#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC8	6833	genome.wustl.edu	37	11	17482153	17482153	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr11:17482153C>T	ENST00000389817.3	-	6	961	c.893G>A	c.(892-894)cGc>cAc	p.R298H	ABCC8_ENST00000302539.4_Missense_Mutation_p.R298H			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	298					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	GAGGACCAGGCGCCTCCCGAA	0.637																																						dbGAP											0													74.0	74.0	74.0					11																	17482153		2200	4293	6493	-	-	-	SO:0001583	missense	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.893G>A	11.37:g.17482153C>T	ENSP00000374467:p.Arg298His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.R298H	ENST00000389817.3	37	c.893	CCDS31437.1	11	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529753	0.64860	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.94862	-3.54;-3.54	5.53	5.53	0.82687	ABC transporter, transmembrane domain, type 1 (1);	0.064020	0.64402	D	0.000016	D	0.92831	0.7720	L	0.38531	1.155	0.48762	D	0.999706	D;D	0.61080	0.966;0.989	B;P	0.50082	0.411;0.63	D	0.92129	0.5710	10	0.40728	T	0.16	.	14.0128	0.64507	0.0:0.7273:0.2727:0.0	.	297;298	B7Z4N0;Q09428	.;ABCC8_HUMAN	H	298;298;312	ENSP00000374467:R298H;ENSP00000303960:R298H	ENSP00000303960:R298H	R	-	2	0	ABCC8	17438729	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.875000	0.69660	2.608000	0.88229	0.561000	0.74099	CGC	ABCC8	-	superfamily_ABC_transptrTM_dom_typ1	ENSG00000006071		0.637	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	40	0.00	0	C	NM_000352		17482153	17482153	-1	no_errors	ENST00000302539	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	1.000	T
ANKRD6	22881	genome.wustl.edu	37	6	90338952	90338952	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr6:90338952C>G	ENST00000522441.1	+	15	2248	c.1607C>G	c.(1606-1608)tCt>tGt	p.S536C	ANKRD6_ENST00000520793.1_Intron|ANKRD6_ENST00000339746.4_Missense_Mutation_p.S536C|LYRM2_ENST00000520441.1_Intron|ANKRD6_ENST00000369408.5_Missense_Mutation_p.S501C|ANKRD6_ENST00000447838.2_Intron	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	536					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		TGTGAGTCCTCTACAGGTAAC	0.483																																						dbGAP											0													77.0	76.0	76.0					6																	90338952		1927	4145	6072	-	-	-	SO:0001583	missense	0			AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.1607C>G	6.37:g.90338952C>G	ENSP00000430985:p.Ser536Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S536C	ENST00000522441.1	37	c.1607	CCDS56441.1	6	.	.	.	.	.	.	.	.	.	.	C	12.23	1.876922	0.33162	.	.	ENSG00000135299	ENST00000369408;ENST00000339746;ENST00000522441;ENST00000521004	T;T;T	0.37915	1.18;1.17;1.17	5.68	4.63	0.57726	.	0.410613	0.20991	N	0.082029	T	0.22244	0.0536	L	0.36672	1.1	0.46849	D	0.999229	P;P	0.42649	0.681;0.786	B;P	0.46339	0.315;0.513	T	0.01367	-1.1373	10	0.40728	T	0.16	-9.0162	10.1617	0.42855	0.0:0.8507:0.0:0.1493	.	536;501	Q9Y2G4;Q9Y2G4-1	ANKR6_HUMAN;.	C	501;536;536;91	ENSP00000358416:S501C;ENSP00000345767:S536C;ENSP00000430985:S536C	ENSP00000345767:S536C	S	+	2	0	ANKRD6	90395673	0.232000	0.23762	0.990000	0.47175	0.574000	0.36063	1.250000	0.32850	2.668000	0.90789	0.563000	0.77884	TCT	ANKRD6	-	NULL	ENSG00000135299		0.483	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ANKRD6	HGNC	protein_coding	OTTHUMT00000376594.1	247	0.00	0	C			90338952	90338952	+1	no_errors	ENST00000339746	ensembl	human	known	69_37n	missense	126	40.57	86	SNP	0.693	G
ANXA6	309	genome.wustl.edu	37	5	150483215	150483215	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr5:150483215C>G	ENST00000354546.5	-	25	2105	c.1878G>C	c.(1876-1878)atG>atC	p.M626I	ANXA6_ENST00000377751.5_Missense_Mutation_p.M283I|ANXA6_ENST00000521512.1_Missense_Mutation_p.M413I|ANXA6_ENST00000356496.5_Missense_Mutation_p.M620I|ANXA6_ENST00000523714.1_Missense_Mutation_p.M594I	NM_001155.4	NP_001146.2	P08133	ANXA6_HUMAN	annexin A6	626					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|protein homooligomerization (GO:0051260)|regulation of muscle contraction (GO:0006937)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|cholesterol binding (GO:0015485)|GTP binding (GO:0005525)|ligand-gated ion channel activity (GO:0015276)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|lung(9)	12		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGCGGGATACCATGATCCTGG	0.547																																						dbGAP											0													45.0	47.0	46.0					5																	150483215		2075	4234	6309	-	-	-	SO:0001583	missense	0			J03578	CCDS47315.1, CCDS54941.1	5q33.1	2008-02-05			ENSG00000197043	ENSG00000197043		"""Annexins"""	544	protein-coding gene	gene with protein product		114070		ANX6		3258820	Standard	NM_001155		Approved		uc003ltl.2	P08133	OTTHUMG00000164179	ENST00000354546.5:c.1878G>C	5.37:g.150483215C>G	ENSP00000346550:p.Met626Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8A7|D3DQH4|E9PGK1|Q6ZT79	Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinVI,prints_AnnexinIV	p.M626I	ENST00000354546.5	37	c.1878	CCDS47315.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.95|12.95	2.092553|2.092553	0.36952|0.36952	.|.	.|.	ENSG00000197043|ENSG00000197043	ENST00000522664|ENST00000354546;ENST00000523714;ENST00000377751;ENST00000356496;ENST00000521512;ENST00000540153;ENST00000517486	.|T;T;T;T;T;T	.|0.03065	.|4.06;4.06;4.06;4.06;4.06;4.06	4.75|4.75	4.75|4.75	0.60458|0.60458	.|Annexin repeat, conserved site (1);	.|0.045004	.|0.85682	.|D	.|0.000000	T|T	0.01940|0.01940	0.0061|0.0061	N|N	0.03050|0.03050	-0.425|-0.425	0.58432|0.58432	D|D	0.999999|0.999999	.|B;B;B	.|0.22003	.|0.063;0.009;0.005	.|B;B;B	.|0.24394	.|0.053;0.016;0.024	T|T	0.57906|0.57906	-0.7730|-0.7730	5|10	.|0.15066	.|T	.|0.55	.|.	12.6427|12.6427	0.56718|0.56718	0.1662:0.8338:0.0:0.0|0.1662:0.8338:0.0:0.0	.|.	.|413;620;626	.|E5RK69;A6NN80;P08133	.|.;.;ANXA6_HUMAN	R|I	23|626;594;283;620;413;500;119	.|ENSP00000346550:M626I;ENSP00000430517:M594I;ENSP00000366980:M283I;ENSP00000348889:M620I;ENSP00000430420:M413I;ENSP00000428916:M119I	.|ENSP00000346550:M626I	G|M	-|-	1|3	0|0	ANXA6|ANXA6	150463408|150463408	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	4.078000|4.078000	0.57606|0.57606	2.370000|2.370000	0.80446|0.80446	0.561000|0.561000	0.74099|0.74099	GGT|ATG	ANXA6	-	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat	ENSG00000197043		0.547	ANXA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANXA6	HGNC	protein_coding	OTTHUMT00000377668.2	212	0.00	0	C	NM_001155		150483215	150483215	-1	no_errors	ENST00000354546	ensembl	human	known	69_37n	missense	126	32.62	61	SNP	1.000	G
ATP13A2	23400	genome.wustl.edu	37	1	17316489	17316489	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr1:17316489G>A	ENST00000326735.8	-	22	2455	c.2422C>T	c.(2422-2424)Cag>Tag	p.Q808*	ATP13A2_ENST00000341676.5_Intron|RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000452699.1_Nonsense_Mutation_p.Q803*			Q9NQ11	AT132_HUMAN	ATPase type 13A2	808					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		CTTGCAGCCTGGTCAGGATCC	0.647																																						dbGAP											0													23.0	27.0	25.0					1																	17316489		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.2422C>T	1.37:g.17316489G>A	ENSP00000327214:p.Gln808*	Somatic		WXS	Illumina GAIIx	Phase_IV	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.Q808*	ENST00000326735.8	37	c.2422	CCDS175.1	1	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793669	0.70452	.	.	ENSG00000159363	ENST00000326735;ENST00000452699;ENST00000502418	.	.	.	4.8	4.8	0.61643	.	1.210470	0.05427	N	0.545331	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-6.4316	15.3886	0.74723	0.0:0.0:1.0:0.0	.	.	.	.	X	808;803;4	.	ENSP00000327214:Q808X	Q	-	1	0	ATP13A2	17189076	0.005000	0.15991	0.257000	0.24404	0.440000	0.31957	0.700000	0.25601	2.496000	0.84212	0.561000	0.74099	CAG	ATP13A2	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_unknown-pump-sp	ENSG00000159363		0.647	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP13A2	HGNC	protein_coding	OTTHUMT00000006617.1	42	0.00	0	G	NM_022089		17316489	17316489	-1	no_errors	ENST00000326735	ensembl	human	known	69_37n	nonsense	47	28.36	19	SNP	0.864	A
B3GNT2	10678	genome.wustl.edu	37	2	62450052	62450052	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:62450052A>T	ENST00000301998.4	+	2	949	c.697A>T	c.(697-699)Act>Tct	p.T233S	B3GNT2_ENST00000405767.1_Missense_Mutation_p.T233S	NM_006577.5	NP_006568.2	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2	233					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)	18	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			GTGGGTAAGTACTTCCTGCCC	0.418																																						dbGAP											0													92.0	80.0	84.0					2																	62450052		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB049584	CCDS1870.1	2p15	2013-02-19	2006-04-12	2006-04-12	ENSG00000170340	ENSG00000170340		"""Beta 3-glycosyltransferases"""	15629	protein-coding gene	gene with protein product		605581	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1"""	B3GNT1		9892646, 11042166	Standard	NM_006577		Approved	B3GNT-2, BETA3GNT, B3GN-T2, B3GN-T1	uc002sbs.3	Q9NY97	OTTHUMG00000129444	ENST00000301998.4:c.697A>T	2.37:g.62450052A>T	ENSP00000305595:p.Thr233Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q54AC1|Q9NQQ9|Q9NQR0|Q9NUT9	Missense_Mutation	SNP	pfam_Glyco_trans_31	p.T233S	ENST00000301998.4	37	c.697	CCDS1870.1	2	.	.	.	.	.	.	.	.	.	.	A	5.154	0.213984	0.09810	.	.	ENSG00000170340	ENST00000301998;ENST00000405767	T;T	0.37411	1.2;1.2	5.74	4.59	0.56863	.	0.585685	0.19334	N	0.116840	T	0.20941	0.0504	N	0.25647	0.755	0.31953	N	0.609374	B	0.10296	0.003	B	0.11329	0.006	T	0.26292	-1.0107	10	0.06891	T	0.86	.	7.7524	0.28904	0.791:0.139:0.0701:0.0	.	233	Q9NY97	B3GN2_HUMAN	S	233	ENSP00000305595:T233S;ENSP00000384692:T233S	ENSP00000305595:T233S	T	+	1	0	B3GNT2	62303556	0.444000	0.25649	1.000000	0.80357	0.996000	0.88848	1.877000	0.39598	0.999000	0.39023	0.528000	0.53228	ACT	B3GNT2	-	pfam_Glyco_trans_31	ENSG00000170340		0.418	B3GNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT2	HGNC	protein_coding	OTTHUMT00000251606.2	245	0.39	1	A	NM_006577		62450052	62450052	+1	no_errors	ENST00000301998	ensembl	human	known	69_37n	missense	132	31.63	62	SNP	0.986	T
BACH2	60468	genome.wustl.edu	37	6	90660211	90660211	+	Silent	SNP	G	G	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr6:90660211G>A	ENST00000257749.4	-	7	2321	c.1614C>T	c.(1612-1614)tgC>tgT	p.C538C	BACH2_ENST00000343122.3_Silent_p.C538C|RP3-512E2.2_ENST00000413986.1_RNA|RP3-512E2.2_ENST00000445838.1_RNA|BACH2_ENST00000537989.1_Silent_p.C538C	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	538						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		GAGGGAGGCTGCAGGGTGAGC	0.612																																						dbGAP											0													69.0	68.0	68.0					6																	90660211		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.1614C>T	6.37:g.90660211G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P518|Q59H70|Q5T793|Q9NTS5	Silent	SNP	pfam_BTB_POZ,pfam_bZIP_1,pfam_bZIP_2,superfamily_BTB/POZ_fold,superfamily_Euk_TF_DNA-bd,smart_BTB/POZ-like,smart_bZIP,pfscan_BTB/POZ-like,pfscan_bZIP	p.C538	ENST00000257749.4	37	c.1614	CCDS5026.1	6																																																																																			BACH2	-	NULL	ENSG00000112182		0.612	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BACH2	HGNC	protein_coding	OTTHUMT00000041522.2	135	0.00	0	G	NM_021813		90660211	90660211	-1	no_errors	ENST00000257749	ensembl	human	known	69_37n	silent	82	31.09	37	SNP	1.000	A
BCO1	53630	genome.wustl.edu	37	16	81303899	81303899	+	Missense_Mutation	SNP	G	G	A	rs572933939		TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr16:81303899G>A	ENST00000258168.2	+	7	1440	c.979G>A	c.(979-981)Gag>Aag	p.E327K	BCMO1_ENST00000425577.2_Missense_Mutation_p.E258K	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						CATTGCCTACGAGGACAACAG	0.562													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18015	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													158.0	118.0	131.0					16																	81303899		2202	4300	6502	-	-	-	SO:0001583	missense	0																														ENST00000258168.2:c.979G>A	16.37:g.81303899G>A	ENSP00000258168:p.Glu327Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Carotenoid_Oase	p.E327K	ENST00000258168.2	37	c.979	CCDS10934.1	16	.	.	.	.	.	.	.	.	.	.	G	6.474	0.455638	0.12283	.	.	ENSG00000135697	ENST00000258168;ENST00000425577	D;D	0.94862	-3.54;-3.54	5.62	2.2	0.27929	.	0.312135	0.37715	N	0.001974	D	0.83464	0.5260	N	0.13272	0.32	0.33899	D	0.638307	B;B	0.15141	0.012;0.002	B;B	0.12156	0.007;0.005	T	0.72792	-0.4186	10	0.11182	T	0.66	-20.7654	2.6646	0.05037	0.4005:0.2529:0.3466:0.0	.	258;327	E7EM88;Q9HAY6	.;BCDO1_HUMAN	K	327;258	ENSP00000258168:E327K;ENSP00000400586:E258K	ENSP00000258168:E327K	E	+	1	0	BCMO1	79861400	0.000000	0.05858	0.993000	0.49108	0.817000	0.46193	0.588000	0.23924	0.710000	0.31997	0.650000	0.86243	GAG	BCMO1	-	pfam_Carotenoid_Oase	ENSG00000135697		0.562	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCMO1	HGNC	protein_coding	OTTHUMT00000269056.1	163	0.00	0	G			81303899	81303899	+1	no_errors	ENST00000258168	ensembl	human	known	69_37n	missense	49	47.92	46	SNP	1.000	A
C2orf43	60526	genome.wustl.edu	37	2	20886840	20886842	+	In_Frame_Del	DEL	ATA	ATA	-			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	ATA	ATA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:20886840_20886842delATA	ENST00000237822.3	-	7	878_880	c.799_801delTAT	c.(799-801)tatdel	p.Y267del	C2orf43_ENST00000541941.1_In_Frame_Del_p.Y137del|C2orf43_ENST00000403006.2_In_Frame_Del_p.Y137del|C2orf43_ENST00000435420.2_In_Frame_Del_p.Y219del|C2orf43_ENST00000440866.2_3'UTR|C2orf43_ENST00000381090.3_In_Frame_Del_p.Y267del	NM_001282721.1|NM_021925.2	NP_001269650.1|NP_068744.1	Q9H6V9	CB043_HUMAN	chromosome 2 open reading frame 43	267										endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTATAGTACCATAATAAAATGTA	0.399																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AK025473	CCDS1702.1, CCDS62864.1, CCDS74488.1, CCDS74489.1	2p24.1	2014-02-07			ENSG00000118961	ENSG00000118961			26145	protein-coding gene	gene with protein product		613570				17135363, 24357060	Standard	NM_001282723		Approved	FLJ21820	uc002rec.3	Q9H6V9	OTTHUMG00000122097	ENST00000237822.3:c.799_801delTAT	2.37:g.20886843_20886845delATA	ENSP00000237822:p.Tyr267del	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZA47|B7ZAJ5|D6W530|E7ESN0|Q53T37|Q53T58	In_Frame_Del	DEL	pfam_DUF2305	p.Y267in_frame_del	ENST00000237822.3	37	c.801_799	CCDS1702.1	2																																																																																			C2orf43	-	pfam_DUF2305	ENSG00000118961		0.399	C2orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf43	HGNC	protein_coding	OTTHUMT00000242861.1	262	0.00	0	ATA	NM_021925		20886840	20886842	-1	no_errors	ENST00000237822	ensembl	human	known	69_37n	in_frame_del	96	37.25	57	DEL	0.989:1.000:1.000	-
C2orf72	257407	genome.wustl.edu	37	2	231906087	231906087	+	Silent	SNP	G	G	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:231906087G>A	ENST00000373640.4	+	2	787	c.711G>A	c.(709-711)aaG>aaA	p.K237K	C2orf72_ENST00000477463.1_3'UTR	NM_001144994.1	NP_001138466.1	A6NCS6	CB072_HUMAN	chromosome 2 open reading frame 72	237																	GCCGGAGGAAGAACCAGGATG	0.602																																						dbGAP											0													47.0	55.0	52.0					2																	231906087		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS46539.1	2q37.1	2012-08-06			ENSG00000204128	ENSG00000204128			27418	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001144994		Approved	LOC257407	uc002vrl.4	A6NCS6	OTTHUMG00000153996	ENST00000373640.4:c.711G>A	2.37:g.231906087G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.K237	ENST00000373640.4	37	c.711	CCDS46539.1	2																																																																																			C2orf72	-	NULL	ENSG00000204128		0.602	C2orf72-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	C2orf72	HGNC	protein_coding	OTTHUMT00000333376.2	86	0.00	0	G	NM_001144994		231906087	231906087	+1	no_errors	ENST00000373640	ensembl	human	putative	69_37n	silent	41	40.58	28	SNP	0.884	A
CAPN1	823	genome.wustl.edu	37	11	64972292	64972292	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr11:64972292G>A	ENST00000527323.1	+	10	1544	c.1304G>A	c.(1303-1305)gGc>gAc	p.G435D	CAPN1_ENST00000533129.1_Missense_Mutation_p.G435D|CAPN1_ENST00000524773.1_Missense_Mutation_p.G435D|CAPN1_ENST00000533820.1_Missense_Mutation_p.G435D|CAPN1_ENST00000279247.6_Missense_Mutation_p.G435D			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit	435	Domain III.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		CGCCGCTTCGGCCGCGACATG	0.662											OREG0021073	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													38.0	44.0	42.0					11																	64972292		2033	4161	6194	-	-	-	SO:0001583	missense	0			X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614	ENST00000527323.1:c.1304G>A	11.37:g.64972292G>A	ENSP00000431984:p.Gly435Asp	Somatic	1080	WXS	Illumina GAIIx	Phase_IV	Q2TTR0|Q6DHV4	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.G435D	ENST00000527323.1	37	c.1304	CCDS44644.1	11	.	.	.	.	.	.	.	.	.	.	G	27.4	4.826804	0.90955	.	.	ENSG00000014216	ENST00000533820;ENST00000533129;ENST00000524773;ENST00000279247;ENST00000259755;ENST00000527323	D;D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48;-2.48	4.51	4.51	0.55191	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.378765	0.27068	N	0.021083	D	0.94470	0.8220	M	0.84433	2.695	0.80722	D	1	P	0.51933	0.949	D	0.67900	0.954	D	0.95310	0.8411	10	0.87932	D	0	.	15.0833	0.72130	0.0:0.0:1.0:0.0	.	435	P07384	CAN1_HUMAN	D	435;435;435;435;381;435	ENSP00000435272:G435D;ENSP00000431686:G435D;ENSP00000434176:G435D;ENSP00000279247:G435D;ENSP00000431984:G435D	ENSP00000259755:G381D	G	+	2	0	CAPN1	64728868	1.000000	0.71417	0.996000	0.52242	0.621000	0.37620	9.716000	0.98752	2.232000	0.73038	0.563000	0.77884	GGC	CAPN1	-	pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Calpain_III	ENSG00000014216		0.662	CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CAPN1	HGNC	protein_coding	OTTHUMT00000385325.1	14	0.00	0	G			64972292	64972292	+1	no_errors	ENST00000279247	ensembl	human	known	69_37n	missense	12	29.41	5	SNP	1.000	A
