#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ATP1A4	480	genome.wustl.edu	37	1	160147410	160147410	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr1:160147410G>C	ENST00000368081.4	+	18	3163	c.2692G>C	c.(2692-2694)Gat>Cat	p.D898H	ATP1A4_ENST00000418334.1_3'UTR|ATP1A4_ENST00000470705.1_Missense_Mutation_p.D34H	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	898					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCACTGGGAAGATAAATACTT	0.507																																						dbGAP											0													135.0	127.0	130.0					1																	160147410		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.2692G>C	1.37:g.160147410G>C	ENSP00000357060:p.Asp898His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.D898H	ENST00000368081.4	37	c.2692	CCDS1197.1	1	.	.	.	.	.	.	.	.	.	.	G	9.171	1.021187	0.19433	.	.	ENSG00000132681	ENST00000368081;ENST00000470705	D;D	0.88896	-2.44;-2.44	4.14	-0.162	0.13367	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.351431	0.30269	N	0.010009	D	0.83727	0.5317	M	0.91406	3.205	0.20403	N	0.9999	B	0.18968	0.032	B	0.26094	0.066	T	0.80082	-0.1531	10	0.87932	D	0	.	8.5179	0.33257	0.3476:0.0:0.6524:0.0	.	898	Q13733	AT1A4_HUMAN	H	898;34	ENSP00000357060:D898H;ENSP00000433094:D34H	ENSP00000357060:D898H	D	+	1	0	ATP1A4	158414034	0.996000	0.38824	0.001000	0.08648	0.616000	0.37450	2.476000	0.45171	-0.112000	0.11979	0.485000	0.47835	GAT	ATP1A4	-	pfam_ATPase_P-typ_cation-transptr_C,tigrfam_ATPase_P-typ_cation-ex_asu_euk	ENSG00000132681		0.507	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	HGNC	protein_coding	OTTHUMT00000077415.1	178	0.00	0	G	NM_144699		160147410	160147410	+1	no_errors	ENST00000368081	ensembl	human	known	69_37n	missense	394	20.08	99	SNP	0.116	C
CFHR2	3080	genome.wustl.edu	37	1	196918689	196918689	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr1:196918689T>C	ENST00000367415.5	+	2	263	c.163T>C	c.(163-165)Tgt>Cgt	p.C55R	CFHR2_ENST00000367421.3_Missense_Mutation_p.C55R|CFHR2_ENST00000476712.2_Missense_Mutation_p.C55R|CFHR2_ENST00000496448.1_Intron	NM_005666.2	NP_005657.1	P36980	FHR2_HUMAN	complement factor H-related 2	55	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						CTATTACTCCTGTGAATATAA	0.368																																						dbGAP											0													83.0	81.0	82.0					1																	196918689		2203	4299	6502	-	-	-	SO:0001583	missense	0			X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367415.5:c.163T>C	1.37:g.196918689T>C	ENSP00000356385:p.Cys55Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14310|Q5T9T1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.C55R	ENST00000367415.5	37	c.163	CCDS30959.1	1	.	.	.	.	.	.	.	.	.	.	T	12.38	1.921438	0.33908	.	.	ENSG00000080910	ENST00000367421;ENST00000367415	D;D	0.99778	-6.73;-6.73	3.33	2.18	0.27775	Complement control module (2);Sushi/SCR/CCP (2);	0.000000	0.36740	N	0.002434	D	0.99603	0.9856	M	0.84082	2.675	0.19775	N	0.999958	D	0.89917	1.0	D	0.91635	0.999	D	0.99066	1.0832	10	0.87932	D	0	.	5.1929	0.15218	0.0:0.1423:0.0:0.8577	.	55	P36980	FHR2_HUMAN	R	55	ENSP00000356391:C55R;ENSP00000356385:C55R	ENSP00000356385:C55R	C	+	1	0	CFHR2	195185312	0.026000	0.19158	0.023000	0.16930	0.044000	0.14063	0.490000	0.22403	0.450000	0.26774	0.416000	0.27883	TGT	CFHR2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP	ENSG00000080910		0.368	CFHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR2	HGNC	protein_coding	OTTHUMT00000088815.2	249	0.00	0	T	NM_005666		196918689	196918689	+1	no_errors	ENST00000367415	ensembl	human	known	69_37n	missense	306	37.90	188	SNP	0.032	C
CLIP1	6249	genome.wustl.edu	37	12	122825972	122825972	+	Silent	SNP	G	G	A			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr12:122825972G>A	ENST00000540338.1	-	10	1820	c.1779C>T	c.(1777-1779)acC>acT	p.T593T	CLIP1_ENST00000361654.4_Silent_p.T547T|CLIP1_ENST00000537178.1_Silent_p.T547T|CLIP1_ENST00000545889.1_Silent_p.T283T|CLIP1_ENST00000358808.2_Silent_p.T582T|CLIP1_ENST00000302528.7_Silent_p.T582T			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	593					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TTTCCGTGGCGGTATACAGAG	0.458																																						dbGAP											0													141.0	142.0	141.0					12																	122825972		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.1779C>T	12.37:g.122825972G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVD3|Q17RS4|Q29RG0	Silent	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_Znf_CCHC,superfamily_Prefoldin,pfscan_CAP-Gly_domain	p.T593	ENST00000540338.1	37	c.1779	CCDS58285.1	12																																																																																			CLIP1	-	NULL	ENSG00000130779		0.458	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLIP1	HGNC	protein_coding	OTTHUMT00000401625.1	64	0.00	0	G	NM_002956		122825972	122825972	-1	no_errors	ENST00000540338	ensembl	human	known	69_37n	silent	111	29.56	47	SNP	0.000	A
