#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ASCL3	56676	genome.wustl.edu	37	11	8959451	8959451	+	Silent	SNP	G	G	A	rs201512605		TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr11:8959451G>A	ENST00000531618.1	-	1	307	c.258C>T	c.(256-258)tgC>tgT	p.C86C	ASCL3_ENST00000325884.1_Silent_p.C86C			Q9NQ33	ASCL3_HUMAN	achaete-scute family bHLH transcription factor 3	85					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(1)|large_intestine(2)|lung(5)|stomach(1)	9				Epithelial(150;1.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0228)		AGGAGTACTCGCACCCTCTGT	0.552													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19014	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													61.0	63.0	62.0					11																	8959451		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			AJ400877	CCDS7795.1	11p15.3	2013-10-17	2013-10-17			ENSG00000176009		"""Basic helix-loop-helix proteins"""	740	protein-coding gene	gene with protein product		609154	"""achaete-scute complex (Drosophila) homolog-like 3"", ""achaete-scute complex homolog 3 (Drosophila)"""			11528127	Standard	NM_020646		Approved	bHLHa42, HASH3, Sgn1	uc001mhd.1	Q9NQ33	OTTHUMG00000165679	ENST00000531618.1:c.258C>T	11.37:g.8959451G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WYQ6	Silent	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.C86	ENST00000531618.1	37	c.258	CCDS7795.1	11																																																																																			ASCL3	-	NULL	ENSG00000176009		0.552	ASCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASCL3	HGNC	protein_coding	OTTHUMT00000385773.1	144	0.00	0	G			8959451	8959451	-1	no_errors	ENST00000325884	ensembl	human	known	69_37n	silent	88	37.59	53	SNP	0.917	A
AHNAK	79026	genome.wustl.edu	37	11	62284554	62284554	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr11:62284554G>A	ENST00000378024.4	-	5	17609	c.17335C>T	c.(17335-17337)Cgc>Tgc	p.R5779C	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000525875.1_5'UTR|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5779					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GAATTTGAGCGGTGCCGTGGC	0.527																																						dbGAP											0													64.0	69.0	67.0					11																	62284554		2202	4299	6501	-	-	-	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.17335C>T	11.37:g.62284554G>A	ENSP00000367263:p.Arg5779Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R5779C	ENST00000378024.4	37	c.17335	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886150	0.51908	.	.	ENSG00000124942	ENST00000378024	T	0.05513	3.43	4.82	4.82	0.62117	.	.	.	.	.	T	0.17789	0.0427	L	0.54323	1.7	0.44995	D	0.998017	D	0.89917	1.0	D	0.79108	0.992	T	0.00179	-1.1950	9	0.56958	D	0.05	.	9.6858	0.40098	0.0:0.1514:0.6924:0.1562	.	5779	Q09666	AHNK_HUMAN	C	5779	ENSP00000367263:R5779C	ENSP00000367263:R5779C	R	-	1	0	AHNAK	62041130	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.794000	0.47853	2.241000	0.73720	0.549000	0.68633	CGC	AHNAK	-	NULL	ENSG00000124942		0.527	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	171	0.00	0	G	NM_024060		62284554	62284554	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	missense	111	29.75	47	SNP	1.000	A
HACL1	26061	genome.wustl.edu	37	3	15643051	15643051	+	5'UTR	SNP	C	C	A			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr3:15643051C>A	ENST00000321169.5	-	0	287				BTD_ENST00000449107.1_5'Flank|HACL1_ENST00000451445.2_5'UTR|BTD_ENST00000303498.5_5'Flank|HACL1_ENST00000435217.2_5'UTR|HACL1_ENST00000457447.2_5'UTR|HACL1_ENST00000456194.2_5'UTR|BTD_ENST00000437172.1_5'Flank|BTD_ENST00000383778.4_5'Flank	NM_012260.2	NP_036392.2	Q9UJ83	HACL1_HUMAN	2-hydroxyacyl-CoA lyase 1						cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carbon-carbon lyase activity (GO:0016830)|cofactor binding (GO:0048037)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|receptor binding (GO:0005102)|thiamine pyrophosphate binding (GO:0030976)			NS(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	16						AAATCGGCAGCACGCCACCTC	0.562																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AJ131753	CCDS2627.1, CCDS68360.1, CCDS68361.1, CCDS68362.1	3p24.3	2009-01-14	2006-05-16	2006-05-16	ENSG00000131373	ENSG00000131373	4.1.-.-		17856	protein-coding gene	gene with protein product		604300	"""2-hydroxyphytanoyl-CoA lyase"""	HPCL		10468558, 15644336	Standard	NM_001284416		Approved	2-HPCL, PHYH2	uc003caf.3	Q9UJ83	OTTHUMG00000129862	ENST00000321169.5:c.-81G>T	3.37:g.15643051C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWI1|B4DXI5|E9PEN4|Q9BV42|Q9P0A2	Missense_Mutation	SNP	NULL	p.A47E	ENST00000321169.5	37	c.140	CCDS2627.1	3																																																																																			BTD	-	NULL	ENSG00000169814		0.562	HACL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTD	HGNC	protein_coding	OTTHUMT00000252104.3	56	0.00	0	C	NM_012260		15643051	15643051	+1	no_errors	ENST00000417015	ensembl	human	known	69_37n	missense	36	23.40	11	SNP	0.000	A
CACNA1A	773	genome.wustl.edu	37	19	13356070	13356070	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr19:13356070G>A	ENST00000360228.5	-	31	4875	c.4876C>T	c.(4876-4878)Cgc>Tgc	p.R1626C	CACNA1A_ENST00000574822.1_5'UTR|CACNA1A_ENST00000573710.2_Missense_Mutation_p.R1627C	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1627					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CAGGCATCGCGGAAATAATTC	0.547																																						dbGAP											0													77.0	76.0	76.0					19																	13356070		1934	4135	6069	-	-	-	SO:0001583	missense	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.4876C>T	19.37:g.13356070G>A	ENSP00000353362:p.Arg1626Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.R1626C	ENST00000360228.5	37	c.4876	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	14.31	2.497632	0.44455	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084;ENST00000445042	D	0.98937	-5.25	4.67	3.6	0.41247	Ion transport (1);	0.262999	0.30949	N	0.008558	D	0.99230	0.9732	M	0.92367	3.3	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;D;D	0.85130	0.987;0.954;0.916;0.997	D	0.99312	1.0904	10	0.87932	D	0	.	12.8655	0.57937	0.0:0.0:0.8356:0.1644	.	1627;1630;1626;1627	O00555;E9PD31;Q9NS88;E7EVF2	CAC1A_HUMAN;.;.;.	C	1626;1630;1627;1627;243	ENSP00000353362:R1626C	ENSP00000317661:R1627C	R	-	1	0	CACNA1A	13217070	1.000000	0.71417	0.987000	0.45799	0.865000	0.49528	6.152000	0.71812	0.912000	0.36772	0.462000	0.41574	CGC	CACNA1A	-	pfam_Ion_trans_dom	ENSG00000141837		0.547	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2	108	0.00	0	G	NM_000068		13356070	13356070	-1	no_errors	ENST00000360228	ensembl	human	known	69_37n	missense	77	32.46	37	SNP	1.000	A
CCP110	9738	genome.wustl.edu	37	16	19548275	19548275	+	Silent	SNP	A	A	G			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr16:19548275A>G	ENST00000381396.5	+	4	1531	c.1284A>G	c.(1282-1284)ttA>ttG	p.L428L	CCP110_ENST00000396212.2_Silent_p.L428L|CCP110_ENST00000396208.2_Silent_p.L428L	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	428	Interaction with CEP76.				cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						TGCCAAAGTTACCAACTGATT	0.363																																						dbGAP											0													96.0	95.0	95.0					16																	19548275		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.1284A>G	16.37:g.19548275A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WP23|O43335|Q68DV9|Q8NE13	Silent	SNP	NULL	p.L428	ENST00000381396.5	37	c.1284	CCDS55992.1	16																																																																																			CCP110	-	NULL	ENSG00000103540		0.363	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCP110	HGNC	protein_coding	OTTHUMT00000254284.2	230	0.00	0	A	NM_014711		19548275	19548275	+1	no_errors	ENST00000381396	ensembl	human	known	69_37n	silent	148	34.22	77	SNP	0.023	G
