#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ALS2CR11	151254	genome.wustl.edu	37	2	202358909	202358909	+	Intron	DEL	T	T	-			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr2:202358909delT	ENST00000286195.3	-	14	1626				ALS2CR11_ENST00000439140.1_Frame_Shift_Del_p.S720fs|ALS2CR11_ENST00000439802.1_Intron|ALS2CR11_ENST00000482942.1_Intron	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11											NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						TCCATACTACTTGATGATTTA	0.299																																						dbGAP											0													29.0	22.0	24.0					2																	202358909		692	1582	2274	-	-	-	SO:0001627	intron_variant	0			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1581+1708A>-	2.37:g.202358909delT		Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Frame_Shift_Del	DEL	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.S719fs	ENST00000286195.3	37	c.2155	CCDS2349.1	2																																																																																			ALS2CR11	-	NULL	ENSG00000155754		0.299	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ALS2CR11	HGNC	protein_coding	OTTHUMT00000256296.2	74	0.00	0	T	NM_152525		202358909	202358909	-1	no_errors	ENST00000439140	ensembl	human	novel	69_37n	frame_shift_del	18	10.00	2	DEL	0.000	-
C2	717	genome.wustl.edu	37	6	31896624	31896624	+	Silent	SNP	G	G	A			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr6:31896624G>A	ENST00000299367.5	+	3	648	c.372G>A	c.(370-372)cgG>cgA	p.R124R	CFB_ENST00000556679.1_Intron|C2_ENST00000442278.2_Intron|C2_ENST00000469372.1_Intron|C2_ENST00000418949.2_Silent_p.R124R|CFB_ENST00000456570.1_Intron|C2_ENST00000452323.2_Intron|CFB_ENST00000477310.1_Silent_p.R124R	NM_000063.4	NP_000054.2	P06681	CO2_HUMAN	complement component 2	124	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	27		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		TCATATTGCGGGGCTCGCCTG	0.572																																						dbGAP											0													110.0	94.0	99.0					6																	31896624		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4728.1, CCDS54991.1, CCDS56416.1, CCDS75427.1, CCDS75428.1	6p21.3	2014-09-17			ENSG00000166278	ENSG00000166278		"""Complement system"""	1248	protein-coding gene	gene with protein product		613927					Standard	NM_001145903		Approved		uc011hbs.1	P06681	OTTHUMG00000031190	ENST00000299367.5:c.372G>A	6.37:g.31896624G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPF3|B4DV20|E9PFN7|O19694|Q13904	Silent	SNP	pfam_VWF_A,pfam_Peptidase_S1_S6,pfam_Sushi_SCR_CCP,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_VWF_A,smart_Peptidase_S1_S6,pirsf_Compl_C2_B,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.R124	ENST00000299367.5	37	c.372	CCDS4728.1	6																																																																																			C2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pirsf_Compl_C2_B,pfscan_Sushi_SCR_CCP	ENSG00000166278		0.572	C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2	HGNC	protein_coding	OTTHUMT00000076379.9	170	0.00	0	G			31896624	31896624	+1	no_errors	ENST00000299367	ensembl	human	known	69_37n	silent	110	50.45	112	SNP	1.000	A
C9orf9	11092	genome.wustl.edu	37	9	135763881	135763881	+	Silent	SNP	G	G	A			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr9:135763881G>A	ENST00000372136.3	+	4	999	c.552G>A	c.(550-552)caG>caA	p.Q184Q	C9orf9_ENST00000350499.6_Intron|C9orf9_ENST00000356311.5_Silent_p.Q184Q			Q96E40	CI009_HUMAN	chromosome 9 open reading frame 9	184						cytoplasmic microtubule (GO:0005881)		p.?(1)		cervix(1)|large_intestine(1)|lung(1)|prostate(1)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|GBM - Glioblastoma multiforme(294;4.84e-07)|Epithelial(140;1.28e-06)		GTCCTGCCCAGGCCATAGGGA	0.632																																						dbGAP											1	Unknown(1)	bone(1)																																								-	-	-	SO:0001819	synonymous_variant	0				CCDS6955.1	9q34.13	2012-03-06			ENSG00000165698	ENSG00000165698			1367	protein-coding gene	gene with protein product							Standard	NM_018956		Approved		uc004cby.1	Q96E40	OTTHUMG00000020847	ENST00000372136.3:c.552G>A	9.37:g.135763881G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UGQ0	Silent	SNP	NULL	p.Q184	ENST00000372136.3	37	c.552		9																																																																																			C9orf9	-	NULL	ENSG00000165698		0.632	C9orf9-001	KNOWN	basic	protein_coding	C9orf9	HGNC	protein_coding	OTTHUMT00000054806.1	13	0.00	0	G	NM_018956		135763881	135763881	+1	no_errors	ENST00000356311	ensembl	human	known	69_37n	silent	12	25.00	4	SNP	0.005	A
CATSPERD	257062	genome.wustl.edu	37	19	5744496	5744496	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr19:5744496C>T	ENST00000381624.3	+	8	693	c.632C>T	c.(631-633)gCg>gTg	p.A211V	CATSPERD_ENST00000381614.2_5'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	211					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											TCACAGGTTGCGATGCTTGTA	0.408																																						dbGAP											0													185.0	162.0	169.0					19																	5744496		1840	4100	5940	-	-	-	SO:0001583	missense	0			BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.632C>T	19.37:g.5744496C>T	ENSP00000371037:p.Ala211Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZRP1	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.A211V	ENST00000381624.3	37	c.632	CCDS12149.2	19	.	.	.	.	.	.	.	.	.	.	C	9.609	1.130804	0.21041	.	.	ENSG00000174898	ENST00000394548;ENST00000381624	T	0.22336	1.96	2.61	0.377	0.16198	.	.	.	.	.	T	0.09949	0.0244	N	0.08118	0	0.19775	N	0.999958	P	0.43607	0.812	B	0.37943	0.261	T	0.20042	-1.0287	9	0.72032	D	0.01	.	8.481	0.33043	0.0:0.4846:0.5154:0.0	.	211	Q86XM0	TM146_HUMAN	V	137;211	ENSP00000371037:A211V	ENSP00000371037:A211V	A	+	2	0	TMEM146	5695496	0.446000	0.25665	0.011000	0.14972	0.008000	0.06430	0.737000	0.26144	0.183000	0.20059	-0.702000	0.03669	GCG	CATSPERD	-	superfamily_WD40_repeat_dom	ENSG00000174898		0.408	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	CATSPERD	HGNC	protein_coding	OTTHUMT00000286953.2	383	0.00	0	C	NM_152784		5744496	5744496	+1	no_errors	ENST00000381624	ensembl	human	known	69_37n	missense	161	50.76	166	SNP	0.012	T