CORO2A	7464	genome.wustl.edu	37	9	100887118	100887118	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr9:100887118C>T	ENST00000343933.5	-	12	1773	c.1516G>A	c.(1516-1518)Gtc>Atc	p.V506I	CORO2A_ENST00000375077.4_Missense_Mutation_p.V506I	NM_003389.3	NP_003380.3	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	506					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	actin cytoskeleton (GO:0015629)|transcriptional repressor complex (GO:0017053)	actin filament binding (GO:0051015)			endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|skin(4)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				TTGGCCTGGACCTCTCGCTGG	0.577																																						dbGAP											0													84.0	72.0	76.0					9																	100887118		2203	4300	6503	-	-	-	SO:0001583	missense	0			U57057	CCDS6735.1	9q22.3	2013-01-10	2001-11-28		ENSG00000106789	ENSG00000106789		"""Coronins"", ""WD repeat domain containing"""	2255	protein-coding gene	gene with protein product	"""coronin 2A"", ""coronin-like protein B"", ""WD protein IR10"", ""WD-repeat protein 2"""	602159	"""coronin, actin-binding protein, 2A"""			8985118	Standard	NM_052820		Approved	IR10, WDR2	uc004aym.3	Q92828	OTTHUMG00000020340	ENST00000343933.5:c.1516G>A	9.37:g.100887118C>T	ENSP00000343746:p.Val506Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBR5|Q92829|Q9BWS5	Missense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V506I	ENST00000343933.5	37	c.1516	CCDS6735.1	9	.	.	.	.	.	.	.	.	.	.	C	14.70	2.612336	0.46631	.	.	ENSG00000106789	ENST00000343933;ENST00000375077	T;T	0.74002	-0.8;-0.8	5.6	5.6	0.85130	.	0.115812	0.64402	D	0.000018	T	0.67135	0.2861	L	0.36672	1.1	0.58432	D	0.999999	B;P	0.37525	0.189;0.598	B;B	0.35312	0.134;0.2	T	0.66964	-0.5790	10	0.37606	T	0.19	-38.1027	18.3822	0.90454	0.0:1.0:0.0:0.0	.	506;506	Q92828;A8K9S3	COR2A_HUMAN;.	I	506	ENSP00000343746:V506I;ENSP00000364218:V506I	ENSP00000343746:V506I	V	-	1	0	CORO2A	99926939	0.672000	0.27530	1.000000	0.80357	0.999000	0.98932	1.356000	0.34079	2.648000	0.89879	0.655000	0.94253	GTC	CORO2A	-	NULL	ENSG00000106789		0.577	CORO2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO2A	HGNC	protein_coding	OTTHUMT00000053357.1	88	0.00	0	C	NM_003389		100887118	100887118	-1	no_errors	ENST00000343933	ensembl	human	known	69_37n	missense	96	20.00	24	SNP	1.000	T
CSPG4P5	114817	genome.wustl.edu	37	15	84958495	84958495	+	RNA	SNP	G	G	A	rs201001162	byFrequency	TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr15:84958495G>A	ENST00000558801.1	-	0	6234									DNM1 pseudogene 51																		GAAATATGGTGGAGCTGTGAC	0.577													.|||	674	0.134585	0.1293	0.2493	5008	,	,		21482	0.1399		0.1581	False		,,,				2504	0.0307					dbGAP											0																																										-	-	-			0					15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84958495G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000558801.1	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	0.534	-0.856746	0.02630	.	.	ENSG00000235370	ENST00000456932	.	.	.	.	.	.	.	0.285739	0.28618	N	0.014718	T	0.43964	0.1271	.	.	.	.	.	.	.	.	.	.	.	.	T	0.51687	-0.8674	4	0.49607	T	0.09	.	5.89	0.18904	8.0E-4:0.0:0.9992:0.0	.	.	.	.	L	388	.	ENSP00000389645:P388L	P	-	2	0	CSPG4P5	82749499	0.000000	0.05858	0.547000	0.28179	0.550000	0.35303	-0.428000	0.06991	0.107000	0.17824	0.109000	0.15622	CCA	CSPG4P5	-	-	ENSG00000235370		0.577	DNM1P51-001	KNOWN	basic	processed_transcript	CSPG4P5	HGNC	pseudogene	OTTHUMT00000471721.1	8	0.00	0	G			84958495	84958495	-1	no_errors	ENST00000456932	ensembl	human	known	69_37n	rna	8	46.67	7	SNP	0.007	A
DSPP	1834	genome.wustl.edu	37	4	88536886	88536886	+	Silent	SNP	C	C	T	rs111205182		TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr4:88536886C>T	ENST00000282478.7	+	4	3105	c.3072C>T	c.(3070-3072)agC>agT	p.S1024S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1024S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1024	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcagcaatagcagtgacagca	0.517																																						dbGAP											0													44.0	40.0	41.0					4																	88536886		1516	2409	3925	-	-	-	SO:0001819	synonymous_variant	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3072C>T	4.37:g.88536886C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUI0|O95815	Silent	SNP	NULL	p.S1024	ENST00000282478.7	37	c.3072	CCDS43248.1	4																																																																																			DSPP	-	NULL	ENSG00000152591		0.517	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	290	0.68	2	C	NM_014208		88536886	88536886	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	silent	277	11.71	37	SNP	0.076	T