CLEC18A	348174	genome.wustl.edu	37	16	69985383	69985383	+	Silent	SNP	G	G	A	rs4985466		TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr16:69985383G>A	ENST00000288040.6	+	1	301	c.114G>A	c.(112-114)ccG>ccA	p.P38P	CLEC18A_ENST00000393701.2_Silent_p.P38P|CLEC18A_ENST00000568461.1_Silent_p.P38P|CLEC18A_ENST00000449317.2_Silent_p.P38P	NM_001136214.2	NP_001129686.1	A5D8T8	CL18A_HUMAN	C-type lectin domain family 18, member A	38						extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(2)|lung(1)|skin(1)	5						AGCAGGCTCCGATGGCCGGAG	0.667																																						dbGAP											0													49.0	50.0	50.0					16																	69985383		1509	3170	4679	-	-	-	SO:0001819	synonymous_variant	0			AF428259	CCDS10886.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157322		"""C-type lectin domain containing"""	30388	protein-coding gene	gene with protein product	"""mannose receptor-like"""					12975309	Standard	NM_001136214		Approved	MRCL	uc010vlo.3	A5D8T8		ENST00000288040.6:c.114G>A	16.37:g.69985383G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1G9|Q6DCB3|Q7Z5K9|Q96HH2	Silent	SNP	pfam_CAP_domain,pfam_C-type_lectin,superfamily_CAP_domain,superfamily_C-type_lectin_fold,smart_Allrgn_V5/Tpx1,smart_EGF-like,smart_C-type_lectin,pfscan_EG-like_dom,pfscan_C-type_lectin,prints_Allrgn_V5/Tpx1	p.P38	ENST00000288040.6	37	c.114	CCDS10886.1	16																																																																																			CLEC18A	-	superfamily_CAP_domain	ENSG00000157322		0.667	CLEC18A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CLEC18A	HGNC	protein_coding	OTTHUMT00000268955.2	62	0.00	0	G	NM_182619		69985383	69985383	+1	no_errors	ENST00000449317	ensembl	human	known	69_37n	silent	29	12.12	4	SNP	0.000	A
CPT1B	1375	genome.wustl.edu	37	22	51009679	51009679	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr22:51009679T>C	ENST00000360719.2	-	15	1920	c.1783A>G	c.(1783-1785)Aga>Gga	p.R595G	CPT1B_ENST00000440709.1_Missense_Mutation_p.R514G|CPT1B_ENST00000457250.1_Missense_Mutation_p.R561G|CPT1B_ENST00000434492.2_Missense_Mutation_p.R390G|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000312108.7_Missense_Mutation_p.R595G|CPT1B_ENST00000395650.2_Missense_Mutation_p.R595G|CPT1B_ENST00000405237.3_Missense_Mutation_p.R595G	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	595					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		CGGAACATTCTGGTCATTGAG	0.577																																					Esophageal Squamous(170;988 1933 25577 30295 48163)	dbGAP											0													114.0	97.0	102.0					22																	51009679		2203	4300	6503	-	-	-	SO:0001583	missense	0			U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.1783A>G	22.37:g.51009679T>C	ENSP00000353945:p.Arg595Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.R595G	ENST00000360719.2	37	c.1783	CCDS14098.1	22	.	.	.	.	.	.	.	.	.	.	T	21.6	4.171015	0.78452	.	.	ENSG00000205560	ENST00000405237;ENST00000312108;ENST00000360719;ENST00000457250;ENST00000440709;ENST00000434492;ENST00000395650	D;D;D;D;D;D;D	0.93189	-3.18;-3.18;-3.18;-3.18;-3.18;-3.18;-3.18	5.82	3.62	0.41486	.	0.000000	0.85682	D	0.000000	D	0.97907	0.9312	H	0.98802	4.335	0.80722	D	1	D;D;D;D	0.76494	0.998;0.999;0.999;0.999	D;D;D;D	0.83275	0.975;0.996;0.982;0.973	D	0.97647	1.0152	10	0.87932	D	0	-15.7167	10.977	0.47472	0.0:0.0:0.493:0.507	.	514;561;390;595	E9PCP2;B7Z4U4;A2RRE8;Q92523	.;.;.;CPT1B_HUMAN	G	595;595;595;561;514;390;595	ENSP00000385486:R595G;ENSP00000312189:R595G;ENSP00000353945:R595G;ENSP00000409342:R561G;ENSP00000414713:R514G;ENSP00000410966:R390G;ENSP00000379011:R595G	ENSP00000312189:R595G	R	-	1	2	CPT1B	49356545	1.000000	0.71417	0.598000	0.28837	0.993000	0.82548	5.659000	0.68010	1.012000	0.39366	0.459000	0.35465	AGA	CPT1B	-	pfam_Carn_acyl_trans	ENSG00000205560		0.577	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT1B	HGNC	protein_coding	OTTHUMT00000317264.5	131	0.00	0	T	NM_152246		51009679	51009679	-1	no_errors	ENST00000312108	ensembl	human	known	69_37n	missense	67	44.63	54	SNP	0.984	C
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29976024	29976024	+	RNA	SNP	C	C	G	rs3765604	byFrequency	TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr6:29976024C>G	ENST00000376797.3	-	0	1053				ZNRD1-AS1_ENST00000420251.1_RNA|HLA-J_ENST00000462773.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		ATAACGAGGTCCTGGGTTCTG	0.592													G|||	959	0.191494	0.2988	0.1744	5008	,	,		14956	0.1905		0.0954	False		,,,				2504	0.1585					dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29976024C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			HLA-J	-	-	ENSG00000204622		0.592	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	HLA-J	HGNC	antisense	OTTHUMT00000253083.1	20	0.00	0	C	NR_026751		29976024	29976024	+1	no_errors	ENST00000462773	ensembl	human	known	69_37n	rna	24	17.24	5	SNP	0.997	G
GLTSCR1L	23506	genome.wustl.edu	37	6	42832565	42832565	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr6:42832565A>C	ENST00000314073.5	+	13	2797	c.2621A>C	c.(2620-2622)aAt>aCt	p.N874T	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.N874T			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	874																	GAACCCATGAATCATGACCAG	0.502																																						dbGAP											0													135.0	104.0	115.0					6																	42832565		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.2621A>C	6.37:g.42832565A>C	ENSP00000313933:p.Asn874Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	NULL	p.N874T	ENST00000314073.5	37	c.2621	CCDS34451.1	6	.	.	.	.	.	.	.	.	.	.	A	12.43	1.935419	0.34189	.	.	ENSG00000112624	ENST00000394167;ENST00000314073;ENST00000394168	T;T	0.48522	0.81;0.81	5.24	4.05	0.47172	.	0.232501	0.38381	N	0.001719	T	0.16041	0.0386	L	0.29908	0.895	0.33699	D	0.614344	B	0.06786	0.001	B	0.09377	0.004	T	0.04621	-1.0938	10	0.41790	T	0.15	-9.0298	7.0658	0.25151	0.7757:0.1497:0.0746:0.0	.	874	Q6AI39	K0240_HUMAN	T	874	ENSP00000313933:N874T;ENSP00000377723:N874T	ENSP00000313933:N874T	N	+	2	0	KIAA0240	42940543	1.000000	0.71417	0.866000	0.34008	0.657000	0.38888	2.814000	0.48010	0.885000	0.36088	0.533000	0.62120	AAT	KIAA0240	-	NULL	ENSG00000112624		0.502	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0240	HGNC	protein_coding	OTTHUMT00000040562.3	147	0.00	0	A	NM_015349		42832565	42832565	+1	no_errors	ENST00000314073	ensembl	human	known	69_37n	missense	116	31.36	53	SNP	0.975	C
LPHN2	23266	genome.wustl.edu	37	1	82409015	82409015	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr1:82409015T>C	ENST00000370728.1	+	8	1405	c.760T>C	c.(760-762)Tca>Cca	p.S254P	LPHN2_ENST00000359929.3_Missense_Mutation_p.S254P|LPHN2_ENST00000370730.1_Missense_Mutation_p.S254P|LPHN2_ENST00000370721.1_Missense_Mutation_p.S258P|LPHN2_ENST00000319517.6_Missense_Mutation_p.S254P|LPHN2_ENST00000370727.1_Missense_Mutation_p.S254P|LPHN2_ENST00000370717.2_Missense_Mutation_p.S254P|LPHN2_ENST00000394879.1_Missense_Mutation_p.S254P|LPHN2_ENST00000370713.1_Missense_Mutation_p.S254P|LPHN2_ENST00000271029.4_Missense_Mutation_p.S254P|LPHN2_ENST00000370725.1_Missense_Mutation_p.S254P|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000335786.5_Missense_Mutation_p.S254P|LPHN2_ENST00000370715.1_Missense_Mutation_p.S254P|LPHN2_ENST00000370723.1_Missense_Mutation_p.S254P			O95490	LPHN2_HUMAN	latrophilin 2	254	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		CCATGATACCTCACCATACAG	0.393																																						dbGAP											0													128.0	124.0	125.0					1																	82409015		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.760T>C	1.37:g.82409015T>C	ENSP00000359763:p.Ser254Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.S254P	ENST00000370728.1	37	c.760		1	.	.	.	.	.	.	.	.	.	.	T	17.87	3.496009	0.64186	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46;-2.46;-2.46;-2.46;-2.46;-2.46;-2.46;-2.46;-2.46;-2.46;-2.46	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000001	D	0.91379	0.7280	L	0.49256	1.55	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.92803	0.6258	10	0.87932	D	0	.	15.6396	0.76984	0.0:0.0:0.0:1.0	.	254;254;254	O95490-3;O95490-4;O95490-2	.;.;.	P	258;254;254;254;254;254;254;254;254;254;254;254;254;254	ENSP00000359756:S258P;ENSP00000359763:S254P;ENSP00000359765:S254P;ENSP00000359762:S254P;ENSP00000359760:S254P;ENSP00000359758:S254P;ENSP00000353006:S254P;ENSP00000359750:S254P;ENSP00000359748:S254P;ENSP00000322270:S254P;ENSP00000359752:S254P;ENSP00000378344:S254P;ENSP00000271029:S254P;ENSP00000337306:S254P	ENSP00000271029:S254P	S	+	1	0	LPHN2	82181603	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	7.698000	0.84413	2.095000	0.63458	0.374000	0.22700	TCA	LPHN2	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000117114		0.393	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	HGNC	protein_coding	OTTHUMT00000027188.1	210	0.00	0	T	NM_012302		82409015	82409015	+1	no_errors	ENST00000370717	ensembl	human	known	69_37n	missense	122	34.05	63	SNP	1.000	C
