97	17	SNP	0.999	T
HRC	3270	genome.wustl.edu	37	19	49655283	49655283	+	Silent	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:49655283G>C	ENST00000252825.4	-	4	2190	c.2004C>G	c.(2002-2004)gtC>gtG	p.V668V	HRC_ENST00000595625.1_Silent_p.V645V	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	668	Metal-binding. {ECO:0000255}.				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		CCGTTTCGCAGACCAGCGGGC	0.687																																					Melanoma(37;75 1097 24567 25669 30645)	dbGAP											0													36.0	38.0	38.0					19																	49655283		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.2004C>G	19.37:g.49655283G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q504Y6	Silent	SNP	pfam_Hist_rich_Ca-bd	p.V668	ENST00000252825.4	37	c.2004	CCDS12759.1	19																																																																																			HRC	-	NULL	ENSG00000130528		0.687	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRC	HGNC	protein_coding	OTTHUMT00000465649.1	16	0.00	0	G	NM_002152		49655283	49655283	-1	no_errors	ENST00000252825	ensembl	human	known	69_37n	silent	38	28.30	15	SNP	1.000	C
HS6ST1	9394	genome.wustl.edu	37	2	129026048	129026048	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:129026048G>C	ENST00000259241.6	-	2	937	c.924C>G	c.(922-924)ttC>ttG	p.F308L		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	308					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		ACTTGAGGTTGAACGTCCGCT	0.617																																						dbGAP											0													34.0	36.0	35.0					2																	129026048		2093	4215	6308	-	-	-	SO:0001583	missense	0			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.924C>G	2.37:g.129026048G>C	ENSP00000259241:p.Phe308Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	pfam_Sulfotransferase	p.F308L	ENST00000259241.6	37	c.924	CCDS42748.1	2	.	.	.	.	.	.	.	.	.	.	G	21.4	4.137487	0.77775	.	.	ENSG00000136720	ENST00000259241	D	0.84223	-1.82	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	D	0.90504	0.7025	M	0.71036	2.16	0.80722	D	1	D	0.57257	0.979	D	0.74023	0.982	D	0.90187	0.4247	9	.	.	.	0.4019	11.8082	0.52167	0.0927:0.0:0.9072:0.0	.	308	O60243	H6ST1_HUMAN	L	308	ENSP00000259241:F308L	.	F	-	3	2	HS6ST1	128742518	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.628000	0.37060	2.203000	0.70933	0.462000	0.41574	TTC	HS6ST1	-	pfam_Sulfotransferase	ENSG00000136720		0.617	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST1	HGNC	protein_coding	OTTHUMT00000331572.1	14	0.00	0	G	NM_004807		129026048	129026048	-1	no_errors	ENST00000259241	ensembl	human	known	69_37n	missense	31	22.50	9	SNP	1.000	C
HTATSF1	27336	genome.wustl.edu	37	X	135593186	135593186	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:135593186G>A	ENST00000218364.4	+	9	1456	c.1282G>A	c.(1282-1284)Gag>Aag	p.E428K	HTATSF1_ENST00000535601.1_Missense_Mutation_p.E428K	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	428	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					ACCTATAGATGAGAAGAAGTT	0.433																																						dbGAP											0													111.0	123.0	119.0					X																	135593186		2203	4299	6502	-	-	-	SO:0001583	missense	0			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1282G>A	X.37:g.135593186G>A	ENSP00000218364:p.Glu428Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E428K	ENST00000218364.4	37	c.1282	CCDS14657.1	X	.	.	.	.	.	.	.	.	.	.	G	16.67	3.188286	0.57909	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	T;T	0.24723	1.84;1.84	5.73	4.87	0.63330	.	0.121961	0.37669	N	0.001991	T	0.18841	0.0452	N	0.24115	0.695	0.30297	N	0.789845	B	0.18461	0.028	B	0.17433	0.018	T	0.09930	-1.0652	10	0.62326	D	0.03	-18.6078	11.9938	0.53189	0.0861:0.0:0.9139:0.0	.	428	O43719	HTSF1_HUMAN	K	428	ENSP00000442699:E428K;ENSP00000218364:E428K	ENSP00000218364:E428K	E	+	1	0	HTATSF1	135420852	0.996000	0.38824	0.993000	0.49108	0.990000	0.78478	2.772000	0.47678	1.306000	0.44926	0.523000	0.50628	GAG	HTATSF1	-	NULL	ENSG00000102241		0.433	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTATSF1	HGNC	protein_coding	OTTHUMT00000058497.1	38	0.00	0	G	NM_014500		135593186	135593186	+1	no_errors	ENST00000218364	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	0.811	A
HTR1D	3352	genome.wustl.edu	37	1	23519996	23519996	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:23519996G>A	ENST00000374619.1	-	1	1226	c.717C>T	c.(715-717)ttC>ttT	p.F239F	HTR1D_ENST00000314113.3_Silent_p.F239F	NM_000864.4	NP_000855.1	P28221	5HT1D_HUMAN	5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled	239					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intestine smooth muscle contraction (GO:0014827)|regulation of behavior (GO:0050795)|regulation of locomotion (GO:0040012)|response to toxic substance (GO:0009636)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000779)|all_lung(284;0.00135)|Breast(348;0.0385)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;4.69e-27)|Colorectal(126;4.86e-08)|COAD - Colon adenocarcinoma(152;2.86e-06)|GBM - Glioblastoma multiforme(114;0.00012)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(1967;0.00122)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.083)|LUSC - Lung squamous cell carcinoma(448;0.185)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Naratriptan(DB00952)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Risperidone(DB00734)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GGGCCGTGGTGAAGCGCTTCC	0.617																																						dbGAP											0													45.0	49.0	48.0					1																	23519996		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M89955	CCDS231.1	1p36.3-p34.3	2012-08-08	2012-02-03		ENSG00000179546	ENSG00000179546		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5289	protein-coding gene	gene with protein product		182133	"""5-hydroxytryptamine (serotonin) receptor 1D"""	HTRL		2541503, 1662665	Standard	NM_000864		Approved	RDC4, HT1DA, 5-HT1D	uc001bgn.3	P28221	OTTHUMG00000003235	ENST00000374619.1:c.717C>T	1.37:g.23519996G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_5HT1D_rcpt,prints_5HT_rcpt	p.F239	ENST00000374619.1	37	c.717	CCDS231.1	1																																																																																			HTR1D	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT1D_rcpt	ENSG00000179546		0.617	HTR1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1D	HGNC	protein_coding	OTTHUMT00000008924.1	29	0.00	0	G	NM_000864		23519996	23519996	-1	no_errors	ENST00000314113	ensembl	human	known	69_37n	silent	30	26.83	11	SNP	1.000	A
HYOU1	10525	genome.wustl.edu	37	11	118926849	118926849	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:118926849C>T	ENST00000404233.3	-	2	148	c.24G>A	c.(22-24)caG>caA	p.Q8Q	HYOU1_ENST00000529972.1_Silent_p.Q8Q|HYOU1_ENST00000525859.1_Silent_p.Q8Q|HYOU1_ENST00000543287.1_5'UTR	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	8					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		TCCTCGGCCTCTGCCTCCTAA	0.537											OREG0021394	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													96.0	85.0	89.0					11																	118926849		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.24G>A	11.37:g.118926849C>T		Somatic	1492	WXS	Illumina GAIIx	Phase_IV	A8C1Z0|B7Z909|Q2I204|Q53H25	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.Q8	ENST00000404233.3	37	c.24	CCDS8408.1	11																																																																																			HYOU1	-	NULL	ENSG00000149428		0.537	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	HYOU1	HGNC	protein_coding	OTTHUMT00000389353.1	44	0.00	0	C	NM_006389		118926849	118926849	-1	no_errors	ENST00000404233	ensembl	human	known	69_37n	silent	86	15.69	16	SNP	1.000	T
IBTK	25998	genome.wustl.edu	37	6	82927697	82927697	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:82927697C>G	ENST00000306270.7	-	10	1955	c.1406G>C	c.(1405-1407)aGa>aCa	p.R469T	IBTK_ENST00000510291.1_Missense_Mutation_p.R469T|IBTK_ENST00000503631.1_Missense_Mutation_p.R469T	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	469					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		AGAACTCTTTCTTTTCTCTTC	0.318																																						dbGAP											0													100.0	102.0	101.0					6																	82927697		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.1406G>C	6.37:g.82927697C>G	ENSP00000305721:p.Arg469Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens	p.R469T	ENST00000306270.7	37	c.1406	CCDS34490.1	6	.	.	.	.	.	.	.	.	.	.	C	11.37	1.619079	0.28801	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	T;T;T	0.28069	1.89;1.63;1.89	5.23	1.98	0.26296	.	0.201379	0.51477	D	0.000098	T	0.08537	0.0212	L	0.44542	1.39	0.40388	D	0.979512	B;B;P;B	0.40834	0.181;0.381;0.73;0.381	B;B;B;B	0.35688	0.031;0.094;0.208;0.094	T	0.10870	-1.0611	10	0.15499	T	0.54	-17.9602	7.4225	0.27079	0.0:0.5217:0.0:0.4783	.	469;469;469;469	E9PDR5;E7EPI0;Q9P2D0-2;Q9P2D0	.;.;.;IBTK_HUMAN	T	469	ENSP00000305721:R469T;ENSP00000422762:R469T;ENSP00000426405:R469T	ENSP00000305721:R469T	R	-	2	0	IBTK	82984416	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	2.388000	0.44398	0.715000	0.32103	-0.258000	0.10820	AGA	IBTK	-	NULL	ENSG00000005700		0.318	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBTK	HGNC	protein_coding	OTTHUMT00000041337.2	339	0.00	0	C	NM_015525		82927697	82927697	-1	no_errors	ENST00000306270	ensembl	human	known	69_37n	missense	214	22.46	62	SNP	1.000	G
IFI16	3428	genome.wustl.edu	37	1	159021644	159021644	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:159021644A>T	ENST00000295809.7	+	10	2096	c.1841A>T	c.(1840-1842)aAg>aTg	p.K614M	IFI16_ENST00000368131.4_Missense_Mutation_p.K558M|IFI16_ENST00000448393.2_Missense_Mutation_p.K502M|IFI16_ENST00000368132.3_Missense_Mutation_p.K558M|IFI16_ENST00000430894.2_Missense_Mutation_p.K562M|IFI16_ENST00000359709.3_Missense_Mutation_p.K558M|IFI16_ENST00000340979.6_Missense_Mutation_p.K502M			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	614	HIN-200 2. {ECO:0000255|PROSITE- ProRule:PRU00106}.|Interaction with TP53 core domain.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TTCCGAGTGAAGGTTTTTAAT	0.413																																						dbGAP											0													102.0	103.0	103.0					1																	159021644		2203	4300	6503	-	-	-	SO:0001583	missense	0			M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.1841A>T	1.37:g.159021644A>T	ENSP00000295809:p.Lys614Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN,pfscan_HIN200/IF120x	p.K614M	ENST00000295809.7	37	c.1841		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.22|14.22	2.470415|2.470415	0.43942|0.43942	.|.	.|.	ENSG00000163565|ENSG00000163565	ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894|ENST00000448393	T;T;T;T;T|.	0.19669|.	2.13;2.13;2.13;2.13;2.13|.	4.85|4.85	4.85|4.85	0.62838|0.62838	.|.	.|.	.|.	.|.	.|.	T|T	0.39064|0.39064	0.1064|0.1064	M|M	0.62723|0.62723	1.935|1.935	0.25976|0.25976	N|N	0.98243|0.98243	D;D;D|.	0.89917|.	0.999;1.0;1.0|.	D;D;D|.	0.97110|.	0.998;1.0;0.999|.	T|T	0.30563|0.30563	-0.9974|-0.9974	9|5	0.87932|.	D|.	0|.	.|.	10.7594|10.7594	0.46256|0.46256	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	562;502;558|.	E7EPR3;Q16666-3;Q16666-2|.	.;.;.|.	M|W	614;502;558;558;562|323	ENSP00000295809:K614M;ENSP00000342741:K502M;ENSP00000357113:K558M;ENSP00000357114:K558M;ENSP00000394935:K562M|.	ENSP00000295809:K614M|.	K|R	+|+	2|1	0|2	IFI16|IFI16	157288268|157288268	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.126000|0.126000	0.20510|0.20510	2.052000|2.052000	0.41316|0.41316	2.029000|2.029000	0.59856|0.59856	0.496000|0.496000	0.49642|0.49642	AAG|AGG	IFI16	-	pfam_HIN200/IF120x,pfscan_HIN200/IF120x	ENSG00000163565		0.413	IFI16-013	KNOWN	basic	protein_coding	IFI16	HGNC	protein_coding	OTTHUMT00000421720.1	78	0.00	0	A	NM_005531		159021644	159021644	+1	no_errors	ENST00000295809	ensembl	human	known	69_37n	missense	55	54.55	66	SNP	1.000	T
IGLV5-48	28780	genome.wustl.edu	37	22	22707577	22707577	+	RNA	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr22:22707577C>T	ENST00000390293.1	+	0	165									immunoglobulin lambda variable 5-48 (non-functional)																		ACAGGATATTCTGGTACCAGC	0.557																																						dbGAP											0													76.0	75.0	75.0					22																	22707577		1959	4150	6109	-	-	-			0			Z73649		22q11.2	2012-02-08	2008-09-15		ENSG00000211647	ENSG00000211647		"""Immunoglobulins / IGL locus"""	5925	other	immunoglobulin gene			"""immunoglobulin lambda variable 5-48"""				Standard	NG_000002		Approved				OTTHUMG00000151041		22.37:g.22707577C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.F55	ENST00000390293.1	37	c.165		22																																																																																			IGLV5-48	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211647		0.557	IGLV5-48-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV5-48	HGNC	IG_V_gene	OTTHUMT00000321100.2	43	0.00	0	C	NG_000002		22707577	22707577	+1	no_stop_codon	ENST00000390293	ensembl	human	known	69_37n	silent	52	27.78	20	SNP	0.027	T
IL6	3569	genome.wustl.edu	37	7	22769291	22769291	+	Intron	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:22769291C>T	ENST00000404625.1	+	5	930				IL6_ENST00000420258.2_Silent_p.S215S|IL6_ENST00000401651.1_Silent_p.S85S|AC073072.5_ENST00000325042.2_RNA|IL6_ENST00000401630.3_Intron|IL6_ENST00000258743.5_Intron|IL6_ENST00000407492.1_Intron|IL6_ENST00000406575.1_Silent_p.S161S			P05231	IL6_HUMAN	interleukin 6						acute-phase response (GO:0006953)|aging (GO:0007568)|bone remodeling (GO:0046849)|branching involved in salivary gland morphogenesis (GO:0060445)|cell growth (GO:0016049)|cell redox homeostasis (GO:0045454)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endocrine pancreas development (GO:0031018)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|glucagon secretion (GO:0070091)|hepatic immune response (GO:0002384)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of hormone secretion (GO:0046888)|negative regulation of lipid storage (GO:0010888)|negative regulation of muscle organ development (GO:0048635)|negative regulation of neuron death (GO:1901215)|negative regulation of protein kinase activity (GO:0006469)|neuron projection development (GO:0031175)|neutrophil apoptotic process (GO:0001781)|neutrophil mediated immunity (GO:0002446)|platelet activation (GO:0030168)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell activation (GO:0050871)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of angiogenesis (GO:0045765)|regulation of cell shape (GO:0008360)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of vascular endothelial growth factor production (GO:0010574)|response to amino acid (GO:0043200)|response to antibiotic (GO:0046677)|response to caffeine (GO:0031000)|response to calcium ion (GO:0051592)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to heat (GO:0009408)|response to insulin (GO:0032868)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to peptidoglycan (GO:0032494)|T-helper 17 cell lineage commitment (GO:0072540)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)			breast(1)|endometrium(2)|large_intestine(4)|lung(1)	8					Ginseng(DB01404)	TGGGTGTGTCCTCATTCCCTC	0.493																																					Esophageal Squamous(47;342 1214 13936 33513)	dbGAP											0													116.0	116.0	116.0					7																	22769291		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			M18403	CCDS5375.1	7p21-p15	2014-04-04	2014-04-04		ENSG00000136244	ENSG00000136244		"""Interleukins and interleukin receptors"", ""Interferons"""	6018	protein-coding gene	gene with protein product	"""interferon, beta 2"""	147620	"""interleukin 6 (interferon, beta 2)"""	IFNB2		3294161	Standard	NM_000600		Approved	IL-6, BSF2, HGF, HSF	uc003svj.4	P05231	OTTHUMG00000023178	ENST00000404625.1:c.471+12C>T	7.37:g.22769291C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UCU2|Q9UCU3|Q9UCU4	Silent	SNP	pfam_IL6_MGF_GCSF,superfamily_4_helix_cytokine-like_core,smart_IL6_MGF_GCSF,prints_Interleukin_6,prints_IL6_MGF_GCSF	p.S215	ENST00000404625.1	37	c.645	CCDS5375.1	7																																																																																			IL6	-	smart_IL6_MGF_GCSF	ENSG00000136244		0.493	IL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL6	HGNC	protein_coding	OTTHUMT00000250225.2	171	0.00	0	C	NM_000600		22769291	22769291	+1	no_errors	ENST00000420258	ensembl	human	known	69_37n	silent	233	13.06	35	SNP	0.000	T
IPO8	10526	genome.wustl.edu	37	12	30834604	30834604	+	Silent	SNP	C	C	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:30834604C>A	ENST00000256079.4	-	4	809	c.471G>T	c.(469-471)gtG>gtT	p.V157V		NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	157					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					CATATGTCTTCACCAGTTGAT	0.438																																						dbGAP											0													114.0	103.0	107.0					12																	30834604		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.471G>T	12.37:g.30834604C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7M3	Silent	SNP	pfam_Importin-beta_N,pfam_Exportin/Importin_Cse1-like,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.V157	ENST00000256079.4	37	c.471	CCDS8719.1	12																																																																																			IPO8	-	superfamily_ARM-type_fold	ENSG00000133704		0.438	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO8	HGNC	protein_coding	OTTHUMT00000402700.2	73	0.00	0	C	NM_006390		30834604	30834604	-1	no_errors	ENST00000256079	ensembl	human	known	69_37n	silent	118	15.00	21	SNP	1.000	A
IQGAP2	10788	genome.wustl.edu	37	5	75906999	75906999	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:75906999G>A	ENST00000274364.6	+	13	1809	c.1512G>A	c.(1510-1512)caG>caA	p.Q504Q	IQGAP2_ENST00000379730.3_Silent_p.Q63Q|CTD-2236F14.1_ENST00000511327.1_RNA|IQGAP2_ENST00000502745.1_Silent_p.Q57Q|IQGAP2_ENST00000396234.3_Silent_p.Q57Q	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	504					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		CTAAATCACAGAAACTCGGAG	0.423																																						dbGAP											0													122.0	122.0	122.0					5																	75906999		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.1512G>A	5.37:g.75906999G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4V1|B7Z8A4|J3KR91	Silent	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_Rsp5_WWP,pfscan_RasGAP	p.Q504	ENST00000274364.6	37	c.1512	CCDS34188.1	5																																																																																			IQGAP2	-	NULL	ENSG00000145703		0.423	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP2	HGNC	protein_coding	OTTHUMT00000368877.1	151	0.00	0	G	NM_006633		75906999	75906999	+1	no_errors	ENST00000274364	ensembl	human	known	69_37n	silent	111	23.97	35	SNP	0.961	A
IQSEC2	23096	genome.wustl.edu	37	X	53267381	53267381	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:53267381C>T	ENST00000375368.5	-	11	3393	c.3193G>A	c.(3193-3195)Gac>Aac	p.D1065N	IQSEC2_ENST00000396435.3_Missense_Mutation_p.D1075N|IQSEC2_ENST00000375365.2_Missense_Mutation_p.D870N			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	1065	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						TCGCGCAGGTCGGATGTAAAG	0.567																																						dbGAP											0													71.0	50.0	57.0					X																	53267381		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.3193G>A	X.37:g.53267381C>T	ENSP00000364517:p.Asp1065Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.D1075N	ENST00000375368.5	37	c.3223		X	.	.	.	.	.	.	.	.	.	.	C	27.3	4.821135	0.90873	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.52057	0.68;0.68;0.68	4.61	4.61	0.57282	.	0.052535	0.64402	D	0.000001	T	0.66954	0.2842	M	0.74881	2.28	0.80722	D	1	P;D	0.69078	0.952;0.997	P;D	0.65987	0.822;0.94	T	0.72503	-0.4273	10	0.87932	D	0	.	15.4241	0.75038	0.0:1.0:0.0:0.0	.	1075;870	Q5JU85-2;Q5JU85-3	.;.	N	1075;1065;870	ENSP00000379712:D1075N;ENSP00000364517:D1065N;ENSP00000364514:D870N	ENSP00000364514:D870N	D	-	1	0	IQSEC2	53284106	1.000000	0.71417	0.886000	0.34754	0.742000	0.42306	7.612000	0.82975	2.148000	0.66965	0.517000	0.50305	GAC	IQSEC2	-	smart_Pleckstrin_homology	ENSG00000124313		0.567	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		34	0.00	0	C	XM_291345		53267381	53267381	-1	no_errors	ENST00000396435	ensembl	human	known	69_37n	missense	82	20.39	21	SNP	1.000	T
IRF6	3664	genome.wustl.edu	37	1	209974721	209974721	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:209974721C>G	ENST00000367021.3	-	3	210	c.38G>C	c.(37-39)tGg>tCg	p.W13S	IRF6_ENST00000542854.1_Intron	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	13					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		GGCCACCAGCCAGGGCTTTAG	0.602										HNSCC(57;0.16)																												dbGAP											0													56.0	64.0	61.0					1																	209974721		2202	4300	6502	-	-	-	SO:0001583	missense	0			AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.38G>C	1.37:g.209974721C>G	ENSP00000355988:p.Trp13Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Missense_Mutation	SNP	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.W13S	ENST00000367021.3	37	c.38	CCDS1492.1	1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686984	0.88639	.	.	ENSG00000117595	ENST00000367021;ENST00000456314	D;D	0.99804	-6.83;-6.83	6.17	6.17	0.99709	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.99866	0.9937	H	0.94771	3.58	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97158	0.9836	9	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	13	O14896	IRF6_HUMAN	S	13	ENSP00000355988:W13S;ENSP00000403855:W13S	.	W	-	2	0	IRF6	208041344	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.311000	0.78958	2.941000	0.99782	0.655000	0.94253	TGG	IRF6	-	pfam_Interferon_reg_fact_DNA-bd_dom,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	ENSG00000117595		0.602	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF6	HGNC	protein_coding	OTTHUMT00000088827.1	40	0.00	0	C	NM_006147		209974721	209974721	-1	no_errors	ENST00000367021	ensembl	human	known	69_37n	missense	46	22.03	13	SNP	1.000	G
ISM2	145501	genome.wustl.edu	37	14	77942061	77942061	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr14:77942061G>A	ENST00000342219.4	-	7	1649	c.1593C>T	c.(1591-1593)atC>atT	p.I531I	ISM2_ENST00000429906.1_Silent_p.I450I|ISM2_ENST00000393684.3_Silent_p.I443I|ISM2_ENST00000412904.1_Silent_p.I450I|ISM2_ENST00000493585.1_3'UTR	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	531	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.					extracellular region (GO:0005576)				endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						CCTTGCACAGGATCCAGGGCG	0.647																																						dbGAP											0													88.0	85.0	86.0					14																	77942061		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.1593C>T	14.37:g.77942061G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Silent	SNP	pfam_AMOP,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_AMOP,pfscan_AMOP,pfscan_Thrombospondin_1_rpt	p.I531	ENST00000342219.4	37	c.1593	CCDS9864.1	14																																																																																			ISM2	-	pfam_AMOP,smart_AMOP,pfscan_AMOP	ENSG00000100593		0.647	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ISM2	HGNC	protein_coding	OTTHUMT00000351309.1	11	0.00	0	G	NM_182509		77942061	77942061	-1	no_errors	ENST00000342219	ensembl	human	known	69_37n	silent	53	15.62	10	SNP	1.000	A
ITPR2	3709	genome.wustl.edu	37	12	26748416	26748416	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:26748416G>A	ENST00000381340.3	-	32	4778	c.4362C>T	c.(4360-4362)ttC>ttT	p.F1454F		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1454					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TATCCACCAAGAAGTTCTCAA	0.333																																						dbGAP											0													119.0	112.0	114.0					12																	26748416		1812	4067	5879	-	-	-	SO:0001819	synonymous_variant	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.4362C>T	12.37:g.26748416G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O94773	Silent	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.F1454	ENST00000381340.3	37	c.4362	CCDS41764.1	12																																																																																			ITPR2	-	superfamily_ARM-type_fold	ENSG00000123104		0.333	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	248	0.00	0	G	NM_002223		26748416	26748416	-1	no_errors	ENST00000381340	ensembl	human	known	69_37n	silent	179	16.36	35	SNP	1.000	A
KAT2B	8850	genome.wustl.edu	37	3	20167519	20167519	+	Silent	SNP	G	G	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:20167519G>T	ENST00000263754.4	+	10	1991	c.1536G>T	c.(1534-1536)ctG>ctT	p.L512L		NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	512	N-acetyltransferase. {ECO:0000250|UniProtKB:Q92830, ECO:0000255|PROSITE-ProRule:PRU00532}.				cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						AGAAGATCCTGATGTGGCTGG	0.517																																						dbGAP											0													74.0	72.0	73.0					3																	20167519		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.1536G>T	3.37:g.20167519G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NSK1	Silent	SNP	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N,pfam_Bromodomain,pfam_GNAT_dom,superfamily_Bromodomain,superfamily_Acyl_CoA_acyltransferase,smart_Bromodomain,pfscan_Bromodomain,pfscan_GNAT_dom,prints_Bromodomain	p.L512	ENST00000263754.4	37	c.1536	CCDS2634.1	3																																																																																			KAT2B	-	pirsf_Hist_acetylase_PCAF,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000114166		0.517	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2B	HGNC	protein_coding	OTTHUMT00000252880.1	61	0.00	0	G	NM_003884		20167519	20167519	+1	no_errors	ENST00000263754	ensembl	human	known	69_37n	silent	57	19.72	14	SNP	1.000	T
KCNT2	343450	genome.wustl.edu	37	1	196295947	196295947	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:196295947C>A	ENST00000294725.9	-	19	3091	c.2176G>T	c.(2176-2178)Gaa>Taa	p.E726*	KCNT2_ENST00000367433.5_Nonsense_Mutation_p.E726*|KCNT2_ENST00000609185.1_Nonsense_Mutation_p.E676*|KCNT2_ENST00000367431.4_Nonsense_Mutation_p.E676*|KCNT2_ENST00000498426.1_Intron|KCNT2_ENST00000451324.2_Nonsense_Mutation_p.E337*			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	726					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						CCAGCTGTTTCAGCTGCAACT	0.338																																						dbGAP											0													90.0	94.0	93.0					1																	196295947		2203	4292	6495	-	-	-	SO:0001587	stop_gained	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2176G>T	1.37:g.196295947C>A	ENSP00000294725:p.Glu726*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY59|Q5VTN1|Q6ZMT3	Nonsense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2	p.E726*	ENST00000294725.9	37	c.2176	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	C	40	8.035554	0.98621	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000451324;ENST00000294725	.	.	.	5.28	5.28	0.74379	.	0.000000	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-21.8435	19.2671	0.93993	0.0:1.0:0.0:0.0	.	.	.	.	X	726;676;337;726	.	ENSP00000294725:E726X	E	-	1	0	KCNT2	194562570	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.608000	0.88229	0.650000	0.86243	GAA	KCNT2	-	NULL	ENSG00000162687		0.338	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	202	0.00	0	C	NM_198503		196295947	196295947	-1	no_errors	ENST00000294725	ensembl	human	known	69_37n	nonsense	125	17.22	26	SNP	1.000	A
SPIDR	23514	genome.wustl.edu	37	8	48647973	48647973	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr8:48647973C>T	ENST00000297423.4	+	20	3093	c.2709C>T	c.(2707-2709)atC>atT	p.I903I	SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000518074.1_Nonsense_Mutation_p.R844*|SPIDR_ENST00000518060.1_3'UTR|SPIDR_ENST00000517693.1_Silent_p.I378I|SPIDR_ENST00000541342.1_Silent_p.I833I	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	903					cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											TGGAGGAAATCGAGCTTCTGA	0.547																																						dbGAP											0													100.0	108.0	106.0					8																	48647973		1969	4150	6119	-	-	-	SO:0001819	synonymous_variant	0			AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.2709C>T	8.37:g.48647973C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFV2|B4E0Y6|Q96BI5	Nonsense_Mutation	SNP	NULL	p.R844*	ENST00000297423.4	37	c.2530	CCDS43737.1	8	.	.	.	.	.	.	.	.	.	.	C	18.22	3.574686	0.65878	.	.	ENSG00000164808	ENST00000518074	.	.	.	5.73	-7.48	0.01360	.	.	.	.	.	.	.	.	.	.	.	0.49687	D	0.999816	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.7724	0.18261	0.0838:0.3953:0.0836:0.4374	.	.	.	.	X	844	.	ENSP00000429487:R844X	R	+	1	2	KIAA0146	48810526	0.000000	0.05858	0.001000	0.08648	0.048000	0.14542	-1.740000	0.01839	-1.338000	0.02233	-0.428000	0.05917	CGA	KIAA0146	-	NULL	ENSG00000164808		0.547	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0146	HGNC	protein_coding	OTTHUMT00000377611.1	80	0.00	0	C	NM_001080394		48647973	48647973	+1	no_errors	ENST00000518074	ensembl	human	putative	69_37n	nonsense	197	15.02	35	SNP	0.009	T
KIAA1551	55196	genome.wustl.edu	37	12	32138135	32138135	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:32138135G>A	ENST00000312561.4	+	4	4660	c.4246G>A	c.(4246-4248)Gaa>Aaa	p.E1416K	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1416																	AAACCCAAACGAAAGAGCCAT	0.338																																						dbGAP											0													78.0	83.0	81.0					12																	32138135		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.4246G>A	12.37:g.32138135G>A	ENSP00000310338:p.Glu1416Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	NULL	p.E1416K	ENST00000312561.4	37	c.4246	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	G	18.23	3.578819	0.65878	.	.	ENSG00000174718	ENST00000312561	T	0.15603	2.41	5.07	4.18	0.49190	.	0.230126	0.30565	N	0.009357	T	0.29945	0.0749	M	0.69823	2.125	0.09310	N	1	D	0.61080	0.989	P	0.54499	0.754	T	0.10019	-1.0648	9	.	.	.	.	9.4207	0.38550	0.1706:0.0:0.8294:0.0	.	1416	Q9HCM1	CL035_HUMAN	K	1416	ENSP00000310338:E1416K	.	E	+	1	0	C12orf35	32029402	0.990000	0.36364	0.050000	0.19076	0.006000	0.05464	2.818000	0.48041	1.248000	0.43934	0.563000	0.77884	GAA	KIAA1551	-	NULL	ENSG00000174718		0.338	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2	63	0.00	0	G	NM_018169		32138135	32138135	+1	no_errors	ENST00000312561	ensembl	human	known	69_37n	missense	62	18.42	14	SNP	0.122	A
KIF3B	9371	genome.wustl.edu	37	20	30898618	30898618	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr20:30898618C>T	ENST00000375712.3	+	2	1205	c.1038C>T	c.(1036-1038)gtC>gtT	p.V346V	KIF3B_ENST00000418717.2_Silent_p.V34V	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	346					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			AACCAAGGGTCAATGAGGACC	0.532																																						dbGAP											0													71.0	59.0	63.0					20																	30898618		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.1038C>T	20.37:g.30898618C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMP4|B4DSR5|E1P5M5	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V346	ENST00000375712.3	37	c.1038	CCDS13200.1	20																																																																																			KIF3B	-	smart_Kinesin_motor_dom	ENSG00000101350		0.532	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3B	HGNC	protein_coding	OTTHUMT00000078619.1	41	0.00	0	C	NM_004798		30898618	30898618	+1	no_errors	ENST00000375712	ensembl	human	known	69_37n	silent	54	19.40	13	SNP	1.000	T
KLHL18	23276	genome.wustl.edu	37	3	47385248	47385248	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:47385248G>A	ENST00000232766.5	+	10	1562	c.1542G>A	c.(1540-1542)agG>agA	p.R514R	KLHL18_ENST00000455924.2_Silent_p.R402R	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	514										endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		ACACGCGCAGGAGCCGGGTCT	0.612																																						dbGAP											0													72.0	73.0	73.0					3																	47385248		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.1542G>A	3.37:g.47385248G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K612|Q7Z3E8|Q8N125	Silent	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R514	ENST00000232766.5	37	c.1542	CCDS33749.1	3																																																																																			KLHL18	-	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000114648		0.612	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL18	HGNC	protein_coding	OTTHUMT00000344493.1	18	0.00	0	G	NM_025010		47385248	47385248	+1	no_errors	ENST00000232766	ensembl	human	known	69_37n	silent	41	22.64	12	SNP	1.000	A
KRT38	8687	genome.wustl.edu	37	17	39595484	39595484	+	Nonsense_Mutation	SNP	G	G	A	rs148768443	byFrequency	TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:39595484G>A	ENST00000246646.3	-	3	702	c.703C>T	c.(703-705)Cag>Tag	p.Q235*		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	235	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.Q235*(2)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				AGGGAGAGCTGCTCCTCCTTC	0.667																																						dbGAP											2	Substitution - Nonsense(2)	breast(1)|central_nervous_system(1)											58.0	53.0	54.0					17																	39595484		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0			Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.703C>T	17.37:g.39595484G>A	ENSP00000246646:p.Gln235*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRM5|Q6A164	Nonsense_Mutation	SNP	pfam_F,prints_Keratin_I	p.Q235*	ENST00000246646.3	37	c.703	CCDS11392.1	17	.	.	.	.	.	.	.	.	.	.	G	16.56	3.158641	0.57368	.	.	ENSG00000171360	ENST00000246646	.	.	.	4.31	1.01	0.19927	.	0.526305	0.15723	N	0.247837	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.0787	0.30731	0.0815:0.0:0.5477:0.3708	.	.	.	.	X	235	.	ENSP00000246646:Q235X	Q	-	1	0	KRT38	36849010	0.779000	0.28652	0.994000	0.49952	0.627000	0.37826	0.894000	0.28350	1.013000	0.39391	0.484000	0.47621	CAG	KRT38	-	pfam_F	ENSG00000171360		0.667	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT38	HGNC	protein_coding	OTTHUMT00000257307.2	17	0.00	0	G	NM_006771		39595484	39595484	-1	no_errors	ENST00000246646	ensembl	human	known	69_37n	nonsense	43	29.51	18	SNP	0.996	A
LHCGR	3973	genome.wustl.edu	37	2	48915942	48915942	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:48915942C>G	ENST00000294954.7	-	11	1015	c.994G>C	c.(994-996)Gaa>Caa	p.E332Q	STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000401907.1_Intron|LHCGR_ENST00000405626.1_Missense_Mutation_p.E305Q|LHCGR_ENST00000403273.1_Intron|LHCGR_ENST00000344775.3_Missense_Mutation_p.E270Q	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	332					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	AAACCATATTCATAGTCCCAG	0.418																																						dbGAP											0													105.0	103.0	104.0					2																	48915942		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.994G>C	2.37:g.48915942C>G	ENSP00000294954:p.Glu332Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_LSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_TSH_rcpt	p.E332Q	ENST00000294954.7	37	c.994	CCDS1842.1	2	.	.	.	.	.	.	.	.	.	.	C	14.67	2.604325	0.46423	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	T;T;T	0.75704	-0.96;-0.95;-0.9	5.91	5.91	0.95273	.	0.184588	0.64402	D	0.000020	T	0.72078	0.3416	L	0.58510	1.815	0.39061	D	0.960536	P	0.42078	0.77	B	0.37387	0.248	T	0.73363	-0.4006	9	.	.	.	.	19.2939	0.94114	0.0:1.0:0.0:0.0	.	332	P22888	LSHR_HUMAN	Q	270;332;305	ENSP00000344301:E270Q;ENSP00000294954:E332Q;ENSP00000386033:E305Q	.	E	-	1	0	LHCGR	48769446	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.890000	0.63178	2.791000	0.96007	0.655000	0.94253	GAA	LHCGR	-	prints_LSH_rcpt	ENSG00000138039		0.418	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	HGNC	protein_coding	OTTHUMT00000251364.4	104	0.00	0	C	NM_000233.3		48915942	48915942	-1	no_errors	ENST00000294954	ensembl	human	known	69_37n	missense	102	17.74	22	SNP	1.000	G
LHX8	431707	genome.wustl.edu	37	1	75622602	75622602	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:75622602C>T	ENST00000294638.5	+	9	1499	c.835C>T	c.(835-837)Cgc>Tgc	p.R279C	LHX8_ENST00000356261.3_Missense_Mutation_p.R269C	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	279					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						TTGTAGAGCACGCCACAAGAA	0.478																																						dbGAP											0													259.0	238.0	245.0					1																	75622602		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.835C>T	1.37:g.75622602C>T	ENSP00000294638:p.Arg279Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PGE3	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.R279C	ENST00000294638.5	37	c.835	CCDS30756.1	1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.861950	0.91433	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.97138	-4.26;-4.26	5.02	5.02	0.67125	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98868	0.9617	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.99709	1.1006	10	0.87932	D	0	.	18.724	0.91705	0.0:1.0:0.0:0.0	.	279	Q68G74	LHX8_HUMAN	C	279;269	ENSP00000294638:R279C;ENSP00000348597:R269C	ENSP00000294638:R279C	R	+	1	0	LHX8	75395190	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.556000	0.60775	2.499000	0.84300	0.455000	0.32223	CGC	LHX8	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000162624		0.478	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LHX8	HGNC	protein_coding	OTTHUMT00000026700.1	174	0.00	0	C	NM_001001933		75622602	75622602	+1	no_errors	ENST00000294638	ensembl	human	known	69_37n	missense	120	27.27	45	SNP	1.000	T
LIFR	3977	genome.wustl.edu	37	5	38504178	38504178	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:38504178G>C	ENST00000263409.4	-	10	1499	c.1337C>G	c.(1336-1338)tCa>tGa	p.S446*	LIFR_ENST00000503088.1_5'UTR|LIFR_ENST00000453190.2_Nonsense_Mutation_p.S446*	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	446	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					AACAGCTGTTGAATTAATATC	0.284			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)	dbGAP		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	0													55.0	60.0	58.0					5																	38504178		2202	4293	6495	-	-	-	SO:0001587	stop_gained	0			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.1337C>G	5.37:g.38504178G>C	ENSP00000263409:p.Ser446*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6LCD9	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S446*	ENST00000263409.4	37	c.1337	CCDS3927.1	5	.	.	.	.	.	.	.	.	.	.	G	39	7.340386	0.98221	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	.	.	.	5.65	5.65	0.86999	.	0.370903	0.26677	N	0.023064	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-16.044	18.2921	0.90134	0.0:0.0:1.0:0.0	.	.	.	.	X	446	.	ENSP00000263409:S446X	S	-	2	0	LIFR	38539935	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.952000	0.70282	2.649000	0.89929	0.650000	0.86243	TCA	LIFR	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000113594		0.284	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR	HGNC	protein_coding	OTTHUMT00000253823.1	109	0.00	0	G	NM_002310		38504178	38504178	-1	no_errors	ENST00000263409	ensembl	human	known	69_37n	nonsense	51	10.53	6	SNP	1.000	C
LMOD1	25802	genome.wustl.edu	37	1	201869306	201869306	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:201869306C>T	ENST00000367288.4	-	2	1081	c.835G>A	c.(835-837)Gaa>Aaa	p.E279K	RP11-307B6.3_ENST00000458139.1_RNA|RP11-307B6.3_ENST00000414927.1_RNA	NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	279	8 X approximate tandem repeats.				muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GCTTCCTTTTCATGTAAGGGT	0.493																																						dbGAP											0													104.0	105.0	104.0					1																	201869306		1999	4167	6166	-	-	-	SO:0001583	missense	0			X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.835G>A	1.37:g.201869306C>T	ENSP00000356257:p.Glu279Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APV6|C4AMB1|Q68EN2	Missense_Mutation	SNP	pfam_Tropomodulin,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.E279K	ENST00000367288.4	37	c.835	CCDS53457.1	1	.	.	.	.	.	.	.	.	.	.	C	8.620	0.891172	0.17613	.	.	ENSG00000163431	ENST00000367288;ENST00000400965;ENST00000412469	D	0.91686	-2.89	4.99	-4.1	0.03940	.	1.040740	0.07703	N	0.940692	T	0.82259	0.4998	N	0.22421	0.69	0.09310	N	1	B;B	0.20887	0.02;0.049	B;B	0.19666	0.018;0.026	T	0.67348	-0.5693	10	0.20519	T	0.43	-0.0327	6.4051	0.21660	0.0:0.1883:0.3956:0.416	.	228;279	B4E3S9;P29536	.;LMOD1_HUMAN	K	279;279;228	ENSP00000356257:E279K	ENSP00000356257:E279K	E	-	1	0	LMOD1	200135929	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	0.264000	0.18497	-0.384000	0.07845	0.603000	0.83216	GAA	LMOD1	-	NULL	ENSG00000163431		0.493	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	LMOD1	HGNC	protein_coding	OTTHUMT00000087085.2	142	0.00	0	C			201869306	201869306	-1	no_errors	ENST00000367288	ensembl	human	known	69_37n	missense	168	17.56	36	SNP	0.000	T
LRPPRC	10128	genome.wustl.edu	37	2	44121732	44121732	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:44121732C>G	ENST00000260665.7	-	36	3994	c.3937G>C	c.(3937-3939)Gaa>Caa	p.E1313Q	RNU6-1048P_ENST00000364054.1_RNA	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	1313	RNA-binding.				mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TCATTTAATTCAGGAATCAAT	0.274																																						dbGAP											0													68.0	74.0	72.0					2																	44121732		2202	4283	6485	-	-	-	SO:0001583	missense	0			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.3937G>C	2.37:g.44121732C>G	ENSP00000260665:p.Glu1313Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.E1313Q	ENST00000260665.7	37	c.3937	CCDS33189.1	2	.	.	.	.	.	.	.	.	.	.	C	17.14	3.314110	0.60414	.	.	ENSG00000138095	ENST00000260665;ENST00000419884	T	0.12255	2.7	6.02	5.15	0.70609	.	0.170496	0.50627	D	0.000107	T	0.18045	0.0433	L	0.54323	1.7	0.80722	D	1	D	0.53619	0.961	P	0.44597	0.454	T	0.01692	-1.1294	10	0.35671	T	0.21	-10.9493	15.0449	0.71819	0.0:0.9325:0.0:0.0675	.	1313	P42704	LPPRC_HUMAN	Q	1313;60	ENSP00000260665:E1313Q	ENSP00000260665:E1313Q	E	-	1	0	LRPPRC	43975236	1.000000	0.71417	0.998000	0.56505	0.381000	0.30169	4.329000	0.59260	1.552000	0.49463	0.650000	0.86243	GAA	LRPPRC	-	NULL	ENSG00000138095		0.274	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	HGNC	protein_coding	OTTHUMT00000327823.1	204	0.00	0	C	NM_133259		44121732	44121732	-1	no_errors	ENST00000260665	ensembl	human	known	69_37n	missense	116	15.33	21	SNP	1.000	G
LRRC16A	55604	genome.wustl.edu	37	6	25510753	25510753	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:25510753C>T	ENST00000329474.6	+	19	1864	c.1496C>T	c.(1495-1497)tCt>tTt	p.S499F		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	499					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						TCTGACCTATCTACCTTAATA	0.318																																						dbGAP											0													63.0	53.0	56.0					6																	25510753		1825	4051	5876	-	-	-	SO:0001583	missense	0			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.1496C>T	6.37:g.25510753C>T	ENSP00000331983:p.Ser499Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.S499F	ENST00000329474.6	37	c.1496	CCDS54973.1	6	.	.	.	.	.	.	.	.	.	.	C	19.49	3.837474	0.71373	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.54866	0.55	5.49	5.49	0.81192	.	0.102536	0.64402	D	0.000001	T	0.51398	0.1672	N	0.14661	0.345	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.76071	0.987;0.982;0.969	T	0.59010	-0.7534	10	0.54805	T	0.06	.	19.745	0.96248	0.0:1.0:0.0:0.0	.	499;499;499	Q5VZK9;B2RTQ5;Q5VZK9-2	LR16A_HUMAN;.;.	F	499	ENSP00000331983:S499F	ENSP00000331983:S499F	S	+	2	0	LRRC16A	25618732	0.995000	0.38212	0.999000	0.59377	0.999000	0.98932	2.948000	0.49066	2.736000	0.93811	0.655000	0.94253	TCT	LRRC16A	-	NULL	ENSG00000079691		0.318	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	HGNC	protein_coding	OTTHUMT00000040045.2	263	0.00	0	C	NM_017640		25510753	25510753	+1	no_errors	ENST00000329474	ensembl	human	novel	69_37n	missense	102	21.54	28	SNP	1.000	T
LRRTM3	347731	genome.wustl.edu	37	10	68687691	68687691	+	Silent	SNP	C	C	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:68687691C>A	ENST00000361320.4	+	2	1595	c.1017C>A	c.(1015-1017)atC>atA	p.I339I	CTNNA3_ENST00000433211.2_Intron|CTNNA3_ENST00000373744.4_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	339	LRRCT.				positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						ATACAATTATCTGTGCCAGTC	0.423																																						dbGAP											0													68.0	71.0	70.0					10																	68687691		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.1017C>A	10.37:g.68687691C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2A3|Q2NKX7|Q6N0A3	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.I339	ENST00000361320.4	37	c.1017	CCDS7270.1	10																																																																																			LRRTM3	-	NULL	ENSG00000198739		0.423	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM3	HGNC	protein_coding	OTTHUMT00000048277.2	107	0.00	0	C	NM_178011		68687691	68687691	+1	no_errors	ENST00000361320	ensembl	human	known	69_37n	silent	47	37.33	28	SNP	1.000	A
MAP4	4134	genome.wustl.edu	37	3	48040186	48040186	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:48040186C>T	ENST00000360240.6	-	2	683	c.165G>A	c.(163-165)gaG>gaA	p.E55E	MAP4_ENST00000426837.2_Silent_p.E55E|MAP4_ENST00000383737.4_Silent_p.E55E|MAP4_ENST00000439356.1_Silent_p.E55E|MAP4_ENST00000434267.1_Silent_p.E55E|MAP4_ENST00000395734.3_Silent_p.E55E	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	55					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	TCCCGGTTTTCTCATCAACAT	0.428																																						dbGAP											0													203.0	200.0	201.0					3																	48040186		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.165G>A	3.37:g.48040186C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	NULL	p.R62K	ENST00000360240.6	37	c.185	CCDS33750.1	3	.	.	.	.	.	.	.	.	.	.	C	8.343	0.829058	0.16749	.	.	ENSG00000047849	ENST00000423088	.	.	.	4.56	1.28	0.21552	.	.	.	.	.	T	0.43656	0.1257	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.26744	-1.0094	4	.	.	.	-17.7726	2.4666	0.04554	0.2308:0.4743:0.0:0.2948	.	.	.	.	K	62	.	.	R	-	2	0	MAP4	48015190	0.611000	0.26992	0.995000	0.50966	0.891000	0.51852	-0.703000	0.05063	0.551000	0.29008	0.467000	0.42956	AGA	MAP4	-	NULL	ENSG00000047849		0.428	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	HGNC	protein_coding	OTTHUMT00000346085.1	229	0.00	0	C	NM_002375		48040186	48040186	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000423088	ensembl	human	putative	69_37n	missense	137	26.74	50	SNP	0.997	T
LSAMP	4045	genome.wustl.edu	37	3	115529227	115529227	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:115529227G>A	ENST00000490035.2	-	7	1453	c.954C>T	c.(952-954)atC>atT	p.I318I	LSAMP_ENST00000539563.1_Silent_p.I338I	NM_002338.3	NP_002329.2	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein	318					cell adhesion (GO:0007155)|locomotory exploration behavior (GO:0035641)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(1)|large_intestine(4)|lung(14)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		CGGCCAGACTGATGGATCCAT	0.423																																						dbGAP											0													49.0	50.0	49.0					3																	115529227		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U41901	CCDS2982.1	3q13.2-q21	2013-01-11			ENSG00000185565	ENSG00000185565		"""Immunoglobulin superfamily / I-set domain containing"""	6705	protein-coding gene	gene with protein product	"""IgLON family member 3"""	603241				9615236	Standard	NM_002338		Approved	LAMP, IGLON3	uc003ebs.3	Q13449	OTTHUMG00000159308	ENST00000490035.2:c.954C>T	3.37:g.115529227G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IV49	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.I318	ENST00000490035.2	37	c.954	CCDS2982.1	3																																																																																			LSAMP	-	NULL	ENSG00000185565		0.423	LSAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSAMP	HGNC	protein_coding	OTTHUMT00000354495.4	14	0.00	0	G	NM_002338		115529227	115529227	-1	no_errors	ENST00000490035	ensembl	human	known	69_37n	silent	27	15.62	5	SNP	1.000	A