EML5	161436	genome.wustl.edu	37	14	89094085	89094085	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr14:89094085delC	ENST00000380664.5	-	32	4411	c.4412delG	c.(4411-4413)ggafs	p.G1471fs	EML5_ENST00000553320.1_5'Flank|EML5_ENST00000352093.5_Frame_Shift_Del_p.G1433fs|EML5_ENST00000554922.1_Frame_Shift_Del_p.G1479fs			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1471						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TGAACATACTCCCTTTGAATG	0.413																																						dbGAP											0													81.0	78.0	79.0					14																	89094085		1891	4115	6006	-	-	-	SO:0001589	frameshift_variant	0			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.4412delG	14.37:g.89094085delC	ENSP00000370039:p.Gly1471fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Frame_Shift_Del	DEL	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G1479fs	ENST00000380664.5	37	c.4436	CCDS45148.1	14																																																																																			EML5	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000165521		0.413	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	HGNC	protein_coding	OTTHUMT00000410491.1	100	0.00	0	C			89094085	89094085	-1	no_errors	ENST00000554922	ensembl	human	known	69_37n	frame_shift_del	162	21.50	46	DEL	1.000	-
FAM69C	125704	genome.wustl.edu	37	18	72114052	72114053	+	Frame_Shift_Ins	INS	-	-	C			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr18:72114052_72114053insC	ENST00000343998.6	-	2	672_673	c.664_665insG	c.(664-666)gtgfs	p.V222fs	FAM69C_ENST00000400291.2_Intron	NM_001044369.2	NP_001037834.2	Q0P6D2	FA69C_HUMAN	family with sequence similarity 69, member C	222						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(1)|large_intestine(2)|ovary(2)	5						CAGGAACTCCACCGCGTAGAAG	0.698																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC019628	CCDS42445.2	18q22.3	2012-08-03	2009-07-23	2009-07-23	ENSG00000187773	ENSG00000187773			31729	protein-coding gene	gene with protein product		614544	"""chromosome 18 open reading frame 51"""	C18orf51		21334309	Standard	NM_001044369		Approved		uc002llk.3	Q0P6D2	OTTHUMG00000156984	ENST00000343998.6:c.665dupG	18.37:g.72114054_72114054dupC	ENSP00000344331:p.Val222fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_Uncharacterised_FAM69,superfamily_Kinase-like_dom	p.V222fs	ENST00000343998.6	37	c.665_664	CCDS42445.2	18																																																																																			FAM69C	-	superfamily_Kinase-like_dom	ENSG00000187773		0.698	FAM69C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM69C	HGNC	protein_coding	OTTHUMT00000346971.2	56	0.00	0	-	XM_058931		72114052	72114053	-1	no_errors	ENST00000343998	ensembl	human	known	69_37n	frame_shift_ins	39	23.53	12	INS	1.000:1.000	C
FAM86B1	85002	genome.wustl.edu	37	8	12044059	12044059	+	Missense_Mutation	SNP	G	G	A	rs533946400	byFrequency	TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr8:12044059G>A	ENST00000448228.2	-	5	491	c.442C>T	c.(442-444)Cgg>Tgg	p.R148W	FAM86B1_ENST00000534520.1_Intron|FAM86B1_ENST00000533852.2_Missense_Mutation_p.R182W|FAM86B1_ENST00000533513.1_3'UTR|FAM86B1_ENST00000321602.8_Intron	NM_001083537.1	NP_001077006.1	Q8N7N1	F86B1_HUMAN	family with sequence similarity 86, member B1	148										kidney(1)|prostate(1)|stomach(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		ATGTATGCCCGGGGGCGGCAC	0.602													g|||	2	0.000399361	0.0008	0.0	5008	,	,		26398	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													20.0	22.0	21.0					8																	12044059		1385	2479	3864	-	-	-	SO:0001583	missense	0			BC007983	CCDS59512.1	8p23.1	2014-02-12	2005-08-19		ENSG00000186523	ENSG00000186523			28268	protein-coding gene	gene with protein product						12477932	Standard	NM_001083537		Approved	MGC16279	uc010lse.3	Q8N7N1	OTTHUMG00000165298	ENST00000448228.2:c.442C>T	8.37:g.12044059G>A	ENSP00000407067:p.Arg148Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.R182W	ENST00000448228.2	37	c.544	CCDS59512.1	8	.	.	.	.	.	.	.	.	.	.	-	19.15	3.772153	0.69992	.	.	ENSG00000186523	ENST00000431227;ENST00000448228;ENST00000526708	T	0.17213	2.29	1.17	-2.34	0.06704	.	.	.	.	.	T	0.31734	0.0806	M	0.77820	2.39	0.09310	N	0.999996	D;D	0.71674	0.997;0.998	D;D	0.65140	0.932;0.912	T	0.15578	-1.0432	9	0.72032	D	0.01	.	3.1239	0.06401	0.0:0.1822:0.2521:0.5657	.	148;182	Q8N7N1;E9PN63	F86B1_HUMAN;.	W	182;148;182	ENSP00000407067:R148W	ENSP00000444227:R182W	R	-	1	2	FAM86B1	12081468	0.000000	0.05858	0.005000	0.12908	0.013000	0.08279	0.384000	0.20668	-0.599000	0.05798	-1.289000	0.01358	CGG	FAM86B1	-	pfam_Nicotinamide_N-MeTfrase-like	ENSG00000186523		0.602	FAM86B1-016	KNOWN	basic|CCDS	protein_coding	FAM86B1	HGNC	protein_coding	OTTHUMT00000383317.1	124	0.00	0	G	NM_032916		12044059	12044059	-1	no_errors	ENST00000431227	ensembl	human	known	69_37n	missense	172	13.00	26	SNP	0.195	A