CCNB3	85417	genome.wustl.edu	37	X	50037884	50037884	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chrX:50037884C>G	ENST00000376042.1	+	5	524	c.226C>G	c.(226-228)Cag>Gag	p.Q76E	CCNB3_ENST00000276014.7_Missense_Mutation_p.Q76E|CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000376038.1_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	76					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					TCAACCTGTCCAGCCCAAGAA	0.423																																						dbGAP											0													69.0	62.0	64.0					X																	50037884		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.226C>G	X.37:g.50037884C>G	ENSP00000365210:p.Gln76Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like	p.Q76E	ENST00000376042.1	37	c.226	CCDS14331.1	X	.	.	.	.	.	.	.	.	.	.	C	8.201	0.798245	0.16397	.	.	ENSG00000147082	ENST00000376042;ENST00000396540;ENST00000276014	T;T	0.11277	2.79;2.79	4.28	3.41	0.39046	.	.	.	.	.	T	0.09202	0.0227	L	0.40543	1.245	0.09310	N	1	P	0.46987	0.888	B	0.39465	0.3	T	0.20438	-1.0275	8	.	.	.	.	8.5756	0.33597	0.2296:0.7704:0.0:0.0	.	76	Q8WWL7	CCNB3_HUMAN	E	76	ENSP00000365210:Q76E;ENSP00000276014:Q76E	.	Q	+	1	0	CCNB3	50054624	0.008000	0.16893	0.002000	0.10522	0.009000	0.06853	1.059000	0.30517	0.927000	0.37143	0.591000	0.81541	CAG	CCNB3	-	NULL	ENSG00000147082		0.423	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	HGNC	protein_coding	OTTHUMT00000056558.1	351	0.00	0	C			50037884	50037884	+1	no_errors	ENST00000276014	ensembl	human	known	69_37n	missense	175	49.42	171	SNP	0.004	G
CGA	1081	genome.wustl.edu	37	6	87796031	87796031	+	Silent	SNP	C	C	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr6:87796031C>T	ENST00000369582.2	-	3	310	c.210G>A	c.(208-210)acG>acA	p.T70T	RN7SKP209_ENST00000516888.1_RNA	NM_000735.3	NP_000726.1	P01215	GLHA_HUMAN	glycoprotein hormones, alpha polypeptide	70					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|cellular response to hormone stimulus (GO:0032870)|developmental growth (GO:0048589)|follicle-stimulating hormone secretion (GO:0046884)|gonad development (GO:0008406)|luteinizing hormone secretion (GO:0032275)|negative regulation of organ growth (GO:0046621)|peptide hormone processing (GO:0016486)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)	15		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)		BRCA - Breast invasive adenocarcinoma(108;0.0484)		GGACCAACATCGTCTTCTTGG	0.488																																						dbGAP											0													193.0	190.0	191.0					6																	87796031		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			V00518	CCDS5007.1, CCDS75492.1	6q14-q21	2013-02-26			ENSG00000135346	ENSG00000135346		"""Endogenous ligands"""	1885	protein-coding gene	gene with protein product	"""follicle-stimulating hormone alpha subunit"", ""chorionic gonadotropin, alpha polypeptide"", ""luteinizing hormone alpha chain"", ""lutropin alpha chain"", ""thyroid-stimulating hormone alpha chain"", ""glycoprotein hormones alpha chain"""	118850				6286817	Standard	NM_000735		Approved	HCG, GPHa, GPHA1, FSHA, LHA, TSHA	uc021zci.1	P01215	OTTHUMG00000015161	ENST00000369582.2:c.210G>A	6.37:g.87796031C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Glyco_hormone,smart_Glyco_hormone,pfscan_Glyco_hormone,prints_Glyco_hormone	p.T70	ENST00000369582.2	37	c.210	CCDS5007.1	6																																																																																			CGA	-	pfam_Glyco_hormone,smart_Glyco_hormone,pfscan_Glyco_hormone,prints_Glyco_hormone	ENSG00000135346		0.488	CGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGA	HGNC	protein_coding	OTTHUMT00000041425.1	264	0.00	0	C	NM_000735		87796031	87796031	-1	no_errors	ENST00000369582	ensembl	human	known	69_37n	silent	165	37.02	97	SNP	0.987	T
CHD8	57680	genome.wustl.edu	37	14	21859709	21859709	+	Silent	SNP	C	C	A			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr14:21859709C>A	ENST00000557364.1	-	36	7241	c.6978G>T	c.(6976-6978)ctG>ctT	p.L2326L	CHD8_ENST00000399982.2_Silent_p.L2326L|CHD8_ENST00000430710.3_Silent_p.L2047L|SNORD9_ENST00000362566.1_RNA			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	2326					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CCTCACCCACCAGCAAAGTAC	0.552																																						dbGAP											0													46.0	47.0	47.0					14																	21859709		2033	4181	6214	-	-	-	SO:0001819	synonymous_variant	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.6978G>T	14.37:g.21859709C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Silent	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.L2326	ENST00000557364.1	37	c.6978	CCDS53885.1	14																																																																																			CHD8	-	pfam_BRK_domain,smart_BRK_domain	ENSG00000100888		0.552	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	86	0.00	0	C	NM_020920		21859709	21859709	-1	no_errors	ENST00000399982	ensembl	human	known	69_37n	silent	90	16.67	18	SNP	1.000	A
CLYBL	171425	genome.wustl.edu	37	13	100518535	100518535	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr13:100518535C>T	ENST00000376360.1	+	6	703	c.676C>T	c.(676-678)Cgg>Tgg	p.R226W	CLYBL_ENST00000376355.3_Missense_Mutation_p.R192W|CLYBL_ENST00000444838.2_Missense_Mutation_p.R192W|CLYBL_ENST00000376354.1_Missense_Mutation_p.R192W|CLYBL_ENST00000339105.4_Missense_Mutation_p.R226W			Q8N0X4	CLYBL_HUMAN	citrate lyase beta like	226						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|metal ion binding (GO:0046872)	p.R226R(1)		NS(1)|kidney(6)|large_intestine(6)|lung(10)|skin(2)	25	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TCTCTACGCCCGGCAAAAGAT	0.453																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											101.0	104.0	103.0					13																	100518535		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF428253	CCDS32002.1	13q32.3	2011-04-08			ENSG00000125246	ENSG00000125246			18355	protein-coding gene	gene with protein product		609686					Standard	XM_005254030		Approved	CLB	uc001vok.3	Q8N0X4	OTTHUMG00000017278	ENST00000376360.1:c.676C>T	13.37:g.100518535C>T	ENSP00000365538:p.Arg226Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W0F7|Q8TDH8	Missense_Mutation	SNP	pfam_Aldehyde-lyase_domain,superfamily_Pyrv/PenolPyrv_Kinase,pirsf_Citrate_lyase_beta	p.R226W	ENST00000376360.1	37	c.676	CCDS32002.1	13	.	.	.	.	.	.	.	.	.	.	C	19.85	3.904105	0.72754	.	.	ENSG00000125246	ENST00000376355;ENST00000376360;ENST00000444838;ENST00000376354;ENST00000339105	T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32	5.75	5.75	0.90469	Aldehyde-lyase domain (1);Pyruvate/Phosphoenolpyruvate kinase (2);	0.109676	0.64402	D	0.000011	T	0.71031	0.3292	H	0.95982	3.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79181	-0.1909	10	0.87932	D	0	-23.1849	13.0629	0.59018	0.1995:0.8005:0.0:0.0	.	192;226	B4DU60;Q8N0X4	.;CLYBL_HUMAN	W	192;226;192;192;226	ENSP00000365533:R192W;ENSP00000365538:R226W;ENSP00000404768:R192W;ENSP00000365532:R192W;ENSP00000342991:R226W	ENSP00000342991:R226W	R	+	1	2	CLYBL	99316536	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.151000	0.42263	2.866000	0.98385	0.650000	0.86243	CGG	CLYBL	-	pfam_Aldehyde-lyase_domain,superfamily_Pyrv/PenolPyrv_Kinase,pirsf_Citrate_lyase_beta	ENSG00000125246		0.453	CLYBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLYBL	HGNC	protein_coding	OTTHUMT00000045611.1	140	0.00	0	C			100518535	100518535	+1	no_errors	ENST00000339105	ensembl	human	known	69_37n	missense	93	44.31	74	SNP	1.000	T