MAP7D3	79649	genome.wustl.edu	37	X	135309524	135309524	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:135309524T>A	ENST00000316077.9	-	12	2173	c.1953A>T	c.(1951-1953)aaA>aaT	p.K651N	MAP7D3_ENST00000495432.1_5'UTR|MAP7D3_ENST00000370663.5_Missense_Mutation_p.K633N|MAP7D3_ENST00000370661.1_Missense_Mutation_p.K616N	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	651					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					CATCTTTGAGTTTCAAGTGGT	0.408																																						dbGAP											0													243.0	209.0	220.0					X																	135309524		1941	4136	6077	-	-	-	SO:0001583	missense	0			AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.1953A>T	X.37:g.135309524T>A	ENSP00000318086:p.Lys651Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	pfam_E-MAP-115	p.K633N	ENST00000316077.9	37	c.1899	CCDS44004.1	X	.	.	.	.	.	.	.	.	.	.	T	15.63	2.890683	0.52014	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.27256	1.68;1.68;1.68;1.68	5.07	-1.43	0.08884	.	.	.	.	.	T	0.41971	0.1182	M	0.73598	2.24	0.09310	N	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.68483	0.958;0.929;0.958;0.929	T	0.24190	-1.0167	9	0.62326	D	0.03	-6.2093	4.6009	0.12352	0.1675:0.4317:0.0:0.4008	.	633;610;651;616	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	N	616;651;633;610	ENSP00000359695:K616N;ENSP00000318086:K651N;ENSP00000359697:K633N;ENSP00000359694:K610N	ENSP00000318086:K651N	K	-	3	2	MAP7D3	135137190	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.283000	0.08433	-0.248000	0.09583	0.486000	0.48141	AAA	MAP7D3	-	pfam_E-MAP-115	ENSG00000129680		0.408	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	MAP7D3	HGNC	protein_coding	OTTHUMT00000058487.2	438	0.00	0	T			135309524	135309524	-1	no_errors	ENST00000370663	ensembl	human	known	69_37n	missense	316	21.00	84	SNP	0.000	A
MDH1	4190	genome.wustl.edu	37	2	63824532	63824532	+	Splice_Site	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:63824532G>A	ENST00000233114.8	+	4	634		c.e4-1		MDH1_ENST00000539945.1_Splice_Site|MDH1_ENST00000544381.1_Splice_Site|MDH1_ENST00000409908.1_Intron|MDH1_ENST00000409476.1_Intron|MDH1_ENST00000394423.1_Splice_Site	NM_005917.3	NP_005908.1	P40925	MDHC_HUMAN	malate dehydrogenase 1, NAD (soluble)						carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|malate metabolic process (GO:0006108)|NADH metabolic process (GO:0006734)|oxaloacetate metabolic process (GO:0006107)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	diiodophenylpyruvate reductase activity (GO:0047860)|L-malate dehydrogenase activity (GO:0030060)|malic enzyme activity (GO:0004470)|NAD binding (GO:0051287)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(4)	13						CATGTCCACAGATGTCATCGC	0.403																																						dbGAP											0													58.0	58.0	58.0					2																	63824532		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS1874.1, CCDS56121.1, CCDS56122.1	2p23	2012-10-02			ENSG00000014641	ENSG00000014641	1.1.1.37		6970	protein-coding gene	gene with protein product		154200					Standard	NM_005917		Approved		uc010ypv.2	P40925	OTTHUMG00000129512	ENST00000233114.8:c.200-1G>A	2.37:g.63824532G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5V5|B4DUN2|B7Z3I7|F5H098|Q6I9V0	Splice_Site	SNP	-	e4-1	ENST00000233114.8	37	c.254-1	CCDS1874.1	2	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469296	0.84533	.	.	ENSG00000014641	ENST00000233114;ENST00000436321;ENST00000454035;ENST00000432309;ENST00000539945;ENST00000394423	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7014	0.96054	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MDH1	63678036	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.751000	0.98889	2.729000	0.93468	0.655000	0.94253	.	MDH1	-	-	ENSG00000014641		0.403	MDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDH1	HGNC	protein_coding	OTTHUMT00000251687.1	55	0.00	0	G		Intron	63824532	63824532	+1	no_errors	ENST00000539945	ensembl	human	known	69_37n	splice_site	55	16.67	11	SNP	1.000	A
MEF2B	100271849	genome.wustl.edu	37	19	19257861	19257861	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:19257861G>A	ENST00000602424.2	-	7	1251	c.525C>T	c.(523-525)ccC>ccT	p.P175P	MEF2B_ENST00000409447.2_Silent_p.P175P|MEF2BNB-MEF2B_ENST00000514819.3_Silent_p.P192P|MEF2B_ENST00000410050.1_Silent_p.P175P|MEF2BNB-MEF2B_ENST00000444486.3_Silent_p.P175P|MEF2B_ENST00000424583.2_Silent_p.P175P|MEF2B_ENST00000409224.1_Silent_p.P178P|MEF2BNB-MEF2B_ENST00000602276.1_5'UTR|MEF2B_ENST00000162023.5_Silent_p.P175P	NM_005919.3	NP_005910.1	Q02080	MEF2B_HUMAN	myocyte enhancer factor 2B	175					muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|haematopoietic_and_lymphoid_tissue(21)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(5;0.00011)|Epithelial(12;0.00412)			GCCCGGCTTTGGGGGCTGCTG	0.677																																						dbGAP											0													13.0	15.0	15.0					19																	19257861		2199	4291	6490	-	-	-	SO:0001819	synonymous_variant	0			X63380	CCDS12394.1, CCDS46024.1	19p13.11	2010-05-12	2007-04-24					"""Myocyte enhancer factors"""	6995	protein-coding gene	gene with protein product		600661				1516833, 8575763	Standard	NM_001145785		Approved	RSRFR2	uc002nll.2	Q02080		ENST00000602424.2:c.525C>T	19.37:g.19257861G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV80|B4DVH7|B7ZVY1|G5E9M1	Silent	SNP	pfam_TF_MADSbox,superfamily_TF_MADSbox,smart_TF_MADSbox,prints_TF_MADSbox,pfscan_TF_MADSbox	p.P175	ENST00000602424.2	37	c.525	CCDS12394.1	19																																																																																			MEF2B	-	NULL	ENSG00000213999		0.677	MEF2B-202	KNOWN	basic|CCDS	protein_coding	MEF2B	HGNC	protein_coding		10	0.00	0	G	NM_005919		19257861	19257861	-1	no_errors	ENST00000162023	ensembl	human	known	69_37n	silent	27	18.18	6	SNP	1.000	A
METTL13	51603	genome.wustl.edu	37	1	171753159	171753159	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:171753159G>T	ENST00000361735.3	+	2	699	c.433G>T	c.(433-435)Gag>Tag	p.E145*	METTL13_ENST00000362019.3_Nonsense_Mutation_p.E59*|METTL13_ENST00000458517.1_Nonsense_Mutation_p.E144*|METTL13_ENST00000367737.5_Nonsense_Mutation_p.E145*	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	145							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						GATGCTGGCTGAGGTTGGCCG	0.592																																						dbGAP											0													118.0	93.0	101.0					1																	171753159		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.433G>T	1.37:g.171753159G>T	ENSP00000354920:p.Glu145*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Nonsense_Mutation	SNP	pfam_Methyltransf_11,pfam_Spermidine/spermine_synthase	p.E145*	ENST00000361735.3	37	c.433	CCDS1299.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.519669	0.97633	.	.	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000367737;ENST00000361735;ENST00000367736;ENST00000341850	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-26.7197	18.1041	0.89515	0.0:0.0:1.0:0.0	.	.	.	.	X	144;59;145;145;62;59	.	ENSP00000341732:E59X	E	+	1	0	METTL13	170019782	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.277000	0.95755	2.327000	0.79052	0.561000	0.74099	GAG	METTL13	-	pfam_Methyltransf_11	ENSG00000010165		0.592	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL13	HGNC	protein_coding	OTTHUMT00000084528.5	30	0.00	0	G	NM_014955		171753159	171753159	+1	no_errors	ENST00000361735	ensembl	human	known	69_37n	nonsense	100	22.31	29	SNP	1.000	T
MGAM	8972	genome.wustl.edu	37	7	141736724	141736724	+	Silent	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:141736724C>G	ENST00000549489.2	+	18	2273	c.2178C>G	c.(2176-2178)ctC>ctG	p.L726L	MGAM_ENST00000475668.2_Silent_p.L726L	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	726	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TATACACCCTCTTCTTCCGTG	0.498																																						dbGAP											0													201.0	205.0	204.0					7																	141736724		2050	4203	6253	-	-	-	SO:0001819	synonymous_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2178C>G	7.37:g.141736724C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.L726	ENST00000549489.2	37	c.2178	CCDS47727.1	7																																																																																			MGAM	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000257335		0.498	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	100	0.00	0	C			141736724	141736724	+1	no_errors	ENST00000549489	ensembl	human	known	69_37n	silent	146	15.12	26	SNP	0.987	G
TRPM3	80036	genome.wustl.edu	37	9	73424946	73424946	+	Intron	SNP	C	C	G	rs372957348		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr9:73424946C>G	ENST00000377111.2	-	6	1217				TRPM3_ENST00000396292.4_Intron|TRPM3_ENST00000396285.1_Intron|TRPM3_ENST00000377105.1_Intron|TRPM3_ENST00000358082.3_Intron|TRPM3_ENST00000377106.1_Intron|TRPM3_ENST00000396280.5_Intron|TRPM3_ENST00000377101.1_Intron|TRPM3_ENST00000408909.2_Intron|MIR204_ENST00000385200.1_RNA|TRPM3_ENST00000377110.3_Intron|TRPM3_ENST00000361823.5_Intron|TRPM3_ENST00000357533.2_Intron|TRPM3_ENST00000423814.3_Intron|TRPM3_ENST00000396283.1_Intron|TRPM3_ENST00000360823.2_Intron	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3						calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CATATATTCTCAGGCATAGGA	0.488																																						dbGAP											0													190.0	168.0	174.0					9																	73424946		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.973+17816G>C	9.37:g.73424946C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	RNA	SNP	-	NULL	ENST00000377111.2	37	NULL		9																																																																																			MIR204	-	-	ENSG00000207935		0.488	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	MIR204	HGNC	protein_coding	OTTHUMT00000214157.5	93	0.00	0	C	NM_206945		73424946	73424946	-1	no_errors	ENST00000385200	ensembl	human	known	69_37n	rna	80	26.61	29	SNP	1.000	G
MMP16	4325	genome.wustl.edu	37	8	89086949	89086949	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr8:89086949C>G	ENST00000286614.6	-	7	1387	c.1106G>C	c.(1105-1107)aGa>aCa	p.R369T	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	369					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R369T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	CCTGTTGTTTCTCACTCGCCA	0.498																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											162.0	154.0	156.0					8																	89086949		2203	4300	6503	-	-	-	SO:0001583	missense	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1106G>C	8.37:g.89086949C>G	ENSP00000286614:p.Arg369Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.R369T	ENST00000286614.6	37	c.1106	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976165	0.92982	.	.	ENSG00000156103	ENST00000286614	T	0.02345	4.33	4.88	4.88	0.63580	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.12092	0.0294	L	0.55017	1.72	0.80722	D	1	D;D	0.71674	0.995;0.998	D;D	0.74348	0.959;0.983	T	0.05683	-1.0870	10	0.36615	T	0.2	.	18.4198	0.90586	0.0:1.0:0.0:0.0	.	369;369	P51512-2;P51512	.;MMP16_HUMAN	T	369	ENSP00000286614:R369T	ENSP00000286614:R369T	R	-	2	0	MMP16	89156065	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.397000	0.81536	0.650000	0.86243	AGA	MMP16	-	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat	ENSG00000156103		0.498	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	107	0.00	0	C	NM_005941		89086949	89086949	-1	no_errors	ENST00000286614	ensembl	human	known	69_37n	missense	133	16.88	27	SNP	1.000	G
MRPL18	29074	genome.wustl.edu	37	6	160218324	160218324	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:160218324G>A	ENST00000367034.4	+	3	367	c.245G>A	c.(244-246)cGa>cAa	p.R82Q	PNLDC1_ENST00000610273.1_5'Flank|MRPL18_ENST00000480842.1_3'UTR|PNLDC1_ENST00000392167.3_5'Flank	NM_014161.3	NP_054880.2	Q9H0U6	RM18_HUMAN	mitochondrial ribosomal protein L18	82					rRNA import into mitochondrion (GO:0035928)|translation (GO:0006412)	extracellular space (GO:0005615)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	11		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)		TTTAGGTTGCGAGTTATAAGG	0.383																																						dbGAP											0													99.0	83.0	89.0					6																	160218324		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161556	CCDS5270.1	6q25.3	2012-09-13			ENSG00000112110	ENSG00000112110		"""Mitochondrial ribosomal proteins / large subunits"""	14477	protein-coding gene	gene with protein product		611831				11042152, 11551941	Standard	NM_014161		Approved	HSPC071	uc003qsw.4	Q9H0U6	OTTHUMG00000015942	ENST00000367034.4:c.245G>A	6.37:g.160218324G>A	ENSP00000356001:p.Arg82Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TAP9|Q9NZW8	Missense_Mutation	SNP	pfam_Ribosomal_L18/L5	p.R82Q	ENST00000367034.4	37	c.245	CCDS5270.1	6	.	.	.	.	.	.	.	.	.	.	G	18.43	3.623078	0.66901	.	.	ENSG00000112110	ENST00000367034	T	0.76186	-1.0	4.7	4.7	0.59300	.	0.315913	0.29572	N	0.011768	T	0.65176	0.2666	L	0.47190	1.495	0.45567	D	0.998519	D	0.57571	0.98	P	0.47981	0.563	T	0.63143	-0.6703	10	0.23891	T	0.37	-6.1113	17.8505	0.88746	0.0:0.0:1.0:0.0	.	82	Q9H0U6	RM18_HUMAN	Q	82	ENSP00000356001:R82Q	ENSP00000356001:R82Q	R	+	2	0	MRPL18	160138314	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.178000	0.58284	2.424000	0.82194	0.655000	0.94253	CGA	MRPL18	-	pfam_Ribosomal_L18/L5	ENSG00000112110		0.383	MRPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL18	HGNC	protein_coding	OTTHUMT00000042925.1	92	0.00	0	G			160218324	160218324	+1	no_errors	ENST00000367034	ensembl	human	known	69_37n	missense	108	21.17	29	SNP	0.998	A
RNF123	63891	genome.wustl.edu	37	3	49724598	49724598	+	5'Flank	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:49724598G>C	ENST00000327697.6	+	0	0				MST1_ENST00000545762.1_Nonsense_Mutation_p.S145*|MST1_ENST00000449682.2_Missense_Mutation_p.I197M|MST1_ENST00000494828.2_5'UTR|RNF123_ENST00000432042.1_5'Flank|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000383728.3_Missense_Mutation_p.I122M	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GGCAGGATTTGATGCCGCAGC	0.622																																						dbGAP											0													29.0	32.0	31.0					3																	49724598		2200	4300	6500	-	-	-	SO:0001631	upstream_gene_variant	0			AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49724598G>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Nonsense_Mutation	SNP	pfam_PAN-1_domain,smart_Pan_app,pfscan_Pan_app	p.S145*	ENST00000327697.6	37	c.434	CCDS33758.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.84|17.84	3.487517|3.487517	0.63962|0.63962	.|.	.|.	ENSG00000173531|ENSG00000173531	ENST00000449682;ENST00000383728|ENST00000545762	T;T|.	0.71461|.	-0.57;-0.57|.	5.9|5.9	3.16|3.16	0.36331|0.36331	Kringle (4);Kringle-like fold (1);|.	0.000000|.	0.43110|.	D|.	0.000606|.	T|.	0.72285|.	0.3441|.	M|M	0.89715|0.89715	3.055|3.055	0.80722|0.80722	A|A	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.996;1.0;1.0|.	T|.	0.78298|.	-0.2258|.	9|.	0.87932|.	D|.	0|.	.|.	7.7617|7.7617	0.28957|0.28957	0.1251:0.0:0.6408:0.2341|0.1251:0.0:0.6408:0.2341	.|.	183;183;197|.	B7Z538;P26927;G3XAK1|.	.;HGFL_HUMAN;.|.	M|X	197;122|145	ENSP00000414287:I197M;ENSP00000373234:I122M|.	ENSP00000373234:I122M|.	I|S	-|-	3|2	3|0	MST1|MST1	49699602|49699602	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.715000|0.715000	0.41141|0.41141	3.566000|3.566000	0.53805|0.53805	0.405000|0.405000	0.25532|0.25532	-0.229000|-0.229000	0.12294|0.12294	ATC|TCA	MST1	-	NULL	ENSG00000173531		0.622	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MST1	HGNC	protein_coding	OTTHUMT00000346475.2	12	0.00	0	G	NM_022064		49724598	49724598	-1	no_errors	ENST00000545762	ensembl	human	known	69_37n	nonsense	33	37.74	20	SNP	1.000	C
MST1R	4486	genome.wustl.edu	37	3	49933743	49933743	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:49933743C>T	ENST00000296474.3	-	10	2561	c.2534G>A	c.(2533-2535)cGa>cAa	p.R845Q	CTD-2330K9.2_ENST00000435478.1_RNA|MST1R_ENST00000344206.4_Missense_Mutation_p.R845Q	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	845	IPT/TIG 3.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		TCCATCCCCTCGGGCACTCAG	0.607																																						dbGAP											0													81.0	82.0	82.0					3																	49933743		2203	4300	6503	-	-	-	SO:0001583	missense	0			X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.2534G>A	3.37:g.49933743C>T	ENSP00000296474:p.Arg845Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_IPT_TIG_rcpt,superfamily_Semaphorin/CD100_Ag,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semaphorin/CD100_Ag,pfscan_Prot_kinase_cat_dom	p.R845Q	ENST00000296474.3	37	c.2534	CCDS2807.1	3	.	.	.	.	.	.	.	.	.	.	C	2.657	-0.280663	0.05642	.	.	ENSG00000164078	ENST00000296474;ENST00000344206	T;T	0.58797	1.7;0.31	5.26	-1.29	0.09288	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);	1.134460	0.06293	N	0.699455	T	0.42404	0.1201	L	0.40543	1.245	0.09310	N	1	B;B	0.15141	0.012;0.003	B;B	0.09377	0.004;0.001	T	0.18053	-1.0349	10	0.21540	T	0.41	-0.0917	4.2532	0.10705	0.1957:0.3867:0.0:0.4175	.	845;845	Q04912-5;Q04912	.;RON_HUMAN	Q	845	ENSP00000296474:R845Q;ENSP00000341325:R845Q	ENSP00000296474:R845Q	R	-	2	0	MST1R	49908747	0.000000	0.05858	0.002000	0.10522	0.260000	0.26232	-0.898000	0.04105	-0.151000	0.11176	0.313000	0.20887	CGA	MST1R	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	ENSG00000164078		0.607	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MST1R	HGNC	protein_coding	OTTHUMT00000345403.1	26	0.00	0	C			49933743	49933743	-1	no_errors	ENST00000296474	ensembl	human	known	69_37n	missense	35	36.84	21	SNP	0.000	T
MTBP	27085	genome.wustl.edu	37	8	121463465	121463465	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr8:121463465G>A	ENST00000305949.1	+	4	373	c.328G>A	c.(328-330)Gaa>Aaa	p.E110K		NM_022045.4	NP_071328.2	Q96DY7	MTBP_HUMAN	MDM2 binding protein	110					cell cycle arrest (GO:0007050)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cell proliferation (GO:0008285)|protein localization to kinetochore (GO:0034501)|traversing start control point of mitotic cell cycle (GO:0007089)	chromatin (GO:0000785)|kinetochore (GO:0000776)		p.E110Q(2)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			AGATAAAATTGAAGATGTTCT	0.308																																						dbGAP											2	Substitution - Missense(2)	lung(2)											87.0	89.0	88.0					8																	121463465		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6333.1	8q24.1-q24.2	2014-03-03	2014-03-03		ENSG00000172167	ENSG00000172167			7417	protein-coding gene	gene with protein product		605927	"""MDM2 (mouse double minute 2)-binding protein, 104kD"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa"""			10906133, 11060448	Standard	NM_022045		Approved		uc003ypc.2	Q96DY7	OTTHUMG00000165040	ENST00000305949.1:c.328G>A	8.37:g.121463465G>A	ENSP00000303398:p.Glu110Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUR5|Q9HA89	Missense_Mutation	SNP	NULL	p.E110K	ENST00000305949.1	37	c.328	CCDS6333.1	8	.	.	.	.	.	.	.	.	.	.	G	23.2	4.386765	0.82902	.	.	ENSG00000172167	ENST00000305949	.	.	.	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.76076	0.3937	M	0.72894	2.215	0.54753	D	0.99998	D;D	0.89917	0.996;1.0	D;D	0.85130	0.99;0.997	T	0.78331	-0.2245	9	0.72032	D	0.01	-23.6834	11.043	0.47842	0.0862:0.0:0.9138:0.0	.	110;110	Q96DY7;B4DUR5	MTBP_HUMAN;.	K	110	.	ENSP00000303398:E110K	E	+	1	0	MTBP	121532646	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	5.332000	0.65911	2.309000	0.77851	0.643000	0.83706	GAA	MTBP	-	NULL	ENSG00000172167		0.308	MTBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTBP	HGNC	protein_coding	OTTHUMT00000381530.1	261	0.00	0	G	NM_022045		121463465	121463465	+1	no_errors	ENST00000305949	ensembl	human	known	69_37n	missense	241	14.23	40	SNP	1.000	A
MTMR3	8897	genome.wustl.edu	37	22	30415818	30415818	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr22:30415818G>A	ENST00000401950.2	+	17	2512	c.2170G>A	c.(2170-2172)Gaa>Aaa	p.E724K	MTMR3_ENST00000406629.1_Missense_Mutation_p.E724K|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000333027.3_Missense_Mutation_p.E724K|CTA-85E5.10_ENST00000453743.2_RNA|MTMR3_ENST00000351488.3_Missense_Mutation_p.E724K|MTMR3_ENST00000323630.5_Missense_Mutation_p.E588K	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	724					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CCCTCTCTTAGAAAAGGAGAG	0.542																																						dbGAP											0													58.0	61.0	60.0					22																	30415818		2203	4300	6503	-	-	-	SO:0001583	missense	0			U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.2170G>A	22.37:g.30415818G>A	ENSP00000384651:p.Glu724Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Missense_Mutation	SNP	pfam_Myotub-related,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Tyr_Pase_cat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.E724K	ENST00000401950.2	37	c.2170	CCDS13870.1	22	.	.	.	.	.	.	.	.	.	.	G	1.751	-0.489212	0.04352	.	.	ENSG00000100330	ENST00000401950;ENST00000333027;ENST00000323630;ENST00000351488;ENST00000406629	D;D;D;D;D	0.93247	-3.0;-2.97;-3.19;-3.02;-2.97	4.89	2.78	0.32641	.	4.915100	0.00166	N	0.000002	D	0.86502	0.5948	N	0.12182	0.205	0.09310	N	1	B;B;B	0.22211	0.066;0.023;0.066	B;B;B	0.21708	0.036;0.01;0.036	T	0.75436	-0.3318	10	0.10636	T	0.68	.	8.8464	0.35172	0.0778:0.0:0.773:0.1492	.	724;724;724	Q13615-3;Q13615;Q13615-2	.;MTMR3_HUMAN;.	K	724;724;588;724;724	ENSP00000384651:E724K;ENSP00000331649:E724K;ENSP00000318070:E588K;ENSP00000307271:E724K;ENSP00000384077:E724K	ENSP00000318070:E588K	E	+	1	0	MTMR3	28745818	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.543000	0.23237	0.652000	0.30806	-0.895000	0.02911	GAA	MTMR3	-	NULL	ENSG00000100330		0.542	MTMR3-001	KNOWN	basic|CCDS	protein_coding	MTMR3	HGNC	protein_coding	OTTHUMT00000322066.1	32	0.00	0	G	NM_021090		30415818	30415818	+1	no_errors	ENST00000401950	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	0.022	A
MUC16	94025	genome.wustl.edu	37	19	9058093	9058093	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:9058093T>C	ENST00000397910.4	-	3	29556	c.29353A>G	c.(29353-29355)Aat>Gat	p.N9785D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9787	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGCTCAAATTTGGAGATGAA	0.473																																						dbGAP											0													68.0	64.0	66.0					19																	9058093		1901	4126	6027	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29353A>G	19.37:g.9058093T>C	ENSP00000381008:p.Asn9785Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.N9785D	ENST00000397910.4	37	c.29353	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	7.482	0.648882	0.14516	.	.	ENSG00000181143	ENST00000397910	T	0.31247	1.5	3.05	-0.652	0.11450	.	.	.	.	.	T	0.14056	0.0340	N	0.14661	0.345	.	.	.	B	0.18741	0.03	B	0.15052	0.012	T	0.27054	-1.0085	8	0.87932	D	0	.	0.4399	0.00484	0.212:0.1406:0.2181:0.4293	.	9785	B5ME49	.	D	9785	ENSP00000381008:N9785D	ENSP00000381008:N9785D	N	-	1	0	MUC16	8919093	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	-1.103000	0.03329	-0.208000	0.10171	0.455000	0.32223	AAT	MUC16	-	NULL	ENSG00000181143		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	86	0.00	0	T	NM_024690		9058093	9058093	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	54	36.47	31	SNP	0.000	C
MXRA5	25878	genome.wustl.edu	37	X	3242463	3242463	+	Silent	SNP	C	C	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:3242463C>A	ENST00000217939.6	-	5	1417	c.1263G>T	c.(1261-1263)gtG>gtT	p.V421V		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	421						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TCTGGGCTCTCACACCTGTGT	0.517																																						dbGAP											0													97.0	88.0	91.0					X																	3242463		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.1263G>T	X.37:g.3242463C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1M7|Q9Y3Y8	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V421	ENST00000217939.6	37	c.1263	CCDS14124.1	X																																																																																			MXRA5	-	NULL	ENSG00000101825		0.517	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	60	0.00	0	C	NM_015419		3242463	3242463	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	silent	74	16.85	15	SNP	0.503	A
MXRA5	25878	genome.wustl.edu	37	X	3248697	3248697	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:3248697G>A	ENST00000217939.6	-	3	460	c.306C>T	c.(304-306)ctC>ctT	p.L102L		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	102						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GAAGAGAGCTGAGGTCTCTTA	0.428																																						dbGAP											0													136.0	122.0	126.0					X																	3248697		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.306C>T	X.37:g.3248697G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1M7|Q9Y3Y8	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L102	ENST00000217939.6	37	c.306	CCDS14124.1	X																																																																																			MXRA5	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000101825		0.428	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	127	0.00	0	G	NM_015419		3248697	3248697	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	silent	120	24.53	39	SNP	0.001	A
MYL12A	10627	genome.wustl.edu	37	18	3253328	3253328	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr18:3253328C>T	ENST00000217652.3	+	2	478	c.83C>T	c.(82-84)tCa>tTa	p.S28L	MYL12A_ENST00000536605.1_Missense_Mutation_p.S28L|MYL12A_ENST00000580887.1_Missense_Mutation_p.S34L|MYL12A_ENST00000578611.1_Missense_Mutation_p.S28L|RP13-270P17.1_ENST00000581905.1_RNA|MYL12A_ENST00000579226.1_Missense_Mutation_p.S28L|RP13-270P17.1_ENST00000578800.1_RNA	NM_006471.2	NP_006462.1	P19105	ML12A_HUMAN	myosin, light chain 12A, regulatory, non-sarcomeric	28	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				platelet aggregation (GO:0070527)|protein targeting to plasma membrane (GO:0072661)|regulation of cell shape (GO:0008360)	extracellular vesicular exosome (GO:0070062)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)			NS(1)|kidney(2)|large_intestine(2)	5						TTTGACCAGTCACAGATTCAG	0.443																																						dbGAP											0													202.0	186.0	191.0					18																	3253328		2203	4300	6503	-	-	-	SO:0001583	missense	0			X54304	CCDS11830.1	18p11.31	2013-01-10	2002-08-29		ENSG00000101608	ENSG00000101608		"""Myosins / Light chain"", ""EF-hand domain containing"""	16701	protein-coding gene	gene with protein product	"""myosin regulatory light chain 3"""		"""myosin, light polypeptide, regulatory, non-sarcomeric (20kD)"""			2216787	Standard	NM_006471		Approved	MLCB, MYL2B, MRLC3, MRCL3	uc002klr.3	P19105	OTTHUMG00000131509	ENST00000217652.3:c.83C>T	18.37:g.3253328C>T	ENSP00000217652:p.Ser28Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53X45	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.S28L	ENST00000217652.3	37	c.83	CCDS11830.1	18	.	.	.	.	.	.	.	.	.	.	C	29.1	4.977034	0.92982	.	.	ENSG00000101608	ENST00000217652;ENST00000536605	T;T	0.79141	-1.24;-1.24	5.4	5.4	0.78164	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.75788	0.3897	L	0.42245	1.32	0.80722	D	1	B;B	0.31193	0.312;0.312	B;B	0.34722	0.188;0.188	T	0.76011	-0.3115	10	0.87932	D	0	.	19.3618	0.94442	0.0:1.0:0.0:0.0	.	28;28	Q53X45;P19105	.;ML12A_HUMAN	L	28	ENSP00000217652:S28L;ENSP00000441231:S28L	ENSP00000217652:S28L	S	+	2	0	MYL12A	3243328	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.645000	0.83430	2.794000	0.96219	0.650000	0.86243	TCA	MYL12A	-	pfscan_EF_HAND_2	ENSG00000101608		0.443	MYL12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYL12A	HGNC	protein_coding	OTTHUMT00000254364.2	164	0.00	0	C	NM_006471		3253328	3253328	+1	no_errors	ENST00000217652	ensembl	human	known	69_37n	missense	122	30.29	53	SNP	1.000	T
MYPOP	339344	genome.wustl.edu	37	19	46393934	46393934	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:46393934G>C	ENST00000322217.5	-	3	1233	c.1147C>G	c.(1147-1149)Cgg>Ggg	p.R383G		NM_001012643.2	NP_001012661.1	Q86VE0	MYPOP_HUMAN	Myb-related transcription factor, partner of profilin	383						nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			large_intestine(2)|lung(1)|skin(1)	4						CCTTTTCTCCGCTTGTGTGGG	0.642																																						dbGAP											0													20.0	22.0	22.0					19																	46393934		2080	4202	6282	-	-	-	SO:0001583	missense	0			BC044311	CCDS33055.1	19q13.32	2014-06-13			ENSG00000176182	ENSG00000176182			20178	protein-coding gene	gene with protein product	"""p42 Myb-related transcription factor, partner of profilin"""					15615774	Standard	NM_001012643		Approved	P42pop	uc002pdt.3	Q86VE0	OTTHUMG00000182486	ENST00000322217.5:c.1147C>G	19.37:g.46393934G>C	ENSP00000325402:p.Arg383Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.R383G	ENST00000322217.5	37	c.1147	CCDS33055.1	19	.	.	.	.	.	.	.	.	.	.	G	15.76	2.929823	0.52759	.	.	ENSG00000176182	ENST00000322217	T	0.62364	0.03	4.48	0.834	0.18880	.	0.000000	0.56097	D	0.000028	T	0.61324	0.2338	N	0.19112	0.55	0.34250	D	0.678627	D	0.63880	0.993	D	0.71184	0.972	T	0.68864	-0.5296	10	0.72032	D	0.01	-12.2244	9.9065	0.41379	0.0:0.0:0.5771:0.4228	.	383	Q86VE0	MYPOP_HUMAN	G	383	ENSP00000325402:R383G	ENSP00000325402:R383G	R	-	1	2	MYPOP	51085774	1.000000	0.71417	0.999000	0.59377	0.877000	0.50540	0.412000	0.21131	0.121000	0.18284	-0.271000	0.10264	CGG	MYPOP	-	NULL	ENSG00000176182		0.642	MYPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYPOP	HGNC	protein_coding	OTTHUMT00000461684.1	8	0.00	0	G	NM_001012643		46393934	46393934	-1	no_errors	ENST00000322217	ensembl	human	known	69_37n	missense	13	45.83	11	SNP	0.999	C
NACA	4666	genome.wustl.edu	37	12	57112229	57112229	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:57112229G>T	ENST00000454682.1	-	3	3366	c.3085C>A	c.(3085-3087)Ccc>Acc	p.P1029T	NACA_ENST00000551793.1_Intron|NACA_ENST00000552540.1_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000550952.1_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000393891.4_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1029	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						GCCCCTTTGGGGAATGGGGTA	0.652			T	BCL6	NHL																																	dbGAP		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0													32.0	38.0	36.0					12																	57112229		1561	3564	5125	-	-	-	SO:0001583	missense	0			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.3085C>A	12.37:g.57112229G>T	ENSP00000403817:p.Pro1029Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx,superfamily_UBA-like,pfscan_Nas_poly-pep-assoc_cplx	p.P1029T	ENST00000454682.1	37	c.3085		12	.	.	.	.	.	.	.	.	.	.	g	4.245	0.044363	0.08196	.	.	ENSG00000196531	ENST00000454682	T	0.48201	0.82	3.5	-0.924	0.10462	.	.	.	.	.	T	0.23965	0.0580	.	.	.	0.09310	N	1	B	0.26081	0.141	B	0.17722	0.019	T	0.14671	-1.0464	7	.	.	.	.	2.524	0.04687	0.183:0.1434:0.5266:0.147	.	1029	E9PAV3	.	T	1029	ENSP00000403817:P1029T	.	P	-	1	0	NACA	55398496	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.805000	0.04530	-0.682000	0.05197	0.121000	0.15741	CCC	NACA	-	NULL	ENSG00000196531		0.652	NACA-201	KNOWN	basic	protein_coding	NACA	HGNC	protein_coding		9	0.00	0	G	NM_005594		57112229	57112229	-1	no_errors	ENST00000454682	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	0.000	T
NACAD	23148	genome.wustl.edu	37	7	45124506	45124506	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:45124506C>T	ENST00000490531.2	-	2	1292	c.1273G>A	c.(1273-1275)Gag>Aag	p.E425K		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	425					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						CCGCTCTCCTCCTCTGTCTTC	0.632																																						dbGAP											0													23.0	24.0	24.0					7																	45124506		692	1591	2283	-	-	-	SO:0001583	missense	0			AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.1273G>A	7.37:g.45124506C>T	ENSP00000420477:p.Glu425Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx,pfscan_Nas_poly-pep-assoc_cplx	p.E425K	ENST00000490531.2	37	c.1273	CCDS47582.1	7	.	.	.	.	.	.	.	.	.	.	C	14.71	2.616093	0.46631	.	.	ENSG00000136274	ENST00000490531	T	0.11821	2.74	2.74	0.528	0.17089	.	0.969624	0.08340	U	0.960986	T	0.06600	0.0169	N	0.08118	0	0.09310	N	1	B	0.29212	0.237	B	0.28553	0.091	T	0.40831	-0.9542	10	0.35671	T	0.21	-1.0368	5.6525	0.17625	0.1781:0.5027:0.3192:0.0	.	425	O15069	NACAD_HUMAN	K	425	ENSP00000420477:E425K	ENSP00000420477:E425K	E	-	1	0	NACAD	45091031	0.006000	0.16342	0.061000	0.19648	0.055000	0.15305	0.521000	0.22893	0.278000	0.22164	0.462000	0.41574	GAG	NACAD	-	NULL	ENSG00000136274		0.632	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACAD	HGNC	protein_coding	OTTHUMT00000353652.2	12	0.00	0	C	NM_001146334		45124506	45124506	-1	no_errors	ENST00000490531	ensembl	human	known	69_37n	missense	39	18.75	9	SNP	0.213	T
NARF	26502	genome.wustl.edu	37	17	80441594	80441594	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:80441594G>A	ENST00000309794.11	+	8	970	c.772G>A	c.(772-774)Gaa>Aaa	p.E258K	NARF_ENST00000390006.4_Missense_Mutation_p.E199K|NARF_ENST00000457415.3_Missense_Mutation_p.E304K|NARF_ENST00000345415.7_Missense_Mutation_p.E210K|NARF_ENST00000412079.2_Missense_Mutation_p.E130K|NARF-IT1_ENST00000584012.1_RNA	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	258						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GTCTGCAGGTGAAATTGCTCA	0.517																																						dbGAP											0													128.0	116.0	120.0					17																	80441594		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.772G>A	17.37:g.80441594G>A	ENSP00000309899:p.Glu258Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	pfam_Fe_hydrogenase_lsu_C,pfam_Fe_hydrogenase_ssu-like,superfamily_Fe_hydrogenase,smart_Fe_hydrogenase_ssu-like	p.E258K	ENST00000309794.11	37	c.772	CCDS32777.1	17	.	.	.	.	.	.	.	.	.	.	.	13.64	2.296325	0.40594	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415;ENST00000412079;ENST00000457415	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	4.9	4.9	0.64082	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.87233	0.6126	H	0.97186	3.955	0.80722	D	1	D;P;P;P;P	0.69078	0.997;0.72;0.72;0.763;0.529	D;P;P;P;P	0.66196	0.942;0.54;0.462;0.67;0.536	D	0.91591	0.5287	10	0.87932	D	0	-5.3983	16.7949	0.85599	0.0:0.0:1.0:0.0	.	130;304;210;305;258	B4DZZ6;Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;.;NARF_HUMAN	K	199;305;258;210;130;259	ENSP00000374656:E199K;ENSP00000309899:E258K;ENSP00000283996:E210K;ENSP00000409710:E130K	ENSP00000309899:E258K	E	+	1	0	NARF	78034883	1.000000	0.71417	0.998000	0.56505	0.556000	0.35491	5.919000	0.70005	2.547000	0.85894	0.655000	0.94253	GAA	NARF	-	pfam_Fe_hydrogenase_lsu_C,superfamily_Fe_hydrogenase	ENSG00000141562		0.517	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARF	HGNC	protein_coding	OTTHUMT00000443573.2	100	0.00	0	G	NM_031968		80441594	80441594	+1	no_errors	ENST00000309794	ensembl	human	known	69_37n	missense	143	27.64	55	SNP	1.000	A
NBPF3	84224	genome.wustl.edu	37	1	21800026	21800026	+	Silent	SNP	C	C	T	rs138236134		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:21800026C>T	ENST00000318249.5	+	7	1238	c.888C>T	c.(886-888)ctC>ctT	p.L296L	NBPF3_ENST00000454000.2_Silent_p.L226L|NBPF3_ENST00000342104.5_Silent_p.L296L|NBPF3_ENST00000318220.6_Silent_p.L240L	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	296	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		ACTCAACTCTCATTGACTCAT	0.463																																						dbGAP											0													251.0	224.0	234.0					1																	21800026		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.888C>T	1.37:g.21800026C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Silent	SNP	pfam_NBPF_dom	p.L296	ENST00000318249.5	37	c.888	CCDS216.1	1																																																																																			NBPF3	-	pfam_NBPF_dom	ENSG00000142794		0.463	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBPF3	HGNC	protein_coding		280	0.00	0	C	NM_032264		21800026	21800026	+1	no_errors	ENST00000318249	ensembl	human	known	69_37n	silent	185	21.94	52	SNP	0.006	T
NCAPD3	23310	genome.wustl.edu	37	11	134047318	134047318	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:134047318C>T	ENST00000534548.2	-	23	2881	c.2817G>A	c.(2815-2817)aaG>aaA	p.K939K	RP11-700F16.3_ENST00000531710.1_RNA	NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	939					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GGATGCTCTTCTTTGCCAGAT	0.483																																						dbGAP											0													129.0	94.0	106.0					11																	134047318		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.2817G>A	11.37:g.134047318C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS2|Q4KMQ9	Silent	SNP	superfamily_ARM-type_fold,pirsf_Condns_HCP-6	p.K939	ENST00000534548.2	37	c.2817	CCDS31723.1	11																																																																																			NCAPD3	-	superfamily_ARM-type_fold,pirsf_Condns_HCP-6	ENSG00000151503		0.483	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD3	HGNC	protein_coding	OTTHUMT00000393575.2	26	0.00	0	C	NM_015261		134047318	134047318	-1	no_errors	ENST00000534548	ensembl	human	known	69_37n	silent	56	21.13	15	SNP	1.000	T
NCOA5	57727	genome.wustl.edu	37	20	44708029	44708029	+	Missense_Mutation	SNP	C	C	T	rs370602943		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr20:44708029C>T	ENST00000290231.6	-	2	199	c.35G>A	c.(34-36)cGa>cAa	p.R12Q		NM_020967.2	NP_066018.1	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	12	Arg/Asp-rich (mixed charge).|Transcription repression.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				ACTTTACCTTCGTGTGGGGCT	0.473																																						dbGAP											0													159.0	143.0	148.0					20																	44708029		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13392.1	20q12-q13.12	2008-07-02			ENSG00000124160	ENSG00000124160			15909	protein-coding gene	gene with protein product	"""coactivator independent of AF-2"""					11780052, 11113208	Standard	XM_005260474		Approved	bA465L10.6, CIA	uc002xre.3	Q9HCD5	OTTHUMG00000032639	ENST00000290231.6:c.35G>A	20.37:g.44708029C>T	ENSP00000290231:p.Arg12Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTV9|E1P5R0|Q6HA99|Q9H1F2|Q9H2T2|Q9H4Y9	Missense_Mutation	SNP	superfamily_Anticodon-bd	p.R12Q	ENST00000290231.6	37	c.35	CCDS13392.1	20	.	.	.	.	.	.	.	.	.	.	C	18.58	3.655132	0.67472	.	.	ENSG00000124160	ENST00000290231	T	0.52983	0.64	5.23	5.23	0.72850	.	0.073766	0.56097	D	0.000031	T	0.64768	0.2628	L	0.53249	1.67	0.53688	D	0.999975	D	0.71674	0.998	D	0.72982	0.979	T	0.61436	-0.7063	10	0.44086	T	0.13	.	18.338	0.90295	0.0:1.0:0.0:0.0	.	12	Q9HCD5	NCOA5_HUMAN	Q	12	ENSP00000290231:R12Q	ENSP00000290231:R12Q	R	-	2	0	NCOA5	44141436	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.144000	0.64832	2.871000	0.98454	0.655000	0.94253	CGA	NCOA5	-	NULL	ENSG00000124160		0.473	NCOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA5	HGNC	protein_coding	OTTHUMT00000079559.1	253	0.00	0	C	NM_020967		44708029	44708029	-1	no_errors	ENST00000290231	ensembl	human	known	69_37n	missense	262	22.26	75	SNP	1.000	T
NLRC5	84166	genome.wustl.edu	37	16	57070087	57070087	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:57070087G>T	ENST00000262510.6	+	14	2928	c.2703G>T	c.(2701-2703)agG>agT	p.R901S	NLRC5_ENST00000539144.1_Missense_Mutation_p.R901S|NLRC5_ENST00000436936.1_Missense_Mutation_p.R901S|NLRC5_ENST00000308149.7_Missense_Mutation_p.R901S	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	901					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				ACATCGCCAGGAAGCTGGAGT	0.617																																						dbGAP											0													42.0	40.0	41.0					16																	57070087		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.2703G>T	16.37:g.57070087G>T	ENSP00000262510:p.Arg901Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Nonsense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.E629*	ENST00000262510.6	37	c.1885	CCDS10773.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.91|19.91	3.914909|3.914909	0.72983|0.72983	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000538805|ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030	.|T;T;T;T;T;T	.|0.52526	.|0.66;0.66;0.66;0.66;0.66;0.66	5.17|5.17	4.15|4.15	0.48705|0.48705	.|.	.|0.628162	.|0.13285	.|N	.|0.399469	.|T	.|0.38214	.|0.1032	L|L	0.54323|0.54323	1.7|1.7	0.26649|0.26649	N|N	0.972148|0.972148	.|P;B;B;B	.|0.41848	.|0.763;0.087;0.352;0.142	.|B;B;B;B	.|0.34536	.|0.121;0.059;0.185;0.054	.|T	.|0.21280	.|-1.0250	.|10	.|0.23302	.|T	.|0.38	.|.	11.0735|11.0735	0.48016|0.48016	0.0964:0.0:0.9036:0.0|0.0964:0.0:0.9036:0.0	.|.	.|901;901;901;901	.|Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3	.|.;.;.;NLRC5_HUMAN	X|S	654|901;901;901;375;901;408;200	.|ENSP00000262510:R901S;ENSP00000308886:R901S;ENSP00000389739:R901S;ENSP00000441727:R901S;ENSP00000441597:R408S;ENSP00000440153:R200S	.|ENSP00000262510:R901S	E|R	+|+	1|3	0|2	NLRC5|NLRC5	55627588|55627588	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.938000|0.938000	0.57974|0.57974	3.577000|3.577000	0.53885|0.53885	2.695000|2.695000	0.91970|0.91970	0.561000|0.561000	0.74099|0.74099	GAA|AGG	NLRC5	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000140853		0.617	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1	9	0.00	0	G	NM_032206		57070087	57070087	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000545081	ensembl	human	known	69_37n	nonsense	17	43.33	13	SNP	0.952	T
NFAT5	10725	genome.wustl.edu	37	16	69718792	69718792	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:69718792G>T	ENST00000354436.2	+	10	1957	c.1639G>T	c.(1639-1641)Gca>Tca	p.A547S	NFAT5_ENST00000566899.1_Missense_Mutation_p.A471S|NFAT5_ENST00000393742.2_Missense_Mutation_p.A471S|NFAT5_ENST00000349945.1_Missense_Mutation_p.A471S|NFAT5_ENST00000432919.1_Missense_Mutation_p.A565S|NFAT5_ENST00000567239.1_Splice_Site	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	547					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						TTTAATAGCAGCAGCTGGTGC	0.318																																						dbGAP											0													56.0	62.0	60.0					16																	69718792		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.1639G>T	16.37:g.69718792G>T	ENSP00000346420:p.Ala547Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Splice_Site	SNP	-	e6-1	ENST00000354436.2	37	c.360-1	CCDS10881.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.09|13.09	2.132576|2.132576	0.37630|0.37630	.|.	.|.	ENSG00000102908|ENSG00000102908	ENST00000426654|ENST00000432919;ENST00000349945;ENST00000354436;ENST00000393742	.|T;T;T;T	.|0.28895	.|1.59;1.59;1.59;1.59	5.31|5.31	1.84|1.84	0.25277|0.25277	.|Immunoglobulin E-set (1);	.|0.662292	.|0.15911	.|N	.|0.238607	.|T	.|0.15565	.|0.0375	N|N	0.22421|0.22421	0.69|0.69	0.38317|0.38317	D|D	0.943418|0.943418	.|B;B	.|0.09022	.|0.001;0.002	.|B;B	.|0.14023	.|0.001;0.01	.|T	.|0.12528	.|-1.0544	.|10	.|0.07482	.|T	.|0.82	.|.	6.6383|6.6383	0.22895|0.22895	0.2521:0.1475:0.6004:0.0|0.2521:0.1475:0.6004:0.0	.|.	.|547;565	.|O94916;E9PHR7	.|NFAT5_HUMAN;.	.|S	-1|565;471;547;471	.|ENSP00000396538:A565S;ENSP00000338806:A471S;ENSP00000346420:A547S;ENSP00000377343:A471S	.|ENSP00000338806:A471S	.|A	+|+	.|1	.|0	NFAT5|NFAT5	68276293|68276293	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.790000|0.790000	0.44656|0.44656	0.682000|0.682000	0.25335|0.25335	0.564000|0.564000	0.29238|0.29238	-0.182000|-0.182000	0.12963|0.12963	.|GCA	NFAT5	-	-	ENSG00000102908		0.318	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	HGNC	protein_coding	OTTHUMT00000268952.2	178	0.00	0	G	NM_138714		69718792	69718792	+1	no_errors	ENST00000567990	ensembl	human	known	69_37n	splice_site	66	20.48	17	SNP	0.992	T
NLRP14	338323	genome.wustl.edu	37	11	7067969	7067969	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:7067969G>C	ENST00000299481.4	+	5	2375	c.2029G>C	c.(2029-2031)Gaa>Caa	p.E677Q		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	677					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)	p.E677*(2)		breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		ACACTTGAGAGAATTGGACCT	0.378																																						dbGAP											2	Substitution - Nonsense(2)	large_intestine(2)											225.0	193.0	204.0					11																	7067969		2201	4296	6497	-	-	-	SO:0001583	missense	0			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2029G>C	11.37:g.7067969G>C	ENSP00000299481:p.Glu677Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7RTR6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.E677Q	ENST00000299481.4	37	c.2029	CCDS7776.1	11	.	.	.	.	.	.	.	.	.	.	G	10.08	1.253540	0.22965	.	.	ENSG00000158077	ENST00000299481	D	0.90069	-2.61	4.52	3.61	0.41365	.	0.149577	0.31323	N	0.007842	D	0.84388	0.5461	L	0.58510	1.815	0.34665	D	0.723149	B	0.09022	0.002	B	0.09377	0.004	T	0.81297	-0.0996	10	0.17369	T	0.5	.	10.8792	0.46929	0.0:0.1903:0.8097:0.0	.	677	Q86W24	NAL14_HUMAN	Q	677	ENSP00000299481:E677Q	ENSP00000299481:E677Q	E	+	1	0	NLRP14	7024545	1.000000	0.71417	0.391000	0.26233	0.307000	0.27823	1.718000	0.38001	1.275000	0.44379	-0.203000	0.12734	GAA	NLRP14	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000158077		0.378	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP14	HGNC	protein_coding	OTTHUMT00000384551.1	131	0.00	0	G	NM_176822		7067969	7067969	+1	no_errors	ENST00000299481	ensembl	human	known	69_37n	missense	87	23.01	26	SNP	0.998	C
NLRP2	55655	genome.wustl.edu	37	19	55493625	55493625	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:55493625G>C	ENST00000543010.1	+	6	702	c.559G>C	c.(559-561)Gag>Cag	p.E187Q	NLRP2_ENST00000339757.7_Missense_Mutation_p.E165Q|NLRP2_ENST00000427260.2_Missense_Mutation_p.E164Q|NLRP2_ENST00000448584.2_Missense_Mutation_p.E187Q|NLRP2_ENST00000391721.4_Missense_Mutation_p.E163Q|NLRP2_ENST00000263437.6_Missense_Mutation_p.E184Q|NLRP2_ENST00000537859.1_Missense_Mutation_p.E165Q|NLRP2_ENST00000538819.1_Missense_Mutation_p.E163Q	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	187					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GGTTATGGCTGAGAGATACAA	0.512																																						dbGAP											0													145.0	153.0	150.0					19																	55493625		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.559G>C	19.37:g.55493625G>C	ENSP00000445135:p.Glu187Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.E187Q	ENST00000543010.1	37	c.559	CCDS12913.1	19	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.516614	0.00975	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.74737	-0.83;-0.74;-0.75;-0.83;-0.75;-0.87;-0.74;0.48	2.05	-0.576	0.11731	.	0.944518	0.08588	N	0.923518	T	0.48277	0.1491	N	0.04508	-0.205	0.09310	N	1	B;B;B;B;B	0.13145	0.002;0.004;0.002;0.004;0.007	B;B;B;B;B	0.15870	0.005;0.012;0.005;0.012;0.014	T	0.29427	-1.0012	10	0.18710	T	0.47	.	7.641	0.28294	0.0:0.4594:0.5406:0.0	.	164;165;184;163;187	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	Q	187;163;165;187;165;164;163;184	ENSP00000445135:E187Q;ENSP00000375601:E163Q;ENSP00000344074:E165Q;ENSP00000409370:E187Q;ENSP00000440601:E165Q;ENSP00000402474:E164Q;ENSP00000441133:E163Q;ENSP00000263437:E184Q	ENSP00000263437:E184Q	E	+	1	0	NLRP2	60185437	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.329000	0.07935	-0.022000	0.13986	-0.540000	0.04249	GAG	NLRP2	-	NULL	ENSG00000022556		0.512	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	HGNC	protein_coding	OTTHUMT00000396152.1	38	0.00	0	G	NM_017852		55493625	55493625	+1	no_errors	ENST00000448584	ensembl	human	known	69_37n	missense	86	11.34	11	SNP	0.000	C
NOP14	8602	genome.wustl.edu	37	4	2951877	2951877	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr4:2951877C>T	ENST00000314262.6	-	8	1114	c.1066G>A	c.(1066-1068)Gag>Aag	p.E356K	NOP14-AS1_ENST00000515194.1_RNA|NOP14-AS1_ENST00000505731.1_RNA|NOP14_ENST00000398071.4_Missense_Mutation_p.E356K|NOP14_ENST00000502735.1_Missense_Mutation_p.E356K|NOP14-AS1_ENST00000503709.1_RNA|NOP14_ENST00000416614.2_Missense_Mutation_p.E356K	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	356					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						TCGTTGCTCTCAGGGTCACTG	0.547																																						dbGAP											0													257.0	255.0	256.0					4																	2951877		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.1066G>A	4.37:g.2951877C>T	ENSP00000315674:p.Glu356Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Missense_Mutation	SNP	pfam_Nop14	p.E356K	ENST00000314262.6	37	c.1066	CCDS33945.1	4	.	.	.	.	.	.	.	.	.	.	C	13.68	2.310831	0.40895	.	.	ENSG00000087269	ENST00000416614;ENST00000314262;ENST00000502735;ENST00000398071;ENST00000546137	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.43	3.71	0.42584	.	1.144810	0.06424	N	0.722811	T	0.38957	0.1060	M	0.72894	2.215	0.09310	N	0.999999	B;B;B	0.17667	0.023;0.006;0.007	B;B;B	0.20577	0.03;0.021;0.012	T	0.40534	-0.9558	10	0.87932	D	0	-7.5963	11.0735	0.48016	0.0:0.8483:0.0:0.1517	.	149;356;356	Q96GC8;E9PFK5;P78316	.;.;NOP14_HUMAN	K	356;356;356;356;255	ENSP00000405068:E356K;ENSP00000315674:E356K;ENSP00000427415:E356K;ENSP00000381146:E356K	ENSP00000315674:E356K	E	-	1	0	NOP14	2921675	0.001000	0.12720	0.001000	0.08648	0.007000	0.05969	1.494000	0.35616	0.670000	0.31165	-0.150000	0.13652	GAG	NOP14	-	pfam_Nop14	ENSG00000087269		0.547	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NOP14	HGNC	protein_coding	OTTHUMT00000358135.2	228	0.00	0	C	NM_003703		2951877	2951877	-1	no_errors	ENST00000416614	ensembl	human	known	69_37n	missense	316	18.77	73	SNP	0.005	T
