#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC5	10057	genome.wustl.edu	37	3	183669317	183669317	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr3:183669317G>C	ENST00000334444.6	-	20	3096	c.2856C>G	c.(2854-2856)ttC>ttG	p.F952L	ABCC5_ENST00000265586.6_Missense_Mutation_p.F952L	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	952	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	GGATCCTTCGGAAAAGCTCGT	0.547																																						dbGAP											0													70.0	75.0	74.0					3																	183669317		2020	4198	6218	-	-	-	SO:0001583	missense	0			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.2856C>G	3.37:g.183669317G>C	ENSP00000333926:p.Phe952Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.F952L	ENST00000334444.6	37	c.2856	CCDS43176.1	3	.	.	.	.	.	.	.	.	.	.	G	22.6	4.308902	0.81247	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	D;D	0.95307	-3.67;-3.67	6.11	3.34	0.38264	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.93109	0.7806	L	0.35414	1.06	0.54753	D	0.999988	P;P	0.49447	0.924;0.838	P;P	0.58266	0.836;0.714	D	0.90220	0.4271	10	0.23891	T	0.37	-25.1372	10.1029	0.42515	0.2483:0.0:0.7517:0.0	.	952;952	Q86UX3;O15440	.;MRP5_HUMAN	L	952	ENSP00000333926:F952L;ENSP00000265586:F952L	ENSP00000265586:F952L	F	-	3	2	ABCC5	185152011	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.992000	0.49417	1.597000	0.50072	0.655000	0.94253	TTC	ABCC5	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000114770		0.547	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC5	HGNC	protein_coding	OTTHUMT00000346350.1	110	0.00	0	G	NM_005688		183669317	183669317	-1	no_errors	ENST00000334444	ensembl	human	known	69_37n	missense	96	17.24	20	SNP	1.000	C
ABCC9	10060	genome.wustl.edu	37	12	22025600	22025600	+	Silent	SNP	G	G	A	rs201848437		TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr12:22025600G>A	ENST00000261201.4	-	16	2156	c.2157C>T	c.(2155-2157)ctC>ctT	p.L719L	ABCC9_ENST00000261200.4_Silent_p.L719L|RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000345162.2_Silent_p.L683L	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	719	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	GCATCTCACCGAGGATGGCAA	0.423													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13677	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													240.0	232.0	234.0					12																	22025600		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2157C>T	12.37:g.22025600G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60707	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.L719	ENST00000261201.4	37	c.2157	CCDS8694.1	12																																																																																			ABCC9	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000069431		0.423	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	228	0.44	1	G	NM_005691		22025600	22025600	-1	no_errors	ENST00000261200	ensembl	human	known	69_37n	silent	196	18.60	45	SNP	0.074	A
ADAMTS7	11173	genome.wustl.edu	37	15	79067106	79067106	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr15:79067106C>T	ENST00000388820.4	-	12	1946	c.1736G>A	c.(1735-1737)gGt>gAt	p.G579D	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	579	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CTTGCGCTCACCCACACAGTA	0.642																																						dbGAP											0													67.0	77.0	73.0					15																	79067106		2196	4292	6488	-	-	-	SO:0001583	missense	0			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1736G>A	15.37:g.79067106C>T	ENSP00000373472:p.Gly579Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14F51|Q6P7J9	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.G579D	ENST00000388820.4	37	c.1736	CCDS32303.1	15	.	.	.	.	.	.	.	.	.	.	C	16.35	3.099412	0.56183	.	.	ENSG00000136378	ENST00000388820	T	0.00498	6.97	3.51	3.51	0.40186	.	0.130450	0.51477	D	0.000090	T	0.03263	0.0095	H	0.97051	3.93	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.07908	-1.0748	10	0.87932	D	0	.	14.2729	0.66162	0.0:1.0:0.0:0.0	.	579;579	A8MQ00;Q9UKP4	.;ATS7_HUMAN	D	579	ENSP00000373472:G579D	ENSP00000373472:G579D	G	-	2	0	ADAMTS7	76854161	1.000000	0.71417	0.872000	0.34217	0.056000	0.15407	7.439000	0.80444	1.986000	0.57962	0.289000	0.19496	GGT	ADAMTS7	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000136378		0.642	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS7	HGNC	protein_coding	OTTHUMT00000421331.1	109	0.00	0	C	NM_014272		79067106	79067106	-1	no_errors	ENST00000388820	ensembl	human	known	69_37n	missense	69	11.54	9	SNP	1.000	T
ANO2	57101	genome.wustl.edu	37	12	5848498	5848498	+	Silent	SNP	G	G	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr12:5848498G>T	ENST00000356134.5	-	14	1481	c.1410C>A	c.(1408-1410)ggC>ggA	p.G470G	ANO2_ENST00000327087.8_Silent_p.G469G|ANO2_ENST00000538154.1_5'UTR|ANO2_ENST00000546188.1_Silent_p.G470G	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	474					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						CCTCTTCTATGCCAGTCAGGT	0.428																																						dbGAP											0													71.0	73.0	73.0					12																	5848498		1914	4127	6041	-	-	-	SO:0001819	synonymous_variant	0			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.1410C>A	12.37:g.5848498G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C4N787|Q9H847	Silent	SNP	pfam_Anoctamin	p.G470	ENST00000356134.5	37	c.1410		12																																																																																			ANO2	-	pfam_Anoctamin	ENSG00000047617		0.428	ANO2-001	KNOWN	basic	protein_coding	ANO2	HGNC	protein_coding	OTTHUMT00000399019.4	241	0.00	0	G	NM_020373		5848498	5848498	-1	no_errors	ENST00000356134	ensembl	human	known	69_37n	silent	205	19.92	51	SNP	0.295	T
ARHGEF2	9181	genome.wustl.edu	37	1	155922540	155922540	+	Silent	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr1:155922540G>A	ENST00000361247.4	-	15	1962	c.1863C>T	c.(1861-1863)ttC>ttT	p.F621F	ARHGEF2_ENST00000313667.4_Silent_p.F620F|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000313695.7_Silent_p.F593F|ARHGEF2_ENST00000462460.2_Silent_p.F666F|ARHGEF2_ENST00000368315.4_Silent_p.F622F|ARHGEF2_ENST00000368316.1_Silent_p.F593F	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	621					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CTTCGGCCTGGAAATGGGTCA	0.622																																					Melanoma(178;35 2768 6610 28839)	dbGAP											0													103.0	93.0	97.0					1																	155922540		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.1863C>T	1.37:g.155922540G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.F622	ENST00000361247.4	37	c.1866	CCDS53376.1	1																																																																																			ARHGEF2	-	NULL	ENSG00000116584		0.622	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF2	HGNC	protein_coding	OTTHUMT00000046204.2	112	0.00	0	G	NM_004723		155922540	155922540	-1	no_errors	ENST00000368315	ensembl	human	known	69_37n	silent	42	65.29	79	SNP	1.000	A
BBS9	27241	genome.wustl.edu	37	7	33407456	33407456	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr7:33407456C>T	ENST00000242067.6	+	17	2292	c.1771C>T	c.(1771-1773)Ctt>Ttt	p.L591F	BBS9_ENST00000354265.4_Missense_Mutation_p.L556F|BBS9_ENST00000396127.2_Missense_Mutation_p.L556F|BBS9_ENST00000355070.2_Missense_Mutation_p.L586F|BBS9_ENST00000350941.3_Missense_Mutation_p.L551F	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	591					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			AATTACTGTTCTTGCTTCCAA	0.353									Bardet-Biedl syndrome																													dbGAP											0													196.0	178.0	185.0					7																	33407456		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.1771C>T	7.37:g.33407456C>T	ENSP00000242067:p.Leu591Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	NULL	p.L591F	ENST00000242067.6	37	c.1771	CCDS43566.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.4|22.4	4.282974|4.282974	0.80692|0.80692	.|.	.|.	ENSG00000122507|ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132|ENST00000434373	T;T;T;T;T|.	0.17691|.	2.26;2.26;2.26;2.26;2.26|.	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.82121|0.82121	0.4968|0.4968	M|M	0.82323|0.82323	2.585|2.585	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.85130|.	0.997;0.997;0.997;0.997;0.996|.	T|T	0.82914|0.82914	-0.0221|-0.0221	10|5	0.72032|.	D|.	0.01|.	-17.5817|-17.5817	18.9484|18.9484	0.92630|0.92630	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	591;551;586;556;591|.	Q3SYG4-3;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4|.	.;.;.;.;PTHB1_HUMAN|.	F|F	591;551;556;586;556;591|157	ENSP00000242067:L591F;ENSP00000313122:L551F;ENSP00000379433:L556F;ENSP00000347182:L586F;ENSP00000346214:L556F|.	ENSP00000242067:L591F|.	L|S	+|+	1|2	0|0	BBS9|BBS9	33373981|33373981	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.911000|0.911000	0.54048|0.54048	2.877000|2.877000	0.48506|0.48506	2.572000|2.572000	0.86782|0.86782	0.655000|0.655000	0.94253|0.94253	CTT|TCT	BBS9	-	NULL	ENSG00000122507		0.353	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBS9	HGNC	protein_coding	OTTHUMT00000329064.1	515	0.00	0	C			33407456	33407456	+1	no_errors	ENST00000242067	ensembl	human	known	69_37n	missense	478	18.95	112	SNP	1.000	T
BROX	148362	genome.wustl.edu	37	1	222903003	222903003	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr1:222903003A>T	ENST00000340934.5	+	10	1204	c.798A>T	c.(796-798)aaA>aaT	p.K266N	BROX_ENST00000537020.1_Missense_Mutation_p.K266N|BROX_ENST00000539697.1_Missense_Mutation_p.K234N	NM_144695.2	NP_653296.2	Q5VW32	BROX_HUMAN	BRO1 domain and CAAX motif containing	266	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|stomach(1)	14						CTAGTGATAAATGCGGTGAAG	0.348																																						dbGAP											0													86.0	91.0	89.0					1																	222903003		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1534.1, CCDS73036.1, CCDS73037.1	1q41	2010-11-30	2010-11-30	2010-11-30	ENSG00000162819	ENSG00000162819			26512	protein-coding gene	gene with protein product	"""BRO1 domain containing protein"""		"""chromosome 1 open reading frame 58"""	C1orf58		18190528	Standard	XM_005273065		Approved	FLJ32421	uc001hnq.1	Q5VW32	OTTHUMG00000037650	ENST00000340934.5:c.798A>T	1.37:g.222903003A>T	ENSP00000343742:p.Lys266Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z9G5|Q96MG1	Missense_Mutation	SNP	pfam_BRO1_dom,pfscan_BRO1_dom	p.K266N	ENST00000340934.5	37	c.798	CCDS1534.1	1	.	.	.	.	.	.	.	.	.	.	a	19.30	3.801673	0.70682	.	.	ENSG00000162819	ENST00000340934;ENST00000537020;ENST00000539697	T;T;T	0.20069	2.1;2.1;2.1	5.87	-4.01	0.04045	BRO1 domain (3);	0.000000	0.85682	D	0.000000	T	0.42291	0.1196	M	0.82056	2.57	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.78314	0.99;0.99;0.991	T	0.30179	-0.9987	10	0.51188	T	0.08	-1.3015	14.0777	0.64900	0.5879:0.0:0.4121:0.0	.	266;234;266	F5GXQ0;B7Z9G5;Q5VW32	.;.;BROX_HUMAN	N	266;266;234	ENSP00000343742:K266N;ENSP00000440041:K266N;ENSP00000441080:K234N	ENSP00000343742:K266N	K	+	3	2	BROX	220969626	0.935000	0.31712	0.820000	0.32676	0.907000	0.53573	0.167000	0.16602	-1.339000	0.02230	-1.139000	0.01908	AAA	BROX	-	pfam_BRO1_dom,pfscan_BRO1_dom	ENSG00000162819		0.348	BROX-001	NOVEL	basic|appris_principal|CCDS	protein_coding	BROX	HGNC	protein_coding	OTTHUMT00000091815.2	184	0.00	0	A	NM_144695		222903003	222903003	+1	no_errors	ENST00000340934	ensembl	human	known	69_37n	missense	124	56.03	158	SNP	0.979	T
BRSK1	84446	genome.wustl.edu	37	19	55820015	55820015	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr19:55820015C>T	ENST00000309383.1	+	18	2375	c.2098C>T	c.(2098-2100)Cgt>Tgt	p.R700C	BRSK1_ENST00000326848.7_Missense_Mutation_p.R395C|BRSK1_ENST00000590333.1_Missense_Mutation_p.R716C	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	700					axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		AGGTCCCAGCCGTCGGTTCAA	0.662																																						dbGAP											0													48.0	41.0	43.0					19																	55820015		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.2098C>T	19.37:g.55820015C>T	ENSP00000310649:p.Arg700Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.R716C	ENST00000309383.1	37	c.2146	CCDS12921.1	19	.	.	.	.	.	.	.	.	.	.	.	17.04	3.286555	0.59867	.	.	ENSG00000160469	ENST00000309383;ENST00000543410;ENST00000326848	D;T	0.82081	-1.57;1.02	4.93	4.93	0.64822	.	0.081227	0.49305	D	0.000147	D	0.88738	0.6518	M	0.68952	2.095	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.59288	0.63;0.855	D	0.90147	0.4218	10	0.87932	D	0	.	17.3573	0.87340	0.0:1.0:0.0:0.0	.	700;716	Q8TDC3;Q8TDC3-2	BRSK1_HUMAN;.	C	700;395;395	ENSP00000310649:R700C;ENSP00000320853:R395C	ENSP00000310649:R700C	R	+	1	0	BRSK1	60511827	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	4.337000	0.59310	2.471000	0.83476	0.544000	0.68410	CGT	BRSK1	-	NULL	ENSG00000160469		0.662	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRSK1	HGNC	protein_coding	OTTHUMT00000452787.1	55	0.00	0	C	NM_032430		55820015	55820015	+1	no_errors	ENST00000590333	ensembl	human	known	69_37n	missense	44	18.52	10	SNP	1.000	T
ATG101	60673	genome.wustl.edu	37	12	52470890	52470890	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr12:52470890G>T	ENST00000336854.4	+	4	1051	c.573G>T	c.(571-573)aaG>aaT	p.K191N	OR7E47P_ENST00000546390.1_RNA|RP11-1100L3.7_ENST00000550301.1_RNA	NM_001098673.1|NM_021934.4	NP_001092143.1|NP_068753.2	Q9BSB4	ATGA1_HUMAN		191					autophagic vacuole assembly (GO:0000045)	pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein complex binding (GO:0032403)			endometrium(1)|lung(2)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(357;0.0978)		ACCTGTACAAGATCTCCTTCC	0.562																																						dbGAP											0													105.0	94.0	98.0					12																	52470890		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000336854.4:c.573G>T	12.37:g.52470890G>T	ENSP00000338990:p.Lys191Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HAE2|Q9HBN1	Missense_Mutation	SNP	pfam_ATG101	p.K191N	ENST00000336854.4	37	c.573	CCDS8820.1	12	.	.	.	.	.	.	.	.	.	.	G	15.66	2.898575	0.52227	.	.	ENSG00000123395	ENST00000336854;ENST00000550984	.	.	.	4.78	2.95	0.34219	.	0.000000	0.85682	D	0.000000	T	0.44201	0.1282	M	0.62723	1.935	0.58432	D	0.999997	P	0.44734	0.842	B	0.37601	0.254	T	0.38866	-0.9641	9	0.49607	T	0.09	-41.5469	7.9244	0.29865	0.2569:0.0:0.7431:0.0	.	191	Q9BSB4	ATGA1_HUMAN	N	191	.	ENSP00000338990:K191N	K	+	3	2	C12orf44	50757157	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.168000	0.50801	0.741000	0.32674	0.655000	0.94253	AAG	C12orf44	-	NULL	ENSG00000123395		0.562	C12orf44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf44	HGNC	protein_coding	OTTHUMT00000405063.1	73	0.00	0	G			52470890	52470890	+1	no_errors	ENST00000336854	ensembl	human	known	69_37n	missense	41	20.75	11	SNP	1.000	T
CD300E	342510	genome.wustl.edu	37	17	72613390	72613390	+	Silent	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr17:72613390G>A	ENST00000328630.3	-	2	295	c.255C>T	c.(253-255)ctC>ctT	p.L85L	CD300E_ENST00000426295.2_Silent_p.L126L|CD300E_ENST00000392619.1_Silent_p.L112L			Q496F6	CLM2_HUMAN	CD300e molecule	85	Ig-like V-type.				innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	19						CAGTGAAGGCGAGAGCCTCCG	0.532																																						dbGAP											0													223.0	161.0	182.0					17																	72613390		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX648376	CCDS11702.1	17q25.1	2013-01-11	2006-03-28	2006-02-22	ENSG00000186407	ENSG00000186407		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	28874	protein-coding gene	gene with protein product		609801	"""CD300 antigen like family member E"", ""CD300e antigen"""	CD300LE		15549731, 15557162	Standard	NM_181449		Approved	IREM2, CLM2	uc002jlb.2	Q496F6	OTTHUMG00000067605	ENST00000328630.3:c.255C>T	17.37:g.72613390G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNS1|Q7Z7I3	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.L126	ENST00000328630.3	37	c.378	CCDS11702.1	17																																																																																			CD300E	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000186407		0.532	CD300E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CD300E	HGNC	protein_coding		155	0.00	0	G	NM_181449		72613390	72613390	-1	no_errors	ENST00000426295	ensembl	human	known	69_37n	silent	103	39.31	68	SNP	0.001	A