LRRC15	131578	genome.wustl.edu	37	3	194080956	194080956	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr3:194080956G>A	ENST00000347624.3	-	2	902	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	LRRC15_ENST00000428839.1_Missense_Mutation_p.R279C|LRRC15_ENST00000439944.2_Missense_Mutation_p.R279C	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	273					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)			biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		AGAGTAAGACGGTTGAGCTGG	0.562																																						dbGAP											0													128.0	136.0	133.0					3																	194080956		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.817C>T	3.37:g.194080956G>A	ENSP00000306276:p.Arg273Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495Q6|Q7RTN7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.R279C	ENST00000347624.3	37	c.835	CCDS3306.1	3	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004681	0.35320	.	.	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	T;T;T	0.09817	2.94;2.94;2.94	5.15	2.98	0.34508	.	0.222920	0.29021	N	0.013397	T	0.18341	0.0440	L	0.39020	1.185	0.38316	D	0.943382	D;D	0.69078	0.997;0.997	P;P	0.60886	0.88;0.648	T	0.04976	-1.0914	10	0.37606	T	0.19	.	12.8875	0.58053	0.0:0.0:0.5424:0.4576	.	273;279	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	C	273;279;279	ENSP00000306276:R273C;ENSP00000389128:R279C;ENSP00000413707:R279C	ENSP00000306276:R273C	R	-	1	0	LRRC15	195562251	1.000000	0.71417	0.943000	0.38184	0.731000	0.41821	1.300000	0.33436	1.244000	0.43870	0.655000	0.94253	CGT	LRRC15	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000172061		0.562	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC15	HGNC	protein_coding	OTTHUMT00000342858.2	524	0.00	0	G			194080956	194080956	-1	no_errors	ENST00000439944	ensembl	human	known	69_37n	missense	357	37.95	219	SNP	0.955	A
MAGEA3	4102	genome.wustl.edu	37	X	151936112	151936112	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chrX:151936112G>A	ENST00000393902.3	-	3	622	c.55C>T	c.(55-57)Cga>Tga	p.R19*	MAGEA3_ENST00000370278.3_Nonsense_Mutation_p.R19*			P43357	MAGA3_HUMAN	melanoma antigen family A, 3	19										endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	15	Acute lymphoblastic leukemia(192;6.56e-05)					GCCTCTCCTCGGGCCTCAAGG	0.627																																						dbGAP											0													1.0	1.0	1.0					X																	151936112		892	1947	2839	-	-	-	SO:0001587	stop_gained	0				CCDS76045.1	Xq28	2009-03-13			ENSG00000221867	ENSG00000221867			6801	protein-coding gene	gene with protein product	"""melanoma-associated antigen 3"", ""antigen MZ2-D"", ""MAGE-3 antigen"", ""cancer/testis antigen family 1, member 3"""	300174		MAGE3		1840703, 8575766	Standard	NM_005362		Approved	HYPD, HIP8, MGC14613, CT1.3	uc004fgp.3	P43357	OTTHUMG00000022640	ENST00000393902.3:c.55C>T	X.37:g.151936112G>A	ENSP00000377480:p.Arg19*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHI6	Nonsense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.R19*	ENST00000393902.3	37	c.55	CCDS14715.1	X	.	.	.	.	.	.	.	.	.	.	N	29.0	4.968934	0.92855	.	.	ENSG00000221867	ENST00000370278;ENST00000393902;ENST00000417212	.	.	.	1.26	0.117	0.14652	.	1.355490	0.04730	N	0.421050	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	4.6439	0.12563	0.0:0.4064:0.5936:0.0	.	.	.	.	X	19	.	ENSP00000359301:R19X	R	-	1	2	MAGEA3	151686768	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	0.499000	0.22546	-0.012000	0.14223	0.358000	0.22013	CGA	MAGEA3	-	pfam_Melanoma_ass_antigen_N	ENSG00000221867		0.627	MAGEA3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA3	HGNC	protein_coding	OTTHUMT00000058744.1	19	0.00	0	G	NM_005362		151936112	151936112	-1	no_errors	ENST00000370278	ensembl	human	known	69_37n	nonsense	10	28.57	4	SNP	0.001	A
MTRF1L	54516	genome.wustl.edu	37	6	153315705	153315705	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr6:153315705C>G	ENST00000367233.5	-	4	629	c.630G>C	c.(628-630)aaG>aaC	p.K210N	MTRF1L_ENST00000367230.1_Missense_Mutation_p.K174N|MTRF1L_ENST00000367231.5_Missense_Mutation_p.K210N|MTRF1L_ENST00000464135.1_5'UTR	NM_019041.5	NP_061914.3	Q9UGC7	RF1ML_HUMAN	mitochondrial translational release factor 1-like	210						mitochondrion (GO:0005739)	translation release factor activity, codon specific (GO:0016149)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	10		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.24e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0888)		CGCGGCCTTGCTTTTCTGTCT	0.498																																						dbGAP											0													176.0	152.0	160.0					6																	153315705		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC011873	CCDS5243.1, CCDS47502.1, CCDS75540.1	6q25-q26	2008-02-05			ENSG00000112031	ENSG00000112031			21051	protein-coding gene	gene with protein product		613542					Standard	NM_019041		Approved		uc003qpi.4	Q9UGC7	OTTHUMG00000015857	ENST00000367233.5:c.630G>C	6.37:g.153315705C>G	ENSP00000356202:p.Lys210Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTA0|Q3KR06|Q5TF44|Q5TF50|Q96CC5|Q96EX4|Q96K40	Missense_Mutation	SNP	pfam_Pep_chain_release_fac_I_II,pfam_PCRF,smart_PCRF	p.K210N	ENST00000367233.5	37	c.630	CCDS5243.1	6	.	.	.	.	.	.	.	.	.	.	C	17.86	3.491697	0.64074	.	.	ENSG00000112031	ENST00000367233;ENST00000367231;ENST00000367230;ENST00000414771;ENST00000448966	T;T;T;T;T	0.11063	2.81;2.81;2.81;2.81;2.81	4.97	4.1	0.47936	.	0.393049	0.31268	N	0.007953	T	0.08935	0.0221	L	0.41079	1.255	0.46317	D	0.998983	P;P;P;P	0.52577	0.843;0.953;0.943;0.954	B;P;P;P	0.53102	0.331;0.615;0.718;0.632	T	0.03335	-1.1047	10	0.72032	D	0.01	-6.5925	10.4991	0.44796	0.0:0.8275:0.0:0.1725	.	174;210;174;210	B4DMX1;Q9UGC7-2;Q9UGC7-4;Q9UGC7	.;.;.;RF1ML_HUMAN	N	210;210;174;61;74	ENSP00000356202:K210N;ENSP00000356200:K210N;ENSP00000356199:K174N;ENSP00000414383:K61N;ENSP00000415113:K74N	ENSP00000356199:K174N	K	-	3	2	MTRF1L	153357398	0.543000	0.26434	0.998000	0.56505	0.975000	0.68041	0.068000	0.14531	1.218000	0.43458	0.585000	0.79938	AAG	MTRF1L	-	NULL	ENSG00000112031		0.498	MTRF1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTRF1L	HGNC	protein_coding	OTTHUMT00000042764.1	393	0.50	2	C	NM_019041		153315705	153315705	-1	no_errors	ENST00000367233	ensembl	human	known	69_37n	missense	278	32.03	131	SNP	1.000	G
MUC16	94025	genome.wustl.edu	37	19	9069332	9069332	+	Silent	SNP	G	G	A			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr19:9069332G>A	ENST00000397910.4	-	3	18317	c.18114C>T	c.(18112-18114)caC>caT	p.H6038H		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6040	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTGGAGGTGTGTGTCCGGATG	0.443																																						dbGAP											0													172.0	178.0	176.0					19																	9069332		2014	4183	6197	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.18114C>T	19.37:g.9069332G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.H6038	ENST00000397910.4	37	c.18114	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.443	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	324	0.31	1	G	NM_024690		9069332	9069332	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	203	29.41	85	SNP	0.003	A