CMTM5	116173	genome.wustl.edu	37	14	23848056	23848056	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr14:23848056G>T	ENST00000339180.4	+	3	674	c.458G>T	c.(457-459)tGc>tTc	p.C153F	CMTM5_ENST00000397227.3_Intron|CMTM5_ENST00000382809.2_Intron|CMTM5_ENST00000555731.1_Intron|CMTM5_ENST00000342473.4_Intron|CMTM5_ENST00000359320.3_Intron			Q96DZ9	CKLF5_HUMAN	CKLF-like MARVEL transmembrane domain containing 5	153	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	8	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.0064)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0382)		TGGTTCATCTGCTTCCACTCC	0.602																																						dbGAP											0													31.0	30.0	30.0					14																	23848056		876	1991	2867	-	-	-	SO:0001583	missense	0			BC013109	CCDS9598.1, CCDS32050.1, CCDS73617.1, CCDS73618.1, CCDS73619.1	14q11.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000166091	ENSG00000166091			19176	protein-coding gene	gene with protein product		607888	"""chemokine-like factor super family 5"", ""chemokine-like factor superfamily 5"""	CKLFSF5			Standard	NM_138460		Approved	FLJ37521	uc001wjs.3	Q96DZ9	OTTHUMG00000028751	ENST00000339180.4:c.458G>T	14.37:g.23848056G>T	ENSP00000344819:p.Cys153Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PH91|Q5PY48	Missense_Mutation	SNP	NULL	p.C153F	ENST00000339180.4	37	c.458		14	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339826	0.41398	.	.	ENSG00000166091	ENST00000339180	T	0.50001	0.76	3.73	2.83	0.33086	Marvel (1);	.	.	.	.	T	0.35913	0.0948	.	.	.	0.19775	N	0.999958	B	0.14012	0.009	B	0.12156	0.007	T	0.27971	-1.0058	8	0.52906	T	0.07	-7.0929	8.8535	0.35214	0.0:0.0:0.7779:0.2221	.	153	Q96DZ9	CKLF5_HUMAN	F	153	ENSP00000344819:C153F	ENSP00000344819:C153F	C	+	2	0	CMTM5	22917896	0.002000	0.14202	0.013000	0.15412	0.216000	0.24613	0.506000	0.22658	1.133000	0.42147	0.462000	0.41574	TGC	CMTM5	-	NULL	ENSG00000166091		0.602	CMTM5-003	KNOWN	basic	protein_coding	CMTM5	HGNC	protein_coding	OTTHUMT00000133708.2	21	0.00	0	G			23848056	23848056	+1	no_errors	ENST00000339180	ensembl	human	known	69_37n	missense	11	45.00	9	SNP	0.009	T
DAZAP1	26528	genome.wustl.edu	37	19	1430254	1430254	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr19:1430254delC	ENST00000233078.4	+	10	925	c.764delC	c.(763-765)gccfs	p.A255fs	DAZAP1_ENST00000336761.6_Frame_Shift_Del_p.A255fs	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	255	Pro-rich.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAAGAGGAGCCCCCCCGCCA	0.652																																						dbGAP											0													17.0	21.0	19.0					19																	1430254		2196	4297	6493	-	-	-	SO:0001589	frameshift_variant	0				CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.764delC	19.37:g.1430254delC	ENSP00000233078:p.Ala255fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MJ3|Q9NRR9	Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P257fs	ENST00000233078.4	37	c.764	CCDS12065.1	19																																																																																			DAZAP1	-	NULL	ENSG00000071626		0.652	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAZAP1	HGNC	protein_coding	OTTHUMT00000449522.3	43	0.00	0	C	NM_170711		1430254	1430254	+1	no_errors	ENST00000233078	ensembl	human	known	69_37n	frame_shift_del	22	62.69	42	DEL	0.998	-
DMD	1756	genome.wustl.edu	37	X	31152232	31152232	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chrX:31152232G>T	ENST00000357033.4	-	77	11207	c.11001C>A	c.(10999-11001)ttC>ttA	p.F3667L	DMD_ENST00000378680.2_Missense_Mutation_p.F489L|DMD_ENST00000361471.4_Missense_Mutation_p.F586L|DMD_ENST00000474231.1_Missense_Mutation_p.F1207L|DMD_ENST00000378707.3_Missense_Mutation_p.F1207L|DMD_ENST00000343523.2_Missense_Mutation_p.F1097L|DMD_ENST00000359836.1_Missense_Mutation_p.F1194L|DMD_ENST00000378723.3_Missense_Mutation_p.F599L|DMD_ENST00000378702.4_Missense_Mutation_p.F599L|DMD_ENST00000541735.1_Missense_Mutation_p.F1097L|DMD_ENST00000378677.2_Missense_Mutation_p.F3663L	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3667					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTGAACTAGGGAAGGAGTTGT	0.468																																						dbGAP											0													205.0	127.0	154.0					X																	31152232		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.11001C>A	X.37:g.31152232G>T	ENSP00000354923:p.Phe3667Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.F3667L	ENST00000357033.4	37	c.11001	CCDS14233.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.2|20.2	3.942765|3.942765	0.73672|0.73672	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000474231;ENST00000361471;ENST00000378680|ENST00000465285	T;T;T;T;T;T;T;T;T;T;T;T|.	0.72942|.	2.05;3.72;-0.7;-0.7;3.69;3.61;3.46;2.72;1.91;3.72;2.07;2.01|.	5.04|5.04	2.31|2.31	0.28768|0.28768	.|.	0.000000|.	0.39210|.	U|.	0.001424|.	T|T	0.60314|0.60314	0.2259|0.2259	L|L	0.59912|0.59912	1.85|1.85	0.39796|0.39796	D|D	0.972505|0.972505	D;D;D;P;D;D;D;D;D;P;P;D;P;D;D;P|.	0.89917|.	0.969;0.986;0.982;0.956;0.982;0.982;0.997;0.997;1.0;0.924;0.954;1.0;0.954;0.995;0.989;0.924|.	D;D;D;D;D;D;D;D;D;P;D;D;D;P;P;P|.	0.91635|.	0.914;0.974;0.952;0.931;0.952;0.952;0.942;0.953;0.998;0.827;0.916;0.999;0.943;0.886;0.78;0.878|.	T|T	0.57906|0.57906	-0.7730|-0.7730	10|5	0.39692|.	T|.	0.17|.	.|.	9.6461|9.6461	0.39868|0.39868	0.3078:0.0:0.6922:0.0|0.3078:0.0:0.6922:0.0	.|.	489;3659;3667;3663;2326;2323;1194;1207;1207;1097;1097;3544;586;599;586;599|.	B4DSV7;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3;P11532-5;Q8N754;Q6NSJ9;E9PDN1|.	.;.;DMD_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.|.	L|T	3659;2326;2323;599;1350;3663;3667;1194;1097;3667;3544;1207;1097;599;1207;586;489|1396	ENSP00000367997:F599L;ENSP00000350765:F1350L;ENSP00000367948:F3663L;ENSP00000354923:F3667L;ENSP00000352894:F1194L;ENSP00000340057:F1097L;ENSP00000367979:F1207L;ENSP00000444119:F1097L;ENSP00000367974:F599L;ENSP00000417123:F1207L;ENSP00000354464:F586L;ENSP00000367951:F489L|.	ENSP00000340057:F1097L|.	F|P	-|-	3|1	2|0	DMD|DMD	31062153|31062153	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.583000|1.583000	0.36579|0.36579	0.622000|0.622000	0.30249|0.30249	0.600000|0.600000	0.82982|0.82982	TTC|CCC	DMD	-	pirsf_Dystrophin/utrophin	ENSG00000198947		0.468	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	246	0.00	0	G	NM_004006		31152232	31152232	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	252	32.35	121	SNP	1.000	T