IL1RL2	8808	genome.wustl.edu	37	2	102818091	102818091	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr2:102818091G>A	ENST00000264257.2	+	5	691	c.565G>A	c.(565-567)Gac>Aac	p.D189N	IL1RL2_ENST00000481806.1_3'UTR|IL1RL2_ENST00000539491.1_Missense_Mutation_p.D189N|IL1RL2_ENST00000441515.2_Missense_Mutation_p.D72N	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	189	Ig-like C2-type 2.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						CTCGGCAGAGGACAGAGGGAA	0.438																																						dbGAP											0													131.0	113.0	119.0					2																	102818091		2203	4300	6503	-	-	-	SO:0001583	missense	0			U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.565G>A	2.37:g.102818091G>A	ENSP00000264257:p.Asp189Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_IL1_rcpt_I/II,prints_IL1R_rcpt	p.D189N	ENST00000264257.2	37	c.565	CCDS2056.1	2	.	.	.	.	.	.	.	.	.	.	G	19.63	3.864330	0.71949	.	.	ENSG00000115598	ENST00000264257;ENST00000441515;ENST00000539491	D;T;D	0.85484	-1.99;3.39;-1.99	4.67	4.67	0.58626	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.227204	0.40144	N	0.001161	D	0.89491	0.6730	M	0.81179	2.53	0.27737	N	0.94461	P;P	0.48407	0.671;0.91	B;P	0.53912	0.302;0.737	D	0.84139	0.0416	10	0.39692	T	0.17	.	13.2462	0.60024	0.0:0.0:1.0:0.0	.	72;189	A4FU63;Q9HB29	.;ILRL2_HUMAN	N	189;72;189	ENSP00000264257:D189N;ENSP00000413348:D72N;ENSP00000442184:D189N	ENSP00000264257:D189N	D	+	1	0	IL1RL2	102184523	1.000000	0.71417	0.114000	0.21550	0.350000	0.29205	4.027000	0.57239	2.588000	0.87417	0.462000	0.41574	GAC	IL1RL2	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000115598		0.438	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RL2	HGNC	protein_coding	OTTHUMT00000253290.1	125	0.00	0	G	NM_003854		102818091	102818091	+1	no_errors	ENST00000264257	ensembl	human	known	69_37n	missense	120	25.31	41	SNP	0.340	A
CLUH	23277	genome.wustl.edu	37	17	2598235	2598235	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr17:2598235G>A	ENST00000570628.2	-	16	2756	c.2651C>T	c.(2650-2652)aCa>aTa	p.T884I	CLUH_ENST00000435359.1_Missense_Mutation_p.T884I|CLUH_ENST00000538975.1_Missense_Mutation_p.T884I			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	884					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											AGCCCAGGCTGTGTTATCTGC	0.622																																						dbGAP											0													24.0	28.0	27.0					17																	2598235		1872	4094	5966	-	-	-	SO:0001583	missense	0			AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.2651C>T	17.37:g.2598235G>A	ENSP00000458986:p.Thr884Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	superfamily_GSKIP/TIF31_domain	p.T884I	ENST00000570628.2	37	c.2651	CCDS45572.1	17	.	.	.	.	.	.	.	.	.	.	g	17.04	3.286498	0.59867	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	T;T	0.80480	-1.38;-1.38	5.48	5.48	0.80851	.	0.101782	0.64402	D	0.000002	T	0.77465	0.4134	L	0.48986	1.54	0.58432	D	0.999997	P;P	0.39759	0.687;0.562	B;B	0.39590	0.304;0.222	T	0.74497	-0.3646	10	0.20519	T	0.43	.	18.3323	0.90274	0.0:0.0:1.0:0.0	.	884;885	O75153;C9J6D7	K0664_HUMAN;.	I	884;885;884	ENSP00000388872:T884I;ENSP00000439628:T884I	ENSP00000320468:T885I	T	-	2	0	KIAA0664	2544985	1.000000	0.71417	0.848000	0.33437	0.836000	0.47400	9.286000	0.95898	2.580000	0.87095	0.556000	0.70494	ACA	KIAA0664	-	NULL	ENSG00000132361		0.622	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0664	HGNC	protein_coding	OTTHUMT00000437807.2	66	0.00	0	G	NM_015229		2598235	2598235	-1	no_errors	ENST00000435359	ensembl	human	known	69_37n	missense	51	32.89	25	SNP	0.993	A
KIFC1	3833	genome.wustl.edu	37	6	33371608	33371608	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr6:33371608G>T	ENST00000428849.2	+	6	908	c.458G>T	c.(457-459)tGc>tTc	p.C153F	KIFC1_ENST00000486695.1_3'UTR	NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	153					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						CTAAAACGGTGCCGTGAGAGG	0.552																																						dbGAP											0													100.0	96.0	98.0					6																	33371608		2203	4300	6503	-	-	-	SO:0001583	missense	0			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.458G>T	6.37:g.33371608G>T	ENSP00000393963:p.Cys153Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.C153F	ENST00000428849.2	37	c.458	CCDS34430.1	6	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.772889	0.00640	.	.	ENSG00000237649	ENST00000428849;ENST00000450504	T	0.77098	-1.07	5.34	-2.44	0.06502	.	0.529435	0.23151	N	0.051357	T	0.36496	0.0969	N	0.24115	0.695	0.09310	N	0.999998	B;B	0.06786	0.001;0.001	B;B	0.08055	0.001;0.003	T	0.41840	-0.9486	10	0.13853	T	0.58	-1.09	12.2313	0.54490	0.7161:0.0:0.2839:0.0	.	145;153	B4E063;Q9BW19	.;KIFC1_HUMAN	F	153;194	ENSP00000393963:C153F	ENSP00000393963:C153F	C	+	2	0	KIFC1	33479586	0.868000	0.29978	0.028000	0.17463	0.056000	0.15407	0.145000	0.16157	-0.776000	0.04578	-0.251000	0.11542	TGC	KIFC1	-	NULL	ENSG00000237649		0.552	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC1	HGNC	protein_coding	OTTHUMT00000076417.1	70	0.00	0	G	NM_002263		33371608	33371608	+1	no_errors	ENST00000428849	ensembl	human	known	69_37n	missense	84	20.75	22	SNP	0.158	T