CENPB	1059	genome.wustl.edu	37	20	3765588	3765588	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr20:3765588C>T	ENST00000379751.4	-	1	1749	c.1543G>A	c.(1543-1545)Gag>Aag	p.E515K	CDC25B_ENST00000379598.5_5'Flank|CDC25B_ENST00000344256.6_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	515	Asp/Glu-rich (acidic).				regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						tcCTCTTCCTCACTGTCTGAA	0.567																																						dbGAP											0													175.0	138.0	150.0					20																	3765588		2203	4300	6503	-	-	-	SO:0001583	missense	0			X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.1543G>A	20.37:g.3765588C>T	ENSP00000369075:p.Glu515Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96EI4	Missense_Mutation	SNP	pfam_Centromere_CenpB_dimerisation,pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_Psq,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.E515K	ENST00000379751.4	37	c.1543	CCDS13064.1	20	.	.	.	.	.	.	.	.	.	.	C	13.52	2.262826	0.39995	.	.	ENSG00000125817	ENST00000379751;ENST00000536335	T	0.23147	1.92	5.0	5.0	0.66597	Centromere protein Cenp-B, dimerisation domain (1);	0.212871	0.22486	U	0.059430	T	0.18467	0.0443	N	0.19112	0.55	0.26549	N	0.973941	B	0.24186	0.099	B	0.24269	0.052	T	0.12889	-1.0530	10	0.42905	T	0.14	.	13.7884	0.63123	0.0:1.0:0.0:0.0	.	515	P07199	CENPB_HUMAN	K	515;54	ENSP00000369075:E515K	ENSP00000369075:E515K	E	-	1	0	CENPB	3713588	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	2.272000	0.43373	2.317000	0.78254	0.655000	0.94253	GAG	CENPB	-	pfam_Centromere_CenpB_dimerisation	ENSG00000125817		0.567	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPB	HGNC	protein_coding	OTTHUMT00000077772.2	296	0.34	1	C	NM_001810		3765588	3765588	-1	no_errors	ENST00000379751	ensembl	human	known	69_37n	missense	246	16.04	47	SNP	1.000	T
CDH4	1002	genome.wustl.edu	37	20	59829897	59829897	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr20:59829897C>G	ENST00000360469.5	+	2	161	c.73C>G	c.(73-75)Ctt>Gtt	p.L25V		NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	25					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TAATGAGGATCTTACAACTAG	0.413																																						dbGAP											0													119.0	132.0	127.0					20																	59829897		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.73C>G	20.37:g.59829897C>G	ENSP00000353656:p.Leu25Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmocollin	p.L25V	ENST00000360469.5	37	c.73	CCDS13488.1	20	.	.	.	.	.	.	.	.	.	.	C	7.123	0.578437	0.13686	.	.	ENSG00000179242	ENST00000360469	T	0.55234	0.53	5.37	5.37	0.77165	.	0.925317	0.08849	N	0.884698	T	0.43166	0.1235	N	0.19112	0.55	0.80722	D	1	B	0.23316	0.083	B	0.24006	0.05	T	0.10965	-1.0607	9	.	.	.	.	17.2799	0.87125	0.0:1.0:0.0:0.0	.	25	P55283	CADH4_HUMAN	V	25	ENSP00000353656:L25V	.	L	+	1	0	CDH4	59263292	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.167000	0.42415	2.515000	0.84797	0.655000	0.94253	CTT	CDH4	-	NULL	ENSG00000179242		0.413	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH4	HGNC	protein_coding	OTTHUMT00000079965.2	183	0.00	0	C	NM_001794		59829897	59829897	+1	no_errors	ENST00000360469	ensembl	human	known	69_37n	missense	259	27.04	96	SNP	1.000	G
DBX2	440097	genome.wustl.edu	37	12	45444337	45444337	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr12:45444337C>T	ENST00000332700.6	-	1	545	c.374G>A	c.(373-375)cGa>cAa	p.R125Q	RP11-478B9.1_ENST00000548424.1_RNA	NM_001004329.2	NP_001004329.2	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	125					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	22	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		GGTACAGTCTCGGTCCCCCGG	0.726																																						dbGAP											0													9.0	13.0	12.0					12																	45444337		2069	4086	6155	-	-	-	SO:0001583	missense	0				CCDS31781.1	12q12	2011-06-20				ENSG00000185610		"""Homeoboxes / ANTP class : NKL subclass"""	33186	protein-coding gene	gene with protein product						11239429	Standard	NM_001004329		Approved	FLJ16139	uc001rok.1	Q6ZNG2	OTTHUMG00000169559	ENST00000332700.6:c.374G>A	12.37:g.45444337C>T	ENSP00000331470:p.Arg125Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.R125Q	ENST00000332700.6	37	c.374	CCDS31781.1	12	.	.	.	.	.	.	.	.	.	.	C	12.65	2.003051	0.35320	.	.	ENSG00000185610	ENST00000332700	D	0.90844	-2.74	3.22	0.228	0.15364	.	0.363183	0.19138	N	0.121757	T	0.71804	0.3383	N	0.17082	0.46	0.24173	N	0.995613	P	0.40376	0.715	B	0.26770	0.073	T	0.67193	-0.5732	10	0.10377	T	0.69	-0.3026	4.8443	0.13505	0.0:0.5997:0.1813:0.219	.	125	Q6ZNG2	DBX2_HUMAN	Q	125	ENSP00000331470:R125Q	ENSP00000331470:R125Q	R	-	2	0	DBX2	43730604	0.610000	0.26983	0.930000	0.37139	0.990000	0.78478	0.927000	0.28818	0.194000	0.20326	0.552000	0.68991	CGA	DBX2	-	NULL	ENSG00000185610		0.726	DBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBX2	HGNC	protein_coding	OTTHUMT00000404810.1	17	0.00	0	C	NM_001004329		45444337	45444337	-1	no_errors	ENST00000332700	ensembl	human	known	69_37n	missense	6	45.45	5	SNP	0.829	T
DDRGK1	65992	genome.wustl.edu	37	20	3184039	3184039	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr20:3184039C>T	ENST00000354488.3	-	2	172	c.115G>A	c.(115-117)Gag>Aag	p.E39K	DDRGK1_ENST00000380201.2_Missense_Mutation_p.E39K	NM_023935.1	NP_076424.1	Q96HY6	DDRGK_HUMAN	DDRGK domain containing 1	39						endoplasmic reticulum (GO:0005783)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(1)	7						GCCAGCTCCTCATTGTGCAGT	0.687																																						dbGAP											0													11.0	13.0	12.0					20																	3184039		2147	4220	6367	-	-	-	SO:0001583	missense	0			AL121891	CCDS13050.1	20p13	2011-08-18	2008-10-03	2008-10-03	ENSG00000198171	ENSG00000198171			16110	protein-coding gene	gene with protein product	"""Dashurin"""		"""chromosome 20 open reading frame 116"""	C20orf116		20036718, 20228063, 21494687	Standard	NM_023935		Approved	dJ1187M17.3	uc002wic.3	Q96HY6	OTTHUMG00000031732	ENST00000354488.3:c.115G>A	20.37:g.3184039C>T	ENSP00000346483:p.Glu39Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIU5|C9JSZ5|Q9BW47	Missense_Mutation	SNP	pfam_DDRGK_dom-contain	p.E39K	ENST00000354488.3	37	c.115	CCDS13050.1	20	.	.	.	.	.	.	.	.	.	.	C	27.4	4.831748	0.91036	.	.	ENSG00000198171	ENST00000354488;ENST00000380213;ENST00000380201	T	0.45668	0.89	4.99	4.99	0.66335	.	0.570211	0.19972	N	0.101958	T	0.27697	0.0681	N	0.24115	0.695	0.29042	N	0.885024	P;B	0.40476	0.718;0.421	B;B	0.39258	0.295;0.154	T	0.08351	-1.0726	10	0.07644	T	0.81	-3.7015	14.1374	0.65295	0.0:1.0:0.0:0.0	.	39;39	Q96HY6-2;Q96HY6	.;DDRGK_HUMAN	K	39	ENSP00000346483:E39K	ENSP00000346483:E39K	E	-	1	0	DDRGK1	3132039	0.996000	0.38824	0.271000	0.24616	0.158000	0.22134	2.213000	0.42844	2.478000	0.83669	0.561000	0.74099	GAG	DDRGK1	-	NULL	ENSG00000198171		0.687	DDRGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDRGK1	HGNC	protein_coding	OTTHUMT00000077709.2	13	0.00	0	C	NM_023935		3184039	3184039	-1	no_errors	ENST00000354488	ensembl	human	known	69_37n	missense	13	40.91	9	SNP	0.610	T
DUSP22	56940	genome.wustl.edu	37	6	348862	348862	+	Intron	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr6:348862C>T	ENST00000344450.5	+	7	951				DUSP22_ENST00000419235.2_Missense_Mutation_p.R177C|DUSP22_ENST00000604971.1_Missense_Mutation_p.R74C|DUSP22_ENST00000605315.1_Missense_Mutation_p.R74C|DUSP22_ENST00000605035.1_3'UTR|DUSP22_ENST00000603453.1_Missense_Mutation_p.R74C	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22						apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		GGAGCAAGGGCGCACAGAGCC	0.552																																						dbGAP											0													65.0	62.0	63.0					6																	348862		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.508+21C>T	6.37:g.348862C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DK56|Q59GW2|Q5VWR2|Q96AR1	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.A114V	ENST00000344450.5	37	c.341	CCDS4468.1	6	.	.	.	.	.	.	.	.	.	.	C	12.61	1.988680	0.35131	.	.	ENSG00000112679	ENST00000419235	D	0.92495	-3.05	4.8	3.94	0.45596	.	.	.	.	.	D	0.87297	0.6142	.	.	.	0.38140	D	0.938427	.	.	.	.	.	.	D	0.85055	0.0931	5	.	.	.	.	7.0963	0.25311	0.0:0.7318:0.1736:0.0947	.	.	.	.	V	114	ENSP00000397459:A114V	.	A	+	2	0	DUSP22	293862	0.981000	0.34729	0.732000	0.30844	0.116000	0.19942	2.828000	0.48120	1.142000	0.42291	-0.136000	0.14681	GCG	DUSP22	-	NULL	ENSG00000112679		0.552	DUSP22-001	KNOWN	basic|CCDS	protein_coding	DUSP22	HGNC	protein_coding	OTTHUMT00000039621.1	115	0.00	0	C	NM_020185		348862	348862	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000419235	ensembl	human	known	69_37n	missense	91	14.81	16	SNP	0.557	T
EEFSEC	60678	genome.wustl.edu	37	3	127983621	127983621	+	Silent	SNP	C	C	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr3:127983621C>A	ENST00000254730.6	+	4	837	c.783C>A	c.(781-783)ctC>ctA	p.L261L	EEFSEC_ENST00000483457.1_Intron	NM_021937.3	NP_068756.2	P57772	SELB_HUMAN	eukaryotic elongation factor, selenocysteine-tRNA-specific	261					selenocysteine incorporation (GO:0001514)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)|translation elongation factor activity (GO:0003746)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)	25						TCCCTGCCCTCAAGGTCAGTC	0.577																																						dbGAP											0													158.0	102.0	121.0					3																	127983621		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33849.1	3q21.3	2007-05-25			ENSG00000132394	ENSG00000132394			24614	protein-coding gene	gene with protein product	"""elongation factor for selenoprotein translation"""	607695				10970870, 15229221	Standard	XM_005247696		Approved	SELB, EFSEC	uc003eki.3	P57772	OTTHUMG00000159659	ENST00000254730.6:c.783C>A	3.37:g.127983621C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96HZ6	Silent	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel,superfamily_Transl_elong_EF1A/Init_IF2_C,prints_ProtSyn_GTP-bd	p.L261	ENST00000254730.6	37	c.783	CCDS33849.1	3																																																																																			EEFSEC	-	pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel	ENSG00000132394		0.577	EEFSEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEFSEC	HGNC	protein_coding	OTTHUMT00000356738.2	118	0.00	0	C	NM_021937		127983621	127983621	+1	no_errors	ENST00000254730	ensembl	human	known	69_37n	silent	49	61.11	77	SNP	1.000	A
EHMT1	79813	genome.wustl.edu	37	9	140729293	140729293	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr9:140729293A>G	ENST00000460843.1	+	27	3812	c.3785A>G	c.(3784-3786)aAg>aGg	p.K1262R		NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1262					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		GGCTCCCCCAAGTGCCGGCAC	0.687																																						dbGAP											0													29.0	28.0	28.0					9																	140729293		2203	4297	6500	-	-	-	SO:0001583	missense	0			AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.3785A>G	9.37:g.140729293A>G	ENSP00000417980:p.Lys1262Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.K1262R	ENST00000460843.1	37	c.3785	CCDS7050.2	9	.	.	.	.	.	.	.	.	.	.	A	21.3	4.130210	0.77549	.	.	ENSG00000181090	ENST00000460843	T	0.72167	-0.63	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.66733	0.2819	L	0.54323	1.7	0.80722	D	1	B	0.33528	0.416	B	0.31390	0.129	T	0.70026	-0.4985	10	0.62326	D	0.03	.	15.3825	0.74669	1.0:0.0:0.0:0.0	.	1262	Q9H9B1	EHMT1_HUMAN	R	1262	ENSP00000417980:K1262R	ENSP00000417980:K1262R	K	+	2	0	EHMT1	139849114	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.655000	0.91098	2.101000	0.63845	0.459000	0.35465	AAG	EHMT1	-	NULL	ENSG00000181090		0.687	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHMT1	HGNC	protein_coding	OTTHUMT00000055371.2	28	0.00	0	A	NM_024757		140729293	140729293	+1	no_errors	ENST00000460843	ensembl	human	known	69_37n	missense	10	50.00	10	SNP	1.000	G
EIF2B5	8893	genome.wustl.edu	37	3	183855975	183855975	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr3:183855975G>A	ENST00000273783.3	+	5	828	c.706G>A	c.(706-708)Gat>Aat	p.D236N	RP11-778D9.12_ENST00000608135.1_RNA|EIF2B5_ENST00000444495.1_Missense_Mutation_p.D236N	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	236					astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GGGCAGTAGTGATGGAGTGGA	0.488																																						dbGAP											0													170.0	158.0	162.0					3																	183855975		2203	4300	6503	-	-	-	SO:0001583	missense	0			U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.706G>A	3.37:g.183855975G>A	ENSP00000273783:p.Asp236Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q541Z1|Q96D04	Missense_Mutation	SNP	pfam_W2_domain,superfamily_ARM-type_fold,superfamily_Trimer_LpxA-like,smart_W2_domain	p.D236N	ENST00000273783.3	37	c.706	CCDS3252.1	3	.	.	.	.	.	.	.	.	.	.	g	15.87	2.959491	0.53400	.	.	ENSG00000145191	ENST00000273783;ENST00000444495	D;D	0.98075	-4.7;-4.7	5.8	5.8	0.92144	.	0.198456	0.51477	D	0.000097	D	0.95834	0.8644	L	0.46157	1.445	0.58432	D	0.999997	B	0.06786	0.001	B	0.08055	0.003	D	0.92940	0.6371	10	0.22109	T	0.4	-17.4274	19.0588	0.93078	0.0:0.0:1.0:0.0	.	236	Q13144	EI2BE_HUMAN	N	236	ENSP00000273783:D236N;ENSP00000409142:D236N	ENSP00000273783:D236N	D	+	1	0	EIF2B5	185338669	1.000000	0.71417	0.879000	0.34478	0.960000	0.62799	6.707000	0.74654	2.744000	0.94065	0.655000	0.94253	GAT	EIF2B5	-	NULL	ENSG00000145191		0.488	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2B5	HGNC	protein_coding	OTTHUMT00000346168.1	289	0.00	0	G			183855975	183855975	+1	no_errors	ENST00000273783	ensembl	human	known	69_37n	missense	255	15.79	48	SNP	0.995	A
ELFN2	114794	genome.wustl.edu	37	22	37771355	37771355	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr22:37771355A>G	ENST00000402918.2	-	3	1005	c.220T>C	c.(220-222)Tcg>Ccg	p.S74P	RP1-63G5.8_ENST00000609322.1_RNA|ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.5_ENST00000430883.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	74					negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					CGGTTGAGCGAGGAGTAGAGC	0.597																																						dbGAP											0													245.0	242.0	243.0					22																	37771355		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.220T>C	22.37:g.37771355A>G	ENSP00000385277:p.Ser74Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PY3	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,pfscan_LPXTG-motif_cell_wall_anchor	p.S74P	ENST00000402918.2	37	c.220	CCDS33642.1	22	.	.	.	.	.	.	.	.	.	.	A	16.21	3.059079	0.55325	.	.	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.55930	0.49;0.49	5.09	5.09	0.68999	.	0.065795	0.64402	D	0.000007	T	0.76118	0.3943	M	0.88241	2.94	0.58432	D	0.999999	D	0.89917	1.0	D	0.74348	0.983	T	0.81647	-0.0838	10	0.72032	D	0.01	-11.4051	14.8554	0.70332	1.0:0.0:0.0:0.0	.	74	Q5R3F8	PPR29_HUMAN	P	74	ENSP00000300147:S74P;ENSP00000385277:S74P	ENSP00000300147:S74P	S	-	1	0	ELFN2	36101301	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	9.231000	0.95317	1.918000	0.55548	0.334000	0.21626	TCG	ELFN2	-	NULL	ENSG00000166897		0.597	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	HGNC	protein_coding	OTTHUMT00000318900.2	461	0.00	0	A	NM_052906		37771355	37771355	-1	no_errors	ENST00000349653	ensembl	human	known	69_37n	missense	219	25.51	75	SNP	1.000	G
PCDHA9	9752	genome.wustl.edu	37	5	140242934	140242934	+	Intron	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr5:140242934G>A	ENST00000532602.1	+	1	3427				PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|AC005609.1_ENST00000502505.1_Silent_p.V14V|PCDHA14_ENST00000562220.1_RNA|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000506939.2_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTGTACACGACGCTGCGGT	0.622																																					Melanoma(55;1800 1972 14909)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2394+12460G>A	5.37:g.140242934G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O15053|Q2M3S5	Silent	SNP	NULL	p.V14	ENST00000532602.1	37	c.42	CCDS54920.1	5																																																																																			AC005609.1	-	NULL	ENSG00000249034		0.622	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000249034	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000372896.2	29	0.00	0	G	NM_031857		140242934	140242934	-1	no_errors	ENST00000502505	ensembl	human	known	69_37n	silent	26	13.33	4	SNP	0.001	A
ERCC3	2071	genome.wustl.edu	37	2	128046289	128046289	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr2:128046289C>T	ENST00000285398.2	-	7	1068	c.974G>A	c.(973-975)cGa>cAa	p.R325Q	ERCC3_ENST00000493187.2_Missense_Mutation_p.R261Q	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3	325					7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		AAACATCTTTCGCAAGCTCTT	0.498			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													dbGAP	yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	0													334.0	333.0	334.0					2																	128046289		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.974G>A	2.37:g.128046289C>T	ENSP00000285398:p.Arg325Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QM0	Missense_Mutation	SNP	pfam_Helicase/UvrB_dom,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_XPGB_DNA_repair,tigrfam_XPGB_DNA_repair	p.R325Q	ENST00000285398.2	37	c.974	CCDS2144.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.7|29.7	5.028074|5.028074	0.93518|0.93518	.|.	.|.	ENSG00000163161|ENSG00000163161	ENST00000456257|ENST00000285398;ENST00000493187	.|T;T	.|0.36878	.|1.23;1.23	5.5|5.5	5.5|5.5	0.81552|0.81552	.|DEAD-like helicase (1);Helicase/UvrB domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.38427|0.38427	0.1040|0.1040	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	.|P	.|0.47962	.|0.903	.|B	.|0.40782	.|0.34	T|T	0.35151|0.35151	-0.9800|-0.9800	5|10	.|0.62326	.|D	.|0.03	-21.9141|-21.9141	19.3996|19.3996	0.94623|0.94623	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|325	.|P19447	.|ERCC3_HUMAN	K|Q	175|325;261	.|ENSP00000285398:R325Q;ENSP00000444796:R261Q	.|ENSP00000285398:R325Q	E|R	-|-	1|2	0|0	ERCC3|ERCC3	127762759|127762759	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.887000|0.887000	0.51463|0.51463	7.757000|7.757000	0.85209|0.85209	2.598000|2.598000	0.87819|0.87819	0.655000|0.655000	0.94253|0.94253	GAA|CGA	ERCC3	-	pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,tigrfam_XPGB_DNA_repair	ENSG00000163161		0.498	ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC3	HGNC	protein_coding	OTTHUMT00000331028.1	156	0.00	0	C	NM_000122		128046289	128046289	-1	no_errors	ENST00000285398	ensembl	human	known	69_37n	missense	115	14.18	19	SNP	1.000	T