DUPD1	338599	genome.wustl.edu	37	10	76818229	76818229	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr10:76818229G>T	ENST00000338487.5	-	1	43	c.44C>A	c.(43-45)tCa>tAa	p.S15*		NM_001003892.1	NP_001003892.1	Q68J44	DUPD1_HUMAN	dual specificity phosphatase and pro isomerase domain containing 1	15					protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.S15*(1)		breast(1)|endometrium(2)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					CTTGGCAGATGAGTAGGCATT	0.537																																						dbGAP											1	Substitution - Nonsense(1)	lung(1)											81.0	76.0	78.0					10																	76818229		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS31223.1	10q22.3	2011-06-09			ENSG00000188716	ENSG00000188716		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	23481	protein-coding gene	gene with protein product							Standard	NM_001003892		Approved	DUSP27	uc001jwq.1	Q68J44	OTTHUMG00000018512	ENST00000338487.5:c.44C>A	10.37:g.76818229G>T	ENSP00000340609:p.Ser15*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP93	Nonsense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP_famA,prints_Atypical_DUSP,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.S15*	ENST00000338487.5	37	c.44	CCDS31223.1	10	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908922	0.72868	.	.	ENSG00000188716	ENST00000338487	.	.	.	4.6	1.48	0.22813	.	28.896400	0.00589	N	0.000346	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.8577	6.7635	0.23554	0.1877:0.159:0.6532:0.0	.	.	.	.	X	15	.	ENSP00000340609:S15X	S	-	2	0	DUPD1	76488235	0.008000	0.16893	0.015000	0.15790	0.730000	0.41778	0.577000	0.23758	0.542000	0.28846	0.563000	0.77884	TCA	DUPD1	-	NULL	ENSG00000188716		0.537	DUPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUPD1	HGNC	protein_coding	OTTHUMT00000048777.2	143	0.00	0	G	XM_291741		76818229	76818229	-1	no_errors	ENST00000338487	ensembl	human	known	69_37n	nonsense	134	19.76	33	SNP	0.000	T
E2F1	1869	genome.wustl.edu	37	20	32267640	32267640	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr20:32267640G>A	ENST00000343380.5	-	3	632	c.493C>T	c.(493-495)Cgg>Tgg	p.R165W		NM_005225.2	NP_005216.1	Q01094	E2F1_HUMAN	E2F transcription factor 1	165	Interaction with BIRC2/c-IAP1.|Leucine-zipper.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|DNA damage checkpoint (GO:0000077)|forebrain development (GO:0030900)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|mRNA stabilization (GO:0048255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(2)|breast(1)|endometrium(3)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	16						TAGATGCGCCGCTTCTGCACC	0.582																																						dbGAP											0													174.0	145.0	155.0					20																	32267640		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13224.1	20q11	2008-05-14			ENSG00000101412	ENSG00000101412			3113	protein-coding gene	gene with protein product		189971		RBBP3		8964493	Standard	NM_005225		Approved	RBP3	uc002wzu.4	Q01094	OTTHUMG00000032265	ENST00000343380.5:c.493C>T	20.37:g.32267640G>A	ENSP00000345571:p.Arg165Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13143|Q92768	Missense_Mutation	SNP	pfam_E2F_TDP	p.R165W	ENST00000343380.5	37	c.493	CCDS13224.1	20	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639260	0.67244	.	.	ENSG00000101412	ENST00000343380	T	0.64803	-0.12	4.72	4.72	0.59763	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.85687	0.5754	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89168	0.3535	10	0.87932	D	0	-3.5871	10.6036	0.45381	0.0:0.0:0.7022:0.2978	.	165	Q01094	E2F1_HUMAN	W	165	ENSP00000345571:R165W	ENSP00000345571:R165W	R	-	1	2	E2F1	31731301	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	3.104000	0.50306	2.608000	0.88229	0.462000	0.41574	CGG	E2F1	-	pfam_E2F_TDP	ENSG00000101412		0.582	E2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F1	HGNC	protein_coding	OTTHUMT00000078731.2	139	0.00	0	G			32267640	32267640	-1	no_errors	ENST00000343380	ensembl	human	known	69_37n	missense	257	14.00	42	SNP	1.000	A
ERVFRD-1	405754	genome.wustl.edu	37	6	11103979	11103979	+	Missense_Mutation	SNP	G	G	T	rs138651238	byFrequency	TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr6:11103979G>T	ENST00000472091.1	-	2	1940	c.1565C>A	c.(1564-1566)aCg>aAg	p.T522K	SMIM13_ENST00000416247.2_Intron|ERVFRD-1_ENST00000542862.1_Missense_Mutation_p.T522K	NM_207582.2	NP_997465.1	P60508	SYCY2_HUMAN	endogenous retrovirus group FRD, member 1	522					syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(4)|stomach(1)	15						actgagattcgtctggagctt	0.488																																						dbGAP											0													38.0	35.0	36.0					6																	11103979		1845	3499	5344	-	-	-	SO:0001583	missense	0			AK075092, AK123938, AY358244	CCDS4519.1	6p24.2	2014-05-02			ENSG00000244476	ENSG00000244476			33823	other	endogenous retrovirus		610524				12970426, 14557543, 15476554, 21542922	Standard	NM_207582		Approved	HERV-W/FRD, HERV-FRD, envFRD, ERVFRDE1, syncytin-2	uc003mzt.3	P60508	OTTHUMG00000159193	ENST00000472091.1:c.1565C>A	6.37:g.11103979G>T	ENSP00000420174:p.Thr522Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_TLV/ENV_coat_polyprotein	p.T522K	ENST00000472091.1	37	c.1565	CCDS4519.1	6	.	.	.	.	.	.	.	.	.	.	G	2.651	-0.282029	0.05642	.	.	ENSG00000244476	ENST00000472091;ENST00000542862	T;T	0.16196	2.36;2.36	0.225	-0.451	0.12214	.	403.832000	0.01344	U	0.011664	T	0.02727	0.0082	N	0.14661	0.345	0.09310	N	1	B	0.19200	0.034	B	0.08055	0.003	T	0.36237	-0.9756	9	0.52906	T	0.07	.	.	.	.	.	522	P60508	EFRD1_HUMAN	K	522	ENSP00000420174:T522K;ENSP00000444461:T522K	ENSP00000420174:T522K	T	-	2	0	ERVFRD-1	11211965	0.055000	0.20627	0.003000	0.11579	0.003000	0.03518	-0.541000	0.06099	-0.694000	0.05113	-0.680000	0.03767	ACG	ERVFRD-1	-	NULL	ENSG00000244476		0.488	ERVFRD-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVFRD-1	HGNC	protein_coding	OTTHUMT00000353776.1	111	0.00	0	G	NM_207582		11103979	11103979	-1	no_errors	ENST00000472091	ensembl	human	known	69_37n	missense	52	38.82	33	SNP	0.003	T