MYF6	4618	genome.wustl.edu	37	12	81101884	81101884	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr12:81101884C>T	ENST00000228641.3	+	1	608	c.386C>T	c.(385-387)cCc>cTc	p.P129L		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	129	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						CAGAGGCTGCCCAAGGTGGAG	0.607																																						dbGAP											0													46.0	51.0	49.0					12																	81101884		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.386C>T	12.37:g.81101884C>T	ENSP00000228641:p.Pro129Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R898|Q53X80|Q6FHI9	Missense_Mutation	SNP	pfam_Basic,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_Basic,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.P129L	ENST00000228641.3	37	c.386	CCDS9019.1	12	.	.	.	.	.	.	.	.	.	.	C	27.0	4.790929	0.90367	.	.	ENSG00000111046	ENST00000228641	D	0.97924	-4.61	5.86	5.86	0.93980	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.98982	0.9653	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99529	1.0960	10	0.87932	D	0	-40.4057	20.1772	0.98182	0.0:1.0:0.0:0.0	.	129	P23409	MYF6_HUMAN	L	129	ENSP00000228641:P129L	ENSP00000228641:P129L	P	+	2	0	MYF6	79626015	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.487000	0.81328	2.778000	0.95560	0.655000	0.94253	CCC	MYF6	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000111046		0.607	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF6	HGNC	protein_coding	OTTHUMT00000407756.1	46	0.00	0	C	NM_002469		81101884	81101884	+1	no_errors	ENST00000228641	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	1.000	T
PCDHB14	56122	genome.wustl.edu	37	5	140605357	140605357	+	Silent	SNP	G	G	C			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr5:140605357G>C	ENST00000239449.4	+	1	2280	c.2280G>C	c.(2278-2280)ggG>ggC	p.G760G	PCDHB14_ENST00000515856.2_Silent_p.G607G	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	760					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGGTTCCGGGACAAATGAGT	0.512																																					Ovarian(141;50 1831 27899 33809 37648)	dbGAP											0													94.0	106.0	102.0					5																	140605357		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.2280G>C	5.37:g.140605357G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G760	ENST00000239449.4	37	c.2280	CCDS4256.1	5																																																																																			PCDHB14	-	NULL	ENSG00000120327		0.512	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	HGNC	protein_coding	OTTHUMT00000251814.2	142	0.00	0	G	NM_018934		140605357	140605357	+1	no_errors	ENST00000239449	ensembl	human	known	69_37n	silent	230	22.30	66	SNP	0.002	C
PCDHGB1	56104	genome.wustl.edu	37	5	140731438	140731438	+	Silent	SNP	G	G	A			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr5:140731438G>A	ENST00000523390.1	+	1	1611	c.1611G>A	c.(1609-1611)gcG>gcA	p.A537A	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	537	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCCCCCGCGCTCAGCGCCA	0.711																																						dbGAP											0													39.0	49.0	45.0					5																	140731438		2118	4229	6347	-	-	-	SO:0001819	synonymous_variant	0			AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.1611G>A	5.37:g.140731438G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY75|Q9Y5C8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A537	ENST00000523390.1	37	c.1611	CCDS54923.1	5																																																																																			PCDHGB1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254221		0.711	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB1	HGNC	protein_coding	OTTHUMT00000374740.1	18	0.00	0	G	NM_018922		140731438	140731438	+1	no_errors	ENST00000523390	ensembl	human	known	69_37n	silent	25	26.47	9	SNP	0.700	A