CENPE	1062	genome.wustl.edu	37	4	104066383	104066383	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr4:104066383C>T	ENST00000265148.3	-	32	4770	c.4681G>A	c.(4681-4683)Gat>Aat	p.D1561N	CENPE_ENST00000380026.3_Missense_Mutation_p.D1536N	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1561					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		AGTGCTGAATCCTTGGCTTTG	0.333																																						dbGAP											0													141.0	129.0	133.0					4																	104066383		2203	4298	6501	-	-	-	SO:0001583	missense	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.4681G>A	4.37:g.104066383C>T	ENSP00000265148:p.Asp1561Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.D1561N	ENST00000265148.3	37	c.4681	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	c	8.720	0.914049	0.17907	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.74526	-0.6;-0.85	4.34	2.63	0.31362	.	.	.	.	.	T	0.72803	0.3506	L	0.49350	1.555	0.09310	N	1	D;D	0.56035	0.974;0.969	P;P	0.51415	0.669;0.526	T	0.60151	-0.7319	9	0.39692	T	0.17	.	7.1853	0.25797	0.0:0.7334:0.1723:0.0943	.	1536;1561	Q02224-3;Q02224	.;CENPE_HUMAN	N	1561;1561;1536	ENSP00000265148:D1561N;ENSP00000369365:D1536N	ENSP00000265148:D1561N	D	-	1	0	CENPE	104285832	0.033000	0.19621	0.001000	0.08648	0.004000	0.04260	2.328000	0.43867	0.480000	0.27534	-0.233000	0.12211	GAT	CENPE	-	NULL	ENSG00000138778		0.333	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		768	0.00	0	C			104066383	104066383	-1	no_errors	ENST00000265148	ensembl	human	known	69_37n	missense	376	22.15	107	SNP	0.003	T
CEP120	153241	genome.wustl.edu	37	5	122729131	122729131	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr5:122729131A>C	ENST00000306467.5	-	6	977	c.673T>G	c.(673-675)Tta>Gta	p.L225V	CEP120_ENST00000395431.2_Missense_Mutation_p.L225V|CEP120_ENST00000328236.5_Missense_Mutation_p.L225V|CEP120_ENST00000306481.6_Missense_Mutation_p.L199V			Q8N960	CE120_HUMAN	centrosomal protein 120kDa	225					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)|regulation of protein localization (GO:0032880)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	29						TTTCCCAGTAAAGAGTAGTAA	0.353																																						dbGAP											0													120.0	117.0	118.0					5																	122729131		1822	4083	5905	-	-	-	SO:0001583	missense	0			AK095646	CCDS4134.2, CCDS54890.1	5q23.2	2014-02-20	2008-08-14	2008-08-14	ENSG00000168944	ENSG00000168944			26690	protein-coding gene	gene with protein product		613446	"""coiled-coil domain containing 100"""	CCDC100		17920017	Standard	NM_153223		Approved	FLJ36090	uc003ktk.3	Q8N960	OTTHUMG00000128922	ENST00000306467.5:c.673T>G	5.37:g.122729131A>C	ENSP00000303058:p.Leu225Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AI52|Q6AW89|Q8IWB5|Q8N9Y0|Q8NDE8	Missense_Mutation	SNP	pfam_DUF3668,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.L225V	ENST00000306467.5	37	c.673	CCDS4134.2	5	.	.	.	.	.	.	.	.	.	.	A	18.60	3.659321	0.67586	.	.	ENSG00000168944	ENST00000306467;ENST00000328236;ENST00000306481;ENST00000508442;ENST00000395431	T;T;T;T	0.64991	1.18;1.18;1.19;-0.13	5.69	4.33	0.51752	.	0.000000	0.64402	D	0.000004	T	0.74329	0.3702	M	0.65975	2.015	0.46458	D	0.999052	D	0.76494	0.999	D	0.74023	0.982	T	0.76680	-0.2870	10	0.72032	D	0.01	-10.2237	10.593	0.45321	0.8698:0.0:0.1302:0.0	.	225	Q8N960	CE120_HUMAN	V	225;225;199;199;225	ENSP00000303058:L225V;ENSP00000327504:L225V;ENSP00000307419:L199V;ENSP00000421620:L199V	ENSP00000303058:L225V	L	-	1	2	CEP120	122757030	0.991000	0.36638	1.000000	0.80357	0.997000	0.91878	1.867000	0.39499	2.182000	0.69389	0.482000	0.46254	TTA	CEP120	-	NULL	ENSG00000168944		0.353	CEP120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP120	HGNC	protein_coding	OTTHUMT00000250899.2	458	0.00	0	A	NM_153223		122729131	122729131	-1	no_errors	ENST00000306467	ensembl	human	known	69_37n	missense	234	28.44	93	SNP	0.999	C
CPNE5	57699	genome.wustl.edu	37	6	36710076	36710076	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr6:36710076G>C	ENST00000244751.2	-	21	2375	c.1751C>G	c.(1750-1752)cCc>cGc	p.P584R	CPNE5_ENST00000459703.1_5'UTR|CPNE5_ENST00000393189.2_Missense_Mutation_p.P292R	NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	584						extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						GGACGCAGGGGGCGTGCGGGC	0.692																																						dbGAP											0													31.0	36.0	34.0					6																	36710076		2201	4298	6499	-	-	-	SO:0001583	missense	0			H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.1751C>G	6.37:g.36710076G>C	ENSP00000244751:p.Pro584Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z6C8	Missense_Mutation	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting,pfscan_VWF_A	p.P584R	ENST00000244751.2	37	c.1751	CCDS4825.1	6	.	.	.	.	.	.	.	.	.	.	G	10.69	1.421039	0.25639	.	.	ENSG00000124772	ENST00000244751;ENST00000393189	T;T	0.11169	3.56;2.8	4.86	3.99	0.46301	.	0.169729	0.52532	D	0.000068	T	0.02156	0.0067	N	0.08118	0	0.43122	D	0.994846	B	0.14012	0.009	B	0.11329	0.006	T	0.30650	-0.9971	10	0.72032	D	0.01	.	9.1462	0.36935	0.1023:0.0:0.8977:0.0	.	584	Q9HCH3	CPNE5_HUMAN	R	584;292	ENSP00000244751:P584R;ENSP00000376885:P292R	ENSP00000244751:P584R	P	-	2	0	CPNE5	36818054	0.972000	0.33761	0.998000	0.56505	0.413000	0.31143	2.930000	0.48924	1.038000	0.40049	-0.258000	0.10820	CCC	CPNE5	-	NULL	ENSG00000124772		0.692	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE5	HGNC	protein_coding	OTTHUMT00000040351.1	32	0.00	0	G	NM_020939		36710076	36710076	-1	no_errors	ENST00000244751	ensembl	human	known	69_37n	missense	22	51.11	23	SNP	0.958	C
CPT1C	126129	genome.wustl.edu	37	19	50195607	50195607	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr19:50195607T>A	ENST00000392518.4	+	3	470	c.98T>A	c.(97-99)cTc>cAc	p.L33H	CPT1C_ENST00000598714.1_3'UTR|CPT1C_ENST00000405931.2_Missense_Mutation_p.L33H|CPT1C_ENST00000354199.5_Missense_Mutation_p.L33H|CPT1C_ENST00000598293.1_Missense_Mutation_p.L33H|CPT1C_ENST00000323446.5_Missense_Mutation_p.L33H|CTB-33G10.6_ENST00000596472.1_RNA	NM_001199752.1	NP_001186681.1	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C	33					carnitine metabolic process (GO:0009437)|fatty acid beta-oxidation (GO:0006635)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endoplasmic reticulum membrane (GO:0005789)|mitochondrial outer membrane (GO:0005741)|synapse (GO:0045202)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		GAGATCTACCTCTCTGGCCTG	0.622																																						dbGAP											0													74.0	57.0	63.0					19																	50195607		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF357970	CCDS12779.1, CCDS46147.1	19q13.33	2014-03-14				ENSG00000169169			18540	protein-coding gene	gene with protein product		608846				12376098, 11001805	Standard	NM_001136052		Approved	FLJ23809, CPTIC, CPT1P	uc010eng.3	Q8TCG5		ENST00000392518.4:c.98T>A	19.37:g.50195607T>A	ENSP00000376303:p.Leu33His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0Z8|Q5K6N5|Q8N6Q9|Q8NDS6|Q8TE84	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.L33H	ENST00000392518.4	37	c.98	CCDS12779.1	19	.	.	.	.	.	.	.	.	.	.	T	16.04	3.010568	0.54361	.	.	ENSG00000169169	ENST00000392518;ENST00000354199;ENST00000405931;ENST00000323446	D;D;D;D	0.85339	-1.97;-1.79;-1.97;-1.97	4.62	3.53	0.40419	.	0.273464	0.19689	N	0.108336	D	0.88127	0.6353	L	0.58810	1.83	0.80722	D	1	D;B;B	0.71674	0.998;0.186;0.117	P;B;B	0.61592	0.891;0.135;0.064	D	0.86781	0.1979	10	0.40728	T	0.16	.	11.005	0.47629	0.0:0.0:0.1546:0.8454	.	33;33;33	Q8TCG5-3;Q8TCG5-2;Q8TCG5	.;.;CPT1C_HUMAN	H	33	ENSP00000376303:L33H;ENSP00000346138:L33H;ENSP00000384465:L33H;ENSP00000319343:L33H	ENSP00000319343:L33H	L	+	2	0	CPT1C	54887419	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	5.311000	0.65786	1.882000	0.54519	0.374000	0.22700	CTC	CPT1C	-	NULL	ENSG00000169169		0.622	CPT1C-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPT1C	HGNC	protein_coding	OTTHUMT00000465873.1	93	0.00	0	T	NM_152359		50195607	50195607	+1	no_errors	ENST00000323446	ensembl	human	known	69_37n	missense	60	32.58	29	SNP	0.999	A
CRYBG3	131544	genome.wustl.edu	37	3	97614826	97614826	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr3:97614826A>G	ENST00000182096.4	+	9	1818	c.1754A>G	c.(1753-1755)cAt>cGt	p.H585R		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2533							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						GAAAAAGAACATTTTAAAGGC	0.393																																						dbGAP											0													135.0	125.0	128.0					3																	97614826		1828	4074	5902	-	-	-	SO:0001583	missense	0					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.1754A>G	3.37:g.97614826A>G	ENSP00000182096:p.His585Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.H585R	ENST00000182096.4	37	c.1754		3	.	.	.	.	.	.	.	.	.	.	A	12.21	1.870910	0.33069	.	.	ENSG00000080200	ENST00000182096	T	0.74209	-0.82	5.73	3.42	0.39159	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.576679	0.18802	N	0.130744	T	0.51058	0.1652	N	0.12746	0.255	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.47289	-0.9129	10	0.27082	T	0.32	.	5.7875	0.18340	0.7248:0.0:0.2752:0.0	.	585	Q68DQ2	CRBG3_HUMAN	R	585	ENSP00000182096:H585R	ENSP00000182096:H585R	H	+	2	0	CRYBG3	99097516	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.368000	0.44222	2.195000	0.70347	0.528000	0.53228	CAT	CRYBG3	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	ENSG00000080200		0.393	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	HGNC	protein_coding	OTTHUMT00000353751.1	639	0.00	0	A	NM_153605		97614826	97614826	+1	no_errors	ENST00000182096	ensembl	human	known	69_37n	missense	280	30.96	126	SNP	1.000	G
CTTNBP2NL	55917	genome.wustl.edu	37	1	112997128	112997130	+	In_Frame_Del	DEL	GAT	GAT	-			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	GAT	GAT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr1:112997128_112997130delGAT	ENST00000271277.6	+	5	613_615	c.388_390delGAT	c.(388-390)gatdel	p.D131del		NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	131					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGCTGAAGGAGATGATGTCACCT	0.424																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.388_390delGAT	1.37:g.112997131_112997133delGAT	ENSP00000271277:p.Asp131del	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMS5|Q96B40	In_Frame_Del	DEL	pfam_Cortactin-binding_p2_N	p.D131in_frame_del	ENST00000271277.6	37	c.388_390	CCDS845.1	1																																																																																			CTTNBP2NL	-	pfam_Cortactin-binding_p2_N	ENSG00000143079		0.424	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2NL	HGNC	protein_coding	OTTHUMT00000030686.1	159	0.00	0	GAT	NM_018704		112997128	112997130	+1	no_errors	ENST00000271277	ensembl	human	known	69_37n	in_frame_del	89	26.45	32	DEL	1.000:1.000:1.000	-
CYP4Z2P	163720	genome.wustl.edu	37	1	47333672	47333672	+	RNA	SNP	C	C	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr1:47333672C>G	ENST00000505841.1	-	0	1016					NR_002788.2		Q8N1L4	CP4Z2_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 2, pseudogene							integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)										CTCAGCATCTCTGCTGATGCT	0.428																																						dbGAP											0																																										-	-	-			0			AY262057		1p33	2013-07-25	2013-05-03		ENSG00000154198	ENSG00000154198		"""Cytochrome P450s"""	24426	pseudogene	pseudogene						15059886	Standard	NR_002788		Approved	FLJ40054	uc031pmm.1	Q8N1L4	OTTHUMG00000008024		1.37:g.47333672C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q66ZJ5	RNA	SNP	-	NULL	ENST00000505841.1	37	NULL		1																																																																																			CYP4Z2P	-	-	ENSG00000154198		0.428	CYP4Z2P-002	KNOWN	basic	processed_transcript	CYP4Z2P	HGNC	pseudogene	OTTHUMT00000361094.1	219	0.00	0	C	NR_002788		47333672	47333672	-1	no_errors	ENST00000505841	ensembl	human	known	69_37n	rna	101	36.88	59	SNP	0.944	G
DMD	1756	genome.wustl.edu	37	X	32328199	32328199	+	Splice_Site	SNP	C	C	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chrX:32328199C>T	ENST00000357033.4	-	42	6323	c.6117G>A	c.(6115-6117)aaG>aaA	p.K2039K	DMD_ENST00000378677.2_Splice_Site_p.K2035K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2039					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTGGTTTTACCTTCAGAGACT	0.388																																						dbGAP											0													78.0	66.0	70.0					X																	32328199		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6117+1G>A	X.37:g.32328199C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.K2039	ENST00000357033.4	37	c.6117	CCDS14233.1	X																																																																																			DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.388	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	110	0.90	1	C	NM_004006	Silent	32328199	32328199	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	silent	38	60.00	57	SNP	1.000	T
DNAH7	56171	genome.wustl.edu	37	2	196749335	196749335	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:196749335T>C	ENST00000312428.6	-	35	5837	c.5737A>G	c.(5737-5739)Att>Gtt	p.I1913V		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1913					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TAATCATAAATTGTTCCTTTT	0.413																																						dbGAP											0													91.0	87.0	88.0					2																	196749335		1903	4120	6023	-	-	-	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.5737A>G	2.37:g.196749335T>C	ENSP00000311273:p.Ile1913Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.I1913V	ENST00000312428.6	37	c.5737	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	T	1.467	-0.560822	0.03939	.	.	ENSG00000118997	ENST00000312428	T	0.17528	2.27	5.67	3.3	0.37823	.	.	.	.	.	T	0.04952	0.0133	N	0.01686	-0.76	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.31806	-0.9930	9	0.02654	T	1	.	8.1632	0.31211	0.0:0.2211:0.0:0.7789	.	1913	Q8WXX0	DYH7_HUMAN	V	1913	ENSP00000311273:I1913V	ENSP00000311273:I1913V	I	-	1	0	DNAH7	196457580	0.364000	0.24997	0.995000	0.50966	0.882000	0.50991	0.565000	0.23578	0.509000	0.28195	0.533000	0.62120	ATT	DNAH7	-	NULL	ENSG00000118997		0.413	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	286	0.35	1	T	NM_018897		196749335	196749335	-1	no_errors	ENST00000312428	ensembl	human	known	69_37n	missense	111	43.65	86	SNP	0.968	C
DPY19L1	23333	genome.wustl.edu	37	7	35057529	35057529	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr7:35057529T>A	ENST00000310974.4	-	3	301	c.157A>T	c.(157-159)Aca>Tca	p.T53S		NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	53						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						CTTTCCAATGTTGAGAGGTGA	0.313																																						dbGAP											0													80.0	80.0	80.0					7																	35057529		1969	4197	6166	-	-	-	SO:0001583	missense	0			AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.157A>T	7.37:g.35057529T>A	ENSP00000308695:p.Thr53Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O94954|Q4G151	Missense_Mutation	SNP	pfam_Dpy-19	p.T53S	ENST00000310974.4	37	c.157	CCDS43567.1	7	.	.	.	.	.	.	.	.	.	.	T	16.25	3.070442	0.55539	.	.	ENSG00000173852	ENST00000310974	T	0.54279	0.58	5.22	2.8	0.32819	.	0.073617	0.52532	U	0.000067	T	0.33323	0.0859	N	0.16368	0.405	0.40797	D	0.983309	B	0.21381	0.055	B	0.29942	0.109	T	0.05971	-1.0853	10	0.12103	T	0.63	-4.7301	9.3354	0.38047	0.0:0.149:0.0:0.851	.	53	Q2PZI1	D19L1_HUMAN	S	53	ENSP00000308695:T53S	ENSP00000308695:T53S	T	-	1	0	DPY19L1	35024054	1.000000	0.71417	0.403000	0.26384	0.968000	0.65278	4.666000	0.61554	0.377000	0.24735	0.477000	0.44152	ACA	DPY19L1	-	pfam_Dpy-19	ENSG00000173852		0.313	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L1	HGNC	protein_coding	OTTHUMT00000337506.1	400	0.00	0	T			35057529	35057529	-1	no_errors	ENST00000310974	ensembl	human	known	69_37n	missense	253	24.70	83	SNP	0.909	A
DYTN	391475	genome.wustl.edu	37	2	207530636	207530636	+	Missense_Mutation	SNP	A	A	C	rs569423152		TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:207530636A>C	ENST00000452335.2	-	10	1214	c.1098T>G	c.(1096-1098)gaT>gaG	p.D366E		NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	366						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		TCCATAGACTATCCTGGTTGG	0.428																																						dbGAP											0													254.0	232.0	239.0					2																	207530636		1879	4115	5994	-	-	-	SO:0001583	missense	0			ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.1098T>G	2.37:g.207530636A>C	ENSP00000396593:p.Asp366Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_EF-hand_dom_typ2,pfam_EF-hand_dom_typ1,pfam_Znf_ZZ,smart_Znf_ZZ,pfscan_Znf_ZZ	p.D366E	ENST00000452335.2	37	c.1098	CCDS46502.1	2	.	.	.	.	.	.	.	.	.	.	A	4.361	0.066479	0.08388	.	.	ENSG00000232125	ENST00000452335	T	0.17054	2.3	4.88	-9.77	0.00500	.	.	.	.	.	T	0.06508	0.0167	N	0.24115	0.695	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.32428	-0.9907	9	0.05351	T	0.99	-0.3478	6.3868	0.21566	0.129:0.3587:0.4234:0.089	.	366	A2CJ06	DYTN_HUMAN	E	366	ENSP00000396593:D366E	ENSP00000396593:D366E	D	-	3	2	DYTN	207238881	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.620000	0.02046	-3.097000	0.00245	0.454000	0.30748	GAT	DYTN	-	NULL	ENSG00000232125		0.428	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYTN	HGNC	protein_coding	OTTHUMT00000336799.1	889	0.11	1	A			207530636	207530636	-1	no_errors	ENST00000452335	ensembl	human	known	69_37n	missense	466	31.87	218	SNP	0.000	C