FBXL3	26224	genome.wustl.edu	37	13	77595895	77595895	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr13:77595895C>G	ENST00000355619.5	-	2	425	c.101G>C	c.(100-102)tGt>tCt	p.C34S		NM_012158.2	NP_036290.1	Q9UKT7	FBXL3_HUMAN	F-box and leucine-rich repeat protein 3	34	F-box.				entrainment of circadian clock by photoperiod (GO:0043153)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|urinary_tract(1)	16		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.218)		GBM - Glioblastoma multiforme(99;0.0521)		ACCCCAATCACAAGTCTGAGA	0.423																																						dbGAP											0													144.0	154.0	150.0					13																	77595895		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF129532	CCDS9457.1	13q22	2011-06-09	2004-07-20	2004-07-21	ENSG00000005812	ENSG00000005812		"""F-boxes / Leucine-rich repeats"""	13599	protein-coding gene	gene with protein product		605653	"""F-box and leucine-rich repeat protein 3A"""	FBXL3A		10531035, 10828603	Standard	NM_012158		Approved	FBL3, FBL3A	uc001vkd.3	Q9UKT7	OTTHUMG00000017099	ENST00000355619.5:c.101G>C	13.37:g.77595895C>G	ENSP00000347834:p.Cys34Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB04|Q9P122	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like	p.C34S	ENST00000355619.5	37	c.101	CCDS9457.1	13	.	.	.	.	.	.	.	.	.	.	C	6.609	0.480694	0.12581	.	.	ENSG00000005812	ENST00000355619;ENST00000417323	T;T	0.52526	2.09;0.66	5.87	1.07	0.20283	F-box domain, Skp2-like (1);	0.835016	0.11742	N	0.533928	T	0.23572	0.0570	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22103	-1.0226	10	0.21540	T	0.41	-1.0399	6.8621	0.24072	0.0:0.2979:0.4213:0.2808	.	34	Q9UKT7	FBXL3_HUMAN	S	34	ENSP00000347834:C34S;ENSP00000412183:C34S	ENSP00000347834:C34S	C	-	2	0	FBXL3	76493896	0.419000	0.25449	0.010000	0.14722	0.992000	0.81027	0.366000	0.20365	-0.112000	0.11979	0.591000	0.81541	TGT	FBXL3	-	superfamily_F-box_dom_cyclin-like	ENSG00000005812		0.423	FBXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL3	HGNC	protein_coding	OTTHUMT00000045312.3	181	0.00	0	C			77595895	77595895	-1	no_errors	ENST00000355619	ensembl	human	known	69_37n	missense	199	14.22	33	SNP	0.014	G
HRNR	388697	genome.wustl.edu	37	1	152188940	152188940	+	Missense_Mutation	SNP	A	A	G	rs34655925	byFrequency	TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr1:152188940A>G	ENST00000368801.2	-	3	5240	c.5165T>C	c.(5164-5166)tTg>tCg	p.L1722S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1722					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGAGTGCCCCAAACCGGACCC	0.632																																						dbGAP											0													5.0	3.0	4.0					1																	152188940		1101	2289	3390	-	-	-	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5165T>C	1.37:g.152188940A>G	ENSP00000357791:p.Leu1722Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.L1722S	ENST00000368801.2	37	c.5165	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	G	5.020	0.189336	0.09547	.	.	ENSG00000197915	ENST00000368801	T	0.01516	4.81	3.03	1.03	0.20045	.	.	.	.	.	T	0.00241	0.0007	N	0.02802	-0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31888	-0.9927	9	0.14656	T	0.56	.	2.8532	0.05564	0.3579:0.0:0.4426:0.1995	.	1722	Q86YZ3	HORN_HUMAN	S	1722	ENSP00000357791:L1722S	ENSP00000357791:L1722S	L	-	2	0	HRNR	150455564	0.635000	0.27199	0.000000	0.03702	0.003000	0.03518	0.914000	0.28624	-0.136000	0.11475	-0.171000	0.13296	TTG	HRNR	-	NULL	ENSG00000197915		0.632	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	17	0.00	0	A	XM_373868		152188940	152188940	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	missense	70	30.69	31	SNP	0.000	G
FCGR3A	2214	genome.wustl.edu	37	1	161600164	161600164	+	Silent	SNP	G	G	T	rs375134752		TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr1:161600164G>T	ENST00000540048.1	-	2	87	c.55C>A	c.(55-57)Cgg>Agg	p.R19R	FCGR2B_ENST00000428605.2_Intron|FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000403078.3_Intron|FCGR3B_ENST00000294800.3_Silent_p.R19R|FCGR3B_ENST00000531221.1_Silent_p.R55R|FCGR3B_ENST00000367964.2_Silent_p.R19R|FCGR2B_ENST00000367962.4_Intron			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)	19					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TCACCAGTCCGCATGCCAGCT	0.438																																						dbGAP											0													38.0	46.0	44.0					1																	161600164		2189	4299	6488	-	-	-	SO:0001819	synonymous_variant	0			BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.55C>A	1.37:g.161600164G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.A40E	ENST00000540048.1	37	c.119		1	.	.	.	.	.	.	.	.	.	.	G	5.048	0.194585	0.09599	.	.	ENSG00000162747	ENST00000421702	.	.	.	3.13	-2.19	0.07015	.	.	.	.	.	T	0.08891	0.0220	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36286	-0.9754	4	.	.	.	.	4.9718	0.14119	0.0:0.1815:0.3259:0.4926	.	.	.	.	E	40	.	.	A	-	2	0	FCGR3B	159866788	0.000000	0.05858	0.000000	0.03702	0.194000	0.23727	-0.038000	0.12144	-0.047000	0.13423	0.388000	0.25769	GCG	FCGR3B	-	NULL	ENSG00000162747		0.438	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	FCGR3B	HGNC	protein_coding		72	0.00	0	G	NM_000569		161600164	161600164	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000421702	ensembl	human	putative	69_37n	missense	132	30.89	59	SNP	0.000	T
IFITM3	10410	genome.wustl.edu	37	11	320790	320790	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr11:320790G>T	ENST00000399808.4	-	1	260	c.24C>A	c.(22-24)ttC>ttA	p.F8L	IFITM3_ENST00000526811.1_Intron|RP11-326C3.11_ENST00000602429.1_RNA|RP11-326C3.11_ENST00000602756.1_RNA|IFITM3_ENST00000602735.1_Intron|RP11-326C3.10_ENST00000534271.1_RNA|RP11-326C3.11_ENST00000508004.2_RNA|RP11-326C3.14_ENST00000602809.1_lincRNA	NM_021034.2	NP_066362.2	Q01628	IFM3_HUMAN	interferon induced transmembrane protein 3	8					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral transcription (GO:0032897)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				central_nervous_system(7)|endometrium(7)|kidney(2)|large_intestine(1)|lung(1)	18		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		CAGGAGAGAAGAAGGTTTGGA	0.602																																						dbGAP											0													130.0	145.0	140.0					11																	320790		1937	4143	6080	-	-	-	SO:0001583	missense	0			X57352	CCDS41585.1	11p15.5	2011-05-24	2011-05-24		ENSG00000142089	ENSG00000142089			5414	protein-coding gene	gene with protein product		605579	"""interferon induced transmembrane protein 3 (1-8U)"""			1906403, 16326387	Standard	NM_021034		Approved	1-8U	uc001lpa.2	Q01628		ENST00000399808.4:c.24C>A	11.37:g.320790G>T	ENSP00000382707:p.Phe8Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53Y76|Q96HK8|Q96J15	Missense_Mutation	SNP	pfam_Interferon-induced_TM_protein	p.F8L	ENST00000399808.4	37	c.24	CCDS41585.1	11	.	.	.	.	.	.	.	.	.	.	G	11.77	1.736251	0.30774	.	.	ENSG00000142089	ENST00000399808	T	0.77877	-1.13	4.0	1.02	0.19986	.	.	.	.	.	T	0.67344	0.2883	M	0.74546	2.27	0.18873	N	0.999986	P	0.36144	0.539	B	0.24394	0.053	T	0.56968	-0.7891	9	0.35671	T	0.21	.	3.0556	0.06183	0.231:0.0:0.5543:0.2147	.	8	Q01628	IFM3_HUMAN	L	8	ENSP00000382707:F8L	ENSP00000382707:F8L	F	-	3	2	IFITM3	310790	0.008000	0.16893	0.001000	0.08648	0.076000	0.17211	0.428000	0.21395	0.464000	0.27142	0.405000	0.27470	TTC	IFITM3	-	NULL	ENSG00000142089		0.602	IFITM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFITM3	HGNC	protein_coding	OTTHUMT00000384765.1	123	0.00	0	G	NM_021034		320790	320790	-1	no_errors	ENST00000399808	ensembl	human	known	69_37n	missense	111	22.92	33	SNP	0.000	T