NOS2	4843	genome.wustl.edu	37	17	26101330	26101330	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:26101330G>A	ENST00000313735.6	-	12	1662	c.1429C>T	c.(1429-1431)Cac>Tac	p.H477Y		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	477					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	ATCTCCTGGTGAAACACGGGG	0.562																																						dbGAP											0													99.0	91.0	94.0					17																	26101330		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.1429C>T	17.37:g.26101330G>A	ENSP00000327251:p.His477Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_met,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.H477Y	ENST00000313735.6	37	c.1429	CCDS11223.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.124844	0.94429	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.27890	1.64	5.67	5.67	0.87782	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.85682	D	0.000000	T	0.71913	0.3396	H	0.97365	3.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	T	0.82458	-0.0447	10	0.87932	D	0	.	18.7664	0.91874	0.0:0.0:1.0:0.0	.	477;477	F8WEM3;P35228	.;NOS2_HUMAN	Y	477;438;477	ENSP00000327251:H477Y	ENSP00000305638:H477Y	H	-	1	0	NOS2	23125457	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	9.743000	0.98849	2.667000	0.90743	0.561000	0.74099	CAC	NOS2	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_met	ENSG00000007171		0.562	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS2	HGNC	protein_coding	OTTHUMT00000255597.1	76	0.00	0	G	NM_000625		26101330	26101330	-1	no_errors	ENST00000313735	ensembl	human	known	69_37n	missense	129	15.13	23	SNP	1.000	A
NOTCH1	4851	genome.wustl.edu	37	9	139393424	139393424	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr9:139393424G>A	ENST00000277541.6	-	33	6182	c.6107C>T	c.(6106-6108)gCc>gTc	p.A2036V		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	2036					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GTTCACGGCGGCGGCCCAGTG	0.622			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																												dbGAP		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													112.0	125.0	121.0					9																	139393424		2083	4202	6285	-	-	-	SO:0001583	missense	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.6107C>T	9.37:g.139393424G>A	ENSP00000277541:p.Ala2036Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59ED8|Q5SXM3	Missense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_1,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.A2036V	ENST00000277541.6	37	c.6107	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744612	0.69418	.	.	ENSG00000148400	ENST00000277541	T	0.70516	-0.49	4.9	4.9	0.64082	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.80518	0.4638	L	0.60012	1.86	0.80722	D	1	D	0.69078	0.997	P	0.61940	0.896	T	0.82904	-0.0226	10	0.87932	D	0	.	17.4199	0.87512	0.0:0.0:1.0:0.0	.	2036	P46531	NOTC1_HUMAN	V	2036	ENSP00000277541:A2036V	ENSP00000277541:A2036V	A	-	2	0	NOTCH1	138513245	1.000000	0.71417	0.138000	0.22173	0.076000	0.17211	9.164000	0.94755	2.429000	0.82318	0.561000	0.74099	GCC	NOTCH1	-	pirsf_Notch,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000148400		0.622	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	28	0.00	0	G	NM_017617		139393424	139393424	-1	no_errors	ENST00000277541	ensembl	human	known	69_37n	missense	113	21.53	31	SNP	0.998	A
NOTCH4	4855	genome.wustl.edu	37	6	32190850	32190850	+	Silent	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:32190850C>G	ENST00000375023.3	-	2	225	c.87G>C	c.(85-87)ggG>ggC	p.G29G		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	29	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CTGGGAAACTCCCACACAGCA	0.617																																						dbGAP											0													97.0	96.0	96.0					6																	32190850		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.87G>C	6.37:g.32190850C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	pfam_EGF-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_4,prints_Notch_dom	p.G29	ENST00000375023.3	37	c.87	CCDS34420.1	6																																																																																			NOTCH4	-	smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Notch,pfscan_EG-like_dom	ENSG00000204301		0.617	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	11	0.00	0	C			32190850	32190850	-1	no_errors	ENST00000375023	ensembl	human	known	69_37n	silent	70	18.60	16	SNP	0.000	G
NPAT	4863	genome.wustl.edu	37	11	108057261	108057261	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:108057261G>C	ENST00000278612.8	-	8	779	c.674C>G	c.(673-675)cCt>cGt	p.P225R	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	225	Interaction with MIZF.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		TGTTGAATGAGGGCCAGACAA	0.318																																						dbGAP											0													117.0	109.0	112.0					11																	108057261		1808	4076	5884	-	-	-	SO:0001583	missense	0			X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.674C>G	11.37:g.108057261G>C	ENSP00000278612:p.Pro225Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.P225R	ENST00000278612.8	37	c.674	CCDS41710.1	11	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299447	0.81136	.	.	ENSG00000149308	ENST00000278612	T	0.04049	3.72	5.76	5.76	0.90799	.	0.271361	0.40385	N	0.001112	T	0.12732	0.0309	L	0.57536	1.79	0.43953	D	0.996629	D;D	0.54601	0.967;0.967	P;P	0.51266	0.664;0.664	T	0.00048	-1.2206	10	0.87932	D	0	-12.7975	16.6764	0.85280	0.0:0.0:1.0:0.0	.	225;225	B9EG70;Q14207	.;NPAT_HUMAN	R	225	ENSP00000278612:P225R	ENSP00000278612:P225R	P	-	2	0	NPAT	107562471	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.381000	0.66208	2.721000	0.93114	0.655000	0.94253	CCT	NPAT	-	NULL	ENSG00000149308		0.318	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAT	HGNC	protein_coding	OTTHUMT00000389506.2	302	0.00	0	G	NM_002519		108057261	108057261	-1	no_errors	ENST00000278612	ensembl	human	known	69_37n	missense	144	35.56	80	SNP	1.000	C
NT5E	4907	genome.wustl.edu	37	6	86197154	86197154	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:86197154C>G	ENST00000257770.3	+	5	1100	c.1051C>G	c.(1051-1053)Caa>Gaa	p.Q351E	NT5E_ENST00000369651.3_Missense_Mutation_p.Q351E	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	351					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	TGGCTCCTCTCAATCATGCCG	0.413																																					Melanoma(140;797 1765 2035 2752 18208)	dbGAP											0													162.0	154.0	157.0					6																	86197154		2203	4300	6503	-	-	-	SO:0001583	missense	0			X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.1051C>G	6.37:g.86197154C>G	ENSP00000257770:p.Gln351Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQI8|O75520|Q5W116	Missense_Mutation	SNP	pfam_5'-Nucleotdase_C,pfam_Metallo_PEstase_dom,superfamily_5'-Nucleotdase_C,prints_5_nucleotidase/apyrase	p.Q351E	ENST00000257770.3	37	c.1051	CCDS5002.1	6	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.281365	0.00251	.	.	ENSG00000135318	ENST00000369647;ENST00000257770;ENST00000369651	T;T	0.53857	0.6;0.6	5.48	1.4	0.22301	5&apos (3);-Nucleotidase, C-terminal (3);	0.570889	0.19384	N	0.115564	T	0.05914	0.0154	N	0.02213	-0.635	0.09310	N	1	B;B	0.14012	0.009;0.005	B;B	0.15484	0.013;0.013	T	0.43814	-0.9368	10	0.02654	T	1	-1.3802	7.7108	0.28677	0.1194:0.3514:0.4641:0.065	.	351;351	B3KQI8;P21589	.;5NTD_HUMAN	E	127;351;351	ENSP00000257770:Q351E;ENSP00000358665:Q351E	ENSP00000257770:Q351E	Q	+	1	0	NT5E	86253873	0.015000	0.18098	0.002000	0.10522	0.269000	0.26545	0.326000	0.19646	-0.031000	0.13781	0.557000	0.71058	CAA	NT5E	-	pfam_5'-Nucleotdase_C,superfamily_5'-Nucleotdase_C	ENSG00000135318		0.413	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5E	HGNC	protein_coding	OTTHUMT00000041388.1	124	0.80	1	C			86197154	86197154	+1	no_errors	ENST00000257770	ensembl	human	known	69_37n	missense	111	22.22	32	SNP	0.000	G
NUFIP2	57532	genome.wustl.edu	37	17	27613780	27613780	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:27613780G>A	ENST00000225388.4	-	2	1290	c.1232C>T	c.(1231-1233)tCt>tTt	p.S411F	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	411	Ser-rich.					cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			AAAGTTGGCAGAAGTAACAGA	0.458																																						dbGAP											0													86.0	88.0	88.0					17																	27613780		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.1232C>T	17.37:g.27613780G>A	ENSP00000225388:p.Ser411Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A6|Q9P2M5	Missense_Mutation	SNP	NULL	p.S411F	ENST00000225388.4	37	c.1232	CCDS32600.1	17	.	.	.	.	.	.	.	.	.	.	G	16.89	3.247371	0.59103	.	.	ENSG00000108256	ENST00000225388	.	.	.	6.17	5.2	0.72013	.	0.077528	0.56097	D	0.000032	T	0.64549	0.2608	L	0.34521	1.04	0.80722	D	1	P	0.51791	0.948	P	0.57720	0.826	T	0.68953	-0.5273	9	0.87932	D	0	-13.141	17.6162	0.88068	0.0:0.1233:0.8767:0.0	.	411	Q7Z417	NUFP2_HUMAN	F	411	.	ENSP00000225388:S411F	S	-	2	0	NUFIP2	24637906	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.476000	0.97823	1.609000	0.50190	-0.175000	0.13238	TCT	NUFIP2	-	NULL	ENSG00000108256		0.458	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP2	HGNC	protein_coding	OTTHUMT00000447015.2	122	0.00	0	G	NM_020772		27613780	27613780	-1	no_errors	ENST00000225388	ensembl	human	known	69_37n	missense	125	17.76	27	SNP	1.000	A
NUFIP2	57532	genome.wustl.edu	37	17	27613855	27613855	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:27613855G>T	ENST00000225388.4	-	2	1215	c.1157C>A	c.(1156-1158)tCt>tAt	p.S386Y	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	386	Ser-rich.					cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			TTCCCCGGTAGATGATGAAGA	0.413																																						dbGAP											0													158.0	157.0	157.0					17																	27613855		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.1157C>A	17.37:g.27613855G>T	ENSP00000225388:p.Ser386Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A6|Q9P2M5	Missense_Mutation	SNP	NULL	p.S386Y	ENST00000225388.4	37	c.1157	CCDS32600.1	17	.	.	.	.	.	.	.	.	.	.	G	16.25	3.071235	0.55646	.	.	ENSG00000108256	ENST00000225388	.	.	.	5.97	5.97	0.96955	.	0.153988	0.46758	D	0.000270	T	0.59197	0.2176	N	0.24115	0.695	0.80722	D	1	D	0.58620	0.983	P	0.53649	0.731	T	0.62742	-0.6790	9	0.87932	D	0	0.0056	18.5963	0.91230	0.0:0.0:1.0:0.0	.	386	Q7Z417	NUFP2_HUMAN	Y	386	.	ENSP00000225388:S386Y	S	-	2	0	NUFIP2	24637981	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	6.024000	0.70857	2.825000	0.97269	0.655000	0.94253	TCT	NUFIP2	-	NULL	ENSG00000108256		0.413	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP2	HGNC	protein_coding	OTTHUMT00000447015.2	170	0.00	0	G	NM_020772		27613855	27613855	-1	no_errors	ENST00000225388	ensembl	human	known	69_37n	missense	164	21.90	46	SNP	1.000	T
NUFIP2	57532	genome.wustl.edu	37	17	27614141	27614141	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:27614141G>A	ENST00000225388.4	-	2	929	c.871C>T	c.(871-873)Cga>Tga	p.R291*	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	291						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			GGTTTTCCTCGACTTGTTCCT	0.453																																						dbGAP											0													110.0	112.0	112.0					17																	27614141		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.871C>T	17.37:g.27614141G>A	ENSP00000225388:p.Arg291*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A6|Q9P2M5	Nonsense_Mutation	SNP	NULL	p.R291*	ENST00000225388.4	37	c.871	CCDS32600.1	17	.	.	.	.	.	.	.	.	.	.	G	24.9	4.578899	0.86645	.	.	ENSG00000108256	ENST00000225388	.	.	.	6.17	4.17	0.49024	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.3405	11.1207	0.48289	0.0663:0.0:0.8041:0.1296	.	.	.	.	X	291	.	ENSP00000225388:R291X	R	-	1	2	NUFIP2	24638267	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.768000	0.38511	0.917000	0.36895	0.655000	0.94253	CGA	NUFIP2	-	NULL	ENSG00000108256		0.453	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP2	HGNC	protein_coding	OTTHUMT00000447015.2	151	0.00	0	G	NM_020772		27614141	27614141	-1	no_errors	ENST00000225388	ensembl	human	known	69_37n	nonsense	136	19.53	33	SNP	0.910	A
NUP205	23165	genome.wustl.edu	37	7	135261125	135261125	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:135261125C>T	ENST00000285968.6	+	4	477	c.451C>T	c.(451-453)Cag>Tag	p.Q151*	NUP205_ENST00000440390.2_5'UTR	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	151					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						AGCCTTGATACAGTCTAGACG	0.418																																						dbGAP											0													159.0	151.0	153.0					7																	135261125		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.451C>T	7.37:g.135261125C>T	ENSP00000285968:p.Gln151*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X3|Q86YC1	Nonsense_Mutation	SNP	pfam_DUF3414	p.Q151*	ENST00000285968.6	37	c.451	CCDS34759.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.475963	0.96291	.	.	ENSG00000155561	ENST00000285968	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-5.99	19.8657	0.96803	0.0:1.0:0.0:0.0	.	.	.	.	X	151	.	ENSP00000285968:Q151X	Q	+	1	0	NUP205	134911665	1.000000	0.71417	0.998000	0.56505	0.934000	0.57294	7.738000	0.84966	2.764000	0.94973	0.591000	0.81541	CAG	NUP205	-	pfam_DUF3414	ENSG00000155561		0.418	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP205	HGNC	protein_coding	OTTHUMT00000340358.1	140	0.00	0	C			135261125	135261125	+1	no_errors	ENST00000285968	ensembl	human	known	69_37n	nonsense	182	14.95	32	SNP	1.000	T
NUP93	9688	genome.wustl.edu	37	16	56782199	56782199	+	Missense_Mutation	SNP	G	G	A	rs528073782		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:56782199G>A	ENST00000308159.5	+	2	161	c.40G>A	c.(40-42)Gaa>Aaa	p.E14K	NUP93_ENST00000569842.1_Missense_Mutation_p.E14K	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	14					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.E14K(3)		breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						TCAGCAAGCTGAACAGCTTGC	0.517																																					Colon(33;610 796 1305 1705 38917)	dbGAP											3	Substitution - Missense(3)	breast(2)|upper_aerodigestive_tract(1)											67.0	65.0	66.0					16																	56782199		2198	4300	6498	-	-	-	SO:0001583	missense	0			D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.40G>A	16.37:g.56782199G>A	ENSP00000310668:p.Glu14Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPQ8|Q14705	Missense_Mutation	SNP	pfam_Nucleoporin_int_Nup93/Nic96	p.E14K	ENST00000308159.5	37	c.40	CCDS10769.1	16	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428130	0.83667	.	.	ENSG00000102900	ENST00000308159	T	0.44083	0.93	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.37812	0.1017	L	0.39898	1.24	0.80722	D	1	B	0.15473	0.013	B	0.15484	0.013	T	0.22208	-1.0223	10	0.12103	T	0.63	-21.6196	20.8598	0.99761	0.0:0.0:1.0:0.0	.	14	Q8N1F7	NUP93_HUMAN	K	14	ENSP00000310668:E14K	ENSP00000310668:E14K	E	+	1	0	NUP93	55339700	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.685000	0.98661	2.937000	0.99478	0.650000	0.86243	GAA	NUP93	-	NULL	ENSG00000102900		0.517	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP93	HGNC	protein_coding	OTTHUMT00000257058.4	25	0.00	0	G	NM_014669		56782199	56782199	+1	no_errors	ENST00000308159	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	1.000	A
NXF3	56000	genome.wustl.edu	37	X	102338576	102338576	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:102338576C>G	ENST00000395065.3	-	4	497	c.396G>C	c.(394-396)ttG>ttC	p.L132F	NXF3_ENST00000425463.2_Missense_Mutation_p.L43F|NXF3_ENST00000425644.1_5'UTR	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	132	RRM.				mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						CATTCTGAATCAAATTCAGCA	0.448																																						dbGAP											0													124.0	114.0	117.0					X																	102338576		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.396G>C	X.37:g.102338576C>G	ENSP00000378504:p.Leu132Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYS7|Q5H9I1|Q9H1A9	Missense_Mutation	SNP	pfam_Tap_RNA-bd,pfam_NTF2,pfscan_Nuclear_transport_factor_2_euk	p.L132F	ENST00000395065.3	37	c.396	CCDS14503.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.585|7.585	0.669572|0.669572	0.14776|0.14776	.|.	.|.	ENSG00000147206|ENSG00000147206	ENST00000427570|ENST00000395065;ENST00000425463	.|T;T	.|0.46451	.|0.87;0.87	3.78|3.78	1.97|1.97	0.26223|0.26223	.|Nuclear RNA export factor Tap, RNA-binding domain (2);Nucleotide-binding, alpha-beta plait (1);	.|0.416358	.|0.25244	.|N	.|0.032073	T|T	0.43612|0.43612	0.1255|0.1255	L|L	0.39397|0.39397	1.21|1.21	0.18873|0.18873	N|N	0.999985|0.999985	.|D;D	.|0.89917	.|1.0;0.992	.|D;D	.|0.97110	.|1.0;0.958	T|T	0.34279|0.34279	-0.9835|-0.9835	5|10	.|0.09084	.|T	.|0.74	-2.6996|-2.6996	4.5771|4.5771	0.12240|0.12240	0.0:0.6491:0.222:0.1289|0.0:0.6491:0.222:0.1289	.|.	.|132;132	.|B4DYI1;Q9H4D5	.|.;NXF3_HUMAN	H|F	9|132;43	.|ENSP00000378504:L132F;ENSP00000404347:L43F	.|ENSP00000378504:L132F	D|L	-|-	1|3	0|2	NXF3|NXF3	102225232|102225232	0.004000|0.004000	0.15560|0.15560	0.022000|0.022000	0.16811|0.16811	0.012000|0.012000	0.07955|0.07955	-0.852000|-0.852000	0.04308|0.04308	0.397000|0.397000	0.25310|0.25310	0.600000|0.600000	0.82982|0.82982	GAT|TTG	NXF3	-	pfam_Tap_RNA-bd	ENSG00000147206		0.448	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF3	HGNC	protein_coding	OTTHUMT00000057684.1	208	0.00	0	C	NM_022052		102338576	102338576	-1	no_errors	ENST00000395065	ensembl	human	known	69_37n	missense	209	19.92	52	SNP	0.240	G
OR2F1	26211	genome.wustl.edu	37	7	143657556	143657556	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:143657556C>T	ENST00000392899.1	+	1	530	c.493C>T	c.(493-495)Cag>Tag	p.Q165*	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	165					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					TATCACCTTTCAGCTGCCCAT	0.522																																						dbGAP											0													148.0	125.0	133.0					7																	143657556		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.493C>T	7.37:g.143657556C>T	ENSP00000376633:p.Gln165*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Q165*	ENST00000392899.1	37	c.493	CCDS5887.1	7	.	.	.	.	.	.	.	.	.	.	C	15.25	2.777726	0.49786	.	.	ENSG00000213215	ENST00000392899	.	.	.	5.53	5.53	0.82687	.	0.146501	0.32852	N	0.005561	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-5.8806	11.8305	0.52293	0.1744:0.8256:0.0:0.0	.	.	.	.	X	165	.	ENSP00000376633:Q165X	Q	+	1	0	OR2F1	143288489	0.000000	0.05858	1.000000	0.80357	0.167000	0.22549	-0.377000	0.07456	2.871000	0.98454	0.655000	0.94253	CAG	OR2F1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000213215		0.522	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2F1	HGNC	protein_coding	OTTHUMT00000349581.1	122	0.00	0	C			143657556	143657556	+1	no_errors	ENST00000392899	ensembl	human	known	69_37n	nonsense	259	15.08	46	SNP	0.999	T
OR2F1	26211	genome.wustl.edu	37	7	143657696	143657696	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:143657696C>T	ENST00000392899.1	+	1	670	c.633C>T	c.(631-633)ttC>ttT	p.F211F	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	211				F -> L (in Ref. 1; AAB01215). {ECO:0000305}.	signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					TGACACCCTTCTGCCTGGTTC	0.502																																						dbGAP											0													238.0	209.0	219.0					7																	143657696		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.633C>T	7.37:g.143657696C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F211	ENST00000392899.1	37	c.633	CCDS5887.1	7																																																																																			OR2F1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000213215		0.502	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2F1	HGNC	protein_coding	OTTHUMT00000349581.1	275	0.00	0	C			143657696	143657696	+1	no_errors	ENST00000392899	ensembl	human	known	69_37n	silent	355	18.58	81	SNP	0.002	T
OR2F1	26211	genome.wustl.edu	37	7	143657793	143657793	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:143657793C>G	ENST00000392899.1	+	1	767	c.730C>G	c.(730-732)Cac>Gac	p.H244D	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	244					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					GTGTGCCTCTCACCTCACAGT	0.498																																						dbGAP											0													163.0	135.0	144.0					7																	143657793		2203	4300	6503	-	-	-	SO:0001583	missense	0			U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.730C>G	7.37:g.143657793C>G	ENSP00000376633:p.His244Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.H244D	ENST00000392899.1	37	c.730	CCDS5887.1	7	.	.	.	.	.	.	.	.	.	.	C	23.5	4.422972	0.83559	.	.	ENSG00000213215	ENST00000392899	T	0.00314	8.14	5.53	5.53	0.82687	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000029	T	0.01421	0.0046	H	0.98178	4.165	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	T	0.19943	-1.0290	10	0.87932	D	0	-27.2918	17.0114	0.86407	0.0:1.0:0.0:0.0	.	244	Q13607	OR2F1_HUMAN	D	244	ENSP00000376633:H244D	ENSP00000376633:H244D	H	+	1	0	OR2F1	143288726	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	5.692000	0.68256	2.871000	0.98454	0.655000	0.94253	CAC	OR2F1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000213215		0.498	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2F1	HGNC	protein_coding	OTTHUMT00000349581.1	205	0.00	0	C			143657793	143657793	+1	no_errors	ENST00000392899	ensembl	human	known	69_37n	missense	281	19.48	68	SNP	1.000	G
OR2A2	442361	genome.wustl.edu	37	7	143807338	143807338	+	Silent	SNP	C	C	T	rs192858969		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:143807338C>T	ENST00000408979.2	+	1	732	c.663C>T	c.(661-663)ctC>ctT	p.L221L		NM_001005480.2	NP_001005480.2	Q6IF42	OR2A2_HUMAN	olfactory receptor, family 2, subfamily A, member 2	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)|skin(4)	22	Melanoma(164;0.0783)					TGCACATCCTCGGGGCCATCC	0.522													.|||	1	0.000199681	0.0	0.0	5008	,	,		19885	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													108.0	113.0	111.0					7																	143807338		2014	4206	6220	-	-	-	SO:0001819	synonymous_variant	0				CCDS43671.1	7q35	2013-09-20		2004-03-10	ENSG00000221989	ENSG00000221989		"""GPCR / Class A : Olfactory receptors"""	8230	protein-coding gene	gene with protein product				OR2A2P, OR2A17P			Standard	NM_001005480		Approved	OST008	uc011ktz.2	Q6IF42	OTTHUMG00000158001	ENST00000408979.2:c.663C>T	7.37:g.143807338C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN85|Q8NGT6	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L221	ENST00000408979.2	37	c.663	CCDS43671.1	7																																																																																			OR2A2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000221989		0.522	OR2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A2	HGNC	protein_coding	OTTHUMT00000349978.1	64	0.00	0	C			143807338	143807338	+1	no_errors	ENST00000408979	ensembl	human	known	69_37n	silent	52	24.29	17	SNP	0.000	T
OR4K15	81127	genome.wustl.edu	37	14	20444652	20444652	+	Silent	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr14:20444652G>C	ENST00000305051.5	+	1	1050	c.975G>C	c.(973-975)ctG>ctC	p.L325L		NM_001005486.1	NP_001005486.1	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K, member 15	325						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|ovary(1)|prostate(2)|skin(1)|stomach(1)	39	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGTCAAAACTGAAGAGTCGGT	0.383																																						dbGAP											0													65.0	68.0	67.0					14																	20444652		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS32026.1	14q11.2	2013-09-23			ENSG00000169488	ENSG00000169488		"""GPCR / Class A : Olfactory receptors"""	15353	protein-coding gene	gene with protein product							Standard	NM_001005486		Approved	OR4K15Q	uc010tkx.2	Q8NH41	OTTHUMG00000170635	ENST00000305051.5:c.975G>C	14.37:g.20444652G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIL3|Q6IEZ4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L325	ENST00000305051.5	37	c.975	CCDS32026.1	14																																																																																			OR4K15	-	NULL	ENSG00000169488		0.383	OR4K15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K15	HGNC	protein_coding	OTTHUMT00000409883.1	141	0.00	0	G			20444652	20444652	+1	no_errors	ENST00000305051	ensembl	human	known	69_37n	silent	105	17.32	22	SNP	0.998	C
OR51A7	119687	genome.wustl.edu	37	11	4929293	4929293	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:4929293G>C	ENST00000359350.4	+	1	694	c.694G>C	c.(694-696)Gag>Cag	p.E232Q	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATCTTTGGCAGAGAGGCTTAA	0.473																																						dbGAP											0													232.0	199.0	210.0					11																	4929293		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.694G>C	11.37:g.4929293G>C	ENSP00000352305:p.Glu232Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFH8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.E232Q	ENST00000359350.4	37	c.694	CCDS31364.1	11	.	.	.	.	.	.	.	.	.	.	G	8.055	0.766801	0.15983	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.37235	1.21	4.87	4.87	0.63330	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000214	T	0.40767	0.1130	L	0.44542	1.39	0.09310	N	1	P	0.37398	0.593	P	0.45506	0.483	T	0.36601	-0.9741	10	0.52906	T	0.07	.	14.8473	0.70270	0.0:0.0:1.0:0.0	.	232	Q8NH64	O51A7_HUMAN	Q	232;232;221	ENSP00000352305:E232Q	ENSP00000352305:E232Q	E	+	1	0	OR51A7	4885869	0.058000	0.20735	0.794000	0.32065	0.318000	0.28184	2.564000	0.45931	2.519000	0.84933	0.655000	0.94253	GAG	OR51A7	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176895		0.473	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A7	HGNC	protein_coding	OTTHUMT00000142175.1	135	0.00	0	G	NM_001004749		4929293	4929293	+1	no_errors	ENST00000359350	ensembl	human	known	69_37n	missense	98	31.94	46	SNP	0.053	C
OR6A2	8590	genome.wustl.edu	37	11	6816236	6816236	+	Nonsense_Mutation	SNP	G	G	T	rs201451646	byFrequency	TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:6816236G>T	ENST00000332601.3	-	1	892	c.704C>A	c.(703-705)tCg>tAg	p.S235*		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	235					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TCCAGCAGCCGAAGGAATGTG	0.488																																						dbGAP											0													95.0	96.0	96.0					11																	6816236		2201	4296	6497	-	-	-	SO:0001587	stop_gained	0			AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.704C>A	11.37:g.6816236G>T	ENSP00000330384:p.Ser235*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJC7|Q6IF35|Q9H206	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S235*	ENST00000332601.3	37	c.704	CCDS7772.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.183094	0.94885	.	.	ENSG00000184933	ENST00000332601	.	.	.	5.07	5.07	0.68467	.	0.149707	0.31279	N	0.007936	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3566	0.83237	0.0:0.0:1.0:0.0	.	.	.	.	X	235	.	ENSP00000330384:S235X	S	-	2	0	OR6A2	6772812	0.028000	0.19301	0.594000	0.28785	0.892000	0.51952	1.991000	0.40727	2.809000	0.96659	0.655000	0.94253	TCG	OR6A2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000184933		0.488	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6A2	HGNC	protein_coding	OTTHUMT00000385981.1	37	0.00	0	G	NM_003696		6816236	6816236	-1	no_errors	ENST00000332601	ensembl	human	known	69_37n	nonsense	34	24.44	11	SNP	0.125	T
OR6C2	341416	genome.wustl.edu	37	12	55846936	55846936	+	Splice_Site	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:55846936G>C	ENST00000322678.1	+	1	939	c.939G>C	c.(937-939)taG>taC	p.*313Y	RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA	NM_054105.1	NP_473446.1	Q9NZP2	OR6C2_HUMAN	olfactory receptor, family 6, subfamily C, member 2	0					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(5)|lung(8)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	23						CAAAGAAGTAGAAGCTGTGAT	0.388																																						dbGAP											0													47.0	46.0	46.0					12																	55846936		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF179766	CCDS31824.1	12q13.2	2012-08-09				ENSG00000179695		"""GPCR / Class A : Olfactory receptors"""	15436	protein-coding gene	gene with protein product							Standard	NM_054105		Approved	OR6C67	uc001sgz.1	Q9NZP2	OTTHUMG00000169957	ENST00000322678.1:c.936+1G>C	12.37:g.55846936G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Nonstop_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.*313Y	ENST00000322678.1	37	c.939	CCDS31824.1	12	.	.	.	.	.	.	.	.	.	.	G	16.51	3.144248	0.57044	.	.	ENSG00000179695	ENST00000322678	.	.	.	5.56	-3.78	0.04333	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.267	0.06869	0.4438:0.1075:0.3426:0.1061	.	.	.	.	Y	313	.	.	X	+	3	2	OR6C2	54133203	0.000000	0.05858	0.000000	0.03702	0.783000	0.44284	-2.431000	0.01023	-1.027000	0.03325	0.604000	0.83254	TAG	OR6C2	-	NULL	ENSG00000179695		0.388	OR6C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C2	HGNC	protein_coding	OTTHUMT00000406676.1	86	0.00	0	G	NM_054105	Nonstop_Mutation	55846936	55846936	+1	no_errors	ENST00000322678	ensembl	human	known	69_37n	nonstop	56	12.50	8	SNP	0.000	C
PAFAH1B1	5048	genome.wustl.edu	37	17	2569362	2569362	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:2569362C>G	ENST00000397195.5	+	4	621	c.170C>G	c.(169-171)tCt>tGt	p.S57C	PAFAH1B1_ENST00000572915.2_Intron	NM_000430.3	NP_000421.1			platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)											endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|skin(1)	11						AAATGGACATCTGTTATTAGA	0.234																																						dbGAP											0													12.0	13.0	13.0					17																	2569362		2099	4189	6288	-	-	-	SO:0001583	missense	0			L25107	CCDS32528.1	17p13.3	2014-04-04	2010-02-10		ENSG00000007168	ENSG00000007168		"""WD repeat domain containing"""	8574	protein-coding gene	gene with protein product	"""lissencephaly-1"""	601545	"""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit (45kD)"", ""Miller-Dieker syndrome chromosome region"", ""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 1 (45kDa)"""	MDCR, MDS		8355785, 9063735	Standard	NM_000430		Approved	LIS1, PAFAH	uc002fuw.4	P43034	OTTHUMG00000177574	ENST00000397195.5:c.170C>G	17.37:g.2569362C>G	ENSP00000380378:p.Ser57Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,pirsf_Dynein_regulator,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S57C	ENST00000397195.5	37	c.170	CCDS32528.1	17	.	.	.	.	.	.	.	.	.	.	C	23.9	4.473653	0.84640	.	.	ENSG00000007168	ENST00000397195	D	0.86164	-2.08	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.95079	0.8406	M	0.93062	3.375	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	D	0.95890	0.8906	10	0.87932	D	0	.	18.0454	0.89330	0.0:1.0:0.0:0.0	.	57	P43034	LIS1_HUMAN	C	57	ENSP00000380378:S57C	ENSP00000380378:S57C	S	+	2	0	PAFAH1B1	2516112	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.392000	0.79840	2.668000	0.90789	0.650000	0.86243	TCT	PAFAH1B1	-	pirsf_Dynein_regulator	ENSG00000007168		0.234	PAFAH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAFAH1B1	HGNC	protein_coding	OTTHUMT00000437797.2	99	0.00	0	C	NM_000430		2569362	2569362	+1	no_errors	ENST00000397195	ensembl	human	known	69_37n	missense	16	38.46	10	SNP	1.000	G
PAOX	196743	genome.wustl.edu	37	10	135194991	135194991	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:135194991G>A	ENST00000278060.5	+	3	779	c.696G>A	c.(694-696)atG>atA	p.M232I	PAOX_ENST00000368539.4_Silent_p.*70*|PAOX_ENST00000357296.3_Missense_Mutation_p.M232I|PAOX_ENST00000480071.2_Missense_Mutation_p.M232I|AL360181.1_ENST00000597657.1_5'Flank|PAOX_ENST00000368535.2_3'UTR	NM_152911.2	NP_690875.1	Q6QHF9	PAOX_HUMAN	polyamine oxidase (exo-N4-amino)	370					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|positive regulation of spermidine biosynthetic process (GO:1901307)|putrescine biosynthetic process (GO:0009446)|putrescine catabolic process (GO:0009447)|small molecule metabolic process (GO:0044281)|spermidine catabolic process (GO:0046203)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	peroxisomal matrix (GO:0005782)	N(1),N(12)-diacetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052899)|N1-acetylspermidine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052904)|N1-acetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052903)|polyamine oxidase activity (GO:0046592)|receptor binding (GO:0005102)|spermidine:oxygen oxidoreductase (3-aminopropanal-forming) activity (GO:0052902)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|urinary_tract(2)	23		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		CAAACTGCATGATGGCCGCCC	0.572																																						dbGAP											0													79.0	69.0	72.0					10																	135194991		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032778	CCDS7682.1, CCDS7683.1, CCDS7684.1	10q26.3	2003-11-13			ENSG00000148832	ENSG00000148832			20837	protein-coding gene	gene with protein product		615853				12660232	Standard	NM_207127		Approved	PAO	uc001lmv.3	Q6QHF9	OTTHUMG00000019318	ENST00000278060.5:c.696G>A	10.37:g.135194991G>A	ENSP00000278060:p.Met232Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DXI6|Q5VWY0|Q6QHF5|Q6QHF6|Q6QHF7|Q6QHF8|Q6QHG0|Q6QHG1|Q6QHG2|Q6QHG3|Q6QHG4|Q6QHG5|Q6QHG6|Q86WP9|Q8N555|Q8NCX3	Missense_Mutation	SNP	pfam_Amino_oxidase	p.M232I	ENST00000278060.5	37	c.696	CCDS7683.1	10	.	.	.	.	.	.	.	.	.	.	G	0.987	-0.695305	0.03303	.	.	ENSG00000148832	ENST00000368542;ENST00000278060;ENST00000357296;ENST00000480071	T;T;T	0.08896	3.04;3.04;3.04	4.76	-7.57	0.01318	.	0.400654	0.27223	N	0.020349	T	0.02193	0.0068	N	0.02420	-0.555	0.19575	N	0.999968	B;B;B	0.10296	0.002;0.003;0.0	B;B;B	0.11329	0.003;0.006;0.002	T	0.33420	-0.9869	10	0.29301	T	0.29	-4.0179	7.8226	0.29296	0.2335:0.3696:0.3969:0.0	.	232;232;232	Q6QHF9-5;Q6QHF9-4;Q6QHF9-2	.;.;.	I	232	ENSP00000278060:M232I;ENSP00000349847:M232I;ENSP00000435514:M232I	ENSP00000278060:M232I	M	+	3	0	PAOX	135044981	0.070000	0.21116	0.000000	0.03702	0.070000	0.16714	0.038000	0.13862	-1.422000	0.02004	-0.346000	0.07831	ATG	PAOX	-	pfam_Amino_oxidase	ENSG00000148832		0.572	PAOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAOX	HGNC	protein_coding	OTTHUMT00000051146.2	25	0.00	0	G	NM_152911		135194991	135194991	+1	no_errors	ENST00000278060	ensembl	human	known	69_37n	missense	34	39.66	23	SNP	0.002	A
PCCA	5095	genome.wustl.edu	37	13	100915005	100915005	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr13:100915005C>G	ENST00000376285.1	+	10	777	c.739C>G	c.(739-741)Caa>Gaa	p.Q247E	PCCA_ENST00000376279.3_Missense_Mutation_p.Q247E|PCCA_ENST00000376286.4_Missense_Mutation_p.Q221E	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	247	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	ATTGTCATCTCAAGAAGCTGC	0.418																																						dbGAP											0													116.0	131.0	126.0					13																	100915005		2203	4298	6501	-	-	-	SO:0001583	missense	0			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.739C>G	13.37:g.100915005C>G	ENSP00000365462:p.Gln247Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_Biotin_lipoyl	p.Q247E	ENST00000376285.1	37	c.739	CCDS9496.2	13	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638542	0.47153	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	D;D;D	0.97575	-4.44;-4.44;-4.44	5.12	5.12	0.69794	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.000000	0.85682	D	0.000000	D	0.93766	0.8007	N	0.21373	0.66	0.80722	D	1	B;B;B	0.13145	0.007;0.006;0.007	B;B;B	0.15484	0.013;0.008;0.013	D	0.90191	0.4250	10	0.33940	T	0.23	.	18.5495	0.91058	0.0:1.0:0.0:0.0	.	247;221;247	C9JPQ8;P05165-2;P05165	.;.;PCCA_HUMAN	E	221;247;247	ENSP00000365463:Q221E;ENSP00000365456:Q247E;ENSP00000365462:Q247E	ENSP00000365456:Q247E	Q	+	1	0	PCCA	99713006	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.175000	0.77632	2.358000	0.79984	0.655000	0.94253	CAA	PCCA	-	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_carboxylate-amine,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom	ENSG00000175198		0.418	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCCA	HGNC	protein_coding	OTTHUMT00000045627.2	157	0.00	0	C			100915005	100915005	+1	no_errors	ENST00000376285	ensembl	human	known	69_37n	missense	46	22.03	13	SNP	1.000	G
PCDHGB1	56104	genome.wustl.edu	37	5	140730032	140730032	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:140730032G>A	ENST00000523390.1	+	1	205	c.205G>A	c.(205-207)Gag>Aag	p.E69K	PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	69	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTTAGTGCAGAGGATTATTT	0.512											OREG0016856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													93.0	90.0	91.0					5																	140730032		1875	4097	5972	-	-	-	SO:0001583	missense	0			AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.205G>A	5.37:g.140730032G>A	ENSP00000429273:p.Glu69Lys	Somatic	1658	WXS	Illumina GAIIx	Phase_IV	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E69K	ENST00000523390.1	37	c.205	CCDS54923.1	5	.	.	.	.	.	.	.	.	.	.	.	17.16	3.317874	0.60524	.	.	ENSG00000254221	ENST00000523390	T	0.38722	1.12	5.52	3.64	0.41730	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.47600	0.1454	L	0.37507	1.11	0.25091	N	0.990852	D;P	0.61697	0.99;0.935	D;P	0.64237	0.923;0.824	T	0.30765	-0.9967	9	0.18276	T	0.48	.	10.3884	0.44154	0.0768:0.1333:0.79:0.0	.	69;69	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	K	69	ENSP00000429273:E69K	ENSP00000429273:E69K	E	+	1	0	PCDHGB1	140710216	0.027000	0.19231	0.975000	0.42487	0.986000	0.74619	0.312000	0.19397	0.725000	0.32318	0.563000	0.77884	GAG	PCDHGB1	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254221		0.512	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB1	HGNC	protein_coding	OTTHUMT00000374740.1	130	0.76	1	G	NM_018922		140730032	140730032	+1	no_errors	ENST00000523390	ensembl	human	known	69_37n	missense	100	30.56	44	SNP	0.994	A
PDZD2	23037	genome.wustl.edu	37	5	32000267	32000267	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:32000267G>A	ENST00000438447.1	+	5	1532	c.1144G>A	c.(1144-1146)Gat>Aat	p.D382N	PDZD2_ENST00000282493.3_Missense_Mutation_p.D382N			O15018	PDZD2_HUMAN	PDZ domain containing 2	382	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.D382Y(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GTCCTTAGGAGATGAGCTGCT	0.547																																						dbGAP											1	Substitution - Missense(1)	lung(1)											98.0	88.0	91.0					5																	32000267		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.1144G>A	5.37:g.32000267G>A	ENSP00000402033:p.Asp382Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D382N	ENST00000438447.1	37	c.1144	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146384	0.77888	.	.	ENSG00000133401	ENST00000438447;ENST00000282493	T;T	0.74002	-0.8;-0.8	5.55	5.55	0.83447	PDZ/DHR/GLGF (4);	0.272836	0.26307	N	0.025125	D	0.92185	0.7522	H	0.98996	4.395	0.51767	D	0.999938	D;D	0.89917	0.994;1.0	D;D	0.97110	0.925;1.0	D	0.95046	0.8182	10	0.87932	D	0	.	17.0708	0.86573	0.0:0.0:1.0:0.0	.	208;382	B4E3P2;O15018	.;PDZD2_HUMAN	N	382	ENSP00000402033:D382N;ENSP00000282493:D382N	ENSP00000282493:D382N	D	+	1	0	PDZD2	32036024	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.941000	0.92964	2.618000	0.88619	0.555000	0.69702	GAT	PDZD2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000133401		0.547	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	59	0.00	0	G			32000267	32000267	+1	no_errors	ENST00000282493	ensembl	human	known	69_37n	missense	103	20.16	26	SNP	1.000	A
PDE8B	8622	genome.wustl.edu	37	5	76700558	76700558	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:76700558C>T	ENST00000264917.5	+	12	1269	c.1224C>T	c.(1222-1224)ttC>ttT	p.F408F	PDE8B_ENST00000342343.4_Silent_p.F388F|PDE8B_ENST00000346042.3_Silent_p.F311F|PDE8B_ENST00000333194.4_Silent_p.F408F|PDE8B_ENST00000340978.3_Silent_p.F361F	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	408					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)		GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	CTCATTCATTCAGATATAAGA	0.358																																						dbGAP											0													84.0	85.0	85.0					5																	76700558		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.1224C>T	5.37:g.76700558C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_PDE8,pfam_Sig_transdc_resp-reg_receiver,pfam_PAS_fold,pfam_PAS_4,pfam_PAS_fold_3,superfamily_CheY-like_superfamily,smart_PAS,smart_HD/PDEase_dom,prints_PDEase,pfscan_PAS,tigrfam_PAS	p.F408	ENST00000264917.5	37	c.1224	CCDS4037.1	5																																																																																			PDE8B	-	NULL	ENSG00000113231		0.358	PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE8B	HGNC	protein_coding	OTTHUMT00000220015.3	146	0.00	0	C	NM_003719		76700558	76700558	+1	no_errors	ENST00000264917	ensembl	human	known	69_37n	silent	77	20.62	20	SNP	0.992	T
PCDHGB6	56100	genome.wustl.edu	37	5	140790173	140790173	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:140790173G>C	ENST00000520790.1	+	1	2404	c.2404G>C	c.(2404-2406)Gag>Cag	p.E802Q	PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA10_ENST00000398610.2_5'Flank|PCDHGA4_ENST00000571252.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	802					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCACATCCTGAGACTCTGAC	0.398																																						dbGAP											0													96.0	99.0	98.0					5																	140790173		1989	4164	6153	-	-	-	SO:0001583	missense	0			AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.2404G>C	5.37:g.140790173G>C	ENSP00000428603:p.Glu802Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5C5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E802Q	ENST00000520790.1	37	c.2404	CCDS54929.1	5	.	.	.	.	.	.	.	.	.	.	g	13.35	2.210244	0.39003	.	.	ENSG00000253305	ENST00000520790	T	0.49720	0.77	5.2	2.35	0.29111	.	.	.	.	.	T	0.26304	0.0642	N	0.08118	0	0.09310	N	1	B;B	0.16603	0.018;0.017	B;B	0.15052	0.004;0.012	T	0.18053	-1.0349	9	0.35671	T	0.21	.	8.9219	0.35617	0.1489:0.1254:0.7258:0.0	.	802;802	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	Q	802	ENSP00000428603:E802Q	ENSP00000428603:E802Q	E	+	1	0	PCDHGB6	140770357	0.550000	0.26489	0.740000	0.30986	0.415000	0.31203	1.651000	0.37302	0.664000	0.31047	0.563000	0.77884	GAG	PCDHGB6	-	NULL	ENSG00000253305		0.398	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB6	HGNC	protein_coding	OTTHUMT00000374746.1	148	0.00	0	G	NM_018926		140790173	140790173	+1	no_errors	ENST00000520790	ensembl	human	known	69_37n	missense	104	18.75	24	SNP	0.195	C
PEF1	553115	genome.wustl.edu	37	1	32098889	32098889	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:32098889C>T	ENST00000373703.4	-	3	374	c.352G>A	c.(352-354)Gag>Aag	p.E118K	PEF1_ENST00000492061.1_5'UTR	NM_012392.3	NP_036524.1	Q9UBV8	PEF1_HUMAN	penta-EF-hand domain containing 1	118	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				proteolysis (GO:0006508)|response to calcium ion (GO:0051592)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|poly(A) RNA binding (GO:0044822)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)	7		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)|all_neural(195;0.186)		STAD - Stomach adenocarcinoma(196;0.0546)		GAGTAGGCCTCAGGATCCACA	0.552											OREG0013316	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													47.0	45.0	46.0					1																	32098889		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS345.1	1p34	2013-01-10			ENSG00000162517	ENSG00000162517		"""EF-hand domain containing"""	30009	protein-coding gene	gene with protein product	"""peflin"""	610033				10486255, 11883899	Standard	NM_012392		Approved	PEF1A	uc001bth.2	Q9UBV8	OTTHUMG00000003877	ENST00000373703.4:c.352G>A	1.37:g.32098889C>T	ENSP00000362807:p.Glu118Lys	Somatic	829	WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.E118K	ENST00000373703.4	37	c.352	CCDS345.1	1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.204922	0.79127	.	.	ENSG00000162517	ENST00000373703	D	0.91068	-2.78	4.46	4.46	0.54185	.	0.246287	0.42821	D	0.000644	D	0.88934	0.6572	L	0.51914	1.62	0.80722	D	1	P	0.36909	0.573	B	0.40602	0.334	D	0.87466	0.2411	10	0.29301	T	0.29	.	16.7395	0.85455	0.0:1.0:0.0:0.0	.	118	Q9UBV8	PEF1_HUMAN	K	118	ENSP00000362807:E118K	ENSP00000362807:E118K	E	-	1	0	PEF1	31871476	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.358000	0.79466	2.418000	0.82041	0.561000	0.74099	GAG	PEF1	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000162517		0.552	PEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEF1	HGNC	protein_coding	OTTHUMT00000011046.1	24	0.00	0	C	NM_012392		32098889	32098889	-1	no_errors	ENST00000373703	ensembl	human	known	69_37n	missense	30	37.50	18	SNP	1.000	T
PELI2	57161	genome.wustl.edu	37	14	56757079	56757079	+	Missense_Mutation	SNP	G	G	A	rs557894615		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr14:56757079G>A	ENST00000267460.4	+	5	887	c.601G>A	c.(601-603)Gag>Aag	p.E201K		NM_021255.2	NP_067078.1	Q9HAT8	PELI2_HUMAN	pellino E3 ubiquitin protein ligase family member 2	201	FHA; atypical.				innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein phosphorylation (GO:0001934)|protein ubiquitination (GO:0016567)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)	ligase activity (GO:0016874)			kidney(6)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	22						GGGCTTCACCGAGGAGTCCCA	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		15959	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													95.0	101.0	99.0					14																	56757079		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF302502	CCDS9726.1	14q21	2012-02-23	2012-02-23		ENSG00000139946	ENSG00000139946		"""Pellino homologs"""	8828	protein-coding gene	gene with protein product		614798	"""pellino (Drosophila) homolog 2"", ""pellino homolog 2 (Drosophila)"""			11306823, 12860405	Standard	XM_006720211		Approved		uc001xch.3	Q9HAT8	OTTHUMG00000152336	ENST00000267460.4:c.601G>A	14.37:g.56757079G>A	ENSP00000267460:p.Glu201Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDY5	Missense_Mutation	SNP	pfam_Pellino	p.E201K	ENST00000267460.4	37	c.601	CCDS9726.1	14	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241308	0.58995	.	.	ENSG00000139946	ENST00000267460	T	0.51574	0.7	5.51	5.51	0.81932	.	0.095404	0.64402	D	0.000001	T	0.45438	0.1342	M	0.70595	2.14	0.47621	D	0.999477	P	0.38767	0.646	B	0.32465	0.146	T	0.48186	-0.9057	10	0.09338	T	0.73	-24.5572	19.4226	0.94727	0.0:0.0:1.0:0.0	.	201	Q9HAT8	PELI2_HUMAN	K	201	ENSP00000267460:E201K	ENSP00000267460:E201K	E	+	1	0	PELI2	55826832	1.000000	0.71417	0.969000	0.41365	0.930000	0.56654	3.208000	0.51114	2.598000	0.87819	0.561000	0.74099	GAG	PELI2	-	pfam_Pellino	ENSG00000139946		0.592	PELI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PELI2	HGNC	protein_coding	OTTHUMT00000276925.1	33	0.00	0	G			56757079	56757079	+1	no_errors	ENST00000267460	ensembl	human	known	69_37n	missense	68	13.92	11	SNP	0.978	A