FAM124B	79843	genome.wustl.edu	37	2	225266233	225266233	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr2:225266233C>T	ENST00000409685.3	-	1	518	c.253G>A	c.(253-255)Gtc>Atc	p.V85I	FAM124B_ENST00000243806.2_Missense_Mutation_p.V85I|FAM124B_ENST00000389874.3_Missense_Mutation_p.V85I	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	85								p.V85I(2)		endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		GAGTCCAGGACGCGAAATAGC	0.552																																						dbGAP											2	Substitution - Missense(2)	endometrium(2)											59.0	57.0	58.0					2																	225266233		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.253G>A	2.37:g.225266233C>T	ENSP00000386895:p.Val85Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNC7|Q8NBZ4|Q8TAV7	Missense_Mutation	SNP	NULL	p.V85I	ENST00000409685.3	37	c.253	CCDS46527.1	2	.	.	.	.	.	.	.	.	.	.	C	4.854	0.158738	0.09236	.	.	ENSG00000124019	ENST00000389874;ENST00000409685;ENST00000243806	T;T;T	0.46063	0.88;0.88;0.88	5.69	1.32	0.21799	.	0.311841	0.33691	N	0.004645	T	0.30510	0.0767	L	0.42686	1.345	0.09310	N	1	B;B	0.21452	0.056;0.004	B;B	0.17433	0.018;0.003	T	0.18871	-1.0323	10	0.44086	T	0.13	-7.8837	7.6061	0.28103	0.0:0.574:0.22:0.206	.	85;85	Q9H5Z6;Q9H5Z6-2	F124B_HUMAN;.	I	85	ENSP00000374524:V85I;ENSP00000386895:V85I;ENSP00000243806:V85I	ENSP00000243806:V85I	V	-	1	0	FAM124B	224974477	0.625000	0.27111	0.000000	0.03702	0.001000	0.01503	1.550000	0.36223	0.332000	0.23536	-0.137000	0.14449	GTC	FAM124B	-	NULL	ENSG00000124019		0.552	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM124B	HGNC	protein_coding	OTTHUMT00000330873.1	74	0.00	0	C	NM_024785		225266233	225266233	-1	no_errors	ENST00000409685	ensembl	human	known	69_37n	missense	76	20.00	19	SNP	0.002	T
FAM205A	259308	genome.wustl.edu	37	9	34723403	34723403	+	Silent	SNP	A	A	G			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr9:34723403A>G	ENST00000378788.3	-	4	3873	c.3834T>C	c.(3832-3834)cgT>cgC	p.R1278R		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	1278						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						TCTGAGCAGGACGAGATTGGG	0.582																																						dbGAP											0													42.0	43.0	42.0					9																	34723403		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.3834T>C	9.37:g.34723403A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVW7	Silent	SNP	NULL	p.R1278	ENST00000378788.3	37	c.3834	CCDS55305.1	9																																																																																			FAM205A	-	NULL	ENSG00000205108		0.582	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM205A	HGNC	protein_coding	OTTHUMT00000001150.2	137	0.00	0	A	NM_001141917		34723403	34723403	-1	no_errors	ENST00000378788	ensembl	human	novel	69_37n	silent	111	11.20	14	SNP	0.000	G
FAM47C	442444	genome.wustl.edu	37	X	37028635	37028635	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chrX:37028635C>T	ENST00000358047.3	+	1	2204	c.2152C>T	c.(2152-2154)Cct>Tct	p.P718S		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	718										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CCACGCGGAGCCTCCTGAGAG	0.637																																						dbGAP											0													46.0	46.0	46.0					X																	37028635		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2152C>T	X.37:g.37028635C>T	ENSP00000367913:p.Pro718Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU46	Missense_Mutation	SNP	NULL	p.P718S	ENST00000358047.3	37	c.2152	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	-	9.110	1.006425	0.19199	.	.	ENSG00000198173	ENST00000358047	T	0.22134	1.97	1.06	-1.69	0.08186	.	.	.	.	.	T	0.31420	0.0796	L	0.55103	1.725	0.09310	N	1	D	0.76494	0.999	D	0.73708	0.981	T	0.18304	-1.0341	9	0.30854	T	0.27	.	4.6299	0.12496	0.0:0.2739:0.0:0.7261	.	718	Q5HY64	FA47C_HUMAN	S	718	ENSP00000367913:P718S	ENSP00000367913:P718S	P	+	1	0	FAM47C	36938556	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.537000	0.06128	-0.486000	0.06744	-0.483000	0.04790	CCT	FAM47C	-	NULL	ENSG00000198173		0.637	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	141	0.00	0	C	NM_001013736		37028635	37028635	+1	no_errors	ENST00000358047	ensembl	human	known	69_37n	missense	106	17.69	23	SNP	0.004	T
GLI3	2737	genome.wustl.edu	37	7	42064883	42064883	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr7:42064883G>A	ENST00000395925.3	-	9	1420	c.1336C>T	c.(1336-1338)Cca>Tca	p.P446S	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	446					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CGAGCCCCTGGGCTGGGGAGG	0.632									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													dbGAP											0													110.0	94.0	100.0					7																	42064883		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.1336C>T	7.37:g.42064883G>A	ENSP00000379258:p.Pro446Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P446S	ENST00000395925.3	37	c.1336	CCDS5465.1	7	.	.	.	.	.	.	.	.	.	.	G	22.1	4.249230	0.80024	.	.	ENSG00000106571	ENST00000395925	T	0.69806	-0.43	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.72708	0.3494	M	0.73962	2.25	0.80722	D	1	P	0.37824	0.609	B	0.40659	0.336	T	0.74899	-0.3507	10	0.56958	D	0.05	.	19.7525	0.96273	0.0:0.0:1.0:0.0	.	446	P10071	GLI3_HUMAN	S	446	ENSP00000379258:P446S	ENSP00000379258:P446S	P	-	1	0	GLI3	42031408	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.229000	0.95273	2.669000	0.90835	0.591000	0.81541	CCA	GLI3	-	NULL	ENSG00000106571		0.632	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI3	HGNC	protein_coding	OTTHUMT00000250806.3	153	0.00	0	G	NM_000168		42064883	42064883	-1	no_errors	ENST00000395925	ensembl	human	known	69_37n	missense	78	24.27	25	SNP	1.000	A
GOLGA2P5	55592	genome.wustl.edu	37	12	100562921	100562921	+	RNA	DEL	T	T	-			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr12:100562921delT	ENST00000397112.4	-	0	599					NR_036632.1		Q9HBQ8	GGA2B_HUMAN								Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)	4						GTCTCATTTGTTTTttttttt	0.403																																						dbGAP											0																																										-	-	-			0																															12.37:g.100562921delT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NSV2	RNA	DEL	-	NULL	ENST00000397112.4	37	NULL		12																																																																																			GOLGA2P5	-	-	ENSG00000238105		0.403	GOLGA2B-004	KNOWN	basic	processed_transcript	GOLGA2P5	HGNC	pseudogene	OTTHUMT00000396439.2	42	0.00	0	T			100562921	100562921	-1	no_errors	ENST00000421840	ensembl	human	known	69_37n	rna	23	17.86	5	DEL	0.000	-
HFM1	164045	genome.wustl.edu	37	1	91859834	91859834	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr1:91859834G>C	ENST00000370425.3	-	4	408	c.310C>G	c.(310-312)Cta>Gta	p.L104V	HFM1_ENST00000370424.3_Intron|HFM1_ENST00000294696.5_De_novo_Start_OutOfFrame	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	104					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TCTAAATTTAGATCATCCTGT	0.308																																						dbGAP											0													90.0	85.0	87.0					1																	91859834		2203	4298	6501	-	-	-	SO:0001583	missense	0			AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.310C>G	1.37:g.91859834G>C	ENSP00000359454:p.Leu104Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L104V	ENST00000370425.3	37	c.310	CCDS30769.2	1	.	.	.	.	.	.	.	.	.	.	G	3.853	-0.031480	0.07543	.	.	ENSG00000162669	ENST00000370425;ENST00000541820;ENST00000427444;ENST00000455133	T;T;T	0.60548	0.18;1.3;1.37	4.53	2.6	0.31112	.	.	.	.	.	T	0.23451	0.0567	L	0.32530	0.975	0.09310	N	0.999998	P;B	0.45044	0.849;0.281	B;B	0.40165	0.321;0.075	T	0.02075	-1.1218	9	0.25106	T	0.35	.	7.6475	0.28329	0.215:0.0:0.785:0.0	.	104;104	B7ZM16;A2PYH4	.;HFM1_HUMAN	V	104;137;62;104	ENSP00000359454:L104V;ENSP00000388900:L62V;ENSP00000409827:L104V	ENSP00000359454:L104V	L	-	1	2	HFM1	91632422	0.138000	0.22547	0.018000	0.16275	0.290000	0.27261	1.495000	0.35627	1.061000	0.40601	-0.229000	0.12294	CTA	HFM1	-	NULL	ENSG00000162669		0.308	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HFM1	HGNC	protein_coding	OTTHUMT00000316716.2	305	0.00	0	G	NM_001017975		91859834	91859834	-1	no_errors	ENST00000370425	ensembl	human	known	69_37n	missense	428	24.43	139	SNP	0.003	C
HNRNPH2	3188	genome.wustl.edu	37	X	100668219	100668219	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chrX:100668219C>A	ENST00000316594.5	+	2	1321	c.1243C>A	c.(1243-1245)Cag>Aag	p.Q415K		NM_001032393.2|NM_001199973.1|NM_001199974.1|NM_019597.4	NP_001027565.1|NP_001186902.1|NP_001186903.1|NP_062543.1	P55795	HNRH2_HUMAN	heterogeneous nuclear ribonucleoprotein H2 (H')	415	2 X 16 AA Gly-rich approximate repeats.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|large_intestine(2)|lung(6)|skin(1)	12						TGCTAGCCAGCAGCTGAGTGG	0.502																																						dbGAP											0													196.0	190.0	192.0					X																	100668219		2203	4300	6503	-	-	-	SO:0001583	missense	0			U01923	CCDS14485.1	Xq22	2013-02-12		2008-04-18	ENSG00000126945	ENSG00000126945		"""RNA binding motif (RRM) containing"""	5042	protein-coding gene	gene with protein product		300610		HNRPH2		7499401	Standard	NM_019597		Approved	hnRNPH', FTP3, HNRPH'	uc004ehn.3	P55795	OTTHUMG00000022029	ENST00000316594.5:c.1243C>A	X.37:g.100668219C>A	ENSP00000361927:p.Gln415Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L400|Q9HHA7	Missense_Mutation	SNP	pfam_RRM_dom,pfam_Znf_CHHC,smart_RRM_dom,pfscan_RRM_dom	p.Q415K	ENST00000316594.5	37	c.1243	CCDS14485.1	X	.	.	.	.	.	.	.	.	.	.	C	7.954	0.745587	0.15710	.	.	ENSG00000126945	ENST00000457902;ENST00000316594	T	0.12039	2.72	5.15	4.28	0.50868	.	0.131922	0.53938	D	0.000047	T	0.11452	0.0279	L	0.50333	1.59	0.40600	D	0.98157	B	0.25667	0.131	B	0.19666	0.026	T	0.12863	-1.0531	10	0.27082	T	0.32	-10.4862	6.2403	0.20787	0.1821:0.7199:0.0:0.098	.	415	P55795	HNRH2_HUMAN	K	370;415	ENSP00000361927:Q415K	ENSP00000361927:Q415K	Q	+	1	0	HNRNPH2	100554875	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.525000	0.45598	1.072000	0.40860	0.513000	0.50165	CAG	HNRNPH2	-	NULL	ENSG00000126945		0.502	HNRNPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPH2	HGNC	protein_coding	OTTHUMT00000057556.1	383	0.26	1	C	NM_019597		100668219	100668219	+1	no_errors	ENST00000316594	ensembl	human	known	69_37n	missense	250	24.70	82	SNP	1.000	A
HNRNPL	3191	genome.wustl.edu	37	19	39329199	39329199	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr19:39329199G>T	ENST00000221419.5	-	10	1761	c.1395C>A	c.(1393-1395)taC>taA	p.Y465*	HNRNPL_ENST00000600873.1_Nonsense_Mutation_p.Y332*|AC104534.3_ENST00000594769.1_Missense_Mutation_p.T82K	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	465	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)	p.Y332Y(1)|p.Y465Y(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			CTTCCAACCCGTATGACTGAC	0.547																																						dbGAP											2	Substitution - coding silent(2)	large_intestine(2)											68.0	56.0	60.0					19																	39329199		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1395C>A	19.37:g.39329199G>T	ENSP00000221419:p.Tyr465*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND69|A6NIT8|Q9H3P3	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.Y465*	ENST00000221419.5	37	c.1395	CCDS33015.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.757327	0.96898	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750	.	.	.	6.17	-2.91	0.05631	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	12.8141	0.57654	0.6257:0.0:0.3743:0.0	.	.	.	.	X	465;332;332	.	ENSP00000221419:Y465X	Y	-	3	2	HNRNPL	44021039	0.662000	0.27439	0.896000	0.35187	0.996000	0.88848	-0.189000	0.09629	-0.317000	0.08677	0.655000	0.94253	TAC	HNRNPL	-	tigrfam_HnRNP-L_PTB	ENSG00000104824		0.547	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPL	HGNC	protein_coding	OTTHUMT00000462670.1	211	0.00	0	G			39329199	39329199	-1	no_errors	ENST00000221419	ensembl	human	known	69_37n	nonsense	99	29.79	42	SNP	0.938	T
HP1BP3	50809	genome.wustl.edu	37	1	21076220	21076220	+	Silent	SNP	A	A	G			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr1:21076220A>G	ENST00000312239.5	-	10	1276	c.1137T>C	c.(1135-1137)taT>taC	p.Y379Y	HP1BP3_ENST00000375003.2_Silent_p.Y227Y	NM_016287.3	NP_057371.2	Q5SSJ5	HP1B3_HUMAN	heterochromatin protein 1, binding protein 3	379	H15 3. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)	nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(2)|skin(2)|urinary_tract(1)	16		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		TCTTACTTTGATAGTTAGAAT	0.458																																						dbGAP											0													96.0	95.0	96.0					1																	21076220		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC053327	CCDS30621.1	1p36.12	2008-02-05			ENSG00000127483	ENSG00000127483			24973	protein-coding gene	gene with protein product						12477932	Standard	NM_016287		Approved	HP1-BP74	uc001bdw.1	Q5SSJ5	OTTHUMG00000002622	ENST00000312239.5:c.1137T>C	1.37:g.21076220A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI71|A8K5D7|B3KMZ8|B4E210|Q05BI0|Q5SSJ6|Q5SWC6|Q6PIM9|Q8NDF0|Q9UHY0	Silent	SNP	pfam_Histone_H1/H5,smart_Histone_H1/H5	p.Y379	ENST00000312239.5	37	c.1137	CCDS30621.1	1																																																																																			HP1BP3	-	pfam_Histone_H1/H5,smart_Histone_H1/H5	ENSG00000127483		0.458	HP1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HP1BP3	HGNC	protein_coding	OTTHUMT00000007457.2	183	0.54	1	A	NM_016287		21076220	21076220	-1	no_errors	ENST00000312239	ensembl	human	known	69_37n	silent	82	51.19	86	SNP	0.974	G
HSPG2	3339	genome.wustl.edu	37	1	22156504	22156504	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr1:22156504C>A	ENST00000374695.3	-	86	11831	c.11752G>T	c.(11752-11754)Ggg>Tgg	p.G3918W	HSPG2_ENST00000486901.1_5'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	3918	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	CACCGCAACCCCGAGCGGCCC	0.697																																						dbGAP											0													23.0	25.0	24.0					1																	22156504		2197	4298	6495	-	-	-	SO:0001583	missense	0			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.11752G>T	1.37:g.22156504C>A	ENSP00000363827:p.Gly3918Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_SEA,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA,pfscan_Ig-like	p.G3918W	ENST00000374695.3	37	c.11752	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764116	0.69878	.	.	ENSG00000142798	ENST00000374695	T	0.79940	-1.32	5.25	5.25	0.73442	Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.40144	N	0.001171	D	0.91369	0.7277	M	0.91717	3.235	0.53688	D	0.999975	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.93004	0.6426	10	0.87932	D	0	.	14.3314	0.66559	0.0:1.0:0.0:0.0	.	1858;3918	Q59EG0;P98160	.;PGBM_HUMAN	W	3918	ENSP00000363827:G3918W	ENSP00000363827:G3918W	G	-	1	0	HSPG2	22029091	1.000000	0.71417	0.229000	0.23960	0.595000	0.36748	6.728000	0.74769	2.460000	0.83146	0.561000	0.74099	GGG	HSPG2	-	smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	ENSG00000142798		0.697	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	35	0.00	0	C	NM_005529		22156504	22156504	-1	no_errors	ENST00000374695	ensembl	human	known	69_37n	missense	32	28.89	13	SNP	0.994	A
IFT122	55764	genome.wustl.edu	37	3	129200411	129200411	+	Silent	SNP	C	C	G			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr3:129200411C>G	ENST00000348417.2	+	14	1604	c.1527C>G	c.(1525-1527)gtC>gtG	p.V509V	IFT122_ENST00000349441.2_Silent_p.V398V|IFT122_ENST00000507564.1_Silent_p.V501V|IFT122_ENST00000440957.2_Silent_p.V300V|IFT122_ENST00000504021.1_Silent_p.V403V|IFT122_ENST00000347300.2_Silent_p.V450V|IFT122_ENST00000296266.3_Silent_p.V560V|IFT122_ENST00000431818.2_Silent_p.V359V	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	509					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						TTGCTATCGTCCTGCTGAAGC	0.517																																						dbGAP											0													62.0	54.0	57.0					3																	129200411		2199	4277	6476	-	-	-	SO:0001819	synonymous_variant	0			AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.1527C>G	3.37:g.129200411C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V560	ENST00000348417.2	37	c.1680	CCDS3061.1	3																																																																																			IFT122	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000163913		0.517	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFT122	HGNC	protein_coding	OTTHUMT00000355852.1	290	0.68	2	C	NM_018262		129200411	129200411	+1	no_errors	ENST00000296266	ensembl	human	known	69_37n	silent	112	56.42	145	SNP	1.000	G