IGHV4-31	28396	genome.wustl.edu	37	14	106805400	106805400	+	RNA	SNP	A	A	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr14:106805400A>T	ENST00000438142.2	-	0	234									immunoglobulin heavy variable 4-31																		ATCCAGCTCCAGTAGTAACCA	0.587																																						dbGAP											0													92.0	139.0	124.0					14																	106805400		1926	4122	6048	-	-	-			0			L10098		14q32.33	2012-02-08			ENSG00000231475	ENSG00000231475		"""Immunoglobulins / IGH locus"""	5649	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152097		14.37:g.106805400A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.W55R	ENST00000438142.2	37	c.163		14																																																																																			IGHV4-31	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000231475		0.587	IGHV4-31-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV4-31	HGNC	IG_V_gene	OTTHUMT00000325194.1	251	0.00	0	A	NG_001019		106805400	106805400	-1	no_stop_codon	ENST00000438142	ensembl	human	known	69_37n	missense	239	42.41	176	SNP	0.000	T
IRAK3	11213	genome.wustl.edu	37	12	66641568	66641568	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr12:66641568T>G	ENST00000261233.4	+	12	1829	c.1408T>G	c.(1408-1410)Ttc>Gtc	p.F470V	IRAK3_ENST00000457197.2_Missense_Mutation_p.F409V	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3											breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		TTCTCCTCTATTCCTGGAGAA	0.398																																						dbGAP											0													121.0	110.0	114.0					12																	66641568		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.1408T>G	12.37:g.66641568T>G	ENSP00000261233:p.Phe470Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Death,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Death,pfscan_Prot_kinase_cat_dom	p.F470V	ENST00000261233.4	37	c.1408	CCDS8975.1	12	.	.	.	.	.	.	.	.	.	.	T	11.79	1.742825	0.30865	.	.	ENSG00000090376	ENST00000261233;ENST00000457197	T;T	0.72282	-0.6;-0.64	5.77	5.77	0.91146	Protein kinase-like domain (1);	0.128422	0.52532	D	0.000067	T	0.67942	0.2947	L	0.32530	0.975	0.31816	N	0.626616	D;D	0.56287	0.975;0.958	P;P	0.51516	0.672;0.471	T	0.72388	-0.4309	9	.	.	.	-21.6787	12.4942	0.55918	0.0:0.0:0.0:1.0	.	409;470	Q9Y616-2;Q9Y616	.;IRAK3_HUMAN	V	470;409	ENSP00000261233:F470V;ENSP00000409852:F409V	.	F	+	1	0	IRAK3	64927835	0.974000	0.33945	0.298000	0.25002	0.173000	0.22820	2.422000	0.44696	2.200000	0.70718	0.459000	0.35465	TTC	IRAK3	-	superfamily_Kinase-like_dom	ENSG00000090376		0.398	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK3	HGNC	protein_coding	OTTHUMT00000401908.1	261	0.38	1	T			66641568	66641568	+1	no_errors	ENST00000261233	ensembl	human	known	69_37n	missense	107	53.07	121	SNP	0.716	G
KLHL38	340359	genome.wustl.edu	37	8	124664638	124664638	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr8:124664638C>T	ENST00000325995.7	-	1	552	c.529G>A	c.(529-531)Gcc>Acc	p.A177T	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	177	BACK.									breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						AACTCCAAGGCACAGAGCTCC	0.567																																						dbGAP											0													56.0	57.0	56.0					8																	124664638		2000	4155	6155	-	-	-	SO:0001583	missense	0				CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.529G>A	8.37:g.124664638C>T	ENSP00000321475:p.Ala177Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK12	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A177T	ENST00000325995.7	37	c.529	CCDS43766.1	8	.	.	.	.	.	.	.	.	.	.	C	7.011	0.556803	0.13436	.	.	ENSG00000175946	ENST00000325995	T	0.69561	-0.41	5.29	4.36	0.52297	BTB/Kelch-associated (2);	0.366785	0.30020	N	0.010620	T	0.63462	0.2513	L	0.52011	1.625	0.09310	N	0.999999	B	0.20368	0.044	B	0.29524	0.103	T	0.50482	-0.8823	10	0.18710	T	0.47	.	18.2092	0.89865	0.0:0.8358:0.1642:0.0	.	177	Q2WGJ6	KLH38_HUMAN	T	177	ENSP00000321475:A177T	ENSP00000321475:A177T	A	-	1	0	KLHL38	124733819	0.660000	0.27420	0.074000	0.20217	0.437000	0.31866	2.308000	0.43690	2.480000	0.83734	0.491000	0.48974	GCC	KLHL38	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000175946		0.567	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL38	HGNC	protein_coding	OTTHUMT00000381288.1	18	0.00	0	C			124664638	124664638	-1	no_errors	ENST00000325995	ensembl	human	known	69_37n	missense	18	43.75	14	SNP	0.311	T
MEGF8	1954	genome.wustl.edu	37	19	42862378	42862378	+	Silent	SNP	G	G	A			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr19:42862378G>A	ENST00000251268.6	+	29	5094	c.5094G>A	c.(5092-5094)ctG>ctA	p.L1698L	MEGF8_ENST00000334370.4_Silent_p.L1631L	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1698					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				ATGTGGAGCTGGCGGCCCCAT	0.627																																						dbGAP											0													70.0	49.0	56.0					19																	42862378		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.5094G>A	19.37:g.42862378G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAY0|O75097	Silent	SNP	pfam_CUB,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB,superfamily_Plexin-like_fold,smart_CUB,smart_EGF-like,smart_Plexin-like,smart_EGF-like_Ca-bd,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin	p.L1698	ENST00000251268.6	37	c.5094		19																																																																																			MEGF8	-	superfamily_Gal_Oxase/kelch_b-propeller	ENSG00000105429		0.627	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	75	0.00	0	G	NM_001410		42862378	42862378	+1	no_errors	ENST00000251268	ensembl	human	known	69_37n	silent	70	15.66	13	SNP	0.999	A