MYO7A	4647	genome.wustl.edu	37	11	76893500	76893500	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr11:76893500G>A	ENST00000409709.3	+	25	3412	c.3140G>A	c.(3139-3141)cGc>cAc	p.R1047H	MYO7A_ENST00000409893.1_Missense_Mutation_p.R1047H|MYO7A_ENST00000409619.2_Missense_Mutation_p.R1036H|MYO7A_ENST00000458637.2_Missense_Mutation_p.R1047H	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1047	MyTH4 1. {ECO:0000255|PROSITE- ProRule:PRU00359}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						ACCATCCTCCGCTTCATGGGG	0.582																																						dbGAP											0													43.0	49.0	47.0					11																	76893500		2058	4182	6240	-	-	-	SO:0001583	missense	0			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.3140G>A	11.37:g.76893500G>A	ENSP00000386331:p.Arg1047His	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.R1047H	ENST00000409709.3	37	c.3140	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	.	20.5	3.999492	0.74818	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419;ENST00000458169	D;D;D;D;D	0.93426	-3.14;-3.18;-3.12;-3.16;-3.22	5.47	5.47	0.80525	MyTH4 domain (2);	0.000000	0.85682	D	0.000000	D	0.96901	0.8988	M	0.80746	2.51	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.996;0.999	D	0.97253	0.9899	10	0.87932	D	0	.	19.3162	0.94215	0.0:0.0:1.0:0.0	.	1047;1036;1047;1047	B9A012;B9A011;F8VUN5;Q13402	.;.;.;MYO7A_HUMAN	H	1047;1047;1047;1036;258;1046;1046;923;1046;228	ENSP00000386331:R1047H;ENSP00000386689:R1047H;ENSP00000392185:R1047H;ENSP00000386635:R1036H;ENSP00000417017:R228H	ENSP00000345075:R923H	R	+	2	0	MYO7A	76571148	1.000000	0.71417	0.865000	0.33974	0.116000	0.19942	9.428000	0.97476	2.573000	0.86826	0.448000	0.29417	CGC	MYO7A	-	smart_MyTH4_dom,pfscan_MyTH4_dom	ENSG00000137474		0.582	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	59	0.00	0	G	NM_000260		76893500	76893500	+1	no_errors	ENST00000409709	ensembl	human	known	69_37n	missense	105	16.54	21	SNP	0.976	A
NAALADL2	254827	genome.wustl.edu	37	3	174974237	174974237	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr3:174974237A>T	ENST00000454872.1	+	4	985	c.857A>T	c.(856-858)gAt>gTt	p.D286V	NAALADL2-AS2_ENST00000424690.1_RNA|NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	286						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		ATGGCAGATGATTTAAAAAGG	0.363																																						dbGAP											0													90.0	84.0	86.0					3																	174974237		1825	4082	5907	-	-	-	SO:0001583	missense	0				CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.857A>T	3.37:g.174974237A>T	ENSP00000404705:p.Asp286Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	superfamily_TFR-like_dimer_dom	p.D286V	ENST00000454872.1	37	c.857	CCDS46960.1	3	.	.	.	.	.	.	.	.	.	.	A	15.58	2.876907	0.51801	.	.	ENSG00000177694	ENST00000454872;ENST00000316366	T	0.72942	-0.7	5.75	5.75	0.90469	.	0.000000	0.64402	D	0.000006	D	0.85716	0.5761	M	0.89214	3.015	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.88180	0.2870	10	0.87932	D	0	-25.4591	12.4921	0.55905	1.0:0.0:0.0:0.0	.	269;286	Q58DX5-2;Q58DX5	.;NADL2_HUMAN	V	286;93	ENSP00000404705:D286V	ENSP00000314951:D93V	D	+	2	0	NAALADL2	176456931	1.000000	0.71417	0.993000	0.49108	0.980000	0.70556	5.061000	0.64319	2.193000	0.70182	0.445000	0.29226	GAT	NAALADL2	-	NULL	ENSG00000177694		0.363	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALADL2	HGNC	protein_coding	OTTHUMT00000347390.2	175	0.00	0	A	NM_207015		174974237	174974237	+1	no_errors	ENST00000454872	ensembl	human	known	69_37n	missense	134	21.97	38	SNP	0.997	T
NMRK2	27231	genome.wustl.edu	37	19	3942216	3942216	+	Missense_Mutation	SNP	G	G	A	rs148078582	byFrequency	TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr19:3942216G>A	ENST00000168977.2	+	8	928	c.638G>A	c.(637-639)cGc>cAc	p.R213H	NMRK2_ENST00000599576.1_3'UTR|NMRK2_ENST00000593949.1_Missense_Mutation_p.R218H	NM_170678.2	NP_733778.1	Q9NPI5	NRK2_HUMAN	nicotinamide riboside kinase 2	213					NAD biosynthetic process (GO:0009435)|negative regulation of myoblast differentiation (GO:0045662)	intracellular (GO:0005622)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|ribosylnicotinamide kinase activity (GO:0050262)										GGACCCGGACGCGGATGCGGC	0.647																																						dbGAP											0													22.0	22.0	22.0					19																	3942216		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF190819	CCDS12115.1, CCDS74259.1	19p13.3	2013-10-28	2012-05-31	2012-05-31	ENSG00000077009	ENSG00000077009			17871	protein-coding gene	gene with protein product	"""muscle-specific beta 1 integrin binding protein"", ""nicotinamide riboside kinase 2"""	608705	"""integrin beta 1 binding protein 3"""	ITGB1BP3		10613898, 15137942	Standard	NM_170678		Approved	MIBP, NRK2	uc002lyz.4	Q9NPI5	OTTHUMG00000181758	ENST00000168977.2:c.638G>A	19.37:g.3942216G>A	ENSP00000168977:p.Arg213His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKR3|Q52M81|Q9NZK3	Missense_Mutation	SNP	NULL	p.R213H	ENST00000168977.2	37	c.638	CCDS12115.1	19	.	.	.	.	.	.	.	.	.	.	G	3.474	-0.107411	0.06924	.	.	ENSG00000077009	ENST00000168977;ENST00000395034	T	0.46451	0.87	1.64	-3.28	0.05033	.	.	.	.	.	T	0.17280	0.0415	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.14364	-1.0475	9	0.36615	T	0.2	.	2.9304	0.05797	0.4578:0.2417:0.3005:0.0	.	218;213	B7ZKR3;Q9NPI5	.;NRK2_HUMAN	H	213;169	ENSP00000168977:R213H	ENSP00000168977:R213H	R	+	2	0	ITGB1BP3	3893216	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.886000	0.04157	-0.609000	0.05724	-0.440000	0.05779	CGC	NMRK2	-	NULL	ENSG00000077009		0.647	NMRK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NMRK2	HGNC	protein_coding	OTTHUMT00000457492.1	14	0.00	0	G	NM_014446, NM_170678		3942216	3942216	+1	no_errors	ENST00000168977	ensembl	human	known	69_37n	missense	9	43.75	7	SNP	0.000	A
NPAS4	266743	genome.wustl.edu	37	11	66188712	66188712	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr11:66188712G>A	ENST00000311034.2	+	1	238	c.62G>A	c.(61-63)cGg>cAg	p.R21Q		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	21	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						GCCGAGATCCGGAACCTCAAG	0.672																																						dbGAP											0													49.0	41.0	43.0					11																	66188712		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.62G>A	11.37:g.66188712G>A	ENSP00000311196:p.Arg21Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	pfam_PAS_fold_3,smart_PAS,pfscan_PAS	p.R21Q	ENST00000311034.2	37	c.62	CCDS8138.1	11	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354143	0.82243	.	.	ENSG00000174576	ENST00000311034	T	0.42900	0.96	5.19	5.19	0.71726	Helix-loop-helix DNA-binding (1);	0.000000	0.49916	D	0.000137	T	0.21962	0.0529	N	0.04880	-0.145	0.80722	D	1	P	0.43287	0.802	B	0.34652	0.187	T	0.08973	-1.0696	10	0.33940	T	0.23	-14.6302	16.2538	0.82501	0.0:0.0:1.0:0.0	.	21	Q8IUM7	NPAS4_HUMAN	Q	21	ENSP00000311196:R21Q	ENSP00000311196:R21Q	R	+	2	0	NPAS4	65945288	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.851000	0.69481	2.691000	0.91804	0.563000	0.77884	CGG	NPAS4	-	NULL	ENSG00000174576		0.672	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS4	HGNC	protein_coding	OTTHUMT00000392634.1	27	0.00	0	G	NM_178864		66188712	66188712	+1	no_errors	ENST00000311034	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	1.000	A
NPSR1	387129	genome.wustl.edu	37	7	34873776	34873776	+	Intron	SNP	G	G	A	rs33911118	byFrequency	TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr7:34873776G>A	ENST00000360581.1	+	6	808				NPSR1_ENST00000531252.1_Intron|NPSR1_ENST00000381539.3_Intron|NPSR1_ENST00000359791.1_Intron|NPSR1_ENST00000381542.1_Intron	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	actttaccaggtcttagcctc	0.443													G|||	1695	0.338458	0.3911	0.3429	5008	,	,		20712	0.4296		0.2913	False		,,,				2504	0.2188					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.681-220G>A	7.37:g.34873776G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	RNA	SNP	-	NULL	ENST00000360581.1	37	NULL	CCDS5444.1	7																																																																																			NPSR1-AS1	-	-	ENSG00000197085		0.443	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPSR1-AS1	HGNC	protein_coding	OTTHUMT00000216837.1	14	0.00	0	G	NM_207173		34873776	34873776	-1	no_errors	ENST00000436945	ensembl	human	known	69_37n	rna	3	57.14	4	SNP	0.000	A