IKBKE	9641	genome.wustl.edu	37	1	206649567	206649567	+	Silent	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr1:206649567C>T	ENST00000367120.3	+	6	775	c.402C>T	c.(400-402)cgC>cgT	p.R134R	IKBKE_ENST00000537984.1_Silent_p.R49R	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	134	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)	p.R134R(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					TTGTGCATCGCGACATCAAGC	0.627																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											97.0	82.0	87.0					1																	206649567		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.402C>T	1.37:g.206649567C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT78|Q3B754|Q3KR43|Q5JTS6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R134	ENST00000367120.3	37	c.402	CCDS30996.1	1																																																																																			IKBKE	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000143466		0.627	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKE	HGNC	protein_coding	OTTHUMT00000088484.1	79	0.00	0	C			206649567	206649567	+1	no_errors	ENST00000367120	ensembl	human	known	69_37n	silent	51	19.05	12	SNP	0.004	T
INTS4L2	644619	genome.wustl.edu	37	7	65157715	65157715	+	RNA	SNP	C	C	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr7:65157715C>A	ENST00000430126.2	+	0	1042							Q2T9F4	IN4L2_HUMAN	integrator complex subunit 4-like 2																		TACTTATTTTCAATGCTGCTA	0.433																																						dbGAP											0																																										-	-	-			0			BC111554		7q11.21	2013-03-26			ENSG00000232270	ENSG00000273024			22351	other	unknown							Standard	NR_027392		Approved	MGC133166	uc003tue.2	Q2T9F4	OTTHUMG00000156558		7.37:g.65157715C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000430126.2	37	NULL		7																																																																																			INTS4L2	-	-	ENSG00000232270		0.433	INTS4L2-002	KNOWN	basic	processed_transcript	INTS4L2	HGNC	pseudogene	OTTHUMT00000345545.2	231	0.43	1	C	NR_027392		65157715	65157715	+1	no_errors	ENST00000430126	ensembl	human	known	69_37n	rna	433	19.52	105	SNP	1.000	A
IWS1	55677	genome.wustl.edu	37	2	128260411	128260411	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr2:128260411C>T	ENST00000295321.4	-	5	1706	c.1447G>A	c.(1447-1449)Gaa>Aaa	p.E483K	AC010976.2_ENST00000599001.1_RNA|IWS1_ENST00000486662.1_5'Flank|IWS1_ENST00000455721.2_Missense_Mutation_p.E490K	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	483	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		TCTTCCTCTTCATCACCAGAT	0.313																																						dbGAP											0													119.0	119.0	119.0					2																	128260411		2201	4300	6501	-	-	-	SO:0001583	missense	0			AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.1447G>A	2.37:g.128260411C>T	ENSP00000295321:p.Glu483Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Missense_Mutation	SNP	pfam_TFIIS_N,superfamily_TFIIS_N	p.E483K	ENST00000295321.4	37	c.1447	CCDS2146.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.129239	0.94473	.	.	ENSG00000163166	ENST00000295321;ENST00000433551;ENST00000455721	T;T	0.61510	2.33;0.1	5.55	5.55	0.83447	.	0.054165	0.64402	D	0.000001	T	0.74068	0.3668	M	0.63843	1.955	0.54753	D	0.999988	D	0.71674	0.998	D	0.77004	0.989	T	0.70699	-0.4800	10	0.34782	T	0.22	-34.3362	19.1022	0.93277	0.0:1.0:0.0:0.0	.	483	Q96ST2	IWS1_HUMAN	K	483;436;490	ENSP00000295321:E483K;ENSP00000399245:E490K	ENSP00000295321:E483K	E	-	1	0	IWS1	127976881	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.298000	0.72763	2.617000	0.88574	0.557000	0.71058	GAA	IWS1	-	NULL	ENSG00000163166		0.313	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IWS1	HGNC	protein_coding	OTTHUMT00000254384.2	404	0.00	0	C	NM_017969		128260411	128260411	-1	no_errors	ENST00000295321	ensembl	human	known	69_37n	missense	462	18.37	104	SNP	1.000	T
IYD	389434	genome.wustl.edu	37	6	150715289	150715289	+	Silent	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr6:150715289C>T	ENST00000344419.3	+	4	725	c.585C>T	c.(583-585)ttC>ttT	p.F195F	IYD_ENST00000392256.2_Silent_p.F195F|IYD_ENST00000425615.3_Silent_p.F140F|IYD_ENST00000392255.3_Silent_p.F195F|IYD_ENST00000229447.5_Silent_p.F195F|IYD_ENST00000500320.3_Silent_p.F195F	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase	195					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	iodide peroxidase activity (GO:0004447)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		TTCTCATTTTCAAACAAGTAC	0.403																																						dbGAP											0													102.0	95.0	97.0					6																	150715289		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765			21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71		16316988, 15289438	Standard	NM_001164694		Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.585C>T	6.37:g.150715289C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	Silent	SNP	pfam_Nitroreductase-like,superfamily_Nitroreductase-like	p.F195	ENST00000344419.3	37	c.585	CCDS5227.1	6																																																																																			IYD	-	pfam_Nitroreductase-like,superfamily_Nitroreductase-like	ENSG00000009765		0.403	IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IYD	HGNC	protein_coding	OTTHUMT00000043754.3	147	0.00	0	C	NM_203395		150715289	150715289	+1	no_errors	ENST00000229447	ensembl	human	known	69_37n	silent	145	22.87	43	SNP	1.000	T
JAKMIP3	282973	genome.wustl.edu	37	10	133967268	133967268	+	Silent	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr10:133967268C>T	ENST00000298622.4	+	17	2211	c.2073C>T	c.(2071-2073)ctC>ctT	p.L691L	JAKMIP3_ENST00000477275.1_3'UTR	NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	691						Golgi apparatus (GO:0005794)		p.L691L(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TCCAGTGGCTCCAGCAGATTG	0.622																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)											118.0	124.0	122.0					10																	133967268		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.2073C>T	10.37:g.133967268C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6PW00|Q69YM6|Q6ZT29	Silent	SNP	NULL	p.L691	ENST00000298622.4	37	c.2073	CCDS44494.1	10																																																																																			JAKMIP3	-	NULL	ENSG00000188385		0.622	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	JAKMIP3	HGNC	protein_coding	OTTHUMT00000051049.3	57	0.00	0	C	NM_194303		133967268	133967268	+1	no_errors	ENST00000298622	ensembl	human	known	69_37n	silent	48	22.58	14	SNP	0.736	T
KCNS3	3790	genome.wustl.edu	37	2	18112646	18112646	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr2:18112646G>A	ENST00000403915.1	+	3	822	c.371G>A	c.(370-372)cGc>cAc	p.R124H	KCNS3_ENST00000304101.4_Missense_Mutation_p.R124H|KCNS3_ENST00000465292.1_Intron	NM_001282428.1	NP_001269357.1	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3	124					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)	p.R124L(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(11)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TACCAGGAACGCAAGGAGGAA	0.507																																						dbGAP											1	Substitution - Missense(1)	lung(1)											109.0	110.0	109.0					2																	18112646		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043472	CCDS1692.1	2p24	2011-07-05			ENSG00000170745	ENSG00000170745		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6302	protein-coding gene	gene with protein product		603888				10484328, 16382104	Standard	NM_002252		Approved	Kv9.3	uc002rcw.3	Q9BQ31	OTTHUMG00000044150	ENST00000403915.1:c.371G>A	2.37:g.18112646G>A	ENSP00000385968:p.Arg124His	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W520|O43651|Q4ZFY1|Q96B56	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv2	p.R124H	ENST00000403915.1	37	c.371	CCDS1692.1	2	.	.	.	.	.	.	.	.	.	.	G	13.90	2.374479	0.42105	.	.	ENSG00000170745	ENST00000403915;ENST00000304101	T;T	0.46451	0.87;0.87	5.77	3.97	0.46021	BTB/POZ-like (1);BTB/POZ fold (2);	0.322797	0.31949	N	0.006818	T	0.36663	0.0975	M	0.73598	2.24	0.38975	D	0.958829	B	0.11235	0.004	B	0.04013	0.001	T	0.20009	-1.0288	10	0.13108	T	0.6	.	6.1021	0.20053	0.2007:0.0:0.6649:0.1343	.	124	Q9BQ31	KCNS3_HUMAN	H	124	ENSP00000385968:R124H;ENSP00000305824:R124H	ENSP00000305824:R124H	R	+	2	0	KCNS3	17976127	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.554000	0.53720	0.895000	0.36342	-0.150000	0.13652	CGC	KCNS3	-	superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv2	ENSG00000170745		0.507	KCNS3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNS3	HGNC	protein_coding	OTTHUMT00000323808.1	157	0.00	0	G	NM_002252		18112646	18112646	+1	no_errors	ENST00000304101	ensembl	human	known	69_37n	missense	118	20.67	31	SNP	1.000	A
KIAA0586	9786	genome.wustl.edu	37	14	58910712	58910715	+	Frame_Shift_Del	DEL	AATT	AATT	-			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	AATT	AATT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr14:58910712_58910715delAATT	ENST00000556134.1	+	7	855_858	c.581_584delAATT	c.(580-585)gaattafs	p.EL194fs	KIAA0586_ENST00000423743.3_Frame_Shift_Del_p.EL165fs|KIAA0586_ENST00000261244.5_Frame_Shift_Del_p.EL209fs|Y_RNA_ENST00000516389.1_RNA|KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000354386.6_Frame_Shift_Del_p.EL262fs	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	194					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TCTGTTACAGAATTACTTAGTAAA	0.319																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.581_584delAATT	14.37:g.58910712_58910715delAATT	ENSP00000452351:p.Glu194fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Frame_Shift_Del	DEL	NULL	p.E194fs	ENST00000556134.1	37	c.581_584	CCDS58321.1	14																																																																																			KIAA0586	-	NULL	ENSG00000100578		0.319	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0586	HGNC	protein_coding	OTTHUMT00000411887.1	104	0.00	0	AATT	NM_014749		58910712	58910715	+1	no_errors	ENST00000556134	ensembl	human	known	69_37n	frame_shift_del	89	17.59	19	DEL	1.000:1.000:1.000:1.000	-
KIAA1328	57536	genome.wustl.edu	37	18	34465536	34465536	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr18:34465536G>A	ENST00000280020.5	+	5	371	c.349G>A	c.(349-351)Gaa>Aaa	p.E117K	KIAA1328_ENST00000543923.1_Missense_Mutation_p.E9K|KIAA1328_ENST00000592521.1_Missense_Mutation_p.E117K|KIAA1328_ENST00000591619.1_Missense_Mutation_p.E113K|KIAA1328_ENST00000435985.2_5'UTR	NM_020776.1	NP_065827.1	Q86T90	K1328_HUMAN	KIAA1328	117										central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	14				COAD - Colon adenocarcinoma(74;0.195)		TGAGGAAAAGGAAGTGACAGA	0.358																																						dbGAP											0													51.0	47.0	48.0					18																	34465536		1828	4087	5915	-	-	-	SO:0001583	missense	0			AB037749	CCDS45855.1	18q12.2	2011-12-12			ENSG00000150477	ENSG00000150477			29248	protein-coding gene	gene with protein product						10718198	Standard	XM_005258317		Approved		uc002kzz.3	Q86T90		ENST00000280020.5:c.349G>A	18.37:g.34465536G>A	ENSP00000280020:p.Glu117Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DL0|Q49AG6|Q9P2L8	Missense_Mutation	SNP	NULL	p.E117K	ENST00000280020.5	37	c.349	CCDS45855.1	18	.	.	.	.	.	.	.	.	.	.	G	31	5.095385	0.94197	.	.	ENSG00000150477	ENST00000543923;ENST00000280020;ENST00000383055	T;T	0.63913	-0.07;-0.07	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000001	T	0.77805	0.4185	L	0.58101	1.795	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79009	-0.1978	10	0.72032	D	0.01	.	19.3552	0.94410	0.0:0.0:1.0:0.0	.	117	Q86T90	K1328_HUMAN	K	9;117;117	ENSP00000441359:E9K;ENSP00000280020:E117K	ENSP00000280020:E117K	E	+	1	0	KIAA1328	32719534	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.677000	0.91203	2.584000	0.87258	0.563000	0.77884	GAA	KIAA1328	-	NULL	ENSG00000150477		0.358	KIAA1328-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1328	HGNC	protein_coding	OTTHUMT00000440455.1	165	0.00	0	G	NM_020776		34465536	34465536	+1	no_errors	ENST00000280020	ensembl	human	known	69_37n	missense	154	18.95	36	SNP	1.000	A
KMO	8564	genome.wustl.edu	37	1	241750005	241750005	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr1:241750005G>C	ENST00000366559.4	+	11	1293	c.982G>C	c.(982-984)Gat>Cat	p.D328H	KMO_ENST00000366557.4_Missense_Mutation_p.D328H|KMO_ENST00000366558.3_Missense_Mutation_p.D328H	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)											NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			CTTGGTATTTGATGAGTTAAT	0.313																																						dbGAP											0													121.0	120.0	121.0					1																	241750005		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.982G>C	1.37:g.241750005G>C	ENSP00000355517:p.Asp328His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_mOase_FAD-bd,prints_Rng_hydrolase-like	p.D328H	ENST00000366559.4	37	c.982	CCDS1618.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.72|19.72	3.879433|3.879433	0.72294|0.72294	.|.	.|.	ENSG00000117009|ENSG00000117009	ENST00000366559;ENST00000366558;ENST00000366557|ENST00000366555	T;T;T|.	0.41400|.	1.0;1.0;1.0|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.146950|.	0.64402|.	D|.	0.000010|.	T|.	0.76730|.	0.4028|.	M|M	0.76838|0.76838	2.35|2.35	0.80722|0.80722	D|D	1|1	P;P;P|.	0.44241|.	0.829;0.829;0.795|.	B;B;B|.	0.42138|.	0.377;0.377;0.26|.	T|.	0.75491|.	-0.3299|.	10|.	0.34782|.	T|.	0.22|.	.|.	16.3795|16.3795	0.83443|0.83443	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	328;328;328|.	O15229;A8K693;O15229-2|.	KMO_HUMAN;.;.|.	H|S	328|13	ENSP00000355517:D328H;ENSP00000355516:D328H;ENSP00000355515:D328H|.	ENSP00000355515:D328H|.	D|X	+|+	1|2	0|2	KMO|KMO	239816628|239816628	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	5.034000|5.034000	0.64152|0.64152	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAT|TGA	KMO	-	NULL	ENSG00000117009		0.313	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMO	HGNC	protein_coding	OTTHUMT00000095612.1	216	0.00	0	G	NM_003679		241750005	241750005	+1	no_errors	ENST00000366559	ensembl	human	known	69_37n	missense	318	16.93	65	SNP	1.000	C
MAS1L	116511	genome.wustl.edu	37	6	29454744	29454744	+	Silent	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr6:29454744G>A	ENST00000377127.3	-	1	994	c.936C>T	c.(934-936)atC>atT	p.I312I		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	312					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						AGAAATAAATGATAGGGTTGG	0.463																																					NSCLC(153;755 1987 3859 11251 32945)	dbGAP											0													62.0	69.0	67.0					6																	29454744		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.936C>T	6.37:g.29454744G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SUN5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.I312	ENST00000377127.3	37	c.936	CCDS4661.1	6																																																																																			MAS1L	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000204687		0.463	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAS1L	HGNC	protein_coding	OTTHUMT00000076126.2	183	0.00	0	G	NM_052967		29454744	29454744	-1	no_errors	ENST00000377127	ensembl	human	known	69_37n	silent	102	24.44	33	SNP	0.748	A
MAS1L	116511	genome.wustl.edu	37	6	29455332	29455332	+	Silent	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr6:29455332G>A	ENST00000377127.3	-	1	406	c.348C>T	c.(346-348)gtC>gtT	p.V116V		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	116					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						CGTCAGCAGCGACCAGGTGGA	0.512																																					NSCLC(153;755 1987 3859 11251 32945)	dbGAP											0													72.0	67.0	68.0					6																	29455332		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.348C>T	6.37:g.29455332G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SUN5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.V116	ENST00000377127.3	37	c.348	CCDS4661.1	6																																																																																			MAS1L	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000204687		0.512	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAS1L	HGNC	protein_coding	OTTHUMT00000076126.2	89	0.00	0	G	NM_052967		29455332	29455332	-1	no_errors	ENST00000377127	ensembl	human	known	69_37n	silent	51	23.88	16	SNP	0.002	A