ELK1	2002	genome.wustl.edu	37	X	47498688	47498688	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chrX:47498688G>C	ENST00000247161.3	-	3	359	c.260C>G	c.(259-261)tCc>tGc	p.S87C	ELK1_ENST00000343894.4_Missense_Mutation_p.S87C|ELK1_ENST00000376983.3_Missense_Mutation_p.S87C|ELK1_ENST00000592066.1_Missense_Mutation_p.S33C	NM_005229.4	NP_005220.2	P19419	ELK1_HUMAN	ELK1, member of ETS oncogene family	87					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	10						CTCAGGGTAGGACACAAACTT	0.582																																						dbGAP											0													29.0	23.0	25.0					X																	47498688		2203	4300	6503	-	-	-	SO:0001583	missense	0			M25269	CCDS14283.1, CCDS59165.1	Xp11.23	2010-07-20			ENSG00000126767	ENSG00000126767			3321	protein-coding gene	gene with protein product		311040				2539641	Standard	NM_001114123		Approved		uc010nhv.4	P19419	OTTHUMG00000021452	ENST00000247161.3:c.260C>G	X.37:g.47498688G>C	ENSP00000247161:p.Ser87Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7H4|O75606|O95058|Q969X8|Q9UJM4	Missense_Mutation	SNP	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.S87C	ENST00000247161.3	37	c.260	CCDS14283.1	X	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483307	0.63962	.	.	ENSG00000126767	ENST00000247161;ENST00000376983;ENST00000343894	T;T;T	0.55413	0.52;0.52;0.52	5.52	5.52	0.82312	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (2);	0.104023	0.64402	D	0.000004	T	0.40040	0.1101	N	0.13272	0.32	0.45172	D	0.998189	P	0.37441	0.595	B	0.41646	0.362	T	0.39761	-0.9598	10	0.49607	T	0.09	.	11.7397	0.51786	0.0:0.1733:0.8267:0.0	.	87	P19419	ELK1_HUMAN	C	87	ENSP00000247161:S87C;ENSP00000366182:S87C;ENSP00000345585:S87C	ENSP00000247161:S87C	S	-	2	0	ELK1	47383632	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	4.241000	0.58707	2.448000	0.82819	0.600000	0.82982	TCC	ELK1	-	pfam_Ets,smart_Ets	ENSG00000126767		0.582	ELK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELK1	HGNC	protein_coding	OTTHUMT00000056436.1	30	0.00	0	G	NM_005229		47498688	47498688	-1	no_errors	ENST00000247161	ensembl	human	known	69_37n	missense	39	11.36	5	SNP	1.000	C
ENAM	10117	genome.wustl.edu	37	4	71510070	71510070	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr4:71510070G>C	ENST00000396073.3	+	9	3208	c.2927G>C	c.(2926-2928)aGt>aCt	p.S976T	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	976					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)		p.S976I(1)		haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			CCTGAAGCCAGTTCCCTTCAA	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	85.0	85.0					4																	71510070		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.2927G>C	4.37:g.71510070G>C	ENSP00000379383:p.Ser976Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RI5|Q9H3D1	Missense_Mutation	SNP	NULL	p.S976T	ENST00000396073.3	37	c.2927	CCDS3544.2	4	.	.	.	.	.	.	.	.	.	.	G	5.997	0.367809	0.11352	.	.	ENSG00000132464	ENST00000396073	T	0.34859	1.34	5.97	2.93	0.34026	.	0.482005	0.21374	N	0.075600	T	0.35740	0.0942	M	0.72894	2.215	0.09310	N	0.999998	B	0.16802	0.019	B	0.23419	0.046	T	0.27806	-1.0063	10	0.38643	T	0.18	-5.1348	8.2078	0.31465	0.2811:0.0:0.7189:0.0	.	976	Q9NRM1	ENAM_HUMAN	T	976	ENSP00000379383:S976T	ENSP00000379383:S976T	S	+	2	0	ENAM	71728934	0.007000	0.16637	0.738000	0.30950	0.377000	0.30045	0.141000	0.16076	0.876000	0.35872	0.655000	0.94253	AGT	ENAM	-	NULL	ENSG00000132464		0.413	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENAM	HGNC	protein_coding	OTTHUMT00000252166.3	245	0.00	0	G	NM_031889		71510070	71510070	+1	no_errors	ENST00000396073	ensembl	human	known	69_37n	missense	121	38.58	76	SNP	0.538	C
FADS2	9415	genome.wustl.edu	37	11	61624993	61624993	+	Missense_Mutation	SNP	G	G	C	rs2526677		TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr11:61624993G>C	ENST00000278840.4	+	7	1503	c.873G>C	c.(871-873)aaG>aaC	p.K291N	FADS2_ENST00000522056.1_Missense_Mutation_p.K260N|FADS2_ENST00000257261.6_Missense_Mutation_p.K269N|FADS2_ENST00000521849.1_Missense_Mutation_p.K291N	NM_004265.2	NP_004256.1	O95864	FADS2_HUMAN	fatty acid desaturase 2	291					alpha-linolenic acid metabolic process (GO:0036109)|linoleic acid metabolic process (GO:0043651)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			breast(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20					Alpha-Linolenic Acid(DB00132)	TCGTCCATAAGAACTGGGTGG	0.612																																						dbGAP											0													112.0	100.0	104.0					11																	61624993		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF084559	CCDS8012.1, CCDS60807.1, CCDS60808.1	11q12.2	2013-01-25			ENSG00000134824	ENSG00000134824	1.14.19.3	"""Fatty acid desaturases"""	3575	protein-coding gene	gene with protein product	"""delta-6-desaturase"""	606149		LLCDL2			Standard	NM_004265		Approved	FADSD6, D6D, TU13, DES6, SLL0262	uc001nsl.1	O95864	OTTHUMG00000163794	ENST00000278840.4:c.873G>C	11.37:g.61624993G>C	ENSP00000278840:p.Lys291Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2M6|B7Z634|Q6MZQ7|Q96H07|Q96SV8|Q9H3G3|Q9Y3X4	Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5,superfamily_Cyt_B5,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5	p.K291N	ENST00000278840.4	37	c.873	CCDS8012.1	11	.	.	.	.	.	.	.	.	.	.	G	9.349	1.064951	0.20067	.	.	ENSG00000134824	ENST00000257261;ENST00000522056;ENST00000278840;ENST00000521849;ENST00000521571;ENST00000355484	T;T;T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89;-0.89;-0.89	5.02	-1.97	0.07503	Fatty acid desaturase, type 1 (1);	0.433946	0.19972	N	0.101973	T	0.69895	0.3162	L	0.59436	1.845	0.09310	N	1	P;B;B;B	0.34699	0.464;0.254;0.057;0.371	B;B;B;B	0.42692	0.395;0.197;0.087;0.345	T	0.61922	-0.6963	10	0.25751	T	0.34	-0.0101	10.4316	0.44411	0.4381:0.0:0.5619:0.0	.	260;291;291;269	B7Z634;O95864;O95864-3;O95864-2	.;FADS2_HUMAN;.;.	N	269;260;291;291;57;57	ENSP00000257261:K269N;ENSP00000429500:K260N;ENSP00000278840:K291N;ENSP00000431091:K291N;ENSP00000443867:K57N;ENSP00000437965:K57N	ENSP00000257261:K269N	K	+	3	2	FADS2	61381569	0.000000	0.05858	0.002000	0.10522	0.188000	0.23474	-0.538000	0.06120	-0.271000	0.09272	0.561000	0.74099	AAG	FADS2	-	pfam_Fatty_acid_desaturase-1,pirsf_Fatty_acid/sphinglp_desaturase	ENSG00000134824		0.612	FADS2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS2	HGNC	protein_coding	OTTHUMT00000375586.2	291	0.00	0	G	NM_004265		61624993	61624993	+1	no_errors	ENST00000278840	ensembl	human	known	69_37n	missense	155	32.90	76	SNP	0.005	C
FBRSL1	57666	genome.wustl.edu	37	12	133158042	133158042	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr12:133158042T>A	ENST00000434748.2	+	14	3001	c.1981T>A	c.(1981-1983)Tcc>Acc	p.S661T	FBRSL1_ENST00000261673.6_Missense_Mutation_p.S588T	NM_001142641.1	NP_001136113.1	Q9HCM7	FBSL_HUMAN	fibrosin-like 1	661							poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(1)|stomach(1)	4						CCATCCTGCCTCCAACCCATT	0.647																																						dbGAP											0													29.0	34.0	32.0					12																	133158042		692	1590	2282	-	-	-	SO:0001583	missense	0				CCDS45010.1	12q24.33	2008-12-09			ENSG00000112787	ENSG00000112787			29308	protein-coding gene	gene with protein product						10997877	Standard	NM_001142641		Approved	KIAA1545	uc001ukf.3	Q9HCM7	OTTHUMG00000167991	ENST00000434748.2:c.1981T>A	12.37:g.133158042T>A	ENSP00000396160:p.Ser661Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XQ1	Missense_Mutation	SNP	prints_AUTS2	p.S661T	ENST00000434748.2	37	c.1981	CCDS45010.1	12	.	.	.	.	.	.	.	.	.	.	T	2.063	-0.414842	0.04766	.	.	ENSG00000112787	ENST00000434748;ENST00000261673	T;T	0.29917	1.55;1.55	4.94	-2.47	0.06442	.	0.349959	0.32703	N	0.005742	T	0.08714	0.0216	N	0.02247	-0.625	0.09310	N	0.999998	B	0.17268	0.021	B	0.18561	0.022	T	0.28038	-1.0056	10	0.16896	T	0.51	-12.7238	5.7414	0.18096	0.2966:0.0:0.4458:0.2576	.	661	Q9HCM7	FBSL_HUMAN	T	661;588	ENSP00000396160:S661T;ENSP00000261673:S588T	ENSP00000261673:S588T	S	+	1	0	FBRSL1	131668115	0.000000	0.05858	0.001000	0.08648	0.414000	0.31173	-0.215000	0.09279	-0.776000	0.04578	-0.908000	0.02827	TCC	FBRSL1	-	prints_AUTS2	ENSG00000112787		0.647	FBRSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBRSL1	HGNC	protein_coding	OTTHUMT00000397404.2	38	0.00	0	T			133158042	133158042	+1	no_errors	ENST00000434748	ensembl	human	known	69_37n	missense	35	37.50	21	SNP	0.059	A
FGFR2	2263	genome.wustl.edu	37	10	123263332	123263333	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr10:123263332_123263333CC>AA	ENST00000358487.5	-	10	1682_1683	c.1410_1411GG>TT	c.(1408-1413)gaGGac>gaTTac	p.470_471ED>DY	FGFR2_ENST00000360144.3_Missense_Mutation_p.382_383ED>DY|FGFR2_ENST00000351936.6_Missense_Mutation_p.468_469ED>DY|FGFR2_ENST00000356226.4_Missense_Mutation_p.353_354ED>DY|FGFR2_ENST00000357555.5_Missense_Mutation_p.381_382ED>DY|FGFR2_ENST00000346997.2_Missense_Mutation_p.468_469ED>DY|FGFR2_ENST00000369060.4_Missense_Mutation_p.354_355ED>DY|FGFR2_ENST00000457416.2_Missense_Mutation_p.471_472ED>DY|FGFR2_ENST00000478859.1_Missense_Mutation_p.242_243ED>DY|FGFR2_ENST00000369056.1_Missense_Mutation_p.471_472ED>DY|FGFR2_ENST00000369061.4_Missense_Mutation_p.358_359ED>DY|FGFR2_ENST00000369059.1_Missense_Mutation_p.356_357ED>DY	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	470					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.D471N(1)		breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	CATTTTGGGTCCTCTGGAAGTT	0.5		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																													dbGAP		Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)																																								-	-	-	SO:0001583	missense	0	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.1410_1411delinsAA	10.37:g.123263332_123263333delinsAA	ENSP00000351276:p.E470_D471delinsDY	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Missense_Mutation	SNP	pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D472Y|p.E471D	ENST00000358487.5	37	c.1414|c.1413	CCDS31298.1	10																																																																																			FGFR2	-	pirsf_Tyr_kinase_fibroblast_GF_rcpt,superfamily_Kinase-like_dom	ENSG00000066468		0.500	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	FGFR2	HGNC	protein_coding	OTTHUMT00000050715.1	264	0.00	0	C	NM_022976, NM_000141		123263332|123263333	123263332|123263333	-1	no_errors	ENST00000457416	ensembl	human	known	69_37n	missense	60|59	49.58|50.42	59|60	SNP	1.000	A
FHOD3	80206	genome.wustl.edu	37	18	34289076	34289076	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr18:34289076A>G	ENST00000359247.4	+	14	1679	c.1679A>G	c.(1678-1680)gAa>gGa	p.E560G	FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000445677.1_Missense_Mutation_p.E539G|FHOD3_ENST00000590592.1_Missense_Mutation_p.E752G|FHOD3_ENST00000587493.1_3'UTR|FHOD3_ENST00000257209.4_Missense_Mutation_p.E577G	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	560					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GGGGATCCTGAACCCGAATCA	0.547																																						dbGAP											0													90.0	108.0	102.0					18																	34289076		2203	4297	6500	-	-	-	SO:0001583	missense	0			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1679A>G	18.37:g.34289076A>G	ENSP00000352186:p.Glu560Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.E577G	ENST00000359247.4	37	c.1730		18	.	.	.	.	.	.	.	.	.	.	A	10.72	1.429808	0.25726	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.20598	2.06;2.07;2.07	5.78	-0.757	0.11054	.	0.479943	0.19729	N	0.107407	T	0.11110	0.0271	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.15719	0.0;0.014;0.0;0.0	B;B;B;B	0.11329	0.0;0.006;0.0;0.0	T	0.16571	-1.0398	10	0.46703	T	0.11	.	1.986	0.03436	0.5887:0.1244:0.167:0.1199	.	539;560;577;752	Q2V2M9-2;Q2V2M9;Q2V2M9-3;E5F5Q0	.;FHOD3_HUMAN;.;.	G	577;560;539	ENSP00000257209:E577G;ENSP00000352186:E560G;ENSP00000411430:E539G	ENSP00000257209:E577G	E	+	2	0	FHOD3	32543074	0.874000	0.30092	0.000000	0.03702	0.053000	0.15095	1.354000	0.34056	-0.350000	0.08262	0.533000	0.62120	GAA	FHOD3	-	NULL	ENSG00000134775		0.547	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1	79	0.00	0	A	XM_371114		34289076	34289076	+1	no_errors	ENST00000257209	ensembl	human	known	69_37n	missense	63	34.38	33	SNP	0.019	G
GHR	2690	genome.wustl.edu	37	5	42718684	42718684	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr5:42718684G>A	ENST00000230882.4	+	10	1265	c.1075G>A	c.(1075-1077)Gaa>Aaa	p.E359K	GHR_ENST00000357703.3_Missense_Mutation_p.E337K|GHR_ENST00000513625.1_3'UTR|GHR_ENST00000537449.1_Missense_Mutation_p.E172K	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	359					2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	AAAGACTGAGGAATCAGACAC	0.438																																						dbGAP											0													146.0	138.0	141.0					5																	42718684		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.1075G>A	5.37:g.42718684G>A	ENSP00000230882:p.Glu359Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HCX2	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.E359K	ENST00000230882.4	37	c.1075	CCDS3940.1	5	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141391	0.57044	.	.	ENSG00000112964	ENST00000230882;ENST00000357703;ENST00000537449	T;T;T	0.35973	1.28;1.28;1.28	5.86	5.86	0.93980	.	0.356482	0.35320	N	0.003285	T	0.43010	0.1228	L	0.55481	1.735	0.23336	N	0.997885	B	0.22003	0.063	B	0.30495	0.116	T	0.36672	-0.9738	10	0.54805	T	0.06	-7.2761	20.1882	0.98224	0.0:0.0:1.0:0.0	.	359	P10912	GHR_HUMAN	K	359;337;172	ENSP00000230882:E359K;ENSP00000350335:E337K;ENSP00000442206:E172K	ENSP00000230882:E359K	E	+	1	0	GHR	42754441	1.000000	0.71417	0.992000	0.48379	0.817000	0.46193	5.160000	0.64929	2.783000	0.95769	0.591000	0.81541	GAA	GHR	-	NULL	ENSG00000112964		0.438	GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHR	HGNC	protein_coding	OTTHUMT00000211605.2	235	0.84	2	G	NM_000163		42718684	42718684	+1	no_errors	ENST00000230882	ensembl	human	known	69_37n	missense	115	34.66	61	SNP	0.998	A
GOLGA6A	342096	genome.wustl.edu	37	15	74367318	74367318	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr15:74367318delG	ENST00000290438.3	-	11	912	c.872delC	c.(871-873)ccafs	p.P291fs	RN7SL429P_ENST00000479090.2_RNA	NM_001038640.2	NP_001033729.2	Q9NYA3	GOG6A_HUMAN	golgin A6 family, member A	291						Golgi apparatus (GO:0005794)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|liver(1)|lung(6)|prostate(1)|urinary_tract(1)	16						GGTCACTGCTGGGGGCGCCAG	0.552																																						dbGAP											0													6.0	9.0	8.0					15																	74367318		1434	3987	5421	-	-	-	SO:0001589	frameshift_variant	0			AF263742	CCDS32290.1	15q24.1	2013-05-10	2010-02-12	2009-09-28	ENSG00000159289	ENSG00000159289			13567	protein-coding gene	gene with protein product		610288	"""golgi autoantigen, golgin subfamily a, member 6"", ""golgi autoantigen, golgin subfamily a, 6"", ""golgi autoantigen, golgin subfamily a, 6A"""	GOLGA6		11161787	Standard	NM_001038640		Approved	GLP	uc002axa.1	Q9NYA3	OTTHUMG00000173035	ENST00000290438.3:c.872delC	15.37:g.74367318delG	ENSP00000290438:p.Pro291fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K959|Q9NYA7	Frame_Shift_Del	DEL	NULL	p.P291fs	ENST00000290438.3	37	c.872	CCDS32290.1	15																																																																																			GOLGA6A	-	NULL	ENSG00000159289		0.552	GOLGA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6A	HGNC	protein_coding	OTTHUMT00000421835.1	227	0.00	0	G	XM_292357		74367318	74367318	-1	no_errors	ENST00000290438	ensembl	human	known	69_37n	frame_shift_del	172	35.32	95	DEL	0.917	-
GRID1	2894	genome.wustl.edu	37	10	87615835	87615835	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr10:87615835G>C	ENST00000327946.7	-	7	1149	c.1064C>G	c.(1063-1065)tCc>tGc	p.S355C		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	355					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TGGCTTAGTGGATTTCCGTAT	0.537										Multiple Myeloma(13;0.14)																												dbGAP											0													169.0	137.0	148.0					10																	87615835		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1064C>G	10.37:g.87615835G>C	ENSP00000330148:p.Ser355Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S355C	ENST00000327946.7	37	c.1064	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862433	0.71949	.	.	ENSG00000182771	ENST00000327946	D	0.86769	-2.17	5.34	5.34	0.76211	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.92338	0.7569	L	0.57536	1.79	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.92789	0.6247	10	0.66056	D	0.02	.	18.0162	0.89241	0.0:0.0:1.0:0.0	.	355	Q9ULK0	GRID1_HUMAN	C	355	ENSP00000330148:S355C	ENSP00000330148:S355C	S	-	2	0	GRID1	87605815	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.868000	0.87116	2.501000	0.84356	0.655000	0.94253	TCC	GRID1	-	pfam_ANF_lig-bd_rcpt	ENSG00000182771		0.537	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	270	0.00	0	G	XM_043613		87615835	87615835	-1	no_errors	ENST00000327946	ensembl	human	known	69_37n	missense	164	33.87	84	SNP	1.000	C
HEATR5B	54497	genome.wustl.edu	37	2	37217922	37217922	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:37217922C>G	ENST00000233099.5	-	34	5661	c.5566G>C	c.(5566-5568)Gat>Cat	p.D1856H	HEATR5B_ENST00000354531.2_Missense_Mutation_p.D1767H	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1856						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				CTTACTTCATCAGGTGTAGGT	0.358																																						dbGAP											0													109.0	101.0	104.0					2																	37217922		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.5566G>C	2.37:g.37217922C>G	ENSP00000233099:p.Asp1856His	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D1856H	ENST00000233099.5	37	c.5566	CCDS33181.1	2	.	.	.	.	.	.	.	.	.	.	C	24.2	4.509416	0.85282	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	T;T	0.65732	-0.17;-0.17	5.52	5.52	0.82312	Armadillo-like helical (1);Armadillo-type fold (1);	0.047823	0.85682	D	0.000000	T	0.80380	0.4612	M	0.78456	2.415	0.40059	D	0.975876	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.79638	-0.1720	10	0.39692	T	0.17	-24.842	19.445	0.94843	0.0:1.0:0.0:0.0	.	1856;1856	Q9P2D3;B9EK47	HTR5B_HUMAN;.	H	1856;1767	ENSP00000233099:D1856H;ENSP00000346531:D1767H	ENSP00000233099:D1856H	D	-	1	0	HEATR5B	37071426	1.000000	0.71417	0.998000	0.56505	0.773000	0.43773	7.779000	0.85648	2.612000	0.88384	0.655000	0.94253	GAT	HEATR5B	-	superfamily_ARM-type_fold	ENSG00000008869		0.358	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR5B	HGNC	protein_coding	OTTHUMT00000325492.1	365	0.00	0	C	NM_019024		37217922	37217922	-1	no_errors	ENST00000233099	ensembl	human	known	69_37n	missense	198	29.68	84	SNP	1.000	G