NOVA2	4858	genome.wustl.edu	37	19	46457123	46457123	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr19:46457123C>T	ENST00000263257.5	-	3	505	c.311G>A	c.(310-312)cGa>cAa	p.R104Q		NM_002516.2	NP_002507.1	Q9UNW9	NOVA2_HUMAN	neuro-oncological ventral antigen 2	104					regulation of RNA metabolic process (GO:0051252)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(5)|lung(13)	21		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)		TGGGATTTCTCGGACCTTCTC	0.562																																						dbGAP											0													300.0	250.0	267.0					19																	46457123		2203	4300	6503	-	-	-	SO:0001583	missense	0			U70477	CCDS12679.1	19q13.3	2008-07-17				ENSG00000104967			7887	protein-coding gene	gene with protein product	"""neuro-oncological ventral antigen 3"""	601991		NOVA3		9344654, 10368286	Standard	NM_002516		Approved	ANOVA	uc002pdv.2	Q9UNW9		ENST00000263257.5:c.311G>A	19.37:g.46457123C>T	ENSP00000263257:p.Arg104Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O43267|Q9UEA1	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.R104Q	ENST00000263257.5	37	c.311	CCDS12679.1	19	.	.	.	.	.	.	.	.	.	.	C	23.8	4.461713	0.84425	.	.	ENSG00000104967	ENST00000263257	T	0.50813	0.73	5.13	5.13	0.70059	K Homology (1);	0.000000	0.85682	D	0.000000	T	0.54271	0.1848	N	0.24115	0.695	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	T	0.53634	-0.8411	10	0.42905	T	0.14	-5.1098	16.13	0.81422	0.0:1.0:0.0:0.0	.	104	Q9UNW9	NOVA2_HUMAN	Q	104	ENSP00000263257:R104Q	ENSP00000263257:R104Q	R	-	2	0	NOVA2	51148963	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.301000	0.78850	2.678000	0.91216	0.563000	0.77884	CGA	NOVA2	-	smart_KH_dom	ENSG00000104967		0.562	NOVA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOVA2	HGNC	protein_coding	OTTHUMT00000437210.2	374	0.27	1	C	NM_002516		46457123	46457123	-1	no_errors	ENST00000263257	ensembl	human	known	69_37n	missense	210	56.31	272	SNP	1.000	T
OCRL	4952	genome.wustl.edu	37	X	128692644	128692644	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chrX:128692644G>T	ENST00000371113.4	+	7	639	c.474G>T	c.(472-474)atG>atT	p.M158I	OCRL_ENST00000357121.5_Missense_Mutation_p.M158I|OCRL_ENST00000486673.1_3'UTR	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	158					cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						TTTCTTCTATGAATTTGGACA	0.403																																						dbGAP											0													75.0	71.0	72.0					X																	128692644		2203	4300	6503	-	-	-	SO:0001583	missense	0			U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.474G>T	X.37:g.128692644G>T	ENSP00000360154:p.Met158Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_RhoGAP_dom,superfamily_Endo/exonuclease/phosphatase,superfamily_Rho_GTPase_activation_prot,smart_IPPc,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.M158I	ENST00000371113.4	37	c.474	CCDS35393.1	X	.	.	.	.	.	.	.	.	.	.	G	15.96	2.988152	0.53934	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	D;D	0.93659	-3.26;-3.26	5.68	4.82	0.62117	.	0.303544	0.37178	N	0.002209	D	0.86628	0.5978	N	0.14661	0.345	0.28794	N	0.899137	B;B	0.11235	0.004;0.002	B;B	0.08055	0.002;0.003	T	0.79517	-0.1771	10	0.52906	T	0.07	.	12.6583	0.56799	0.0809:0.0:0.9191:0.0	.	158;158	Q01968-2;Q01968	.;OCRL_HUMAN	I	158	ENSP00000360154:M158I;ENSP00000349635:M158I	ENSP00000349635:M158I	M	+	3	0	OCRL	128520325	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.557000	0.36299	1.153000	0.42468	0.594000	0.82650	ATG	OCRL	-	NULL	ENSG00000122126		0.403	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	OCRL	HGNC	protein_coding	OTTHUMT00000058917.1	264	0.38	1	G	NM_000276		128692644	128692644	+1	no_errors	ENST00000371113	ensembl	human	known	69_37n	missense	136	40.61	93	SNP	1.000	T
OR5T2	219464	genome.wustl.edu	37	11	56000198	56000198	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr11:56000198G>A	ENST00000313264.4	-	1	539	c.464C>T	c.(463-465)gCt>gTt	p.A155V		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					AGCCATTGCAGCCAAGAGAAA	0.423																																						dbGAP											0													183.0	156.0	165.0					11																	56000198		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.464C>T	11.37:g.56000198G>A	ENSP00000323688:p.Ala155Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGX5|Q6IFC8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A155V	ENST00000313264.4	37	c.464	CCDS31523.1	11	.	.	.	.	.	.	.	.	.	.	G	24.0	4.485385	0.84854	.	.	ENSG00000181718	ENST00000313264	T	0.02015	4.5	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39834	U	0.001258	T	0.06096	0.0158	L	0.60845	1.875	0.34551	D	0.711275	P	0.41524	0.753	P	0.44647	0.456	T	0.07424	-1.0773	10	0.87932	D	0	.	18.4134	0.90559	0.0:0.0:1.0:0.0	.	155	Q8NGG2	OR5T2_HUMAN	V	155	ENSP00000323688:A155V	ENSP00000323688:A155V	A	-	2	0	OR5T2	55756774	0.479000	0.25925	0.953000	0.39169	0.848000	0.48234	3.490000	0.53245	2.520000	0.84964	0.471000	0.43371	GCT	OR5T2	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181718		0.423	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T2	HGNC	protein_coding	OTTHUMT00000391598.1	268	0.00	0	G	NM_001004746		56000198	56000198	-1	no_errors	ENST00000313264	ensembl	human	known	69_37n	missense	187	21.76	52	SNP	0.957	A
OR5AR1	219493	genome.wustl.edu	37	11	56431680	56431680	+	Silent	SNP	C	C	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr11:56431680C>T	ENST00000302969.2	+	1	543	c.519C>T	c.(517-519)atC>atT	p.I173I		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						GTTCCAATATCATCAATCATT	0.493																																						dbGAP											0													227.0	200.0	209.0					11																	56431680		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.519C>T	11.37:g.56431680C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF61	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I173	ENST00000302969.2	37	c.519	CCDS31535.1	11																																																																																			OR5AR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172459		0.493	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AR1	HGNC	protein_coding	OTTHUMT00000334434.1	301	0.00	0	C	NM_001004730		56431680	56431680	+1	no_errors	ENST00000302969	ensembl	human	known	69_37n	silent	215	25.09	72	SNP	0.574	T
PCDHGA7	56108	genome.wustl.edu	37	5	140764680	140764680	+	Silent	SNP	G	G	A	rs541716228		TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr5:140764680G>A	ENST00000518325.1	+	1	2214	c.2214G>A	c.(2212-2214)tcG>tcA	p.S738S	PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_5'Flank|PCDHGA6_ENST00000517434.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	738					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCCCACCTCGCACTTTGTGG	0.627													.|||	1	0.000199681	0.0	0.0	5008	,	,		19123	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													59.0	65.0	63.0					5																	140764680		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.2214G>A	5.37:g.140764680G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN87|Q9Y5D0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S738	ENST00000518325.1	37	c.2214	CCDS54927.1	5																																																																																			PCDHGA7	-	NULL	ENSG00000253537		0.627	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA7	HGNC	protein_coding	OTTHUMT00000374744.1	74	0.00	0	G	NM_018920		140764680	140764680	+1	no_errors	ENST00000518325	ensembl	human	known	69_37n	silent	52	47.52	48	SNP	0.173	A