OR11H1	81061	genome.wustl.edu	37	22	16449768	16449769	+	Frame_Shift_Ins	INS	-	-	A			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr22:16449768_16449769insA	ENST00000252835.4	-	1	36_37	c.36_37insT	c.(34-39)atgaatfs	p.N13fs		NM_001005239.1	NP_001005239.1	Q8NG94	O11H1_HUMAN	olfactory receptor, family 11, subfamily H, member 1	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)	11	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)		TCAGAGACATTCATTAGGCCAG	0.371																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AP000535, AF399611	CCDS74807.1	22q11.1	2012-08-09			ENSG00000130538	ENSG00000130538		"""GPCR / Class A : Olfactory receptors"""	15404	protein-coding gene	gene with protein product						12213199	Standard	NM_001005239		Approved	OR22-1	uc011agd.2	Q8NG94	OTTHUMG00000030069	ENST00000252835.4:c.36_37insT	22.37:g.16449768_16449769insA	ENSP00000252835:p.Asn13fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEX0|Q96R32	Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.N12fs	ENST00000252835.4	37	c.37_36	CCDS33594.1	22																																																																																			OR11H1	-	NULL	ENSG00000130538		0.371	OR11H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H1	HGNC	protein_coding	OTTHUMT00000074923.2	107	0.00	0	-	NM_001005239		16449768	16449769	-1	no_errors	ENST00000252835	ensembl	human	known	69_37n	frame_shift_ins	112	18.84	26	INS	0.999:1.000	A
PCDH11X	27328	genome.wustl.edu	37	X	91133194	91133194	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chrX:91133194C>A	ENST00000373094.1	+	2	2800	c.1955C>A	c.(1954-1956)tCa>tAa	p.S652*	PCDH11X_ENST00000395337.2_Nonsense_Mutation_p.S652*|PCDH11X_ENST00000504220.2_Nonsense_Mutation_p.S652*|PCDH11X_ENST00000406881.1_Nonsense_Mutation_p.S652*|PCDH11X_ENST00000373088.1_Nonsense_Mutation_p.S652*|PCDH11X_ENST00000361724.1_Nonsense_Mutation_p.S652*|PCDH11X_ENST00000298274.8_Nonsense_Mutation_p.S652*|PCDH11X_ENST00000361655.2_Nonsense_Mutation_p.S652*|PCDH11X_ENST00000373097.1_Nonsense_Mutation_p.S652*	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	652	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GGTAGAGTATCACGTTCTTCA	0.373																																					NSCLC(38;925 1092 2571 38200 45895)	dbGAP											0													59.0	52.0	55.0					X																	91133194		2202	4281	6483	-	-	-	SO:0001587	stop_gained	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.1955C>A	X.37:g.91133194C>A	ENSP00000362186:p.Ser652*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S652*	ENST00000373094.1	37	c.1955	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	C	31	5.069481	0.93950	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	.	.	.	5.35	4.43	0.53597	.	0.276324	0.36167	N	0.002746	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	10.1408	0.42734	0.3843:0.6157:0.0:0.0	.	.	.	.	X	652	.	ENSP00000298274:S652X	S	+	2	0	PCDH11X	91019850	0.991000	0.36638	0.971000	0.41717	0.981000	0.71138	2.888000	0.48594	2.212000	0.71576	0.415000	0.27848	TCA	PCDH11X	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000102290		0.373	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	117	0.00	0	C	NM_032969		91133194	91133194	+1	no_errors	ENST00000373094	ensembl	human	known	69_37n	nonsense	71	39.32	46	SNP	0.951	A
PDE3A	5139	genome.wustl.edu	37	12	20522503	20522503	+	Silent	SNP	G	G	A			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr12:20522503G>A	ENST00000359062.3	+	1	325	c.285G>A	c.(283-285)gcG>gcA	p.A95A	RP11-284H19.1_ENST00000535755.1_RNA	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	95	Poly-Ala.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	GTAAGGAGGCGGCGGCGGCGG	0.746																																						dbGAP											0													4.0	4.0	4.0					12																	20522503		2054	4075	6129	-	-	-	SO:0001819	synonymous_variant	0				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.285G>A	12.37:g.20522503G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60865|Q13348|Q17RD1	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.A95	ENST00000359062.3	37	c.285	CCDS31754.1	12																																																																																			PDE3A	-	NULL	ENSG00000172572		0.746	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE3A	HGNC	protein_coding	OTTHUMT00000401756.2	12	0.00	0	G			20522503	20522503	+1	no_errors	ENST00000359062	ensembl	human	known	69_37n	silent	9	30.77	4	SNP	1.000	A
PIK3R1	5295	genome.wustl.edu	37	5	67589601	67589602	+	In_Frame_Ins	INS	-	-	GTT			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr5:67589601_67589602insGTT	ENST00000521381.1	+	11	1980_1981	c.1364_1365insGTT	c.(1363-1368)cagttt>caGTTgttt	p.455_456QF>QLF	PIK3R1_ENST00000336483.5_In_Frame_Ins_p.185_186QF>QLF|PIK3R1_ENST00000396611.1_In_Frame_Ins_p.455_456QF>QLF|PIK3R1_ENST00000320694.8_In_Frame_Ins_p.155_156QF>QLF|PIK3R1_ENST00000523872.1_In_Frame_Ins_p.92_93QF>QLF|PIK3R1_ENST00000274335.5_In_Frame_Ins_p.455_456QF>QLF|PIK3R1_ENST00000521657.1_In_Frame_Ins_p.455_456QF>QLF	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	455					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.F456_R461del(1)|p.T454_D464del(1)|p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	TATAACACTCAGTTTCAAGAAA	0.287			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																												dbGAP		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	4	Deletion - In frame(2)|Whole gene deletion(1)|Unknown(1)	endometrium(2)|large_intestine(1)|lung(1)																																								-	-	-	SO:0001652	inframe_insertion	0			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1365_1367dupGTT	5.37:g.67589602_67589604dupGTT	ENSP00000428056:p.Gln455_Phe456insLeu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	In_Frame_Ins	INS	pfam_SH2,pfam_RhoGAP_dom,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Guanylate-bd_C,smart_SH3_domain,smart_RhoGAP_dom,smart_SH2,pfscan_SH2,pfscan_SH3_domain,pfscan_RhoGAP_dom,prints_PI3kinase_P85,prints_SH2	p.456in_frame_insL	ENST00000521381.1	37	c.1364_1365	CCDS3993.1	5																																																																																			PIK3R1	-	superfamily_Guanylate-bd_C	ENSG00000145675		0.287	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R1	HGNC	protein_coding	OTTHUMT00000254013.2	136	0.00	0	-	NM_181504		67589601	67589602	+1	no_errors	ENST00000396611	ensembl	human	known	69_37n	in_frame_ins	107	38.51	67	INS	1.000:1.000	GTT
PLEKHA1	59338	genome.wustl.edu	37	10	124177438	124177438	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr10:124177438A>G	ENST00000368990.3	+	8	766	c.635A>G	c.(634-636)tAt>tGt	p.Y212C	MIR3941_ENST00000582572.1_RNA|PLEKHA1_ENST00000368988.1_Missense_Mutation_p.Y212C|PLEKHA1_ENST00000538022.1_Missense_Mutation_p.Y212C|PLEKHA1_ENST00000433307.1_Missense_Mutation_p.Y212C|PLEKHA1_ENST00000368989.2_Missense_Mutation_p.Y212C	NM_001001974.2	NP_001001974.1	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1	212	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				androgen metabolic process (GO:0008209)|B cell receptor signaling pathway (GO:0050853)|cellular response to hydrogen peroxide (GO:0070301)|establishment of protein localization (GO:0045184)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|multicellular organism growth (GO:0035264)|negative regulation of protein kinase B signaling (GO:0051898)|palate development (GO:0060021)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|ruffle organization (GO:0031529)|skeletal system morphogenesis (GO:0048705)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	13		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				AAGAGAAGATATTTTCAATTG	0.328																																						dbGAP											0													92.0	87.0	89.0					10																	124177438		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF286160	CCDS7629.1, CCDS55730.1	10q26.3	2013-01-10	2002-01-14		ENSG00000107679	ENSG00000107679		"""Pleckstrin homology (PH) domain containing"""	14335	protein-coding gene	gene with protein product	"""tandem PH domain containing protein-1"""	607772	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 1"""			11001876, 15485858	Standard	NM_001001974		Approved	TAPP1	uc001lge.2	Q9HB21	OTTHUMG00000019184	ENST00000368990.3:c.635A>G	10.37:g.124177438A>G	ENSP00000357986:p.Tyr212Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ55|D3DRE2|Q9BVK0	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Y212C	ENST00000368990.3	37	c.635	CCDS7629.1	10	.	.	.	.	.	.	.	.	.	.	A	23.5	4.423841	0.83667	.	.	ENSG00000107679	ENST00000368990;ENST00000368989;ENST00000409427;ENST00000368988;ENST00000538022;ENST00000433307	T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41	5.77	5.77	0.91146	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.54919	0.1888	H	0.94658	3.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.68812	-0.5310	10	0.87932	D	0	-20.3047	16.1043	0.81209	1.0:0.0:0.0:0.0	.	212;212	B3KQ55;Q9HB21	.;PKHA1_HUMAN	C	212	ENSP00000357986:Y212C;ENSP00000357985:Y212C;ENSP00000357984:Y212C;ENSP00000438608:Y212C;ENSP00000394416:Y212C	ENSP00000357984:Y212C	Y	+	2	0	PLEKHA1	124167428	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.801000	0.91905	2.201000	0.70794	0.528000	0.53228	TAT	PLEKHA1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000107679		0.328	PLEKHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA1	HGNC	protein_coding	OTTHUMT00000050783.1	166	0.00	0	A	NM_001001974		124177438	124177438	+1	no_errors	ENST00000368990	ensembl	human	known	69_37n	missense	44	47.62	40	SNP	1.000	G