HFE2	148738	genome.wustl.edu	37	1	145415526	145415526	+	Missense_Mutation	SNP	C	C	G	rs142575526		TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr1:145415526C>G	ENST00000336751.5	+	3	583	c.345C>G	c.(343-345)atC>atG	p.I115M	HFE2_ENST00000357836.5_Missense_Mutation_p.I2M|HFE2_ENST00000475797.1_Intron|HFE2_ENST00000497365.1_Intron	NM_213653.3	NP_998818.1	Q6ZVN8	RGMC_HUMAN	hemochromatosis type 2 (juvenile)	115					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|iron ion homeostasis (GO:0055072)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	14	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ACCTGATGATCCAGCACAACT	0.731																																						dbGAP											0													32.0	35.0	34.0					1																	145415526		2203	4298	6501	-	-	-	SO:0001583	missense	0			AY372521	CCDS72877.1, CCDS72878.1, CCDS72879.1	1q21.2	2014-06-26			ENSG00000168509	ENSG00000168509			4887	protein-coding gene	gene with protein product	"""repulsive guidance molecule c"""	608374				10205270, 14647275	Standard	NM_213653		Approved	JH, HFE2A, RGMC, HJV, hemojuvelin, haemojuvelin	uc001eni.2	Q6ZVN8	OTTHUMG00000013748	ENST00000336751.5:c.345C>G	1.37:g.145415526C>G	ENSP00000337014:p.Ile115Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALI7|Q2PQ63|Q6IMF6|Q8NAH2|Q8WVJ5	Missense_Mutation	SNP	pfam_RGM_N,pfam_RGM_C	p.I115M	ENST00000336751.5	37	c.345	CCDS910.1	1	.	.	.	.	.	.	.	.	.	.	C	16.30	3.084701	0.55861	.	.	ENSG00000168509	ENST00000357836;ENST00000336751	D;D	0.97430	-4.38;-4.38	4.72	-3.68	0.04463	Repulsive guidance molecule, N-terminal (1);	0.109676	0.52532	D	0.000074	D	0.92126	0.7504	L	0.54323	1.7	0.80722	D	1	P	0.48503	0.911	P	0.52267	0.694	D	0.86571	0.1847	10	0.45353	T	0.12	-14.9301	0.7973	0.01068	0.2468:0.2363:0.1212:0.3957	.	115	Q6ZVN8	RGMC_HUMAN	M	2;115	ENSP00000350495:I2M;ENSP00000337014:I115M	ENSP00000337014:I115M	I	+	3	3	HFE2	144126883	0.061000	0.20836	0.828000	0.32881	0.992000	0.81027	-0.596000	0.05720	-1.037000	0.03283	-0.258000	0.10820	ATC	HFE2	-	pfam_RGM_N	ENSG00000168509		0.731	HFE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HFE2	HGNC	protein_coding	OTTHUMT00000038527.1	8	0.00	0	C	NM_145277		145415526	145415526	+1	no_errors	ENST00000336751	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	0.338	G
TMEM86A	144110	genome.wustl.edu	37	11	18727602	18727602	+	IGR	SNP	C	C	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr11:18727602C>T	ENST00000280734.2	+	0	3595				RP11-1081L13.4_ENST00000527285.1_RNA|IGSF22_ENST00000513874.1_Silent_p.V1224V|IGSF22_ENST00000510673.1_5'UTR	NM_153347.1	NP_699178.1	Q8N2M4	TM86A_HUMAN	transmembrane protein 86A							integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	11						GGCCGCGGAGCACCGTGTGTG	0.667																																						dbGAP											0													71.0	70.0	70.0					11																	18727602		692	1591	2283	-	-	-	SO:0001628	intergenic_variant	0			BC035692	CCDS7844.1	11p15.1	2005-10-28				ENSG00000151117			26890	protein-coding gene	gene with protein product							Standard	NM_153347		Approved	FLJ90119	uc001moz.1	Q8N2M4			11.37:g.18727602C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AJ0	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V1224	ENST00000280734.2	37	c.3672	CCDS7844.1	11																																																																																			IGSF22	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000179057		0.667	TMEM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	HGNC	protein_coding	OTTHUMT00000387812.1	74	0.00	0	C	NM_153347		18727602	18727602	-1	no_errors	ENST00000513874	ensembl	human	known	69_37n	silent	53	33.33	27	SNP	0.308	T
INADL	10207	genome.wustl.edu	37	1	62293244	62293244	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr1:62293244delC	ENST00000371158.2	+	16	2083	c.1969delC	c.(1969-1971)cctfs	p.P657fs	INADL_ENST00000316485.6_Frame_Shift_Del_p.P657fs	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	657					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						AACCTCTCTTCCTGAGACAGA	0.458																																						dbGAP											0													134.0	130.0	131.0					1																	62293244		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.1969delC	1.37:g.62293244delC	ENSP00000360200:p.Pro657fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Frame_Shift_Del	DEL	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_L27,smart_PDZ,pfscan_L27,pfscan_PDZ	p.P657fs	ENST00000371158.2	37	c.1969	CCDS617.2	1																																																																																			INADL	-	NULL	ENSG00000132849		0.458	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INADL	HGNC	protein_coding	OTTHUMT00000023639.2	334	0.00	0	C	NM_170605		62293244	62293244	+1	no_errors	ENST00000371158	ensembl	human	known	69_37n	frame_shift_del	174	30.74	79	DEL	0.000	-
ITGA10	8515	genome.wustl.edu	37	1	145530313	145530313	+	Silent	SNP	C	C	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr1:145530313C>T	ENST00000369304.3	+	6	703	c.528C>T	c.(526-528)aaC>aaT	p.N176N	ITGA10_ENST00000538811.1_Silent_p.N45N|ITGA10_ENST00000539363.1_Silent_p.N33N	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	176	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ATGGCTCCAACAGCATCTACC	0.493																																						dbGAP											0													207.0	164.0	179.0					1																	145530313		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.528C>T	1.37:g.145530313C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.N176	ENST00000369304.3	37	c.528	CCDS918.1	1																																																																																			ITGA10	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000143127		0.493	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2	198	0.00	0	C	NM_003637		145530313	145530313	+1	no_errors	ENST00000369304	ensembl	human	known	69_37n	silent	115	31.55	53	SNP	1.000	T
KCNH7	90134	genome.wustl.edu	37	2	163236470	163236470	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:163236470delA	ENST00000332142.5	-	14	3123	c.3024delT	c.(3022-3024)agtfs	p.S1008fs		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	1008					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GTGCAGATGGACTGGAGTCTT	0.502																																					GBM(196;1492 2208 17507 24132 45496)	dbGAP											0													197.0	182.0	187.0					2																	163236470		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.3024delT	2.37:g.163236470delA	ENSP00000331727:p.Ser1008fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Frame_Shift_Del	DEL	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold_3,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,tigrfam_PAS	p.P1009fs	ENST00000332142.5	37	c.3024	CCDS2219.1	2																																																																																			KCNH7	-	NULL	ENSG00000184611		0.502	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	HGNC	protein_coding	OTTHUMT00000255093.1	346	0.00	0	A	NM_033272		163236470	163236470	-1	no_errors	ENST00000332142	ensembl	human	known	69_37n	frame_shift_del	160	31.28	76	DEL	0.985	-
CEMIP	57214	genome.wustl.edu	37	15	81216988	81216988	+	Silent	SNP	C	C	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr15:81216988C>G	ENST00000394685.3	+	18	2648	c.2229C>G	c.(2227-2229)gtC>gtG	p.V743V	RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Silent_p.V743V|KIAA1199_ENST00000356249.5_Silent_p.V743V			Q8WUJ3	CEMIP_HUMAN		743					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						ACAACGGAGTCAAAACCACCG	0.532																																						dbGAP											0													120.0	99.0	106.0					15																	81216988		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000394685.3:c.2229C>G	15.37:g.81216988C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.V743	ENST00000394685.3	37	c.2229	CCDS10315.1	15																																																																																			KIAA1199	-	superfamily_Pectin_lyase_fold/virulence	ENSG00000103888		0.532	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1199	HGNC	protein_coding	OTTHUMT00000291389.1	165	0.00	0	C			81216988	81216988	+1	no_errors	ENST00000220244	ensembl	human	known	69_37n	silent	181	24.58	59	SNP	0.999	G
KIAA1549L	25758	genome.wustl.edu	37	11	33667477	33667477	+	Silent	SNP	G	G	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr11:33667477G>A	ENST00000321505.4	+	16	4944	c.4764G>A	c.(4762-4764)tcG>tcA	p.S1588S	KIAA1549L_ENST00000389726.3_Silent_p.S1594S			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1588						integral component of membrane (GO:0016021)											TGCCCTATTCGGAGGTGGTGA	0.682																																						dbGAP											0													17.0	20.0	19.0					11																	33667477		2024	4177	6201	-	-	-	SO:0001819	synonymous_variant	0			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.4764G>A	11.37:g.33667477G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYU0	Silent	SNP	NULL	p.S1594	ENST00000321505.4	37	c.4782	CCDS44565.2	11																																																																																			KIAA1549L	-	NULL	ENSG00000110427		0.682	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1549L	HGNC	protein_coding	OTTHUMT00000317998.1	33	0.00	0	G	NM_012194		33667477	33667477	+1	no_errors	ENST00000389726	ensembl	human	known	69_37n	silent	25	37.50	15	SNP	0.000	A
KREMEN1	83999	genome.wustl.edu	37	22	29534662	29534662	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr22:29534662G>T	ENST00000407188.1	+	7	1009	c.1009G>T	c.(1009-1011)Gcc>Tcc	p.A337S	KREMEN1_ENST00000400335.4_Missense_Mutation_p.A339S|KREMEN1_ENST00000327813.5_Missense_Mutation_p.A339S|KREMEN1_ENST00000400338.2_Missense_Mutation_p.A339S			Q96MU8	KREM1_HUMAN	kringle containing transmembrane protein 1	337					cell communication (GO:0007154)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.A339S(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	20						CCAGACGGTGGCCGAGGTGAT	0.582																																						dbGAP											1	Substitution - Missense(1)	lung(1)											68.0	77.0	74.0					22																	29534662		2019	4186	6205	-	-	-	SO:0001583	missense	0			AB059618	CCDS43000.1, CCDS13849.1, CCDS43000.2	22q12.1	2008-03-27	2002-11-13	2002-11-15	ENSG00000183762	ENSG00000183762			17550	protein-coding gene	gene with protein product		609898	"""kringle containing transmembrane protein"""	KREMEN		11267660	Standard	NM_001039570		Approved	KRM1	uc011akm.1	Q96MU8	OTTHUMG00000030987	ENST00000407188.1:c.1009G>T	22.37:g.29534662G>T	ENSP00000385431:p.Ala337Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QY46|B0QY47|B1AJR5|Q5TIB9|Q6P3X6|Q9BY70|Q9UGS5|Q9UGU1	Missense_Mutation	SNP	pirsf_Kremen,pfam_Kringle,pfam_WSC_carb-bd,pfam_CUB,superfamily_Kringle-like,superfamily_CUB,smart_Kringle,smart_WSC_carb-bd_subgr,smart_CUB,pfscan_CUB,pfscan_Kringle,pfscan_WSC_carb-bd	p.A339S	ENST00000407188.1	37	c.1015	CCDS43000.2	22	.	.	.	.	.	.	.	.	.	.	G	9.672	1.147062	0.21288	.	.	ENSG00000183762	ENST00000400335;ENST00000400338;ENST00000327813;ENST00000407188	T;T;T;T	0.60040	0.24;0.22;0.24;0.22	5.3	2.84	0.33178	.	0.413038	0.21424	N	0.074778	T	0.29783	0.0744	N	0.04508	-0.205	0.23913	N	0.996484	B;B;B	0.25272	0.013;0.018;0.122	B;B;B	0.28305	0.003;0.019;0.088	T	0.08994	-1.0695	10	0.38643	T	0.18	.	3.7719	0.08645	0.2016:0.2285:0.5699:0.0	.	337;339;339	Q96MU8;Q96MU8-2;Q96MU8-3	KREM1_HUMAN;.;.	S	339;339;339;337	ENSP00000383189:A339S;ENSP00000383192:A339S;ENSP00000331242:A339S;ENSP00000385431:A337S	ENSP00000331242:A339S	A	+	1	0	KREMEN1	27864662	0.794000	0.28838	0.919000	0.36401	0.271000	0.26615	0.894000	0.28350	1.378000	0.46305	0.655000	0.94253	GCC	KREMEN1	-	pirsf_Kremen	ENSG00000183762		0.582	KREMEN1-004	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	KREMEN1	HGNC	protein_coding	OTTHUMT00000320947.1	183	0.00	0	G			29534662	29534662	+1	no_errors	ENST00000327813	ensembl	human	known	69_37n	missense	59	59.59	87	SNP	0.686	T
KRTAP5-1	387264	genome.wustl.edu	37	11	1606146	1606147	+	In_Frame_Ins	INS	-	-	GCC	rs138363822|rs199501537	byFrequency	TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr11:1606146_1606147insGCC	ENST00000382171.2	-	1	366_367	c.333_334insGGC	c.(331-336)tcttgt>tctGGCtgt	p.111_112SC>SGC	KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	111	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GATCCCCCACAAGAGCCACAGC	0.663																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.333_334insGGC	11.37:g.1606146_1606147insGCC	ENSP00000371606:p.Ser111_Cys112insGly	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Ins	INS	NULL	p.111in_frame_insG	ENST00000382171.2	37	c.334_333	CCDS31330.1	11																																																																																			KRTAP5-1	-	NULL	ENSG00000205869		0.663	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-1	HGNC	protein_coding	OTTHUMT00000127922.1	15	0.00	0	-	NM_001005922		1606146	1606147	-1	no_errors	ENST00000382171	ensembl	human	known	69_37n	in_frame_ins	9	30.77	4	INS	0.458:0.354	GCC
LETM1	3954	genome.wustl.edu	37	4	1836571	1836571	+	Splice_Site	SNP	C	C	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr4:1836571C>A	ENST00000302787.2	-	5	1173		c.e5+1			NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1						cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			TATCACAGCACCTTCTGGAAA	0.562																																						dbGAP											0													127.0	115.0	119.0					4																	1836571		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.876+1G>T	4.37:g.1836571C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DED2|Q9UF65	Splice_Site	SNP	-	e5+1	ENST00000302787.2	37	c.876+1	CCDS3355.1	4	.	.	.	.	.	.	.	.	.	.	-	24.4	4.527431	0.85706	.	.	ENSG00000168924	ENST00000302787	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7392	0.91767	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LETM1	1806369	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	5.591000	0.67536	2.433000	0.82419	0.486000	0.48141	.	LETM1	-	-	ENSG00000168924		0.562	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LETM1	HGNC	protein_coding	OTTHUMT00000241634.1	124	0.00	0	C		Intron	1836571	1836571	-1	no_errors	ENST00000302787	ensembl	human	known	69_37n	splice_site	85	33.85	44	SNP	1.000	A
LRRC4B	94030	genome.wustl.edu	37	19	51022417	51022417	+	Silent	SNP	G	G	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr19:51022417G>T	ENST00000599957.1	-	3	750	c.553C>A	c.(553-555)Cgg>Agg	p.R185R	LRRC4B_ENST00000389201.3_Silent_p.R185R			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	185					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		TCCAGGCGCCGCAGCGAGGGC	0.652																																						dbGAP											0													44.0	51.0	49.0					19																	51022417		2196	4298	6494	-	-	-	SO:0001819	synonymous_variant	0			BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.553C>A	19.37:g.51022417G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCQ4|Q58F20	Silent	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R185	ENST00000599957.1	37	c.553	CCDS42595.1	19																																																																																			LRRC4B	-	NULL	ENSG00000131409		0.652	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4B	HGNC	protein_coding	OTTHUMT00000464907.1	64	0.00	0	G	NM_001080457		51022417	51022417	-1	no_errors	ENST00000389201	ensembl	human	known	69_37n	silent	62	30.34	27	SNP	1.000	T
MAP2	4133	genome.wustl.edu	37	2	210559282	210559282	+	Silent	SNP	C	C	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:210559282C>T	ENST00000360351.4	+	7	2894	c.2388C>T	c.(2386-2388)taC>taT	p.Y796Y	MAP2_ENST00000199940.6_Intron|MAP2_ENST00000447185.1_Silent_p.Y792Y|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000361559.4_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	796					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AAGATTTTTACAAAAATGGTA	0.443																																					Pancreas(27;423 979 28787 29963)	dbGAP											0													116.0	116.0	116.0					2																	210559282		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2388C>T	2.37:g.210559282C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	pfam_MAP2_projctn,pfam_Tau/MAP_tubulin-bd_rpt	p.Y796	ENST00000360351.4	37	c.2388	CCDS2384.1	2																																																																																			MAP2	-	pfam_MAP2_projctn	ENSG00000078018		0.443	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	210	0.00	0	C	NM_001039538		210559282	210559282	+1	no_errors	ENST00000360351	ensembl	human	known	69_37n	silent	123	17.45	26	SNP	1.000	T
MAS1	4142	genome.wustl.edu	37	6	160328951	160328951	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr6:160328951G>C	ENST00000252660.4	+	1	978	c.964G>C	c.(964-966)Gag>Cag	p.E322Q		NM_002377.2	NP_002368.1	P04201	MAS_HUMAN	MAS1 proto-oncogene, G protein-coupled receptor	322					activation of NF-kappaB-inducing kinase activity (GO:0007250)|anatomical structure morphogenesis (GO:0009653)|cell proliferation (GO:0008283)|cellular response to peptide hormone stimulus (GO:0071375)|G-protein coupled receptor signaling pathway (GO:0007186)|hippocampus development (GO:0021766)|male gonad development (GO:0008584)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|protein kinase C signaling (GO:0070528)|regulation of inflammatory response (GO:0050727)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin receptor activity (GO:0001595)|angiotensin type II receptor activity (GO:0004945)|G-protein coupled receptor activity (GO:0004930)|peptide binding (GO:0042277)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.6e-06)		GGTCACAGTTGAGACTGTCGT	0.408																																						dbGAP											0													58.0	59.0	58.0					6																	160328951		2163	4292	6455	-	-	-	SO:0001583	missense	0			M13150	CCDS5272.1	6q24-q27	2014-06-26	2014-06-26		ENSG00000130368	ENSG00000130368		"""GPCR / Class A : Orphans"""	6899	protein-coding gene	gene with protein product		165180	"""MAS1 oncogene"""				Standard	NM_002377		Approved		uc003qsz.3	P04201	OTTHUMG00000015944	ENST00000252660.4:c.964G>C	6.37:g.160328951G>C	ENSP00000252660:p.Glu322Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5B3|Q2TBC9|Q6FG47	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Mas_TM,prints_7TM_GPCR_Rhodpsn	p.E322Q	ENST00000252660.4	37	c.964	CCDS5272.1	6	.	.	.	.	.	.	.	.	.	.	G	11.17	1.558385	0.27827	.	.	ENSG00000130368	ENST00000252660	T	0.21031	2.03	5.26	5.26	0.73747	.	0.000000	0.48286	D	0.000187	T	0.34658	0.0905	L	0.55834	1.745	0.45528	D	0.998482	D	0.89917	1.0	D	0.80764	0.994	T	0.05937	-1.0855	10	0.56958	D	0.05	.	17.8612	0.88781	0.0:0.0:1.0:0.0	.	322	P04201	MAS_HUMAN	Q	322	ENSP00000252660:E322Q	ENSP00000252660:E322Q	E	+	1	0	MAS1	160248941	1.000000	0.71417	0.951000	0.38953	0.014000	0.08584	4.989000	0.63870	2.443000	0.82685	0.655000	0.94253	GAG	MAS1	-	prints_Mas_TM	ENSG00000130368		0.408	MAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAS1	HGNC	protein_coding	OTTHUMT00000042930.2	64	0.00	0	G	NM_002377		160328951	160328951	+1	no_errors	ENST00000252660	ensembl	human	known	69_37n	missense	37	50.00	37	SNP	1.000	C