PEX10	5192	genome.wustl.edu	37	1	2340225	2340225	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:2340225G>A	ENST00000447513.2	-	3	334	c.266C>T	c.(265-267)tCg>tTg	p.S89L	PEX10_ENST00000507596.1_Missense_Mutation_p.S89L|PEX10_ENST00000288774.3_Missense_Mutation_p.S89L|PEX10_ENST00000515760.1_5'UTR	NM_002617.3	NP_002608.1	O60683	PEX10_HUMAN	peroxisomal biogenesis factor 10	89					peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	integral component of peroxisomal membrane (GO:0005779)|intracellular (GO:0005622)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(2)	7	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00102)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0169)|Lung(427;0.199)		ACGGCGCAGCGAGGAGGGCAC	0.652																																					GBM(12;9 508 1649 13619)	dbGAP											0													107.0	107.0	107.0					1																	2340225		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF060502	CCDS41.1, CCDS44045.1	1p36.32	2013-01-09	2008-08-26		ENSG00000157911	ENSG00000157911		"""RING-type (C3HC4) zinc fingers"""	8851	protein-coding gene	gene with protein product		602859	"""peroxisome biogenesis factor 10"""			9683594	Standard	NM_002617		Approved	RNF69	uc001ajg.3	O60683	OTTHUMG00000001637	ENST00000447513.2:c.266C>T	1.37:g.2340225G>A	ENSP00000407922:p.Ser89Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWD8|Q5T095|Q9BW90	Missense_Mutation	SNP	pfam_Pex_N,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.S89L	ENST00000447513.2	37	c.266	CCDS44045.1	1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.772871	0.00640	.	.	ENSG00000157911	ENST00000288774;ENST00000447513;ENST00000507596	D;D;D	0.82081	-1.57;-1.57;-1.57	4.62	0.505	0.16953	Pex, N-terminal (1);	0.914831	0.09603	N	0.779984	T	0.47060	0.1425	N	0.00554	-1.385	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.42430	-0.9452	10	0.11485	T	0.65	-3.2133	1.6177	0.02707	0.3905:0.3221:0.1231:0.1644	.	89;89	O60683;O60683-2	PEX10_HUMAN;.	L	89	ENSP00000288774:S89L;ENSP00000407922:S89L;ENSP00000424291:S89L	ENSP00000288774:S89L	S	-	2	0	PEX10	2330085	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.027000	0.12371	-0.158000	0.11040	-2.750000	0.00124	TCG	PEX10	-	pfam_Pex_N	ENSG00000157911		0.652	PEX10-002	KNOWN	basic|CCDS	protein_coding	PEX10	HGNC	protein_coding	OTTHUMT00000367454.1	11	0.00	0	G	NM_153818		2340225	2340225	-1	no_errors	ENST00000288774	ensembl	human	known	69_37n	missense	43	28.33	17	SNP	0.000	A
PHACTR4	65979	genome.wustl.edu	37	1	28800206	28800206	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:28800206G>A	ENST00000373839.3	+	7	1225	c.964G>A	c.(964-966)Gaa>Aaa	p.E322K	PHACTR4_ENST00000493669.1_3'UTR|PHACTR4_ENST00000373836.3_Missense_Mutation_p.E332K	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	322	Pro-rich.				actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		ACCAAGTGATGAAAGAGAGAA	0.527																																						dbGAP											0													168.0	172.0	171.0					1																	28800206		2094	4219	6313	-	-	-	SO:0001583	missense	0			AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.964G>A	1.37:g.28800206G>A	ENSP00000362945:p.Glu322Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Missense_Mutation	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.E332K	ENST00000373839.3	37	c.994	CCDS41293.1	1	.	.	.	.	.	.	.	.	.	.	G	7.959	0.746593	0.15710	.	.	ENSG00000204138	ENST00000373839;ENST00000373836;ENST00000373838	T;T	0.21543	2.0;2.0	5.74	4.82	0.62117	.	2.124000	0.01799	N	0.032764	T	0.13543	0.0328	N	0.08118	0	0.19775	N	0.999959	B;B	0.11235	0.004;0.002	B;B	0.12156	0.007;0.006	T	0.30475	-0.9977	10	0.06494	T	0.89	-1.7755	12.2661	0.54679	0.1315:0.7379:0.1306:0.0	.	332;322	Q8IZ21-2;Q8IZ21	.;PHAR4_HUMAN	K	322;332;321	ENSP00000362945:E322K;ENSP00000362942:E332K	ENSP00000362942:E332K	E	+	1	0	PHACTR4	28672793	0.999000	0.42202	1.000000	0.80357	0.757000	0.42996	1.138000	0.31491	1.426000	0.47256	-0.153000	0.13522	GAA	PHACTR4	-	NULL	ENSG00000204138		0.527	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHACTR4	HGNC	protein_coding	OTTHUMT00000009868.4	125	0.00	0	G	NM_023923		28800206	28800206	+1	no_errors	ENST00000373836	ensembl	human	known	69_37n	missense	110	26.49	40	SNP	0.999	A
PIAS2	9063	genome.wustl.edu	37	18	44409752	44409752	+	Missense_Mutation	SNP	C	C	T	rs369021708		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr18:44409752C>T	ENST00000585916.1	-	10	1280	c.1281G>A	c.(1279-1281)atG>atA	p.M427I	PIAS2_ENST00000324794.7_Missense_Mutation_p.M427I|PIAS2_ENST00000545673.1_Missense_Mutation_p.M137I	NM_004671.3	NP_004662.2	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT, 2	427					androgen receptor signaling pathway (GO:0030521)|negative regulation of androgen receptor signaling pathway (GO:0060766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|regulation of osteoblast differentiation (GO:0045667)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	22						TCTTCGGTCTCATTGGACACC	0.378																																						dbGAP											0													216.0	218.0	218.0					18																	44409752		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF077953	CCDS32824.1, CCDS32825.1	18q12.1-q12.3	2011-10-11				ENSG00000078043		"""Zinc fingers, MIZ-type"""	17311	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 4"""	603567				9724754, 9256341	Standard	NM_004671		Approved	PIASX-BETA, miz, PIASX-ALPHA, ZMIZ4	uc002lck.3	O75928		ENST00000585916.1:c.1281G>A	18.37:g.44409752C>T	ENSP00000465676:p.Met427Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O75927|Q96BT5|Q96KE3	Missense_Mutation	SNP	pfam_Znf_MIZ,smart_SAP_DNA-bd,pfscan_Znf_MIZ,pfscan_SAP_DNA-bd	p.M427I	ENST00000585916.1	37	c.1281	CCDS32824.1	18	.	.	.	.	.	.	.	.	.	.	C	16.08	3.022817	0.54683	.	.	ENSG00000078043	ENST00000398654;ENST00000262161;ENST00000545673;ENST00000324794	T;T	0.41758	0.99;1.58	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.38214	0.1032	L	0.35542	1.07	0.80722	D	1	B;B;B;B	0.18610	0.01;0.004;0.003;0.029	B;B;B;B	0.22753	0.007;0.004;0.01;0.041	T	0.08513	-1.0718	10	0.37606	T	0.19	-15.8775	19.7762	0.96393	0.0:1.0:0.0:0.0	.	137;427;427;427	B4DGW0;Q2TA77;O75928-2;O75928	.;.;.;PIAS2_HUMAN	I	427;427;137;427	ENSP00000443238:M137I;ENSP00000317163:M427I	ENSP00000262161:M427I	M	-	3	0	PIAS2	42663750	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.664000	0.90586	0.557000	0.71058	ATG	PIAS2	-	NULL	ENSG00000078043		0.378	PIAS2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS2	HGNC	protein_coding	OTTHUMT00000445656.2	178	0.00	0	C	NM_004671		44409752	44409752	-1	no_errors	ENST00000585916	ensembl	human	known	69_37n	missense	111	24.49	36	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	130	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	39	36.07	22	SNP	1.000	A
PKHD1L1	93035	genome.wustl.edu	37	8	110400725	110400725	+	Splice_Site	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr8:110400725G>A	ENST00000378402.5	+	7	673		c.e7-1			NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1						immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TATTTGTACAGAGTTTACATT	0.284										HNSCC(38;0.096)																												dbGAP											0													24.0	22.0	23.0					8																	110400725		1694	3784	5478	-	-	-	SO:0001630	splice_region_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.570-1G>A	8.37:g.110400725G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Splice_Site	SNP	-	e7-1	ENST00000378402.5	37	c.570-1	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	21.6	4.174849	0.78564	.	.	ENSG00000205038	ENST00000378402	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5426	0.84406	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PKHD1L1	110469901	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.003000	0.76310	2.495000	0.84180	0.655000	0.94253	.	PKHD1L1	-	-	ENSG00000205038		0.284	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	97	0.00	0	G	NM_177531	Intron	110400725	110400725	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	splice_site	71	13.41	11	SNP	1.000	A
PLEKHA5	54477	genome.wustl.edu	37	12	19467754	19467754	+	Intron	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:19467754G>C	ENST00000299275.6	+	13	1851				PLEKHA5_ENST00000359180.3_Intron|PLEKHA5_ENST00000543806.1_Missense_Mutation_p.E510Q|PLEKHA5_ENST00000538714.1_Intron|PLEKHA5_ENST00000539256.1_Intron|PLEKHA5_ENST00000429027.2_Missense_Mutation_p.E682Q|PLEKHA5_ENST00000424268.1_Missense_Mutation_p.E510Q|PLEKHA5_ENST00000355397.3_Intron|PLEKHA5_ENST00000317589.4_Intron	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5						reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					ATAGATGAAAGAAAATGAACC	0.388																																					Pancreas(196;329 2193 11246 14234 19524)	dbGAP											0													129.0	109.0	115.0					12																	19467754		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.1846-5742G>C	12.37:g.19467754G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E510Q	ENST00000299275.6	37	c.1528	CCDS8682.1	12	.	.	.	.	.	.	.	.	.	.	G	24.5	4.542662	0.85917	.	.	ENSG00000052126	ENST00000542828;ENST00000429027;ENST00000424268;ENST00000543806	T;T;T	0.29917	1.55;2.4;2.4	5.32	5.32	0.75619	.	.	.	.	.	T	0.55449	0.1921	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.71870	0.975;0.946;0.946	T	0.51325	-0.8720	8	0.34782	T	0.22	.	18.9962	0.92813	0.0:0.0:1.0:0.0	.	510;510;682	F5H0I0;E7EME8;B4DHK5	.;.;.	Q	683;682;510;510	ENSP00000404296:E682Q;ENSP00000400411:E510Q;ENSP00000439837:E510Q	ENSP00000400411:E510Q	E	+	1	0	PLEKHA5	19359021	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.080000	0.94040	2.487000	0.83934	0.643000	0.83706	GAA	PLEKHA5	-	NULL	ENSG00000052126		0.388	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA5	HGNC	protein_coding	OTTHUMT00000397013.1	77	0.00	0	G	NM_019012		19467754	19467754	+1	no_errors	ENST00000424268	ensembl	human	known	69_37n	missense	107	13.01	16	SNP	1.000	C
PLEKHH2	130271	genome.wustl.edu	37	2	43934621	43934621	+	Missense_Mutation	SNP	C	C	G	rs377250307		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:43934621C>G	ENST00000282406.4	+	11	2013	c.1903C>G	c.(1903-1905)Cgg>Ggg	p.R635G		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	635	Ser-rich.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ATCCAGCTCCCGGACGTCAGA	0.537																																						dbGAP											0													82.0	87.0	85.0					2																	43934621		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.1903C>G	2.37:g.43934621C>G	ENSP00000282406:p.Arg635Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.R635G	ENST00000282406.4	37	c.1903	CCDS1812.1	2	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673729	0.47781	.	.	ENSG00000152527	ENST00000282406	T	0.12672	2.66	4.87	3.99	0.46301	.	0.425860	0.23583	N	0.046637	T	0.11281	0.0275	L	0.39898	1.24	0.39917	D	0.974104	B;P;P	0.43701	0.041;0.491;0.815	B;B;B	0.38378	0.021;0.202;0.272	T	0.07712	-1.0758	10	0.52906	T	0.07	-3.0534	9.1588	0.37009	0.1545:0.7661:0.0:0.0794	.	635;72;635	Q8IVE3;Q8IVE3-2;Q8IVE3-3	PKHH2_HUMAN;.;.	G	635	ENSP00000282406:R635G	ENSP00000282406:R635G	R	+	1	2	PLEKHH2	43788125	0.939000	0.31865	0.964000	0.40570	0.851000	0.48451	2.035000	0.41155	1.281000	0.44480	0.460000	0.39030	CGG	PLEKHH2	-	NULL	ENSG00000152527		0.537	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH2	HGNC	protein_coding	OTTHUMT00000250537.1	65	0.00	0	C	NM_172069		43934621	43934621	+1	no_errors	ENST00000282406	ensembl	human	known	69_37n	missense	83	15.31	15	SNP	0.998	G
PLXNA4	91584	genome.wustl.edu	37	7	132193072	132193072	+	Silent	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:132193072C>G	ENST00000359827.3	-	2	1343	c.381G>C	c.(379-381)ctG>ctC	p.L127L	PLXNA4_ENST00000321063.4_Silent_p.L127L|PLXNA4_ENST00000378539.5_Silent_p.L127L|PLXNA4_ENST00000423507.2_Silent_p.L127L			Q9HCM2	PLXA4_HUMAN	plexin A4	127	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CACAGGCAATCAGCCTGTTCT	0.537																																						dbGAP											0													59.0	56.0	57.0					7																	132193072		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.381G>C	7.37:g.132193072C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.L127	ENST00000359827.3	37	c.381	CCDS43646.1	7																																																																																			PLXNA4	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000221866		0.537	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	22	0.00	0	C	NM_181775		132193072	132193072	-1	no_errors	ENST00000321063	ensembl	human	known	69_37n	silent	49	16.95	10	SNP	0.998	G
PMFBP1	83449	genome.wustl.edu	37	16	72166725	72166725	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:72166725C>T	ENST00000237353.10	-	10	1630	c.1369G>A	c.(1369-1371)Gag>Aag	p.E457K	PMFBP1_ENST00000537465.1_Missense_Mutation_p.E457K|PMFBP1_ENST00000355636.6_Missense_Mutation_p.E312K	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	457						cytoplasm (GO:0005737)		p.E457Q(1)		NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				GCCTTGCACTCCGCCTCCTTG	0.577																																						dbGAP											1	Substitution - Missense(1)	lung(1)											158.0	126.0	137.0					16																	72166725		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.1369G>A	16.37:g.72166725C>T	ENSP00000237353:p.Glu457Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	NULL	p.E457K	ENST00000237353.10	37	c.1369	CCDS32483.1	16	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972653	0.53614	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000355636	T;T;T	0.16324	2.36;2.37;2.35	4.51	3.51	0.40186	.	1.516960	0.04144	N	0.320168	T	0.17831	0.0428	L	0.29908	0.895	0.09310	N	1	P;P;P	0.44139	0.728;0.827;0.728	B;B;B	0.40982	0.23;0.345;0.23	T	0.33701	-0.9858	10	0.72032	D	0.01	-3.925	11.7546	0.51868	0.0:0.8228:0.1772:0.0	.	457;457;457	Q8TBY8;Q8TBY8-2;G3V1Q7	PMFBP_HUMAN;.;.	K	457;457;312	ENSP00000443817:E457K;ENSP00000237353:E457K;ENSP00000347854:E312K	ENSP00000237353:E457K	E	-	1	0	PMFBP1	70724226	0.029000	0.19370	0.019000	0.16419	0.236000	0.25371	1.129000	0.31381	2.060000	0.61445	0.561000	0.74099	GAG	PMFBP1	-	NULL	ENSG00000118557		0.577	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PMFBP1	HGNC	protein_coding	OTTHUMT00000396473.2	45	0.00	0	C	NM_031293		72166725	72166725	-1	no_errors	ENST00000537465	ensembl	human	known	69_37n	missense	71	27.55	27	SNP	0.061	T
PNLDC1	154197	genome.wustl.edu	37	6	160240082	160240082	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:160240082G>C	ENST00000610273.1	+	17	1500	c.1329G>C	c.(1327-1329)caG>caC	p.Q443H	PNLDC1_ENST00000392167.3_Missense_Mutation_p.Q454H	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	443						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		ATAAGTTTCAGAATCTCTGCA	0.507																																						dbGAP											0													103.0	100.0	101.0					6																	160240082		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1329G>C	6.37:g.160240082G>C	ENSP00000476448:p.Gln443His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TAP7|Q8N7X5	Missense_Mutation	SNP	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	p.Q443H	ENST00000610273.1	37	c.1329	CCDS5271.1	6	.	.	.	.	.	.	.	.	.	.	G	6.599	0.478892	0.12581	.	.	ENSG00000146453	ENST00000275275;ENST00000392167	.	.	.	4.57	3.67	0.42095	.	0.122950	0.37012	N	0.002300	T	0.19725	0.0474	N	0.24115	0.695	0.09310	N	1	D;P	0.59767	0.986;0.947	P;P	0.54100	0.742;0.453	T	0.02933	-1.1092	9	0.45353	T	0.12	.	8.7479	0.34598	0.2099:0.0:0.7901:0.0	.	454;443	Q8NA58-2;Q8NA58	.;PNDC1_HUMAN	H	443;454	.	ENSP00000275275:Q443H	Q	+	3	2	PNLDC1	160160072	0.987000	0.35691	0.997000	0.53966	0.046000	0.14306	1.297000	0.33400	2.360000	0.80028	0.462000	0.41574	CAG	PNLDC1	-	NULL	ENSG00000146453		0.507	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	PNLDC1	HGNC	protein_coding		103	0.00	0	G	NM_173516		160240082	160240082	+1	no_errors	ENST00000275275	ensembl	human	known	69_37n	missense	84	20.75	22	SNP	0.108	C
POLR3A	11128	genome.wustl.edu	37	10	79745020	79745020	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:79745020C>T	ENST00000372371.3	-	24	3287	c.3150G>A	c.(3148-3150)ctG>ctA	p.L1050L		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	1050					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			GGAAAGTCTTCAGGGTCATCT	0.567																																						dbGAP											0													144.0	141.0	142.0					10																	79745020		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.3150G>A	10.37:g.79745020C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW34|Q8TCW5	Silent	SNP	pfam_RNA_pol_Rpb1_1,pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,smart_RNA_pol_N	p.L1050	ENST00000372371.3	37	c.3150	CCDS7354.1	10																																																																																			POLR3A	-	pfam_RNA_pol_Rpb1_5	ENSG00000148606		0.567	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3A	HGNC	protein_coding	OTTHUMT00000048923.1	30	0.00	0	C	NM_007055		79745020	79745020	-1	no_errors	ENST00000372371	ensembl	human	known	69_37n	silent	341	14.11	56	SNP	1.000	T
POM121	9883	genome.wustl.edu	37	7	72414040	72414040	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:72414040G>A	ENST00000434423.2	+	11	3508	c.3508G>A	c.(3508-3510)Gag>Aag	p.E1170K	POM121_ENST00000358357.3_Missense_Mutation_p.E905K|POM121_ENST00000446813.1_Missense_Mutation_p.E905K|POM121_ENST00000257622.4_Missense_Mutation_p.E905K|POM121_ENST00000395270.1_Missense_Mutation_p.E905K			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	1170	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				CAGCACAACTGAGAGCAAACC	0.627																																						dbGAP											0													42.0	42.0	42.0					7																	72414040		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.3508G>A	7.37:g.72414040G>A	ENSP00000405562:p.Glu1170Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	NULL	p.E1170K	ENST00000434423.2	37	c.3508		7	.	.	.	.	.	.	.	.	.	.	G	5.301	0.240985	0.10077	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.06687	3.27;3.27;3.27;3.27;3.49	3.01	3.01	0.34805	.	0.373117	0.19282	N	0.118129	T	0.07593	0.0191	L	0.50333	1.59	0.09310	N	1	P;P	0.40731	0.728;0.557	B;B	0.36186	0.219;0.117	T	0.24476	-1.0159	10	0.36615	T	0.2	.	7.8734	0.29580	0.1287:0.0:0.8713:0.0	.	905;1170	A8MXF9;Q96HA1	.;P121A_HUMAN	K	905;905;905;905;1170	ENSP00000393020:E905K;ENSP00000257622:E905K;ENSP00000378687:E905K;ENSP00000351124:E905K;ENSP00000405562:E1170K	ENSP00000257622:E905K	E	+	1	0	POM121	72051976	0.998000	0.40836	0.135000	0.22099	0.005000	0.04900	3.941000	0.56607	1.684000	0.51022	0.391000	0.25812	GAG	POM121	-	NULL	ENSG00000196313		0.627	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	POM121	HGNC	protein_coding	OTTHUMT00000347344.1	26	0.00	0	G			72414040	72414040	+1	no_errors	ENST00000434423	ensembl	human	known	69_37n	missense	78	18.75	18	SNP	0.016	A
PPRC1	23082	genome.wustl.edu	37	10	103906618	103906618	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:103906618A>G	ENST00000278070.2	+	9	3908	c.3869A>G	c.(3868-3870)cAt>cGt	p.H1290R	PPRC1_ENST00000413464.2_Intron|PPRC1_ENST00000489648.1_Intron|PPRC1_ENST00000370012.1_Missense_Mutation_p.H257R	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1290					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		AGTCGAGTCCATGTGGGCTCT	0.592																																						dbGAP											0													90.0	79.0	83.0					10																	103906618		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.3869A>G	10.37:g.103906618A>G	ENSP00000278070:p.His1290Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.H1290R	ENST00000278070.2	37	c.3869	CCDS7529.1	10	.	.	.	.	.	.	.	.	.	.	A	16.19	3.051761	0.55218	.	.	ENSG00000148840	ENST00000278070;ENST00000370012	T;T	0.34472	1.72;1.36	5.46	5.46	0.80206	.	0.434763	0.26000	N	0.026949	T	0.56499	0.1989	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.963	T	0.53865	-0.8378	10	0.35671	T	0.21	.	15.5376	0.76016	1.0:0.0:0.0:0.0	.	1170;1290	Q5VV67-2;Q5VV67	.;PPRC1_HUMAN	R	1290;257	ENSP00000278070:H1290R;ENSP00000359029:H257R	ENSP00000278070:H1290R	H	+	2	0	PPRC1	103896608	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.346000	0.65992	2.072000	0.62099	0.379000	0.24179	CAT	PPRC1	-	NULL	ENSG00000148840		0.592	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPRC1	HGNC	protein_coding	OTTHUMT00000050021.1	37	0.00	0	A	NM_015062		103906618	103906618	+1	no_errors	ENST00000278070	ensembl	human	known	69_37n	missense	25	59.02	36	SNP	1.000	G
PRDM14	63978	genome.wustl.edu	37	8	70981480	70981480	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr8:70981480G>A	ENST00000276594.2	-	2	817	c.616C>T	c.(616-618)Ctg>Ttg	p.L206L		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	206					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			ACCCCGTACAGAACGAAGTGC	0.602																																					NSCLC(129;99 1813 5906 40656 46114)	dbGAP											0													83.0	85.0	84.0					8																	70981480		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.616C>T	8.37:g.70981480G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UX9	Silent	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.L206	ENST00000276594.2	37	c.616	CCDS6206.1	8																																																																																			PRDM14	-	NULL	ENSG00000147596		0.602	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM14	HGNC	protein_coding	OTTHUMT00000318505.1	33	0.00	0	G			70981480	70981480	-1	no_errors	ENST00000276594	ensembl	human	known	69_37n	silent	115	13.53	18	SNP	0.980	A
PRDM15	63977	genome.wustl.edu	37	21	43222950	43222950	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr21:43222950G>A	ENST00000269844.3	-	30	4073	c.3963C>T	c.(3961-3963)agC>agT	p.S1321S	PRDM15_ENST00000538201.1_Silent_p.S975S|PRDM15_ENST00000398548.1_Silent_p.S992S|PRDM15_ENST00000447207.2_Silent_p.S955S|PRDM15_ENST00000470586.1_5'UTR|PRDM15_ENST00000422911.1_Silent_p.S1012S	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						CTGAGTATTCGCTGAAGGTGG	0.557																																						dbGAP											0													196.0	199.0	198.0					21																	43222950		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.3963C>T	21.37:g.43222950G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.S1321	ENST00000269844.3	37	c.3963	CCDS13676.1	21																																																																																			PRDM15	-	NULL	ENSG00000141956		0.557	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	HGNC	protein_coding		47	0.00	0	G	NM_022115		43222950	43222950	-1	no_errors	ENST00000269844	ensembl	human	known	69_37n	silent	85	22.73	25	SNP	0.996	A
PRMT2	3275	genome.wustl.edu	37	21	48084230	48084230	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr21:48084230C>T	ENST00000397637.1	+	11	2247	c.1293C>T	c.(1291-1293)atC>atT	p.I431I	PRMT2_ENST00000397638.2_Silent_p.I431I|PRMT2_ENST00000458387.2_Silent_p.L284L|PRMT2_ENST00000291705.6_Silent_p.I226I|PRMT2_ENST00000355680.3_Silent_p.I431I|PRMT2_ENST00000440086.1_Silent_p.I329I|PRMT2_ENST00000451211.2_Missense_Mutation_p.S285F			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	431	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		TCTTCCCCATCTGGAGATGAC	0.388																																						dbGAP											0													133.0	116.0	122.0					21																	48084230		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.1293C>T	21.37:g.48084230C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Arg_MeTrfase,pfam_tRNA_Trfase_Trm5/Tyw2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.S285F	ENST00000397637.1	37	c.854	CCDS13737.1	21	.	.	.	.	.	.	.	.	.	.	.	14.22	2.469514	0.43839	.	.	ENSG00000160310	ENST00000451211	T	0.62105	0.05	4.71	3.83	0.44106	.	.	.	.	.	T	0.46698	0.1406	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.32693	-0.9897	7	.	.	.	-25.3272	10.8163	0.46578	0.0:0.9074:0.0:0.0926	.	285	B7U630	.	F	285	ENSP00000411984:S285F	.	S	+	2	0	PRMT2	46908658	1.000000	0.71417	0.997000	0.53966	0.928000	0.56348	1.089000	0.30890	1.360000	0.45960	0.655000	0.94253	TCT	PRMT2	-	NULL	ENSG00000160310		0.388	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRMT2	HGNC	protein_coding	OTTHUMT00000207401.1	133	0.00	0	C	NM_001535		48084230	48084230	+1	no_errors	ENST00000451211	ensembl	human	known	69_37n	missense	95	26.92	35	SNP	1.000	T
PROSER1	80209	genome.wustl.edu	37	13	39587532	39587532	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr13:39587532G>A	ENST00000352251.3	-	11	2690	c.1857C>T	c.(1855-1857)ttC>ttT	p.F619F	PROSER1_ENST00000484434.3_Intron|PROSER1_ENST00000350125.3_Silent_p.F597F	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	619	Ser-rich.																ATGGACCTTTGAAGGCCGAGG	0.483																																						dbGAP											0													150.0	158.0	155.0					13																	39587532		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.1857C>T	13.37:g.39587532G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Silent	SNP	NULL	p.F597	ENST00000352251.3	37	c.1791	CCDS9368.2	13																																																																																			PROSER1	-	NULL	ENSG00000120685		0.483	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSER1	HGNC	protein_coding	OTTHUMT00000044607.5	78	0.00	0	G	NM_025138		39587532	39587532	-1	no_errors	ENST00000350125	ensembl	human	known	69_37n	silent	69	25.00	23	SNP	1.000	A
PRRX1	5396	genome.wustl.edu	37	1	170695469	170695469	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:170695469G>C	ENST00000239461.6	+	3	839	c.526G>C	c.(526-528)Gag>Cag	p.E176Q	PRRX1_ENST00000367760.3_Missense_Mutation_p.E176Q|PRRX1_ENST00000476867.2_3'UTR|PRRX1_ENST00000497230.2_Missense_Mutation_p.E176Q	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1	176					artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GACTGCTGTGGAGCAGCCCAT	0.562																																						dbGAP											0													109.0	96.0	101.0					1																	170695469		2203	4300	6503	-	-	-	SO:0001583	missense	0			M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.526G>C	1.37:g.170695469G>C	ENSP00000239461:p.Glu176Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BUM7|O60807	Missense_Mutation	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.E176Q	ENST00000239461.6	37	c.526	CCDS1290.1	1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.719781	0.89205	.	.	ENSG00000116132	ENST00000367760;ENST00000239461;ENST00000497230;ENST00000476867;ENST00000495280	D;D;D;D	0.91295	-2.78;-2.82;-2.81;-1.98	5.39	5.39	0.77823	.	0.050853	0.85682	D	0.000000	D	0.93442	0.7908	M	0.66939	2.045	0.80722	D	1	D;D	0.57899	0.981;0.969	D;P	0.65140	0.932;0.634	D	0.93143	0.6543	10	0.51188	T	0.08	.	17.7361	0.88394	0.0:0.0:1.0:0.0	.	176;176	P54821;P54821-2	PRRX1_HUMAN;.	Q	176;176;176;21;21	ENSP00000356734:E176Q;ENSP00000239461:E176Q;ENSP00000450762:E176Q;ENSP00000451225:E21Q	ENSP00000239461:E176Q	E	+	1	0	PRRX1	168962093	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.058000	0.93896	2.533000	0.85409	0.650000	0.86243	GAG	PRRX1	-	NULL	ENSG00000116132		0.562	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRX1	HGNC	protein_coding	OTTHUMT00000085236.3	40	0.00	0	G	NM_006902		170695469	170695469	+1	no_errors	ENST00000239461	ensembl	human	known	69_37n	missense	65	20.73	17	SNP	1.000	C
PSG3	5671	genome.wustl.edu	37	19	43233520	43233520	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:43233520T>A	ENST00000327495.5	-	5	1182	c.998A>T	c.(997-999)gAc>gTc	p.D333V	PSG3_ENST00000595140.1_Missense_Mutation_p.D333V	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	333				Missing (in Ref. 9). {ECO:0000305}.	defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				TCTGGGGAGGTCTGGACCATC	0.502																																						dbGAP											0													101.0	113.0	109.0					19																	43233520		2203	4296	6499	-	-	-	SO:0001583	missense	0				CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.998A>T	19.37:g.43233520T>A	ENSP00000332215:p.Asp333Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.D333V	ENST00000327495.5	37	c.998	CCDS12611.1	19	.	.	.	.	.	.	.	.	.	.	N	8.259	0.810664	0.16537	.	.	ENSG00000221826	ENST00000327495	T	0.33216	1.42	1.36	1.36	0.22044	.	.	.	.	.	T	0.53206	0.1782	M	0.88105	2.93	0.23254	N	0.998039	D;D	0.71674	0.985;0.998	D;D	0.73380	0.956;0.98	T	0.34775	-0.9815	9	0.37606	T	0.19	.	4.7401	0.13008	0.0:0.0:0.0:1.0	.	333;333	P11464-2;Q16557	.;PSG3_HUMAN	V	333	ENSP00000332215:D333V	ENSP00000332215:D333V	D	-	2	0	PSG3	47925360	0.011000	0.17503	0.062000	0.19696	0.013000	0.08279	1.694000	0.37752	0.582000	0.29556	0.329000	0.21502	GAC	PSG3	-	NULL	ENSG00000221826		0.502	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	PSG3	HGNC	protein_coding	OTTHUMT00000321423.2	157	0.00	0	T	NM_021016		43233520	43233520	-1	no_errors	ENST00000327495	ensembl	human	known	69_37n	missense	91	35.00	49	SNP	0.294	A
PSMC6	5706	genome.wustl.edu	37	14	53173920	53173920	+	5'Flank	SNP	G	G	A	rs537400605|rs140545868	byFrequency	TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr14:53173920G>A	ENST00000606149.1	+	0	0				PSMC6_ENST00000445930.2_Missense_Mutation_p.E9K	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					CATCCCCTATGAGAGACGGCT	0.632																																						dbGAP											0													39.0	35.0	36.0					14																	53173920		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0				CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333		14.37:g.53173920G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R975|P49719|Q6IBU3|Q92524	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.E9K	ENST00000606149.1	37	c.25		14	.	.	.	.	.	.	.	.	.	.	G	18.07	3.542417	0.65198	.	.	ENSG00000100519	ENST00000445930	D	0.93859	-3.3	5.14	5.14	0.70334	.	.	.	.	.	D	0.93390	0.7892	.	.	.	0.44055	D	0.996799	.	.	.	.	.	.	D	0.90768	0.4670	6	0.17832	T	0.49	.	17.3468	0.87311	0.0:0.0:1.0:0.0	.	.	.	.	K	9	ENSP00000401802:E9K	ENSP00000401802:E9K	E	+	1	0	PSMC6	52243670	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.951000	0.70273	2.676000	0.91093	0.561000	0.74099	GAG	PSMC6	-	NULL	ENSG00000100519		0.632	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	PSMC6	HGNC	protein_coding	OTTHUMT00000470741.1	12	0.00	0	G	NM_002806		53173920	53173920	+1	no_errors	ENST00000445930	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	1.000	A
PSMD1	5707	genome.wustl.edu	37	2	231940241	231940241	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:231940241G>C	ENST00000308696.6	+	8	1060	c.898G>C	c.(898-900)Gaa>Caa	p.E300Q	PSMD1_ENST00000409643.1_Missense_Mutation_p.E300Q|PSMD1_ENST00000373635.4_Missense_Mutation_p.E300Q	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	300					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	GATGGAAACAGAAGAAAAGAC	0.388																																						dbGAP											0													90.0	94.0	93.0					2																	231940241		2203	4300	6503	-	-	-	SO:0001583	missense	0			D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.898G>C	2.37:g.231940241G>C	ENSP00000309474:p.Glu300Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	pfam_APC_proteasome,superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn2	p.E300Q	ENST00000308696.6	37	c.898	CCDS2482.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.4|20.4	3.984560|3.984560	0.74474|0.74474	.|.	.|.	ENSG00000173692|ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000409643|ENST00000444007	.|.	.|.	.|.	5.64|5.64	5.64|5.64	0.86602|0.86602	Armadillo-type fold (1);|.	0.139207|.	0.64402|.	D|.	0.000004|.	T|T	0.67297|0.67297	0.2878|0.2878	L|L	0.41573|0.41573	1.285|1.285	0.80722|0.80722	D|D	1|1	B;B|.	0.15930|.	0.001;0.015|.	B;B|.	0.13407|.	0.002;0.009|.	T|T	0.61959|0.61959	-0.6955|-0.6955	9|5	0.21540|.	T|.	0.41|.	-11.1145|-11.1145	19.2882|19.2882	0.94087|0.94087	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	300;300|.	Q99460;Q99460-2|.	PSMD1_HUMAN;.|.	Q|T	300|151	.|.	ENSP00000309474:E300Q|.	E|R	+|+	1|2	0|0	PSMD1|PSMD1	231648485|231648485	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	8.124000|8.124000	0.89588|0.89588	2.664000|2.664000	0.90586|0.90586	0.655000|0.655000	0.94253|0.94253	GAA|AGA	PSMD1	-	superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn2	ENSG00000173692		0.388	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD1	HGNC	protein_coding	OTTHUMT00000256958.2	153	0.00	0	G			231940241	231940241	+1	no_errors	ENST00000308696	ensembl	human	known	69_37n	missense	81	22.86	24	SNP	1.000	C
PTH1R	5745	genome.wustl.edu	37	3	46937242	46937242	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:46937242G>A	ENST00000313049.5	+	3	399	c.196G>A	c.(196-198)Gac>Aac	p.D66N	PTH1R_ENST00000430002.2_Missense_Mutation_p.D66N|PTH1R_ENST00000490109.1_3'UTR|PTH1R_ENST00000449590.1_Missense_Mutation_p.D66N|PTH1R_ENST00000418619.1_Missense_Mutation_p.D66N			Q03431	PTH1R_HUMAN	parathyroid hormone 1 receptor	66					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|bone mineralization (GO:0030282)|bone resorption (GO:0045453)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|osteoblast development (GO:0002076)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|skeletal system development (GO:0001501)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	parathyroid hormone receptor activity (GO:0004991)|peptide hormone binding (GO:0017046)|protein self-association (GO:0043621)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(2)|stomach(1)|urinary_tract(2)	19					Preotact(DB05829)|Teriparatide(DB06285)	AATGGAATCAGACAAGGGATG	0.552											OREG0015543	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													138.0	120.0	126.0					3																	46937242		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2747.1	3p22-p21.1	2012-08-10	2008-11-18	2008-11-18	ENSG00000160801	ENSG00000160801		"""GPCR / Class B : Parathyroid hormone receptors"""	9608	protein-coding gene	gene with protein product		168468	"""parathyroid hormone receptor 1"""	PTHR, PTHR1		8020952	Standard	NM_001184744		Approved		uc021wxg.1	Q03431	OTTHUMG00000133515	ENST00000313049.5:c.196G>A	3.37:g.46937242G>A	ENSP00000321999:p.Asp66Asn	Somatic	943	WXS	Illumina GAIIx	Phase_IV	Q2M1U3	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_parathyroid_rcpt	p.D66N	ENST00000313049.5	37	c.196	CCDS2747.1	3	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723082	0.30503	.	.	ENSG00000160801	ENST00000449590;ENST00000418619;ENST00000427125;ENST00000430002;ENST00000313049;ENST00000313063	T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72	4.9	3.06	0.35304	GPCR, family 2, extracellular hormone receptor domain (1);	.	.	.	.	T	0.32164	0.0820	L	0.29908	0.895	0.26170	N	0.979882	B	0.10296	0.003	B	0.04013	0.001	T	0.14980	-1.0453	9	0.27082	T	0.32	.	6.9257	0.24414	0.0956:0.1763:0.7281:0.0	.	66	Q03431	PTH1R_HUMAN	N	66;66;66;66;66;238	ENSP00000402723:D66N;ENSP00000411424:D66N;ENSP00000400977:D66N;ENSP00000413774:D66N;ENSP00000321999:D66N	ENSP00000321999:D66N	D	+	1	0	PTH1R	46912246	1.000000	0.71417	0.998000	0.56505	0.936000	0.57629	2.492000	0.45311	1.292000	0.44672	-0.304000	0.09214	GAC	PTH1R	-	pfscan_GPCR_2_extracellular_dom	ENSG00000160801		0.552	PTH1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH1R	HGNC	protein_coding	OTTHUMT00000257481.1	54	0.00	0	G	NM_000316		46937242	46937242	+1	no_errors	ENST00000313049	ensembl	human	known	69_37n	missense	67	27.17	25	SNP	0.974	A
PTOV1	53635	genome.wustl.edu	37	19	50360970	50360970	+	Silent	SNP	C	C	G	rs201981695		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:50360970C>G	ENST00000601675.1	+	7	839	c.735C>G	c.(733-735)gtC>gtG	p.V245V	PTOV1_ENST00000391842.1_Silent_p.V245V|PTOV1_ENST00000599732.1_Silent_p.V245V|PTOV1_ENST00000598325.1_3'UTR|AC018766.4_ENST00000596624.1_RNA|AC018766.5_ENST00000601893.1_RNA|PTOV1_ENST00000221557.9_Silent_p.V213V|PTOV1_ENST00000600603.1_Silent_p.V213V|AC018766.5_ENST00000599259.1_RNA|AC018766.6_ENST00000601211.1_RNA|PTOV1_ENST00000601638.1_Silent_p.V213V|AC018766.5_ENST00000593654.1_RNA			Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	245	Interaction with FLOT1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(5)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)	16		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		CTGGTGGTGTCAACTCAGGCC	0.617																																						dbGAP											0													93.0	77.0	83.0					19																	50360970		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF238381	CCDS12782.1	19q13.33	2014-08-28	2008-09-12		ENSG00000104960	ENSG00000104960			9632	protein-coding gene	gene with protein product		610195				12598323, 15713644	Standard	XM_005258998		Approved		uc002pqf.1	Q86YD1	OTTHUMG00000183162	ENST00000601675.1:c.735C>G	19.37:g.50360970C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXX7|Q96BU3|Q9HBN4|Q9NYL1	Silent	SNP	pfam_Mediator_Med25	p.V245	ENST00000601675.1	37	c.735	CCDS12782.1	19																																																																																			PTOV1	-	NULL	ENSG00000104960		0.617	PTOV1-007	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|CCDS	protein_coding	PTOV1	HGNC	protein_coding	OTTHUMT00000465347.1	38	0.00	0	C	NM_017432		50360970	50360970	+1	no_errors	ENST00000391842	ensembl	human	known	69_37n	silent	91	15.74	17	SNP	0.003	G
PTPLA	9200	genome.wustl.edu	37	10	17645931	17645931	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:17645931C>G	ENST00000361271.3	-	2	410	c.373G>C	c.(373-375)Gag>Cag	p.E125Q		NM_014241.3	NP_055056.3	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A	125					fatty acid biosynthetic process (GO:0006633)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	13						AAACTTACCTCAAGCAAGGCA	0.313																																						dbGAP											0													60.0	68.0	65.0					10																	17645931		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF114494	CCDS7121.1	10p14-p13	2008-08-01	2005-11-11		ENSG00000165996	ENSG00000165996			9639	protein-coding gene	gene with protein product	"""cementum attachment protein"""	610467	"""protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a"""			10644438	Standard	XM_005252641		Approved	CAP	uc001ipg.3	B0YJ81	OTTHUMG00000017750	ENST00000361271.3:c.373G>C	10.37:g.17645931C>G	ENSP00000355308:p.Glu125Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ80|Q6JIC5|Q96FW7|Q9HB93|Q9UHX2	Missense_Mutation	SNP	pfam_Tyr_Pase-like_PTPLA	p.E125Q	ENST00000361271.3	37	c.373	CCDS7121.1	10	.	.	.	.	.	.	.	.	.	.	C	12.70	2.017877	0.35606	.	.	ENSG00000165996	ENST00000361271	T	0.54479	0.57	4.78	4.78	0.61160	.	0.194082	0.46145	D	0.000316	D	0.82829	0.5122	H	0.97315	3.98	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.957	D	0.89636	0.3859	10	0.87932	D	0	-22.7958	18.2062	0.89855	0.0:1.0:0.0:0.0	.	125;125	B0YJ81-2;B0YJ81	.;HACD1_HUMAN	Q	125	ENSP00000355308:E125Q	ENSP00000355308:E125Q	E	-	1	0	PTPLA	17685937	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.673000	0.83973	2.366000	0.80165	0.557000	0.71058	GAG	PTPLA	-	pfam_Tyr_Pase-like_PTPLA	ENSG00000165996		0.313	PTPLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPLA	HGNC	protein_coding	OTTHUMT00000047046.1	110	0.00	0	C	NM_014241		17645931	17645931	-1	no_errors	ENST00000361271	ensembl	human	known	69_37n	missense	66	16.46	13	SNP	1.000	G
PXDN	7837	genome.wustl.edu	37	2	1653128	1653128	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:1653128G>A	ENST00000252804.4	-	17	2474	c.2424C>T	c.(2422-2424)gtC>gtT	p.V808V		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	808					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CGTCGGGTGTGACGGTCTCCG	0.657																																						dbGAP											0													58.0	69.0	65.0					2																	1653128		2177	4273	6450	-	-	-	SO:0001819	synonymous_variant	0			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2424C>T	2.37:g.1653128G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like	p.V808	ENST00000252804.4	37	c.2424	CCDS46221.1	2																																																																																			PXDN	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000130508		0.657	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	HGNC	protein_coding	OTTHUMT00000322505.1	14	0.00	0	G	XM_056455		1653128	1653128	-1	no_errors	ENST00000252804	ensembl	human	known	69_37n	silent	50	21.88	14	SNP	1.000	A
PXMP4	11264	genome.wustl.edu	37	20	32295624	32295624	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr20:32295624G>A	ENST00000409299.3	-	4	619	c.527C>T	c.(526-528)tCc>tTc	p.S176F	PXMP4_ENST00000217398.3_3'UTR|PXMP4_ENST00000344022.3_3'UTR	NM_007238.4	NP_009169.3	Q9Y6I8	PXMP4_HUMAN	peroxisomal membrane protein 4, 24kDa	176						integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|large_intestine(2)|lung(8)	13						CTGCAGGGTGGATCGGTGATA	0.577																																						dbGAP											0													136.0	122.0	127.0					20																	32295624		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF072864	CCDS13225.1, CCDS13226.1	20q11.22	2008-07-02	2002-08-29		ENSG00000101417	ENSG00000101417			15920	protein-coding gene	gene with protein product	"""24 kDa peroxisomal intrinsic membrane protein"""		"""peroxisomal membrane protein 4 (24kD)"""			10366717	Standard	NM_183397		Approved	PMP24	uc002wzv.3	Q9Y6I8	OTTHUMG00000032273	ENST00000409299.3:c.527C>T	20.37:g.32295624G>A	ENSP00000386385:p.Ser176Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2I7|Q9H0T4	Missense_Mutation	SNP	pirsf_Pmp4	p.S176F	ENST00000409299.3	37	c.527	CCDS13225.1	20	.	.	.	.	.	.	.	.	.	.	g	15.37	2.814637	0.50527	.	.	ENSG00000101417	ENST00000409299	T	0.45276	0.9	5.73	-4.65	0.03339	.	0.664389	0.16757	N	0.200778	T	0.24084	0.0583	N	0.19112	0.55	0.58432	D	0.999997	B	0.22346	0.068	B	0.23150	0.044	T	0.03051	-1.1078	10	0.62326	D	0.03	-5.6916	11.4231	0.49993	0.0:0.1523:0.251:0.5967	.	176	Q9Y6I8	PXMP4_HUMAN	F	176	ENSP00000386385:S176F	ENSP00000386385:S176F	S	-	2	0	PXMP4	31759285	0.934000	0.31675	0.768000	0.31515	0.675000	0.39556	1.302000	0.33459	-0.478000	0.06823	0.638000	0.83543	TCC	PXMP4	-	pirsf_Pmp4	ENSG00000101417		0.577	PXMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXMP4	HGNC	protein_coding	OTTHUMT00000078739.2	52	0.00	0	G	NM_007238		32295624	32295624	-1	no_errors	ENST00000409299	ensembl	human	known	69_37n	missense	62	26.19	22	SNP	0.829	A
RAG1	5896	genome.wustl.edu	37	11	36597333	36597333	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:36597333G>C	ENST00000299440.5	+	2	2591	c.2479G>C	c.(2479-2481)Gag>Cag	p.E827Q		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	827					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				TGCTTCCAAAGAGGAAAGGAA	0.468									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	dbGAP											0													61.0	60.0	60.0					11																	36597333		2202	4298	6500	-	-	-	SO:0001583	missense	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.2479G>C	11.37:g.36597333G>C	ENSP00000299440:p.Glu827Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	pfam_Znf_VDJ_recomb-activ_1,smart_Znf_RING,pfscan_Znf_RING	p.E827Q	ENST00000299440.5	37	c.2479	CCDS7902.1	11	.	.	.	.	.	.	.	.	.	.	G	21.4	4.137322	0.77775	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	D;D	0.86769	-2.17;-2.17	6.13	6.13	0.99165	.	0.000000	0.85682	D	0.000000	D	0.94886	0.8347	H	0.95437	3.67	0.80722	D	1	P	0.48089	0.905	P	0.54026	0.74	D	0.95280	0.8385	10	0.87932	D	0	.	20.8401	0.99726	0.0:0.0:1.0:0.0	.	827	P15918	RAG1_HUMAN	Q	827	ENSP00000434610:E827Q;ENSP00000299440:E827Q	ENSP00000299440:E827Q	E	+	1	0	RAG1	36553909	1.000000	0.71417	0.986000	0.45419	0.990000	0.78478	9.476000	0.97823	2.932000	0.99384	0.644000	0.83932	GAG	RAG1	-	NULL	ENSG00000166349		0.468	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAG1	HGNC	protein_coding	OTTHUMT00000389535.1	30	0.00	0	G	NM_000448		36597333	36597333	+1	no_errors	ENST00000299440	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	1.000	C
RAI2	10742	genome.wustl.edu	37	X	17818567	17818567	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:17818567G>A	ENST00000545871.1	-	3	2024	c.1564C>T	c.(1564-1566)Cgg>Tgg	p.R522W	RAI2_ENST00000415486.3_Missense_Mutation_p.R472W|RAI2_ENST00000451717.1_Missense_Mutation_p.R522W|RAI2_ENST00000360011.1_Missense_Mutation_p.R522W|RAI2_ENST00000331511.1_Missense_Mutation_p.R522W	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	522					embryo development (GO:0009790)			p.R522W(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					GTGGCCAGCCGTTGTTTTTTG	0.373																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											231.0	250.0	244.0					X																	17818567		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.1564C>T	X.37:g.17818567G>A	ENSP00000444210:p.Arg522Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Missense_Mutation	SNP	NULL	p.R522W	ENST00000545871.1	37	c.1564	CCDS14183.1	X	.	.	.	.	.	.	.	.	.	.	G	14.83	2.651826	0.47362	.	.	ENSG00000131831	ENST00000331511;ENST00000360011;ENST00000545871;ENST00000451717;ENST00000415486	T;T;T;T;T	0.54071	0.62;0.62;0.62;0.62;0.59	4.96	4.96	0.65561	.	0.000000	0.64402	D	0.000001	T	0.62282	0.2415	L	0.36672	1.1	0.51767	D	0.999931	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.64993	-0.6276	10	0.87932	D	0	-25.1477	12.7319	0.57203	0.0:0.0:0.8361:0.1639	.	472;522	E7EMN4;Q9Y5P3	.;RAI2_HUMAN	W	522;522;522;522;472	ENSP00000333456:R522W;ENSP00000353106:R522W;ENSP00000444210:R522W;ENSP00000401323:R522W;ENSP00000392578:R472W	ENSP00000333456:R522W	R	-	1	2	RAI2	17728488	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.011000	0.49567	2.445000	0.82738	0.600000	0.82982	CGG	RAI2	-	NULL	ENSG00000131831		0.373	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI2	HGNC	protein_coding	OTTHUMT00000055937.1	366	0.00	0	G	NM_021785		17818567	17818567	-1	no_errors	ENST00000331511	ensembl	human	known	69_37n	missense	194	21.14	52	SNP	1.000	A
RALYL	138046	genome.wustl.edu	37	8	85799846	85799846	+	Missense_Mutation	SNP	G	G	T	rs551280537		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr8:85799846G>T	ENST00000521268.1	+	8	1798	c.693G>T	c.(691-693)caG>caT	p.Q231H	RALYL_ENST00000522455.1_Missense_Mutation_p.Q231H|RALYL_ENST00000521695.1_Missense_Mutation_p.Q231H|RALYL_ENST00000517638.1_Missense_Mutation_p.Q244H|RALYL_ENST00000521376.1_Intron|RALYL_ENST00000518566.1_Missense_Mutation_p.Q220H|RALYL_ENST00000523850.1_Missense_Mutation_p.Q158H	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	231							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						CAGAAGCTCAGAAGAAGCAAT	0.478													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17488	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													99.0	95.0	96.0					8																	85799846		1887	4112	5999	-	-	-	SO:0001583	missense	0				CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.693G>T	8.37:g.85799846G>T	ENSP00000430367:p.Gln231His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.Q231H	ENST00000521268.1	37	c.693	CCDS55253.1	8	.	.	.	.	.	.	.	.	.	.	G	11.62	1.694154	0.30052	.	.	ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850	T;T;T;T;T;T	0.15139	2.84;2.84;2.84;2.84;2.83;2.45	5.34	4.46	0.54185	.	0.575016	0.17590	N	0.168817	T	0.10121	0.0248	N	0.17674	0.51	0.80722	D	1	B;B;B;B	0.28713	0.006;0.22;0.001;0.006	B;B;B;B	0.28465	0.005;0.09;0.005;0.005	T	0.12218	-1.0556	10	0.46703	T	0.11	-10.5285	5.3483	0.16022	0.2793:0.0:0.7207:0.0	.	220;158;244;231	B3KT61;Q86SE5-2;G3V129;Q86SE5	.;.;.;RALYL_HUMAN	H	231;231;231;220;244;158	ENSP00000430394:Q231H;ENSP00000428667:Q231H;ENSP00000430367:Q231H;ENSP00000430065:Q220H;ENSP00000430128:Q244H;ENSP00000428807:Q158H	ENSP00000430128:Q244H	Q	+	3	2	RALYL	85962401	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.598000	0.61069	2.664000	0.90586	0.561000	0.74099	CAG	RALYL	-	pirsf_hnRNP_C_Raly	ENSG00000184672		0.478	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALYL	HGNC	protein_coding	OTTHUMT00000379448.1	104	0.00	0	G			85799846	85799846	+1	no_errors	ENST00000521268	ensembl	human	known	69_37n	missense	134	19.76	33	SNP	1.000	T
RAPGEF6	51735	genome.wustl.edu	37	5	130857085	130857085	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:130857085G>C	ENST00000509018.1	-	7	830	c.625C>G	c.(625-627)Cag>Gag	p.Q209E	RAPGEF6_ENST00000296859.6_Missense_Mutation_p.Q209E|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.Q209E|RAPGEF6_ENST00000510071.1_Missense_Mutation_p.Q209E|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.Q209E|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.Q259E|RAPGEF6_ENST00000308008.6_Missense_Mutation_p.Q209E	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	209					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		GGTATTACCTGATAGATATCA	0.388																																					Melanoma(168;435 1955 13113 13877 23213)	dbGAP											0													96.0	93.0	94.0					5																	130857085		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.625C>G	5.37:g.130857085G>C	ENSP00000421684:p.Gln209Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_PDZ,pfam_Ras-assoc,pfam_cNMP-bd_dom,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.Q209E	ENST00000509018.1	37	c.625	CCDS34225.1	5	.	.	.	.	.	.	.	.	.	.	G	28.9	4.958233	0.92726	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000308008;ENST00000510071;ENST00000513227;ENST00000504575;ENST00000504039;ENST00000514667	T;T;T;T;T;T;T;T	0.45668	1.85;1.77;1.77;1.85;1.7;2.25;0.89;1.95	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.64875	0.2638	M	0.63428	1.95	0.80722	D	1	D;D;D;D;D;D	0.76494	0.998;0.996;0.994;0.996;0.999;0.996	D;D;D;D;D;P	0.79108	0.966;0.989;0.972;0.989;0.992;0.874	T	0.62383	-0.6866	10	0.54805	T	0.06	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	209;209;209;259;209;209	A3KN82;B7ZML2;Q8TEU7-2;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;RPGF6_HUMAN	E	209;209;209;209;209;209;209;37;62;62;259	ENSP00000421684:Q209E;ENSP00000309298:Q209E;ENSP00000426081:Q209E;ENSP00000296859:Q209E;ENSP00000311419:Q209E;ENSP00000425389:Q209E;ENSP00000424574:Q37E;ENSP00000426948:Q259E	ENSP00000426948:Q259E	Q	-	1	0	RAPGEF6;FNIP1	130884984	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.476000	0.97823	2.824000	0.97209	0.655000	0.94253	CAG	RAPGEF6	-	NULL	ENSG00000158987		0.388	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF6	HGNC	protein_coding	OTTHUMT00000370059.1	74	0.00	0	G	NM_016340		130857085	130857085	-1	no_errors	ENST00000509018	ensembl	human	known	69_37n	missense	38	28.30	15	SNP	1.000	C