PSMC6	5706	genome.wustl.edu	37	14	53173897	53173897	+	5'Flank	SNP	T	T	C			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr14:53173897T>C	ENST00000606149.1	+	0	0				PSMC6_ENST00000445930.2_Start_Codon_SNP_p.M1T	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					CGGACGGCCATGGCCATTCCC	0.642																																						dbGAP											0													25.0	23.0	23.0					14																	53173897		2203	4299	6502	-	-	-	SO:0001631	upstream_gene_variant	0				CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333		14.37:g.53173897T>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R975|P49719|Q6IBU3|Q92524	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.M1T	ENST00000606149.1	37	c.2		14	.	.	.	.	.	.	.	.	.	.	T	15.43	2.831287	0.50845	.	.	ENSG00000100519	ENST00000445930	D	0.93604	-3.25	5.36	5.36	0.76844	.	.	.	.	.	D	0.95023	0.8389	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.95203	0.8318	6	0.87932	D	0	.	11.0338	0.47789	0.1391:0.0:0.0:0.8609	.	.	.	.	T	1	ENSP00000401802:M1T	ENSP00000401802:M1T	M	+	2	0	PSMC6	52243647	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.185000	0.50934	2.254000	0.74563	0.459000	0.35465	ATG	PSMC6	-	NULL	ENSG00000100519		0.642	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	PSMC6	HGNC	protein_coding	OTTHUMT00000470741.1	19	0.00	0	T	NM_002806		53173897	53173897	+1	no_errors	ENST00000445930	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	1.000	C
POMT2	29954	genome.wustl.edu	37	14	77757676	77757676	+	Silent	SNP	C	C	T			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr14:77757676C>T	ENST00000261534.4	-	10	1366	c.1164G>A	c.(1162-1164)aaG>aaA	p.K388K		NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	388	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		TGTTATGTTTCTTGATAATCC	0.493																																						dbGAP											0													187.0	134.0	152.0					14																	77757676		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.1164G>A	14.37:g.77757676C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NSG6|Q9P1W0|Q9P1W2	Silent	SNP	pfam_Glyco_trans_39,pfam_MIR,superfamily_MIR,smart_MIR_motif,pfscan_MIR_motif	p.K388	ENST00000261534.4	37	c.1164	CCDS9857.1	14																																																																																			POMT2	-	pfam_MIR,superfamily_MIR,smart_MIR_motif,pfscan_MIR_motif	ENSG00000009830		0.493	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMT2	HGNC	protein_coding	OTTHUMT00000414155.1	136	0.00	0	C	NM_013382		77757676	77757676	-1	no_errors	ENST00000261534	ensembl	human	known	69_37n	silent	191	24.71	63	SNP	1.000	T
RAD54B	25788	genome.wustl.edu	37	8	95392443	95392443	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr8:95392443C>A	ENST00000336148.5	-	12	2301	c.2177G>T	c.(2176-2178)gGa>gTa	p.G726V		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	726	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			GAGGTTAAGTCCTACACCACC	0.353								Direct reversal of damage;Homologous recombination																														dbGAP											0													64.0	62.0	63.0					8																	95392443		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.2177G>T	8.37:g.95392443C>A	ENSP00000336606:p.Gly726Val	Somatic		WXS	Illumina GAIIx	Phase_IV	F6WBS8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_HDA_complex_subunit-2/3,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G726V	ENST00000336148.5	37	c.2177	CCDS6262.1	8	.	.	.	.	.	.	.	.	.	.	C	27.0	4.788609	0.90367	.	.	ENSG00000197275	ENST00000336148;ENST00000546218	D	0.97598	-4.45	5.83	5.83	0.93111	Helicase, C-terminal (3);	0.052264	0.85682	D	0.000000	D	0.99408	0.9791	H	0.99946	5.015	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97933	1.0321	10	0.87932	D	0	-30.9737	18.2956	0.90145	0.0:1.0:0.0:0.0	.	726	Q9Y620	RA54B_HUMAN	V	726;398	ENSP00000336606:G726V	ENSP00000336606:G726V	G	-	2	0	RAD54B	95461619	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.625000	0.83145	2.761000	0.94854	0.650000	0.86243	GGA	RAD54B	-	pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,smart_Helicase_C,pfscan_Helicase_C	ENSG00000197275		0.353	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54B	HGNC	protein_coding	OTTHUMT00000257806.3	65	0.00	0	C	NM_012415		95392443	95392443	-1	no_errors	ENST00000336148	ensembl	human	known	69_37n	missense	79	26.17	28	SNP	1.000	A
RBAK	57786	genome.wustl.edu	37	7	5103484	5103484	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr7:5103484A>G	ENST00000353796.3	+	6	721	c.397A>G	c.(397-399)Ata>Gta	p.I133V	RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK_ENST00000396912.1_Missense_Mutation_p.I133V|RBAK-RBAKDN_ENST00000407184.1_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	133					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TTCAAGCATAATAGCTCATAA	0.353																																						dbGAP											0													109.0	105.0	106.0					7																	5103484		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.397A>G	7.37:g.5103484A>G	ENSP00000275423:p.Ile133Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I133V	ENST00000353796.3	37	c.397	CCDS5337.1	7	.	.	.	.	.	.	.	.	.	.	A	2.495	-0.316533	0.05422	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.06528	3.29;3.29	3.91	-2.96	0.05547	.	1.961470	0.02284	N	0.069620	T	0.06781	0.0173	L	0.38733	1.17	0.20821	N	0.999846	B	0.02656	0.0	B	0.01281	0.0	T	0.41592	-0.9500	8	.	.	.	.	11.0651	0.47970	0.2715:0.0:0.7285:0.0	.	133	Q9NYW8	RBAK_HUMAN	V	133	ENSP00000275423:I133V;ENSP00000380120:I133V	.	I	+	1	0	RBAK	5070010	0.000000	0.05858	0.000000	0.03702	0.981000	0.71138	0.154000	0.16343	-0.456000	0.07043	0.454000	0.30748	ATA	RBAK	-	NULL	ENSG00000146587		0.353	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBAK	HGNC	protein_coding	OTTHUMT00000241640.2	114	0.00	0	A	NM_021163		5103484	5103484	+1	no_errors	ENST00000353796	ensembl	human	known	69_37n	missense	175	28.46	70	SNP	0.000	G