METTL23	124512	genome.wustl.edu	37	17	74729124	74729124	+	Nonsense_Mutation	SNP	C	C	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr17:74729124C>G	ENST00000341249.6	+	3	481	c.149C>G	c.(148-150)tCa>tGa	p.S50*	METTL23_ENST00000591571.1_5'UTR|METTL23_ENST00000589977.1_Nonsense_Mutation_p.S50*|METTL23_ENST00000586752.1_5'UTR|RP11-318A15.7_ENST00000587459.1_Nonsense_Mutation_p.S22*|METTL23_ENST00000586200.1_Intron|METTL23_ENST00000586738.1_Nonsense_Mutation_p.S50*|METTL23_ENST00000588302.1_5'UTR|METTL23_ENST00000588783.1_Nonsense_Mutation_p.S50*|MFSD11_ENST00000586622.1_5'Flank|METTL23_ENST00000588822.1_5'UTR|METTL23_ENST00000590964.1_5'UTR	NM_001206984.1	NP_001193913.1	Q86XA0	MET23_HUMAN	methyltransferase like 23	50						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	methyltransferase activity (GO:0008168)			large_intestine(2)|lung(1)	3						GTAATACTGTCAGACAGCTCA	0.453																																						dbGAP											0													36.0	34.0	35.0					17																	74729124		1926	4136	6062	-	-	-	SO:0001587	stop_gained	0				CCDS45787.1, CCDS59298.1	17q25.2	2011-03-03	2011-03-03	2011-03-03	ENSG00000181038	ENSG00000181038			26988	protein-coding gene	gene with protein product		615262	"""chromosome 17 open reading frame 95"""	C17orf95		12477932	Standard	NM_001080510		Approved	LOC124512	uc021udl.1	Q86XA0		ENST00000341249.6:c.149C>G	17.37:g.74729124C>G	ENSP00000341543:p.Ser50*	Somatic		WXS	Illumina GAIIx	Phase_IV	H9ZYJ0|K7EK32	Nonsense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.S50*	ENST00000341249.6	37	c.149	CCDS45787.1	17	.	.	.	.	.	.	.	.	.	.	C	38	6.717670	0.97784	.	.	ENSG00000181038	ENST00000317409;ENST00000341249	.	.	.	5.82	4.86	0.63082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.9889	14.6783	0.68998	0.0:0.9297:0.0:0.0703	.	.	.	.	X	129;50	.	ENSP00000316862:S129X	S	+	2	0	METTL23	72240719	1.000000	0.71417	0.521000	0.27850	0.802000	0.45316	7.384000	0.79751	1.471000	0.48121	0.563000	0.77884	TCA	METTL23	-	pfam_Nicotinamide_N-MeTfrase-like	ENSG00000181038		0.453	METTL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL23	HGNC	protein_coding	OTTHUMT00000451002.1	123	0.00	0	C	NM_001080510		74729124	74729124	+1	no_errors	ENST00000341249	ensembl	human	known	69_37n	nonsense	196	14.04	32	SNP	0.999	G
MGAT5B	146664	genome.wustl.edu	37	17	74934211	74934211	+	Missense_Mutation	SNP	C	C	A	rs200596583		TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr17:74934211C>A	ENST00000569840.2	+	13	2144	c.1570C>A	c.(1570-1572)Ctg>Atg	p.L524M	MGAT5B_ENST00000301618.4_Missense_Mutation_p.L522M|MGAT5B_ENST00000428789.2_Missense_Mutation_p.L533M	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	524					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TCAGCAGCTGCTGCGCAAGGC	0.627																																						dbGAP											0													60.0	55.0	57.0					17																	74934211		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.1570C>A	17.37:g.74934211C>A	ENSP00000456037:p.Leu524Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Missense_Mutation	SNP	superfamily_PyrdxlP-dep_Trfase_major_dom	p.L533M	ENST00000569840.2	37	c.1597	CCDS59299.1	17	.	.	.	.	.	.	.	.	.	.	C	15.33	2.800484	0.50315	.	.	ENSG00000167889	ENST00000301618;ENST00000428789	T;T	0.59772	0.25;0.24	4.78	2.35	0.29111	.	0.000000	0.64402	D	0.000001	T	0.68118	0.2966	L	0.52905	1.665	0.58432	D	0.999993	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	T	0.67772	-0.5584	10	0.46703	T	0.11	-18.8275	11.6299	0.51168	0.0:0.8267:0.0:0.1733	.	533;522	Q3V5L5-2;Q3V5L5-5	.;.	M	522;533	ENSP00000301618:L522M;ENSP00000391227:L533M	ENSP00000301618:L522M	L	+	1	2	MGAT5B	72445806	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	3.108000	0.50337	0.988000	0.38734	0.555000	0.69702	CTG	MGAT5B	-	NULL	ENSG00000167889		0.627	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGAT5B	HGNC	protein_coding	OTTHUMT00000460624.2	62	0.00	0	C	NM_144677		74934211	74934211	+1	no_errors	ENST00000428789	ensembl	human	known	69_37n	missense	125	16.11	24	SNP	1.000	A
MYO18B	84700	genome.wustl.edu	37	22	26299726	26299726	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr22:26299726G>T	ENST00000407587.2	+	31	5248	c.5079G>T	c.(5077-5079)aaG>aaT	p.K1693N	CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA|CTA-125H2.2_ENST00000609275.1_RNA|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|MYO18B_ENST00000536204.1_3'UTR|CTA-125H2.2_ENST00000600211.1_RNA|MYO18B_ENST00000335473.7_Missense_Mutation_p.K1692N|MYO18B_ENST00000536101.1_Missense_Mutation_p.K1692N|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1692	Gln-rich.|Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GGCTCTGGAAGTTGGAATCCA	0.557																																						dbGAP											0													45.0	50.0	48.0					22																	26299726		1918	4127	6045	-	-	-	SO:0001583	missense	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.5079G>T	22.37:g.26299726G>T	ENSP00000386096:p.Lys1693Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd_dom,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K1692N	ENST00000407587.2	37	c.5076		22	.	.	.	.	.	.	.	.	.	.	G	11.45	1.642938	0.29246	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.86627	-2.13;-2.13;-2.15	4.74	-4.2	0.03823	.	0.444445	0.23123	N	0.051665	T	0.73210	0.3558	L	0.44542	1.39	0.22446	N	0.999091	P;P;P;P	0.43352	0.688;0.704;0.763;0.804	B;B;B;B	0.37144	0.165;0.113;0.242;0.225	T	0.66999	-0.5781	10	0.72032	D	0.01	.	1.5905	0.02653	0.414:0.2717:0.1881:0.1262	.	1205;1692;1693;1692	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	N	1692;1692;1693	ENSP00000441229:K1692N;ENSP00000334563:K1692N;ENSP00000386096:K1693N	ENSP00000334563:K1692N	K	+	3	2	MYO18B	24629726	0.549000	0.26481	0.978000	0.43139	0.134000	0.20937	-0.518000	0.06267	-0.430000	0.07318	0.655000	0.94253	AAG	MYO18B	-	NULL	ENSG00000133454		0.557	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	162	0.00	0	G	NM_032608		26299726	26299726	+1	no_errors	ENST00000335473	ensembl	human	known	69_37n	missense	144	13.25	22	SNP	0.903	T
NAV3	89795	genome.wustl.edu	37	12	78542637	78542637	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr12:78542637C>T	ENST00000397909.2	+	22	4896	c.4723C>T	c.(4723-4725)Cgg>Tgg	p.R1575W	NAV3_ENST00000536525.2_Missense_Mutation_p.R1575W|NAV3_ENST00000266692.7_Missense_Mutation_p.R1398W|NAV3_ENST00000228327.6_Missense_Mutation_p.R1575W			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1575						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.R1575G(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CCATAAACTGCGGAGAGAGCT	0.333										HNSCC(70;0.22)																												dbGAP											1	Substitution - Missense(1)	lung(1)											74.0	71.0	72.0					12																	78542637		1841	4094	5935	-	-	-	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4723C>T	12.37:g.78542637C>T	ENSP00000381007:p.Arg1575Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.R1575W	ENST00000397909.2	37	c.4723		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.22|17.22	3.333227|3.333227	0.60853|0.60853	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000552895|ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788	.|D;D;D;D;D	.|0.95518	.|-3.73;-3.73;-3.73;-3.73;-3.73	5.42|5.42	3.54|3.54	0.40534|0.40534	.|.	.|0.000000	.|0.36778	.|U	.|0.002418	D|D	0.96790|0.96790	0.8952|0.8952	M|M	0.62266|0.62266	1.93|1.93	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;0.988;0.999;0.996	D|D	0.96238|0.96238	0.9173|0.9173	5|10	.|0.62326	.|D	.|0.03	-14.3427|-14.3427	13.022|13.022	0.58794|0.58794	0.4239:0.5761:0.0:0.0|0.4239:0.5761:0.0:0.0	.|.	.|1575;1398;1575;1575	.|E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.|.;.;NAV3_HUMAN;.	V|W	469|1575;1575;1575;1398;196;204	.|ENSP00000446132:R1575W;ENSP00000381007:R1575W;ENSP00000228327:R1575W;ENSP00000266692:R1398W;ENSP00000448303:R204W	.|ENSP00000228327:R1575W	A|R	+|+	2|1	0|2	NAV3|NAV3	77066768|77066768	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.931000|0.931000	0.56810|0.56810	1.228000|1.228000	0.32588|0.32588	0.626000|0.626000	0.30322|0.30322	-0.188000|-0.188000	0.12872|0.12872	GCG|CGG	NAV3	-	NULL	ENSG00000067798		0.333	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	414	0.24	1	C	NM_001024383		78542637	78542637	+1	no_errors	ENST00000397909	ensembl	human	known	69_37n	missense	285	48.19	266	SNP	1.000	T
NCAM2	4685	genome.wustl.edu	37	21	22664443	22664443	+	Silent	SNP	A	A	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr21:22664443A>T	ENST00000400546.1	+	5	750	c.501A>T	c.(499-501)gcA>gcT	p.A167A	NCAM2_ENST00000486367.1_3'UTR|NCAM2_ENST00000284894.7_Silent_p.A25A|NCAM2_ENST00000535285.1_Silent_p.A192A	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	167	Ig-like C2-type 2.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		CTATGTTAGCAAACAATAACC	0.393																																						dbGAP											0													142.0	130.0	134.0					21																	22664443		1840	4099	5939	-	-	-	SO:0001819	synonymous_variant	0				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.501A>T	21.37:g.22664443A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQ06|B7Z841|Q7Z7F2	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like,prints_Neural_cell_adh	p.A167	ENST00000400546.1	37	c.501	CCDS42910.1	21																																																																																			NCAM2	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000154654		0.393	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1	556	0.18	1	A	NM_004540		22664443	22664443	+1	no_errors	ENST00000400546	ensembl	human	known	69_37n	silent	307	33.84	157	SNP	0.977	T
NEO1	4756	genome.wustl.edu	37	15	73409162	73409162	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr15:73409162A>C	ENST00000339362.5	+	3	859	c.412A>C	c.(412-414)Act>Cct	p.T138P	NEO1_ENST00000558964.1_Missense_Mutation_p.T138P|NEO1_ENST00000261908.6_Missense_Mutation_p.T138P|NEO1_ENST00000560262.1_Missense_Mutation_p.T138P			Q92859	NEO1_HUMAN	neogenin 1	138	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						GAGTCTTGGAACTATTATCAG	0.343																																						dbGAP											0													97.0	96.0	97.0					15																	73409162		2198	4296	6494	-	-	-	SO:0001583	missense	0			U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.412A>C	15.37:g.73409162A>C	ENSP00000341198:p.Thr138Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.T138P	ENST00000339362.5	37	c.412	CCDS10247.1	15	.	.	.	.	.	.	.	.	.	.	A	21.4	4.136892	0.77662	.	.	ENSG00000067141	ENST00000339362;ENST00000261908	T;T	0.40225	1.04;1.04	5.92	5.92	0.95590	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.147898	0.64402	D	0.000014	T	0.52468	0.1736	L	0.43554	1.36	0.50632	D	0.999881	D;P;P	0.54601	0.967;0.747;0.933	P;P;P	0.58077	0.832;0.756;0.826	T	0.45745	-0.9240	10	0.36615	T	0.2	-23.5276	16.371	0.83361	1.0:0.0:0.0:0.0	.	138;138;138	B7ZKM9;B7ZKN0;Q92859	.;.;NEO1_HUMAN	P	138	ENSP00000341198:T138P;ENSP00000261908:T138P	ENSP00000261908:T138P	T	+	1	0	NEO1	71196215	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.454000	0.73493	2.267000	0.75376	0.477000	0.44152	ACT	NEO1	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000067141		0.343	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEO1	HGNC	protein_coding	OTTHUMT00000257472.2	290	0.00	0	A	NM_002499		73409162	73409162	+1	no_errors	ENST00000261908	ensembl	human	known	69_37n	missense	224	26.56	81	SNP	1.000	C
NLRP12	91662	genome.wustl.edu	37	19	54307284	54307284	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr19:54307284C>T	ENST00000324134.6	-	6	2675	c.2507G>A	c.(2506-2508)gGa>gAa	p.G836E	NLRP12_ENST00000391772.1_Missense_Mutation_p.G837E|NLRP12_ENST00000354278.3_Missense_Mutation_p.G836E|NLRP12_ENST00000391773.1_Missense_Mutation_p.G837E|NLRP12_ENST00000391775.3_Missense_Mutation_p.G836E|NLRP12_ENST00000535162.1_Missense_Mutation_p.G836E|NLRP12_ENST00000351894.4_Missense_Mutation_p.G836E|NLRP12_ENST00000345770.5_Missense_Mutation_p.G837E	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	836					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CAGTGCATTTCCTGTCAGGTC	0.562																																						dbGAP											0													88.0	75.0	80.0					19																	54307284		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2507G>A	19.37:g.54307284C>T	ENSP00000319377:p.Gly836Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.G837E	ENST00000324134.6	37	c.2510	CCDS12864.1	19	.	.	.	.	.	.	.	.	.	.	C	2.609	-0.291135	0.05568	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000358661;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	T;T;T;T;T;T;T	0.54279	1.05;1.05;0.58;0.58;1.05;1.05;0.58	4.92	-2.66	0.06077	.	0.000000	0.34906	U	0.003586	T	0.53174	0.1780	L	0.37507	1.11	0.09310	N	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.996;0.999;1.0;0.995	T	0.51545	-0.8692	10	0.27082	T	0.32	.	8.9124	0.35561	0.0:0.4821:0.0:0.5179	.	837;119;836;836;836	F2Z321;P59046-5;A8K407;A8MTQ2;P59046	.;.;.;.;NAL12_HUMAN	E	836;836;836;836;119;836;837;837;837	ENSP00000319377:G836E;ENSP00000438030:G836E;ENSP00000340473:G836E;ENSP00000346231:G836E;ENSP00000375655:G836E;ENSP00000375653:G837E;ENSP00000375652:G837E	ENSP00000319377:G836E	G	-	2	0	NLRP12	58999096	0.000000	0.05858	0.000000	0.03702	0.239000	0.25481	0.462000	0.21956	-0.530000	0.06349	0.442000	0.29010	GGA	NLRP12	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000142405		0.562	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	HGNC	protein_coding	OTTHUMT00000134340.1	206	0.00	0	C	NM_144687		54307284	54307284	-1	no_errors	ENST00000391773	ensembl	human	known	69_37n	missense	124	36.41	71	SNP	0.001	T
OLFML2B	25903	genome.wustl.edu	37	1	161953515	161953515	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr1:161953515C>G	ENST00000294794.3	-	8	2626	c.2203G>C	c.(2203-2205)Gcc>Ccc	p.A735P	OLFML2B_ENST00000367940.2_Missense_Mutation_p.A736P|OLFML2B_ENST00000367938.1_Missense_Mutation_p.A218P	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	735	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			TTGTCCCAGGCATAGAGCAGG	0.542																																						dbGAP											0													240.0	215.0	224.0					1																	161953515		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.2203G>C	1.37:g.161953515C>G	ENSP00000294794:p.Ala735Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	pfam_Olfac-like,superfamily_NA-bd_OB-fold-like,smart_Olfac-like,pfscan_Olfac-like	p.A735P	ENST00000294794.3	37	c.2203	CCDS1236.1	1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.200912	0.79015	.	.	ENSG00000162745	ENST00000294794;ENST00000367940;ENST00000367938	D;D;D	0.92397	-3.03;-3.03;-3.03	5.6	5.6	0.85130	Olfactomedin-like (3);	.	.	.	.	D	0.95940	0.8678	M	0.91612	3.225	0.40609	D	0.981650	D;D	0.76494	0.999;0.996	D;D	0.79784	0.993;0.972	D	0.96847	0.9622	8	0.87932	D	0	.	10.5308	0.44975	0.0:0.9123:0.0:0.0877	.	736;735	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	P	735;736;218	ENSP00000294794:A735P;ENSP00000356917:A736P;ENSP00000356915:A218P	ENSP00000294794:A735P	A	-	1	0	OLFML2B	160220139	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.986000	0.70563	2.618000	0.88619	0.655000	0.94253	GCC	OLFML2B	-	pfam_Olfac-like,superfamily_NA-bd_OB-fold-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000162745		0.542	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OLFML2B	HGNC	protein_coding	OTTHUMT00000060552.2	503	0.20	1	C	NM_015441		161953515	161953515	-1	no_errors	ENST00000294794	ensembl	human	known	69_37n	missense	321	33.88	165	SNP	1.000	G
OR2B6	26212	genome.wustl.edu	37	6	27925573	27925573	+	Silent	SNP	C	C	G	rs563529794		TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr6:27925573C>G	ENST00000244623.1	+	1	555	c.555C>G	c.(553-555)ctC>ctG	p.L185L		NM_012367.1	NP_036499.1	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B, member 6	185						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CTGCACTGCTCAAGTTATCTT	0.448													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21197	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													171.0	169.0	170.0					6																	27925573		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U86275	CCDS4642.1	6p22.1	2012-08-09			ENSG00000124657	ENSG00000124657		"""GPCR / Class A : Olfactory receptors"""	8241	protein-coding gene	gene with protein product				OR2B6P, OR2B1, OR2B1P, OR2B5		9500546	Standard	NM_012367		Approved	OR6-31, dJ408B20.2, OR5-40, OR5-41	uc011dkx.2	P58173	OTTHUMG00000014497	ENST00000244623.1:c.555C>G	6.37:g.27925573C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O43883|Q6IF89|Q9H5B0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L185	ENST00000244623.1	37	c.555	CCDS4642.1	6																																																																																			OR2B6	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000124657		0.448	OR2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B6	HGNC	protein_coding	OTTHUMT00000040165.1	403	0.00	0	C			27925573	27925573	+1	no_errors	ENST00000244623	ensembl	human	known	69_37n	silent	177	35.64	98	SNP	0.936	G