PLOD3	8985	genome.wustl.edu	37	7	100854922	100854922	+	Silent	SNP	C	C	T			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr7:100854922C>T	ENST00000223127.3	-	12	1706	c.1308G>A	c.(1306-1308)gaG>gaA	p.E436E		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	436					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	GGGCGTAGTACTCATCGGGGC	0.701																																						dbGAP											0													29.0	27.0	28.0					7																	100854922		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.1308G>A	7.37:g.100854922C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6W6|Q540C3	Missense_Mutation	SNP	NULL	p.S49N	ENST00000223127.3	37	c.146	CCDS5715.1	7	.	.	.	.	.	.	.	.	.	.	C	1.998	-0.430022	0.04701	.	.	ENSG00000106397	ENST00000454310;ENST00000421736	.	.	.	4.3	4.3	0.51218	.	.	.	.	.	T	0.60983	0.2311	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59369	-0.7467	4	.	.	.	-10.7673	10.3798	0.44104	0.0:0.8002:0.1998:0.0	.	.	.	.	N	11;227	.	.	S	-	2	0	PLOD3	100641642	0.874000	0.30092	0.998000	0.56505	0.124000	0.20399	-0.005000	0.12855	1.965000	0.57142	0.462000	0.41574	AGT	PLOD3	-	NULL	ENSG00000106397		0.701	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLOD3	HGNC	protein_coding	OTTHUMT00000347470.1	19	0.00	0	C			100854922	100854922	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000440925	ensembl	human	known	69_37n	missense	15	37.50	9	SNP	1.000	T
RAD18	56852	genome.wustl.edu	37	3	8983486	8983486	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr3:8983486T>A	ENST00000264926.2	-	5	385	c.269A>T	c.(268-270)aAt>aTt	p.N90I	RAD18_ENST00000495087.1_5'UTR	NM_020165.3	NP_064550.3	Q9NS91	RAD18_HUMAN	RAD18 E3 ubiquitin protein ligase	90					DNA repair (GO:0006281)|negative regulation of DNA recombination (GO:0045910)|protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|spermatogenesis (GO:0007283)	chromatin (GO:0000785)|nucleus (GO:0005634)|replication fork (GO:0005657)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|ligase activity (GO:0016874)|polyubiquitin binding (GO:0031593)|ubiquitin protein ligase binding (GO:0031625)|Y-form DNA binding (GO:0000403)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(3)	15				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		CAGCAGATGATTCCTTGAAGC	0.378								Rad6 pathway																														dbGAP											0													73.0	75.0	74.0					3																	8983486		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2571.1	3p25-p24	2014-08-04	2014-08-04		ENSG00000070950	ENSG00000070950		"""RING-type (C3HC4) zinc fingers"""	18278	protein-coding gene	gene with protein product		605256	"""RAD18 homolog (S. cerevisiae)"""			10884424, 10908344	Standard	NM_020165		Approved	RNF73	uc003brd.3	Q9NS91	OTTHUMG00000090545	ENST00000264926.2:c.269A>T	3.37:g.8983486T>A	ENSP00000264926:p.Asn90Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q58F55|Q9NRT6	Missense_Mutation	SNP	pfam_SAP_DNA-bd,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_Rad18_put,smart_SAP_DNA-bd,pfscan_Znf_RING,pfscan_SAP_DNA-bd	p.N90I	ENST00000264926.2	37	c.269	CCDS2571.1	3	.	.	.	.	.	.	.	.	.	.	T	9.554	1.116700	0.20795	.	.	ENSG00000070950	ENST00000264926;ENST00000413832	T;T	0.31510	1.85;1.49	5.39	1.58	0.23477	.	0.635526	0.17196	N	0.183323	T	0.24275	0.0588	L	0.57536	1.79	0.26632	N	0.972451	B	0.30763	0.294	B	0.26614	0.071	T	0.16897	-1.0387	10	0.49607	T	0.09	-2.2384	4.4829	0.11776	0.0:0.1818:0.1756:0.6426	.	90	Q9NS91	RAD18_HUMAN	I	90	ENSP00000264926:N90I;ENSP00000412261:N90I	ENSP00000264926:N90I	N	-	2	0	RAD18	8958486	1.000000	0.71417	0.989000	0.46669	0.183000	0.23260	0.541000	0.23207	0.027000	0.15297	0.533000	0.62120	AAT	RAD18	-	NULL	ENSG00000070950		0.378	RAD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD18	HGNC	protein_coding	OTTHUMT00000207071.2	199	0.00	0	T	NM_020165		8983486	8983486	-1	no_errors	ENST00000264926	ensembl	human	known	69_37n	missense	140	35.78	78	SNP	1.000	A
RASSF2	9770	genome.wustl.edu	37	20	4771137	4771137	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr20:4771137C>T	ENST00000379400.3	-	7	692	c.497G>A	c.(496-498)cGc>cAc	p.R166H	RASSF2_ENST00000379376.2_Missense_Mutation_p.R166H|RASSF2_ENST00000478553.1_5'UTR	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2	166				R -> C (in Ref. 4; BAD96370). {ECO:0000305}.	bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						GAAGCGGTGGCGTCTGATTCG	0.602																																					Melanoma(158;1891 3343 50738)	dbGAP											0													132.0	98.0	109.0					20																	4771137		2203	4300	6503	-	-	-	SO:0001583	missense	0			D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.497G>A	20.37:g.4771137C>T	ENSP00000368710:p.Arg166His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	Missense_Mutation	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH	p.R166H	ENST00000379400.3	37	c.497	CCDS13083.1	20	.	.	.	.	.	.	.	.	.	.	C	35	5.466315	0.96257	.	.	ENSG00000101265	ENST00000379400;ENST00000379376	T;T	0.11277	2.79;2.79	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.37019	0.0988	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.70716	0.97	T	0.21211	-1.0252	10	0.72032	D	0.01	.	17.2582	0.87063	0.0:1.0:0.0:0.0	.	166	P50749	RASF2_HUMAN	H	166	ENSP00000368710:R166H;ENSP00000368684:R166H	ENSP00000368684:R166H	R	-	2	0	RASSF2	4719137	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.452000	0.80683	2.650000	0.89964	0.563000	0.77884	CGC	RASSF2	-	NULL	ENSG00000101265		0.602	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF2	HGNC	protein_coding	OTTHUMT00000077828.1	115	0.00	0	C	NM_014737		4771137	4771137	-1	no_errors	ENST00000379376	ensembl	human	known	69_37n	missense	74	37.50	45	SNP	1.000	T
SLC9A7P1	121456	genome.wustl.edu	37	12	98850195	98850195	+	RNA	SNP	C	C	T	rs829864	byFrequency	TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr12:98850195C>T	ENST00000554295.1	-	0	728					NR_033801.1				solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 pseudogene 1																		TCTCATAATCCTCATGAGCTT	0.423													T|||	2968	0.592652	0.9062	0.379	5008	,	,		21201	0.4425		0.5586	False		,,,				2504	0.5102					dbGAP											0																																										-	-	-			0					12q23.1	2013-05-22	2012-03-22		ENSG00000227825	ENSG00000227825		"""Solute carriers"""	32679	pseudogene	pseudogene			"""solute carrier family 9 (sodium/hydrogen exchanger), member 7 pseudogene 1"""				Standard	NR_033801		Approved		uc009ztm.2		OTTHUMG00000170629		12.37:g.98850195C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000554295.1	37	NULL		12																																																																																			SLC9A7P1	-	-	ENSG00000227825		0.423	SLC9A7P1-002	PUTATIVE	basic	processed_transcript	SLC9A7P1	HGNC	pseudogene	OTTHUMT00000409869.1	177	0.00	0	C			98850195	98850195	-1	no_errors	ENST00000554295	ensembl	human	putative	69_37n	rna	205	10.87	25	SNP	0.998	T