RGS9	8787	genome.wustl.edu	37	17	63221255	63221255	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr17:63221255C>T	ENST00000262406.9	+	18	1610	c.1543C>T	c.(1543-1545)Cgg>Tgg	p.R515W	RGS9_ENST00000443584.3_Missense_Mutation_p.R512W|RGS9_ENST00000449996.3_Missense_Mutation_p.R512W	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	515					dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						CCGCTTCATCCGGCGACCCAG	0.662																																						dbGAP											0													92.0	110.0	104.0					17																	63221255		2071	4212	6283	-	-	-	SO:0001583	missense	0			AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.1543C>T	17.37:g.63221255C>T	ENSP00000262406:p.Arg515Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.R515W	ENST00000262406.9	37	c.1543	CCDS42373.1	17	.	.	.	.	.	.	.	.	.	.	C	16.24	3.067180	0.55539	.	.	ENSG00000108370	ENST00000262406;ENST00000449996	T;T	0.32988	1.43;1.43	3.91	-1.38	0.09027	.	0.303719	0.23598	N	0.046463	T	0.29684	0.0741	L	0.51422	1.61	0.22185	N	0.999301	D;D;D	0.63880	0.993;0.983;0.99	P;B;P	0.50352	0.638;0.424;0.627	T	0.16630	-1.0396	10	0.56958	D	0.05	.	6.4721	0.22013	0.522:0.3071:0.1709:0.0	.	515;515;512	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	W	515;512	ENSP00000262406:R515W;ENSP00000396329:R512W	ENSP00000262406:R515W	R	+	1	2	RGS9	60651717	0.017000	0.18338	0.944000	0.38274	0.898000	0.52572	0.020000	0.13466	0.015000	0.14971	0.561000	0.74099	CGG	RGS9	-	NULL	ENSG00000108370		0.662	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS9	HGNC	protein_coding	OTTHUMT00000445885.1	174	0.00	0	C	NM_003835		63221255	63221255	+1	no_errors	ENST00000262406	ensembl	human	known	69_37n	missense	159	29.33	66	SNP	0.588	T
RYR2	6262	genome.wustl.edu	37	1	237881772	237881772	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr1:237881772A>G	ENST00000366574.2	+	73	10822	c.10505A>G	c.(10504-10506)gAg>gGg	p.E3502G	RYR2_ENST00000360064.6_Missense_Mutation_p.E3500G|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.E3486G	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3502					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAAGATACCGAGGATGAAGTA	0.323																																						dbGAP											0													66.0	62.0	63.0					1																	237881772		1840	4086	5926	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10505A>G	1.37:g.237881772A>G	ENSP00000355533:p.Glu3502Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E3500G	ENST00000366574.2	37	c.10499	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.874462	0.91664	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.97665	-4.48;-4.45;-4.48	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000005	D	0.96608	0.8893	M	0.62723	1.935	0.80722	D	1	D	0.58970	0.984	P	0.47673	0.554	D	0.96963	0.9703	10	0.87932	D	0	-18.1603	15.898	0.79350	1.0:0.0:0.0:0.0	.	3502	Q92736	RYR2_HUMAN	G	3502;3500;3486;457	ENSP00000355533:E3502G;ENSP00000353174:E3500G;ENSP00000443798:E3486G	ENSP00000353174:E3500G	E	+	2	0	RYR2	235948395	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.014000	0.93635	2.150000	0.67090	0.528000	0.53228	GAG	RYR2	-	NULL	ENSG00000198626		0.323	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	83	0.00	0	A	NM_001035		237881772	237881772	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	194	14.91	34	SNP	1.000	G
USP42	84132	genome.wustl.edu	37	7	6155014	6155014	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr7:6155014T>G	ENST00000306177.5	+	3	460	c.302T>G	c.(301-303)cTt>cGt	p.L101R		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	101					cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		AAGATTTGTCTTAAGTGGCAA	0.443																																						dbGAP											0													116.0	110.0	112.0					7																	6155014		1878	4104	5982	-	-	-	SO:0001583	missense	0			AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.302T>G	7.37:g.6155014T>G	ENSP00000301962:p.Leu101Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.L101R	ENST00000306177.5	37	c.302	CCDS47535.1	7	.	.	.	.	.	.	.	.	.	.	T	31	5.087375	0.94100	.	.	ENSG00000106346	ENST00000306177	T	0.19394	2.15	5.95	5.95	0.96441	.	0.219434	0.32430	N	0.006117	T	0.48768	0.1518	M	0.75085	2.285	0.45946	D	0.998777	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.991	T	0.50634	-0.8805	10	0.87932	D	0	.	16.4237	0.83790	0.0:0.0:0.0:1.0	.	101;101	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	R	101	ENSP00000301962:L101R	ENSP00000301962:L101R	L	+	2	0	USP42	6121540	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.279000	0.76181	0.533000	0.62120	CTT	USP42	-	NULL	ENSG00000106346		0.443	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	USP42	HGNC	protein_coding	OTTHUMT00000324262.3	112	0.00	0	T	XM_166526		6155014	6155014	+1	no_errors	ENST00000306177	ensembl	human	known	69_37n	missense	177	21.33	48	SNP	1.000	G