OR2T34	127068	genome.wustl.edu	37	1	248737334	248737334	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr1:248737334G>T	ENST00000328782.2	-	1	746	c.725C>A	c.(724-726)gCc>gAc	p.A242D		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGTGGCCAAGGCCTTCCTGCG	0.562																																						dbGAP											0													108.0	121.0	117.0					1																	248737334		2176	4300	6476	-	-	-	SO:0001583	missense	0			BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.725C>A	1.37:g.248737334G>T	ENSP00000330904:p.Ala242Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A242D	ENST00000328782.2	37	c.725	CCDS31120.1	1	.	.	.	.	.	.	.	.	.	.	.	14.65	2.598148	0.46318	.	.	ENSG00000183310	ENST00000328782	T	0.00358	7.88	2.37	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01558	0.0050	H	0.99143	4.445	0.37305	D	0.908856	D	0.76494	0.999	D	0.78314	0.991	T	0.15009	-1.0452	9	0.87932	D	0	.	11.6319	0.51181	0.0:0.0:1.0:0.0	.	242	Q8NGX1	O2T34_HUMAN	D	242	ENSP00000330904:A242D	ENSP00000330904:A242D	A	-	2	0	OR2T34	246803957	0.993000	0.37304	0.108000	0.21378	0.309000	0.27889	3.534000	0.53568	1.169000	0.42739	0.123000	0.15791	GCC	OR2T34	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000183310		0.562	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T34	HGNC	protein_coding	OTTHUMT00000097138.1	320	0.62	2	G	NM_001001821		248737334	248737334	-1	no_errors	ENST00000328782	ensembl	human	known	69_37n	missense	189	34.26	99	SNP	0.999	T
OR7D4	125958	genome.wustl.edu	37	19	9324875	9324876	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	CC	CC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr19:9324875_9324876delCC	ENST00000308682.2	-	1	666_667	c.638_639delGG	c.(637-639)gggfs	p.G213fs		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G213E(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						AGAAGAGGATCCCAGCTACAGG	0.525																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.638_639delGG	19.37:g.9324875_9324876delCC	ENSP00000310488:p.Gly213fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G213fs	ENST00000308682.2	37	c.639_638	CCDS32901.1	19																																																																																			OR7D4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000174667		0.525	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D4	HGNC	protein_coding	OTTHUMT00000449004.1	101	0.00	0	CC			9324875	9324876	-1	no_errors	ENST00000308682	ensembl	human	known	69_37n	frame_shift_del	62	30.00	27	DEL	0.726:0.720	-
PAGE1	8712	genome.wustl.edu	37	X	49454099	49454099	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chrX:49454099C>G	ENST00000376150.3	-	5	472	c.340G>C	c.(340-342)Ggg>Cgg	p.G114R		NM_003785.3	NP_003776.2	O75459	PAGE1_HUMAN	P antigen family, member 1 (prostate associated)	114					cellular defense response (GO:0006968)					endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	7	Ovarian(276;0.236)					CGCTCACACCCAGTCTTCGGG	0.428																																						dbGAP											0													93.0	85.0	88.0					X																	49454099		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF058989	CCDS14327.1	Xp11.23	2009-06-17	2005-01-26	2005-01-27	ENSG00000068985	ENSG00000068985			4107	protein-coding gene	gene with protein product		300288	"""G antigen, family B, 1 (prostate associated)"""	GAGEB1		9651357, 9724777	Standard	NM_003785		Approved	PAGE-1, GAGE-9, CT16.3	uc004dom.3	O75459	OTTHUMG00000033224	ENST00000376150.3:c.340G>C	X.37:g.49454099C>G	ENSP00000365320:p.Gly114Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FGM3|Q9BSS7	Missense_Mutation	SNP	pfam_GAGE	p.G114R	ENST00000376150.3	37	c.340	CCDS14327.1	X	.	.	.	.	.	.	.	.	.	.	C	11.01	1.514240	0.27123	.	.	ENSG00000068985	ENST00000376150	T	0.16196	2.36	1.03	1.03	0.20045	.	.	.	.	.	T	0.34424	0.0897	M	0.73962	2.25	0.09310	N	1	D	0.76494	0.999	D	0.74674	0.984	T	0.07083	-1.0791	9	0.49607	T	0.09	.	5.029	0.14400	0.0:1.0:0.0:0.0	.	114	O75459	GAGB1_HUMAN	R	114	ENSP00000365320:G114R	ENSP00000365320:G114R	G	-	1	0	PAGE1	49341053	0.010000	0.17322	0.006000	0.13384	0.014000	0.08584	0.647000	0.24812	0.781000	0.33589	0.179000	0.17066	GGG	PAGE1	-	pfam_GAGE	ENSG00000068985		0.428	PAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAGE1	HGNC	protein_coding	OTTHUMT00000081210.1	64	0.00	0	C			49454099	49454099	-1	no_errors	ENST00000376150	ensembl	human	known	69_37n	missense	17	54.05	20	SNP	0.006	G
PATL2	197135	genome.wustl.edu	37	15	44962197	44962197	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr15:44962197G>A	ENST00000560775.1	-	7	805	c.746C>T	c.(745-747)cCt>cTt	p.P249L	PATL2_ENST00000560780.1_Missense_Mutation_p.P60L|PATL2_ENST00000434130.1_Missense_Mutation_p.P249L			C9JE40	PATL2_HUMAN	protein associated with topoisomerase II homolog 2 (yeast)	249					negative regulation of cytoplasmic mRNA processing body assembly (GO:0010607)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)	RNA binding (GO:0003723)			kidney(2)|stomach(1)	3						CGGAATGTAAGGCGTTACCAG	0.552																																						dbGAP											0													124.0	118.0	120.0					15																	44962197		687	1589	2276	-	-	-	SO:0001583	missense	0			BC036924	CCDS45253.1	15q21.1	2010-06-04			ENSG00000229474	ENSG00000229474			33630	protein-coding gene	gene with protein product		614661				17936923	Standard	NM_001145112		Approved		uc010uej.2	C9JE40		ENST00000560775.1:c.746C>T	15.37:g.44962197G>A	ENSP00000453915:p.Pro249Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Topo_II-assoc_PAT1	p.P249L	ENST00000560775.1	37	c.746	CCDS45253.1	15	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885207	0.72410	.	.	ENSG00000229474	ENST00000434130	T	0.55760	0.5	5.59	5.59	0.84812	.	.	.	.	.	T	0.63581	0.2523	M	0.83012	2.62	0.80722	D	1	P	0.34864	0.473	B	0.41088	0.347	T	0.63892	-0.6534	9	0.37606	T	0.19	-26.6829	17.0883	0.86616	0.0:0.0:1.0:0.0	.	249	C9JE40	PATL2_HUMAN	L	249	ENSP00000416673:P249L	ENSP00000416673:P249L	P	-	2	0	PATL2	42749489	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	7.856000	0.86956	2.642000	0.89623	0.561000	0.74099	CCT	PATL2	-	NULL	ENSG00000229474		0.552	PATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATL2	HGNC	protein_coding	OTTHUMT00000415947.1	314	0.00	0	G	NM_001145112		44962197	44962197	-1	no_errors	ENST00000434130	ensembl	human	known	69_37n	missense	156	40.00	104	SNP	1.000	A
PCNT	5116	genome.wustl.edu	37	21	47783719	47783719	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr21:47783719G>A	ENST00000359568.5	+	14	2586	c.2479G>A	c.(2479-2481)Gac>Aac	p.D827N	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	827					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GCTGGAACAGGACCTCACTTC	0.637																																						dbGAP											0													70.0	77.0	75.0					21																	47783719		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.2479G>A	21.37:g.47783719G>A	ENSP00000352572:p.Asp827Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O43152|Q7Z7C9	Missense_Mutation	SNP	pfam_PACT_domain	p.D827N	ENST00000359568.5	37	c.2479	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298831	0.40694	.	.	ENSG00000160299	ENST00000359568	T	0.22134	1.97	4.81	3.91	0.45181	.	0.804918	0.10158	N	0.708639	T	0.09598	0.0236	N	0.08118	0	0.09310	N	1	B;B	0.23937	0.0;0.094	B;B	0.18871	0.001;0.023	T	0.23833	-1.0177	10	0.17832	T	0.49	.	6.3514	0.21377	0.1891:0.0:0.8109:0.0	.	709;827	O95613-2;O95613	.;PCNT_HUMAN	N	827	ENSP00000352572:D827N	ENSP00000352572:D827N	D	+	1	0	PCNT	46608147	0.075000	0.21258	0.007000	0.13788	0.355000	0.29361	2.117000	0.41939	2.388000	0.81334	0.591000	0.81541	GAC	PCNT	-	NULL	ENSG00000160299		0.637	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	24	0.00	0	G	NM_006031		47783719	47783719	+1	no_errors	ENST00000359568	ensembl	human	known	69_37n	missense	12	33.33	6	SNP	0.003	A
PDGFRL	5157	genome.wustl.edu	37	8	17486008	17486008	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr8:17486008T>C	ENST00000541323.1	+	5	963	c.518T>C	c.(517-519)cTc>cCc	p.L173P	PDGFRL_ENST00000251630.6_Missense_Mutation_p.L173P|PDGFRL_ENST00000398074.3_Missense_Mutation_p.L173P	NM_006207.2	NP_006198.1	Q15198	PGFRL_HUMAN	platelet-derived growth factor receptor-like	173					G-protein coupled receptor signaling pathway (GO:0007186)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)	extracellular region (GO:0005576)	platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)	9				Colorectal(111;0.0752)		AAAGGAGAACTCTTTGTACCT	0.498																																						dbGAP											0													118.0	118.0	118.0					8																	17486008		2203	4300	6503	-	-	-	SO:0001583	missense	0			D37965	CCDS6003.1	8p22-p21.3	2013-01-29			ENSG00000104213	ENSG00000104213		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8805	protein-coding gene	gene with protein product		604584					Standard	NM_006207		Approved	PRLTS	uc003wxr.3	Q15198	OTTHUMG00000130818	ENST00000541323.1:c.518T>C	8.37:g.17486008T>C	ENSP00000444211:p.Leu173Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K085|Q6FH04	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L173P	ENST00000541323.1	37	c.518	CCDS6003.1	8	.	.	.	.	.	.	.	.	.	.	T	17.07	3.295151	0.60086	.	.	ENSG00000104213	ENST00000251630;ENST00000541323;ENST00000398074	T;T;T	0.24151	1.87;1.87;1.87	5.44	5.44	0.79542	Immunoglobulin-like fold (1);	0.189837	0.46758	D	0.000272	T	0.42653	0.1212	L	0.41124	1.26	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.26573	-1.0099	10	0.56958	D	0.05	-17.4094	15.8052	0.78501	0.0:0.0:0.0:1.0	.	173	Q15198	PGFRL_HUMAN	P	173	ENSP00000251630:L173P;ENSP00000444211:L173P;ENSP00000381149:L173P	ENSP00000251630:L173P	L	+	2	0	PDGFRL	17530288	1.000000	0.71417	1.000000	0.80357	0.315000	0.28087	7.698000	0.84413	2.206000	0.71126	0.533000	0.62120	CTC	PDGFRL	-	NULL	ENSG00000104213		0.498	PDGFRL-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRL	HGNC	protein_coding	OTTHUMT00000253366.3	192	0.00	0	T	NM_006207		17486008	17486008	+1	no_errors	ENST00000251630	ensembl	human	known	69_37n	missense	37	59.78	55	SNP	1.000	C
PLCE1	51196	genome.wustl.edu	37	10	96058171	96058171	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr10:96058171T>A	ENST00000371380.3	+	23	5438	c.5203T>A	c.(5203-5205)Tct>Act	p.S1735T	PLCE1_ENST00000371375.1_Missense_Mutation_p.S1427T|PLCE1_ENST00000371385.3_Missense_Mutation_p.S1427T|PLCE1_ENST00000260766.3_Missense_Mutation_p.S1735T			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1735	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.|Required for activation by RHOA, RHOB, GNA12, GNA13 and G-beta gamma. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				CTGGGAGGAATCTTCTTCCCC	0.428																																						dbGAP											0													90.0	88.0	89.0					10																	96058171		1881	4112	5993	-	-	-	SO:0001583	missense	0				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.5203T>A	10.37:g.96058171T>A	ENSP00000360431:p.Ser1735Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,smart_Ras-assoc,pfscan_C2_membr_targeting,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.S1735T	ENST00000371380.3	37	c.5203	CCDS41552.1	10	.	.	.	.	.	.	.	.	.	.	T	6.333	0.429551	0.11987	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.24908	1.83;1.83;1.83;1.83	5.08	-2.23	0.06930	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);Phospholipase C, phosphatidylinositol-specific, Y domain (1);	0.387803	0.26062	N	0.026566	T	0.06645	0.0170	N	0.08118	0	0.09310	N	1	B;B;B	0.33883	0.0;0.43;0.0	B;B;B	0.24006	0.001;0.05;0.001	T	0.31613	-0.9937	10	0.14252	T	0.57	.	2.2779	0.04107	0.1369:0.2846:0.3876:0.1908	.	1719;1427;1735	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	T	1735;1735;1427;1427	ENSP00000260766:S1735T;ENSP00000360431:S1735T;ENSP00000360438:S1427T;ENSP00000360426:S1427T	ENSP00000260766:S1735T	S	+	1	0	PLCE1	96048161	0.041000	0.20044	0.017000	0.16124	0.293000	0.27360	0.580000	0.23803	-0.033000	0.13736	-0.313000	0.08912	TCT	PLCE1	-	superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_Pinositol-sp_Y	ENSG00000138193		0.428	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	HGNC	protein_coding	OTTHUMT00000049469.3	200	0.00	0	T	NM_016341		96058171	96058171	+1	no_errors	ENST00000371380	ensembl	human	known	69_37n	missense	61	50.00	61	SNP	0.000	A
PPP2R3A	5523	genome.wustl.edu	37	3	135721060	135721060	+	Silent	SNP	C	C	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr3:135721060C>A	ENST00000264977.3	+	2	1337	c.720C>A	c.(718-720)tcC>tcA	p.S240S	PPP2R3A_ENST00000490467.1_Intron	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	240					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TGAAATGCTCCGAGGATTTAA	0.328																																						dbGAP											0													42.0	45.0	44.0					3																	135721060		2197	4297	6494	-	-	-	SO:0001819	synonymous_variant	0			L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.720C>A	3.37:g.135721060C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Silent	SNP	pfscan_EF_HAND_2	p.S240	ENST00000264977.3	37	c.720	CCDS3087.1	3																																																																																			PPP2R3A	-	NULL	ENSG00000073711		0.328	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3A	HGNC	protein_coding	OTTHUMT00000357232.1	126	0.00	0	C	NM_002718		135721060	135721060	+1	no_errors	ENST00000264977	ensembl	human	known	69_37n	silent	44	43.59	34	SNP	0.976	A
PPP2R3A	5523	genome.wustl.edu	37	3	135745705	135745705	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr3:135745705C>T	ENST00000264977.3	+	3	2644	c.2027C>T	c.(2026-2028)aCa>aTa	p.T676I	PPP2R3A_ENST00000492624.2_5'Flank|PPP2R3A_ENST00000334546.2_Missense_Mutation_p.T55I|PPP2R3A_ENST00000490467.1_5'UTR	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	676	Pro-rich.				eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AAACCTGGAACACCACTCCCA	0.393																																						dbGAP											0													71.0	73.0	72.0					3																	135745705		2203	4300	6503	-	-	-	SO:0001583	missense	0			L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.2027C>T	3.37:g.135745705C>T	ENSP00000264977:p.Thr676Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	pfscan_EF_HAND_2	p.T676I	ENST00000264977.3	37	c.2027	CCDS3087.1	3	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144939	0.77888	.	.	ENSG00000073711	ENST00000264977;ENST00000334546	T;T	0.16897	2.31;2.31	5.52	5.52	0.82312	.	0.280074	0.33364	N	0.004999	T	0.32194	0.0821	L	0.39898	1.24	0.80722	D	1	D;D	0.76494	0.971;0.999	P;D	0.65233	0.776;0.933	T	0.00928	-1.1511	10	0.72032	D	0.01	.	15.9405	0.79750	0.0:0.8651:0.1349:0.0	.	55;676	Q06190-2;Q06190	.;P2R3A_HUMAN	I	676;55	ENSP00000264977:T676I;ENSP00000334748:T55I	ENSP00000264977:T676I	T	+	2	0	PPP2R3A	137228395	0.993000	0.37304	0.994000	0.49952	0.977000	0.68977	2.947000	0.49058	2.757000	0.94681	0.585000	0.79938	ACA	PPP2R3A	-	NULL	ENSG00000073711		0.393	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3A	HGNC	protein_coding	OTTHUMT00000357232.1	143	0.00	0	C	NM_002718		135745705	135745705	+1	no_errors	ENST00000264977	ensembl	human	known	69_37n	missense	79	34.71	42	SNP	1.000	T
PREX2	80243	genome.wustl.edu	37	8	69002851	69002851	+	Silent	SNP	G	G	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr8:69002851G>A	ENST00000288368.4	+	20	2428	c.2151G>A	c.(2149-2151)caG>caA	p.Q717Q	PREX2_ENST00000529398.1_3'UTR|RP11-403D15.2_ENST00000526901.1_RNA	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	717	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						ACCCTGGACAGTGCATTATCA	0.428																																						dbGAP											0													109.0	98.0	102.0					8																	69002851		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2151G>A	8.37:g.69002851G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.Q717	ENST00000288368.4	37	c.2151	CCDS6201.1	8																																																																																			PREX2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000046889		0.428	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	182	0.00	0	G	NM_025170		69002851	69002851	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	silent	186	16.59	37	SNP	1.000	A
RELN	5649	genome.wustl.edu	37	7	103183270	103183270	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr7:103183270C>G	ENST00000428762.1	-	43	6738	c.6579G>C	c.(6577-6579)aaG>aaC	p.K2193N	RELN_ENST00000343529.5_Missense_Mutation_p.K2193N|RELN_ENST00000424685.2_Missense_Mutation_p.K2193N	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2193					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GGATTCCACACTTTCGAGATG	0.388																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											0													101.0	97.0	98.0					7																	103183270		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6579G>C	7.37:g.103183270C>G	ENSP00000392423:p.Lys2193Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.K2193N	ENST00000428762.1	37	c.6579	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	11.24	1.579848	0.28180	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.25749	1.78;1.78;1.78	5.79	0.197	0.15164	Neuraminidase (1);	0.053230	0.64402	D	0.000001	T	0.32071	0.0817	L	0.34521	1.04	0.44976	D	0.997995	D;D	0.89917	1.0;0.994	D;D	0.87578	0.998;0.952	T	0.02081	-1.1217	10	0.25106	T	0.35	.	9.4628	0.38796	0.0:0.4293:0.0:0.5707	.	2193;2193	P78509-2;P78509	.;RELN_HUMAN	N	2193	ENSP00000392423:K2193N;ENSP00000345694:K2193N;ENSP00000388446:K2193N	ENSP00000345694:K2193N	K	-	3	2	RELN	102970506	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	0.610000	0.24253	0.077000	0.16863	0.591000	0.81541	AAG	RELN	-	superfamily_Neuraminidase	ENSG00000189056		0.388	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	263	0.00	0	C	NM_005045		103183270	103183270	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	131	31.05	59	SNP	0.987	G