SNRK	54861	genome.wustl.edu	37	3	43389153	43389153	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr3:43389153C>T	ENST00000296088.7	+	7	1706	c.1402C>T	c.(1402-1404)Cgc>Tgc	p.R468C	SNRK_ENST00000437827.1_Missense_Mutation_p.R262C|SNRK-AS1_ENST00000422681.1_RNA|SNRK_ENST00000429705.2_Missense_Mutation_p.R468C|RP11-188P20.3_ENST00000607513.1_RNA|SNRK_ENST00000454177.1_Missense_Mutation_p.R468C	NM_017719.4	NP_060189.3			SNF related kinase									p.R468C(2)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		AGTGGTTTTGCGCCGGAAGCC	0.527																																						dbGAP											2	Substitution - Missense(2)	ovary(2)											132.0	146.0	141.0					3																	43389153		2089	4195	6284	-	-	-	SO:0001583	missense	0			D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.1402C>T	3.37:g.43389153C>T	ENSP00000296088:p.Arg468Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.R468C	ENST00000296088.7	37	c.1402	CCDS43075.1	3	.	.	.	.	.	.	.	.	.	.	C	19.32	3.804579	0.70682	.	.	ENSG00000163788	ENST00000454177;ENST00000429705;ENST00000296088;ENST00000437827	T;T;T;T	0.70749	-0.51;-0.51;-0.51;2.14	4.84	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.79335	0.4428	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.64410	0.925	T	0.81178	-0.1051	10	0.72032	D	0.01	.	13.2194	0.59879	0.0:0.9221:0.0:0.0779	.	468	Q9NRH2	SNRK_HUMAN	C	468;468;468;262	ENSP00000401246:R468C;ENSP00000411375:R468C;ENSP00000296088:R468C;ENSP00000409516:R262C	ENSP00000296088:R468C	R	+	1	0	SNRK	43364157	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	5.966000	0.70395	1.179000	0.42884	0.563000	0.77884	CGC	SNRK	-	NULL	ENSG00000163788		0.527	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNRK	HGNC	protein_coding	OTTHUMT00000344325.1	248	0.00	0	C	NM_017719		43389153	43389153	+1	no_errors	ENST00000296088	ensembl	human	known	69_37n	missense	168	37.08	99	SNP	1.000	T
ST3GAL5	8869	genome.wustl.edu	37	2	86073664	86073664	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr2:86073664C>T	ENST00000377332.3	-	5	793	c.685G>A	c.(685-687)Gga>Aga	p.G229R	ST3GAL5_ENST00000393808.3_Missense_Mutation_p.G206R|ST3GAL5_ENST00000393805.1_Missense_Mutation_p.G201R	NM_003896.3	NP_003887.3	Q9UNP4	SIAT9_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 5	229					carbohydrate metabolic process (GO:0005975)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	lactosylceramide alpha-2,3-sialyltransferase activity (GO:0047291)|neolactotetraosylceramide alpha-2,3-sialyltransferase activity (GO:0004513)|sialyltransferase activity (GO:0008373)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15						TCTGAATATCCCTCAACTGGT	0.393																																						dbGAP											0													119.0	115.0	116.0					2																	86073664		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB018356	CCDS1986.2, CCDS42705.1	2p11.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000115525	ENSG00000115525	2.4.99.9	"""Sialyltransferases"""	10872	protein-coding gene	gene with protein product		604402	"""sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase; GM3 synthase)"""	SIAT9		9822625	Standard	NM_003896		Approved	ST3GalV, SIATGM3S	uc002sqq.1	Q9UNP4	OTTHUMG00000130171	ENST00000377332.3:c.685G>A	2.37:g.86073664C>T	ENSP00000366549:p.Gly229Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KM82|D6W5L9|O94902|Q53QU1|Q6NZX4|Q6YFL1	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.G229R	ENST00000377332.3	37	c.685	CCDS1986.2	2	.	.	.	.	.	.	.	.	.	.	C	25.5	4.648987	0.87958	.	.	ENSG00000115525	ENST00000393808;ENST00000393805;ENST00000377332	T;T;T	0.37411	1.2;1.2;1.2	5.65	5.65	0.86999	.	0.101759	0.64402	D	0.000002	T	0.65354	0.2683	M	0.86953	2.85	0.80722	D	1	D;D;D	0.69078	0.996;0.997;0.996	P;D;P	0.63488	0.862;0.915;0.862	T	0.71293	-0.4636	10	0.87932	D	0	-21.2477	18.7095	0.91651	0.0:1.0:0.0:0.0	.	201;229;206	Q9UNP4-2;Q9UNP4;Q9UNP4-3	.;SIAT9_HUMAN;.	R	206;201;229	ENSP00000377397:G206R;ENSP00000377394:G201R;ENSP00000366549:G229R	ENSP00000366549:G229R	G	-	1	0	ST3GAL5	85927175	0.991000	0.36638	0.613000	0.29037	0.990000	0.78478	2.278000	0.43426	2.666000	0.90696	0.555000	0.69702	GGA	ST3GAL5	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000115525		0.393	ST3GAL5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ST3GAL5	HGNC	protein_coding	OTTHUMT00000252486.1	227	0.00	0	C	NM_003896		86073664	86073664	-1	no_errors	ENST00000377332	ensembl	human	known	69_37n	missense	166	25.89	58	SNP	0.998	T
TAS2R43	259289	genome.wustl.edu	37	12	11244166	11244166	+	Silent	SNP	G	G	C	rs35720106	byFrequency	TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr12:11244166G>C	ENST00000531678.1	-	1	746	c.663C>G	c.(661-663)acC>acG	p.T221T	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	221					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.T221T(1)		endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TGTGGACCTTGGTGCTGGGAT	0.398													.|||	3199	0.638778	0.1218	0.7205	5008	,	,		13366	0.9405		0.7793	False		,,,				2504	0.8241					dbGAP											1	Substitution - coding silent(1)	prostate(1)											130.0	112.0	118.0					12																	11244166		2176	4249	6425	-	-	-	SO:0001819	synonymous_variant	0			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.663C>G	12.37:g.11244166G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	P59546|Q645X4	Silent	SNP	pfam_TAS2_rcpt	p.T221	ENST00000531678.1	37	c.663	CCDS53749.1	12																																																																																			TAS2R43	-	pfam_TAS2_rcpt	ENSG00000255374		0.398	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	HGNC	protein_coding	OTTHUMT00000383561.1	55	0.00	0	G	NM_176884		11244166	11244166	-1	no_errors	ENST00000531678	ensembl	human	known	69_37n	silent	63	30.77	28	SNP	0.185	C
TAS2R43	259289	genome.wustl.edu	37	12	11244194	11244194	+	Missense_Mutation	SNP	T	T	C	rs71443637	byFrequency	TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr12:11244194T>C	ENST00000531678.1	-	1	718	c.635A>G	c.(634-636)cAt>cGt	p.H212R	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	212				H -> R (in Ref. 1; AAM19328, 3; AAU21145 and 5; AAI17424). {ECO:0000305}.	detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TCCTTTACCATGGAGCTGCAT	0.408													.|||	3114	0.621805	0.0998	0.7104	5008	,	,		13446	0.9425		0.7525	False		,,,				2504	0.7996					dbGAP											0													123.0	99.0	107.0					12																	11244194		2155	4165	6320	-	-	-	SO:0001583	missense	0			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.635A>G	12.37:g.11244194T>C	ENSP00000431719:p.His212Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	P59546|Q645X4	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.H212R	ENST00000531678.1	37	c.635	CCDS53749.1	12	949	0.43452380952380953	28	0.056910569105691054	163	0.45027624309392267	439	0.7674825174825175	319	0.420844327176781	-	2.129	-0.399500	0.04865	.	.	ENSG00000255374	ENST00000531678	T	0.00737	5.76	1.45	-1.32	0.09201	.	.	.	.	.	T	0.00012	0.0000	M	0.86178	2.8	0.80722	P	0.0	.	.	.	.	.	.	T	0.07028	-1.0794	6	0.52906	T	0.07	.	4.3248	0.11034	0.0:0.4339:0.0:0.5661	.	.	.	.	R	212	ENSP00000431719:H212R	ENSP00000431719:H212R	H	-	2	0	TAS2R43	11135461	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.381000	0.07417	-0.374000	0.07967	-1.273000	0.01405	CAT	TAS2R43	-	pfam_TAS2_rcpt	ENSG00000255374		0.408	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	HGNC	protein_coding	OTTHUMT00000383561.1	56	0.00	0	T	NM_176884		11244194	11244194	-1	no_errors	ENST00000531678	ensembl	human	known	69_37n	missense	61	33.70	31	SNP	0.000	C
U2AF1L4	199746	genome.wustl.edu	37	19	36235431	36235431	+	Silent	SNP	A	A	G	rs3761087	byFrequency	TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr19:36235431A>G	ENST00000412391.2	-	4	223	c.210T>C	c.(208-210)agT>agC	p.S70S	PSENEN_ENST00000222266.2_5'Flank|AC002398.11_ENST00000591091.1_RNA|IGFLR1_ENST00000588992.1_5'Flank|IGFLR1_ENST00000246532.1_5'Flank|PSENEN_ENST00000587708.2_5'Flank|PSENEN_ENST00000591949.1_5'Flank|AC002398.11_ENST00000585365.1_RNA|U2AF1L4_ENST00000588100.1_5'Flank|IGFLR1_ENST00000592537.1_5'Flank|U2AF1L4_ENST00000292879.5_Intron|U2AF1L4_ENST00000378975.3_Intron|AD000671.6_ENST00000589807.1_Intron|AC002398.9_ENST00000591613.2_5'Flank|IGFLR1_ENST00000344990.3_5'Flank			Q8WU68	U2AF4_HUMAN	U2 small nuclear RNA auxiliary factor 1-like 4	70	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCTCCACGTCACTCACATGAC	0.602													G|||	718	0.143371	0.0915	0.1671	5008	,	,		17554	0.0962		0.1571	False		,,,				2504	0.2311					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BC021186, AY569437	CCDS12473.1, CCDS42551.1	19q13.13	2013-02-12	2006-04-12	2006-04-12		ENSG00000161265		"""RNA binding motif (RRM) containing"""	23020	protein-coding gene	gene with protein product		601080	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 3"", ""U2 small nuclear RNA auxiliary factor 1-like 3"""	U2AF1L3		8586425, 11739736	Standard	NM_001040425		Approved	MGC33901, U2af26	uc002obf.3	Q8WU68		ENST00000412391.2:c.210T>C	19.37:g.36235431A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKI8|Q56UU3	Silent	SNP	pfam_Znf_CCCH,pfam_RRM_dom,smart_Znf_CCCH,smart_RRM_dom_euk,pfscan_RRM_dom,prints_U2_small	p.S70	ENST00000412391.2	37	c.210		19																																																																																			U2AF1L4	-	smart_RRM_dom_euk,pfscan_RRM_dom	ENSG00000161265		0.602	U2AF1L4-201	KNOWN	basic|appris_principal	protein_coding	U2AF1L4	HGNC	protein_coding		28	0.00	0	A	NM_144987		36235431	36235431	-1	no_errors	ENST00000412391	ensembl	human	known	69_37n	silent	17	19.05	4	SNP	0.999	G