LTA	4049	genome.wustl.edu	37	6	31541102	31541102	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr6:31541102G>A	ENST00000454783.1	+	4	508	c.250G>A	c.(250-252)Gac>Aac	p.D84N	TNF_ENST00000449264.2_5'Flank|LTA_ENST00000418386.2_Missense_Mutation_p.D84N	NM_001159740.2	NP_001153212.1	P01374	TNFB_HUMAN	lymphotoxin alpha	84					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|defense response to Gram-positive bacterium (GO:0050830)|humoral immune response (GO:0006959)|lymph node development (GO:0048535)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of growth of symbiont in host (GO:0044130)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of interferon-gamma production (GO:0032729)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|membrane (GO:0016020)	receptor binding (GO:0005102)			endometrium(2)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9					Etanercept(DB00005)	AGCAAACACGGACCGTGCCTT	0.567																																						dbGAP											0													91.0	78.0	82.0					6																	31541102		2203	4300	6503	-	-	-	SO:0001583	missense	0			X01393	CCDS4701.1	6p21.3	2013-05-22	2013-05-22		ENSG00000226979	ENSG00000226979		"""Tumor necrosis factor (ligand) superfamily"""	6709	protein-coding gene	gene with protein product	"""TNF superfamily member 1"""	153440	"""lymphotoxin alpha (TNF superfamily, member 1)"""	TNFB		2995927, 3001529	Standard	NM_001159740		Approved	TNFSF1, LT	uc011dnu.2	P01374	OTTHUMG00000031135	ENST00000454783.1:c.250G>A	6.37:g.31541102G>A	ENSP00000403495:p.Asp84Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N4C3|Q9UKS8	Missense_Mutation	SNP	pfam_TNF,superfamily_Tumour_necrosis_fac-like,smart_TNF,pfscan_TNF,prints_TNF_beta,prints_TNF_a/b/c	p.D84N	ENST00000454783.1	37	c.250	CCDS4701.1	6	.	.	.	.	.	.	.	.	.	.	G	11.42	1.633318	0.29068	.	.	ENSG00000226979	ENST00000454783;ENST00000418386;ENST00000436827	T;T	0.63744	-0.06;-0.06	5.16	5.16	0.70880	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.057026	0.64402	D	0.000002	T	0.72179	0.3428	M	0.78637	2.42	0.24245	N	0.99535	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	T	0.65977	-0.6037	10	0.54805	T	0.06	-20.7841	14.0181	0.64536	0.0:0.0:1.0:0.0	.	84;84;84	E7ET53;F8WB56;P01374	.;.;TNFB_HUMAN	N	84	ENSP00000403495:D84N;ENSP00000413450:D84N	ENSP00000413450:D84N	D	+	1	0	LTA	31649081	0.827000	0.29292	0.074000	0.20217	0.040000	0.13550	2.861000	0.48380	2.676000	0.91093	0.655000	0.94253	GAC	LTA	-	pfam_TNF,superfamily_Tumour_necrosis_fac-like,smart_TNF,pfscan_TNF,prints_TNF_beta,prints_TNF_a/b/c	ENSG00000226979		0.567	LTA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LTA	HGNC	protein_coding	OTTHUMT00000259097.1	128	0.00	0	G			31541102	31541102	+1	no_errors	ENST00000418386	ensembl	human	known	69_37n	missense	66	22.35	19	SNP	0.176	A
MBD6	114785	genome.wustl.edu	37	12	57919306	57919306	+	Silent	SNP	C	C	T	rs371650701		TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr12:57919306C>T	ENST00000355673.3	+	6	911	c.555C>T	c.(553-555)ttC>ttT	p.F185F	MBD6_ENST00000431731.2_Silent_p.F185F	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	185	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						GGGGGCTTTTCCCCCCAAGGC	0.642																																						dbGAP											0													52.0	59.0	57.0					12																	57919306		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.555C>T	12.37:g.57919306C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N3M0|Q8NA81|Q96Q00	Silent	SNP	superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	p.F185	ENST00000355673.3	37	c.555	CCDS8944.1	12																																																																																			MBD6	-	NULL	ENSG00000166987		0.642	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD6	HGNC	protein_coding	OTTHUMT00000407250.1	94	0.00	0	C			57919306	57919306	+1	no_errors	ENST00000355673	ensembl	human	known	69_37n	silent	28	41.67	20	SNP	0.998	T
MBOAT4	619373	genome.wustl.edu	37	8	29989859	29989859	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr8:29989859G>C	ENST00000320542.3	-	3	992	c.908C>G	c.(907-909)tCa>tGa	p.S303*	LEPROTL1_ENST00000523116.1_Intron|LEPROTL1_ENST00000442880.2_Intron	NM_001100916.1	NP_001094386.1	Q96T53	MBOA4_HUMAN	membrane bound O-acyltransferase domain containing 4	303					cellular protein metabolic process (GO:0044267)|peptidyl-serine octanoylation (GO:0018191)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	serine O-acyltransferase activity (GO:0016412)			endometrium(1)	1						CCACTTTCTTGAGAACACAGA	0.557																																						dbGAP											0													191.0	165.0	173.0					8																	29989859		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AF359269	CCDS47835.1	8p12	2008-08-04	2006-06-29	2006-06-29	ENSG00000177669	ENSG00000177669			32311	protein-coding gene	gene with protein product	"""ghrelin O-acyltransferase"""	611940	"""O-acyltransferase (membrane bound) domain containing 4"""	OACT4		18443287	Standard	NM_001100916		Approved	FKSG89, GOAT	uc010lvg.3	Q96T53	OTTHUMG00000163824	ENST00000320542.3:c.908C>G	8.37:g.29989859G>C	ENSP00000314196:p.Ser303*	Somatic		WXS	Illumina GAIIx	Phase_IV	B1Q003	Nonsense_Mutation	SNP	pfam_MBOAT_fam	p.S303*	ENST00000320542.3	37	c.908	CCDS47835.1	8	.	.	.	.	.	.	.	.	.	.	G	17.17	3.321844	0.60634	.	.	ENSG00000177669	ENST00000320542	.	.	.	5.17	5.17	0.71159	.	0.406583	0.20145	N	0.098286	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2171	0.82237	0.0:0.0:1.0:0.0	.	.	.	.	X	303	.	.	S	-	2	0	MBOAT4	30109401	0.984000	0.35163	0.006000	0.13384	0.322000	0.28314	7.769000	0.85360	2.700000	0.92200	0.563000	0.77884	TCA	MBOAT4	-	pfam_MBOAT_fam	ENSG00000177669		0.557	MBOAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT4	HGNC	protein_coding	OTTHUMT00000375795.1	235	0.00	0	G			29989859	29989859	-1	no_errors	ENST00000320542	ensembl	human	known	69_37n	nonsense	144	19.44	35	SNP	0.124	C
MCM7	4176	genome.wustl.edu	37	7	99695338	99695338	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr7:99695338G>T	ENST00000303887.5	-	9	1661	c.1016C>A	c.(1015-1017)tCa>tAa	p.S339*	MCM7_ENST00000354230.3_Nonsense_Mutation_p.S163*|MCM7_ENST00000343023.6_Intron	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	339	MCM.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGGGGCGATTGAAGCTGCCAG	0.488																																						dbGAP											0													188.0	187.0	187.0					7																	99695338		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.1016C>A	7.37:g.99695338G>T	ENSP00000307288:p.Ser339*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Nonsense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_MCM_7,prints_MCM_4	p.S339*	ENST00000303887.5	37	c.1016	CCDS5683.1	7	.	.	.	.	.	.	.	.	.	.	G	45	12.054923	0.99631	.	.	ENSG00000166508	ENST00000303887;ENST00000542483;ENST00000362082;ENST00000354230	.	.	.	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.9245	15.5729	0.76354	0.0:0.0:1.0:0.0	.	.	.	.	X	339;276;232;163	.	ENSP00000307288:S339X	S	-	2	0	MCM7	99533274	1.000000	0.71417	0.986000	0.45419	0.874000	0.50279	9.595000	0.98260	2.548000	0.85928	0.655000	0.94253	TCA	MCM7	-	pfam_MCM_DNA-dep_ATPase,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase	ENSG00000166508		0.488	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM7	HGNC	protein_coding	OTTHUMT00000336534.3	490	0.00	0	G			99695338	99695338	-1	no_errors	ENST00000303887	ensembl	human	known	69_37n	nonsense	427	22.18	122	SNP	1.000	T
MFAP3L	9848	genome.wustl.edu	37	4	170912621	170912621	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr4:170912621C>T	ENST00000361618.3	-	3	1445	c.1138G>A	c.(1138-1140)Gat>Aat	p.D380N	RP11-6E9.4_ENST00000508955.1_RNA|MFAP3L_ENST00000393704.3_Missense_Mutation_p.D277N	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	380						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		AGTACCTTATCTGGTACCTCA	0.502																																						dbGAP											0													156.0	132.0	140.0					4																	170912621		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.1138G>A	4.37:g.170912621C>T	ENSP00000354583:p.Asp380Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.D380N	ENST00000361618.3	37	c.1138	CCDS34103.1	4	.	.	.	.	.	.	.	.	.	.	C	6.216	0.408037	0.11754	.	.	ENSG00000198948	ENST00000393704;ENST00000361618	D;D	0.98192	-4.78;-1.82	5.27	5.27	0.74061	.	0.591872	0.16109	N	0.229163	D	0.95928	0.8674	L	0.40543	1.245	0.34641	D	0.72069	B	0.06786	0.001	B	0.04013	0.001	D	0.95292	0.8396	10	0.30078	T	0.28	-11.4359	14.2568	0.66058	0.0:1.0:0.0:0.0	.	380	O75121	MFA3L_HUMAN	N	277;380	ENSP00000377307:D277N;ENSP00000354583:D380N	ENSP00000354583:D380N	D	-	1	0	MFAP3L	171149196	0.044000	0.20184	0.043000	0.18650	0.007000	0.05969	2.301000	0.43628	2.740000	0.93945	0.650000	0.86243	GAT	MFAP3L	-	NULL	ENSG00000198948		0.502	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP3L	HGNC	protein_coding	OTTHUMT00000363043.2	283	0.00	0	C	NM_021647		170912621	170912621	-1	no_errors	ENST00000361618	ensembl	human	known	69_37n	missense	152	21.65	42	SNP	0.046	T
TPTE2P2	644623	genome.wustl.edu	37	13	52854827	52854827	+	RNA	SNP	G	G	A	rs539051932	byFrequency	TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr13:52854827G>A	ENST00000451298.1	-	0	456																											CATCACTTTCGTATCACCTTT	0.284																																						dbGAP											0																																										-	-	-			0																															13.37:g.52854827G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000451298.1	37	NULL		13																																																																																			RP11-64P12.8	-	-	ENSG00000217576		0.284	RP11-248G5.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	MRPS31P3	Clone_based_vega_gene	processed_transcript	OTTHUMT00000471093.1	122	0.00	0	G			52854827	52854827	-1	no_errors	ENST00000422308	ensembl	human	known	69_37n	rna	67	18.29	15	SNP	0.260	A
NMUR1	10316	genome.wustl.edu	37	2	232392911	232392911	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr2:232392911G>A	ENST00000305141.4	-	2	954	c.821C>T	c.(820-822)tCt>tTt	p.S274F		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	274					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GGCTGCTGCAGAGCCCCTGCC	0.632																																						dbGAP											0													41.0	40.0	40.0					2																	232392911		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.821C>T	2.37:g.232392911G>A	ENSP00000305877:p.Ser274Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O43664|Q7LDP6|Q8NE20	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_NeuromedU_rcpt_1,prints_NeuromedU_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S274F	ENST00000305141.4	37	c.821	CCDS2486.1	2	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025426	0.35701	.	.	ENSG00000171596	ENST00000305141	T	0.50813	0.73	2.43	1.44	0.22558	GPCR, rhodopsin-like superfamily (1);	7739.210000	0.00166	U	0.000006	T	0.52419	0.1733	L	0.52573	1.65	0.09310	N	1	D	0.56287	0.975	P	0.49140	0.601	T	0.35450	-0.9788	10	0.59425	D	0.04	.	7.4878	0.27443	0.0:0.0:0.7419:0.2581	.	274	Q9HB89	NMUR1_HUMAN	F	274	ENSP00000305877:S274F	ENSP00000305877:S274F	S	-	2	0	NMUR1	232101155	0.000000	0.05858	0.003000	0.11579	0.017000	0.09413	-0.643000	0.05421	0.084000	0.17077	0.456000	0.33151	TCT	NMUR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_NeuromedU_rcpt_1,pfscan_GPCR_Rhodpsn_supfam	ENSG00000171596		0.632	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMUR1	HGNC	protein_coding	OTTHUMT00000256961.1	36	0.00	0	G	NM_006056		232392911	232392911	-1	no_errors	ENST00000305141	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.007	A
NPSR1	387129	genome.wustl.edu	37	7	34724283	34724283	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr7:34724283G>T	ENST00000360581.1	+	2	395	c.267G>T	c.(265-267)caG>caT	p.Q89H	NPSR1_ENST00000359791.1_Missense_Mutation_p.Q89H|NPSR1_ENST00000381539.3_Missense_Mutation_p.Q89H|NPSR1-AS1_ENST00000419766.1_RNA|NPSR1_ENST00000465305.1_Missense_Mutation_p.Q89H|NPSR1_ENST00000531252.1_Missense_Mutation_p.Q89H|NPSR1_ENST00000381553.3_Missense_Mutation_p.Q89H|NPSR1_ENST00000381542.1_Missense_Mutation_p.Q89H	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	89						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	TTGTGACTCAGCTGGCCATCA	0.398																																						dbGAP											0													113.0	107.0	109.0					7																	34724283		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.267G>T	7.37:g.34724283G>T	ENSP00000353788:p.Gln89His	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Vasoprsn_rcpt	p.Q89H	ENST00000360581.1	37	c.267	CCDS5444.1	7	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252429	0.59212	.	.	ENSG00000187258	ENST00000381553;ENST00000465305;ENST00000360581;ENST00000381542;ENST00000359791;ENST00000531252;ENST00000381539	T;T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29;1.29	4.95	1.0	0.19881	GPCR, rhodopsin-like superfamily (1);	0.435939	0.20762	N	0.086152	T	0.24890	0.0604	N	0.01438	-0.865	0.40702	D	0.982495	D;D;D;B;D;B	0.69078	0.997;0.989;0.997;0.235;0.989;0.118	D;P;D;B;P;B	0.85130	0.997;0.769;0.995;0.09;0.769;0.088	T	0.08534	-1.0717	10	0.15499	T	0.54	-0.9337	8.9129	0.35563	0.3313:0.0:0.6687:0.0	.	89;89;89;89;89;89	B7ZMA2;Q6W5P4-5;Q6W5P4-2;Q6W5P4-4;Q6W5P4-3;Q6W5P4	.;.;.;.;.;NPSR1_HUMAN	H	89	ENSP00000370965:Q89H;ENSP00000434955:Q89H;ENSP00000353788:Q89H;ENSP00000370953:Q89H;ENSP00000352839:Q89H;ENSP00000433258:Q89H;ENSP00000370950:Q89H	ENSP00000352839:Q89H	Q	+	3	2	NPSR1	34690808	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	0.646000	0.24797	0.267000	0.21916	0.655000	0.94253	CAG	NPSR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Vasoprsn_rcpt	ENSG00000187258		0.398	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPSR1	HGNC	protein_coding	OTTHUMT00000216837.1	321	0.00	0	G	NM_207173		34724283	34724283	+1	no_errors	ENST00000381539	ensembl	human	known	69_37n	missense	288	17.95	63	SNP	1.000	T
OR4K2	390431	genome.wustl.edu	37	14	20344474	20344474	+	Silent	SNP	G	G	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr14:20344474G>T	ENST00000298642.2	+	1	84	c.48G>T	c.(46-48)ggG>ggT	p.G16G		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G16G(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTTTGCTGGGGCTCTCTAATT	0.373																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											192.0	208.0	203.0					14																	20344474		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.48G>T	14.37:g.20344474G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNK8|Q6IFA5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.G16	ENST00000298642.2	37	c.48	CCDS32023.1	14																																																																																			OR4K2	-	NULL	ENSG00000165762		0.373	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K2	HGNC	protein_coding	OTTHUMT00000409864.1	401	0.00	0	G			20344474	20344474	+1	no_errors	ENST00000298642	ensembl	human	known	69_37n	silent	513	23.55	158	SNP	1.000	T
OR8J1	219477	genome.wustl.edu	37	11	56127893	56127893	+	Silent	SNP	C	C	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr11:56127893C>A	ENST00000303039.3	+	1	203	c.171C>A	c.(169-171)acC>acA	p.T57T		NM_001005205.2	NP_001005205.2	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J, member 1	57						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	47	Esophageal squamous(21;0.00448)					GACTTCAAACCCCCATGTACT	0.453																																						dbGAP											0													175.0	156.0	162.0					11																	56127893		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065748	CCDS31529.1	11q11	2012-08-09			ENSG00000172487	ENSG00000172487		"""GPCR / Class A : Olfactory receptors"""	14855	protein-coding gene	gene with protein product							Standard	NM_001005205		Approved		uc010rjh.2	Q8NGP2	OTTHUMG00000166859	ENST00000303039.3:c.171C>A	11.37:g.56127893C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNQ6|B9EH63|Q6IFC2|Q96RC3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.T57	ENST00000303039.3	37	c.171	CCDS31529.1	11																																																																																			OR8J1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172487		0.453	OR8J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8J1	HGNC	protein_coding	OTTHUMT00000391606.2	353	0.28	1	C	NM_001005205		56127893	56127893	+1	no_errors	ENST00000303039	ensembl	human	known	69_37n	silent	401	12.64	58	SNP	0.525	A
OXER1	165140	genome.wustl.edu	37	2	42990664	42990664	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr2:42990664C>T	ENST00000378661.2	-	1	737	c.656G>A	c.(655-657)gGc>gAc	p.G219D		NM_148962.4	NP_683765.1	Q8TDS5	OXER1_HUMAN	oxoeicosanoid (OXE) receptor 1	219					G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cAMP biosynthetic process (GO:0030817)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	5(S)-hydroxyperoxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050648)|5-hydroxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050647)|5-oxo-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050646)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10						GAGCAGGATGCCCACCCAGAG	0.697																																						dbGAP											0													15.0	17.0	16.0					2																	42990664		2172	4221	6393	-	-	-	SO:0001583	missense	0			AB083055	CCDS1810.1	2p22.1	2012-08-10			ENSG00000162881	ENSG00000162881		"""GPCR / Class A : Leukotriene receptors"""	24884	protein-coding gene	gene with protein product	"""5-oxo-ETE acid G-protein-coupled receptor 1"""					12065583, 15001665	Standard	NM_148962		Approved	GPCR, TG1019, GPR170	uc002rss.3	Q8TDS5	OTTHUMG00000128643	ENST00000378661.2:c.656G>A	2.37:g.42990664C>T	ENSP00000367930:p.Gly219Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86WP7|Q8NGW4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.G219D	ENST00000378661.2	37	c.656	CCDS1810.1	2	.	.	.	.	.	.	.	.	.	.	C	12.81	2.049246	0.36181	.	.	ENSG00000162881	ENST00000378661	T	0.72051	-0.62	3.71	-1.25	0.09405	GPCR, rhodopsin-like superfamily (1);	2.033040	0.03629	U	0.237652	T	0.50735	0.1633	N	0.14661	0.345	0.09310	N	1	P	0.38677	0.642	B	0.33960	0.173	T	0.49753	-0.8906	10	0.66056	D	0.02	.	5.9654	0.19322	0.4604:0.2507:0.2889:0.0	.	219	Q8TDS5	OXER1_HUMAN	D	219	ENSP00000367930:G219D	ENSP00000367930:G219D	G	-	2	0	OXER1	42844168	0.000000	0.05858	0.287000	0.24848	0.974000	0.67602	-1.732000	0.01851	-0.070000	0.12908	0.555000	0.69702	GGC	OXER1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000162881		0.697	OXER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXER1	HGNC	protein_coding	OTTHUMT00000250514.1	31	0.00	0	C	NM_148962		42990664	42990664	-1	no_errors	ENST00000378661	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	0.006	T