RGAG4	340526	genome.wustl.edu	37	X	71351178	71351178	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chrX:71351178G>C	ENST00000545866.1	-	1	580	c.213C>G	c.(211-213)ttC>ttG	p.F71L	RGAG4_ENST00000609883.1_Missense_Mutation_p.F71L|NHSL2_ENST00000540800.1_Intron|NHSL2_ENST00000510661.1_5'Flank|NHSL2_ENST00000373677.1_5'Flank|NHSL2_ENST00000535692.1_5'Flank	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	71										cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					CACTGAGCGCGAACTCCAAGT	0.602																																						dbGAP											0													43.0	47.0	45.0					X																	71351178		1976	4133	6109	-	-	-	SO:0001583	missense	0			AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.213C>G	X.37:g.71351178G>C	ENSP00000441366:p.Phe71Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	pfam_Retrotrans_gag	p.F71L	ENST00000545866.1	37	c.213	CCDS55446.1	X	.	.	.	.	.	.	.	.	.	.	G	17.19	3.326797	0.60743	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.16196	2.36;2.36	4.09	3.21	0.36854	.	.	.	.	.	T	0.17619	0.0423	N	0.19112	0.55	0.26305	N	0.977919	D	0.67145	0.996	P	0.56127	0.792	T	0.08310	-1.0728	8	.	.	.	.	7.1567	0.25641	0.1249:0.0:0.8751:0.0	.	71	Q5HYW3	RGAG4_HUMAN	L	71	ENSP00000441366:F71L;ENSP00000418667:F71L	.	F	-	3	2	RGAG4	71267903	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	1.197000	0.32211	1.048000	0.40298	0.556000	0.70494	TTC	RGAG4	-	NULL	ENSG00000242732		0.602	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG4	HGNC	protein_coding	OTTHUMT00000057171.1	16	0.00	0	G	NM_001024455		71351178	71351178	-1	no_errors	ENST00000479991	ensembl	human	known	69_37n	missense	9	60.87	14	SNP	0.999	C
RYR1	6261	genome.wustl.edu	37	19	38990591	38990591	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr19:38990591C>A	ENST00000359596.3	+	45	7258	c.7258C>A	c.(7258-7260)Cac>Aac	p.H2420N	RYR1_ENST00000355481.4_Missense_Mutation_p.H2420N|RYR1_ENST00000360985.3_Missense_Mutation_p.H2420N			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2420	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GCACCTGGGACACGCCATCAT	0.637																																						dbGAP											0													142.0	106.0	119.0					19																	38990591		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7258C>A	19.37:g.38990591C>A	ENSP00000352608:p.His2420Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.H2420N	ENST00000359596.3	37	c.7258	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	C	11.88	1.769627	0.31320	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97016	-4.21;-4.21;-4.21	3.99	2.89	0.33648	.	0.076047	0.48767	U	0.000174	T	0.79724	0.4495	N	0.00289	-1.7	0.36003	D	0.837501	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.79926	-0.1597	10	0.02654	T	1	.	9.0682	0.36475	0.4437:0.5563:0.0:0.0	.	2420;2420	P21817-2;P21817	.;RYR1_HUMAN	N	2420	ENSP00000352608:H2420N;ENSP00000347667:H2420N;ENSP00000354254:H2420N	ENSP00000347667:H2420N	H	+	1	0	RYR1	43682431	1.000000	0.71417	0.997000	0.53966	0.802000	0.45316	5.396000	0.66297	2.045000	0.60652	0.297000	0.19635	CAC	RYR1	-	NULL	ENSG00000196218		0.637	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	135	0.74	1	C			38990591	38990591	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	missense	92	37.41	55	SNP	1.000	A
SATB1	6304	genome.wustl.edu	37	3	18458465	18458465	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr3:18458465A>T	ENST00000338745.6	-	3	2051	c.317T>A	c.(316-318)cTt>cAt	p.L106H	SATB1_ENST00000454909.2_Missense_Mutation_p.L106H|TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000417717.2_Missense_Mutation_p.L106H|SATB1_ENST00000475083.1_5'UTR	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	106	PDZ-like dimerization domain.				activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						CTGGTTGAAAAGCATATCCTT	0.438																																						dbGAP											0													176.0	156.0	163.0					3																	18458465		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.317T>A	3.37:g.18458465A>T	ENSP00000341024:p.Leu106His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXF1|C9JTR6|Q59EQ0	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.L106H	ENST00000338745.6	37	c.317	CCDS2631.1	3	.	.	.	.	.	.	.	.	.	.	A	17.13	3.309750	0.60414	.	.	ENSG00000182568	ENST00000338745;ENST00000454909;ENST00000417717;ENST00000440737;ENST00000452260;ENST00000415069;ENST00000457005;ENST00000414509	T;T;T;T;T;T;T;T	0.60171	0.21;0.21;0.21;0.21;0.21;0.21;0.21;0.21	5.33	5.33	0.75918	.	0.126528	0.53938	D	0.000042	T	0.72859	0.3513	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.75698	-0.3227	10	0.72032	D	0.01	-12.6182	15.5967	0.76587	1.0:0.0:0.0:0.0	.	106;106	Q01826-2;Q01826	.;SATB1_HUMAN	H	106	ENSP00000341024:L106H;ENSP00000399708:L106H;ENSP00000399518:L106H;ENSP00000402982:L106H;ENSP00000406727:L106H;ENSP00000390529:L106H;ENSP00000398072:L106H;ENSP00000408871:L106H	ENSP00000341024:L106H	L	-	2	0	SATB1	18433469	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.287000	0.95975	2.138000	0.66242	0.459000	0.35465	CTT	SATB1	-	NULL	ENSG00000182568		0.438	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB1	HGNC	protein_coding	OTTHUMT00000252138.4	288	0.00	0	A	NM_001131010		18458465	18458465	-1	no_errors	ENST00000338745	ensembl	human	known	69_37n	missense	161	39.70	106	SNP	1.000	T
SLC8B1	80024	genome.wustl.edu	37	12	113753164	113753164	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr12:113753164delC	ENST00000552014.1	-	12	1626	c.1111delG	c.(1111-1113)gtcfs	p.V371fs	SLC8B1_ENST00000553238.1_5'UTR|SLC8B1_ENST00000202831.3_Frame_Shift_Del_p.V371fs|SLC8B1_ENST00000546737.1_Frame_Shift_Del_p.V315fs			Q6J4K2	NCKX6_HUMAN	solute carrier family 8 (sodium/lithium/calcium exchanger), member B1	371					cytosolic calcium ion homeostasis (GO:0051480)|glucose homeostasis (GO:0042593)|ion transport (GO:0006811)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of insulin secretion (GO:0050796)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial crista (GO:0030061)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)|calcium:sodium antiporter activity involved in regulation of cardiac muscle cell membrane potential (GO:0086038)|protein homodimerization activity (GO:0042803)										AGGGTCAGGACCACAACCAGG	0.607																																						dbGAP											0													59.0	49.0	53.0					12																	113753164		2179	4265	6444	-	-	-	SO:0001589	frameshift_variant	0			AK025886	CCDS31909.1	12q24.13	2013-07-19	2013-07-19	2013-07-19	ENSG00000089060	ENSG00000089060		"""Solute carriers"""	26175	protein-coding gene	gene with protein product		609841	"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 6"", ""solute carrier family 24 (sodium/lithium/calcium exchanger), member 6"""	SLC24A6		14625281, 23506867	Standard	NM_024959		Approved	FLJ22233, NCKX6, NCLX	uc001tvc.3	Q6J4K2	OTTHUMG00000169566	ENST00000552014.1:c.1111delG	12.37:g.113753164delC	ENSP00000447091:p.Val371fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP50|Q4KMS9|Q6J4K1|Q9H6I8	Frame_Shift_Del	DEL	pfam_NaCa_Exmemb	p.V371fs	ENST00000552014.1	37	c.1111	CCDS31909.1	12																																																																																			SLC24A6	-	NULL	ENSG00000089060		0.607	SLC8B1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SLC24A6	HGNC	protein_coding	OTTHUMT00000404830.3	111	0.00	0	C	NM_024959		113753164	113753164	-1	no_errors	ENST00000202831	ensembl	human	known	69_37n	frame_shift_del	61	33.70	31	DEL	1.000	-
SORD	6652	genome.wustl.edu	37	15	45335550	45335550	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr15:45335550A>G	ENST00000267814.9	+	3	376	c.196A>G	c.(196-198)Atg>Gtg	p.M66V	RP11-109D20.1_ENST00000560324.1_RNA|SORD_ENST00000558580.1_Missense_Mutation_p.M45V	NM_003104.5	NP_003095.2	Q00796	DHSO_HUMAN	sorbitol dehydrogenase	66					fructose biosynthetic process (GO:0046370)|glucose metabolic process (GO:0006006)|L-xylitol catabolic process (GO:0051160)|L-xylitol metabolic process (GO:0051164)|sorbitol catabolic process (GO:0006062)|sperm motility (GO:0030317)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)	carbohydrate binding (GO:0030246)|L-iditol 2-dehydrogenase activity (GO:0003939)|NAD binding (GO:0051287)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(3)|lung(4)	9		all_cancers(109;3.43e-12)|all_epithelial(112;2.33e-10)|Lung NSC(122;6.01e-07)|all_lung(180;4.38e-06)|Melanoma(134;0.0122)		all cancers(107;1.6e-18)|GBM - Glioblastoma multiforme(94;4.95e-07)|COAD - Colon adenocarcinoma(120;0.0704)|Colorectal(133;0.0706)		GAAAAAGCCCATGGTGCTGGG	0.463																																						dbGAP											0													10.0	10.0	10.0					15																	45335550		1546	3664	5210	-	-	-	SO:0001583	missense	0				CCDS10116.1	15q15-q21.1	2012-10-02			ENSG00000140263	ENSG00000140263	1.1.1.14		11184	protein-coding gene	gene with protein product		182500				7782086	Standard	NM_003104		Approved		uc001zul.4	Q00796	OTTHUMG00000131265	ENST00000267814.9:c.196A>G	15.37:g.45335550A>G	ENSP00000267814:p.Met66Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R655|B7Z3A6|J3JZZ5|Q16682|Q9UMD6	Missense_Mutation	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.M66V	ENST00000267814.9	37	c.196	CCDS10116.1	15	.	.	.	.	.	.	.	.	.	.	A	18.14	3.556606	0.65425	.	.	ENSG00000140263	ENST00000267814	T	0.04275	3.66	4.59	4.59	0.56863	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.036848	0.85682	D	0.000000	T	0.08935	0.0221	N	0.11427	0.14	0.80722	D	1	D	0.69078	0.997	D	0.72625	0.978	T	0.42120	-0.9470	10	0.87932	D	0	-10.3102	13.5785	0.61888	1.0:0.0:0.0:0.0	.	66	Q00796	DHSO_HUMAN	V	66	ENSP00000267814:M66V	ENSP00000267814:M66V	M	+	1	0	SORD	43122842	1.000000	0.71417	0.999000	0.59377	0.729000	0.41735	7.158000	0.77470	2.048000	0.60808	0.460000	0.39030	ATG	SORD	-	pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	ENSG00000140263		0.463	SORD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORD	HGNC	protein_coding	OTTHUMT00000254033.3	65	0.00	0	A			45335550	45335550	+1	no_errors	ENST00000267814	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	1.000	G
SOS1	6654	genome.wustl.edu	37	2	39249723	39249723	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:39249723G>A	ENST00000426016.1	-	11	1932	c.1846C>T	c.(1846-1848)Cat>Tat	p.H616Y	SOS1_ENST00000472480.1_5'Flank|SOS1_ENST00000395038.2_Missense_Mutation_p.H616Y|SOS1_ENST00000402219.2_Missense_Mutation_p.H616Y			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	616	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				GCGTACATATGGTACGTAAGC	0.368									Noonan syndrome																													dbGAP											0													61.0	61.0	61.0					2																	39249723		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.1846C>T	2.37:g.39249723G>A	ENSP00000387784:p.His616Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2G3|B4DXG2	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.H616Y	ENST00000426016.1	37	c.1846	CCDS1802.1	2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076634	0.76415	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038;ENST00000263879	T;T;T	0.52295	0.67;0.67;0.67	5.78	5.78	0.91487	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.76572	0.4006	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.80739	-0.1248	10	0.87932	D	0	.	20.0039	0.97428	0.0:0.0:1.0:0.0	.	348;616	F5GX06;Q07889	.;SOS1_HUMAN	Y	616;616;348;616;616	ENSP00000387784:H616Y;ENSP00000384675:H616Y;ENSP00000378479:H616Y	ENSP00000263879:H616Y	H	-	1	0	SOS1	39103227	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.731000	0.98807	2.722000	0.93159	0.557000	0.71058	CAT	SOS1	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000115904		0.368	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SOS1	HGNC	protein_coding	OTTHUMT00000219948.3	158	0.00	0	G	NM_005633		39249723	39249723	-1	no_errors	ENST00000402219	ensembl	human	known	69_37n	missense	70	34.58	37	SNP	1.000	A
SPECC1L	23384	genome.wustl.edu	37	22	24765272	24765272	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr22:24765272A>C	ENST00000314328.9	+	14	3356	c.3071A>C	c.(3070-3072)aAa>aCa	p.K1024T	SPECC1L-ADORA2A_ENST00000358654.2_3'UTR|SPECC1L_ENST00000437398.1_Missense_Mutation_p.K1024T|SPECC1L_ENST00000541492.1_Missense_Mutation_p.K1024T	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	1024	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						TGTCAGAAGAAAACAGAAGGC	0.428																																						dbGAP											0													119.0	100.0	106.0					22																	24765272		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.3071A>C	22.37:g.24765272A>C	ENSP00000325785:p.Lys1024Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_HLH_DNA-bd,smart_CH-domain,pfscan_CH-domain	p.K1024T	ENST00000314328.9	37	c.3071	CCDS33619.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.8|23.8	4.462795|4.462795	0.84425|0.84425	.|.	.|.	ENSG00000258555|ENSG00000100014	ENST00000493440|ENST00000437398;ENST00000314328;ENST00000541492	.|D;D;T	.|0.94966	.|-3.57;-3.57;0.07	5.56|5.56	5.56|5.56	0.83823|0.83823	.|Calponin homology domain (5);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96522|0.96522	0.8865|0.8865	M|M	0.62266|0.62266	1.93|1.93	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.91635	.|0.999;0.996	D|D	0.97047|0.97047	0.9761|0.9761	5|10	.|0.87932	.|D	.|0	-28.5773|-28.5773	14.8894|14.8894	0.70597|0.70597	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1024;1024	.|F5H1H6;Q69YQ0	.|.;CYTSA_HUMAN	D|T	38|1024	.|ENSP00000393363:K1024T;ENSP00000325785:K1024T;ENSP00000439633:K1024T	.|ENSP00000325785:K1024T	E|K	+|+	3|2	2|0	KB-1896H10.1|SPECC1L	23095272|23095272	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	8.582000|8.582000	0.90791|0.90791	2.107000|2.107000	0.64212|0.64212	0.460000|0.460000	0.39030|0.39030	GAA|AAA	SPECC1L	-	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000100014		0.428	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1L	HGNC	protein_coding	OTTHUMT00000319986.2	304	0.33	1	A	NM_015330		24765272	24765272	+1	no_errors	ENST00000314328	ensembl	human	known	69_37n	missense	156	29.73	66	SNP	1.000	C
SULT1C4	27233	genome.wustl.edu	37	2	108998294	108998294	+	Silent	SNP	T	T	C			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:108998294T>C	ENST00000272452.2	+	2	572	c.246T>C	c.(244-246)acT>acC	p.T82T	SULT1C4_ENST00000409309.3_Silent_p.T82T	NM_006588.2	NP_006579.2	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 4	82					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						GGGCACCGACTCATCAACGAT	0.398																																						dbGAP											0													143.0	122.0	129.0					2																	108998294		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF055584	CCDS2077.1	2q12.3	2008-09-04	2007-03-16	2007-03-16	ENSG00000198075	ENSG00000198075		"""Sulfotransferases, cytosolic"""	11457	protein-coding gene	gene with protein product		608357	"""sulfotransferase family, cytosolic, 1C, member 2"""	SULT1C2		10783263, 9852044	Standard	NM_006588		Approved	SULT1C	uc002tea.1	O75897	OTTHUMG00000130958	ENST00000272452.2:c.246T>C	2.37:g.108998294T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q069I8|Q08AS5|Q53S63	Silent	SNP	pfam_Sulfotransferase_dom	p.T82	ENST00000272452.2	37	c.246	CCDS2077.1	2																																																																																			SULT1C4	-	pfam_Sulfotransferase_dom	ENSG00000198075		0.398	SULT1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1C4	HGNC	protein_coding	OTTHUMT00000253561.1	279	0.00	0	T	NM_006588		108998294	108998294	+1	no_errors	ENST00000272452	ensembl	human	known	69_37n	silent	137	26.74	50	SNP	0.010	C
SUMO1	7341	genome.wustl.edu	37	2	203084812	203084812	+	Silent	SNP	A	A	C	rs373269466		TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:203084812A>C	ENST00000392246.2	-	2	186	c.30T>G	c.(28-30)acT>acG	p.T10T	SUMO1_ENST00000409205.1_5'UTR|SUMO1_ENST00000392245.1_Silent_p.T10T|SUMO1_ENST00000409712.1_Silent_p.T10T|SUMO1_ENST00000392244.3_Intron|SUMO1_ENST00000409181.1_Silent_p.T10T|SUMO1_ENST00000409498.2_5'UTR|SUMO1_ENST00000469034.1_5'UTR|SUMO1_ENST00000409368.1_Silent_p.T10T	NM_003352.4	NP_003343.1	P63165	SUMO1_HUMAN	small ubiquitin-like modifier 1	10					cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|DNA repair (GO:0006281)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of DNA binding (GO:0043392)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|PML body organization (GO:0030578)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein complex assembly (GO:0031334)|post-translational protein modification (GO:0043687)|protein localization to nuclear pore (GO:0090204)|protein sumoylation (GO:0016925)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein localization (GO:0032880)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)										CCAAGTCCTCAGTTGAAGGTT	0.338																																						dbGAP											0													112.0	123.0	120.0					2																	203084812		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U38784	CCDS2352.1, CCDS46493.1	2q33	2013-06-05	2013-06-05	2004-05-19	ENSG00000116030	ENSG00000116030			12502	protein-coding gene	gene with protein product		601912	"""ubiquitin-like 1 (sentrin)"", ""SMT3 suppressor of mif two 3 homolog 1 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)"""	UBL1		8812453, 8906799	Standard	NM_003352		Approved	PIC1, GMP1, SMT3C, SUMO-1, SMT3H3, OFC10	uc002uyz.1	P63165	OTTHUMG00000132839	ENST00000392246.2:c.30T>G	2.37:g.203084812A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUS8|B2R4I5|P55856|Q6FGG0|Q6NZ62|Q93068	Nonstop_Mutation	SNP	NULL	p.*74G	ENST00000392246.2	37	c.220	CCDS2352.1	2																																																																																			SUMO1	-	NULL	ENSG00000116030		0.338	SUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUMO1	HGNC	protein_coding	OTTHUMT00000256312.2	511	0.00	0	A	NM_003352		203084812	203084812	-1	no_errors	ENST00000409627	ensembl	human	known	69_37n	nonstop	218	31.56	101	SNP	0.998	C
TMEM39A	55254	genome.wustl.edu	37	3	119153657	119153657	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr3:119153657delC	ENST00000319172.5	-	8	1605	c.1185delG	c.(1183-1185)gggfs	p.G395fs		NM_018266.1	NP_060736.1	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	395						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	13				GBM - Glioblastoma multiforme(114;0.244)		CGTTGTAAGGCCCCATGGCTC	0.443																																						dbGAP											0													121.0	114.0	116.0					3																	119153657		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC021277	CCDS2987.1	3q13.33	2005-01-10			ENSG00000176142	ENSG00000176142			25600	protein-coding gene	gene with protein product						12477932	Standard	NM_018266		Approved	FLJ10902	uc003eck.2	Q9NV64	OTTHUMG00000159361	ENST00000319172.5:c.1185delG	3.37:g.119153657delC	ENSP00000326063:p.Gly395fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN80|Q53FN4|Q53GI1|Q6PKB5	Frame_Shift_Del	DEL	pfam_Uncharacterised_TMEM39	p.P396fs	ENST00000319172.5	37	c.1185	CCDS2987.1	3																																																																																			TMEM39A	-	pfam_Uncharacterised_TMEM39	ENSG00000176142		0.443	TMEM39A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM39A	HGNC	protein_coding	OTTHUMT00000354941.3	275	0.00	0	C	NM_018266		119153657	119153657	-1	no_errors	ENST00000319172	ensembl	human	known	69_37n	frame_shift_del	179	21.74	50	DEL	0.826	-