USP29	57663	genome.wustl.edu	37	19	57640371	57640371	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr19:57640371C>T	ENST00000254181.4	+	4	782	c.328C>T	c.(328-330)Ccc>Tcc	p.P110S	USP29_ENST00000598197.1_Missense_Mutation_p.P110S	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	110					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATCTCAGCAACCCATGAAATC	0.348																																						dbGAP											0													54.0	52.0	52.0					19																	57640371		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.328C>T	19.37:g.57640371C>T	ENSP00000254181:p.Pro110Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.P110S	ENST00000254181.4	37	c.328	CCDS33124.1	19	.	.	.	.	.	.	.	.	.	.	C	3.656	-0.070497	0.07228	.	.	ENSG00000131864	ENST00000254181	T	0.47528	0.84	2.79	-3.77	0.04346	.	0.514631	0.14677	N	0.304955	T	0.22551	0.0544	L	0.32530	0.975	0.09310	N	1	P	0.36027	0.533	B	0.27076	0.076	T	0.17899	-1.0354	10	0.21540	T	0.41	-0.1897	3.537	0.07798	0.1869:0.3153:0.0:0.4978	.	110	Q9HBJ7	UBP29_HUMAN	S	110	ENSP00000254181:P110S	ENSP00000254181:P110S	P	+	1	0	USP29	62332183	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.044000	0.12023	-0.793000	0.04475	-0.218000	0.12543	CCC	USP29	-	NULL	ENSG00000131864		0.348	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP29	HGNC	protein_coding	OTTHUMT00000465075.1	69	0.00	0	C			57640371	57640371	+1	no_errors	ENST00000254181	ensembl	human	known	69_37n	missense	41	34.92	22	SNP	0.000	T
VPS18	57617	genome.wustl.edu	37	15	41194898	41194898	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr15:41194898C>G	ENST00000220509.5	+	5	2620	c.2281C>G	c.(2281-2283)Cgg>Ggg	p.R761G	VPS18_ENST00000558474.1_3'UTR	NM_020857.2	NP_065908.1	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18 homolog (S. cerevisiae)	761					endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|vesicle-mediated transport (GO:0016192)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	28		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GAAGATCGCACGGCACGTGGT	0.572																																						dbGAP											0													156.0	135.0	142.0					15																	41194898		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF308802	CCDS10069.1	15q14-q15	2006-12-19	2006-12-19		ENSG00000104142	ENSG00000104142			15972	protein-coding gene	gene with protein product		608551	"""vacuolar protein sorting protein 18"""			11250079, 16203730	Standard	NM_020857		Approved	KIAA1475, PEP3	uc001zne.3	Q9P253	OTTHUMG00000130135	ENST00000220509.5:c.2281C>G	15.37:g.41194898C>G	ENSP00000220509:p.Arg761Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCG0|Q96DI3|Q9H268	Missense_Mutation	SNP	pfam_Pep3_Vps18,pfam_Clathrin_H-chain/VPS_repeat,superfamily_ARM-type_fold	p.R761G	ENST00000220509.5	37	c.2281	CCDS10069.1	15	.	.	.	.	.	.	.	.	.	.	C	25.9	4.687917	0.88639	.	.	ENSG00000104142	ENST00000220509	T	0.18657	2.2	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.48732	0.1516	M	0.84585	2.705	0.80722	D	1	P	0.52577	0.954	P	0.56088	0.791	T	0.50320	-0.8842	10	0.56958	D	0.05	-38.5842	20.1579	0.98126	0.0:1.0:0.0:0.0	.	761	Q9P253	VPS18_HUMAN	G	761	ENSP00000220509:R761G	ENSP00000220509:R761G	R	+	1	2	VPS18	38982190	0.994000	0.37717	0.969000	0.41365	0.963000	0.63663	3.222000	0.51223	2.767000	0.95098	0.555000	0.69702	CGG	VPS18	-	pfam_Clathrin_H-chain/VPS_repeat	ENSG00000104142		0.572	VPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS18	HGNC	protein_coding	OTTHUMT00000252443.2	167	0.00	0	C			41194898	41194898	+1	no_errors	ENST00000220509	ensembl	human	known	69_37n	missense	109	29.49	46	SNP	1.000	G
ZNF333	84449	genome.wustl.edu	37	19	14830057	14830057	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr19:14830057C>T	ENST00000292530.6	+	12	2009	c.1918C>T	c.(1918-1920)Cat>Tat	p.H640Y	ZNF333_ENST00000536363.1_Missense_Mutation_p.H531Y|ZNF333_ENST00000540689.2_Intron	NM_032433.2	NP_115809.1	Q96JL9	ZN333_HUMAN	zinc finger protein 333	640					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|prostate(1)	21						CAAAAGAACCCATGTGGGAAG	0.453																																					NSCLC(60;75 1281 16985 25154 29885)	dbGAP											0													121.0	124.0	123.0					19																	14830057		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12316.1, CCDS74298.1	19p13	2013-01-08				ENSG00000160961		"""Zinc fingers, C2H2-type"", ""-"""	15624	protein-coding gene	gene with protein product		611811				12151103	Standard	XM_005260098		Approved	KIAA1806	uc002mzn.3	Q96JL9		ENST00000292530.6:c.1918C>T	19.37:g.14830057C>T	ENSP00000292530:p.His640Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2E6|Q86WS6|Q8TDL0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H640Y	ENST00000292530.6	37	c.1918	CCDS12316.1	19	.	.	.	.	.	.	.	.	.	.	C	16.29	3.081013	0.55753	.	.	ENSG00000160961	ENST00000536363;ENST00000292530	D;D	0.81908	-1.55;-1.55	2.61	2.61	0.31194	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.90885	0.7136	M	0.87038	2.855	0.27072	N	0.96331	D	0.76494	0.999	D	0.71184	0.972	T	0.82228	-0.0561	9	0.87932	D	0	.	11.4031	0.49880	0.0:1.0:0.0:0.0	.	640	Q96JL9	ZN333_HUMAN	Y	531;640	ENSP00000439749:H531Y;ENSP00000292530:H640Y	ENSP00000292530:H640Y	H	+	1	0	ZNF333	14691057	0.997000	0.39634	0.022000	0.16811	0.600000	0.36913	3.749000	0.55150	1.784000	0.52394	0.655000	0.94253	CAT	ZNF333	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160961		0.453	ZNF333-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF333	HGNC	protein_coding	OTTHUMT00000466496.1	150	0.00	0	C	NM_032433		14830057	14830057	+1	no_errors	ENST00000292530	ensembl	human	known	69_37n	missense	86	37.23	51	SNP	0.660	T
ZNF668	79759	genome.wustl.edu	37	16	31075619	31075619	+	Silent	SNP	G	G	A			TCGA-E2-A14S-01A-11D-A12B-09	TCGA-E2-A14S-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	78f39325-e1d0-4181-87f4-cb7f00e886d7	5cfbabf6-5143-4dae-a386-25a208ba147f	g.chr16:31075619G>A	ENST00000538906.1	-	2	946	c.162C>T	c.(160-162)gcC>gcT	p.A54A	ZNF668_ENST00000394983.2_Silent_p.A54A|AC135050.5_ENST00000568708.1_RNA|ZNF668_ENST00000539836.3_Silent_p.A77A|ZNF668_ENST00000535577.1_Silent_p.A54A|ZNF668_ENST00000300849.4_Silent_p.A54A|ZNF668_ENST00000426488.2_Silent_p.A77A|ZNF668_ENST00000564456.1_5'Flank	NM_001172668.1	NP_001166139	Q96K58	ZN668_HUMAN	zinc finger protein 668	54					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	27						GCTTCACCTCGGCCACCTCTT	0.627																																					Colon(181;1111 1980 5060 10512 25785)	dbGAP											0													80.0	77.0	78.0					16																	31075619		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS10701.1, CCDS54003.1	16p11.2	2013-01-08			ENSG00000167394	ENSG00000167394		"""Zinc fingers, C2H2-type"""	25821	protein-coding gene	gene with protein product						12477932	Standard	NM_024706		Approved	FLJ13479	uc021tgt.1	Q96K58	OTTHUMG00000047357	ENST00000538906.1:c.162C>T	16.37:g.31075619G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JHH8|F5H7E7|Q59EV1|Q8N669|Q9H8L4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A77	ENST00000538906.1	37	c.231	CCDS10701.1	16																																																																																			ZNF668	-	NULL	ENSG00000167394		0.627	ZNF668-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF668	HGNC	protein_coding	OTTHUMT00000108516.2	97	0.00	0	G	NM_024706		31075619	31075619	-1	no_errors	ENST00000426488	ensembl	human	known	69_37n	silent	63	28.41	25	SNP	0.000	A