PABPC1L	80336	genome.wustl.edu	37	20	43538932	43538932	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr20:43538932C>T	ENST00000217073.2	+	1	148	c.148C>T	c.(148-150)Cgc>Tgc	p.R50C	PABPC1L_ENST00000537323.1_Missense_Mutation_p.R50C|PABPC1L_ENST00000255136.3_Missense_Mutation_p.R50C|PABPC1L_ENST00000217074.4_Missense_Mutation_p.R50C			Q4VXU2	PAP1L_HUMAN	poly(A) binding protein, cytoplasmic 1-like	50	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA polyadenylation (GO:0006378)|oocyte maturation (GO:0001556)	extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20						AGCCACCCGGCGCTCGCTGGG	0.682																																						dbGAP											0													9.0	10.0	10.0					20																	43538932		1530	3518	5048	-	-	-	SO:0001583	missense	0			AK026760	CCDS42878.1	20q12-q13.1	2013-02-12	2007-11-21	2007-11-21	ENSG00000101104	ENSG00000101104		"""RNA binding motif (RRM) containing"""	15797	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 119"""	C20orf119		11549316	Standard	NM_001124756		Approved	dJ1069P2.3, PABPC1L1, ePAB	uc010ggv.1	Q4VXU2	OTTHUMG00000032553	ENST00000217073.2:c.148C>T	20.37:g.43538932C>T	ENSP00000217073:p.Arg50Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VY17	Missense_Mutation	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.R50C	ENST00000217073.2	37	c.148	CCDS42878.1	20	.	.	.	.	.	.	.	.	.	.	C	29.9	5.046279	0.93740	.	.	ENSG00000101104	ENST00000217074;ENST00000255136;ENST00000537323;ENST00000217073	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	5.94	5.94	0.96194	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.51669	0.1688	M	0.86502	2.82	0.80722	D	1	D	0.76494	0.999	P	0.59889	0.865	T	0.57248	-0.7844	10	0.87932	D	0	.	20.3594	0.98849	0.0:1.0:0.0:0.0	.	50	Q4VXU2	PAP1L_HUMAN	C	50	ENSP00000217074:R50C;ENSP00000255136:R50C;ENSP00000445661:R50C;ENSP00000217073:R50C	ENSP00000217073:R50C	R	+	1	0	PABPC1L	42972346	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.390000	0.44416	2.816000	0.96949	0.563000	0.77884	CGC	PABPC1L	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000101104		0.682	PABPC1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PABPC1L	HGNC	protein_coding	OTTHUMT00000127816.2	23	0.00	0	C			43538932	43538932	+1	no_errors	ENST00000217073	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	1.000	T
PCDHGA2	56113	genome.wustl.edu	37	5	140720243	140720243	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr5:140720243A>G	ENST00000394576.2	+	1	1705	c.1705A>G	c.(1705-1707)Aca>Gca	p.T569A	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	569					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCCTTCCCCACAGACGGTTC	0.637																																						dbGAP											0													129.0	132.0	131.0					5																	140720243		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1705A>G	5.37:g.140720243A>G	ENSP00000378077:p.Thr569Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.T569A	ENST00000394576.2	37	c.1705	CCDS47289.1	5	.	.	.	.	.	.	.	.	.	.	.	6.316	0.426393	0.11987	.	.	ENSG00000081853	ENST00000394576	T	0.48201	0.82	4.88	3.7	0.42460	Cadherin-like (1);	0.000000	0.42548	U	0.000694	T	0.27205	0.0667	N	0.04355	-0.22	0.24224	N	0.995426	P;P	0.37423	0.553;0.594	B;B	0.38880	0.281;0.284	T	0.12604	-1.0541	10	0.42905	T	0.14	.	11.7701	0.51953	0.8524:0.1476:0.0:0.0	.	569;569	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	A	569	ENSP00000378077:T569A	ENSP00000378077:T569A	T	+	1	0	PCDHGA2	140700427	0.000000	0.05858	0.268000	0.24571	0.047000	0.14425	0.442000	0.21628	0.808000	0.34231	0.397000	0.26171	ACA	PCDHGA2	-	superfamily_Cadherin-like	ENSG00000081853		0.637	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA2	HGNC	protein_coding	OTTHUMT00000374738.1	96	0.00	0	A	NM_018915		140720243	140720243	+1	no_errors	ENST00000394576	ensembl	human	known	69_37n	missense	29	44.23	23	SNP	0.999	G
PIEZO2	63895	genome.wustl.edu	37	18	10696087	10696087	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr18:10696087G>A	ENST00000503781.3	-	43	6835	c.6836C>T	c.(6835-6837)cCt>cTt	p.P2279L	PIEZO2_ENST00000538948.1_Missense_Mutation_p.P236L|PIEZO2_ENST00000580640.1_Missense_Mutation_p.P2304L|PIEZO2_ENST00000302079.6_Missense_Mutation_p.P2279L|PIEZO2_ENST00000285141.4_Missense_Mutation_p.P134L	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2279					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										AGTCACACCAGGTAAGATGAA	0.507																																						dbGAP											0													125.0	115.0	118.0					18																	10696087		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.6836C>T	18.37:g.10696087G>A	ENSP00000421377:p.Pro2279Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	pfam_DUF3595	p.P236L	ENST00000503781.3	37	c.707		18	.	.	.	.	.	.	.	.	.	.	G	23.4	4.415081	0.83449	.	.	ENSG00000154864	ENST00000503781;ENST00000302079;ENST00000538948;ENST00000285141	D;D;D	0.86297	-2.1;-2.1;-2.1	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000001	D	0.94637	0.8271	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94331	0.7562	10	0.45353	T	0.12	.	19.2082	0.93744	0.0:0.0:1.0:0.0	.	236	D6RFZ0	.	L	236;2279;236;134	ENSP00000303316:P2279L;ENSP00000443129:P236L;ENSP00000285141:P134L	ENSP00000285141:P134L	P	-	2	0	FAM38B	10686087	1.000000	0.71417	0.437000	0.26809	0.912000	0.54170	9.375000	0.97178	2.543000	0.85770	0.561000	0.74099	CCT	PIEZO2	-	NULL	ENSG00000154864		0.507	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	PIEZO2	HGNC	protein_coding	OTTHUMT00000442385.4	116	0.85	1	G	NM_022068		10696087	10696087	-1	no_errors	ENST00000538948	ensembl	human	known	69_37n	missense	95	18.10	21	SNP	1.000	A
PIAS2	9063	genome.wustl.edu	37	18	44400931	44400931	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr18:44400931T>C	ENST00000585916.1	-	12	1612	c.1613A>G	c.(1612-1614)cAt>cGt	p.H538R	PIAS2_ENST00000545673.1_Missense_Mutation_p.H248R|PIAS2_ENST00000324794.7_Missense_Mutation_p.H538R	NM_004671.3	NP_004662.2	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT, 2	538					androgen receptor signaling pathway (GO:0030521)|negative regulation of androgen receptor signaling pathway (GO:0060766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|regulation of osteoblast differentiation (GO:0045667)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	22						TATTGGCGTATGGTGGAATGG	0.388																																						dbGAP											0													210.0	182.0	191.0					18																	44400931		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF077953	CCDS32824.1, CCDS32825.1	18q12.1-q12.3	2011-10-11				ENSG00000078043		"""Zinc fingers, MIZ-type"""	17311	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 4"""	603567				9724754, 9256341	Standard	NM_004671		Approved	PIASX-BETA, miz, PIASX-ALPHA, ZMIZ4	uc002lck.3	O75928		ENST00000585916.1:c.1613A>G	18.37:g.44400931T>C	ENSP00000465676:p.His538Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O75927|Q96BT5|Q96KE3	Missense_Mutation	SNP	pfam_Znf_MIZ,smart_SAP_DNA-bd,pfscan_Znf_MIZ,pfscan_SAP_DNA-bd	p.H538R	ENST00000585916.1	37	c.1613	CCDS32824.1	18	.	.	.	.	.	.	.	.	.	.	T	16.90	3.251005	0.59212	.	.	ENSG00000078043	ENST00000398654;ENST00000262161;ENST00000545673;ENST00000324794	T;T	0.43294	0.95;1.52	5.76	5.76	0.90799	.	0.238351	0.44902	D	0.000406	T	0.37293	0.0998	L	0.36672	1.1	0.80722	D	1	P;P;P	0.40332	0.59;0.713;0.59	B;B;B	0.40038	0.317;0.306;0.258	T	0.10706	-1.0618	10	0.30854	T	0.27	-3.4767	16.0796	0.80995	0.0:0.0:0.0:1.0	.	248;538;538	B4DGW0;O75928-2;O75928	.;.;PIAS2_HUMAN	R	538;538;248;538	ENSP00000443238:H248R;ENSP00000317163:H538R	ENSP00000262161:H538R	H	-	2	0	PIAS2	42654929	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	4.724000	0.61972	2.195000	0.70347	0.528000	0.53228	CAT	PIAS2	-	NULL	ENSG00000078043		0.388	PIAS2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS2	HGNC	protein_coding	OTTHUMT00000445656.2	363	0.55	2	T	NM_004671		44400931	44400931	-1	no_errors	ENST00000585916	ensembl	human	known	69_37n	missense	286	20.56	74	SNP	1.000	C
PLXNA4	91584	genome.wustl.edu	37	7	131982906	131982906	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr7:131982906G>A	ENST00000359827.3	-	4	2409	c.1447C>T	c.(1447-1449)Cgg>Tgg	p.R483W	PLXNA4_ENST00000321063.4_Missense_Mutation_p.R483W			Q9HCM2	PLXA4_HUMAN	plexin A4	483	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GCCATATCCCGGAGGACTGGG	0.577																																						dbGAP											0													72.0	77.0	75.0					7																	131982906		1959	4143	6102	-	-	-	SO:0001583	missense	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1447C>T	7.37:g.131982906G>A	ENSP00000352882:p.Arg483Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.R483W	ENST00000359827.3	37	c.1447	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979425	0.74360	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.05199	3.48;3.48	6.04	2.84	0.33178	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.26557	0.0649	M	0.82823	2.61	0.58432	D	0.999999	D	0.89917	1.0	D	0.75020	0.985	T	0.13710	-1.0499	10	0.52906	T	0.07	.	15.9567	0.79893	0.0:0.0:0.5511:0.4489	.	483	Q9HCM2	PLXA4_HUMAN	W	483	ENSP00000323194:R483W;ENSP00000352882:R483W	ENSP00000323194:R483W	R	-	1	2	PLXNA4	131633446	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	1.082000	0.30803	0.816000	0.34421	0.561000	0.74099	CGG	PLXNA4	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000221866		0.577	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	88	0.00	0	G	NM_181775		131982906	131982906	-1	no_errors	ENST00000321063	ensembl	human	known	69_37n	missense	54	37.21	32	SNP	0.989	A
POTEF	728378	genome.wustl.edu	37	2	130868152	130868155	+	Frame_Shift_Del	DEL	GTCT	GTCT	-			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	GTCT	GTCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr2:130868152_130868155delGTCT	ENST00000409914.2	-	7	1415_1418	c.1016_1019delAGAC	c.(1015-1020)cagacgfs	p.QT339fs	POTEF_ENST00000361163.4_Frame_Shift_Del_p.QT349fs|AC018804.3_ENST00000433507.1_RNA|POTEF_ENST00000357462.5_Frame_Shift_Del_p.QT339fs|RNU6-1049P_ENST00000516414.1_RNA|POTEF_ENST00000360967.5_Frame_Shift_Del_p.QT339fs	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	339					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CTCTCTGGCCGTCTGTCCAGATAG	0.363																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.1016_1019delAGAC	2.37:g.130868152_130868155delGTCT	ENSP00000386786:p.Gln339fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC34	Frame_Shift_Del	DEL	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,prints_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q339fs	ENST00000409914.2	37	c.1019_1016	CCDS46409.1	2																																																																																			POTEF	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000196604		0.363	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	174	0.00	0	GTCT	NM_001099771		130868152	130868155	-1	no_errors	ENST00000357462	ensembl	human	known	69_37n	frame_shift_del	122	12.23	17	DEL	0.018:0.018:0.015:0.007	-
PRMT5	10419	genome.wustl.edu	37	14	23397820	23397820	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr14:23397820C>G	ENST00000324366.8	-	2	338	c.115G>C	c.(115-117)Gat>Cat	p.D39H	RP11-298I3.1_ENST00000548322.1_RNA|RP11-298I3.1_ENST00000548819.1_RNA|PRMT5-AS1_ENST00000587245.2_RNA|PRMT5_ENST00000216350.8_Missense_Mutation_p.D22H|PRMT5-AS1_ENST00000595662.1_RNA|PRMT5-AS1_ENST00000599580.2_RNA|PRMT5_ENST00000397441.2_Missense_Mutation_p.D22H|PRMT5_ENST00000397440.4_Missense_Mutation_p.D22H|PRMT5_ENST00000538452.1_Intron|PRMT5_ENST00000553641.1_5'UTR|PRMT5-AS1_ENST00000590290.1_RNA|PRMT5_ENST00000553897.1_Missense_Mutation_p.D39H	NM_006109.3	NP_006100.2	O14744	ANM5_HUMAN	protein arginine methyltransferase 5	39	TIM barrel. {ECO:0000269|PubMed:23071334}.				cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|endothelial cell activation (GO:0042118)|gene expression (GO:0010467)|histone H4-R3 methylation (GO:0043985)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|peptidyl-arginine N-methylation (GO:0035246)|regulation of mitosis (GO:0007088)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|histone-arginine N-methyltransferase activity (GO:0008469)|methyltransferase activity (GO:0008168)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|transcription corepressor activity (GO:0003714)			endometrium(4)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	25	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		CAGAGGAAATCAAACCTACAA	0.507																																						dbGAP											0													107.0	100.0	103.0					14																	23397820		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF015913	CCDS9579.1, CCDS41922.1, CCDS61394.1, CCDS61395.1, CCDS61396.1	14q11.2	2014-06-12	2006-02-16	2006-02-16	ENSG00000100462	ENSG00000100462	2.1.1.125	"""Protein arginine methyltransferases"""	10894	protein-coding gene	gene with protein product		604045	"""skb1 (S. pombe) homolog"", ""SKB1 homolog (S. pombe)"""	HRMT1L5, SKB1		9843966	Standard	NM_001282955		Approved	SKB1Hs	uc001whm.1	O14744	OTTHUMG00000028709	ENST00000324366.8:c.115G>C	14.37:g.23397820C>G	ENSP00000319169:p.Asp39His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTP3|A8MZ91|B4DX49|B4DY30|B5BU10|D3DS33|E2QRE7|Q6IBR1|Q9UKH1	Missense_Mutation	SNP	pfam_Arg_MeTrfase,pirsf_Arg_MeTrfase_PRMT5	p.D39H	ENST00000324366.8	37	c.115	CCDS9579.1	14	.	.	.	.	.	.	.	.	.	.	C	24.5	4.536297	0.85812	.	.	ENSG00000100462	ENST00000324366;ENST00000397441;ENST00000397440;ENST00000216350;ENST00000553897;ENST00000553550;ENST00000554867;ENST00000421938	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.77948	0.4207	M	0.67953	2.075	0.80722	D	1	P;P;D;P;P	0.76494	0.782;0.799;0.999;0.676;0.944	B;B;D;B;P	0.77557	0.317;0.117;0.99;0.188;0.533	T	0.78272	-0.2268	9	0.54805	T	0.06	-17.1683	17.8216	0.88652	0.0:1.0:0.0:0.0	.	39;22;22;39;22	G3V5W5;B4DX49;A8MTP3;O14744;A8MZ91	.;.;.;ANM5_HUMAN;.	H	39;22;22;22;39;39;39;39	.	ENSP00000216350:D22H	D	-	1	0	PRMT5	22467660	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.383000	0.73172	2.735000	0.93741	0.557000	0.71058	GAT	PRMT5	-	pirsf_Arg_MeTrfase_PRMT5	ENSG00000100462		0.507	PRMT5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT5	HGNC	protein_coding	OTTHUMT00000071674.3	120	0.00	0	C			23397820	23397820	-1	no_errors	ENST00000324366	ensembl	human	known	69_37n	missense	143	27.04	53	SNP	1.000	G
PTPRM	5797	genome.wustl.edu	37	18	8387170	8387170	+	Missense_Mutation	SNP	G	G	A	rs145737173		TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr18:8387170G>A	ENST00000332175.8	+	29	5143	c.4106G>A	c.(4105-4107)cGc>cAc	p.R1369H	PTPRM_ENST00000444013.1_Missense_Mutation_p.R1156H|PTPRM_ENST00000400053.4_Missense_Mutation_p.R1307H|PTPRM_ENST00000400060.4_Missense_Mutation_p.R1383H|PTPRM_ENST00000580170.1_Missense_Mutation_p.R1382H	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1369	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				AAGCTCATTCGCCAGGTGGAC	0.547																																						dbGAP											0													115.0	98.0	104.0					18																	8387170		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.4106G>A	18.37:g.8387170G>A	ENSP00000331418:p.Arg1369His	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.R1383H	ENST00000332175.8	37	c.4148	CCDS11840.1	18	.	.	.	.	.	.	.	.	.	.	G	15.88	2.962978	0.53507	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86	5.58	5.58	0.84498	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.122888	0.53938	D	0.000042	D	0.85831	0.5788	L	0.42686	1.345	0.58432	D	0.999995	B;D;P	0.60575	0.065;0.988;0.637	B;P;B	0.49597	0.023;0.616;0.089	D	0.85519	0.1202	10	0.44086	T	0.13	.	19.6328	0.95718	0.0:0.0:1.0:0.0	.	1156;1382;1369	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	H	1369;1383;1307;1156	ENSP00000331418:R1369H;ENSP00000382933:R1383H;ENSP00000382927:R1307H;ENSP00000387608:R1156H	ENSP00000331418:R1369H	R	+	2	0	PTPRM	8377170	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.402000	0.73260	2.644000	0.89710	0.585000	0.79938	CGC	PTPRM	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000173482		0.547	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	HGNC	protein_coding	OTTHUMT00000254456.1	192	0.00	0	G			8387170	8387170	+1	no_errors	ENST00000400060	ensembl	human	known	69_37n	missense	131	35.15	71	SNP	1.000	A