TNRC6A	27327	genome.wustl.edu	37	16	24817933	24817933	+	Silent	SNP	A	A	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr16:24817933A>G	ENST00000395799.3	+	17	4497	c.4368A>G	c.(4366-4368)caA>caG	p.Q1456Q	TNRC6A_ENST00000315183.7_Silent_p.Q1407Q|TNRC6A_ENST00000432286.2_5'Flank|CTD-2515A14.1_ENST00000568895.1_RNA	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1456					cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		TGATGCAACAATCTCGTCAAC	0.443																																						dbGAP											0													148.0	134.0	138.0					16																	24817933		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.4368A>G	16.37:g.24817933A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	NULL	p.N156S	ENST00000395799.3	37	c.467	CCDS10624.2	16	.	.	.	.	.	.	.	.	.	.	A	9.662	1.144479	0.21288	.	.	ENSG00000090905	ENST00000450465	.	.	.	6.16	-1.8	0.07907	.	.	.	.	.	T	0.58278	0.2111	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57046	-0.7878	4	.	.	.	-1.2772	12.0886	0.53713	0.4137:0.0:0.5863:0.0	.	.	.	.	V	347	.	.	I	+	1	0	TNRC6A	24725434	0.998000	0.40836	0.821000	0.32701	0.991000	0.79684	0.303000	0.19210	-0.138000	0.11434	-0.263000	0.10527	ATC	TNRC6A	-	NULL	ENSG00000090905		0.443	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TNRC6A	HGNC	protein_coding	OTTHUMT00000214081.1	395	0.00	0	A	NM_020847		24817933	24817933	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000568750	ensembl	human	novel	69_37n	missense	186	53.27	212	SNP	0.961	G
TRABD2A	129293	genome.wustl.edu	37	2	85066288	85066288	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:85066288A>T	ENST00000409520.2	-	4	1018	c.976T>A	c.(976-978)Ttt>Att	p.F326I	TRABD2A_ENST00000409133.1_Missense_Mutation_p.F326I|TRABD2A_ENST00000335459.5_Missense_Mutation_p.F277I	NM_001277053.1	NP_001263982.1	Q86V40	TIKI1_HUMAN	TraB domain containing 2A	326					head development (GO:0060322)|metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)										CCAAAGGCAAAGAAGAAGCCT	0.527																																						dbGAP											0													85.0	84.0	84.0					2																	85066288		1892	4120	6012	-	-	-	SO:0001583	missense	0			BC049209	CCDS46349.1, CCDS62946.1	2p11.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000186854	ENSG00000186854			27013	protein-coding gene	gene with protein product		614912	"""chromosome 2 open reading frame 89"""	C2orf89		12477932	Standard	NM_001080824		Approved		uc010ysl.3	Q86V40	OTTHUMG00000152922	ENST00000409520.2:c.976T>A	2.37:g.85066288A>T	ENSP00000387075:p.Phe326Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKK8|I6UMB9	Missense_Mutation	SNP	NULL	p.F326I	ENST00000409520.2	37	c.976		2	.	.	.	.	.	.	.	.	.	.	A	19.70	3.875768	0.72180	.	.	ENSG00000186854	ENST00000335459;ENST00000409520;ENST00000409133	T;T;T	0.38240	1.49;1.15;1.15	3.75	2.58	0.30949	.	0.000000	0.64402	D	0.000002	T	0.48624	0.1510	.	.	.	0.40435	D	0.979989	P;P;D	0.76494	0.895;0.481;0.999	P;B;D	0.70016	0.629;0.3;0.967	T	0.40553	-0.9557	9	0.27082	T	0.32	.	7.1416	0.25558	0.8878:0.0:0.1122:0.0	.	326;326;277	Q86V40;C9IYB5;Q86V40-2	CB089_HUMAN;.;.	I	277;326;326	ENSP00000335004:F277I;ENSP00000387075:F326I;ENSP00000387183:F326I	ENSP00000335004:F277I	F	-	1	0	C2orf89	84919799	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.076000	0.71267	0.518000	0.28383	0.460000	0.39030	TTT	TRABD2A	-	NULL	ENSG00000186854		0.527	TRABD2A-201	KNOWN	basic|appris_principal	protein_coding	TRABD2A	HGNC	protein_coding		218	0.00	0	A	NM_001080824		85066288	85066288	-1	no_errors	ENST00000409520	ensembl	human	known	69_37n	missense	134	27.57	51	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179613021	179613021	+	Intron	DEL	T	T	-			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:179613021delT	ENST00000591111.1	-	45	10585				TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000360870.5_Frame_Shift_Del_p.K4702fs|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCGGACTTCTTTTTCTAAAG	0.323																																						dbGAP											0													61.0	67.0	65.0					2																	179613021		2193	4291	6484	-	-	-	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+4829A>-	2.37:g.179613021delT		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E4703fs	ENST00000591111.1	37	c.14106		2																																																																																			TTN	-	NULL	ENSG00000155657		0.323	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	219	0.00	0	T	NM_133378		179613021	179613021	-1	no_errors	ENST00000360870	ensembl	human	known	69_37n	frame_shift_del	96	34.23	51	DEL	0.006	-
TNS1	7145	genome.wustl.edu	37	2	218686502	218686502	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr2:218686502C>T	ENST00000171887.4	-	23	3673	c.3221G>A	c.(3220-3222)aGc>aAc	p.S1074N	TNS1_ENST00000430930.1_Missense_Mutation_p.S1053N|TNS1_ENST00000419504.1_Missense_Mutation_p.S1061N	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	1074	Ser-rich.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GGAGAGGGGGCTGGGGGAGAC	0.647																																						dbGAP											0													17.0	18.0	18.0					2																	218686502		2200	4299	6499	-	-	-	SO:0001583	missense	0			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.3221G>A	2.37:g.218686502C>T	ENSP00000171887:p.Ser1074Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.S1074N	ENST00000171887.4	37	c.3221	CCDS2407.1	2	.	.	.	.	.	.	.	.	.	.	C	20.1	3.939022	0.73557	.	.	ENSG00000079308	ENST00000171887;ENST00000446688;ENST00000419504;ENST00000430930	D;T;D;D	0.91945	-2.87;2.1;-2.91;-2.94	4.41	4.41	0.53225	.	0.719537	0.14124	N	0.339828	D	0.93321	0.7871	L	0.27053	0.805	0.80722	D	1	D;D;D	0.65815	0.983;0.994;0.995	P;D;D	0.72338	0.763;0.977;0.918	D	0.93702	0.7016	10	0.66056	D	0.02	.	17.0281	0.86453	0.0:1.0:0.0:0.0	.	1074;1053;1061	Q9HBL0;E9PGF5;E9PF55	TENS1_HUMAN;.;.	N	1074;212;1061;1053	ENSP00000171887:S1074N;ENSP00000394171:S212N;ENSP00000408724:S1061N;ENSP00000406016:S1053N	ENSP00000171887:S1074N	S	-	2	0	TNS1	218394747	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	3.032000	0.49736	2.003000	0.58678	0.561000	0.74099	AGC	TNS1	-	NULL	ENSG00000079308		0.647	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNS1	HGNC	protein_coding	OTTHUMT00000256672.2	38	0.00	0	C	NM_022648		218686502	218686502	-1	no_errors	ENST00000171887	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	1.000	T
TYMP	1890	genome.wustl.edu	37	22	50967953	50967953	+	Silent	SNP	C	C	T			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr22:50967953C>T	ENST00000252029.3	-	2	348	c.186G>A	c.(184-186)gtG>gtA	p.V62V	TYMP_ENST00000395680.1_Silent_p.V62V|TYMP_ENST00000395678.3_Silent_p.V62V|TYMP_ENST00000395681.1_Silent_p.V62V	NM_001113755.2|NM_001113756.2|NM_001257988.1|NM_001257989.1|NM_001953.4	NP_001107227.1|NP_001107228.1|NP_001244917.1|NP_001244918.1|NP_001944.1	P19971	TYPH_HUMAN	thymidine phosphorylase	62					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|chemotaxis (GO:0006935)|DNA replication (GO:0006260)|mitochondrial genome maintenance (GO:0000002)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphorylase activity (GO:0004645)|platelet-derived growth factor receptor binding (GO:0005161)|pyrimidine-nucleoside phosphorylase activity (GO:0016154)|thymidine phosphorylase activity (GO:0009032)|transferase activity, transferring pentosyl groups (GO:0016763)			large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Cidofovir(DB00369)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Trifluridine(DB00432)	CGCTCCCATTCACCACAGCGG	0.682																																						dbGAP											0													41.0	46.0	44.0					22																	50967953		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			M63193	CCDS14096.1, CCDS58811.1	22q13	2014-09-17	2008-01-21	2008-01-21	ENSG00000025708	ENSG00000025708	2.4.2.4		3148	protein-coding gene	gene with protein product	"""gliostatin"""	131222	"""endothelial cell growth factor 1 (platelet-derived)"""	MNGIE, ECGF1		1590793, 11733540	Standard	NM_001113755		Approved		uc003bme.5	P19971	OTTHUMG00000150249	ENST00000252029.3:c.186G>A	22.37:g.50967953C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MW15|H9KVA0|Q13390|Q8WVB7	Silent	SNP	pfam_Glycosyl_Trfase_fam3,pfam_Glycosyl_Trfase_fam3_N_dom,pfam_PYNP_C,superfamily_Glycosyl_Trfase_fam3,superfamily_PYNP_C,superfamily_Glycosyl_Trfase_fam3_N_dom,smart_PYNP_C,pirsf_Pyrmidine_PPase,tigrfam_Pyrmidine_PPas_bac/euk	p.V62	ENST00000252029.3	37	c.186	CCDS14096.1	22																																																																																			TYMP	-	pfam_Glycosyl_Trfase_fam3_N_dom,superfamily_Glycosyl_Trfase_fam3_N_dom,pirsf_Pyrmidine_PPase,tigrfam_Pyrmidine_PPas_bac/euk	ENSG00000025708		0.682	TYMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TYMP	HGNC	protein_coding	OTTHUMT00000317081.1	33	0.00	0	C	NM_001953		50967953	50967953	-1	no_errors	ENST00000252029	ensembl	human	known	69_37n	silent	12	47.83	11	SNP	0.426	T
UTP20	27340	genome.wustl.edu	37	12	101705565	101705565	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr12:101705565C>A	ENST00000261637.4	+	20	2474	c.2300C>A	c.(2299-2301)gCt>gAt	p.A767D		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	767					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GAAAAAGCAGCTACGCATGCT	0.343																																						dbGAP											0													74.0	75.0	75.0					12																	101705565		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.2300C>A	12.37:g.101705565C>A	ENSP00000261637:p.Ala767Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.A767D	ENST00000261637.4	37	c.2300	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	C	16.18	3.050809	0.55218	.	.	ENSG00000120800	ENST00000261637	T	0.19669	2.13	5.69	5.69	0.88448	Armadillo-type fold (1);	0.051847	0.85682	D	0.000000	T	0.24236	0.0587	M	0.72118	2.19	0.58432	D	0.999995	B	0.22746	0.074	B	0.21917	0.037	T	0.05338	-1.0891	10	0.12103	T	0.63	-17.4079	14.0273	0.64592	0.0:0.928:0.0:0.072	.	767	O75691	UTP20_HUMAN	D	767	ENSP00000261637:A767D	ENSP00000261637:A767D	A	+	2	0	UTP20	100229696	0.998000	0.40836	0.993000	0.49108	0.987000	0.75469	3.879000	0.56138	2.687000	0.91594	0.561000	0.74099	GCT	UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.343	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	294	0.00	0	C	NM_014503		101705565	101705565	+1	no_errors	ENST00000261637	ensembl	human	known	69_37n	missense	143	34.40	75	SNP	0.992	A
VCX3A	51481	genome.wustl.edu	37	X	6451836	6451836	+	Missense_Mutation	SNP	C	C	G	rs140208785	byFrequency	TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chrX:6451836C>G	ENST00000381089.3	-	3	817	c.511G>C	c.(511-513)Gag>Cag	p.E171Q	VCX3A_ENST00000398729.1_Missense_Mutation_p.E151Q	NM_016379.3	NP_057463.2	Q9NNX9	VCX3_HUMAN	variable charge, X-linked 3A	171	8 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.|Glu-rich.				brain development (GO:0007420)	nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|lung(2)|pancreas(1)	4						AGTGGTTCCTCCACCTGGCTC	0.582																																						dbGAP											0													218.0	195.0	203.0					X																	6451836		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF159128	CCDS35199.1	Xp22.31	2008-02-05	2005-01-11	2005-01-12	ENSG00000169059	ENSG00000169059			18159	protein-coding gene	gene with protein product		300533	"""variable charge, X-linked 3"""	VCX3		10607842	Standard	NM_016379		Approved	VCX-8r, VCX-8R, VCX-A	uc004crs.3	Q9NNX9	OTTHUMG00000021097	ENST00000381089.3:c.511G>C	X.37:g.6451836C>G	ENSP00000370479:p.Glu171Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P0H4	Missense_Mutation	SNP	NULL	p.E171Q	ENST00000381089.3	37	c.511	CCDS35199.1	X	.	.	.	.	.	.	.	.	.	.	C	5.647	0.303983	0.10678	.	.	ENSG00000169059	ENST00000381089;ENST00000398729	T;T	0.20332	2.08;2.08	0.595	-1.19	0.09585	.	.	.	.	.	T	0.11750	0.0286	L	0.46157	1.445	0.09310	N	1	P	0.43024	0.798	B	0.28232	0.087	T	0.20706	-1.0267	9	0.30078	T	0.28	.	5.8033	0.18426	0.0:0.6657:0.3342:0.0	.	171	Q9NNX9	VCX3_HUMAN	Q	171;151	ENSP00000370479:E171Q;ENSP00000381713:E151Q	ENSP00000370479:E171Q	E	-	1	0	VCX3A	6461836	0.001000	0.12720	0.003000	0.11579	0.006000	0.05464	-0.359000	0.07632	-0.322000	0.08615	0.402000	0.26972	GAG	VCX3A	-	NULL	ENSG00000169059		0.582	VCX3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VCX3A	HGNC	protein_coding	OTTHUMT00000055679.1	304	0.00	0	C	NM_016379		6451836	6451836	-1	no_errors	ENST00000381089	ensembl	human	known	69_37n	missense	171	40.83	118	SNP	0.129	G
VCX	26609	genome.wustl.edu	37	X	7812007	7812007	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chrX:7812007G>C	ENST00000381059.3	+	3	790	c.571G>C	c.(571-573)Gag>Cag	p.E191Q	VCX_ENST00000341408.4_Missense_Mutation_p.E171Q	NM_013452.2	NP_038480.2	Q9H320	VCX1_HUMAN	variable charge, X-linked	191	10 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.|Glu-rich.				chromatin organization (GO:0006325)|ribosome assembly (GO:0042255)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	10		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				GAGCCAGGTGGAGGAACCACC	0.577																																						dbGAP											0													163.0	156.0	159.0					X																	7812007		2077	3870	5947	-	-	-	SO:0001583	missense	0			AF167081	CCDS14128.1	Xp22.31	2008-02-05	2003-09-12		ENSG00000182583	ENSG00000182583			12667	protein-coding gene	gene with protein product		300229	"""variable charge, X chromosome"""			10607842, 10903929	Standard	NM_013452		Approved	VCX1, VCX10R, VCX-10r, VCX-B1	uc004crz.3	Q9H320	OTTHUMG00000028608	ENST00000381059.3:c.571G>C	X.37:g.7812007G>C	ENSP00000370447:p.Glu191Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JNS5|Q4V774|Q9P0H3	Missense_Mutation	SNP	NULL	p.E191Q	ENST00000381059.3	37	c.571	CCDS14128.1	X	.	.	.	.	.	.	.	.	.	.	g	3.770	-0.047739	0.07407	.	.	ENSG00000182583	ENST00000381059;ENST00000341408	T;T	0.20332	2.08;2.08	.	.	.	.	.	.	.	.	T	0.17704	0.0425	L	0.46157	1.445	0.09310	N	1	D	0.55172	0.97	P	0.45506	0.483	T	0.12426	-1.0548	8	0.41790	T	0.15	.	4.5027	0.11872	0.332:0.0:0.668:0.0	.	191	Q9H320	VCX1_HUMAN	Q	191;171	ENSP00000370447:E191Q;ENSP00000344144:E171Q	ENSP00000344144:E171Q	E	+	1	0	VCX	7772007	0.006000	0.16342	0.000000	0.03702	0.000000	0.00434	-0.479000	0.06567	-0.586000	0.05898	-0.577000	0.04142	GAG	VCX	-	NULL	ENSG00000182583		0.577	VCX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VCX	HGNC	protein_coding	OTTHUMT00000071474.1	202	0.00	0	G	NM_013452		7812007	7812007	+1	no_errors	ENST00000381059	ensembl	human	known	69_37n	missense	137	32.18	65	SNP	0.429	C
WDR49	151790	genome.wustl.edu	37	3	167320043	167320043	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr3:167320043T>G	ENST00000308378.3	-	3	429	c.124A>C	c.(124-126)Aaa>Caa	p.K42Q	WDR49_ENST00000479765.1_Missense_Mutation_p.K383Q|WDR49_ENST00000453925.2_Missense_Mutation_p.K95Q	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	42										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						AGGCAAACTTTATTGTTAATG	0.383																																						dbGAP											0													56.0	53.0	54.0					3																	167320043		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.124A>C	3.37:g.167320043T>G	ENSP00000311343:p.Lys42Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N297	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.K42Q	ENST00000308378.3	37	c.124	CCDS3201.1	3	.	.	.	.	.	.	.	.	.	.	T	10.56	1.383414	0.25031	.	.	ENSG00000174776	ENST00000308378;ENST00000479765;ENST00000453925	T;T;T	0.29655	1.61;1.56;2.19	5.4	4.24	0.50183	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.385818	0.26991	N	0.021473	T	0.20901	0.0503	L	0.34521	1.04	0.25804	N	0.984473	B;B;B	0.24533	0.085;0.037;0.105	B;B;B	0.21360	0.017;0.017;0.034	T	0.14868	-1.0457	10	0.36615	T	0.2	.	7.1197	0.25437	0.0:0.0786:0.1468:0.7746	.	95;383;42	E7EQK3;E9PDB0;Q8IV35	.;.;WDR49_HUMAN	Q	42;383;95	ENSP00000311343:K42Q;ENSP00000419749:K383Q;ENSP00000410863:K95Q	ENSP00000311343:K42Q	K	-	1	0	WDR49	168802737	0.978000	0.34361	1.000000	0.80357	0.991000	0.79684	0.594000	0.24014	0.875000	0.35847	0.455000	0.32223	AAA	WDR49	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000174776		0.383	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR49	HGNC	protein_coding	OTTHUMT00000350592.3	166	0.00	0	T	NM_178824		167320043	167320043	-1	no_errors	ENST00000308378	ensembl	human	known	69_37n	missense	100	22.48	29	SNP	1.000	G
ZFYVE16	9765	genome.wustl.edu	37	5	79743961	79743961	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A14W-01A-11D-A12B-09	TCGA-E2-A14W-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fbdc8659-e9cc-483f-bd0a-1a24b5ada1cf	7dfbdd33-5e89-45ef-a636-fe72cc25f3b9	g.chr5:79743961delG	ENST00000338008.5	+	7	3021	c.2841delG	c.(2839-2841)gtgfs	p.V947fs	ZFYVE16_ENST00000505560.1_Frame_Shift_Del_p.V947fs|ZFYVE16_ENST00000510158.1_Frame_Shift_Del_p.V947fs	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	947					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)	p.E948fs*5(1)		breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		TTCCATCAGTGGAAAAATTGT	0.373																																					Melanoma(150;1452 1854 16018 17851 37292)	dbGAP											1	Deletion - Frameshift(1)	lung(1)											108.0	105.0	106.0					5																	79743961		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.2841delG	5.37:g.79743961delG	ENSP00000337159:p.Val947fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Frame_Shift_Del	DEL	pfam_DUF3480,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pirsf_Znf_FYVE_SARA/endofin,pfscan_Znf_FYVE-rel	p.E948fs	ENST00000338008.5	37	c.2841	CCDS4050.1	5																																																																																			ZFYVE16	-	pirsf_Znf_FYVE_SARA/endofin	ENSG00000039319		0.373	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE16	HGNC	protein_coding	OTTHUMT00000226982.2	340	0.00	0	G	NM_014733		79743961	79743961	+1	no_errors	ENST00000338008	ensembl	human	known	69_37n	frame_shift_del	166	33.85	87	DEL	0.792	-