RASEF	158158	genome.wustl.edu	37	9	85624562	85624562	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr9:85624562G>A	ENST00000376447.3	-	6	1213	c.953C>T	c.(952-954)aCt>aTt	p.T318I		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	318					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						ATACCTTTCAGTATTCAGACT	0.343																																						dbGAP											0													131.0	120.0	124.0					9																	85624562		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.953C>T	9.37:g.85624562G>A	ENSP00000365630:p.Thr318Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC29|Q96N04	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_Vinculin/catenin,smart_EF_hand_Ca-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,pfscan_EF_HAND_2,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.T318I	ENST00000376447.3	37	c.953	CCDS6662.1	9	.	.	.	.	.	.	.	.	.	.	G	15.33	2.802620	0.50315	.	.	ENSG00000165105	ENST00000376447	T	0.60797	0.16	5.92	5.92	0.95590	.	0.328901	0.33515	N	0.004837	T	0.49490	0.1560	N	0.22421	0.69	0.27766	N	0.943648	B	0.24823	0.112	B	0.26310	0.068	T	0.48246	-0.9052	10	0.52906	T	0.07	.	19.9255	0.97101	0.0:0.0:1.0:0.0	.	318	Q8IZ41	RASEF_HUMAN	I	318	ENSP00000365630:T318I	ENSP00000365630:T318I	T	-	2	0	RASEF	84814382	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.843000	0.55865	2.809000	0.96659	0.467000	0.42956	ACT	RASEF	-	NULL	ENSG00000165105		0.343	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASEF	HGNC	protein_coding	OTTHUMT00000052825.1	233	0.00	0	G	NM_152573		85624562	85624562	-1	no_errors	ENST00000376447	ensembl	human	known	69_37n	missense	162	16.49	32	SNP	1.000	A
RBMS1	5937	genome.wustl.edu	37	2	161135089	161135089	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:161135089C>G	ENST00000348849.3	-	11	1462	c.1032G>C	c.(1030-1032)atG>atC	p.M344I	RBMS1_ENST00000409075.1_Missense_Mutation_p.M308I|RBMS1_ENST00000474820.1_5'UTR|RBMS1_ENST00000392753.3_Missense_Mutation_p.M357I|RBMS1_ENST00000409972.1_Missense_Mutation_p.M308I|RBMS1_ENST00000409289.2_Missense_Mutation_p.M308I	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting protein 1	344					DNA replication (GO:0006260)|RNA processing (GO:0006396)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)		PLA2R1/RBMS1(2)								ACAGATGACTCATCTGCTGGG	0.507											OREG0015036	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													102.0	88.0	93.0					2																	161135089		2203	4300	6503	-	-	-	SO:0001583	missense	0			D28482	CCDS2213.1	2q24.2	2013-02-12			ENSG00000153250	ENSG00000153250		"""RNA binding motif (RRM) containing"""	9907	protein-coding gene	gene with protein product	"""suppressor of cdc 2 (cdc13) with RNA binding motif 2"", ""c-myc gene single strand binding protein 2"""	602310	"""chromosome 2 open reading frame 12"""	C2orf12		8041632, 8134115, 7838710	Standard	NM_016836		Approved	SCR2, MSSP-1, MSSP-2, MSSP-3, YC1, HCC-4, DKFZp564H0764	uc002ubo.3	P29558	OTTHUMG00000132031	ENST00000348849.3:c.1032G>C	2.37:g.161135089C>G	ENSP00000294904:p.Met344Ile	Somatic	1814	WXS	Illumina GAIIx	Phase_IV	Q14869|Q15433|Q53P46|Q53QX8|Q53RG6|Q8WV20	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA	p.M357I	ENST00000348849.3	37	c.1071	CCDS2213.1	2	.	.	.	.	.	.	.	.	.	.	C	29.7	5.031543	0.93575	.	.	ENSG00000153250	ENST00000348849;ENST00000409075;ENST00000409289;ENST00000392753;ENST00000409972	T;T;T;T;T	0.25912	1.77;2.04;2.04;1.81;2.04	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.49270	0.1547	M	0.69823	2.125	0.80722	D	1	P;P;P;B;B;P	0.44281	0.604;0.604;0.831;0.228;0.417;0.813	B;B;P;B;B;P	0.54664	0.407;0.354;0.758;0.146;0.206;0.49	T	0.35001	-0.9806	10	0.66056	D	0.02	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	223;344;341;226;308;357	Q5CZ65;P29558;P29558-2;Q5CZ66;E7ETU5;B4DN88	.;RBMS1_HUMAN;.;.;.;.	I	344;308;308;357;308	ENSP00000294904:M344I;ENSP00000386347:M308I;ENSP00000386571:M308I;ENSP00000376508:M357I;ENSP00000387280:M308I	ENSP00000294904:M344I	M	-	3	0	RBMS1	160843335	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.601000	0.82783	2.894000	0.99253	0.655000	0.94253	ATG	RBMS1	-	NULL	ENSG00000153250		0.507	RBMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMS1	HGNC	protein_coding	OTTHUMT00000255043.4	63	0.00	0	C	NM_016836		161135089	161135089	-1	no_errors	ENST00000392753	ensembl	human	known	69_37n	missense	158	17.71	34	SNP	1.000	G
RC3H2	54542	genome.wustl.edu	37	9	125622277	125622277	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr9:125622277G>C	ENST00000373670.1	-	10	2368	c.1768C>G	c.(1768-1770)Cct>Gct	p.P590A	RC3H2_ENST00000357244.2_Missense_Mutation_p.P590A|RC3H2_ENST00000423239.2_Missense_Mutation_p.P590A			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	590	Pro-rich.				B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						GAATGCGGAGGATATACTGGT	0.428																																						dbGAP											0													212.0	210.0	211.0					9																	125622277		1844	4097	5941	-	-	-	SO:0001583	missense	0			AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.1768C>G	9.37:g.125622277G>C	ENSP00000362774:p.Pro590Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_RING,smart_Znf_CCCH,pfscan_Znf_RING	p.P590A	ENST00000373670.1	37	c.1768	CCDS43874.1	9	.	.	.	.	.	.	.	.	.	.	G	23.8	4.464414	0.84425	.	.	ENSG00000056586	ENST00000373670;ENST00000357244;ENST00000373663;ENST00000423239	T;T;T	0.49139	0.79;0.79;0.82	5.87	5.87	0.94306	.	0.055575	0.64402	D	0.000001	T	0.52058	0.1711	N	0.12182	0.205	0.80722	D	1	D;D	0.67145	0.993;0.996	D;D	0.73708	0.956;0.981	T	0.54111	-0.8342	10	0.42905	T	0.14	-2.6061	17.7375	0.88397	0.0:0.0:1.0:0.0	.	590;590	Q9HBD1;Q9HBD1-4	RC3H2_HUMAN;.	A	590;590;461;590	ENSP00000362774:P590A;ENSP00000349783:P590A;ENSP00000411767:P590A	ENSP00000349783:P590A	P	-	1	0	RC3H2	124662098	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.761000	0.62243	2.941000	0.99782	0.655000	0.94253	CCT	RC3H2	-	NULL	ENSG00000056586		0.428	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RC3H2	HGNC	protein_coding	OTTHUMT00000053966.1	154	0.00	0	G	NM_018835		125622277	125622277	-1	no_errors	ENST00000357244	ensembl	human	known	69_37n	missense	121	20.39	31	SNP	1.000	C
RFX6	222546	genome.wustl.edu	37	6	117232129	117232129	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:117232129C>T	ENST00000332958.2	+	7	720	c.704C>T	c.(703-705)tCa>tTa	p.S235L	RFX6_ENST00000471966.1_3'UTR	NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	235					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						TCGCTTAGCTCAAAAACTGGA	0.353																																						dbGAP											0													106.0	109.0	108.0					6																	117232129		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.704C>T	6.37:g.117232129C>T	ENSP00000332208:p.Ser235Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T6B3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.S235L	ENST00000332958.2	37	c.704	CCDS5113.1	6	.	.	.	.	.	.	.	.	.	.	C	24.8	4.570819	0.86542	.	.	ENSG00000185002	ENST00000332958	T	0.58797	0.31	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.48714	0.1515	L	0.61218	1.895	0.58432	D	0.999992	P	0.36144	0.539	B	0.38755	0.281	T	0.50734	-0.8793	10	0.42905	T	0.14	-16.2616	16.5801	0.84712	0.0:0.8699:0.1301:0.0	.	235	Q8HWS3	RFX6_HUMAN	L	235	ENSP00000332208:S235L	ENSP00000332208:S235L	S	+	2	0	RFX6	117338822	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.687000	0.68219	2.884000	0.98904	0.655000	0.94253	TCA	RFX6	-	NULL	ENSG00000185002		0.353	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	HGNC	protein_coding	OTTHUMT00000041970.2	195	0.00	0	C	NM_173560		117232129	117232129	+1	no_errors	ENST00000332958	ensembl	human	known	69_37n	missense	119	15.00	21	SNP	1.000	T
RGS4	5999	genome.wustl.edu	37	1	163044339	163044339	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:163044339C>T	ENST00000367909.6	+	5	947	c.607C>T	c.(607-609)Cag>Tag	p.Q203*	RGS4_ENST00000367906.3_Nonsense_Mutation_p.Q185*|RGS4_ENST00000527809.1_Nonsense_Mutation_p.Q185*|RGS4_ENST00000367908.4_3'UTR|RGS4_ENST00000531057.1_Intron|RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000421743.2_Nonsense_Mutation_p.Q300*	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	203					inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						CCTGGTCCCTCAGTGTGCCTA	0.488																																					Ovarian(76;1257 1738 3039 6086)	dbGAP											0													105.0	112.0	110.0					1																	163044339		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.607C>T	1.37:g.163044339C>T	ENSP00000356885:p.Gln203*	Somatic		WXS	Illumina GAIIx	Phase_IV	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Nonsense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.Q300*	ENST00000367909.6	37	c.898	CCDS1243.1	1	.	.	.	.	.	.	.	.	.	.	C	38	6.640552	0.97726	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000527809;ENST00000367906	.	.	.	5.11	4.19	0.49359	.	2.691420	0.00763	N	0.001144	.	.	.	.	.	.	0.33170	D	0.548129	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	13.3712	0.60713	0.0:0.8408:0.1592:0.0	.	.	.	.	X	300;203;185;185	.	ENSP00000356882:Q185X	Q	+	1	0	RGS4	161310963	0.973000	0.33851	0.997000	0.53966	0.929000	0.56500	3.212000	0.51145	1.350000	0.45770	0.655000	0.94253	CAG	RGS4	-	NULL	ENSG00000117152		0.488	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS4	HGNC	protein_coding	OTTHUMT00000083197.2	76	0.00	0	C	NM_005613		163044339	163044339	+1	no_errors	ENST00000421743	ensembl	human	known	69_37n	nonsense	87	14.71	15	SNP	0.926	T
RGS8	85397	genome.wustl.edu	37	1	182616022	182616022	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:182616022T>A	ENST00000483095.2	-	7	648	c.391A>T	c.(391-393)Acg>Tcg	p.T131S	RGS8_ENST00000367557.4_Missense_Mutation_p.T131S|RGS8_ENST00000367556.1_Missense_Mutation_p.T131S|RGS8_ENST00000258302.4_Missense_Mutation_p.T149S			P57771	RGS8_HUMAN	regulator of G-protein signaling 8	131	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			haematopoietic_and_lymphoid_tissue(1)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	5						TTCTTCCTCGTGGCTTCTCGG	0.527																																					Ovarian(189;1262 3804 41973)	dbGAP											0													150.0	147.0	148.0					1																	182616022		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF297015	CCDS1349.1, CCDS41443.1	1q25	2008-07-18	2007-08-14		ENSG00000135824	ENSG00000135824		"""Regulators of G-protein signaling"""	16810	protein-coding gene	gene with protein product		607189	"""regulator of G-protein signalling 8"""			11318611	Standard	NM_001102450		Approved	MGC119067, MGC119068, MGC119069	uc001gpm.1	P57771	OTTHUMG00000035219	ENST00000483095.2:c.391A>T	1.37:g.182616022T>A	ENSP00000426289:p.Thr131Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGL9|Q3SYD2	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.T149S	ENST00000483095.2	37	c.445	CCDS41443.1	1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.576262	0.86645	.	.	ENSG00000135824	ENST00000483095;ENST00000258302;ENST00000367557;ENST00000367556	T;T;T;T	0.02032	4.49;4.49;4.49;4.49	4.94	4.94	0.65067	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.11580	0.0282	M	0.74881	2.28	0.80722	D	1	D;D	0.69078	0.988;0.997	D;D	0.69479	0.912;0.964	T	0.00382	-1.1775	10	0.87932	D	0	.	14.5877	0.68339	0.0:0.0:0.0:1.0	.	131;149	P57771;P57771-2	RGS8_HUMAN;.	S	131;149;131;131	ENSP00000426289:T131S;ENSP00000258302:T149S;ENSP00000356528:T131S;ENSP00000356527:T131S	ENSP00000258302:T149S	T	-	1	0	RGS8	180882645	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.727000	0.84838	1.974000	0.57490	0.397000	0.26171	ACG	RGS8	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	ENSG00000135824		0.527	RGS8-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RGS8	HGNC	protein_coding	OTTHUMT00000358979.1	143	0.00	0	T	NM_033345		182616022	182616022	-1	no_errors	ENST00000258302	ensembl	human	known	69_37n	missense	186	15.77	35	SNP	1.000	A
RLBP1	6017	genome.wustl.edu	37	15	89762200	89762200	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr15:89762200C>T	ENST00000268125.5	-	3	446	c.7G>A	c.(7-9)Gaa>Aaa	p.E3K		NM_000326.4	NP_000317.1	P12271	RLBP1_HUMAN	retinaldehyde binding protein 1	3					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	cell body (GO:0044297)|cytosol (GO:0005829)	11-cis retinal binding (GO:0005502)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(1)|prostate(1)|skin(1)	18	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)	CTTACCCCTTCTGACATGTTG	0.542																																						dbGAP											0													146.0	126.0	133.0					15																	89762200		2200	4299	6499	-	-	-	SO:0001583	missense	0			BC004199	CCDS32324.1	15q26.1	2007-07-16	2001-11-28			ENSG00000140522			10024	protein-coding gene	gene with protein product		180090	"""retinaldehyde-binding protein 1"""			1733864, 9326942	Standard	NM_000326		Approved	CRALBP	uc002bnl.3	P12271		ENST00000268125.5:c.7G>A	15.37:g.89762200C>T	ENSP00000268125:p.Glu3Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R667	Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,prints_CRAL-bd_toc_tran	p.E3K	ENST00000268125.5	37	c.7	CCDS32324.1	15	.	.	.	.	.	.	.	.	.	.	C	13.79	2.342288	0.41498	.	.	ENSG00000140522	ENST00000268125	T	0.79352	-1.26	5.17	5.17	0.71159	.	0.467603	0.23298	N	0.049703	T	0.59972	0.2233	N	0.14661	0.345	0.31395	N	0.677368	B	0.19200	0.034	B	0.14023	0.01	T	0.53457	-0.8436	10	0.09590	T	0.72	-10.8678	14.0302	0.64610	0.0:1.0:0.0:0.0	.	3	P12271	RLBP1_HUMAN	K	3	ENSP00000268125:E3K	ENSP00000268125:E3K	E	-	1	0	RLBP1	87563204	0.999000	0.42202	0.998000	0.56505	0.161000	0.22273	2.318000	0.43779	2.699000	0.92147	0.655000	0.94253	GAA	RLBP1	-	NULL	ENSG00000140522		0.542	RLBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLBP1	HGNC	protein_coding	OTTHUMT00000421135.1	87	0.00	0	C	NM_000326		89762200	89762200	-1	no_errors	ENST00000268125	ensembl	human	known	69_37n	missense	157	15.51	29	SNP	0.999	T
RNF126P1	376412	genome.wustl.edu	37	17	55123443	55123443	+	RNA	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:55123443C>T	ENST00000567452.1	+	0	605					NR_002818.2				ring finger protein 126 pseudogene 1																		TGGACGCCTTCGCACAGCTCC	0.612																																						dbGAP											0																																										-	-	-			0			BC033555		17q23.2	2004-04-22				ENSG00000261192		"""RING-type (C3HC4) zinc fingers"""	30340	pseudogene	pseudogene						12477932	Standard	NR_002818		Approved		uc002iuw.3				17.37:g.55123443C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000567452.1	37	NULL		17																																																																																			RNF126P1	-	-	ENSG00000261192		0.612	RNF126P1-002	KNOWN	basic	processed_transcript	RNF126P1	HGNC	pseudogene	OTTHUMT00000431453.1	88	0.00	0	C			55123443	55123443	+1	no_errors	ENST00000567452	ensembl	human	known	69_37n	rna	111	23.45	34	SNP	0.046	T
RNF169	254225	genome.wustl.edu	37	11	74500681	74500681	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:74500681C>G	ENST00000299563.4	+	2	526	c.513C>G	c.(511-513)ttC>ttG	p.F171L		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	171					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						ACTTTATATTCAGAGCACCAA	0.343																																						dbGAP											0													102.0	94.0	96.0					11																	74500681		1798	4066	5864	-	-	-	SO:0001583	missense	0			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.513C>G	11.37:g.74500681C>G	ENSP00000299563:p.Phe171Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6N015	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.F171L	ENST00000299563.4	37	c.513	CCDS41691.1	11	.	.	.	.	.	.	.	.	.	.	C	21.6	4.176533	0.78564	.	.	ENSG00000166439	ENST00000299563	T	0.45276	0.9	5.03	4.12	0.48240	.	0.287447	0.28772	N	0.014195	T	0.54935	0.1889	M	0.65975	2.015	0.45161	D	0.998179	D	0.63880	0.993	D	0.68192	0.956	T	0.53201	-0.8472	10	0.13470	T	0.59	-30.8482	9.9316	0.41525	0.0:0.905:0.0:0.095	.	171	Q8NCN4	RN169_HUMAN	L	171	ENSP00000299563:F171L	ENSP00000299563:F171L	F	+	3	2	RNF169	74178329	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.049000	0.41288	1.235000	0.43724	0.655000	0.94253	TTC	RNF169	-	NULL	ENSG00000166439		0.343	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF169	HGNC	protein_coding	OTTHUMT00000384741.1	236	0.00	0	C	XM_495886		74500681	74500681	+1	no_errors	ENST00000299563	ensembl	human	known	69_37n	missense	107	10.08	12	SNP	1.000	G
RPA1	6117	genome.wustl.edu	37	17	1795220	1795220	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:1795220G>A	ENST00000254719.5	+	15	1755	c.1645G>A	c.(1645-1647)Gaa>Aaa	p.E549K		NM_002945.3	NP_002936.1	P27694	RFA1_HUMAN	replication protein A1, 70kDa	549					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of cell proliferation (GO:0008284)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|DNA replication factor A complex (GO:0005662)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|single-stranded DNA binding (GO:0003697)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)	10						TTATCTTGGGGAATTAAAAGA	0.338								Nucleotide excision repair (NER)																														dbGAP											0													72.0	74.0	73.0					17																	1795220		2203	4300	6503	-	-	-	SO:0001583	missense	0			M63488	CCDS11014.1	17p13.3	2008-02-05	2002-08-29		ENSG00000132383	ENSG00000132383			10289	protein-coding gene	gene with protein product		179835	"""replication protein A1 (70kD)"""			8454588	Standard	NM_002945		Approved	REPA1, RPA70, HSSB, RF-A, RP-A	uc002fto.2	P27694	OTTHUMG00000090579	ENST00000254719.5:c.1645G>A	17.37:g.1795220G>A	ENSP00000254719:p.Glu549Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0Y9|Q59ES9	Missense_Mutation	SNP	pfam_Rep_factor-A_C,pfam_Rep_factor-A_N,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,tigrfam_Rep_factor_Rpa1	p.E549K	ENST00000254719.5	37	c.1645	CCDS11014.1	17	.	.	.	.	.	.	.	.	.	.	G	14.82	2.650659	0.47362	.	.	ENSG00000132383	ENST00000254719	T	0.45668	0.89	5.72	5.72	0.89469	Nucleic acid-binding, OB-fold-like (1);Replication factor A, C-terminal (1);Nucleic acid-binding, OB-fold (1);	0.046003	0.85682	D	0.000000	T	0.35098	0.0920	L	0.38838	1.175	0.80722	D	1	P	0.40250	0.709	B	0.35655	0.207	T	0.06445	-1.0826	10	0.20519	T	0.43	-18.3409	19.9401	0.97155	0.0:0.0:1.0:0.0	.	549	P27694	RFA1_HUMAN	K	549	ENSP00000254719:E549K	ENSP00000254719:E549K	E	+	1	0	RPA1	1741970	1.000000	0.71417	0.697000	0.30258	0.220000	0.24768	7.293000	0.78740	2.712000	0.92718	0.650000	0.86243	GAA	RPA1	-	pfam_Rep_factor-A_C,superfamily_NA-bd_OB-fold-like,tigrfam_Rep_factor_Rpa1	ENSG00000132383		0.338	RPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA1	HGNC	protein_coding	OTTHUMT00000207118.2	167	0.00	0	G	NM_002945		1795220	1795220	+1	no_errors	ENST00000254719	ensembl	human	known	69_37n	missense	71	22.83	21	SNP	1.000	A
RPLP2	6181	genome.wustl.edu	37	11	812762	812762	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:812762G>C	ENST00000321153.4	+	5	668	c.274G>C	c.(274-276)Gag>Cag	p.E92Q	RPLP2_ENST00000532004.1_3'UTR|SNORA52_ENST00000362915.1_RNA|RPLP2_ENST00000530797.1_Missense_Mutation_p.E92Q	NM_001004.3	NP_000995.1	P05387	RLA2_HUMAN	ribosomal protein, large, P2	92					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(1)	1		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTCCACAGCAGAGGAGAAGAA	0.537																																						dbGAP											0													118.0	110.0	113.0					11																	812762		2203	4299	6502	-	-	-	SO:0001583	missense	0			M17887	CCDS7717.1	11p15.5	2011-07-29			ENSG00000177600	ENSG00000177600		"""L ribosomal proteins"""	10377	protein-coding gene	gene with protein product	"""60S acidic ribosomal protein P2"", ""acidic ribosomal phosphoprotein P2"""	180530		D11S2243E		3323886	Standard	NM_001004		Approved	P2, RPP2, MGC71408, LP2	uc001lrq.1	P05387	OTTHUMG00000133317	ENST00000321153.4:c.274G>C	11.37:g.812762G>C	ENSP00000322419:p.Glu92Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FG96	Missense_Mutation	SNP	pfam_Ribosomal_60S	p.E92Q	ENST00000321153.4	37	c.274	CCDS7717.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.25|16.25	3.069006|3.069006	0.55539|0.55539	.|.	.|.	ENSG00000177600|ENSG00000177600	ENST00000321153;ENST00000530797|ENST00000530398	.|.	.|.	.|.	4.42|4.42	3.47|3.47	0.39725|0.39725	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74543|0.74543	0.3730|0.3730	M|M	0.81112|0.81112	2.525|2.525	0.80722|0.80722	D|D	1|1	P|.	0.37594|.	0.601|.	B|.	0.39419|.	0.299|.	T|T	0.76589|0.76589	-0.2904|-0.2904	9|5	0.66056|.	D|.	0.02|.	-28.7039|-28.7039	13.5703|13.5703	0.61843|0.61843	0.0:0.1571:0.8429:0.0|0.0:0.1571:0.8429:0.0	.|.	92|.	P05387|.	RLA2_HUMAN|.	Q|H	92|68	.|.	ENSP00000322419:E92Q|.	E|Q	+|+	1|3	0|2	RPLP2|RPLP2	802762|802762	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.886000|0.886000	0.51366|0.51366	9.310000|9.310000	0.96267|0.96267	1.154000|1.154000	0.42482|0.42482	0.561000|0.561000	0.74099|0.74099	GAG|CAG	RPLP2	-	pfam_Ribosomal_60S	ENSG00000177600		0.537	RPLP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPLP2	HGNC	protein_coding	OTTHUMT00000257115.2	154	0.00	0	G	NM_001004		812762	812762	+1	no_errors	ENST00000321153	ensembl	human	known	69_37n	missense	142	27.78	55	SNP	1.000	C
RTBDN	83546	genome.wustl.edu	37	19	12936703	12936703	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:12936703G>A	ENST00000458671.2	-	6	659	c.507C>T	c.(505-507)caC>caT	p.H169H	RTBDN_ENST00000322912.5_Silent_p.H201H|RTBDN_ENST00000592204.1_Silent_p.H179H|CTD-2265O21.3_ENST00000588469.1_RNA|RTBDN_ENST00000589272.1_3'UTR|RTBDN_ENST00000393233.2_3'UTR	NM_001080997.2	NP_001074466.1	Q9BSG5	RTBDN_HUMAN	retbindin	169						extracellular region (GO:0005576)				kidney(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12						CCGGTAGGGCGTGGCCCAGAG	0.652											OREG0025275	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													28.0	25.0	26.0					19																	12936703		2199	4299	6498	-	-	-	SO:0001819	synonymous_variant	0			AY028917	CCDS12283.1, CCDS45994.1, CCDS59355.1, CCDS59356.1	19p13	2006-03-22				ENSG00000132026			30310	protein-coding gene	gene with protein product		609553				12107411	Standard	NM_001080997		Approved	FLJ36353	uc002mvj.4	Q9BSG5		ENST00000458671.2:c.507C>T	19.37:g.12936703G>A		Somatic	683	WXS	Illumina GAIIx	Phase_IV	F1T0I8|Q9BWT5	Silent	SNP	pfam_Folate_rcpt-like	p.H201	ENST00000458671.2	37	c.603	CCDS45994.1	19																																																																																			RTBDN	-	pfam_Folate_rcpt-like	ENSG00000132026		0.652	RTBDN-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RTBDN	HGNC	protein_coding	OTTHUMT00000451513.1	11	0.00	0	G	NM_031429		12936703	12936703	-1	no_errors	ENST00000322912	ensembl	human	known	69_37n	silent	7	41.67	5	SNP	0.000	A
RTL1	388015	genome.wustl.edu	37	14	101349406	101349406	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr14:101349406C>T	ENST00000534062.1	-	1	1778	c.1720G>A	c.(1720-1722)Gag>Aag	p.E574K	MIR432_ENST00000606207.1_RNA|MIR136_ENST00000385207.1_RNA|MIR431_ENST00000385266.1_RNA|MIR433_ENST00000384837.1_RNA|MIR127_ENST00000384876.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	574					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						TCGGAAGTCTCATCATCTGCT	0.557																																						dbGAP											0													60.0	56.0	57.0					14																	101349406		1568	3582	5150	-	-	-	SO:0001583	missense	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.1720G>A	14.37:g.101349406C>T	ENSP00000435342:p.Glu574Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag,superfamily_Peptidase_aspartic	p.E574K	ENST00000534062.1	37	c.1720	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	C	18.02	3.530759	0.64860	.	.	ENSG00000254656	ENST00000534062	T	0.24350	1.86	3.71	3.71	0.42584	.	0.000000	0.34879	N	0.003615	T	0.46964	0.1420	M	0.78344	2.41	0.25178	N	0.990226	D	0.76494	0.999	D	0.63488	0.915	T	0.32693	-0.9897	10	0.33940	T	0.23	.	13.7738	0.63041	0.0:1.0:0.0:0.0	.	574	E9PKS8	.	K	574	ENSP00000435342:E574K	ENSP00000435342:E574K	E	-	1	0	RTL1	100419159	0.998000	0.40836	0.997000	0.53966	0.986000	0.74619	2.141000	0.42168	2.369000	0.80426	0.591000	0.81541	GAG	RTL1	-	NULL	ENSG00000254656		0.557	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	23	0.00	0	C	NM_001134888		101349406	101349406	-1	no_errors	ENST00000534062	ensembl	human	known	69_37n	missense	60	28.57	24	SNP	0.970	T
RTTN	25914	genome.wustl.edu	37	18	67833354	67833354	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr18:67833354G>T	ENST00000255674.6	-	14	2159	c.1873C>A	c.(1873-1875)Cac>Aac	p.H625N	RTTN_ENST00000437017.1_Missense_Mutation_p.H625N|RTTN_ENST00000454359.1_Missense_Mutation_p.H625N	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	625					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				GGCAATGGGTGAGACAACATA	0.418																																						dbGAP											0													82.0	80.0	80.0					18																	67833354		1923	4146	6069	-	-	-	SO:0001583	missense	0			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.1873C>A	18.37:g.67833354G>T	ENSP00000255674:p.His625Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.H625N	ENST00000255674.6	37	c.1873	CCDS42443.1	18	.	.	.	.	.	.	.	.	.	.	G	15.52	2.856992	0.51376	.	.	ENSG00000176225	ENST00000255674;ENST00000454359;ENST00000437017	T;T;T	0.63580	3.63;-0.05;-0.05	5.42	4.43	0.53597	Armadillo-type fold (1);	0.053753	0.64402	D	0.000001	T	0.74359	0.3706	M	0.66939	2.045	0.49389	D	0.999783	D	0.89917	1.0	D	0.66196	0.942	T	0.76903	-0.2787	10	0.72032	D	0.01	.	12.6966	0.57008	0.111:0.0:0.889:0.0	.	625	Q86VV8	RTTN_HUMAN	N	625	ENSP00000255674:H625N;ENSP00000402352:H625N;ENSP00000399520:H625N	ENSP00000255674:H625N	H	-	1	0	RTTN	65984334	1.000000	0.71417	0.995000	0.50966	0.680000	0.39746	5.601000	0.67606	2.526000	0.85167	0.585000	0.79938	CAC	RTTN	-	superfamily_ARM-type_fold	ENSG00000176225		0.418	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTTN	HGNC	protein_coding	OTTHUMT00000442988.1	61	0.00	0	G	NM_173630		67833354	67833354	-1	no_errors	ENST00000255674	ensembl	human	known	69_37n	missense	52	25.35	18	SNP	1.000	T
RYR2	6262	genome.wustl.edu	37	1	237670043	237670043	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:237670043G>C	ENST00000366574.2	+	23	2964	c.2647G>C	c.(2647-2649)Gaa>Caa	p.E883Q	RYR2_ENST00000360064.6_Missense_Mutation_p.E881Q|RYR2_ENST00000542537.1_Missense_Mutation_p.E867Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	883	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAGAATAAGAGAAAAACTGGC	0.348																																						dbGAP											0													97.0	97.0	97.0					1																	237670043		1817	4079	5896	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2647G>C	1.37:g.237670043G>C	ENSP00000355533:p.Glu883Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E881Q	ENST00000366574.2	37	c.2641	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.355883	0.82243	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.93307	-3.2;-3.2;-3.2	5.49	5.49	0.81192	Ryanodine receptor Ryr (1);	0.000000	0.64402	D	0.000004	D	0.96306	0.8795	M	0.70842	2.15	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.95345	0.8441	10	0.38643	T	0.18	.	19.3546	0.94407	0.0:0.0:1.0:0.0	.	883	Q92736	RYR2_HUMAN	Q	883;881;867	ENSP00000355533:E883Q;ENSP00000353174:E881Q;ENSP00000443798:E867Q	ENSP00000353174:E881Q	E	+	1	0	RYR2	235736666	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.009000	0.88606	2.568000	0.86640	0.585000	0.79938	GAA	RYR2	-	pfam_Ryanodine_rcpt,prints_Ryan_recept	ENSG00000198626		0.348	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	217	0.00	0	G	NM_001035		237670043	237670043	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	212	19.70	52	SNP	1.000	C
RYR3	6263	genome.wustl.edu	37	15	33765740	33765740	+	Splice_Site	SNP	G	G	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr15:33765740G>T	ENST00000389232.4	+	2	241		c.e2+1		RYR3_ENST00000415757.3_Splice_Site	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3						calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGAAGCCAAGGTGAGATTGGC	0.537																																						dbGAP											0													66.0	67.0	67.0					15																	33765740		2044	4183	6227	-	-	-	SO:0001630	splice_region_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.171+1G>T	15.37:g.33765740G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Splice_Site	SNP	-	e2+1	ENST00000389232.4	37	c.171+1	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497893	0.85069	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	.	.	.	4.86	4.86	0.63082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.924	0.86170	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RYR3	31553032	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	9.149000	0.94659	2.508000	0.84585	0.650000	0.86243	.	RYR3	-	-	ENSG00000198838		0.537	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	21	0.00	0	G		Intron	33765740	33765740	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	splice_site	28	49.09	27	SNP	1.000	T
SAMD9	54809	genome.wustl.edu	37	7	92732458	92732458	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:92732458G>A	ENST00000379958.2	-	3	3222	c.2953C>T	c.(2953-2955)Cac>Tac	p.H985Y		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	985						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			ATCAAAGAGTGAATGATGCGT	0.378																																						dbGAP											0													123.0	119.0	120.0					7																	92732458		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.2953C>T	7.37:g.92732458G>A	ENSP00000369292:p.His985Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.H985Y	ENST00000379958.2	37	c.2953	CCDS34680.1	7	.	.	.	.	.	.	.	.	.	.	G	12.82	2.052288	0.36181	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.45276	0.9;1.77	4.88	4.88	0.63580	.	0.070785	0.53938	D	0.000054	T	0.59183	0.2175	M	0.67397	2.05	0.37081	D	0.899003	D	0.76494	0.999	D	0.65233	0.933	T	0.67601	-0.5629	10	0.87932	D	0	-7.4954	12.6433	0.56721	0.0:0.0:0.834:0.166	.	985	Q5K651	SAMD9_HUMAN	Y	985	ENSP00000369292:H985Y;ENSP00000414529:H985Y	ENSP00000369292:H985Y	H	-	1	0	SAMD9	92570394	1.000000	0.71417	0.993000	0.49108	0.256000	0.26092	7.291000	0.78721	2.547000	0.85894	0.609000	0.83330	CAC	SAMD9	-	NULL	ENSG00000205413		0.378	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	HGNC	protein_coding	OTTHUMT00000341761.1	200	0.00	0	G	NM_017654		92732458	92732458	-1	no_errors	ENST00000379958	ensembl	human	known	69_37n	missense	168	20.00	42	SNP	1.000	A
SCN10A	6336	genome.wustl.edu	37	3	38755529	38755529	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:38755529C>T	ENST00000449082.2	-	21	3723	c.3724G>A	c.(3724-3726)Gaa>Aaa	p.E1242K		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1242					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GGAGCCACTTCAGAATATTCC	0.512																																						dbGAP											0													118.0	116.0	116.0					3																	38755529		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3724G>A	3.37:g.38755529C>T	ENSP00000390600:p.Glu1242Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.E1242K	ENST00000449082.2	37	c.3724	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	C	16.92	3.254180	0.59212	.	.	ENSG00000185313	ENST00000449082	D	0.97352	-4.35	4.23	3.35	0.38373	Ion transport (1);	0.238566	0.40144	N	0.001172	D	0.93501	0.7926	L	0.35341	1.055	0.20403	N	0.999906	B	0.24317	0.101	B	0.31442	0.13	D	0.88106	0.2822	10	0.72032	D	0.01	.	6.9908	0.24753	0.0:0.687:0.1452:0.1679	.	1242	Q9Y5Y9	SCNAA_HUMAN	K	1242	ENSP00000390600:E1242K	ENSP00000390600:E1242K	E	-	1	0	SCN10A	38730533	1.000000	0.71417	0.044000	0.18714	0.574000	0.36063	4.345000	0.59360	0.980000	0.38523	0.411000	0.27672	GAA	SCN10A	-	pfam_Ion_trans_dom	ENSG00000185313		0.512	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	50	0.00	0	C	NM_006514		38755529	38755529	-1	no_errors	ENST00000449082	ensembl	human	known	69_37n	missense	49	27.94	19	SNP	0.505	T
SCN3A	6328	genome.wustl.edu	37	2	165946941	165946941	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:165946941G>A	ENST00000360093.3	-	28	6213	c.5722C>T	c.(5722-5724)Cag>Tag	p.Q1908*	SCN3A_ENST00000283254.7_Nonsense_Mutation_p.Q1908*|AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000465043.1_5'Flank|SCN3A_ENST00000409101.3_Nonsense_Mutation_p.Q1859*|SCN3A_ENST00000540861.1_Nonsense_Mutation_p.Q391*	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1908	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAATTACGCTGAATGATAGCG	0.363																																						dbGAP											0													74.0	71.0	72.0					2																	165946941		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.5722C>T	2.37:g.165946941G>A	ENSP00000353206:p.Gln1908*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.Q1908*	ENST00000360093.3	37	c.5722		2	.	.	.	.	.	.	.	.	.	.	G	48	14.345472	0.99791	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	.	.	.	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	.	.	.	X	1908;1908;1859;391	.	ENSP00000283254:Q1908X	Q	-	1	0	SCN3A	165655187	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.861000	0.98227	0.655000	0.94253	CAG	SCN3A	-	pfscan_IQ_motif_EF-hand-BS	ENSG00000153253		0.363	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		132	0.00	0	G	NM_006922		165946941	165946941	-1	no_errors	ENST00000283254	ensembl	human	known	69_37n	nonsense	67	24.72	22	SNP	1.000	A
SCN8A	6334	genome.wustl.edu	37	12	52078046	52078046	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:52078046G>C	ENST00000354534.6	+	3	543	c.365G>C	c.(364-366)aGa>aCa	p.R122T	SCN8A_ENST00000545061.1_Missense_Mutation_p.R122T|SCN8A_ENST00000550891.1_Missense_Mutation_p.R122T	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	122					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	AACCTGATAAGAAGAATAGCT	0.373																																						dbGAP											0													73.0	74.0	74.0					12																	52078046		1846	4096	5942	-	-	-	SO:0001583	missense	0			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.365G>C	12.37:g.52078046G>C	ENSP00000346534:p.Arg122Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.R122T	ENST00000354534.6	37	c.365	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	G	18.66	3.671633	0.67928	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D;D	0.98455	-4.94;-4.66;-4.94;-4.82	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.98115	0.9378	H	0.96518	3.835	0.80722	D	1	P	0.48764	0.915	B	0.33750	0.169	D	0.99920	1.1250	10	0.87932	D	0	.	18.5569	0.91088	0.0:0.0:1.0:0.0	.	122	Q9UQD0	SCN8A_HUMAN	T	122;122;122;122;35	ENSP00000448415:R122T;ENSP00000346534:R122T;ENSP00000440360:R122T;ENSP00000347255:R122T	ENSP00000346534:R122T	R	+	2	0	SCN8A	50364313	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.636000	0.98440	2.696000	0.92011	0.655000	0.94253	AGA	SCN8A	-	NULL	ENSG00000196876		0.373	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	122	0.00	0	G	NM_014191		52078046	52078046	+1	no_errors	ENST00000354534	ensembl	human	known	69_37n	missense	93	24.39	30	SNP	1.000	C
SCPEP1	59342	genome.wustl.edu	37	17	55065576	55065576	+	Splice_Site	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:55065576G>C	ENST00000262288.3	+	5	526		c.e5-1		SCPEP1_ENST00000571898.1_Splice_Site	NM_021626.2	NP_067639.1	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1						negative regulation of blood pressure (GO:0045776)|positive regulation of vasodilation (GO:0045909)|retinoic acid metabolic process (GO:0042573)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	14	Breast(9;2.86e-08)					TTTCTTGCTAGACAGTTCCAT	0.338																																						dbGAP											0													142.0	139.0	140.0					17																	55065576		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF282618	CCDS11593.1	17q22	2012-09-20			ENSG00000121064	ENSG00000121064			29507	protein-coding gene	gene with protein product	"""retinoid inducible serine carboxypeptidase"""					11447226, 12975309	Standard	NM_021626		Approved	RISC	uc002iuv.4	Q9HB40	OTTHUMG00000178129	ENST00000262288.3:c.472-1G>C	17.37:g.55065576G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96A94|Q9H3F0	Splice_Site	SNP	-	e5-1	ENST00000262288.3	37	c.472-1	CCDS11593.1	17	.	.	.	.	.	.	.	.	.	.	G	20.9	4.069041	0.76301	.	.	ENSG00000121064	ENST00000262288	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8407	0.96681	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SCPEP1	52420575	1.000000	0.71417	0.896000	0.35187	0.929000	0.56500	8.802000	0.91910	2.763000	0.94921	0.563000	0.77884	.	SCPEP1	-	-	ENSG00000121064		0.338	SCPEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCPEP1	HGNC	protein_coding	OTTHUMT00000440622.1	260	0.00	0	G	NM_021626	Intron	55065576	55065576	+1	no_errors	ENST00000262288	ensembl	human	known	69_37n	splice_site	211	18.53	48	SNP	1.000	C
SCYL3	57147	genome.wustl.edu	37	1	169831924	169831924	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:169831924C>A	ENST00000367770.1	-	9	1017	c.970G>T	c.(970-972)Gaa>Taa	p.E324*	RN7SL333P_ENST00000476398.2_RNA|SCYL3_ENST00000367771.6_Nonsense_Mutation_p.E324*|SCYL3_ENST00000470238.1_5'UTR|SCYL3_ENST00000367772.4_Nonsense_Mutation_p.E324*			Q8IZE3	PACE1_HUMAN	SCY1-like 3 (S. cerevisiae)	324					cell migration (GO:0016477)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CAAGGAGTTTCTCCCTGCGCA	0.438																																						dbGAP											0													112.0	104.0	107.0					1																	169831924		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC014662	CCDS1286.1, CCDS1287.1	1q24.2	2008-02-05			ENSG00000000457	ENSG00000000457			19285	protein-coding gene	gene with protein product	"""ezrin-binding partner PACE-1"""	608192				12651155	Standard	NM_020423		Approved	PACE-1, PACE1	uc001ggs.3	Q8IZE3	OTTHUMG00000035941	ENST00000367770.1:c.970G>T	1.37:g.169831924C>A	ENSP00000356744:p.Glu324*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Z2|Q5THA6|Q5THA8|Q8IZN9|Q96C56|Q9UBK6	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_HEAT_type_2,pfscan_Prot_kinase_cat_dom	p.E324*	ENST00000367770.1	37	c.970	CCDS1287.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.476895	0.98309	.	.	ENSG00000000457	ENST00000367772;ENST00000367771;ENST00000367770;ENST00000423670	.	.	.	5.58	4.66	0.58398	.	0.612883	0.18744	N	0.132380	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.0709	7.018	0.24899	0.0:0.5721:0.3196:0.1083	.	.	.	.	X	324	.	ENSP00000356744:E324X	E	-	1	0	SCYL3	168098548	1.000000	0.71417	0.650000	0.29550	0.764000	0.43329	1.864000	0.39469	1.334000	0.45468	0.609000	0.83330	GAA	SCYL3	-	superfamily_ARM-type_fold	ENSG00000000457		0.438	SCYL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL3	HGNC	protein_coding	OTTHUMT00000087550.4	12	0.00	0	C	NM_181093		169831924	169831924	-1	no_errors	ENST00000367770	ensembl	human	known	69_37n	nonsense	41	20.75	11	SNP	0.998	A
SH3YL1	26751	genome.wustl.edu	37	2	230038	230038	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:230038C>G	ENST00000405430.1	-	10	1085	c.709G>C	c.(709-711)Gaa>Caa	p.E237Q	SH3YL1_ENST00000356150.5_Missense_Mutation_p.E237Q|SH3YL1_ENST00000468321.1_5'UTR|SH3YL1_ENST00000403657.1_Missense_Mutation_p.E141Q|SH3YL1_ENST00000403712.2_Missense_Mutation_p.E237Q|SH3YL1_ENST00000403658.1_Missense_Mutation_p.E141Q|SH3YL1_ENST00000415006.2_Missense_Mutation_p.E141Q			Q96HL8	SH3Y1_HUMAN	SH3 and SYLF domain containing 1	237					phosphatidylinositol biosynthetic process (GO:0006661)|regulation of ruffle assembly (GO:1900027)	ruffle membrane (GO:0032587)	phosphatase binding (GO:0019902)|phosphatidylinositol binding (GO:0035091)			large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.034)		all cancers(51;0.000647)|Epithelial(75;0.0043)|OV - Ovarian serous cystadenocarcinoma(76;0.00871)|GBM - Glioblastoma multiforme(21;0.148)		GGAGGTAATTCTTTAGCCTGG	0.348																																						dbGAP											0													72.0	68.0	69.0					2																	230038		1845	4092	5937	-	-	-	SO:0001583	missense	0				CCDS42646.1, CCDS42646.2, CCDS54332.1, CCDS62841.1	2p25.3	2013-10-18	2013-10-18		ENSG00000035115	ENSG00000035115			29546	protein-coding gene	gene with protein product			"""SH3 domain containing, Ysc84-like 1 (S. cerevisiae)"""			21624956	Standard	NM_001282687		Approved	Ray, DKFZP586F1318	uc002qvx.3	Q96HL8	OTTHUMG00000151359	ENST00000405430.1:c.709G>C	2.37:g.230038C>G	ENSP00000384269:p.Glu237Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8E7|B7WNJ4|B7WPL6|Q8NEL2|Q9H5X4|Q9Y3V5	Missense_Mutation	SNP	pfam_Ysc84_actin-binding,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,prints_SH3_domain,pfscan_SH3_domain	p.E237Q	ENST00000405430.1	37	c.709		2	.	.	.	.	.	.	.	.	.	.	C	2.774	-0.255106	0.05829	.	.	ENSG00000035115	ENST00000415006;ENST00000403712;ENST00000403657;ENST00000405430;ENST00000356150;ENST00000403658;ENST00000451005;ENST00000431160	T;T;T;T;T;T;T	0.23147	2.14;2.1;2.11;1.99;1.99;2.11;1.92	4.92	4.92	0.64577	.	0.719106	0.13343	N	0.395026	T	0.16896	0.0406	N	0.19112	0.55	0.32545	N	0.533164	P;B;B;P	0.37864	0.467;0.145;0.201;0.61	B;B;B;B	0.35971	0.154;0.099;0.068;0.215	T	0.06826	-1.0805	10	0.15066	T	0.55	-24.4679	13.9765	0.64277	0.0:1.0:0.0:0.0	.	141;237;237;141	Q96HL8-4;Q96HL8-2;Q96HL8;Q96HL8-3	.;.;SH3Y1_HUMAN;.	Q	141;237;141;237;237;141;169;193	ENSP00000404143:E141Q;ENSP00000384276:E237Q;ENSP00000385668:E141Q;ENSP00000384269:E237Q;ENSP00000348471:E237Q;ENSP00000383928:E141Q;ENSP00000416312:E169Q	ENSP00000348471:E237Q	E	-	1	0	SH3YL1	220038	0.985000	0.35326	0.623000	0.29173	0.054000	0.15201	3.676000	0.54612	2.431000	0.82371	0.462000	0.41574	GAA	SH3YL1	-	NULL	ENSG00000035115		0.348	SH3YL1-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SH3YL1	HGNC	protein_coding	OTTHUMT00000322352.1	128	0.00	0	C	NM_015677		230038	230038	-1	no_errors	ENST00000356150	ensembl	human	known	69_37n	missense	96	25.58	33	SNP	0.975	G
SIGLEC1	6614	genome.wustl.edu	37	20	3677446	3677446	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr20:3677446G>A	ENST00000344754.4	-	10	2469	c.2470C>T	c.(2470-2472)Ctg>Ttg	p.L824L	SIGLEC1_ENST00000202578.4_Silent_p.L824L	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	824	Ig-like C2-type 8.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						AGCAAGGCCAGGGGGCGGCTG	0.637																																						dbGAP											0													43.0	41.0	42.0					20																	3677446		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.2470C>T	20.37:g.3677446G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L824	ENST00000344754.4	37	c.2470	CCDS13060.1	20																																																																																			SIGLEC1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000088827		0.637	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC1	HGNC	protein_coding	OTTHUMT00000077761.2	10	0.00	0	G	NM_023068		3677446	3677446	-1	no_errors	ENST00000344754	ensembl	human	known	69_37n	silent	13	27.78	5	SNP	0.035	A
SIGLEC7	27036	genome.wustl.edu	37	19	51645628	51645630	+	Start_Codon_Del	DEL	TGC	TGC	-			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	TGC	TGC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:51645628_51645630delTGC	ENST00000317643.6	+	0	71_73				SIGLEC7_ENST00000305628.7_Start_Codon_Del|SIGLEC7_ENST00000600577.1_Start_Codon_Del	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7						cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		ACCCCAGATAtgctgctgctgct	0.596																																						dbGAP											0																																										-	-	-	SO:0001582	initiator_codon_variant	0			AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895		19.37:g.51645637_51645639delTGC		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	In_Frame_Del	DEL	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L5in_frame_del	ENST00000317643.6	37	c.2_4	CCDS12826.1	19																																																																																			SIGLEC7	-	NULL	ENSG00000168995		0.596	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC7	HGNC	protein_coding	OTTHUMT00000464226.2	23	0.00	0	TGC	NM_016543		51645628	51645630	+1	no_errors	ENST00000317643	ensembl	human	known	69_37n	in_frame_del	31	11.43	4	DEL	0.564:0.611:0.635	-
SIRPB1	10326	genome.wustl.edu	37	20	1559202	1559202	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr20:1559202C>G	ENST00000381605.4	-	2	279	c.215G>C	c.(214-216)gGa>gCa	p.G72A	SIRPB1_ENST00000262929.5_Missense_Mutation_p.G71A|SIRPB1_ENST00000381603.3_Missense_Mutation_p.G72A|RP4-576H24.4_ENST00000564763.1_Missense_Mutation_p.G72A	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	72	Ig-like V-type.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						CCGGCCTGCTCCAGCTCCTCT	0.512																																						dbGAP											0													143.0	130.0	134.0					20																	1559202		2195	4238	6433	-	-	-	SO:0001583	missense	0			Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.215G>C	20.37:g.1559202C>G	ENSP00000371018:p.Gly72Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_C1-set,pfscan_Ig-like	p.G72A	ENST00000381605.4	37	c.215	CCDS13019.1	20	.	.	.	.	.	.	.	.	.	.	.	11.62	1.692979	0.30052	.	.	ENSG00000101307	ENST00000381605;ENST00000381603;ENST00000262929	T;T;T	0.03982	3.74;3.74;3.74	2.36	0.211	0.15236	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.765456	0.12063	N	0.502935	T	0.19087	0.0458	M	0.88181	2.935	0.09310	N	1	D;D	0.76494	0.999;0.993	D;D	0.72075	0.976;0.957	T	0.07947	-1.0746	10	0.72032	D	0.01	.	3.4817	0.07605	0.0:0.563:0.2688:0.1682	.	72;72	O00241;O00241-2	SIRB1_HUMAN;.	A	72;72;71	ENSP00000371018:G72A;ENSP00000371016:G72A;ENSP00000262929:G71A	ENSP00000262929:G71A	G	-	2	0	SIRPB1	1507202	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.044000	0.12023	-0.055000	0.13244	-0.502000	0.04539	GGA	SIRPB1	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	ENSG00000101307		0.512	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIRPB1	HGNC	protein_coding	OTTHUMT00000077555.2	146	0.00	0	C	NM_006065		1559202	1559202	-1	no_errors	ENST00000381605	ensembl	human	known	69_37n	missense	111	32.73	54	SNP	0.001	G