RNF103	7844	genome.wustl.edu	37	2	86831287	86831287	+	Silent	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr2:86831287G>A	ENST00000237455.4	-	4	2705	c.1737C>T	c.(1735-1737)gcC>gcT	p.A579A	CHMP3_ENST00000439940.2_Intron|RNF103_ENST00000477307.1_5'Flank|AC015971.2_ENST00000597638.1_RNA|AC015971.2_ENST00000424788.1_RNA|AC015971.2_ENST00000426549.1_RNA|AC015971.2_ENST00000439077.1_RNA|RNF103-CHMP3_ENST00000604011.1_Intron	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	579					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						AATATTTATTGGCACATGAAC	0.418																																						dbGAP											0													173.0	167.0	169.0					2																	86831287		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.1737C>T	2.37:g.86831287G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Silent	SNP	pfam_Znf_C3HC4_RING-type,superfamily_Thioredoxin-like_fold,smart_Znf_RING,pfscan_Znf_RING	p.A579	ENST00000237455.4	37	c.1737	CCDS33237.1	2																																																																																			RNF103	-	NULL	ENSG00000239305		0.418	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF103	HGNC	protein_coding	OTTHUMT00000330041.2	216	0.00	0	G	NM_005667		86831287	86831287	-1	no_errors	ENST00000237455	ensembl	human	known	69_37n	silent	165	19.12	39	SNP	0.997	A
RNF170	81790	genome.wustl.edu	37	8	42711536	42711536	+	Silent	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr8:42711536C>T	ENST00000534961.1	-	7	1019	c.543G>A	c.(541-543)ctG>ctA	p.L181L	RNF170_ENST00000319104.3_Intron|RNF170_ENST00000527424.1_Silent_p.L181L|RNF170_ENST00000319073.4_Silent_p.L85L|RNF170_ENST00000526349.1_Silent_p.L97L	NM_001160223.1	NP_001153695.1	Q96K19	RN170_HUMAN	ring finger protein 170	181					protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			lung(3)	3	all_lung(13;1.25e-11)|Lung NSC(13;3.55e-10)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00645)|Lung NSC(58;0.0176)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			ATGCATGCCTCAGTAAAGTGG	0.358																																						dbGAP											0													68.0	71.0	70.0					8																	42711536		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AL136620	CCDS6138.1, CCDS55229.1, CCDS55230.1	8p11.21	2014-01-29				ENSG00000120925		"""RING-type (C3HC4) zinc fingers"""	25358	protein-coding gene	gene with protein product		614649	"""sensory ataxia 1 (autosomal dominant)"""	SNAX1		11230166, 21115467	Standard	NR_027668		Approved	DKFZP564A022, ADSA	uc003xpm.3	Q96K19		ENST00000534961.1:c.543G>A	8.37:g.42711536C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSY6|E9PIL4|Q7Z483|Q86YC0|Q8IXR7|Q8N2B5|Q8N5G9|Q8NG30|Q9H0V6	Silent	SNP	pfam_DUF1232,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L181	ENST00000534961.1	37	c.543	CCDS6138.1	8																																																																																			RNF170	-	NULL	ENSG00000120925		0.358	RNF170-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF170	HGNC	protein_coding	OTTHUMT00000383166.1	210	0.00	0	C	NM_030954		42711536	42711536	-1	no_errors	ENST00000527424	ensembl	human	known	69_37n	silent	274	29.20	113	SNP	1.000	T
SAMD4A	23034	genome.wustl.edu	37	14	55251057	55251057	+	Intron	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr14:55251057G>A	ENST00000554335.1	+	12	2707				SAMD4A_ENST00000251091.5_Intron|SAMD4A_ENST00000357634.3_Intron|SAMD4A_ENST00000555192.1_Splice_Site|SAMD4A_ENST00000392067.3_Intron			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A						negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						TTTTGTTCCAGGTTCCCAAGT	0.532																																						dbGAP											0													158.0	132.0	140.0					14																	55251057		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.2045-198G>A	14.37:g.55251057G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPZ5|Q0VA96|Q6PEW4	Splice_Site	SNP	-	NULL	ENST00000554335.1	37	c.NULL	CCDS32084.2	14	.	.	.	.	.	.	.	.	.	.	G	5.699	0.313591	0.10789	.	.	ENSG00000020577	ENST00000555192	.	.	.	3.68	2.77	0.32553	.	.	.	.	.	.	.	.	.	.	.	0.18873	N	0.999987	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.1768	0.37116	0.0:0.2223:0.7777:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SAMD4A	54320807	0.799000	0.28903	0.038000	0.18304	0.003000	0.03518	2.247000	0.43151	1.099000	0.41499	0.462000	0.41574	.	SAMD4A	-	-	ENSG00000020577		0.532	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAMD4A	HGNC	protein_coding	OTTHUMT00000411186.1	266	0.00	0	G	NM_015589		55251057	55251057	+1	no_errors	ENST00000553988	ensembl	human	known	69_37n	splice_site	167	22.22	48	SNP	0.043	A
SLC5A9	200010	genome.wustl.edu	37	1	48696327	48696327	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr1:48696327A>G	ENST00000438567.2	+	5	612	c.560A>G	c.(559-561)tAc>tGc	p.Y187C	SLC5A9_ENST00000236495.5_Missense_Mutation_p.Y212C|SLC5A9_ENST00000533824.1_Missense_Mutation_p.Y208C|SLC5A9_ENST00000420136.2_Intron|RP5-1024N4.4_ENST00000606809.1_RNA	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9	187					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						TGGAACCTGTACCTCTCCACA	0.592																																						dbGAP											0													128.0	103.0	112.0					1																	48696327		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.560A>G	1.37:g.48696327A>G	ENSP00000401730:p.Tyr187Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.Y212C	ENST00000438567.2	37	c.635	CCDS30709.2	1	.	.	.	.	.	.	.	.	.	.	A	15.61	2.885859	0.51908	.	.	ENSG00000117834	ENST00000533824;ENST00000438567;ENST00000236495	D;D;D	0.88664	-2.41;-2.41;-2.41	5.3	5.3	0.74995	Sodium/solute symporter, conserved site (1);	0.055098	0.85682	D	0.000000	D	0.93900	0.8048	H	0.97077	3.935	0.80722	D	1	B;B;B	0.28971	0.031;0.229;0.229	B;B;B	0.37451	0.119;0.169;0.25	D	0.94139	0.7395	10	0.87932	D	0	.	14.5888	0.68347	1.0:0.0:0.0:0.0	.	208;187;212	E9PJ08;Q2M3M2;E9PAK4	.;SC5A9_HUMAN;.	C	208;187;212	ENSP00000431900:Y208C;ENSP00000401730:Y187C;ENSP00000236495:Y212C	ENSP00000236495:Y212C	Y	+	2	0	SLC5A9	48468914	1.000000	0.71417	0.648000	0.29521	0.662000	0.39071	7.203000	0.77864	2.235000	0.73313	0.533000	0.62120	TAC	SLC5A9	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000117834		0.592	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A9	HGNC	protein_coding	OTTHUMT00000022061.3	174	0.00	0	A	XM_117174		48696327	48696327	+1	no_errors	ENST00000236495	ensembl	human	known	69_37n	missense	128	29.95	56	SNP	1.000	G
SMPD3	55512	genome.wustl.edu	37	16	68404767	68404767	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr16:68404767G>T	ENST00000219334.5	-	3	1921	c.1318C>A	c.(1318-1320)Ctc>Atc	p.L440I	SMPD3_ENST00000568373.1_Missense_Mutation_p.L440I|SMPD3_ENST00000563226.1_Missense_Mutation_p.L440I|SMPD3_ENST00000566009.1_5'UTR	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	440					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	CCTACCTTGAGAAACAGAGCT	0.607																																						dbGAP											0													45.0	48.0	47.0					16																	68404767		2198	4300	6498	-	-	-	SO:0001583	missense	0			AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.1318C>A	16.37:g.68404767G>T	ENSP00000219334:p.Leu440Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL82|Q2M1S8	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.L440I	ENST00000219334.5	37	c.1318	CCDS10867.1	16	.	.	.	.	.	.	.	.	.	.	G	11.67	1.708133	0.30322	.	.	ENSG00000103056	ENST00000219334	T	0.28895	1.59	5.37	4.35	0.52113	Endonuclease/exonuclease/phosphatase (2);	0.327353	0.32868	N	0.005560	T	0.23649	0.0572	L	0.36672	1.1	0.31470	N	0.668456	B;B;B	0.31351	0.097;0.32;0.03	B;B;B	0.33392	0.093;0.163;0.017	T	0.10989	-1.0606	10	0.12766	T	0.61	-24.6209	13.3575	0.60635	0.0:0.2445:0.7555:0.0	.	440;440;440	B7ZL82;B7ZL84;Q9NY59	.;.;NSMA2_HUMAN	I	440	ENSP00000219334:L440I	ENSP00000219334:L440I	L	-	1	0	SMPD3	66962268	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.244000	0.58728	2.516000	0.84829	0.655000	0.94253	CTC	SMPD3	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	ENSG00000103056		0.607	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMPD3	HGNC	protein_coding	OTTHUMT00000268895.3	98	0.00	0	G	NM_018667		68404767	68404767	-1	no_errors	ENST00000219334	ensembl	human	known	69_37n	missense	105	14.63	18	SNP	1.000	T
STIL	6491	genome.wustl.edu	37	1	47728698	47728698	+	Silent	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr1:47728698C>T	ENST00000360380.3	-	16	3066	c.2703G>A	c.(2701-2703)caG>caA	p.Q901Q	STIL_ENST00000396221.2_Silent_p.Q884Q|STIL_ENST00000243182.6_Silent_p.Q901Q|STIL_ENST00000371877.3_Silent_p.Q902Q|STIL_ENST00000337817.5_Silent_p.Q901Q	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	901					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				TTGGTCCAGTCTGTAAACACA	0.453																																						dbGAP											0													164.0	143.0	150.0					1																	47728698		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.2703G>A	1.37:g.47728698C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T0C5|Q68CN9	Silent	SNP	NULL	p.Q902	ENST00000360380.3	37	c.2706	CCDS548.1	1																																																																																			STIL	-	NULL	ENSG00000123473		0.453	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STIL	HGNC	protein_coding	OTTHUMT00000021649.2	356	0.00	0	C	NM_003035		47728698	47728698	-1	no_errors	ENST00000371877	ensembl	human	known	69_37n	silent	477	14.05	78	SNP	0.220	T
TBC1D9	23158	genome.wustl.edu	37	4	141578724	141578724	+	Silent	SNP	A	A	G			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr4:141578724A>G	ENST00000442267.2	-	12	2238	c.2164T>C	c.(2164-2166)Ttg>Ctg	p.L722L		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	722							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TTGCAGTTCAACAGTTTGTCC	0.438																																						dbGAP											0													223.0	211.0	215.0					4																	141578724		1991	4166	6157	-	-	-	SO:0001819	synonymous_variant	0			AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.2164T>C	4.37:g.141578724A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8U8|D3DNZ1|O94958	Silent	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_HAND_2,pfscan_Rab-GTPase-TBC_dom	p.L722	ENST00000442267.2	37	c.2164	CCDS47136.1	4																																																																																			TBC1D9	-	superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom	ENSG00000109436		0.438	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D9	HGNC	protein_coding	OTTHUMT00000364806.1	248	0.00	0	A	NM_015130		141578724	141578724	-1	no_errors	ENST00000442267	ensembl	human	known	69_37n	silent	179	19.37	43	SNP	1.000	G
TP53	7157	genome.wustl.edu	37	17	7578461	7578461	+	Missense_Mutation	SNP	C	C	A	rs121912654		TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr17:7578461C>A	ENST00000269305.4	-	5	658	c.469G>T	c.(469-471)Gtc>Ttc	p.V157F	TP53_ENST00000445888.2_Missense_Mutation_p.V157F|TP53_ENST00000413465.2_Missense_Mutation_p.V157F|TP53_ENST00000420246.2_Missense_Mutation_p.V157F|TP53_ENST00000455263.2_Missense_Mutation_p.V157F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.V157F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	157	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9419979}.|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V157F(161)|p.V157I(10)|p.0?(8)|p.V157L(6)|p.V64F(6)|p.V25F(6)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.R156_V157insV(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGCGCGGACGCGGGTGCCG	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	231	Substitution - Missense(189)|Deletion - Frameshift(15)|Deletion - In frame(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)|Complex - frameshift(1)	lung(69)|liver(30)|upper_aerodigestive_tract(26)|breast(19)|oesophagus(14)|ovary(13)|stomach(9)|large_intestine(7)|haematopoietic_and_lymphoid_tissue(7)|central_nervous_system(6)|bone(5)|vulva(4)|urinary_tract(4)|skin(3)|pancreas(3)|endometrium(2)|kidney(2)|biliary_tract(2)|soft_tissue(2)|prostate(1)|adrenal_gland(1)|salivary_gland(1)|thymus(1)											50.0	52.0	51.0					17																	7578461		2202	4300	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.469G>T	17.37:g.7578461C>A	ENSP00000269305:p.Val157Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V157F	ENST00000269305.4	37	c.469	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	12.19	1.865109	0.32977	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.47	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.216722	0.39210	N	0.001429	D	0.99718	0.9891	M	0.86420	2.815	0.33606	D	0.603	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.994;0.984;0.981;0.996;0.998;0.996	D	0.97998	1.0358	10	0.72032	D	0.01	-16.7152	5.3541	0.16051	0.0:0.6119:0.146:0.2421	.	118;157;157;64;157;157;157	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	157;157;157;157;157;157;146;64;25;64;25;157	ENSP00000410739:V157F;ENSP00000352610:V157F;ENSP00000269305:V157F;ENSP00000398846:V157F;ENSP00000391127:V157F;ENSP00000391478:V157F;ENSP00000425104:V25F;ENSP00000423862:V64F;ENSP00000424104:V157F	ENSP00000269305:V157F	V	-	1	0	TP53	7519186	0.137000	0.22531	0.013000	0.15412	0.150000	0.21749	0.548000	0.23314	0.386000	0.24997	-0.253000	0.11424	GTC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	84	0.00	0	C	NM_000546		7578461	7578461	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	32	52.24	35	SNP	0.032	A
TTN	7273	genome.wustl.edu	37	2	179456809	179456809	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr2:179456809A>C	ENST00000591111.1	-	252	55123	c.54899T>G	c.(54898-54900)cTg>cGg	p.L18300R	TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L11001R|TTN_ENST00000460472.2_Missense_Mutation_p.L10876R|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L11068R|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.L19941R|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.L17373R|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589234.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18300	Fibronectin type-III 32. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCTTCATTCAGATGCTTAGC	0.468																																						dbGAP											0													81.0	79.0	80.0					2																	179456809		1932	4138	6070	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.54899T>G	2.37:g.179456809A>C	ENSP00000465570:p.Leu18300Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L17373R	ENST00000591111.1	37	c.52118		2	.	.	.	.	.	.	.	.	.	.	A	13.07	2.127656	0.37533	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95	6.03	6.03	0.97812	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.95053	0.8398	H	0.95982	3.75	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96436	0.9323	9	0.87932	D	0	.	16.5724	0.84622	1.0:0.0:0.0:0.0	.	10876;11001;11068;18300	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	17373;10876;11068;11001;10874	ENSP00000343764:L17373R;ENSP00000434586:L10876R;ENSP00000340554:L11068R;ENSP00000352154:L11001R	ENSP00000340554:L11068R	L	-	2	0	TTN	179165055	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	9.281000	0.95811	2.313000	0.78055	0.455000	0.32223	CTG	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.468	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	180	0.00	0	A	NM_133378		179456809	179456809	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	171	16.99	35	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179476280	179476280	+	Silent	SNP	A	A	G			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr2:179476280A>G	ENST00000591111.1	-	219	45977	c.45753T>C	c.(45751-45753)tgT>tgC	p.C15251C	TTN_ENST00000359218.5_Silent_p.C7952C|TTN_ENST00000460472.2_Silent_p.C7827C|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Silent_p.C8019C|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Silent_p.C16892C|TTN_ENST00000342992.6_Silent_p.C14324C|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589234.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15251	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCCTACTGGACACATTTCAA	0.418																																						dbGAP											0													112.0	107.0	108.0					2																	179476280		1905	4125	6030	-	-	-	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.45753T>C	2.37:g.179476280A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.C14324	ENST00000591111.1	37	c.42972		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	157	0.00	0	A	NM_133378		179476280	179476280	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	silent	155	16.13	30	SNP	1.000	G