USP49	25862	genome.wustl.edu	37	6	41773690	41773690	+	Silent	SNP	G	G	A			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr6:41773690G>A	ENST00000394253.3	-	3	1361	c.1032C>T	c.(1030-1032)ctC>ctT	p.L344L	USP49_ENST00000297229.2_Silent_p.L344L|USP49_ENST00000373006.1_Silent_p.L344L|USP49_ENST00000373009.3_Silent_p.L344L|USP49_ENST00000373010.1_Silent_p.L344L			Q70CQ1	UBP49_HUMAN	ubiquitin specific peptidase 49	344	USP.				histone H2B conserved C-terminal lysine deubiquitination (GO:0035616)|mRNA splicing, via spliceosome (GO:0000398)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)|skin(2)	23	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGTTCTGGATGAGCTCCAGAC	0.607																																						dbGAP											0													43.0	45.0	44.0					6																	41773690		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ586139	CCDS4861.1, CCDS69111.1	6p12.1	2008-02-05	2005-08-08		ENSG00000164663	ENSG00000164663		"""Ubiquitin-specific peptidases"""	20078	protein-coding gene	gene with protein product			"""ubiquitin specific protease 49"""			14715245	Standard	NM_018561		Approved	MGC20741	uc003ori.3	Q70CQ1	OTTHUMG00000014688	ENST00000394253.3:c.1032C>T	6.37:g.41773690G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3D9|Q5T3E0|Q96CK4	Silent	SNP	pfam_Peptidase_C19,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.L344	ENST00000394253.3	37	c.1032		6																																																																																			USP49	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000164663		0.607	USP49-007	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	USP49	HGNC	protein_coding	OTTHUMT00000316513.3	29	0.00	0	G	NM_018561		41773690	41773690	-1	no_errors	ENST00000373009	ensembl	human	known	69_37n	silent	33	17.50	7	SNP	1.000	A
ZHX3	23051	genome.wustl.edu	37	20	39832443	39832443	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14Q-01A-11D-A12B-09	TCGA-E2-A14Q-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ee51cf6d-351f-48f8-ab93-639c27c50e9f	323a490c-8dd7-4715-b083-f238c565b60d	g.chr20:39832443G>A	ENST00000309060.3	-	4	1529	c.1114C>T	c.(1114-1116)Cgg>Tgg	p.R372W	ZHX3_ENST00000544979.2_Missense_Mutation_p.R372W|ZHX3_ENST00000559234.1_Missense_Mutation_p.R372W|ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000560361.1_Missense_Mutation_p.R372W|ZHX3_ENST00000540170.1_Missense_Mutation_p.R372W|ZHX3_ENST00000432768.2_Missense_Mutation_p.R372W			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	372	Required for homodimerization and interaction with NFYA.|Required for repressor activity.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				ATCTTTTTCCGGGCATCCTCA	0.517																																						dbGAP											0													89.0	81.0	84.0					20																	39832443		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.1114C>T	20.37:g.39832443G>A	ENSP00000312222:p.Arg372Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain	p.R372W	ENST00000309060.3	37	c.1114	CCDS13315.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.88|15.88	2.964943|2.964943	0.53507|0.53507	.|.	.|.	ENSG00000174306|ENSG00000174306	ENST00000421422|ENST00000309060;ENST00000373263;ENST00000540170;ENST00000544979;ENST00000373262;ENST00000432768	.|T;T;T;T;T	.|0.58210	.|0.35;1.78;1.78;1.52;0.35	5.88|5.88	2.69|2.69	0.31865|0.31865	.|Homeodomain-related (1);Homeodomain-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.71451|0.71451	0.3341|0.3341	M|M	0.76170|0.76170	2.325|2.325	0.45172|0.45172	D|D	0.998187|0.998187	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	T|T	0.76785|0.76785	-0.2831|-0.2831	5|10	.|0.87932	.|D	.|0	-28.1689|-28.1689	15.7704|15.7704	0.78164|0.78164	0.0:0.0:0.4125:0.5875|0.0:0.0:0.4125:0.5875	.|.	.|372;372;372	.|A8K8Q0;Q9H4I2;F5H820	.|.;ZHX3_HUMAN;.	L|W	80|372;372;372;372;150;372	.|ENSP00000312222:R372W;ENSP00000362360:R372W;ENSP00000442290:R372W;ENSP00000443783:R372W;ENSP00000415498:R372W	.|ENSP00000312222:R372W	P|R	-|-	2|1	0|2	ZHX3|ZHX3	39265857|39265857	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.704000|1.704000	0.37857|0.37857	0.769000|0.769000	0.33313|0.33313	0.655000|0.655000	0.94253|0.94253	CCG|CGG	ZHX3	-	superfamily_Homeodomain-like	ENSG00000174306		0.517	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZHX3	HGNC	protein_coding	OTTHUMT00000079262.3	104	0.00	0	G	NM_015035		39832443	39832443	-1	no_errors	ENST00000373263	ensembl	human	known	69_37n	missense	130	24.86	43	SNP	1.000	A