SIRT2	22933	genome.wustl.edu	37	19	39371529	39371529	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:39371529C>T	ENST00000249396.7	-	12	1057	c.756G>A	c.(754-756)ctG>ctA	p.L252L	SIRT2_ENST00000392081.2_Silent_p.L215L|SIRT2_ENST00000358931.5_Silent_p.L252L|RINL_ENST00000591812.1_5'Flank|RINL_ENST00000340740.3_5'Flank	NM_012237.3	NP_036369.2	Q8IXJ6	SIR2_HUMAN	sirtuin 2	252	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.|Peptide inhibitor binding.				autophagy (GO:0006914)|cellular lipid catabolic process (GO:0044242)|cellular response to caloric restriction (GO:0061433)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to hypoxia (GO:0071456)|cellular response to molecule of bacterial origin (GO:0071219)|cellular response to oxidative stress (GO:0034599)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|chromatin silencing at telomere (GO:0006348)|gene silencing (GO:0016458)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|innate immune response (GO:0045087)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|myelination in peripheral nervous system (GO:0022011)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)|negative regulation of defense response to bacterium (GO:1900425)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of oligodendrocyte progenitor proliferation (GO:0070446)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of cell division (GO:0051781)|positive regulation of DNA binding (GO:0043388)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of meiosis (GO:0045836)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)|protein kinase B signaling (GO:0043491)|regulation of cell cycle (GO:0051726)|regulation of exit from mitosis (GO:0007096)|regulation of myelination (GO:0031641)|regulation of phosphorylation (GO:0042325)|response to redox state (GO:0051775)|ripoptosome assembly involved in necroptotic process (GO:1901026)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)	centriole (GO:0005814)|centrosome (GO:0005813)|chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|glial cell projection (GO:0097386)|juxtaparanode region of axon (GO:0044224)|lateral loop (GO:0043219)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|myelin sheath (GO:0043209)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|spindle (GO:0005819)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|NAD-dependent protein deacetylase activity (GO:0034979)|protein deacetylase activity (GO:0033558)|transcription factor binding (GO:0008134)|tubulin deacetylase activity (GO:0042903)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)	9	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)			GGTCCACCTTCAGGAAGTCCT	0.692																																						dbGAP											0													55.0	54.0	55.0					19																	39371529		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF083107	CCDS12523.1, CCDS46069.1, CCDS74361.1	19q13	2010-06-25	2010-06-25		ENSG00000068903	ENSG00000068903			10886	protein-coding gene	gene with protein product		604480	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 2"", ""sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae)"""	SIR2L		10393250, 10381378	Standard	NM_012237		Approved		uc002ojt.2	Q8IXJ6	OTTHUMG00000150480	ENST00000249396.7:c.756G>A	19.37:g.39371529C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3V1|B2RB45|O95889|Q924Y7|Q9P0G8|Q9UNT0|Q9Y6E9|U5TP13	Silent	SNP	pfam_NAD-dep_deAcase_sirtuin,pirsf_NAD-dep_deAcase_SIR2_euk,pfscan_NAD-dep_deAcase_sirtuin	p.L252	ENST00000249396.7	37	c.756	CCDS12523.1	19																																																																																			SIRT2	-	pfam_NAD-dep_deAcase_sirtuin,pirsf_NAD-dep_deAcase_SIR2_euk,pfscan_NAD-dep_deAcase_sirtuin	ENSG00000068903		0.692	SIRT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIRT2	HGNC	protein_coding	OTTHUMT00000318278.1	12	0.00	0	C			39371529	39371529	-1	no_errors	ENST00000249396	ensembl	human	known	69_37n	silent	32	17.95	7	SNP	0.440	T
SLC16A12	387700	genome.wustl.edu	37	10	91198588	91198588	+	Silent	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:91198588G>C	ENST00000341233.4	-	6	1101	c.711C>G	c.(709-711)ctC>ctG	p.L237L	SLC16A12_ENST00000371790.4_Silent_p.L267L	NM_213606.3	NP_998771.3	Q6ZSM3	MOT12_HUMAN	solute carrier family 16, member 12	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|skin(1)|stomach(1)	14						AACAGCAACAGAGGCAAGTCT	0.458																																						dbGAP											0													119.0	108.0	112.0					10																	91198588		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS7404.1, CCDS7404.2	10q23.32	2013-07-18	2013-07-18		ENSG00000152779	ENSG00000152779		"""Solute carriers"""	23094	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 12"""	611910	"""solute carrier family 16 (monocarboxylic acid transporters), member 12"", ""solute carrier family 16, member 12 (monocarboxylic acid transporter 12)"""				Standard	NM_213606		Approved	MCT12	uc001kgm.3	Q6ZSM3	OTTHUMG00000018714	ENST00000341233.4:c.711C>G	10.37:g.91198588G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5M9M9|Q5T7J2|Q6ZV76	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L267	ENST00000341233.4	37	c.801		10																																																																																			SLC16A12	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000152779		0.458	SLC16A12-201	KNOWN	basic|appris_principal	protein_coding	SLC16A12	HGNC	protein_coding		91	0.00	0	G	NM_213606		91198588	91198588	-1	no_errors	ENST00000371790	ensembl	human	known	69_37n	silent	68	24.44	22	SNP	0.009	C
SLC28A2	9153	genome.wustl.edu	37	15	45564978	45564978	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr15:45564978C>T	ENST00000347644.3	+	17	1920	c.1855C>T	c.(1855-1857)Cag>Tag	p.Q619*	CTD-2651B20.3_ENST00000561404.1_RNA|CTD-2651B20.3_ENST00000560344.1_RNA|SLC28A2_ENST00000560767.1_3'UTR	NM_004212.3	NP_004203.2	O43868	S28A2_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 2	619					nucleobase-containing compound metabolic process (GO:0006139)|purine nucleoside transmembrane transport (GO:0015860)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside:sodium symporter activity (GO:0005415)|purine nucleoside transmembrane transporter activity (GO:0015211)	p.Q619E(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(4)|skin(1)	26		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	Mercaptopurine(DB01033)	AGGGCTCTTTCAGAGGTGAGC	0.522																																					NSCLC(92;493 1501 26361 28917 47116)	dbGAP											1	Substitution - Missense(1)	lung(1)											61.0	57.0	58.0					15																	45564978		2198	4298	6496	-	-	-	SO:0001587	stop_gained	0			U84392	CCDS10121.1	15q15	2013-07-17	2013-07-17		ENSG00000137860	ENSG00000137860		"""Solute carriers"""	11002	protein-coding gene	gene with protein product		606208	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 2"""			9435697	Standard	NM_004212		Approved	CNT2, SPNT1, HCNT2, HsT17153	uc001zva.2	O43868	OTTHUMG00000131426	ENST00000347644.3:c.1855C>T	15.37:g.45564978C>T	ENSP00000315006:p.Gln619*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7F9|O43239|Q52LZ0	Nonsense_Mutation	SNP	pfam_Nucleos_tra2_C,pfam_Nuclsd_transpt2,pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	p.Q619*	ENST00000347644.3	37	c.1855	CCDS10121.1	15	.	.	.	.	.	.	.	.	.	.	C	39	7.332511	0.98217	.	.	ENSG00000137860	ENST00000347644	.	.	.	5.99	5.99	0.97316	.	0.341315	0.34580	N	0.003845	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	-1.5246	15.9778	0.80083	0.0:1.0:0.0:0.0	.	.	.	.	X	619	.	ENSP00000315006:Q619X	Q	+	1	0	SLC28A2	43352270	0.996000	0.38824	1.000000	0.80357	0.949000	0.60115	2.156000	0.42310	2.840000	0.97914	0.655000	0.94253	CAG	SLC28A2	-	NULL	ENSG00000137860		0.522	SLC28A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC28A2	HGNC	protein_coding	OTTHUMT00000254219.2	42	0.00	0	C	NM_004212		45564978	45564978	+1	no_errors	ENST00000347644	ensembl	human	known	69_37n	nonsense	25	16.67	5	SNP	1.000	T
SLC2A13	114134	genome.wustl.edu	37	12	40265720	40265720	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:40265720C>T	ENST00000280871.4	-	5	1128	c.1078G>A	c.(1078-1080)Gat>Aat	p.D360N		NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	360					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				GCAAGTCTATCATCTTCAACA	0.423										HNSCC(50;0.14)																												dbGAP											0													72.0	66.0	68.0					12																	40265720		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.1078G>A	12.37:g.40265720C>T	ENSP00000280871:p.Asp360Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S07	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,superfamily_Plexin-like_fold,prints_Sugar/inositol_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.D360N	ENST00000280871.4	37	c.1078	CCDS8736.2	12	.	.	.	.	.	.	.	.	.	.	C	13.08	2.129743	0.37630	.	.	ENSG00000151229	ENST00000280871	T	0.75367	-0.93	5.72	5.72	0.89469	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.094441	0.64402	D	0.000001	T	0.54870	0.1885	N	0.05158	-0.105	0.80722	D	1	B	0.09022	0.002	B	0.14023	0.01	T	0.55250	-0.8170	10	0.06365	T	0.9	-24.2107	20.2406	0.98372	0.0:1.0:0.0:0.0	.	360	Q96QE2	MYCT_HUMAN	N	360	ENSP00000280871:D360N	ENSP00000280871:D360N	D	-	1	0	SLC2A13	38551987	1.000000	0.71417	0.987000	0.45799	0.707000	0.40811	7.531000	0.81973	2.857000	0.98124	0.650000	0.86243	GAT	SLC2A13	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000151229		0.423	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A13	HGNC	protein_coding	OTTHUMT00000132849.2	65	0.00	0	C			40265720	40265720	-1	no_errors	ENST00000280871	ensembl	human	known	69_37n	missense	63	18.18	14	SNP	1.000	T
SLC36A2	153201	genome.wustl.edu	37	5	150696593	150696593	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:150696593C>T	ENST00000335244.4	-	10	1366	c.1237G>A	c.(1237-1239)Gtg>Atg	p.V413M	SLC36A2_ENST00000450886.1_Missense_Mutation_p.V137M	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	413					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	GTGCCACTCACGGAGCCCACC	0.632																																						dbGAP											0													58.0	51.0	53.0					5																	150696593		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.1237G>A	5.37:g.150696593C>T	ENSP00000334223:p.Val413Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.V413M	ENST00000335244.4	37	c.1237	CCDS4315.1	5	.	.	.	.	.	.	.	.	.	.	C	15.59	2.877725	0.51801	.	.	ENSG00000186335	ENST00000335244;ENST00000450886	T;T	0.02472	4.28;4.28	4.92	1.16	0.20824	.	0.195687	0.44097	N	0.000493	T	0.04679	0.0127	L	0.55017	1.72	0.54753	D	0.999988	P	0.48350	0.909	P	0.47102	0.537	T	0.44559	-0.9320	10	0.56958	D	0.05	-12.8173	7.6343	0.28257	0.0:0.6102:0.1223:0.2675	.	413	Q495M3	S36A2_HUMAN	M	413;137	ENSP00000334223:V413M;ENSP00000399479:V137M	ENSP00000334223:V413M	V	-	1	0	SLC36A2	150676786	0.162000	0.22906	0.992000	0.48379	0.986000	0.74619	0.571000	0.23669	0.356000	0.24157	0.650000	0.86243	GTG	SLC36A2	-	pfam_AA_transpt_TM	ENSG00000186335		0.632	SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC36A2	HGNC	protein_coding	OTTHUMT00000252437.1	44	0.00	0	C			150696593	150696593	-1	no_errors	ENST00000335244	ensembl	human	known	69_37n	missense	66	18.52	15	SNP	0.954	T
SLC39A7	7922	genome.wustl.edu	37	6	33169325	33169325	+	Silent	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:33169325C>G	ENST00000374677.3	+	1	676	c.303C>G	c.(301-303)ctC>ctG	p.L101L	RXRB_ENST00000544186.1_5'Flank|RXRB_ENST00000374680.3_5'Flank|RXRB_ENST00000413614.2_5'Flank|RXRB_ENST00000374685.4_5'Flank|RNY4P10_ENST00000365571.1_RNA|SLC39A7_ENST00000374675.3_Silent_p.L101L	NM_006979.2	NP_008910.2	Q92504	S39A7_HUMAN	solute carrier family 39 (zinc transporter), member 7	101	His-rich.				transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						ATGAGAGCCTCTACCACAGAG	0.542																																						dbGAP											0													90.0	89.0	89.0					6																	33169325		2041	4209	6250	-	-	-	SO:0001819	synonymous_variant	0			AF117221	CCDS43453.1	6p21.3	2014-01-28		2003-10-27	ENSG00000112473	ENSG00000112473		"""Solute carriers"""	4927	protein-coding gene	gene with protein product		601416	"""HLA class II region expressed gene KE4"""	HKE4		8812499, 1855816, 19246244, 15705588	Standard	NM_006979		Approved	H2-KE4, D6S2244E, KE4, RING5, ZIP7	uc003odf.3	Q92504	OTTHUMG00000031238	ENST00000374677.3:c.303C>G	6.37:g.33169325C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B0UXF6|Q5STP8|Q9UIQ0	Silent	SNP	pfam_ZIP,prints_Kininogen	p.L101	ENST00000374677.3	37	c.303	CCDS43453.1	6																																																																																			SLC39A7	-	NULL	ENSG00000112473		0.542	SLC39A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC39A7	HGNC	protein_coding	OTTHUMT00000076499.2	17	0.00	0	C	NM_006979		33169325	33169325	+1	no_errors	ENST00000374675	ensembl	human	known	69_37n	silent	76	22.45	22	SNP	0.672	G
SLC4A3	6508	genome.wustl.edu	37	2	220501551	220501551	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:220501551C>T	ENST00000358055.3	+	16	3002	c.2490C>T	c.(2488-2490)ctC>ctT	p.L830L	SLC4A3_ENST00000317151.3_Silent_p.L830L|SLC4A3_ENST00000273063.6_Silent_p.L857L|SLC4A3_ENST00000373760.2_Silent_p.L830L|SLC4A3_ENST00000373762.3_Silent_p.L857L			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	830	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTGCCTTTCTCATCTCACTCA	0.567																																						dbGAP											0													176.0	165.0	169.0					2																	220501551		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.2490C>T	2.37:g.220501551C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Silent	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange_3,prints_Anion_exchange,tigrfam_HCO3_transpt_euk	p.L857	ENST00000358055.3	37	c.2571	CCDS2445.1	2																																																																																			SLC4A3	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000114923		0.567	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC4A3	HGNC	protein_coding	OTTHUMT00000316472.1	58	0.00	0	C	NM_005070		220501551	220501551	+1	no_errors	ENST00000273063	ensembl	human	known	69_37n	silent	124	23.46	38	SNP	1.000	T
SLX4	84464	genome.wustl.edu	37	16	3633370	3633370	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:3633370C>G	ENST00000294008.3	-	14	5521	c.4881G>C	c.(4879-4881)caG>caC	p.Q1627H	RP11-461A8.1_ENST00000573982.1_lincRNA	NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	1627	Interaction with MUS81.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						AGGCGAGGGTCTGGCAGTGAG	0.627								Direct reversal of damage																														dbGAP											0													74.0	73.0	73.0					16																	3633370		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.4881G>C	16.37:g.3633370C>G	ENSP00000294008:p.Gln1627His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.Q1627H	ENST00000294008.3	37	c.4881	CCDS10506.2	16	.	.	.	.	.	.	.	.	.	.	C	15.75	2.926957	0.52759	.	.	ENSG00000188827	ENST00000294008	T	0.01209	5.17	5.08	2.98	0.34508	.	0.328373	0.26180	N	0.025862	T	0.01835	0.0058	L	0.32530	0.975	0.09310	N	1	D	0.62365	0.991	P	0.51999	0.687	T	0.49204	-0.8964	10	0.66056	D	0.02	.	8.0563	0.30606	0.0:0.6104:0.3082:0.0814	.	1627	Q8IY92	SLX4_HUMAN	H	1627	ENSP00000294008:Q1627H	ENSP00000294008:Q1627H	Q	-	3	2	SLX4	3573371	0.012000	0.17670	0.262000	0.24481	0.047000	0.14425	-0.112000	0.10791	1.128000	0.42052	0.655000	0.94253	CAG	SLX4	-	NULL	ENSG00000188827		0.627	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLX4	HGNC	protein_coding	OTTHUMT00000157301.3	50	0.00	0	C	NM_032444		3633370	3633370	-1	no_errors	ENST00000294008	ensembl	human	known	69_37n	missense	158	18.04	35	SNP	0.000	G
SMARCA4	6597	genome.wustl.edu	37	19	11170495	11170495	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:11170495G>A	ENST00000429416.3	+	34	4983	c.4702G>A	c.(4702-4704)Gat>Aat	p.D1568N	SMARCA4_ENST00000444061.3_Missense_Mutation_p.D1534N|SMARCA4_ENST00000358026.2_Missense_Mutation_p.D1600N|SMARCA4_ENST00000413806.3_Missense_Mutation_p.D1538N|SMARCA4_ENST00000589677.1_Missense_Mutation_p.D1537N|SMARCA4_ENST00000541122.2_Missense_Mutation_p.D1538N|SMARCA4_ENST00000450717.3_Missense_Mutation_p.D1537N|SMARCA4_ENST00000590574.1_Missense_Mutation_p.D1535N|SMARCA4_ENST00000344626.4_Missense_Mutation_p.D1568N	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1568					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				Cgagaaggaggatgacagtga	0.597			"""F, N, Mis"""		NSCLC																																	dbGAP		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	1	Unknown(1)	lung(1)											52.0	46.0	48.0					19																	11170495		2203	4300	6503	-	-	-	SO:0001583	missense	0			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.4702G>A	19.37:g.11170495G>A	ENSP00000395654:p.Asp1568Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_HSA,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_Bromodomain,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain,prints_Bromodomain	p.D1600N	ENST00000429416.3	37	c.4798	CCDS12253.1	19	.	.	.	.	.	.	.	.	.	.	G	15.67	2.902030	0.52227	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2;2.2	4.05	4.05	0.47172	Bromodomain (1);	0.293918	0.31301	N	0.007887	T	0.17492	0.0420	L	0.34521	1.04	0.53688	D	0.999979	B;B;B;B;B;B	0.18610	0.0;0.0;0.0;0.029;0.0;0.0	B;B;B;B;B;B	0.14578	0.0;0.0;0.0;0.011;0.0;0.0	T	0.04268	-1.0964	10	0.32370	T	0.25	-16.3273	15.5023	0.75709	0.0:0.0:1.0:0.0	.	1537;1534;1535;1600;1538;1568	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;P51532	.;.;.;.;.;SMCA4_HUMAN	N	1568;1600;1602;1568;1535;1534;1537;1538	ENSP00000395654:D1568N;ENSP00000350720:D1600N;ENSP00000343896:D1568N;ENSP00000392837:D1534N;ENSP00000397783:D1537N;ENSP00000414727:D1538N	ENSP00000343896:D1568N	D	+	1	0	SMARCA4	11031495	1.000000	0.71417	0.990000	0.47175	0.865000	0.49528	9.426000	0.97469	2.262000	0.75019	0.561000	0.74099	GAT	SMARCA4	-	superfamily_Bromodomain	ENSG00000127616		0.597	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	HGNC	protein_coding	OTTHUMT00000452638.2	24	0.00	0	G	NM_003072		11170495	11170495	+1	no_errors	ENST00000358026	ensembl	human	known	69_37n	missense	62	16.22	12	SNP	1.000	A
RPL23A	6147	genome.wustl.edu	37	17	27049656	27049656	+	Intron	SNP	C	C	T	rs546580315		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:27049656C>T	ENST00000422514.2	+	3	822				SNORD4B_ENST00000459083.1_RNA|SNORD42A_ENST00000459584.1_RNA|AC010761.8_ENST00000582718.1_RNA|RPL23A_ENST00000472628.1_Intron|SNORD42B_ENST00000458893.1_RNA|SNORD4A_ENST00000459174.1_RNA|RPL23A_ENST00000394938.4_Intron|RPL23A_ENST00000496182.1_Intron	NM_000984.5	NP_000975.2	P62750	RL23A_HUMAN	ribosomal protein L23a						cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			endometrium(1)|lung(3)|ovary(1)	5	Lung NSC(42;0.00431)					ATTGGTACCTCGTTGTCTGAT	0.542													C|||	1	0.000199681	0.0	0.0	5008	,	,		21895	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													247.0	220.0	228.0					17																	27049656		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			U43701	CCDS11241.1	17q11.2	2011-04-06			ENSG00000198242	ENSG00000198242		"""L ribosomal proteins"""	10317	protein-coding gene	gene with protein product		602326				9417910	Standard	NM_000984		Approved	L23A	uc002hci.3	P62750	OTTHUMG00000132684	ENST00000422514.2:c.210-85C>T	17.37:g.27049656C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5B2|P29316|P39024|Q92774	RNA	SNP	-	NULL	ENST00000422514.2	37	NULL	CCDS11241.1	17																																																																																			SNORD4A	-	-	ENSG00000238578		0.542	RPL23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORD4A	HGNC	protein_coding	OTTHUMT00000255975.1	21	0.00	0	C	NM_000984		27049656	27049656	+1	no_errors	ENST00000459174	ensembl	human	known	69_37n	rna	35	18.60	8	SNP	0.010	T
SMG8	55181	genome.wustl.edu	37	17	57290598	57290598	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:57290598G>C	ENST00000543872.2	+	4	2678	c.2414G>C	c.(2413-2415)aGa>aCa	p.R805T	SMG8_ENST00000300917.5_Missense_Mutation_p.R805T|CTD-2510F5.6_ENST00000577660.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	805					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						ATCAGGACTAGAGCTGAAGAT	0.443																																						dbGAP											0													132.0	131.0	131.0					17																	57290598		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.2414G>C	17.37:g.57290598G>C	ENSP00000438748:p.Arg805Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	pfam_Smg8/Smg9	p.R805T	ENST00000543872.2	37	c.2414	CCDS11615.1	17	.	.	.	.	.	.	.	.	.	.	G	16.13	3.034548	0.54896	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.45276	0.9;0.9	6.07	6.07	0.98685	.	0.041463	0.85682	D	0.000000	T	0.46014	0.1371	L	0.53249	1.67	0.51767	D	0.999932	P	0.42078	0.77	P	0.45449	0.481	T	0.41197	-0.9522	10	0.59425	D	0.04	-22.095	12.8913	0.58073	0.0734:0.0:0.9266:0.0	.	805	Q8ND04	SMG8_HUMAN	T	805	ENSP00000300917:R805T;ENSP00000438748:R805T	ENSP00000300917:R805T	R	+	2	0	SMG8	54645380	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.690000	0.84178	2.885000	0.99019	0.655000	0.94253	AGA	SMG8	-	pfam_Smg8/Smg9	ENSG00000167447		0.443	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG8	HGNC	protein_coding	OTTHUMT00000445960.2	121	0.00	0	G	NM_018149		57290598	57290598	+1	no_errors	ENST00000300917	ensembl	human	known	69_37n	missense	114	30.91	51	SNP	1.000	C
SOX2	6657	genome.wustl.edu	37	3	181430398	181430398	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:181430398G>A	ENST00000325404.1	+	1	677	c.250G>A	c.(250-252)Gag>Aag	p.E84K	SOX2_ENST00000431565.2_Missense_Mutation_p.E84K	NM_003106.3	NP_003097.1	P48431	SOX2_HUMAN	SRY (sex determining region Y)-box 2	84					adenohypophysis development (GO:0021984)|cell cycle arrest (GO:0007050)|cerebral cortex development (GO:0021987)|chromatin organization (GO:0006325)|detection of mechanical stimulus involved in equilibrioception (GO:0050973)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|diencephalon morphogenesis (GO:0048852)|endodermal cell fate specification (GO:0001714)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|eye development (GO:0001654)|forebrain development (GO:0030900)|forebrain neuron differentiation (GO:0021879)|glial cell fate commitment (GO:0021781)|inner ear development (GO:0048839)|inner ear morphogenesis (GO:0042472)|lens induction in camera-type eye (GO:0060235)|lung alveolus development (GO:0048286)|male genitalia development (GO:0030539)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate commitment (GO:0048663)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|osteoblast differentiation (GO:0001649)|pigment biosynthetic process (GO:0046148)|pituitary gland development (GO:0021983)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to growth factor (GO:0070848)|response to retinoic acid (GO:0032526)|response to wounding (GO:0009611)|retina morphogenesis in camera-type eye (GO:0060042)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	10	all_cancers(143;1.22e-16)|Ovarian(172;0.0283)		all cancers(12;1.82e-48)|Epithelial(37;9.85e-40)|OV - Ovarian serous cystadenocarcinoma(80;7.37e-23)|Lung(8;2.01e-21)|GBM - Glioblastoma multiforme(1;2.13e-08)			ACTTTTGTCGGAGACGGAGAA	0.622			A		"""NSCLC, oesophageal squamous carcinoma"""		MICROPHTHALMIA AND ESOPHAGEAL ATRESIA SYNDROME																															dbGAP		Dom	yes		3	3q26.3-q27	6657	SRY (sex determining region Y)-box 2	yes	E	0													39.0	43.0	42.0					3																	181430398		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC013923	CCDS3239.1	3q26.3-q27	2014-09-17						"""SRY (sex determining region Y)-boxes"""	11195	protein-coding gene	gene with protein product		184429				7849401	Standard	NM_003106		Approved		uc003fkx.3	P48431		ENST00000325404.1:c.250G>A	3.37:g.181430398G>A	ENSP00000323588:p.Glu84Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14537	Missense_Mutation	SNP	pfam_TF_SOX,pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.E84K	ENST00000325404.1	37	c.250	CCDS3239.1	3	.	.	.	.	.	.	.	.	.	.	G	16.84	3.232755	0.58777	.	.	ENSG00000181449	ENST00000431565;ENST00000325404	D;D	0.98221	-4.8;-4.8	5.0	5.0	0.66597	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.055499	0.64402	N	0.000001	D	0.98842	0.9609	M	0.78456	2.415	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	D	0.99864	1.1087	10	0.87932	D	0	.	17.6633	0.88198	0.0:0.0:1.0:0.0	.	84	P48431	SOX2_HUMAN	K	84	ENSP00000439111:E84K;ENSP00000323588:E84K	ENSP00000323588:E84K	E	+	1	0	SOX2	182913092	1.000000	0.71417	0.999000	0.59377	0.159000	0.22180	9.754000	0.98908	2.473000	0.83533	0.561000	0.74099	GAG	SOX2	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000181449		0.622	SOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX2	HGNC	protein_coding	OTTHUMT00000350419.1	18	0.00	0	G	NM_003106		181430398	181430398	+1	no_errors	ENST00000325404	ensembl	human	known	69_37n	missense	28	26.32	10	SNP	1.000	A
SPDYE4	388333	genome.wustl.edu	37	17	8661642	8661642	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:8661642G>A	ENST00000328794.6	-	1	235	c.59C>T	c.(58-60)aCg>aTg	p.T20M		NM_001128076.1	NP_001121548.1	A6NLX3	SPDE4_HUMAN	speedy/RINGO cell cycle regulator family member E4	20										breast(1)|endometrium(2)|kidney(1)	4						GGACCGTACCGTTGTGCTAGG	0.572																																						dbGAP											0													30.0	32.0	31.0					17																	8661642		692	1591	2283	-	-	-	SO:0001583	missense	0			BC146949	CCDS45609.1	17p13.1	2013-05-08	2013-05-08			ENSG00000183318		"""Speedy homologs"""	35463	protein-coding gene	gene with protein product			"""speedy homolog E4 (Xenopus laevis)"""				Standard	NM_001128076		Approved		uc010cnz.1	A6NLX3		ENST00000328794.6:c.59C>T	17.37:g.8661642G>A	ENSP00000329522:p.Thr20Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUZ6	Missense_Mutation	SNP	pfam_Cell_cycle_regulatory_Spy1	p.T20M	ENST00000328794.6	37	c.59	CCDS45609.1	17	.	.	.	.	.	.	.	.	.	.	G	3.834	-0.035107	0.07543	.	.	ENSG00000183318	ENST00000328794	.	.	.	2.34	1.31	0.21738	.	1.247700	0.06220	N	0.686659	T	0.21841	0.0526	L	0.38175	1.15	0.09310	N	1	P	0.37997	0.614	B	0.15052	0.012	T	0.19418	-1.0306	9	0.46703	T	0.11	.	4.9445	0.13982	0.1907:0.0:0.8093:0.0	.	20	A6NLX3	SPDE4_HUMAN	M	20	.	ENSP00000329522:T20M	T	-	2	0	SPDYE4	8602367	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	1.324000	0.33712	0.303000	0.22785	0.467000	0.42956	ACG	SPDYE4	-	NULL	ENSG00000183318		0.572	SPDYE4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPDYE4	HGNC	protein_coding	OTTHUMT00000442494.1	28	0.00	0	G	NM_001128076		8661642	8661642	-1	no_errors	ENST00000328794	ensembl	human	known	69_37n	missense	51	16.39	10	SNP	0.001	A
SPG11	80208	genome.wustl.edu	37	15	44900705	44900705	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr15:44900705G>A	ENST00000261866.7	-	19	3406	c.3390C>T	c.(3388-3390)ctC>ctT	p.L1130L	SPG11_ENST00000535302.2_Silent_p.L1130L|SPG11_ENST00000558319.1_Silent_p.L1130L|SPG11_ENST00000427534.2_Silent_p.L1130L	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	1130					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		ACTGTGGGAAGAGAGCAGTTT	0.413																																						dbGAP											0													151.0	136.0	141.0					15																	44900705		2198	4298	6496	-	-	-	SO:0001819	synonymous_variant	0				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.3390C>T	15.37:g.44900705G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	NULL	p.S40F	ENST00000261866.7	37	c.119	CCDS10112.1	15																																																																																			SPG11	-	NULL	ENSG00000104133		0.413	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	HGNC	protein_coding	OTTHUMT00000253927.1	191	0.00	0	G			44900705	44900705	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000559754	ensembl	human	putative	69_37n	missense	143	19.66	35	SNP	0.970	A
SPTBN4	57731	genome.wustl.edu	37	19	41029470	41029470	+	Missense_Mutation	SNP	G	G	A	rs142716266		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:41029470G>A	ENST00000352632.3	+	17	3867	c.3781G>A	c.(3781-3783)Gct>Act	p.A1261T	SPTBN4_ENST00000392025.1_5'Flank|SPTBN4_ENST00000598249.1_Missense_Mutation_p.A1261T|SPTBN4_ENST00000344104.3_Missense_Mutation_p.A1261T|SPTBN4_ENST00000338932.3_Missense_Mutation_p.A1261T|SPTBN4_ENST00000595535.1_Missense_Mutation_p.A1261T			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1261					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGCCGTGCAGGCTGCAGAGGG	0.627																																						dbGAP											0													60.0	50.0	54.0					19																	41029470		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.3781G>A	19.37:g.41029470G>A	ENSP00000263373:p.Ala1261Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.A1261T	ENST00000352632.3	37	c.3781	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	g	12.25	1.882841	0.33255	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.34072	1.39;1.38;1.38	4.31	4.31	0.51392	.	0.000000	0.64402	U	0.000008	T	0.27663	0.0680	N	0.25485	0.75	0.80722	D	1	P;B	0.47106	0.89;0.089	B;B	0.42692	0.395;0.161	T	0.03112	-1.1071	10	0.16896	T	0.51	.	15.7579	0.78051	0.0:0.0:1.0:0.0	.	1261;1261	Q9H254;Q71S06	SPTN4_HUMAN;.	T	1261	ENSP00000263373:A1261T;ENSP00000340345:A1261T;ENSP00000340741:A1261T	ENSP00000340345:A1261T	A	+	1	0	SPTBN4	45721310	1.000000	0.71417	1.000000	0.80357	0.403000	0.30841	1.857000	0.39399	2.245000	0.73994	0.165000	0.16767	GCT	SPTBN4	-	pirsf_Spectrin_bsu,smart_Spectrin/alpha-actinin	ENSG00000160460		0.627	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	HGNC	protein_coding	OTTHUMT00000462559.2	9	0.00	0	G			41029470	41029470	+1	no_errors	ENST00000352632	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	1.000	A
SSC4D	136853	genome.wustl.edu	37	7	76023178	76023178	+	Silent	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:76023178G>C	ENST00000275560.3	-	8	1337	c.990C>G	c.(988-990)ctC>ctG	p.L330L	SRCRB4D_ENST00000492979.2_5'Flank	NM_080744.1	NP_542782.1														autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(9)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21						CGGCGGTGGTGAGCAGTGCTG	0.682																																						dbGAP											0													29.0	30.0	30.0					7																	76023178		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000275560.3:c.990C>G	7.37:g.76023178G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Srcr_rcpt	p.L330	ENST00000275560.3	37	c.990	CCDS5585.1	7																																																																																			SRCRB4D	-	NULL	ENSG00000146700		0.682	SRCRB4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCRB4D	HGNC	protein_coding	OTTHUMT00000253001.3	17	0.00	0	G			76023178	76023178	-1	no_errors	ENST00000275560	ensembl	human	known	69_37n	silent	48	20.00	12	SNP	0.001	C
STAG2	10735	genome.wustl.edu	37	X	123182867	123182867	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:123182867C>G	ENST00000371160.1	+	10	1122	c.832C>G	c.(832-834)Caa>Gaa	p.Q278E	STAG2_ENST00000354548.5_Missense_Mutation_p.Q209E|STAG2_ENST00000218089.9_Missense_Mutation_p.Q278E|STAG2_ENST00000371144.3_Missense_Mutation_p.Q278E|STAG2_ENST00000371145.3_Missense_Mutation_p.Q278E|STAG2_ENST00000371157.3_Missense_Mutation_p.Q278E|STAG2_ENST00000469481.1_Intron	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	278					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TCAGGAAAATCAAGATGAAAT	0.299																																						dbGAP											0													93.0	86.0	88.0					X																	123182867		2203	4297	6500	-	-	-	SO:0001583	missense	0			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.832C>G	X.37:g.123182867C>G	ENSP00000360202:p.Gln278Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.Q278E	ENST00000371160.1	37	c.832	CCDS14607.1	X	.	.	.	.	.	.	.	.	.	.	C	22.8	4.340520	0.81911	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51;1.51	5.61	5.61	0.85477	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.39759	0.1090	M	0.74647	2.275	0.80722	D	1	P;P	0.45474	0.699;0.859	B;B	0.43301	0.415;0.393	T	0.26916	-1.0089	10	0.21540	T	0.41	-3.5515	18.1337	0.89610	0.0:1.0:0.0:0.0	.	278;278	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	E	278;278;209;278;278;278;278	ENSP00000218089:Q278E;ENSP00000397265:Q278E;ENSP00000346555:Q209E;ENSP00000360202:Q278E;ENSP00000360199:Q278E;ENSP00000360187:Q278E;ENSP00000360186:Q278E	ENSP00000218089:Q278E	Q	+	1	0	STAG2	123010548	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.726000	0.84824	2.325000	0.78763	0.600000	0.82982	CAA	STAG2	-	superfamily_ARM-type_fold	ENSG00000101972		0.299	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	STAG2	HGNC	protein_coding	OTTHUMT00000156159.2	286	0.35	1	C	NM_006603		123182867	123182867	+1	no_errors	ENST00000218089	ensembl	human	known	69_37n	missense	205	22.64	60	SNP	1.000	G
STK31	56164	genome.wustl.edu	37	7	23766900	23766900	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:23766900G>A	ENST00000355870.3	+	5	409	c.290G>A	c.(289-291)aGa>aAa	p.R97K	STK31_ENST00000354639.3_Missense_Mutation_p.R74K|STK31_ENST00000428484.1_Missense_Mutation_p.R74K|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000433467.2_Missense_Mutation_p.R97K	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	97	Tudor. {ECO:0000255|PROSITE- ProRule:PRU00211}.					acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TGTTGGTACAGATGCAAAGTA	0.308																																						dbGAP											0													130.0	122.0	125.0					7																	23766900		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.290G>A	7.37:g.23766900G>A	ENSP00000348132:p.Arg97Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	pfam_Tudor,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tudor,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Tudor,pfscan_Prot_kinase_cat_dom	p.R97K	ENST00000355870.3	37	c.290	CCDS5386.1	7	.	.	.	.	.	.	.	.	.	.	G	32	5.137266	0.94517	.	.	ENSG00000196335	ENST00000355870;ENST00000422637;ENST00000456014;ENST00000433467;ENST00000354639;ENST00000444333;ENST00000428484	D;D;D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83	5.67	5.67	0.87782	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.000000	0.85682	D	0.000000	D	0.93109	0.7806	M	0.84082	2.675	0.49915	D	0.999833	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.93624	0.6950	10	0.87932	D	0	-16.9804	18.534	0.91002	0.0:0.0:1.0:0.0	.	97;97	B4DZ06;Q9BXU1	.;STK31_HUMAN	K	97;53;74;97;74;74;74	ENSP00000348132:R97K;ENSP00000414087:R53K;ENSP00000389340:R74K;ENSP00000411852:R97K;ENSP00000346660:R74K;ENSP00000398413:R74K;ENSP00000406146:R74K	ENSP00000346660:R74K	R	+	2	0	STK31	23733425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.105000	0.77031	2.677000	0.91161	0.650000	0.86243	AGA	STK31	-	pfam_Tudor,smart_Tudor,pfscan_Tudor	ENSG00000196335		0.308	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK31	HGNC	protein_coding	OTTHUMT00000214036.2	294	0.00	0	G	NM_031414		23766900	23766900	+1	no_errors	ENST00000355870	ensembl	human	known	69_37n	missense	264	15.87	50	SNP	1.000	A
STOX1	219736	genome.wustl.edu	37	10	70646331	70646331	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:70646331G>C	ENST00000298596.6	+	3	2862	c.2779G>C	c.(2779-2781)Gaa>Caa	p.E927Q	STOX1_ENST00000399162.2_Intron|STOX1_ENST00000421961.2_Missense_Mutation_p.E817Q|STOX1_ENST00000399165.4_Intron|STOX1_ENST00000399169.4_Missense_Mutation_p.E927Q	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	927						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						GGAAGGGACAGAAAATCACAG	0.453																																						dbGAP											0													68.0	67.0	67.0					10																	70646331		2002	4187	6189	-	-	-	SO:0001583	missense	0			AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.2779G>C	10.37:g.70646331G>C	ENSP00000298596:p.Glu927Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Missense_Mutation	SNP	pfam_Storkhead-box_winged-helix	p.E927Q	ENST00000298596.6	37	c.2779	CCDS41535.1	10	.	.	.	.	.	.	.	.	.	.	G	29.6	5.019583	0.93462	.	.	ENSG00000165730	ENST00000399169;ENST00000298596;ENST00000421961	T;T;T	0.80824	-1.42;-1.42;-1.1	6.02	6.02	0.97574	.	0.048106	0.85682	D	0.000000	D	0.89757	0.6807	M	0.72894	2.215	0.54753	D	0.999981	D	0.89917	1.0	D	0.74674	0.984	D	0.89400	0.3695	10	0.72032	D	0.01	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	927	Q6ZVD7	STOX1_HUMAN	Q	927;927;817	ENSP00000382121:E927Q;ENSP00000298596:E927Q;ENSP00000394509:E817Q	ENSP00000298596:E927Q	E	+	1	0	STOX1	70316337	1.000000	0.71417	0.997000	0.53966	0.940000	0.58332	9.102000	0.94226	2.865000	0.98341	0.655000	0.94253	GAA	STOX1	-	NULL	ENSG00000165730		0.453	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STOX1	HGNC	protein_coding	OTTHUMT00000276849.3	24	0.00	0	G	NM_152709		70646331	70646331	+1	no_errors	ENST00000298596	ensembl	human	known	69_37n	missense	24	29.41	10	SNP	1.000	C
STXBP5	134957	genome.wustl.edu	37	6	147660341	147660341	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:147660341G>A	ENST00000321680.6	+	20	2173	c.2173G>A	c.(2173-2175)Gat>Aat	p.D725N	STXBP5_ENST00000367480.3_Intron|STXBP5_ENST00000179882.6_Missense_Mutation_p.D396N|STXBP5_ENST00000367481.3_Intron	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	725					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		CAATTCAGATGATGAACAAAA	0.279																																						dbGAP											0													152.0	115.0	126.0					6																	147660341		692	1587	2279	-	-	-	SO:0001583	missense	0			AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.2173G>A	6.37:g.147660341G>A	ENSP00000321826:p.Asp725Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.D725N	ENST00000321680.6	37	c.2173	CCDS47499.1	6	.	.	.	.	.	.	.	.	.	.	G	12.39	1.924663	0.34002	.	.	ENSG00000164506	ENST00000321680;ENST00000179882	T;T	0.21361	2.01;2.01	5.03	5.03	0.67393	.	0.373118	0.28343	N	0.015695	T	0.09992	0.0245	L	0.43152	1.355	0.52501	D	0.999957	B;B;B	0.19583	0.0;0.037;0.037	B;B;B	0.09377	0.001;0.003;0.004	T	0.08391	-1.0724	10	0.15952	T	0.53	.	18.709	0.91649	0.0:0.0:1.0:0.0	.	66;725;396	Q5JRH1;Q5T5C0;B3KXX0	.;STXB5_HUMAN;.	N	725;396	ENSP00000321826:D725N;ENSP00000179882:D396N	ENSP00000179882:D396N	D	+	1	0	STXBP5	147702034	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.168000	0.89670	2.483000	0.83821	0.585000	0.79938	GAT	STXBP5	-	NULL	ENSG00000164506		0.279	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STXBP5	HGNC	protein_coding	OTTHUMT00000042606.1	268	0.37	1	G			147660341	147660341	+1	no_errors	ENST00000321680	ensembl	human	known	69_37n	missense	149	17.68	32	SNP	1.000	A
SUGP2	10147	genome.wustl.edu	37	19	19136939	19136939	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:19136939C>G	ENST00000601879.1	-	3	515	c.218G>C	c.(217-219)aGa>aCa	p.R73T	SUGP2_ENST00000600377.1_Missense_Mutation_p.R87T|SUGP2_ENST00000598202.1_5'UTR|SUGP2_ENST00000337018.6_Missense_Mutation_p.R73T|SUGP2_ENST00000456085.2_5'UTR|SUGP2_ENST00000452918.2_Missense_Mutation_p.R73T			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	73					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TCCGGCATCTCTAGAGTGAGC	0.498																																						dbGAP											0													62.0	53.0	56.0					19																	19136939		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.218G>C	19.37:g.19136939C>G	ENSP00000472286:p.Arg73Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Missense_Mutation	SNP	pfam_Surp,pfam_G_patch_dom,superfamily_Surp,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.R73T	ENST00000601879.1	37	c.218	CCDS12392.1	19	.	.	.	.	.	.	.	.	.	.	C	6.487	0.458067	0.12342	.	.	ENSG00000064607	ENST00000337018;ENST00000330854;ENST00000452918	T;T;T	0.11495	2.77;2.77;2.77	4.91	2.71	0.32032	.	0.324082	0.22273	N	0.062224	T	0.05823	0.0152	N	0.19112	0.55	0.19300	N	0.999974	P;B	0.42827	0.791;0.18	B;B	0.38428	0.273;0.017	T	0.29488	-1.0010	10	0.39692	T	0.17	-1.4125	4.7738	0.13169	0.178:0.6377:0.0:0.1843	.	73;73	A8K5G0;Q8IX01	.;SUGP2_HUMAN	T	73	ENSP00000337926:R73T;ENSP00000332373:R73T;ENSP00000389380:R73T	ENSP00000332373:R73T	R	-	2	0	SUGP2	18997939	0.004000	0.15560	0.005000	0.12908	0.404000	0.30871	0.813000	0.27225	0.560000	0.29169	0.484000	0.47621	AGA	SUGP2	-	NULL	ENSG00000064607		0.498	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SUGP2	HGNC	protein_coding	OTTHUMT00000464627.1	19	0.00	0	C	NM_001017392		19136939	19136939	-1	no_errors	ENST00000337018	ensembl	human	known	69_37n	missense	60	17.81	13	SNP	0.021	G
SULF2	55959	genome.wustl.edu	37	20	46365493	46365493	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr20:46365493C>T	ENST00000359930.4	-	3	1220	c.369G>A	c.(367-369)gaG>gaA	p.E123E	SULF2_ENST00000478766.1_5'UTR|SULF2_ENST00000467815.1_Silent_p.E123E|SULF2_ENST00000484875.1_Silent_p.E123E|SULF2_ENST00000361612.4_Silent_p.E123E	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	123					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						AGGTGCGGCTCTCGTGCTGTG	0.622																																						dbGAP											0													183.0	131.0	149.0					20																	46365493		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.369G>A	20.37:g.46365493C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Silent	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.E123	ENST00000359930.4	37	c.369	CCDS13408.1	20																																																																																			SULF2	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	ENSG00000196562		0.622	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SULF2	HGNC	protein_coding	OTTHUMT00000079606.1	65	0.00	0	C	NM_018837		46365493	46365493	-1	no_errors	ENST00000359930	ensembl	human	known	69_37n	silent	151	22.56	44	SNP	1.000	T
SUOX	6821	genome.wustl.edu	37	12	56397621	56397621	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr12:56397621G>A	ENST00000394109.3	+	3	1172	c.448G>A	c.(448-450)Gag>Aag	p.E150K	SUOX_ENST00000266971.3_Missense_Mutation_p.E150K|SUOX_ENST00000394115.2_Missense_Mutation_p.E150K|SUOX_ENST00000356124.4_Missense_Mutation_p.E150K|SUOX_ENST00000551841.2_Intron|SUOX_ENST00000548274.1_Missense_Mutation_p.E150K|SUOX_ENST00000550478.1_3'UTR			P51687	SUOX_HUMAN	sulfite oxidase	150	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|sulfite oxidase activity (GO:0008482)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)	15			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			CCATGTGCGTGAGTTACTGGC	0.562																																						dbGAP											0													98.0	95.0	96.0					12																	56397621		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC065193	CCDS8901.2	12q13.13	2011-02-10			ENSG00000139531	ENSG00000139531	1.8.3.1		11460	protein-coding gene	gene with protein product		606887				7599189	Standard	XM_005269112		Approved		uc001siz.3	P51687	OTTHUMG00000128503	ENST00000394109.3:c.448G>A	12.37:g.56397621G>A	ENSP00000377668:p.Glu150Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_OxRdtase_Mopterin-bd_dom,pfam_MoCF_OxRdtse_dimer,pfam_Cyt_B5,superfamily_OxRdtase_Mopterin-bd_dom,superfamily_Ig_E-set,superfamily_Cyt_B5,pfscan_Cyt_B5,prints_Mopterin_OxRdtase_euk,prints_Cyt_B5	p.E150K	ENST00000394109.3	37	c.448	CCDS8901.2	12	.	.	.	.	.	.	.	.	.	.	G	21.1	4.103050	0.76983	.	.	ENSG00000139531	ENST00000356124;ENST00000266971;ENST00000394115;ENST00000548274;ENST00000546833;ENST00000394109	T;T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31;-1.31	4.46	4.46	0.54185	Cytochrome b5 (5);	0.000000	0.85682	D	0.000000	T	0.75347	0.3837	L	0.38953	1.18	0.80722	D	1	P	0.36465	0.554	B	0.39531	0.302	T	0.73880	-0.3843	10	0.32370	T	0.25	-7.85	17.0907	0.86621	0.0:0.0:1.0:0.0	.	150	P51687	SUOX_HUMAN	K	150	ENSP00000348440:E150K;ENSP00000266971:E150K;ENSP00000377674:E150K;ENSP00000450245:E150K;ENSP00000449872:E150K;ENSP00000377668:E150K	ENSP00000266971:E150K	E	+	1	0	SUOX	54683888	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	8.939000	0.92951	2.767000	0.95098	0.655000	0.94253	GAG	SUOX	-	pfam_Cyt_B5,superfamily_Cyt_B5,pfscan_Cyt_B5,prints_Cyt_B5	ENSG00000139531		0.562	SUOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUOX	HGNC	protein_coding	OTTHUMT00000250309.1	57	0.00	0	G	NM_000456		56397621	56397621	+1	no_errors	ENST00000266971	ensembl	human	known	69_37n	missense	92	15.60	17	SNP	1.000	A
SYNE2	23224	genome.wustl.edu	37	14	64669652	64669652	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr14:64669652G>A	ENST00000344113.4	+	100	18384	c.18172G>A	c.(18172-18174)Gag>Aag	p.E6058K	SYNE2_ENST00000357395.3_Missense_Mutation_p.E2443K|SYNE2_ENST00000555022.1_5'Flank|SYNE2_ENST00000555002.1_Missense_Mutation_p.E2692K|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000554584.1_Missense_Mutation_p.E6020K|SYNE2_ENST00000394768.2_Missense_Mutation_p.E2443K|SYNE2_ENST00000358025.3_Missense_Mutation_p.E6058K	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6058					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CGATGATCAAGAGATCCAGAA	0.512																																						dbGAP											0													105.0	94.0	98.0					14																	64669652		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.18172G>A	14.37:g.64669652G>A	ENSP00000341781:p.Glu6058Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E6058K	ENST00000344113.4	37	c.18172	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	35	5.516734	0.96402	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768;ENST00000556906	T;T;T;T;T;T;T	0.54071	0.59;1.43;0.59;0.59;1.43;1.43;1.43	5.93	5.93	0.95920	.	0.000000	0.52532	D	0.000076	T	0.74253	0.3692	M	0.75447	2.3	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.999;0.999	T	0.71384	-0.4609	10	0.41790	T	0.15	.	20.3409	0.98764	0.0:0.0:1.0:0.0	.	2443;446;6020;6058;6058	Q8WXH0-7;Q7Z362;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;.;SYNE2_HUMAN;.	K	6058;2443;6058;6020;6026;2692;2443;28	ENSP00000350719:E6058K;ENSP00000349969:E2443K;ENSP00000341781:E6058K;ENSP00000452570:E6020K;ENSP00000450831:E2692K;ENSP00000378249:E2443K;ENSP00000452298:E28K	ENSP00000261678:E6026K	E	+	1	0	SYNE2	63739405	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	9.869000	0.99810	2.814000	0.96858	0.655000	0.94253	GAG	SYNE2	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000054654		0.512	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	81	0.00	0	G	NM_182914		64669652	64669652	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	110	17.91	24	SNP	1.000	A
SYT11	23208	genome.wustl.edu	37	1	155838071	155838071	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:155838071C>G	ENST00000368324.4	+	2	603	c.350C>G	c.(349-351)tCt>tGt	p.S117C	SYT11_ENST00000539162.1_Intron	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	117					negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			AGCTCTGGATCTTGTATAGAC	0.547																																						dbGAP											0													90.0	92.0	92.0					1																	155838071		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.350C>G	1.37:g.155838071C>G	ENSP00000357307:p.Ser117Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin	p.S117C	ENST00000368324.4	37	c.350	CCDS1122.1	1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.874726	0.51695	.	.	ENSG00000132718	ENST00000368324	T	0.46451	0.87	5.66	5.66	0.87406	.	0.339861	0.31123	N	0.008206	T	0.23532	0.0569	L	0.29908	0.895	0.80722	D	1	P	0.39831	0.69	B	0.35971	0.215	T	0.08617	-1.0713	10	0.56958	D	0.05	.	19.3455	0.94361	0.0:1.0:0.0:0.0	.	117	Q9BT88	SYT11_HUMAN	C	117	ENSP00000357307:S117C	ENSP00000357307:S117C	S	+	2	0	SYT11	154104695	.	.	0.441000	0.26858	0.979000	0.70002	.	.	2.671000	0.90904	0.655000	0.94253	TCT	SYT11	-	NULL	ENSG00000132718		0.547	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT11	HGNC	protein_coding	OTTHUMT00000039597.1	34	0.00	0	C	NM_152280		155838071	155838071	+1	no_errors	ENST00000368324	ensembl	human	known	69_37n	missense	54	12.90	8	SNP	0.766	G
TAAR2	9287	genome.wustl.edu	37	6	132938838	132938838	+	Silent	SNP	C	C	A	rs147231065		TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr6:132938838C>A	ENST00000367931.1	-	2	506	c.507G>T	c.(505-507)tcG>tcT	p.S169S	TAAR2_ENST00000537809.1_Silent_p.S124S|TAAR2_ENST00000275191.2_Silent_p.S124S			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	169					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.S169S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		CTCCAGGGACCGACCAACATA	0.438																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											61.0	60.0	60.0					6																	132938838		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.507G>T	6.37:g.132938838C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Trace_amine_rcpt	p.S169	ENST00000367931.1	37	c.507	CCDS34541.1	6																																																																																			TAAR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000146378		0.438	TAAR2-002	KNOWN	basic|CCDS	protein_coding	TAAR2	HGNC	protein_coding	OTTHUMT00000390735.1	84	0.00	0	C	NM_014626		132938838	132938838	-1	no_errors	ENST00000367931	ensembl	human	known	69_37n	silent	45	22.41	13	SNP	0.003	A
TAF13	6884	genome.wustl.edu	37	1	109607256	109607256	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:109607256G>A	ENST00000338366.5	-	4	318	c.264C>T	c.(262-264)ttC>ttT	p.F88F		NM_005645.3	NP_005636.1	Q15543	TAF13_HUMAN	TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa	88					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(1)	3		all_epithelial(167;0.000102)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0138)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.166)|all cancers(265;0.191)|LUSC - Lung squamous cell carcinoma(189;0.228)		TTCGAATCAAGAAGACGATAT	0.343																																						dbGAP											0													196.0	207.0	203.0					1																	109607256		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			XM_496381	CCDS30788.1	1p13.3	2010-04-22	2002-08-29	2001-12-07	ENSG00000197780	ENSG00000197780			11546	protein-coding gene	gene with protein product		600774	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, K, 18kD"""	TAF2K		7729427	Standard	NM_005645		Approved	TAFII18	uc001dwm.1	Q15543	OTTHUMG00000042363	ENST00000338366.5:c.264C>T	1.37:g.109607256G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5E5|Q5TYV6	Silent	SNP	pfam_TFIID-18,superfamily_Histone-fold	p.F88	ENST00000338366.5	37	c.264	CCDS30788.1	1																																																																																			TAF13	-	pfam_TFIID-18	ENSG00000197780		0.343	TAF13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF13	HGNC	protein_coding	OTTHUMT00000100609.2	280	0.00	0	G	NM_005645		109607256	109607256	-1	no_errors	ENST00000338366	ensembl	human	known	69_37n	silent	144	31.10	65	SNP	1.000	A