UBR5	51366	genome.wustl.edu	37	8	103284901	103284901	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr8:103284901C>T	ENST00000520539.1	-	48	7435	c.6829G>A	c.(6829-6831)Gta>Ata	p.V2277I	UBR5_ENST00000518205.1_Missense_Mutation_p.V6I|UBR5_ENST00000220959.4_Missense_Mutation_p.V2277I|UBR5_ENST00000521922.1_Missense_Mutation_p.V2271I	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2277					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			GTGACTTTTACTCTGTGTACA	0.428																																					Ovarian(131;96 1741 5634 7352 27489)	dbGAP											0													126.0	104.0	112.0					8																	103284901		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.6829G>A	8.37:g.103284901C>T	ENSP00000429084:p.Val2277Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	pfam_HECT,pfam_E3_UbLigase_EDD_UBA,pfam_PABP_HYD,pfam_Znf_N-recognin,superfamily_HECT,superfamily_PABP_HYD,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Znf_N-recognin_met,smart_PABP_HYD,smart_HECT,pfscan_HECT,pfscan_Znf_N-recognin	p.V2277I	ENST00000520539.1	37	c.6829	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	C	32	5.140818	0.94560	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000518205;ENST00000521922;ENST00000521566	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	5.44	4.57	0.56435	HECT (1);	0.068410	0.56097	N	0.000022	T	0.59101	0.2169	L	0.59436	1.845	0.50313	D	0.999865	D;D	0.69078	0.997;0.994	D;P	0.67382	0.951;0.84	T	0.63260	-0.6677	10	0.87932	D	0	.	14.3426	0.66639	0.0:0.9283:0.0:0.0717	.	2271;2277	E7EMW7;O95071	.;UBR5_HUMAN	I	2277;2277;6;2271;102	ENSP00000429084:V2277I;ENSP00000220959:V2277I;ENSP00000428693:V6I;ENSP00000427819:V2271I	ENSP00000220959:V2277I	V	-	1	0	UBR5	103354077	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	7.487000	0.81328	1.310000	0.45006	0.585000	0.79938	GTA	UBR5	-	superfamily_HECT	ENSG00000104517		0.428	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	HGNC	protein_coding	OTTHUMT00000380075.2	185	0.00	0	C	NM_015902		103284901	103284901	-1	no_errors	ENST00000520539	ensembl	human	known	69_37n	missense	138	22.03	39	SNP	1.000	T
UBXN11	91544	genome.wustl.edu	37	1	26608929	26608929	+	Missense_Mutation	SNP	G	G	A	rs572966404		TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr1:26608929G>A	ENST00000374222.1	-	16	1888	c.1424C>T	c.(1423-1425)cCg>cTg	p.P475L	UBXN11_ENST00000374223.1_Missense_Mutation_p.P232L|UBXN11_ENST00000374221.3_Missense_Mutation_p.P475L|UBXN11_ENST00000357089.4_Missense_Mutation_p.P442L|UBXN11_ENST00000314675.7_Missense_Mutation_p.P355L|UBXN11_ENST00000374217.2_Missense_Mutation_p.P442L			Q5T124	UBX11_HUMAN	UBX domain protein 11	475						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						GCTGGACTTCGGGGCTCGGCG	0.701																																						dbGAP											0													62.0	75.0	71.0					1																	26608929		1906	4093	5999	-	-	-	SO:0001583	missense	0			AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1424C>T	1.37:g.26608929G>A	ENSP00000363339:p.Pro475Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	pfam_SEP_domain,superfamily_SEP_domain,pfscan_UBX	p.P475L	ENST00000374222.1	37	c.1424	CCDS41288.1	1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.130552	0.37630	.	.	ENSG00000158062	ENST00000314675;ENST00000374223;ENST00000357089;ENST00000374221;ENST00000374222;ENST00000374217	T;T;T;T;T;T	0.19250	2.23;2.16;2.53;2.5;2.5;2.53	4.29	1.23	0.21249	.	0.533866	0.16360	N	0.217835	T	0.10337	0.0253	N	0.19112	0.55	0.09310	N	0.999991	B;B;B;B	0.20459	0.045;0.025;0.009;0.027	B;B;B;B	0.09377	0.004;0.004;0.003;0.003	T	0.24870	-1.0148	10	0.34782	T	0.22	-0.8938	3.1669	0.06539	0.2374:0.0:0.5534:0.2092	.	442;437;355;475	Q5T124-2;Q5T124-4;Q5T124-3;Q5T124	.;.;.;UBX11_HUMAN	L	355;232;442;475;475;442	ENSP00000324721:P355L;ENSP00000363340:P232L;ENSP00000349601:P442L;ENSP00000363338:P475L;ENSP00000363339:P475L;ENSP00000363334:P442L	ENSP00000324721:P355L	P	-	2	0	UBXN11	26481516	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	-0.889000	0.04144	-0.040000	0.13580	0.561000	0.74099	CCG	UBXN11	-	NULL	ENSG00000158062		0.701	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBXN11	HGNC	protein_coding	OTTHUMT00000009500.1	43	0.00	0	G	NM_145345		26608929	26608929	-1	no_errors	ENST00000374221	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.003	A
VIP	7432	genome.wustl.edu	37	6	153077328	153077328	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr6:153077328A>T	ENST00000367244.3	+	5	567	c.395A>T	c.(394-396)gAc>gTc	p.D132V	VIP_ENST00000367243.3_Missense_Mutation_p.D131V	NM_003381.3	NP_003372.1	P01282	VIP_HUMAN	vasoactive intestinal peptide	132					body fluid secretion (GO:0007589)|G-protein coupled receptor signaling pathway (GO:0007186)|learning or memory (GO:0007611)|negative regulation of apoptotic process (GO:0043066)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of penile erection (GO:0060406)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of vasodilation (GO:0045909)|regulation of protein localization (GO:0032880)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)	extracellular region (GO:0005576)|neuronal cell body (GO:0043025)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)			haematopoietic_and_lymphoid_tissue(1)|lung(4)|skin(1)	6		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;4.5e-11)|BRCA - Breast invasive adenocarcinoma(81;0.144)		GTCTTCACTGACAACTATACC	0.378																																						dbGAP											0													88.0	96.0	94.0					6																	153077328		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5240.1, CCDS5241.1	6q24-q27	2013-02-28			ENSG00000146469	ENSG00000146469		"""Endogenous ligands"""	12693	protein-coding gene	gene with protein product	"""prepro-VIP"""	192320					Standard	NM_003381		Approved		uc003qpe.4	P01282	OTTHUMG00000015851	ENST00000367244.3:c.395A>T	6.37:g.153077328A>T	ENSP00000356213:p.Asp132Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TCY8|Q5TCY9|Q96QK3	Missense_Mutation	SNP	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP	p.D132V	ENST00000367244.3	37	c.395	CCDS5240.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.02|17.02	3.282376|3.282376	0.59867|0.59867	.|.	.|.	ENSG00000146469|ENSG00000146469	ENST00000367244;ENST00000367243|ENST00000431366	T;T|.	0.33216|.	1.42;1.42|.	6.16|6.16	6.16|6.16	0.99307|0.99307	Glucagon/GIP/secretin/VIP (3);|.	0.054982|.	0.85682|.	D|.	0.000000|.	T|.	0.74199|.	0.3685|.	M|M	0.83118|0.83118	2.625|2.625	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;0.998|.	T|.	0.76471|.	-0.2947|.	10|.	0.87932|.	D|.	0|.	.|.	16.8061|16.8061	0.85666|0.85666	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	131;131;132|.	A8K7E4;P01282-2;P01282|.	.;.;VIP_HUMAN|.	V|C	132;131|81	ENSP00000356213:D132V;ENSP00000356212:D131V|.	ENSP00000356212:D131V|.	D|X	+|+	2|3	0|0	VIP|VIP	153119021|153119021	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.031000|0.031000	0.12232|0.12232	7.093000|7.093000	0.76937|0.76937	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	GAC|TGA	VIP	-	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP	ENSG00000146469		0.378	VIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VIP	HGNC	protein_coding	OTTHUMT00000042751.1	103	0.00	0	A			153077328	153077328	+1	no_errors	ENST00000367244	ensembl	human	known	69_37n	missense	182	17.27	38	SNP	1.000	T
WDR76	79968	genome.wustl.edu	37	15	44119242	44119242	+	Silent	SNP	G	G	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr15:44119242G>T	ENST00000263795.6	+	1	82	c.12G>T	c.(10-12)tcG>tcT	p.S4S	WDR76_ENST00000381246.2_5'UTR|MFAP1_ENST00000267812.3_5'Flank	NM_001167941.1|NM_024908.3	NP_001161413.1|NP_079184.2	Q9H967	WDR76_HUMAN	WD repeat domain 76	4										breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)	20		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		all cancers(107;3.78e-21)|GBM - Glioblastoma multiforme(94;5.04e-07)		TGTCCAGGTCGGGCGCGGCGG	0.672											OREG0003948	type=REGULATORY REGION|Gene=WDR76|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													44.0	46.0	45.0					15																	44119242		2195	4297	6492	-	-	-	SO:0001819	synonymous_variant	0			AK023035	CCDS10106.1, CCDS53938.1	15q15.3	2013-01-09			ENSG00000092470	ENSG00000092470		"""WD repeat domain containing"""	25773	protein-coding gene	gene with protein product						12860291	Standard	NM_024908		Approved	FLJ12973	uc001zti.2	Q9H967	OTTHUMG00000060143	ENST00000263795.6:c.12G>T	15.37:g.44119242G>T		Somatic	921	WXS	Illumina GAIIx	Phase_IV	A0MNP5|Q05CI4	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.S4	ENST00000263795.6	37	c.12	CCDS10106.1	15																																																																																			WDR76	-	NULL	ENSG00000092470		0.672	WDR76-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR76	HGNC	protein_coding	OTTHUMT00000133482.2	44	0.00	0	G	NM_024908		44119242	44119242	+1	no_errors	ENST00000263795	ensembl	human	known	69_37n	silent	32	17.95	7	SNP	0.000	T
WDR93	56964	genome.wustl.edu	37	15	90276247	90276248	+	Frame_Shift_Ins	INS	-	-	G			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr15:90276247_90276248insG	ENST00000268130.7	+	13	1442_1443	c.1341_1342insG	c.(1342-1344)gggfs	p.G448fs	WDR93_ENST00000444934.2_Frame_Shift_Ins_p.G165fs|WDR93_ENST00000560294.1_Intron	NM_020212.1	NP_064597.1	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	448					electron transport chain (GO:0022900)		oxidoreductase activity, acting on NAD(P)H (GO:0016651)			NS(1)|breast(3)|endometrium(2)|kidney(4)|large_intestine(5)|liver(2)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	33	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			GATTCCCTCTTGGGGTCGCTGC	0.51																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS32326.1, CCDS66862.1, CCDS73779.1	15q26.1	2012-11-02						"""WD repeat domain containing"""	26924	protein-coding gene	gene with protein product							Standard	NM_020212		Approved		uc002boj.3	Q6P2C0		ENST00000268130.7:c.1345dupG	15.37:g.90276251_90276251dupG	ENSP00000268130:p.Gly448fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N7Y8|Q9NP89	Frame_Shift_Ins	INS	superfamily_WD40_repeat_dom	p.V448fs	ENST00000268130.7	37	c.1341_1342	CCDS32326.1	15																																																																																			WDR93	-	superfamily_WD40_repeat_dom	ENSG00000140527		0.510	WDR93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR93	HGNC	protein_coding	OTTHUMT00000416369.1	128	0.00	0	-	NM_020212		90276247	90276248	+1	no_errors	ENST00000268130	ensembl	human	known	69_37n	frame_shift_ins	171	14.50	29	INS	0.705:0.975	G
YLPM1	56252	genome.wustl.edu	37	14	75248571	75248571	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr14:75248571T>C	ENST00000552421.1	+	4	1949	c.1825T>C	c.(1825-1827)Tct>Cct	p.S609P	YLPM1_ENST00000325680.7_Missense_Mutation_p.S609P|YLPM1_ENST00000238571.3_Intron			P49750	YLPM1_HUMAN	YLP motif containing 1	0					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TCCCCCACCATCTCTCTCTTC	0.587																																						dbGAP											0													108.0	113.0	111.0					14																	75248571		2019	4184	6203	-	-	-	SO:0001583	missense	0			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.1825T>C	14.37:g.75248571T>C	ENSP00000447921:p.Ser609Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	superfamily_FH2_actin-bd	p.S609P	ENST00000552421.1	37	c.1825		14	.	.	.	.	.	.	.	.	.	.	T	7.352	0.623131	0.14193	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000423680	.	.	.	5.9	3.51	0.40186	.	.	.	.	.	T	0.29945	0.0749	N	0.22421	0.69	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.09357	-1.0678	8	0.19590	T	0.45	.	1.3458	0.02163	0.1765:0.1463:0.1264:0.5507	.	609	P49750-4	.	P	609;609;322	.	ENSP00000324463:S609P	S	+	1	0	YLPM1	74318324	0.029000	0.19370	0.912000	0.35992	0.996000	0.88848	0.079000	0.14782	0.464000	0.27142	0.482000	0.46254	TCT	YLPM1	-	NULL	ENSG00000119596		0.587	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	YLPM1	HGNC	protein_coding	OTTHUMT00000404450.1	291	0.00	0	T	NM_019589		75248571	75248571	+1	no_errors	ENST00000325680	ensembl	human	known	69_37n	missense	152	37.30	91	SNP	0.397	C
ZCCHC6	79670	genome.wustl.edu	37	9	88920155	88920155	+	Splice_Site	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr9:88920155C>T	ENST00000375963.3	-	23	4011		c.e23-1		ZCCHC6_ENST00000277141.6_Splice_Site|ZCCHC6_ENST00000375957.1_Splice_Site|ZCCHC6_ENST00000375960.2_Splice_Site|ZCCHC6_ENST00000375961.2_Splice_Site	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6						RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						TCAAAGGGATCTAAGCAAAAA	0.274																																						dbGAP											0													42.0	46.0	45.0					9																	88920155		2197	4288	6485	-	-	-	SO:0001630	splice_region_variant	0			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.3839-1G>A	9.37:g.88920155C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Splice_Site	SNP	-	e22-1	ENST00000375963.3	37	c.3839-1	CCDS35057.1	9	.	.	.	.	.	.	.	.	.	.	C	16.85	3.236668	0.58886	.	.	ENSG00000083223	ENST00000277141;ENST00000375960;ENST00000375961;ENST00000375957;ENST00000375963	.	.	.	4.95	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7551	0.91828	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZCCHC6	88109975	1.000000	0.71417	1.000000	0.80357	0.543000	0.35085	7.113000	0.77095	2.730000	0.93505	0.655000	0.94253	.	ZCCHC6	-	-	ENSG00000083223		0.274	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC6	HGNC	protein_coding	OTTHUMT00000052918.1	182	0.00	0	C	NM_024617	Intron	88920155	88920155	-1	no_errors	ENST00000375963	ensembl	human	known	69_37n	splice_site	184	34.98	99	SNP	1.000	T
ZDBF2	57683	genome.wustl.edu	37	2	207175720	207175720	+	Silent	SNP	C	C	T			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr2:207175720C>T	ENST00000374423.3	+	5	6854	c.6468C>T	c.(6466-6468)gtC>gtT	p.V2156V		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2156							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						ATGATGTTGTCAAAATCTCTC	0.343																																						dbGAP											0													37.0	38.0	38.0					2																	207175720		1798	4066	5864	-	-	-	SO:0001819	synonymous_variant	0			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.6468C>T	2.37:g.207175720C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZNP7|Q6ZSN8	Silent	SNP	pfam_Znf_DBF,smart_Znf_DBF	p.V2156	ENST00000374423.3	37	c.6468	CCDS46501.1	2																																																																																			ZDBF2	-	NULL	ENSG00000204186		0.343	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	HGNC	protein_coding	OTTHUMT00000336458.1	51	0.00	0	C	NM_020923		207175720	207175720	+1	no_errors	ENST00000374423	ensembl	human	known	69_37n	silent	53	17.19	11	SNP	0.005	T
ZDHHC4	55146	genome.wustl.edu	37	7	6621256	6621256	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr7:6621256C>G	ENST00000396706.2	+	4	579	c.136C>G	c.(136-138)Cca>Gca	p.P46A	AC079742.4_ENST00000434951.1_RNA|ZDHHC4_ENST00000405731.3_Missense_Mutation_p.P46A|ZDHHC4_ENST00000396707.2_Missense_Mutation_p.P46A|ZDHHC4_ENST00000335965.6_Missense_Mutation_p.P46A|ZDHHC4_ENST00000396713.2_Missense_Mutation_p.P46A|ZDHHC4_ENST00000396709.1_Missense_Mutation_p.P46A			Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	46						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		CTGTATAATTCCAGAATGTCT	0.378																																						dbGAP											0													136.0	131.0	133.0					7																	6621256		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF201931	CCDS5352.1	7p22.1	2011-01-11			ENSG00000136247	ENSG00000136247		"""Zinc fingers, DHHC-type"""	18471	protein-coding gene	gene with protein product							Standard	NM_018106		Approved	FLJ10479, ZNF374	uc003sqj.3	Q9NPG8	OTTHUMG00000023579	ENST00000396706.2:c.136C>G	7.37:g.6621256C>G	ENSP00000379934:p.Pro46Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2N9|Q53EV7|Q6FIB5|Q9H0R9	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Znf_DHHC_palmitoyltrfase	p.P46A	ENST00000396706.2	37	c.136	CCDS5352.1	7	.	.	.	.	.	.	.	.	.	.	c	15.63	2.890401	0.52014	.	.	ENSG00000136247	ENST00000405731;ENST00000396713;ENST00000396707;ENST00000335965;ENST00000396709;ENST00000483589;ENST00000396706	T;T;T;T;T;T;T	0.38240	1.19;1.19;1.19;1.19;1.19;1.15;1.19	4.51	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.55893	0.1949	M	0.80746	2.51	0.51482	D	0.999926	D;D	0.67145	0.996;0.98	P;P	0.59703	0.862;0.762	T	0.58086	-0.7698	10	0.40728	T	0.16	-2.3776	13.4416	0.61117	0.0:1.0:0.0:0.0	.	46;46	Q9NPG8;C9J5I9	ZDHC4_HUMAN;.	A	46	ENSP00000385027:P46A;ENSP00000379941:P46A;ENSP00000379935:P46A;ENSP00000337475:P46A;ENSP00000379937:P46A;ENSP00000418496:P46A;ENSP00000379934:P46A	ENSP00000337475:P46A	P	+	1	0	ZDHHC4	6587781	0.998000	0.40836	0.668000	0.29813	0.548000	0.35241	3.214000	0.51161	2.429000	0.82318	0.563000	0.77884	CCA	ZDHHC4	-	NULL	ENSG00000136247		0.378	ZDHHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC4	HGNC	protein_coding	OTTHUMT00000207477.3	423	0.00	0	C	NM_018106		6621256	6621256	+1	no_errors	ENST00000335965	ensembl	human	known	69_37n	missense	233	58.47	328	SNP	0.972	G
ZNF733P	643955	genome.wustl.edu	37	7	62752198	62752198	+	RNA	SNP	G	G	A			TCGA-E2-A14P-01A-31D-A12B-09	TCGA-E2-A14P-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	35a96eee-113b-45cb-a999-81c13545b104	ddf38d71-5acf-4b09-9796-d26fa1089daa	g.chr7:62752198G>A	ENST00000331425.6	-	0	1237					NR_003952.1				zinc finger protein 733, pseudogene																		GTCAGTGAGGGTTGAGGATAA	0.448																																						dbGAP											0																																										-	-	-			0					7q11.21	2012-04-20	2012-04-20	2012-04-20	ENSG00000185037	ENSG00000185037			32473	pseudogene	pseudogene			"""zinc finger protein 733"""	ZNF733			Standard	NR_003952		Approved		uc011kdj.2		OTTHUMG00000156270		7.37:g.62752198G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000331425.6	37	NULL		7																																																																																			ZNF733P	-	-	ENSG00000185037		0.448	ZNF733P-002	KNOWN	basic	processed_transcript	ZNF733P	HGNC	pseudogene	OTTHUMT00000343679.1	114	0.00	0	G			62752198	62752198	-1	no_errors	ENST00000331425	ensembl	human	known	69_37n	rna	117	26.88	43	SNP	0.000	A