TANC2	26115	genome.wustl.edu	37	17	61490920	61490920	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:61490920G>A	ENST00000424789.2	+	22	3697	c.3693G>A	c.(3691-3693)gcG>gcA	p.A1231A	AC015923.1_ENST00000431604.1_RNA|RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Silent_p.A1241A	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1231					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						CCACATGGGCGATGGCCACCT	0.488																																						dbGAP											0													42.0	41.0	41.0					17																	61490920		2039	4205	6244	-	-	-	SO:0001819	synonymous_variant	0			AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.3693G>A	17.37:g.61490920G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.R1160Q	ENST00000424789.2	37	c.3479	CCDS45754.1	17																																																																																			TANC2	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000170921		0.488	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TANC2	HGNC	protein_coding	OTTHUMT00000444765.1	48	0.00	0	G			61490920	61490920	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000583356	ensembl	human	putative	69_37n	missense	93	19.66	23	SNP	1.000	A
TAS2R16	50833	genome.wustl.edu	37	7	122635653	122635653	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:122635653G>A	ENST00000249284.2	-	1	101	c.36C>T	c.(34-36)atC>atT	p.I12I		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	12					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GCACATAGATGATCATGAAGA	0.458																																						dbGAP											0													56.0	53.0	54.0					7																	122635653		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.36C>T	7.37:g.122635653G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0X2|Q502V3|Q549U8|Q645W1	Silent	SNP	pfam_TAS2_rcpt	p.I12	ENST00000249284.2	37	c.36	CCDS5785.1	7																																																																																			TAS2R16	-	pfam_TAS2_rcpt	ENSG00000128519		0.458	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R16	HGNC	protein_coding	OTTHUMT00000347409.1	31	0.00	0	G	NM_016945		122635653	122635653	-1	no_errors	ENST00000249284	ensembl	human	known	69_37n	silent	21	29.03	9	SNP	0.006	A
TBC1D16	125058	genome.wustl.edu	37	17	77921632	77921632	+	Splice_Site	SNP	T	T	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr17:77921632T>A	ENST00000310924.2	-	9	1657		c.e9-2		TBC1D16_ENST00000570373.1_Splice_Site|TBC1D16_ENST00000576768.1_Splice_Site|TBC1D16_ENST00000572862.1_Splice_Site|TBC1D16_ENST00000340848.7_Splice_Site	NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16								Rab GTPase activator activity (GO:0005097)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			AGGATCCTCCTGGGAGGCGGT	0.657																																					Ovarian(14;397 562 4850 31922 49378)	dbGAP											0													54.0	38.0	44.0					17																	77921632		2201	4300	6501	-	-	-	SO:0001630	splice_region_variant	0			AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.1542-2A>T	17.37:g.77921632T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Splice_Site	SNP	-	e8-2	ENST00000310924.2	37	c.1542-2	CCDS11766.1	17	.	.	.	.	.	.	.	.	.	.	T	13.75	2.329061	0.41197	.	.	ENSG00000167291	ENST00000340848;ENST00000310924	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7306	0.77800	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TBC1D16	75536227	1.000000	0.71417	0.996000	0.52242	0.138000	0.21146	5.894000	0.69806	2.117000	0.64856	0.459000	0.35465	.	TBC1D16	-	-	ENSG00000167291		0.657	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D16	HGNC	protein_coding	OTTHUMT00000437145.1	9	0.00	0	T	NM_019020	Intron	77921632	77921632	-1	no_errors	ENST00000310924	ensembl	human	known	69_37n	splice_site	22	31.25	10	SNP	1.000	A
TBRG1	84897	genome.wustl.edu	37	11	124495579	124495579	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:124495579G>A	ENST00000441174.3	+	3	438	c.234G>A	c.(232-234)aaG>aaA	p.K78K	TBRG1_ENST00000375005.4_5'UTR	NM_032811.2	NP_116200.2	Q3YBR2	TBRG1_HUMAN	transforming growth factor beta regulator 1	78					cell cycle arrest (GO:0007050)|DNA replication (GO:0006260)|negative regulation of cell proliferation (GO:0008285)|nucleolus to nucleoplasm transport (GO:0032066)|protein stabilization (GO:0050821)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				kidney(1)|prostate(1)	2	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0218)		ACTTGCTAAAGAAGCTCCTCC	0.478																																						dbGAP											0													38.0	35.0	36.0					11																	124495579		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK074140	CCDS8448.2	11q24.2	2008-02-05			ENSG00000154144	ENSG00000154144			29551	protein-coding gene	gene with protein product	"""nuclear interactor of ARF and MDM2"""	610614				7654366, 17110379	Standard	NM_032811		Approved	FLJ14621, TB-5, NIAM	uc001qak.4	Q3YBR2	OTTHUMG00000153024	ENST00000441174.3:c.234G>A	11.37:g.124495579G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53GJ5|Q66ZJ6|Q69YS7|Q8TCS4|Q8TEI4|Q96SV0	Silent	SNP	pfam_FYrich_N,pfam_FYrich_C,smart_FYrich_N,smart_FYrich_C	p.K78	ENST00000441174.3	37	c.234	CCDS8448.2	11																																																																																			TBRG1	-	NULL	ENSG00000154144		0.478	TBRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBRG1	HGNC	protein_coding	OTTHUMT00000329057.2	40	0.00	0	G	NM_032811		124495579	124495579	+1	no_errors	ENST00000441174	ensembl	human	known	69_37n	silent	30	26.83	11	SNP	1.000	A
TDGF1	6997	genome.wustl.edu	37	3	46620626	46620626	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:46620626G>A	ENST00000296145.5	+	2	810	c.77G>A	c.(76-78)gGa>gAa	p.G26E	TDGF1_ENST00000542931.1_Missense_Mutation_p.G10E|LRRC2_ENST00000296144.3_Intron	NM_003212.3	NP_003203.1	P13385	TDGF1_HUMAN	teratocarcinoma-derived growth factor 1	26					activation of MAPK activity (GO:0000187)|anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle cell differentiation (GO:0055007)|cell differentiation (GO:0030154)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-6 (GO:0071354)|cellular response to tumor necrosis factor (GO:0071356)|embryo development (GO:0009790)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of signal transduction (GO:0009966)|vasculogenesis (GO:0001570)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	growth factor activity (GO:0008083)|receptor binding (GO:0005102)	p.G26A(1)		cervix(2)|endometrium(1)|kidney(1)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		TTTGAACTGGGATTAGTTGCC	0.383																																						dbGAP											1	Substitution - Missense(1)	cervix(1)											196.0	180.0	186.0					3																	46620626		2203	4300	6503	-	-	-	SO:0001583	missense	0			M96955	CCDS2742.1, CCDS54575.1	3p21.31	2012-10-03			ENSG00000241186	ENSG00000241186			11701	protein-coding gene	gene with protein product		187395				1882841, 10393436	Standard	NM_003212		Approved	CRIPTO, CR, Cripto-1	uc021wxd.1	P13385	OTTHUMG00000133482	ENST00000296145.5:c.77G>A	3.37:g.46620626G>A	ENSP00000296145:p.Gly26Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCC1	Missense_Mutation	SNP	pfam_Cryptic/Cripto_CFC-dom,pirsf_Cripto_growth_factor,pfscan_EG-like_dom	p.G26E	ENST00000296145.5	37	c.77	CCDS2742.1	3	.	.	.	.	.	.	.	.	.	.	G	8.852	0.944762	0.18356	.	.	ENSG00000241186	ENST00000542931;ENST00000296145	T;T	0.67698	-0.21;-0.28	4.14	2.28	0.28536	.	0.431198	0.19993	N	0.101505	T	0.45377	0.1339	N	0.20401	0.57	0.27484	N	0.952498	B	0.17465	0.022	B	0.14578	0.011	T	0.25813	-1.0121	10	0.30078	T	0.28	.	6.2359	0.20762	0.2232:0.0:0.7768:0.0	.	26	P13385	TDGF1_HUMAN	E	10;26	ENSP00000446375:G10E;ENSP00000296145:G26E	ENSP00000296145:G26E	G	+	2	0	AC104304.1	46595630	0.815000	0.29118	0.883000	0.34634	0.786000	0.44442	0.620000	0.24403	0.647000	0.30713	0.655000	0.94253	GGA	TDGF1	-	pirsf_Cripto_growth_factor	ENSG00000241186		0.383	TDGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDGF1	HGNC	protein_coding	OTTHUMT00000257378.2	345	0.00	0	G	NM_003212		46620626	46620626	+1	no_errors	ENST00000296145	ensembl	human	known	69_37n	missense	226	21.99	64	SNP	0.916	A
TECRL	253017	genome.wustl.edu	37	4	65175565	65175565	+	Silent	SNP	T	T	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr4:65175565T>C	ENST00000381210.3	-	6	746	c.636A>G	c.(634-636)acA>acG	p.T212T	TECRL_ENST00000507440.1_Silent_p.T212T|TECRL_ENST00000513125.1_5'UTR	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	212					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)	p.P213fs*23(1)		endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						TTTTCAAAGGTGTGTGTCCTG	0.313																																						dbGAP											1	Deletion - Frameshift(1)	lung(1)											107.0	113.0	111.0					4																	65175565		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.636A>G	4.37:g.65175565T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_3-oxo-5_a-steroid_4-DH_C,pfscan_3-oxo-5_a-steroid_4-DH_C	p.T212	ENST00000381210.3	37	c.636	CCDS33990.1	4																																																																																			TECRL	-	pfam_3-oxo-5_a-steroid_4-DH_C	ENSG00000205678		0.313	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECRL	HGNC	protein_coding	OTTHUMT00000361705.4	172	0.00	0	T	NM_001010874		65175565	65175565	-1	no_errors	ENST00000381210	ensembl	human	known	69_37n	silent	70	31.37	32	SNP	0.999	C
TERT	7015	genome.wustl.edu	37	5	1260685	1260685	+	Silent	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:1260685G>C	ENST00000310581.5	-	12	2931	c.2874C>G	c.(2872-2874)ctC>ctG	p.L958L	TERT_ENST00000334602.6_Silent_p.L895L|TERT_ENST00000296820.5_3'UTR	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	958	CTE.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	GGTTGAAGGTGAGACTGGCTC	0.587									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																													dbGAP											0													84.0	96.0	92.0					5																	1260685		2117	4218	6335	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.2874C>G	5.37:g.1260685G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Silent	SNP	pfam_Telomerase_RBD,pfam_RVT,smart_Telomerase_RBD,prints_Telomerase_RT,pfscan_RVT	p.L958	ENST00000310581.5	37	c.2874	CCDS3861.2	5																																																																																			TERT	-	NULL	ENSG00000164362		0.587	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TERT	HGNC	protein_coding	OTTHUMT00000206729.2	26	0.00	0	G			1260685	1260685	-1	no_errors	ENST00000310581	ensembl	human	known	69_37n	silent	56	21.13	15	SNP	0.941	C
THSD7A	221981	genome.wustl.edu	37	7	11676319	11676319	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:11676319G>A	ENST00000423059.4	-	2	711	c.460C>T	c.(460-462)Cag>Tag	p.Q154*	THSD7A_ENST00000480061.1_5'UTR	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	154					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TCCCTCACCTGAATACCTTCT	0.498										HNSCC(18;0.044)																												dbGAP											0													116.0	111.0	112.0					7																	11676319		1982	4188	6170	-	-	-	SO:0001587	stop_gained	0				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.460C>T	7.37:g.11676319G>A	ENSP00000406482:p.Gln154*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.Q154*	ENST00000423059.4	37	c.460	CCDS47543.1	7	.	.	.	.	.	.	.	.	.	.	G	30	5.051153	0.93740	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	19.9278	0.97110	0.0:0.0:1.0:0.0	.	.	.	.	X	154	.	ENSP00000262042:Q154X	Q	-	1	0	THSD7A	11642844	1.000000	0.71417	1.000000	0.80357	0.494000	0.33585	9.813000	0.99286	2.770000	0.95276	0.650000	0.86243	CAG	THSD7A	-	superfamily_Thrombospondin_1_rpt	ENSG00000005108		0.498	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4	141	0.00	0	G	XM_928187.2		11676319	11676319	-1	no_errors	ENST00000423059	ensembl	human	known	69_37n	nonsense	186	15.77	35	SNP	1.000	A
TMC5	79838	genome.wustl.edu	37	16	19468194	19468194	+	Intron	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:19468194C>G	ENST00000396229.2	+	6	1797				TMC5_ENST00000381414.4_Intron|TMC5_ENST00000541464.1_Intron|TMC5_ENST00000542583.2_Intron|TMC5_ENST00000561503.1_Intron|TMC5_ENST00000219821.5_Missense_Mutation_p.Q56E|TMC5_ENST00000564959.1_Intron	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5						ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						GATAGACTCTCAGACAGTCAG	0.423																																						dbGAP											0													111.0	98.0	102.0					16																	19468194		2197	4300	6497	-	-	-	SO:0001627	intron_variant	0			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.1049-3363C>G	16.37:g.19468194C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	pfam_TMC	p.Q56E	ENST00000396229.2	37	c.166	CCDS45431.1	16	.	.	.	.	.	.	.	.	.	.	C	7.194	0.592126	0.13812	.	.	ENSG00000103534	ENST00000219821	T	0.70282	-0.47	4.02	3.04	0.35103	.	.	.	.	.	T	0.53850	0.1822	N	0.22421	0.69	0.18873	N	0.999984	B;B	0.13145	0.007;0.004	B;B	0.19666	0.01;0.026	T	0.36138	-0.9760	9	0.17369	T	0.5	.	9.6938	0.40145	0.0:0.7885:0.2115:0.0	.	56;56	Q6UXY8-3;B3KUQ8	.;.	E	56	ENSP00000219821:Q56E	ENSP00000219821:Q56E	Q	+	1	0	TMC5	19375695	0.010000	0.17322	0.010000	0.14722	0.005000	0.04900	1.697000	0.37784	1.267000	0.44247	0.644000	0.83932	CAG	TMC5	-	NULL	ENSG00000103534		0.423	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC5	HGNC	protein_coding	OTTHUMT00000435888.1	87	0.00	0	C	NM_024780		19468194	19468194	+1	no_errors	ENST00000219821	ensembl	human	known	69_37n	missense	146	35.65	82	SNP	0.011	G
TMC5	79838	genome.wustl.edu	37	16	19468321	19468321	+	Intron	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:19468321C>T	ENST00000396229.2	+	6	1797				TMC5_ENST00000381414.4_Intron|TMC5_ENST00000541464.1_Intron|TMC5_ENST00000542583.2_Intron|TMC5_ENST00000561503.1_Intron|TMC5_ENST00000219821.5_Missense_Mutation_p.S98L|TMC5_ENST00000564959.1_Intron	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5						ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CCTGGTTCTTCACATGAAACT	0.438																																						dbGAP											0													89.0	79.0	82.0					16																	19468321		2197	4300	6497	-	-	-	SO:0001627	intron_variant	0			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.1049-3236C>T	16.37:g.19468321C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	pfam_TMC	p.S98L	ENST00000396229.2	37	c.293	CCDS45431.1	16	.	.	.	.	.	.	.	.	.	.	C	7.789	0.711175	0.15239	.	.	ENSG00000103534	ENST00000219821	T	0.50001	0.76	3.87	1.89	0.25635	.	.	.	.	.	T	0.22282	0.0537	N	0.08118	0	0.19775	N	0.999954	B;B	0.33612	0.419;0.295	B;B	0.29785	0.107;0.05	T	0.11991	-1.0565	9	0.26408	T	0.33	.	5.6424	0.17571	0.0:0.7573:0.0:0.2427	.	98;98	Q6UXY8-3;B3KUQ8	.;.	L	98	ENSP00000219821:S98L	ENSP00000219821:S98L	S	+	2	0	TMC5	19375822	0.167000	0.22975	0.058000	0.19502	0.850000	0.48378	1.002000	0.29796	0.593000	0.29745	0.655000	0.94253	TCA	TMC5	-	NULL	ENSG00000103534		0.438	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC5	HGNC	protein_coding	OTTHUMT00000435888.1	70	0.00	0	C	NM_024780		19468321	19468321	+1	no_errors	ENST00000219821	ensembl	human	known	69_37n	missense	118	29.76	50	SNP	0.085	T
TOX	9760	genome.wustl.edu	37	8	59750744	59750744	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr8:59750744C>A	ENST00000361421.1	-	5	1040	c.820G>T	c.(820-822)Gat>Tat	p.D274Y		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	274						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D274N(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				GCCTGAGTATCACGAAAGAAT	0.458																																					Pancreas(161;610 1969 17913 21374 22725)	dbGAP											1	Substitution - Missense(1)	lung(1)											116.0	114.0	115.0					8																	59750744		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.820G>T	8.37:g.59750744C>A	ENSP00000354842:p.Asp274Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AV5	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.D274Y	ENST00000361421.1	37	c.820	CCDS34897.1	8	.	.	.	.	.	.	.	.	.	.	C	26.8	4.775221	0.90108	.	.	ENSG00000198846	ENST00000361421;ENST00000456290	T	0.49432	0.78	5.59	5.59	0.84812	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	T	0.79046	0.4380	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84779	0.0772	9	.	.	.	.	19.5961	0.95538	0.0:1.0:0.0:0.0	.	274	O94900	TOX_HUMAN	Y	274;32	ENSP00000354842:D274Y	.	D	-	1	0	TOX	59913298	1.000000	0.71417	0.994000	0.49952	0.969000	0.65631	7.818000	0.86416	2.621000	0.88768	0.591000	0.81541	GAT	TOX	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000198846		0.458	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOX	HGNC	protein_coding	OTTHUMT00000378307.1	104	0.00	0	C	NM_014729		59750744	59750744	-1	no_errors	ENST00000361421	ensembl	human	known	69_37n	missense	78	35.54	43	SNP	1.000	A
TP53BP1	7158	genome.wustl.edu	37	15	43700247	43700247	+	Silent	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr15:43700247G>C	ENST00000263801.3	-	27	5877	c.5625C>G	c.(5623-5625)ctC>ctG	p.L1875L	TP53BP1_ENST00000382044.4_Silent_p.L1880L|TP53BP1_ENST00000450115.2_Silent_p.L1878L|TP53BP1_ENST00000382039.3_Silent_p.L1830L	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1875	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CTGATACCAAGAGTACCTTCA	0.478								Other conserved DNA damage response genes																														dbGAP											0													92.0	87.0	89.0					15																	43700247		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.5625C>G	15.37:g.43700247G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Silent	SNP	pfam_53-BP1_Tudor,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.L1880	ENST00000263801.3	37	c.5640	CCDS10096.1	15																																																																																			TP53BP1	-	superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	ENSG00000067369		0.478	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	HGNC	protein_coding	OTTHUMT00000132897.3	32	0.00	0	G			43700247	43700247	-1	no_errors	ENST00000382044	ensembl	human	known	69_37n	silent	35	20.45	9	SNP	0.931	C
TPK1	27010	genome.wustl.edu	37	7	144320315	144320315	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:144320315C>T	ENST00000360057.3	-	6	400	c.298G>A	c.(298-300)Gac>Aac	p.D100N	TPK1_ENST00000549981.1_5'UTR|TPK1_ENST00000547966.1_5'UTR|TPK1_ENST00000538212.2_Missense_Mutation_p.D95N|TPK1_ENST00000378099.3_Missense_Mutation_p.D100N	NM_022445.3	NP_071890.2	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1	100					small molecule metabolic process (GO:0044281)|thiamine diphosphate biosynthetic process (GO:0009229)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|thiamine binding (GO:0030975)|thiamine diphosphokinase activity (GO:0004788)			large_intestine(3)|lung(12)|ovary(2)|urinary_tract(2)	19					Thiamine(DB00152)	TTAGTAAAGTCAGTGTGGTCT	0.318																																					Ovarian(45;88 1034 2073 5829 28455)	dbGAP											0													216.0	231.0	226.0					7																	144320315		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028138	CCDS5888.1, CCDS55178.1	7q34-q35	2008-07-18			ENSG00000196511	ENSG00000196511			17358	protein-coding gene	gene with protein product	"""placental protein 20"", ""thiamine pyrophosphokinase 1"", ""thiamine kinase"", ""thiamine diphosphokinase"""	606370				11342111	Standard	NM_022445		Approved	HTPK1, PP20	uc003weq.3	Q9H3S4	OTTHUMG00000152774	ENST00000360057.3:c.298G>A	7.37:g.144320315C>T	ENSP00000353165:p.Asp100Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0T7|D3DWG0|I6L9B8|Q6NUR5|Q9H602	Missense_Mutation	SNP	pfam_TPK_catalytic,pfam_Thiamin_PyroPKinase_B1-bd,superfamily_TPK_catalytic,superfamily_Thiamin_PyroPKinase_B1-bd,pirsf_Thiamin_pyrophosphokinase_euk,tigrfam_Thi_PPkinase	p.D100N	ENST00000360057.3	37	c.298	CCDS5888.1	7	.	.	.	.	.	.	.	.	.	.	C	27.7	4.857471	0.91433	.	.	ENSG00000196511	ENST00000360057;ENST00000538212;ENST00000378099;ENST00000552881	D;D;D;D	0.99701	-6.45;-3.91;-6.45;-6.45	6.02	6.02	0.97574	Thiamin pyrophosphokinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	D	0.99849	0.9930	H	0.97874	4.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96914	0.9669	10	0.87932	D	0	-25.27	16.0408	0.80680	0.0:1.0:0.0:0.0	.	100;100;95	F5GZG6;Q9H3S4;Q6ZQX6	.;TPK1_HUMAN;.	N	100;95;100;100	ENSP00000353165:D100N;ENSP00000438813:D95N;ENSP00000367339:D100N;ENSP00000448655:D100N	ENSP00000353165:D100N	D	-	1	0	TPK1	143951248	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.677000	0.61634	2.865000	0.98341	0.655000	0.94253	GAC	TPK1	-	pfam_TPK_catalytic,superfamily_TPK_catalytic,pirsf_Thiamin_pyrophosphokinase_euk,tigrfam_Thi_PPkinase	ENSG00000196511		0.318	TPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPK1	HGNC	protein_coding	OTTHUMT00000327777.1	349	0.00	0	C	NM_022445		144320315	144320315	-1	no_errors	ENST00000360057	ensembl	human	known	69_37n	missense	253	17.59	54	SNP	1.000	T
TPR	7175	genome.wustl.edu	37	1	186283810	186283810	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:186283810C>G	ENST00000367478.4	-	50	7283	c.6987G>C	c.(6985-6987)caG>caC	p.Q2329H	RNU6-1240P_ENST00000365155.1_RNA	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	2329					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TCAATGTTGTCTGAAGTCTTA	0.348			T	NTRK1	papillary thyroid																																	dbGAP		Dom	yes		1	1q25	7175	translocated promoter region		E	0													150.0	141.0	144.0					1																	186283810		1832	4097	5929	-	-	-	SO:0001583	missense	0			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.6987G>C	1.37:g.186283810C>G	ENSP00000356448:p.Gln2329His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.Q2329H	ENST00000367478.4	37	c.6987	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.799888	0.90538	.	.	ENSG00000047410	ENST00000367478	T	0.26660	1.72	5.46	5.46	0.80206	.	0.410133	0.25094	N	0.033194	T	0.49729	0.1574	M	0.63428	1.95	0.46678	D	0.999156	D	0.61697	0.99	D	0.70487	0.969	T	0.48969	-0.8987	10	0.87932	D	0	.	17.4796	0.87669	0.0:1.0:0.0:0.0	.	2329	P12270	TPR_HUMAN	H	2329	ENSP00000356448:Q2329H	ENSP00000356448:Q2329H	Q	-	3	2	TPR	184550433	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.027000	0.41078	2.541000	0.85698	0.585000	0.79938	CAG	TPR	-	NULL	ENSG00000047410		0.348	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	HGNC	protein_coding	OTTHUMT00000086353.2	209	0.00	0	C	NM_003292		186283810	186283810	-1	no_errors	ENST00000367478	ensembl	human	known	69_37n	missense	209	17.39	44	SNP	1.000	G
TPR	7175	genome.wustl.edu	37	1	186316447	186316447	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:186316447C>T	ENST00000367478.4	-	22	3216	c.2920G>A	c.(2920-2922)Gaa>Aaa	p.E974K		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	974					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TTCAGGGATTCTTCTAAACTA	0.353			T	NTRK1	papillary thyroid																																	dbGAP		Dom	yes		1	1q25	7175	translocated promoter region		E	0													236.0	217.0	223.0					1																	186316447		1879	4111	5990	-	-	-	SO:0001583	missense	0			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.2920G>A	1.37:g.186316447C>T	ENSP00000356448:p.Glu974Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.E974K	ENST00000367478.4	37	c.2920	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	C	16.98	3.272459	0.59649	.	.	ENSG00000047410	ENST00000367478	T	0.29142	1.58	5.25	5.25	0.73442	Prefoldin (1);	0.093957	0.64402	D	0.000001	T	0.27349	0.0671	L	0.32530	0.975	0.58432	D	0.999999	B	0.24963	0.115	B	0.22880	0.042	T	0.03008	-1.1083	10	0.32370	T	0.25	.	18.8445	0.92200	0.0:1.0:0.0:0.0	.	974	P12270	TPR_HUMAN	K	974	ENSP00000356448:E974K	ENSP00000356448:E974K	E	-	1	0	TPR	184583070	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	7.065000	0.76727	2.445000	0.82738	0.591000	0.81541	GAA	TPR	-	superfamily_Prefoldin	ENSG00000047410		0.353	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	HGNC	protein_coding	OTTHUMT00000086353.2	373	0.00	0	C	NM_003292		186316447	186316447	-1	no_errors	ENST00000367478	ensembl	human	known	69_37n	missense	347	16.95	71	SNP	1.000	T
TPTE	7179	genome.wustl.edu	37	21	10941954	10941954	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr21:10941954G>A	ENST00000361285.4	-	14	1078	c.749C>T	c.(748-750)tCa>tTa	p.S250L	TPTE_ENST00000342420.5_Missense_Mutation_p.S212L|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.S232L	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	250	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGATGGAAATGACATAGCAAT	0.294																																						dbGAP											0													211.0	203.0	206.0					21																	10941954		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.749C>T	21.37:g.10941954G>A	ENSP00000355208:p.Ser250Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Ion_trans_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.S250L	ENST00000361285.4	37	c.749	CCDS13560.2	21	.	.	.	.	.	.	.	.	.	.	.	11.74	1.729474	0.30684	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.98889	-5.21;-5.21;-5.21	1.8	1.8	0.24995	Phosphatase tensin type (1);	0.000000	0.85682	U	0.000000	D	0.99058	0.9677	M	0.91249	3.19	0.54753	D	0.999986	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.85130	0.996;0.997;0.973	D	0.98745	1.0718	10	0.72032	D	0.01	-6.2679	9.6369	0.39814	0.0:0.0:1.0:0.0	.	212;232;250	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	L	232;250;212	ENSP00000298232:S232L;ENSP00000355208:S250L;ENSP00000344441:S212L	ENSP00000298232:S232L	S	-	2	0	TPTE	9963825	1.000000	0.71417	1.000000	0.80357	0.076000	0.17211	7.245000	0.78237	1.318000	0.45170	0.194000	0.17425	TCA	TPTE	-	pfscan_Phosphatase_tensin-typ	ENSG00000166157		0.294	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	HGNC	protein_coding	OTTHUMT00000157413.1	338	0.00	0	G			10941954	10941954	-1	no_errors	ENST00000361285	ensembl	human	known	69_37n	missense	195	12.56	28	SNP	1.000	A
TRAF3IP3	80342	genome.wustl.edu	37	1	209953885	209953885	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:209953885G>A	ENST00000367024.1	+	15	1899	c.1383G>A	c.(1381-1383)gaG>gaA	p.E461E	TRAF3IP3_ENST00000010338.4_Silent_p.E441E|TRAF3IP3_ENST00000367026.3_Silent_p.E441E|TRAF3IP3_ENST00000367025.3_Silent_p.E461E|TRAF3IP3_ENST00000477431.1_Intron			Q9Y228	T3JAM_HUMAN	TRAF3 interacting protein 3	461						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32				OV - Ovarian serous cystadenocarcinoma(81;0.045)		CAGGGAAGGAGAAAGACTGGG	0.517																																						dbGAP											0													102.0	101.0	101.0					1																	209953885		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1490.1, CCDS1490.2, CCDS73023.1	1q32.3-q41	2008-02-05			ENSG00000009790	ENSG00000009790			30766	protein-coding gene	gene with protein product	"""TRAF3 interacting Jun N terminal kinase (JNK) activating modulator"""	608255				14572659	Standard	XR_247044		Approved	T3JAM	uc001hho.3	Q9Y228	OTTHUMG00000036480	ENST00000367024.1:c.1383G>A	1.37:g.209953885G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L464|A6NIU9|Q2YDB5|Q4VY06|Q7Z706	Silent	SNP	NULL	p.E461	ENST00000367024.1	37	c.1383	CCDS1490.2	1																																																																																			TRAF3IP3	-	NULL	ENSG00000009790		0.517	TRAF3IP3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRAF3IP3	HGNC	protein_coding	OTTHUMT00000088734.2	61	0.00	0	G			209953885	209953885	+1	no_errors	ENST00000367024	ensembl	human	known	69_37n	silent	76	17.39	16	SNP	0.976	A
TRAPPC12	51112	genome.wustl.edu	37	2	3483128	3483128	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:3483128G>A	ENST00000324266.5	+	12	2299	c.2104G>A	c.(2104-2106)Gag>Aag	p.E702K	TRAPPC12_ENST00000382110.2_Missense_Mutation_p.E702K|TRAPPC12-AS1_ENST00000453806.1_RNA	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	702					vesicle-mediated transport (GO:0016192)												CACCATGTACGAGCTGGAGTC	0.622																																						dbGAP											0													114.0	109.0	111.0					2																	3483128		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.2104G>A	2.37:g.3483128G>A	ENSP00000324318:p.Glu702Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E702K	ENST00000324266.5	37	c.2104	CCDS1652.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.6|28.6	4.930549|4.930549	0.92389|0.92389	.|.	.|.	ENSG00000171853|ENSG00000171853	ENST00000382110;ENST00000324266;ENST00000415624|ENST00000416918	T;T|.	0.63096|.	-0.02;-0.02|.	4.55|4.55	3.67|3.67	0.42095|0.42095	.|.	0.145313|.	0.64402|.	N|.	0.000009|.	T|T	0.77018|0.77018	0.4069|0.4069	M|M	0.87827|0.87827	2.91|2.91	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.79978|0.79978	-0.1575|-0.1575	10|5	0.87932|.	D|.	0|.	.|.	11.921|11.921	0.52791|0.52791	0.084:0.0:0.916:0.0|0.084:0.0:0.916:0.0	.|.	702|.	Q8WVT3|.	TPC12_HUMAN|.	K|Q	702;702;201|88	ENSP00000371544:E702K;ENSP00000324318:E702K|.	ENSP00000324318:E702K|.	E|R	+|+	1|2	0|0	TTC15|TTC15	3462135|3462135	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.457000|9.457000	0.97630|0.97630	1.271000|1.271000	0.44313|0.44313	0.655000|0.655000	0.94253|0.94253	GAG|CGA	TRAPPC12	-	NULL	ENSG00000171853		0.622	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRAPPC12	HGNC	protein_coding	OTTHUMT00000206693.2	8	0.00	0	G	NM_016030		3483128	3483128	+1	no_errors	ENST00000324266	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	A
TRIM13	10206	genome.wustl.edu	37	13	50587226	50587226	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr13:50587226G>A	ENST00000378182.3	+	2	1888	c.1150G>A	c.(1150-1152)Gaa>Aaa	p.E384K	TRIM13_ENST00000356017.4_Missense_Mutation_p.E387K|TRIM13_ENST00000457662.2_Missense_Mutation_p.E384K|TRIM13_ENST00000298772.5_Missense_Mutation_p.E387K|TRIM13_ENST00000420995.2_Missense_Mutation_p.E384K|KCNRG_ENST00000360473.4_5'Flank|TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000312942.1_5'Flank	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13	384					anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		CATTTTCAATGAAAGATTCAA	0.323																																						dbGAP											0													89.0	97.0	94.0					13																	50587226		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.1150G>A	13.37:g.50587226G>A	ENSP00000367424:p.Glu384Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.E387K	ENST00000378182.3	37	c.1159	CCDS9423.1	13	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896357	0.33442	.	.	ENSG00000204977	ENST00000420995;ENST00000378182;ENST00000356017;ENST00000457662;ENST00000298772	T;T;T;T;T	0.26223	1.75;1.75;2.29;1.75;2.29	5.81	3.16	0.36331	.	0.290858	0.36338	N	0.002642	T	0.15132	0.0365	L	0.27053	0.805	0.33942	D	0.64339	B;B	0.12630	0.003;0.006	B;B	0.08055	0.001;0.003	T	0.20306	-1.0279	9	.	.	.	-1.1387	7.7188	0.28721	0.1343:0.2518:0.6138:0.0	.	384;387	O60858;O60858-3	TRI13_HUMAN;.	K	384;384;387;384;387	ENSP00000412943:E384K;ENSP00000367424:E384K;ENSP00000348299:E387K;ENSP00000399206:E384K;ENSP00000298772:E387K	.	E	+	1	0	TRIM13	49485227	1.000000	0.71417	0.930000	0.37139	0.991000	0.79684	2.818000	0.48041	0.376000	0.24707	-0.150000	0.13652	GAA	TRIM13	-	NULL	ENSG00000204977		0.323	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	TRIM13	HGNC	protein_coding	OTTHUMT00000354875.1	203	0.00	0	G	NM_001007278		50587226	50587226	+1	no_errors	ENST00000298772	ensembl	human	known	69_37n	missense	75	21.88	21	SNP	0.996	A
TRIM51	84767	genome.wustl.edu	37	11	55657466	55657466	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:55657466C>T	ENST00000449290.2	+	6	902	c.810C>T	c.(808-810)ctC>ctT	p.L270L	TRIM51_ENST00000244891.3_Silent_p.L127L	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	270	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)										ATCCAGAGCTCAGTGCAGGGC	0.483																																						dbGAP											0													52.0	48.0	49.0					11																	55657466		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.810C>T	11.37:g.55657466C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMG2	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.L270	ENST00000449290.2	37	c.810		11																																																																																			TRIM51	-	pfscan_B30.2/SPRY	ENSG00000124900		0.483	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	TRIM51	HGNC	protein_coding	OTTHUMT00000391522.1	146	0.00	0	C	NM_032681		55657466	55657466	+1	no_errors	ENST00000449290	ensembl	human	known	69_37n	silent	75	45.26	62	SNP	0.081	T
TRPC3	7222	genome.wustl.edu	37	4	122825623	122825623	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr4:122825623C>T	ENST00000379645.3	-	8	2180	c.2107G>A	c.(2107-2109)Gaa>Aaa	p.E703K	TRPC3_ENST00000264811.5_Missense_Mutation_p.E630K|TRPC3_ENST00000513531.1_Missense_Mutation_p.E575K	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	618					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GAAGTCACTTCAGACAACCCA	0.299																																						dbGAP											0													78.0	76.0	77.0					4																	122825623		2203	4297	6500	-	-	-	SO:0001583	missense	0			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.2107G>A	4.37:g.122825623C>T	ENSP00000368966:p.Glu703Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPC3_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.E703K	ENST00000379645.3	37	c.2107	CCDS47130.1	4	.	.	.	.	.	.	.	.	.	.	C	32	5.173859	0.94807	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	D;D;D	0.98550	-4.99;-4.99;-4.99	5.77	5.77	0.91146	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98931	0.9637	M	0.80982	2.52	0.80722	D	1	P;P;D	0.76494	0.786;0.786;0.999	P;P;D	0.81914	0.566;0.566;0.995	D	0.98693	1.0697	10	0.35671	T	0.21	-25.8978	20.3627	0.98863	0.0:1.0:0.0:0.0	.	618;575;703	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	K	630;703;575	ENSP00000264811:E630K;ENSP00000368966:E703K;ENSP00000426899:E575K	ENSP00000264811:E630K	E	-	1	0	TRPC3	123045073	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.687000	0.84139	2.885000	0.99019	0.655000	0.94253	GAA	TRPC3	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel,tigrfam_TRP_channel	ENSG00000138741		0.299	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC3	HGNC	protein_coding	OTTHUMT00000364252.1	159	0.62	1	C	NM_003305		122825623	122825623	-1	no_errors	ENST00000379645	ensembl	human	known	69_37n	missense	75	21.88	21	SNP	1.000	T
TRRAP	8295	genome.wustl.edu	37	7	98529178	98529178	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:98529178G>C	ENST00000359863.4	+	26	3951	c.3742G>C	c.(3742-3744)Gaa>Caa	p.E1248Q	TRRAP_ENST00000355540.3_Missense_Mutation_p.E1248Q|TRRAP_ENST00000446306.3_Missense_Mutation_p.E1247Q	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1248					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTTGGTTCGAGAAGTCACCTC	0.557																																						dbGAP											0													89.0	73.0	78.0					7																	98529178		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.3742G>C	7.37:g.98529178G>C	ENSP00000352925:p.Glu1248Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E1248Q	ENST00000359863.4	37	c.3742	CCDS59066.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.29|17.29	3.352889|3.352889	0.61293|0.61293	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000456197|ENST00000359863;ENST00000355540;ENST00000446306	.|T;T	.|0.64618	.|-0.11;-0.11	6.06|6.06	6.06|6.06	0.98353|0.98353	.|Armadillo-like helical (1);Armadillo-type fold (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.43942|0.43942	0.1270|0.1270	N|N	0.03608|0.03608	-0.345|-0.345	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.29136	.|0.234;0.047;0.184	.|B;B;B	.|0.28465	.|0.09;0.023;0.038	T|T	0.39057|0.39057	-0.9632|-0.9632	6|10	.|0.33940	.|T	.|0.23	.|.	20.6243|20.6243	0.99512|0.99512	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1248;962;1248	.|Q9Y4A5-2;Q59FH1;Q9Y4A5	.|.;.;TRRAP_HUMAN	D|Q	962|1248;1248;1246	.|ENSP00000352925:E1248Q;ENSP00000347733:E1248Q	.|ENSP00000347733:E1248Q	E|E	+|+	3|1	2|0	TRRAP|TRRAP	98367114|98367114	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.471000|9.471000	0.97696|0.97696	2.879000|2.879000	0.98667|0.98667	0.650000|0.650000	0.86243|0.86243	GAG|GAA	TRRAP	-	superfamily_ARM-type_fold	ENSG00000196367		0.557	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	17	0.00	0	G	NM_003496		98529178	98529178	+1	no_errors	ENST00000359863	ensembl	human	known	69_37n	missense	54	14.29	9	SNP	1.000	C
TSSC4	10078	genome.wustl.edu	37	11	2424787	2424787	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr11:2424787G>C	ENST00000333256.6	+	3	1367	c.924G>C	c.(922-924)agG>agC	p.R308S	AC124057.5_ENST00000433035.1_RNA|TSSC4_ENST00000451491.2_Missense_Mutation_p.R308S|TSSC4_ENST00000380996.5_Missense_Mutation_p.R244S|TSSC4_ENST00000467308.1_3'UTR|TSSC4_ENST00000380992.1_Splice_Site_p.E109Q			Q9Y5U2	TSSC4_HUMAN	tumor suppressing subtransferable candidate 4	308										endometrium(3)|large_intestine(1)|lung(4)	8		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.00145)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATGGCAGCAGGAAGCGGAGTC	0.642																																						dbGAP											0													47.0	43.0	44.0					11																	2424787		2199	4298	6497	-	-	-	SO:0001583	missense	0			AF125568	CCDS7735.1, CCDS73241.1	11p15.5	2008-02-05			ENSG00000184281	ENSG00000184281			12386	protein-coding gene	gene with protein product		603852				10072438	Standard	XM_005252722		Approved		uc001lwl.3	Q9Y5U2	OTTHUMG00000009895	ENST00000333256.6:c.924G>C	11.37:g.2424787G>C	ENSP00000331087:p.Arg308Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JS66|Q86VL2|Q9BRS6	Missense_Mutation	SNP	NULL	p.R308S	ENST00000333256.6	37	c.924	CCDS7735.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.97|11.97	1.796918|1.796918	0.31777|0.31777	.|.	.|.	ENSG00000184281|ENSG00000184281	ENST00000380992|ENST00000380996;ENST00000333256;ENST00000451491	T|T;T;T	0.46451|0.22743	0.87|1.94;2.2;2.2	3.81|3.81	2.89|2.89	0.33648|0.33648	.|.	.|0.295815	.|0.25052	.|U	.|0.033502	T|T	0.16642|0.16642	0.0400|0.0400	L|L	0.51422|0.51422	1.61|1.61	0.27030|0.27030	N|N	0.964251|0.964251	.|P;P	.|0.40731	.|0.728;0.728	.|B;B	.|0.33521	.|0.165;0.165	T|T	0.12863|0.12863	-1.0531|-1.0531	7|10	0.44086|0.72032	T|D	0.13|0.01	-15.261|-15.261	8.903|8.903	0.35505|0.35505	0.1061:0.0:0.8939:0.0|0.1061:0.0:0.8939:0.0	.|.	.|308;244	.|Q9Y5U2;Q9Y5U2-2	.|TSSC4_HUMAN;.	Q|S	109|244;308;308	ENSP00000370380:E109Q|ENSP00000370384:R244S;ENSP00000331087:R308S;ENSP00000411224:R308S	ENSP00000370380:E109Q|ENSP00000331087:R308S	E|R	+|+	1|3	0|2	TSSC4|TSSC4	2381363|2381363	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.503000|0.503000	0.33858|0.33858	1.401000|1.401000	0.34589|0.34589	0.949000|0.949000	0.37715|0.37715	0.462000|0.462000	0.41574|0.41574	GAA|AGG	TSSC4	-	NULL	ENSG00000184281		0.642	TSSC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSC4	HGNC	protein_coding	OTTHUMT00000027369.3	13	0.00	0	G	NM_005706		2424787	2424787	+1	no_errors	ENST00000333256	ensembl	human	known	69_37n	missense	32	27.27	12	SNP	1.000	C
TTC23	64927	genome.wustl.edu	37	15	99715275	99715275	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr15:99715275G>A	ENST00000394132.2	-	10	1662	c.845C>T	c.(844-846)tCa>tTa	p.S282L	TTC23_ENST00000394130.1_Missense_Mutation_p.S282L|TTC23_ENST00000394129.2_Missense_Mutation_p.S282L|TTC23_ENST00000394136.1_Missense_Mutation_p.S282L|TTC23_ENST00000262074.4_Missense_Mutation_p.S282L|TTC23_ENST00000394135.3_Missense_Mutation_p.S282L|TTC23_ENST00000558663.1_Missense_Mutation_p.S282L|TTC23_ENST00000558613.1_Missense_Mutation_p.S282L			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	282										endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			GTGTCTCCCTGAAGCGACAGC	0.522																																						dbGAP											0													88.0	68.0	75.0					15																	99715275		2197	4297	6494	-	-	-	SO:0001583	missense	0				CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.845C>T	15.37:g.99715275G>A	ENSP00000377690:p.Ser282Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	Missense_Mutation	SNP	smart_TPR_repeat	p.S282L	ENST00000394132.2	37	c.845	CCDS10379.2	15	.	.	.	.	.	.	.	.	.	.	G	14.37	2.514456	0.44763	.	.	ENSG00000103852	ENST00000394132;ENST00000394136;ENST00000262074;ENST00000394135;ENST00000394130;ENST00000394129	T;T;T;T;T;T	0.72167	0.33;0.33;0.33;0.33;0.33;-0.63	6.07	6.07	0.98685	Tetratricopeptide-like helical (1);	0.140928	0.49305	D	0.000147	T	0.81767	0.4892	M	0.71581	2.175	0.30373	N	0.782718	D;D	0.89917	1.0;0.979	D;P	0.87578	0.998;0.747	T	0.75921	-0.3147	10	0.13853	T	0.58	-20.6427	16.1594	0.81686	0.0:0.0:1.0:0.0	.	282;282	Q5W5X9-2;Q5W5X9	.;TTC23_HUMAN	L	282	ENSP00000377690:S282L;ENSP00000377693:S282L;ENSP00000262074:S282L;ENSP00000377692:S282L;ENSP00000377688:S282L;ENSP00000457901:S282L	ENSP00000262074:S282L	S	-	2	0	TTC23	97532798	0.990000	0.36364	0.220000	0.23810	0.165000	0.22458	4.867000	0.63013	2.885000	0.99019	0.655000	0.94253	TCA	TTC23	-	NULL	ENSG00000103852		0.522	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC23	HGNC	protein_coding	OTTHUMT00000303953.2	19	0.00	0	G	NM_022905		99715275	99715275	-1	no_errors	ENST00000262074	ensembl	human	known	69_37n	missense	37	26.00	13	SNP	0.536	A
TTN	7273	genome.wustl.edu	37	2	179452019	179452019	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:179452019C>T	ENST00000591111.1	-	257	59220	c.58996G>A	c.(58996-58998)Gag>Aag	p.E19666K	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E12434K|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E18739K|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E12367K|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E12242K|TTN_ENST00000589042.1_Missense_Mutation_p.E21307K			Q8WZ42	TITIN_HUMAN	titin	19666	Fibronectin type-III 42. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTCTGCCTCACGTTTCTCC	0.458																																						dbGAP											0													103.0	99.0	100.0					2																	179452019		1936	4139	6075	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.58996G>A	2.37:g.179452019C>T	ENSP00000465570:p.Glu19666Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E18739K	ENST00000591111.1	37	c.56215		2	.	.	.	.	.	.	.	.	.	.	C	33	5.213556	0.95069	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.98	5.98	0.97165	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57184	0.2036	L	0.50993	1.605	0.80722	D	1	P;P;P;P	0.49783	0.581;0.581;0.581;0.928	B;B;B;P	0.45610	0.226;0.226;0.362;0.487	T	0.60316	-0.7287	9	0.87932	D	0	.	20.4581	0.99154	0.0:1.0:0.0:0.0	.	12242;12367;12434;19666	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	18739;12242;12434;12367;12240	ENSP00000343764:E18739K;ENSP00000434586:E12242K;ENSP00000340554:E12434K;ENSP00000352154:E12367K	ENSP00000340554:E12434K	E	-	1	0	TTN	179160265	1.000000	0.71417	0.987000	0.45799	0.909000	0.53808	7.770000	0.85390	2.835000	0.97688	0.650000	0.86243	GAG	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.458	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	87	0.00	0	C	NM_133378		179452019	179452019	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	81	15.62	15	SNP	1.000	T
TUBA3C	7278	genome.wustl.edu	37	13	19751442	19751442	+	Silent	SNP	G	G	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr13:19751442G>T	ENST00000400113.3	-	4	785	c.681C>A	c.(679-681)ctC>ctA	p.L227L		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	227					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		TCAGGCGATTGAGGTTGGTGT	0.552																																						dbGAP											0													199.0	169.0	179.0					13																	19751442		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.681C>A	13.37:g.19751442G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.L227	ENST00000400113.3	37	c.681	CCDS9284.1	13																																																																																			TUBA3C	-	superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Delta_tubulin	ENSG00000198033		0.552	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	HGNC	protein_coding	OTTHUMT00000044007.2	125	0.00	0	G	NM_006001		19751442	19751442	-1	no_errors	ENST00000400113	ensembl	human	known	69_37n	silent	152	29.63	64	SNP	0.996	T
TUBA3C	7278	genome.wustl.edu	37	13	19751650	19751650	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr13:19751650G>T	ENST00000400113.3	-	4	577	c.473C>A	c.(472-474)tCa>tAa	p.S158*		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	158					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GTAATCCACTGAGAGCCGCTC	0.592																																						dbGAP											0													94.0	97.0	96.0					13																	19751650		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.473C>A	13.37:g.19751650G>T	ENSP00000382982:p.Ser158*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Nonsense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.S158*	ENST00000400113.3	37	c.473	CCDS9284.1	13	.	.	.	.	.	.	.	.	.	.	g	12.82	2.053171	0.36181	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	.	.	.	1.19	1.19	0.21007	.	0.000000	0.45126	U	0.000385	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.3041	0.32032	0.0:0.0:1.0:0.0	.	.	.	.	X	158	.	ENSP00000354037:S158X	S	-	2	0	TUBA3C	18649650	1.000000	0.71417	0.997000	0.53966	0.098000	0.18820	7.924000	0.87555	0.966000	0.38159	0.162000	0.16502	TCA	TUBA3C	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Alpha_tubulin,prints_Tubulin	ENSG00000198033		0.592	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	HGNC	protein_coding	OTTHUMT00000044007.2	85	0.00	0	G	NM_006001		19751650	19751650	-1	no_errors	ENST00000400113	ensembl	human	known	69_37n	nonsense	95	25.78	33	SNP	1.000	T
UBLCP1	134510	genome.wustl.edu	37	5	158697440	158697440	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr5:158697440G>A	ENST00000296786.6	+	4	645	c.319G>A	c.(319-321)Gaa>Aaa	p.E107K		NM_145049.3	NP_659486.2	Q8WVY7	UBCP1_HUMAN	ubiquitin-like domain containing CTD phosphatase 1	107						nucleolus (GO:0005730)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)			endometrium(1)|kidney(3)|large_intestine(4)|ovary(1)	9	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGAAGTAGTTGAAGTAGAAAA	0.323																																						dbGAP											0													140.0	143.0	142.0					5																	158697440		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK057996	CCDS4345.1	5q33.3	2010-06-21			ENSG00000164332	ENSG00000164332	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	28110	protein-coding gene	gene with protein product	"""CTD phosphatase-like with ubiquitin domain 1"""	609867				15883030	Standard	NM_145049		Approved	MGC10067, CPUB1	uc003lxq.2	Q8WVY7	OTTHUMG00000130305	ENST00000296786.6:c.319G>A	5.37:g.158697440G>A	ENSP00000296786:p.Glu107Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQJ7|Q96DK5	Missense_Mutation	SNP	pfam_NIF,pfam_Ubiquitin,superfamily_HAD-like_dom,smart_Ubiquitin,smart_NIF,pfscan_NIF,pfscan_Ubiquitin_supergroup,tigrfam_HAD-SF_hydro_IIID	p.E107K	ENST00000296786.6	37	c.319	CCDS4345.1	5	.	.	.	.	.	.	.	.	.	.	G	12.97	2.098546	0.37048	.	.	ENSG00000164332	ENST00000296786	.	.	.	5.92	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.49167	0.1541	L	0.34521	1.04	0.53005	D	0.999967	B	0.13594	0.008	B	0.09377	0.004	T	0.42849	-0.9427	9	0.10377	T	0.69	-19.9986	15.0765	0.72080	0.0678:0.0:0.9322:0.0	.	107	Q8WVY7	UBCP1_HUMAN	K	107	.	ENSP00000296786:E107K	E	+	1	0	UBLCP1	158630018	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.281000	0.95811	1.522000	0.49001	-0.136000	0.14681	GAA	UBLCP1	-	NULL	ENSG00000164332		0.323	UBLCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBLCP1	HGNC	protein_coding	OTTHUMT00000252650.2	291	0.00	0	G	NM_145049		158697440	158697440	+1	no_errors	ENST00000296786	ensembl	human	known	69_37n	missense	134	18.79	31	SNP	1.000	A
UPRT	139596	genome.wustl.edu	37	X	74517354	74517354	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:74517354G>A	ENST00000373383.4	+	4	695	c.528G>A	c.(526-528)gaG>gaA	p.E176E	UPRT_ENST00000531704.1_3'UTR|UPRT_ENST00000530743.1_Silent_p.E40E|UPRT_ENST00000373379.1_Silent_p.E176E	NM_145052.3	NP_659489.1	Q96BW1	UPP_HUMAN	uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)	176					female pregnancy (GO:0007565)|lactation (GO:0007595)|response to insulin (GO:0032868)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(4)|lung(4)	18						TGAAATTTGAGAAGGGAAATT	0.368																																						dbGAP											0													222.0	204.0	210.0					X																	74517354		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC015116	CCDS14429.1	Xq13.3	2009-01-14			ENSG00000094841	ENSG00000094841			28334	protein-coding gene	gene with protein product		300656				12477932	Standard	NM_145052		Approved	DKFZp781E1243, MGC23937, FUR1, RP11-311P8.3	uc004ecb.2	Q96BW1	OTTHUMG00000021864	ENST00000373383.4:c.528G>A	X.37:g.74517354G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRL1|Q5JRL3|Q68DN0|Q96MW2	Silent	SNP	pfam_PRibTrfase	p.E176	ENST00000373383.4	37	c.528	CCDS14429.1	X																																																																																			UPRT	-	NULL	ENSG00000094841		0.368	UPRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPRT	HGNC	protein_coding	OTTHUMT00000057278.1	448	0.00	0	G	NM_145052		74517354	74517354	+1	no_errors	ENST00000373383	ensembl	human	known	69_37n	silent	294	20.33	75	SNP	1.000	A
WAC	51322	genome.wustl.edu	37	10	28908478	28908478	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:28908478G>C	ENST00000354911.4	+	14	2048	c.1887G>C	c.(1885-1887)ttG>ttC	p.L629F	WAC_ENST00000375664.4_Missense_Mutation_p.L584F|WAC_ENST00000347934.4_Missense_Mutation_p.L526F|WAC_ENST00000375646.1_Missense_Mutation_p.L477F	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil	629					cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						TACTATTTTTGAGACAACAAA	0.284																																						dbGAP											0													42.0	44.0	43.0					10																	28908478		2201	4300	6501	-	-	-	SO:0001583	missense	0			AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.1887G>C	10.37:g.28908478G>C	ENSP00000346986:p.Leu629Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.L629F	ENST00000354911.4	37	c.1887	CCDS7159.1	10	.	.	.	.	.	.	.	.	.	.	G	14.98	2.696491	0.48202	.	.	ENSG00000095787	ENST00000375664;ENST00000375646;ENST00000347934;ENST00000354911	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.78496	0.4292	L	0.61218	1.895	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.85130	0.996;0.997;0.991	T	0.79825	-0.1640	10	0.87932	D	0	-3.231	19.4897	0.95046	0.0:0.0:1.0:0.0	.	584;526;629	Q9BTA9-2;Q9BTA9-5;Q9BTA9	.;.;WAC_HUMAN	F	584;477;526;629	ENSP00000364816:L584F;ENSP00000364797:L477F;ENSP00000311106:L526F;ENSP00000346986:L629F	ENSP00000311106:L526F	L	+	3	2	WAC	28948484	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.898000	0.87363	2.675000	0.91044	0.585000	0.79938	TTG	WAC	-	NULL	ENSG00000095787		0.284	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	WAC	HGNC	protein_coding	OTTHUMT00000047371.1	113	0.00	0	G	NM_100264		28908478	28908478	+1	no_errors	ENST00000354911	ensembl	human	known	69_37n	missense	57	25.00	19	SNP	1.000	C
VCL	7414	genome.wustl.edu	37	10	75832608	75832608	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr10:75832608C>A	ENST00000211998.4	+	5	714	c.620C>A	c.(619-621)tCa>tAa	p.S207*	VCL_ENST00000372755.3_Nonsense_Mutation_p.S207*|VCL_ENST00000417648.2_Intron|VCL_ENST00000478896.2_Intron	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	207	N-terminal globular head.|Talin-interaction. {ECO:0000250}.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					GTTCTCATTTCAGGTACTTCC	0.413																																						dbGAP											0													153.0	134.0	140.0					10																	75832608		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.620C>A	10.37:g.75832608C>A	ENSP00000211998:p.Ser207*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Nonsense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin	p.S207*	ENST00000211998.4	37	c.620	CCDS7341.1	10	.	.	.	.	.	.	.	.	.	.	C	37	6.543002	0.97650	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000415462;ENST00000537043	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.1028	0.97881	0.0:1.0:0.0:0.0	.	.	.	.	X	207;207;114;134	.	ENSP00000211998:S207X	S	+	2	0	VCL	75502614	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.378000	0.79679	2.827000	0.97445	0.644000	0.83932	TCA	VCL	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000035403		0.413	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	HGNC	protein_coding		99	0.00	0	C	NM_003373, NM_014000		75832608	75832608	+1	no_errors	ENST00000211998	ensembl	human	known	69_37n	nonsense	69	28.87	28	SNP	1.000	A
WHSC1	7468	genome.wustl.edu	37	4	1976719	1976719	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr4:1976719G>A	ENST00000382895.3	+	21	3933	c.3502G>A	c.(3502-3504)Gac>Aac	p.D1168N	SCARNA22_ENST00000503991.1_RNA|WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000508803.1_Missense_Mutation_p.D1168N|WHSC1_ENST00000382892.2_Missense_Mutation_p.D1168N|WHSC1_ENST00000382888.3_Missense_Mutation_p.D516N|WHSC1_ENST00000382891.5_Missense_Mutation_p.D1168N	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	1168	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		TGCCGTCTGTGACATTCCTGC	0.582			T	IGH@	MM																																	dbGAP		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	0													113.0	118.0	116.0					4																	1976719		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.3502G>A	4.37:g.1976719G>A	ENSP00000372351:p.Asp1168Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	pfam_PWWP,pfam_SET_dom,pfam_Znf_PHD-finger,pfam_HMG_superfamily,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_PWWP,smart_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_HMG_superfamily	p.D1168N	ENST00000382895.3	37	c.3502	CCDS33940.1	4	.	.	.	.	.	.	.	.	.	.	G	17.36	3.369710	0.61624	.	.	ENSG00000109685	ENST00000508803;ENST00000382891;ENST00000382892;ENST00000382895;ENST00000382888	D;D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96;-2.96	4.77	4.77	0.60923	SET domain (3);	0.000000	0.52532	D	0.000064	D	0.95313	0.8479	M	0.64676	1.99	0.80722	D	1	B;D	0.89917	0.096;1.0	B;D	0.85130	0.342;0.997	D	0.95462	0.8544	10	0.59425	D	0.04	.	17.9806	0.89140	0.0:0.0:1.0:0.0	.	516;1168	A2A2T2;O96028	.;NSD2_HUMAN	N	1168;1168;1168;1168;516	ENSP00000423972:D1168N;ENSP00000372347:D1168N;ENSP00000372348:D1168N;ENSP00000372351:D1168N;ENSP00000372344:D516N	ENSP00000372344:D516N	D	+	1	0	WHSC1	1946517	1.000000	0.71417	0.975000	0.42487	0.139000	0.21198	5.358000	0.66064	2.484000	0.83849	0.467000	0.42956	GAC	WHSC1	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000109685		0.582	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1	HGNC	protein_coding	OTTHUMT00000366269.2	35	0.00	0	G	NM_133330		1976719	1976719	+1	no_errors	ENST00000382891	ensembl	human	known	69_37n	missense	70	19.54	17	SNP	1.000	A
XIRP2	129446	genome.wustl.edu	37	2	168102468	168102468	+	Silent	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:168102468C>G	ENST00000409195.1	+	9	4655	c.4566C>G	c.(4564-4566)gtC>gtG	p.V1522V	XIRP2_ENST00000409273.1_Silent_p.V1300V|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Silent_p.V1522V	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1347					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CTTCTGATGTCAAAACAACCA	0.353																																						dbGAP											0													79.0	72.0	74.0					2																	168102468		1855	4099	5954	-	-	-	SO:0001819	synonymous_variant	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.4566C>G	2.37:g.168102468C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.V1522	ENST00000409195.1	37	c.4566	CCDS42769.1	2																																																																																			XIRP2	-	pfam_Actin-binding_Xin_repeat	ENSG00000163092		0.353	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	63	0.00	0	C	NM_152381		168102468	168102468	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	silent	16	22.73	5	SNP	0.967	G
XPO1	7514	genome.wustl.edu	37	2	61715794	61715794	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:61715794C>T	ENST00000401558.2	-	18	2862	c.2135G>A	c.(2134-2136)aGa>aAa	p.R712K	XPO1_ENST00000404992.2_Missense_Mutation_p.R712K|XPO1_ENST00000406957.1_Missense_Mutation_p.R712K	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	712					gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TAAATAAATTCTTCCAAGCTG	0.383			Mis		CLL																																	dbGAP	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0													64.0	65.0	65.0					2																	61715794		2203	4298	6501	-	-	-	SO:0001583	missense	0			Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.2135G>A	2.37:g.61715794C>T	ENSP00000384863:p.Arg712Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	pfam_CRM1_C_dom,pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.R712K	ENST00000401558.2	37	c.2135	CCDS33205.1	2	.	.	.	.	.	.	.	.	.	.	C	19.61	3.860605	0.71834	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	.	.	.	5.57	5.57	0.84162	Armadillo-like helical (1);Armadillo-type fold (2);Exportin 1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.54967	0.1891	L	0.46947	1.48	0.58432	D	0.999999	B;B	0.19583	0.021;0.037	B;B	0.20767	0.021;0.031	T	0.54125	-0.8340	9	0.05620	T	0.96	-18.9395	19.918	0.97070	0.0:1.0:0.0:0.0	.	359;712	B3KWD0;O14980	.;XPO1_HUMAN	K	712	.	ENSP00000384863:R712K	R	-	2	0	XPO1	61569298	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.767000	0.85331	2.785000	0.95823	0.591000	0.81541	AGA	XPO1	-	pfam_CRM1_C_dom,superfamily_ARM-type_fold	ENSG00000082898		0.383	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	HGNC	protein_coding	OTTHUMT00000325872.3	107	0.00	0	C	NM_003400		61715794	61715794	-1	no_errors	ENST00000401558	ensembl	human	known	69_37n	missense	91	21.55	25	SNP	1.000	T
XIRP2	129446	genome.wustl.edu	37	2	168105425	168105425	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:168105425C>T	ENST00000409195.1	+	9	7612	c.7523C>T	c.(7522-7524)tCa>tTa	p.S2508L	XIRP2_ENST00000409273.1_Missense_Mutation_p.S2286L|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.S2508L	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2333					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CCAGGAACTTCAGCACCCAGG	0.368																																						dbGAP											0													90.0	86.0	88.0					2																	168105425		1860	4090	5950	-	-	-	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.7523C>T	2.37:g.168105425C>T	ENSP00000386840:p.Ser2508Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.S2508L	ENST00000409195.1	37	c.7523	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	C	1.306	-0.603596	0.03717	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02682	4.21;4.21;4.2	6.05	3.29	0.37713	.	0.790844	0.11718	N	0.536259	T	0.02929	0.0087	L	0.35414	1.06	0.09310	N	1	B;B;B	0.14012	0.002;0.004;0.009	B;B;B	0.15484	0.004;0.006;0.013	T	0.44711	-0.9310	10	0.25106	T	0.35	-1.6022	9.2181	0.37360	0.0:0.7146:0.0:0.2854	.	2333;2333;2286	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	L	2508;2508;2286	ENSP00000386840:S2508L;ENSP00000295237:S2508L;ENSP00000387255:S2286L	ENSP00000295237:S2508L	S	+	2	0	XIRP2	167813671	0.001000	0.12720	0.006000	0.13384	0.006000	0.05464	0.861000	0.27885	0.900000	0.36469	-0.152000	0.13540	TCA	XIRP2	-	NULL	ENSG00000163092		0.368	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	91	0.00	0	C	NM_152381		168105425	168105425	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	missense	49	15.52	9	SNP	0.008	T
ZAN	7455	genome.wustl.edu	37	7	100363041	100363041	+	RNA	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr7:100363041C>T	ENST00000348028.3	+	0	4499				ZAN_ENST00000427578.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546292.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACCTGCCATTCAGGATTCTCC	0.607																																						dbGAP											0													53.0	55.0	54.0					7																	100363041		2124	4245	6369	-	-	-			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100363041C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,pfscan_EG-like_dom,pfscan_MAM_dom	p.S1445L	ENST00000348028.3	37	c.4334		7	.	.	.	.	.	.	.	.	.	.	C	18.06	3.540055	0.65085	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	D;D;D;D	0.90900	-2.75;-2.75;-2.75;-2.75	3.76	2.76	0.32466	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	0.699637	0.11860	N	0.522520	D	0.88362	0.6416	M	0.71920	2.185	0.09310	N	1	P;P	0.43826	0.782;0.818	B;B	0.39465	0.199;0.3	T	0.82135	-0.0607	10	0.66056	D	0.02	.	8.3924	0.32537	0.0:0.7572:0.2428:0.0	.	1445;1445	F5H0T8;Q9Y493	.;ZAN_HUMAN	L	1445;1445;1445;22	ENSP00000445943:S1445L;ENSP00000445091:S1445L;ENSP00000444427:S1445L;ENSP00000441117:S22L	ENSP00000423579:S1445L	S	+	2	0	ZAN	100200977	0.000000	0.05858	0.302000	0.25058	0.762000	0.43233	-0.535000	0.06142	2.066000	0.61787	0.462000	0.41574	TCA	ZAN	-	pfam_TIL_dom,superfamily_TIL_dom,smart_EGF-like	ENSG00000146839		0.607	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	13	0.00	0	C	NM_003386		100363041	100363041	+1	no_errors	ENST00000546292	ensembl	human	known	69_37n	missense	81	19.80	20	SNP	0.000	T
ZBED4	9889	genome.wustl.edu	37	22	50279480	50279480	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr22:50279480G>A	ENST00000216268.5	+	2	2647	c.2170G>A	c.(2170-2172)Gag>Aag	p.E724K		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	724						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		TAAGGAAGCTGAGAGTGGTGT	0.522																																						dbGAP											0													74.0	75.0	75.0					22																	50279480		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.2170G>A	22.37:g.50279480G>A	ENSP00000216268:p.Glu724Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	pfam_Znf_BED_prd,pfam_HATC,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.E724K	ENST00000216268.5	37	c.2170	CCDS33677.1	22	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289122	0.80914	.	.	ENSG00000100426	ENST00000216268	T	0.45668	0.89	5.43	5.43	0.79202	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.62171	0.2406	L	0.58428	1.81	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.59080	-0.7521	10	0.40728	T	0.16	-36.6208	19.239	0.93875	0.0:0.0:1.0:0.0	.	724	O75132	ZBED4_HUMAN	K	724	ENSP00000216268:E724K	ENSP00000216268:E724K	E	+	1	0	ZBED4	48665484	1.000000	0.71417	0.944000	0.38274	0.852000	0.48524	9.312000	0.96287	2.533000	0.85409	0.561000	0.74099	GAG	ZBED4	-	superfamily_RNaseH-like_dom	ENSG00000100426		0.522	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED4	HGNC	protein_coding	OTTHUMT00000317408.2	43	0.00	0	G	NM_014838		50279480	50279480	+1	no_errors	ENST00000216268	ensembl	human	known	69_37n	missense	50	16.67	10	SNP	1.000	A
ZBTB5	9925	genome.wustl.edu	37	9	37441978	37441978	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr9:37441978G>A	ENST00000307750.4	-	2	759	c.571C>T	c.(571-573)Cat>Tat	p.H191Y		NM_014872.2	NP_055687.1	O15062	ZBTB5_HUMAN	zinc finger and BTB domain containing 5	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8				GBM - Glioblastoma multiforme(29;0.00733)|Lung(182;0.226)		TTGCGCTTATGAAGGCGTCTC	0.597																																						dbGAP											0													55.0	58.0	57.0					9																	37441978		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002352	CCDS6610.1	9p13.1	2013-01-09			ENSG00000168795	ENSG00000168795		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23836	protein-coding gene	gene with protein product						9205841	Standard	NM_014872		Approved	KIAA0354	uc003zzx.3	O15062	OTTHUMG00000019918	ENST00000307750.4:c.571C>T	9.37:g.37441978G>A	ENSP00000307604:p.His191Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.H191Y	ENST00000307750.4	37	c.571	CCDS6610.1	9	.	.	.	.	.	.	.	.	.	.	G	14.04	2.415581	0.42817	.	.	ENSG00000168795	ENST00000307750	T	0.10192	2.9	5.54	5.54	0.83059	.	0.050949	0.85682	D	0.000000	T	0.11067	0.0270	L	0.27053	0.805	0.46954	D	0.999261	P	0.49185	0.92	B	0.41036	0.346	T	0.02751	-1.1115	10	0.51188	T	0.08	.	19.6787	0.95950	0.0:0.0:1.0:0.0	.	191	O15062	ZBTB5_HUMAN	Y	191	ENSP00000307604:H191Y	ENSP00000307604:H191Y	H	-	1	0	ZBTB5	37431978	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	6.809000	0.75211	2.884000	0.98904	0.655000	0.94253	CAT	ZBTB5	-	NULL	ENSG00000168795		0.597	ZBTB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB5	HGNC	protein_coding	OTTHUMT00000052462.1	13	0.00	0	G	NM_014872		37441978	37441978	-1	no_errors	ENST00000307750	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	1.000	A
ZC3H7B	23264	genome.wustl.edu	37	22	41752441	41752441	+	Silent	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr22:41752441G>A	ENST00000352645.4	+	21	2735	c.2478G>A	c.(2476-2478)gaG>gaA	p.E826E	ZC3H7B_ENST00000351589.4_Silent_p.E826E	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	842					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						GGGAAGGGGAGAAGCAGATCC	0.607																																						dbGAP											0													138.0	127.0	131.0					22																	41752441		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.2478G>A	22.37:g.41752441G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Silent	SNP	pfam_Znf_CCCH,pfam_TPR-1,smart_TPR_repeat,smart_Znf_CCCH,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E826	ENST00000352645.4	37	c.2478	CCDS14013.1	22																																																																																			ZC3H7B	-	NULL	ENSG00000100403		0.607	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H7B	HGNC	protein_coding	OTTHUMT00000320696.1	31	0.00	0	G	NM_017590		41752441	41752441	+1	no_errors	ENST00000351589	ensembl	human	known	69_37n	silent	24	29.41	10	SNP	1.000	A
ZCCHC11	23318	genome.wustl.edu	37	1	52991817	52991817	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr1:52991817C>T	ENST00000371544.3	-	2	398	c.136G>A	c.(136-138)Gag>Aag	p.E46K	ZCCHC11_ENST00000355809.4_Missense_Mutation_p.E46K|ZCCHC11_ENST00000257177.4_Missense_Mutation_p.E46K|ZCCHC11_ENST00000371541.1_5'Flank	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	46					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						GAGCTGTTCTCAATTTCTTTT	0.284																																						dbGAP											0													57.0	58.0	58.0					1																	52991817		2203	4297	6500	-	-	-	SO:0001583	missense	0			D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.136G>A	1.37:g.52991817C>T	ENSP00000360599:p.Glu46Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Znf_CCHC,pfam_Nucleotidyltransferase,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.E46K	ENST00000371544.3	37	c.136	CCDS30716.1	1	.	.	.	.	.	.	.	.	.	.	C	17.64	3.439748	0.63067	.	.	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000355809;ENST00000470626;ENST00000524582	T;T;T	0.43688	0.95;0.95;0.94	5.81	5.81	0.92471	.	0.532893	0.18723	N	0.132970	T	0.25680	0.0625	N	0.08118	0	0.29019	N	0.886416	B;B;B;B	0.19817	0.0;0.001;0.001;0.039	B;B;B;B	0.15052	0.0;0.001;0.001;0.012	T	0.06041	-1.0849	10	0.17369	T	0.5	.	17.2393	0.87008	0.0:1.0:0.0:0.0	.	46;46;46;46	E9PKY2;Q5TAX3-2;E9PRG2;Q5TAX3	.;.;.;TUT4_HUMAN	K	46	ENSP00000257177:E46K;ENSP00000360599:E46K;ENSP00000433486:E46K	ENSP00000257177:E46K	E	-	1	0	ZCCHC11	52764405	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	4.845000	0.62853	2.756000	0.94617	0.655000	0.94253	GAG	ZCCHC11	-	NULL	ENSG00000134744		0.284	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZCCHC11	HGNC	protein_coding	OTTHUMT00000022462.1	123	0.00	0	C	XM_038288		52991817	52991817	-1	no_errors	ENST00000257177	ensembl	human	known	69_37n	missense	48	21.31	13	SNP	1.000	T
ZCWPW2	152098	genome.wustl.edu	37	3	28562576	28562576	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr3:28562576G>A	ENST00000383768.2	+	9	1066	c.878G>A	c.(877-879)gGa>gAa	p.G293E	ZCWPW2_ENST00000421010.1_Missense_Mutation_p.G293E			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	293							zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						TCAGAAGAAGGACATGGAGAG	0.373																																						dbGAP											0													80.0	74.0	76.0					3																	28562576		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.878G>A	3.37:g.28562576G>A	ENSP00000373278:p.Gly293Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_CW,pfam_PWWP,pfscan_PWWP,pfscan_Znf_CW	p.G293E	ENST00000383768.2	37	c.878	CCDS33723.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.501|7.501	0.652574|0.652574	0.14580|0.14580	.|.	.|.	ENSG00000206559|ENSG00000206559	ENST00000457897|ENST00000383768;ENST00000421010	.|T;T	.|0.26660	.|1.72;1.72	5.64|5.64	0.0175|0.0175	0.14113|0.14113	.|.	.|1.006310	.|0.07988	.|N	.|0.986672	T|T	0.09379|0.09379	0.0231|0.0231	N|N	0.04880|0.04880	-0.145|-0.145	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.34004|0.34004	-0.9846|-0.9846	5|10	.|0.02654	.|T	.|1	-2.2545|-2.2545	5.5801|5.5801	0.17245|0.17245	0.6082:0.1535:0.2384:0.0|0.6082:0.1535:0.2384:0.0	.|.	.|293	.|Q504Y3	.|ZCPW2_HUMAN	N|E	116|293	.|ENSP00000373278:G293E;ENSP00000412386:G293E	.|ENSP00000373278:G293E	D|G	+|+	1|2	0|0	ZCWPW2|ZCWPW2	28537580|28537580	0.001000|0.001000	0.12720|0.12720	0.001000|0.001000	0.08648|0.08648	0.033000|0.033000	0.12548|0.12548	-0.145000|-0.145000	0.10265|0.10265	0.080000|0.080000	0.16959|0.16959	-0.157000|-0.157000	0.13467|0.13467	GAC|GGA	ZCWPW2	-	NULL	ENSG00000206559		0.373	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCWPW2	HGNC	protein_coding	OTTHUMT00000341318.1	194	0.00	0	G	XM_087384		28562576	28562576	+1	no_errors	ENST00000383768	ensembl	human	known	69_37n	missense	78	25.47	27	SNP	0.000	A
ZFP36L2	678	genome.wustl.edu	37	2	43453450	43453450	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:43453450G>C	ENST00000282388.3	-	1	298	c.5C>G	c.(4-6)tCg>tGg	p.S2W	THADA_ENST00000330266.7_Intron	NM_006887.4	NP_008818.3	P47974	TISD_HUMAN	ZFP36 ring finger protein-like 2	2					cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|hemopoiesis (GO:0030097)|mRNA catabolic process (GO:0006402)|negative regulation of stem cell differentiation (GO:2000737)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				AAGTGTGGTCGACATGTTTCT	0.652																																						dbGAP											0													53.0	45.0	48.0					2																	43453450		2192	4294	6486	-	-	-	SO:0001583	missense	0			X78992	CCDS1811.1	2p22.3-p21	2012-11-27	2012-11-27	2001-11-23	ENSG00000152518	ENSG00000152518		"""RING-type (C3HC4) zinc fingers"""	1108	protein-coding gene	gene with protein product		612053	"""zinc finger protein 36, C3H type-like 1"", ""zinc finger protein 36, C3H type-like 2"""	BRF2		7835719, 8545129, 14981510, 17172869	Standard	NM_006887		Approved	ERF2, RNF162C, TIS11D	uc002rsv.4	P47974	OTTHUMG00000128642	ENST00000282388.3:c.5C>G	2.37:g.43453450G>C	ENSP00000282388:p.Ser2Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TB4|Q9BSJ3	Missense_Mutation	SNP	pfam_Tis11B_N,pfam_Znf_CCCH,smart_Znf_CCCH	p.S2W	ENST00000282388.3	37	c.5	CCDS1811.1	2	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569940	0.86542	.	.	ENSG00000152518	ENST00000282388	T	0.59364	0.27	5.28	5.28	0.74379	Tis11B-like protein, N-terminal (1);	0.000000	0.64402	D	0.000002	T	0.74152	0.3679	L	0.58101	1.795	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76583	-0.2906	10	0.87932	D	0	-9.9258	18.5306	0.90990	0.0:0.0:1.0:0.0	.	2	P47974	TISD_HUMAN	W	2	ENSP00000282388:S2W	ENSP00000282388:S2W	S	-	2	0	ZFP36L2	43306954	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.218000	0.89768	2.467000	0.83353	0.655000	0.94253	TCG	ZFP36L2	-	pfam_Tis11B_N	ENSG00000152518		0.652	ZFP36L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP36L2	HGNC	protein_coding	OTTHUMT00000250513.2	14	0.00	0	G	NM_006887		43453450	43453450	-1	no_errors	ENST00000282388	ensembl	human	known	69_37n	missense	36	28.00	14	SNP	1.000	C
ZFYVE19	84936	genome.wustl.edu	37	15	41099931	41099931	+	Silent	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr15:41099931G>C	ENST00000355341.4	+	1	645	c.144G>C	c.(142-144)cgG>cgC	p.R48R	ZFYVE19_ENST00000570108.1_Intron|ZFYVE19_ENST00000563530.1_3'UTR|ZFYVE19_ENST00000336455.5_Intron|DNAJC17_ENST00000220496.4_5'Flank|ZFYVE19_ENST00000564258.1_Intron|ZFYVE19_ENST00000299173.10_Silent_p.R48R	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19	48					abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		gggaagggcggagctgggGTG	0.692																																						dbGAP											0													24.0	33.0	30.0					15																	41099931		2020	4171	6191	-	-	-	SO:0001819	synonymous_variant	0			AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.144G>C	15.37:g.41099931G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.G31A	ENST00000355341.4	37	c.92	CCDS42025.1	15																																																																																			ZFYVE19	-	NULL	ENSG00000166140		0.692	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE19	HGNC	protein_coding	OTTHUMT00000418996.1	12	0.00	0	G	NM_032850		41099931	41099931	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000568062	ensembl	human	known	69_37n	missense	38	22.00	11	SNP	0.096	C
ZNF181	339318	genome.wustl.edu	37	19	35232425	35232425	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:35232425G>C	ENST00000492450.1	+	4	1228	c.1139G>C	c.(1138-1140)aGa>aCa	p.R380T	ZNF181_ENST00000392232.3_Missense_Mutation_p.R424T|ZNF181_ENST00000459757.2_Missense_Mutation_p.R379T			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	380					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TATGAATGTAGAGAATGTGGG	0.393																																						dbGAP											0													52.0	50.0	51.0					19																	35232425		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.1139G>C	19.37:g.35232425G>C	ENSP00000420727:p.Arg380Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKX3|Q49A75	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R380T	ENST00000492450.1	37	c.1139	CCDS32990.2	19	.	.	.	.	.	.	.	.	.	.	G	6.561	0.471786	0.12461	.	.	ENSG00000197841	ENST00000392232;ENST00000425140;ENST00000492450;ENST00000459757	T;T;T	0.17370	2.28;2.28;2.28	2.84	2.84	0.33178	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07638	0.0192	N	0.04297	-0.235	0.09310	N	1	B;B	0.21688	0.001;0.059	B;B	0.19946	0.002;0.027	T	0.27872	-1.0061	9	0.28530	T	0.3	.	7.9492	0.30003	0.0:0.2552:0.7448:0.0	.	379;380	B7ZKX3;Q2M3W8	.;ZN181_HUMAN	T	424;379;380;379	ENSP00000376065:R424T;ENSP00000420727:R380T;ENSP00000419435:R379T	ENSP00000376065:R424T	R	+	2	0	ZNF181	39924265	0.000000	0.05858	0.981000	0.43875	0.922000	0.55478	-2.276000	0.01161	1.876000	0.54355	0.561000	0.74099	AGA	ZNF181	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197841		0.393	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ZNF181	HGNC	protein_coding	OTTHUMT00000349005.3	108	0.00	0	G	NM_001029997		35232425	35232425	+1	no_errors	ENST00000492450	ensembl	human	known	69_37n	missense	69	18.82	16	SNP	0.142	C
ZNF267	10308	genome.wustl.edu	37	16	31926785	31926785	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:31926785G>C	ENST00000300870.10	+	4	1424	c.1215G>C	c.(1213-1215)gaG>gaC	p.E405D		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	405					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						ACACTGGAGAGAAACCATACA	0.348																																						dbGAP											0													45.0	50.0	49.0					16																	31926785		2197	4298	6495	-	-	-	SO:0001583	missense	0			X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.1215G>C	16.37:g.31926785G>C	ENSP00000300870:p.Glu405Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E405D	ENST00000300870.10	37	c.1215	CCDS32440.1	16	.	.	.	.	.	.	.	.	.	.	.	17.65	3.440994	0.63067	.	.	ENSG00000185947	ENST00000300870	T	0.26810	1.71	0.458	0.458	0.16670	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15998	0.0385	L	0.33792	1.035	0.80722	D	1	P	0.38978	0.652	B	0.35182	0.197	T	0.07347	-1.0777	9	0.66056	D	0.02	.	6.6931	0.23183	1.0E-4:0.0:0.9999:0.0	.	405	Q14586	ZN267_HUMAN	D	405	ENSP00000300870:E405D	ENSP00000300870:E405D	E	+	3	2	ZNF267	31834286	0.983000	0.35010	0.930000	0.37139	0.919000	0.55068	0.115000	0.15540	0.482000	0.27582	0.484000	0.47621	GAG	ZNF267	-	pfscan_Znf_C2H2	ENSG00000185947		0.348	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF267	HGNC	protein_coding	OTTHUMT00000432446.2	75	0.00	0	G	NM_003414		31926785	31926785	+1	no_errors	ENST00000300870	ensembl	human	known	69_37n	missense	83	35.66	46	SNP	1.000	C
ZNF267	10308	genome.wustl.edu	37	16	31926979	31926979	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:31926979G>A	ENST00000300870.10	+	4	1618	c.1409G>A	c.(1408-1410)aGc>aAc	p.S470N		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	470					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						AAAGTATGTAGCAAATCTTAT	0.343																																						dbGAP											0													69.0	77.0	74.0					16																	31926979		2197	4298	6495	-	-	-	SO:0001583	missense	0			X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.1409G>A	16.37:g.31926979G>A	ENSP00000300870:p.Ser470Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S470N	ENST00000300870.10	37	c.1409	CCDS32440.1	16	.	.	.	.	.	.	.	.	.	.	.	13.09	2.133958	0.37630	.	.	ENSG00000185947	ENST00000300870	T	0.02032	4.49	0.458	0.458	0.16670	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01800	0.0057	N	0.24115	0.695	0.80722	D	1	B	0.17465	0.022	B	0.06405	0.002	T	0.50759	-0.8790	9	0.87932	D	0	.	6.6931	0.23183	1.0E-4:0.0:0.9999:0.0	.	470	Q14586	ZN267_HUMAN	N	470	ENSP00000300870:S470N	ENSP00000300870:S470N	S	+	2	0	ZNF267	31834480	1.000000	0.71417	0.169000	0.22859	0.145000	0.21501	1.646000	0.37249	0.482000	0.27582	0.484000	0.47621	AGC	ZNF267	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185947		0.343	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF267	HGNC	protein_coding	OTTHUMT00000432446.2	122	0.00	0	G	NM_003414		31926979	31926979	+1	no_errors	ENST00000300870	ensembl	human	known	69_37n	missense	79	35.48	44	SNP	0.956	A
ZNF28	7576	genome.wustl.edu	37	19	53304398	53304398	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:53304398G>C	ENST00000457749.2	-	4	819	c.700C>G	c.(700-702)Cag>Gag	p.Q234E	ZNF28_ENST00000438150.2_Missense_Mutation_p.Q181E|ZNF28_ENST00000414252.2_Missense_Mutation_p.Q181E|ZNF28_ENST00000360272.4_Missense_Mutation_p.Q181E	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	234					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TGGGTTATCTGATGTTTTTTT	0.343																																						dbGAP											0													115.0	108.0	110.0					19																	53304398		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.700C>G	19.37:g.53304398G>C	ENSP00000397693:p.Gln234Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q234E	ENST00000457749.2	37	c.700	CCDS33093.2	19	.	.	.	.	.	.	.	.	.	.	-	11.29	1.594285	0.28445	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252;ENST00000391783	T;T;T;T;T	0.16073	2.37;2.37;2.37;2.37;2.37	1.53	1.53	0.23141	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.27866	0.0686	M	0.66939	2.045	0.09310	N	1	P	0.40332	0.713	P	0.51806	0.68	T	0.13202	-1.0518	9	0.62326	D	0.03	.	5.2346	0.15439	0.1923:0.0:0.8077:0.0	.	234	P17035	ZNF28_HUMAN	E	181;234;181;181;181	ENSP00000412143:Q181E;ENSP00000397693:Q234E;ENSP00000353410:Q181E;ENSP00000444965:Q181E;ENSP00000375661:Q181E	ENSP00000353410:Q181E	Q	-	1	0	ZNF28	57996210	0.000000	0.05858	0.021000	0.16686	0.033000	0.12548	0.555000	0.23422	0.835000	0.34877	0.298000	0.19748	CAG	ZNF28	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198538		0.343	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF28	HGNC	protein_coding	OTTHUMT00000336038.2	259	0.00	0	G	NM_006969		53304398	53304398	-1	no_errors	ENST00000457749	ensembl	human	known	69_37n	missense	168	18.05	37	SNP	0.199	C
ZNF431	170959	genome.wustl.edu	37	19	21365597	21365597	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:21365597T>A	ENST00000311048.7	+	5	635	c.491T>A	c.(490-492)cTa>cAa	p.L164Q	ZNF431_ENST00000594425.1_Intron|ZNF431_ENST00000600692.1_3'UTR	NM_133473.2	NP_597730.2	Q8TF32	ZN431_HUMAN	zinc finger protein 431	164					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23						TATAATGAGCTAAACCAGTGT	0.333																																						dbGAP											0													86.0	86.0	86.0					19																	21365597		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB075849	CCDS32979.1	19p12	2013-01-08				ENSG00000196705		"""Zinc fingers, C2H2-type"", ""-"""	20809	protein-coding gene	gene with protein product						11853319	Standard	NM_133473		Approved	KIAA1969	uc002npp.2	Q8TF32		ENST00000311048.7:c.491T>A	19.37:g.21365597T>A	ENSP00000308578:p.Leu164Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAK7|Q8IWC4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L164Q	ENST00000311048.7	37	c.491	CCDS32979.1	19	.	.	.	.	.	.	.	.	.	.	.	8.999	0.979570	0.18812	.	.	ENSG00000196705	ENST00000311048	T	0.07567	3.18	0.588	0.588	0.17445	.	.	.	.	.	T	0.22936	0.0554	M	0.84683	2.71	0.09310	N	1	D	0.76494	0.999	P	0.62491	0.903	T	0.06991	-1.0796	9	0.66056	D	0.02	.	3.9248	0.09259	0.0:0.254:0.0:0.746	.	164	Q8TF32	ZN431_HUMAN	Q	164	ENSP00000308578:L164Q	ENSP00000308578:L164Q	L	+	2	0	ZNF431	21157437	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.135000	0.15952	0.501000	0.28013	0.369000	0.22263	CTA	ZNF431	-	NULL	ENSG00000196705		0.333	ZNF431-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF431	HGNC	protein_coding	OTTHUMT00000463943.1	227	0.00	0	T	XM_086098		21365597	21365597	+1	no_errors	ENST00000311048	ensembl	human	known	69_37n	missense	127	19.11	30	SNP	0.000	A
ZNF585B	92285	genome.wustl.edu	37	19	37677367	37677367	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:37677367C>T	ENST00000532828.2	-	5	1323	c.1072G>A	c.(1072-1074)Gag>Aag	p.E358K	CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000527838.1_3'UTR|ZNF585B_ENST00000312908.5_5'UTR|ZNF585B_ENST00000531805.1_Missense_Mutation_p.E303K	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	358					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTCCCACACTCAGTACATATG	0.413																																					Melanoma(93;882 1454 18863 28917 48427)	dbGAP											0													98.0	94.0	96.0					19																	37677367		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.1072G>A	19.37:g.37677367C>T	ENSP00000433773:p.Glu358Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IZD3|Q96JW6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E358K	ENST00000532828.2	37	c.1072	CCDS12500.1	19	.	.	.	.	.	.	.	.	.	.	C	8.815	0.936162	0.18206	.	.	ENSG00000245680	ENST00000531805;ENST00000532828	T;T	0.07567	3.18;3.2	3.08	0.773	0.18516	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38381	N	0.001703	T	0.06280	0.0162	L	0.38953	1.18	0.09310	N	0.999998	B;B	0.20164	0.042;0.015	B;B	0.20955	0.013;0.032	T	0.29119	-1.0022	10	0.52906	T	0.07	.	5.6055	0.17377	0.0:0.6708:0.2039:0.1253	.	303;358	E9PQH3;Q52M93	.;Z585B_HUMAN	K	303;358	ENSP00000436774:E303K;ENSP00000433773:E358K	ENSP00000436774:E303K	E	-	1	0	ZNF585B	42369207	0.000000	0.05858	0.162000	0.22713	0.800000	0.45204	0.633000	0.24598	0.128000	0.18479	0.455000	0.32223	GAG	ZNF585B	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000245680		0.413	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF585B	HGNC	protein_coding	OTTHUMT00000388272.2	215	0.00	0	C	NM_152279		37677367	37677367	-1	no_errors	ENST00000532828	ensembl	human	known	69_37n	missense	137	23.89	43	SNP	0.002	T
ZNF528	84436	genome.wustl.edu	37	19	52919501	52919501	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:52919501G>A	ENST00000360465.3	+	7	1822	c.1396G>A	c.(1396-1398)Gaa>Aaa	p.E466K	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	466					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		GAAACCTTATGAATGTAAAGA	0.383																																						dbGAP											0													63.0	63.0	63.0					19																	52919501		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.1396G>A	19.37:g.52919501G>A	ENSP00000353652:p.Glu466Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPN4|Q86T88|Q96JK0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E466K	ENST00000360465.3	37	c.1396	CCDS33091.1	19	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.813882	0.00600	.	.	ENSG00000167555	ENST00000360465	T	0.06608	3.28	1.96	-0.333	0.12671	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01523	0.0049	N	0.01522	-0.82	0.09310	N	1	B	0.14438	0.01	B	0.12837	0.008	T	0.45323	-0.9269	9	0.05525	T	0.97	.	0.598	0.00740	0.2555:0.206:0.3355:0.203	.	466	Q3MIS6	ZN528_HUMAN	K	466	ENSP00000353652:E466K	ENSP00000353652:E466K	E	+	1	0	ZNF528	57611313	0.000000	0.05858	0.018000	0.16275	0.008000	0.06430	-3.565000	0.00429	0.037000	0.15575	-0.312000	0.09012	GAA	ZNF528	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167555		0.383	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF528	HGNC	protein_coding	OTTHUMT00000344336.1	66	0.00	0	G	NM_032423		52919501	52919501	+1	no_errors	ENST00000360465	ensembl	human	known	69_37n	missense	51	15.00	9	SNP	0.000	A
ZNF470	388566	genome.wustl.edu	37	19	57088676	57088676	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:57088676C>A	ENST00000330619.8	+	6	1565	c.879C>A	c.(877-879)ttC>ttA	p.F293L	ZNF470_ENST00000391709.3_Missense_Mutation_p.F293L|ZNF470_ENST00000601902.1_Intron	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	293					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		GGAAAGCCTTCAGCCAGAATG	0.443																																						dbGAP											0													76.0	78.0	77.0					19																	57088676		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.879C>A	19.37:g.57088676C>A	ENSP00000333223:p.Phe293Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F293L	ENST00000330619.8	37	c.879	CCDS33122.1	19	.	.	.	.	.	.	.	.	.	.	C	16.55	3.154851	0.57259	.	.	ENSG00000197016	ENST00000391709;ENST00000330619	T;T	0.46063	0.88;0.88	3.89	0.429	0.16506	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.64349	0.2590	M	0.86805	2.84	0.26514	N	0.974543	D	0.89917	1.0	D	0.91635	0.999	T	0.53012	-0.8498	9	0.87932	D	0	.	8.1292	0.31016	0.0:0.6297:0.0:0.3703	.	293	Q6ECI4	ZN470_HUMAN	L	293	ENSP00000375590:F293L;ENSP00000333223:F293L	ENSP00000333223:F293L	F	+	3	2	ZNF470	61780488	0.092000	0.21681	1.000000	0.80357	0.984000	0.73092	0.316000	0.19469	0.333000	0.23563	-0.378000	0.06908	TTC	ZNF470	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197016		0.443	ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF470	HGNC	protein_coding	OTTHUMT00000459707.2	104	0.00	0	C	NM_001001668		57088676	57088676	+1	no_errors	ENST00000330619	ensembl	human	known	69_37n	missense	95	12.84	14	SNP	0.997	A
ZNF470	388566	genome.wustl.edu	37	19	57088944	57088944	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:57088944C>G	ENST00000330619.8	+	6	1833	c.1147C>G	c.(1147-1149)Ctt>Gtt	p.L383V	ZNF470_ENST00000391709.3_Missense_Mutation_p.L383V|ZNF470_ENST00000601902.1_Intron	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	383					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		GAATGCTTCTCTTATACGTCA	0.413																																						dbGAP											0													95.0	88.0	90.0					19																	57088944		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.1147C>G	19.37:g.57088944C>G	ENSP00000333223:p.Leu383Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L383V	ENST00000330619.8	37	c.1147	CCDS33122.1	19	.	.	.	.	.	.	.	.	.	.	-	9.961	1.222928	0.22457	.	.	ENSG00000197016	ENST00000391709;ENST00000330619	T;T	0.52983	0.64;0.64	4.17	4.17	0.49024	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.75057	0.3798	M	0.92317	3.295	0.21878	N	0.999493	D	0.71674	0.998	D	0.85130	0.997	T	0.67703	-0.5602	9	0.72032	D	0.01	.	13.4892	0.61384	0.0:1.0:0.0:0.0	.	383	Q6ECI4	ZN470_HUMAN	V	383	ENSP00000375590:L383V;ENSP00000333223:L383V	ENSP00000333223:L383V	L	+	1	0	ZNF470	61780756	0.003000	0.15002	0.064000	0.19789	0.028000	0.11728	1.042000	0.30303	2.167000	0.68274	0.590000	0.80494	CTT	ZNF470	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197016		0.413	ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF470	HGNC	protein_coding	OTTHUMT00000459707.2	130	0.00	0	C	NM_001001668		57088944	57088944	+1	no_errors	ENST00000330619	ensembl	human	known	69_37n	missense	120	16.67	24	SNP	0.569	G
ZNF324	25799	genome.wustl.edu	37	19	58980584	58980584	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:58980584C>T	ENST00000536459.2	+	2	741	c.32C>T	c.(31-33)tCc>tTc	p.S11F	ZNF324_ENST00000196482.3_Missense_Mutation_p.S11F|ZNF324_ENST00000535298.1_5'Flank			O75467	Z324A_HUMAN	zinc finger protein 324	11	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(2)|prostate(2)|urinary_tract(2)	16		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		GTGTACTTCTCCCAGGAGGAG	0.567																																						dbGAP											0													81.0	71.0	75.0					19																	58980584		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF060503	CCDS12981.1	19q13.43	2013-01-08				ENSG00000083812		"""Zinc fingers, C2H2-type"", ""-"""	14096	protein-coding gene	gene with protein product							Standard	NM_014347		Approved	ZF5128, ZNF324A	uc002qsw.2	O75467		ENST00000536459.2:c.32C>T	19.37:g.58980584C>T	ENSP00000444812:p.Ser11Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRX1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S11F	ENST00000536459.2	37	c.32	CCDS12981.1	19	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130772	0.56828	.	.	ENSG00000083812	ENST00000378044;ENST00000196482;ENST00000536459	T;T	0.02944	4.1;4.1	3.44	2.37	0.29283	Krueppel-associated box (4);	0.000000	0.34025	N	0.004337	T	0.21550	0.0519	H	0.96720	3.87	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	T	0.06197	-1.0840	10	0.87932	D	0	.	9.621	0.39721	0.0:0.5799:0.4201:0.0	.	11	O75467	Z324A_HUMAN	F	11	ENSP00000196482:S11F;ENSP00000444812:S11F	ENSP00000196482:S11F	S	+	2	0	ZNF324	63672396	0.862000	0.29867	0.998000	0.56505	0.995000	0.86356	1.359000	0.34113	0.753000	0.32945	0.462000	0.41574	TCC	ZNF324	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000083812		0.567	ZNF324-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF324	HGNC	protein_coding	OTTHUMT00000467044.1	70	0.00	0	C	NM_014347		58980584	58980584	+1	no_errors	ENST00000196482	ensembl	human	known	69_37n	missense	88	23.48	27	SNP	0.998	T
ZNF75D	7626	genome.wustl.edu	37	X	134427833	134427833	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chrX:134427833C>T	ENST00000370766.3	-	3	2943	c.234G>A	c.(232-234)ctG>ctA	p.L78L	ZNF75D_ENST00000494295.1_Intron|ZNF75D_ENST00000370764.1_Silent_p.L78L	NM_007131.3	NP_009062.2	P51815	ZN75D_HUMAN	zinc finger protein 75D	78	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						TCTCTGGCCTCAGCCACTGAT	0.522																																						dbGAP											0													80.0	70.0	74.0					X																	134427833		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			S43109	CCDS14648.1, CCDS55503.1	Xq26	2013-01-09	2008-06-11	2008-06-11	ENSG00000186376	ENSG00000186376		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13145	protein-coding gene	gene with protein product		314997	"""zinc finger protein 75 (D8C6)"""	ZNF82, ZNF75		1505955	Standard	XM_005262469		Approved	ZKSCAN24, D8C6, ZSCAN28	uc004eyo.3	P51815	OTTHUMG00000022482	ENST00000370766.3:c.234G>A	X.37:g.134427833C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK62|B3KRI7|Q5JPG0|Q6LDE0	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L78	ENST00000370766.3	37	c.234	CCDS14648.1	X																																																																																			ZNF75D	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000186376		0.522	ZNF75D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF75D	HGNC	protein_coding	OTTHUMT00000058415.1	72	0.00	0	C	NM_007131		134427833	134427833	-1	no_errors	ENST00000370766	ensembl	human	known	69_37n	silent	64	20.99	17	SNP	0.028	T
ZNF776	284309	genome.wustl.edu	37	19	58265613	58265613	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr19:58265613G>C	ENST00000317178.5	+	3	1378	c.1115G>C	c.(1114-1116)gGa>gCa	p.G372A	ZNF776_ENST00000489376.1_3'UTR	NM_173632.3	NP_775903.3	Q68DI1	ZN776_HUMAN	zinc finger protein 776	372					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(13)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		GTTCACACTGGAGAAAGACCT	0.463																																						dbGAP											0													131.0	112.0	118.0					19																	58265613		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095607	CCDS12962.2	19q13.43	2013-01-08			ENSG00000152443	ENSG00000152443		"""Zinc fingers, C2H2-type"", ""-"""	26765	protein-coding gene	gene with protein product							Standard	NM_173632		Approved	FLJ38288		Q68DI1	OTTHUMG00000156943	ENST00000317178.5:c.1115G>C	19.37:g.58265613G>C	ENSP00000321812:p.Gly372Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZS36|Q8N968	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G372A	ENST00000317178.5	37	c.1115	CCDS12962.2	19	.	.	.	.	.	.	.	.	.	.	G	16.38	3.106076	0.56291	.	.	ENSG00000152443	ENST00000317178	T	0.26373	1.74	1.86	1.86	0.25419	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36717	0.0977	L	0.43646	1.37	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.932	T	0.15723	-1.0427	9	0.87932	D	0	.	6.8703	0.24117	0.0:0.0:0.7243:0.2757	.	372;372	Q68DI1;B4DSC6	ZN776_HUMAN;.	A	372	ENSP00000321812:G372A	ENSP00000321812:G372A	G	+	2	0	ZNF776	62957425	0.968000	0.33430	0.364000	0.25888	0.291000	0.27294	3.385000	0.52485	1.027000	0.39758	0.313000	0.20887	GGA	ZNF776	-	pfscan_Znf_C2H2	ENSG00000152443		0.463	ZNF776-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF776	HGNC	protein_coding	OTTHUMT00000346722.2	157	0.00	0	G	NM_173632		58265613	58265613	+1	no_errors	ENST00000317178	ensembl	human	known	69_37n	missense	163	19.31	39	SNP	1.000	C
ZP2	7783	genome.wustl.edu	37	16	21213434	21213434	+	Silent	SNP	C	C	T			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr16:21213434C>T	ENST00000574002.1	-	12	1760	c.1278G>A	c.(1276-1278)acG>acA	p.T426T	ZP2_ENST00000574091.1_Silent_p.T426T|AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000219593.4_Silent_p.T426T			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	426	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		CCTTATATCTCGTTCCACATC	0.488																																						dbGAP											0													94.0	81.0	85.0					16																	21213434		2200	4300	6500	-	-	-	SO:0001819	synonymous_variant	0			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.1278G>A	16.37:g.21213434C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Silent	SNP	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.T426	ENST00000574002.1	37	c.1278	CCDS10596.1	16																																																																																			ZP2	-	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	ENSG00000103310		0.488	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZP2	HGNC	protein_coding	OTTHUMT00000207365.2	64	0.00	0	C			21213434	21213434	-1	no_errors	ENST00000219593	ensembl	human	known	69_37n	silent	78	43.07	59	SNP	0.360	T
ZRANB3	84083	genome.wustl.edu	37	2	135957946	135957946	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A10C-01A-21D-A10M-09	TCGA-E2-A10C-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2750ed41-0bd4-4cf4-98f5-762957cf80b7	92567dce-0f9e-4885-8260-0196fef7a91b	g.chr2:135957946C>A	ENST00000264159.6	-	21	3322	c.3206G>T	c.(3205-3207)gGa>gTa	p.G1069V	ZRANB3_ENST00000401392.1_Missense_Mutation_p.G1067V|ZRANB3_ENST00000536680.1_Missense_Mutation_p.G1067V|ZRANB3_ENST00000412849.1_5'UTR	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	1069	Endonuclease activity.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		GATGTCTGATCCATGCTTTGA	0.348																																						dbGAP											0													128.0	119.0	122.0					2																	135957946		1872	4110	5982	-	-	-	SO:0001583	missense	0			AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.3206G>T	2.37:g.135957946C>A	ENSP00000264159:p.Gly1069Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HNH,pfam_Znf_RanBP2,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Znf_RanBP2,smart_HNH_nuc,pfscan_Znf_RanBP2,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G1069V	ENST00000264159.6	37	c.3206	CCDS46419.1	2	.	.	.	.	.	.	.	.	.	.	C	22.3	4.268341	0.80469	.	.	ENSG00000121988	ENST00000538542;ENST00000283060;ENST00000401392;ENST00000264159;ENST00000536680	D;D;D	0.91011	-2.77;-2.77;-2.75	5.47	5.47	0.80525	.	0.280892	0.34932	N	0.003567	D	0.91835	0.7416	L	0.44542	1.39	0.80722	D	1	D;D	0.65815	0.995;0.992	P;P	0.56700	0.642;0.804	D	0.92556	0.6054	10	0.72032	D	0.01	-17.7195	16.3285	0.82997	0.0:0.868:0.132:0.0	.	1069;1067	Q5FWF4;Q5FWF4-3	ZRAB3_HUMAN;.	V	532;532;1067;1069;1067	ENSP00000383979:G1067V;ENSP00000264159:G1069V;ENSP00000441320:G1067V	ENSP00000264159:G1069V	G	-	2	0	ZRANB3	135674416	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.979000	0.56888	2.573000	0.86826	0.591000	0.81541	GGA	ZRANB3	-	NULL	ENSG00000121988		0.348	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB3	HGNC	protein_coding	OTTHUMT00000318254.1	312	0.00	0	C	NM_032143		135957946	135957946	-1	no_errors	ENST00000264159	ensembl	human	known	69_37n	missense	226	21.99	64	SNP	1.000	A