PGLYRP3	114771	genome.wustl.edu	37	1	153270481	153270481	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr1:153270481C>A	ENST00000290722.1	-	7	1029	c.977G>T	c.(976-978)gGg>gTg	p.G326V		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	326					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAAAGCCTGCCCAGGGGACAG	0.592																																						dbGAP											0													228.0	193.0	205.0					1																	153270481		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.977G>T	1.37:g.153270481C>A	ENSP00000290722:p.Gly326Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4U8|Q5SY65	Missense_Mutation	SNP	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.G326V	ENST00000290722.1	37	c.977	CCDS1035.1	1	.	.	.	.	.	.	.	.	.	.	c	12.61	1.989400	0.35131	.	.	ENSG00000159527	ENST00000290722	T	0.48522	0.81	4.26	3.29	0.37713	N-acetylmuramoyl-L-alanine amidase domain (3);	0.110119	0.37012	N	0.002290	T	0.72479	0.3465	H	0.97707	4.06	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79538	-0.1762	10	0.87932	D	0	-39.0163	10.0047	0.41951	0.0:0.7948:0.2052:0.0	.	326	Q96LB9	PGRP3_HUMAN	V	326	ENSP00000290722:G326V	ENSP00000290722:G326V	G	-	2	0	PGLYRP3	151537105	0.820000	0.29190	0.941000	0.38009	0.210000	0.24377	2.785000	0.47782	2.186000	0.69663	0.563000	0.77884	GGG	PGLYRP3	-	pfam_Amidase_domain,superfamily_Amidase_domain,smart_Amidase_domain	ENSG00000159527		0.592	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP3	HGNC	protein_coding	OTTHUMT00000039488.1	100	0.00	0	C	NM_052891		153270481	153270481	-1	no_errors	ENST00000290722	ensembl	human	known	69_37n	missense	198	13.91	32	SNP	0.802	A
PGM5	5239	genome.wustl.edu	37	9	70993224	70993224	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr9:70993224G>T	ENST00000396396.1	+	2	600	c.371G>T	c.(370-372)tGc>tTc	p.C124F	PGM5_ENST00000604870.2_3'UTR|PGM5_ENST00000396392.1_Missense_Mutation_p.C124F	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	124					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						GCCAGCCACTGCCCTGGAGGA	0.468																																						dbGAP											0													27.0	28.0	28.0					9																	70993224		2202	4280	6482	-	-	-	SO:0001583	missense	0			L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.371G>T	9.37:g.70993224G>T	ENSP00000379678:p.Cys124Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_a/b/a-II,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.C124F	ENST00000396396.1	37	c.371	CCDS6622.2	9	.	.	.	.	.	.	.	.	.	.	.	13.72	2.322756	0.41096	.	.	ENSG00000154330	ENST00000396396;ENST00000396392;ENST00000377314;ENST00000431583	T;T;T	0.62639	0.01;0.01;0.01	4.37	4.37	0.52481	Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (1);Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);Alpha-D-phosphohexomutase, conserved site (1);	0.167118	0.51477	U	0.000081	T	0.50222	0.1603	N	0.08118	0	0.33604	D	0.602696	P	0.35527	0.507	P	0.46419	0.516	T	0.65857	-0.6066	10	0.87932	D	0	.	9.8642	0.41134	0.0985:0.0:0.9015:0.0	.	124	Q15124	PGM5_HUMAN	F	124;124;124;90	ENSP00000379678:C124F;ENSP00000379674:C124F;ENSP00000394864:C90F	ENSP00000366531:C124F	C	+	2	0	PGM5	70183044	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	1.970000	0.40520	2.131000	0.65755	0.544000	0.68410	TGC	PGM5	-	pfam_A-D-PHexomutase_a/b/a-I,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	ENSG00000154330		0.468	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PGM5	HGNC	protein_coding	OTTHUMT00000052548.2	182	0.00	0	G	NM_021965		70993224	70993224	+1	no_errors	ENST00000396396	ensembl	human	known	69_37n	missense	169	15.08	30	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	T	rs121913279		TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr3:178952085A>T	ENST00000263967.3	+	21	3297	c.3140A>T	c.(3139-3141)cAt>cTt	p.H1047L	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>T	3.37:g.178952085A>T	ENSP00000263967:p.His1047Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047L	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	4.518	0.096038	0.08681	.	.	ENSG00000121879	ENST00000263967	T	0.78126	-1.15	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.47002	0.1422	N	0.00611	-1.325	0.80722	D	1	B	0.14438	0.01	B	0.12156	0.007	T	0.58053	-0.7704	10	0.02654	T	1	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	L	1047	ENSP00000263967:H1047L	ENSP00000263967:H1047L	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	147	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	68	51.06	72	SNP	1.000	T
PPID	5481	genome.wustl.edu	37	4	159644428	159644428	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr4:159644428A>C	ENST00000307720.3	-	1	120	c.13T>G	c.(13-15)Tcc>Gcc	p.S5A		NM_005038.2	NP_005029.1	Q08752	PPID_HUMAN	peptidylprolyl isomerase D	5					apoptotic process (GO:0006915)|cellular response to UV-A (GO:0071492)|chaperone-mediated protein folding (GO:0061077)|lipid particle organization (GO:0034389)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein secretion (GO:0050714)|positive regulation of viral genome replication (GO:0045070)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|protein transport (GO:0015031)|viral release from host cell (GO:0019076)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|estrogen receptor binding (GO:0030331)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|transcription factor binding (GO:0008134)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0159)		GCTTGGGGGGACGGGTGCGAC	0.607																																						dbGAP											0													88.0	79.0	82.0					4																	159644428		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3801.1	4q31.3	2013-01-10	2008-10-24		ENSG00000171497	ENSG00000171497		"""Tetratricopeptide (TTC) repeat domain containing"""	9257	protein-coding gene	gene with protein product	"""cyclophilin 40"""	601753	"""peptidylprolyl isomerase D (cyclophilin D)"""			8509368	Standard	NM_005038		Approved	CYP-40	uc003iqc.3	Q08752	OTTHUMG00000161927	ENST00000307720.3:c.13T>G	4.37:g.159644428A>C	ENSP00000303754:p.Ser5Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9V2	Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,pfam_TPR-1,superfamily_Cyclophilin-like_PPIase_dom,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.S5A	ENST00000307720.3	37	c.13	CCDS3801.1	4	.	.	.	.	.	.	.	.	.	.	A	5.235	0.228830	0.09916	.	.	ENSG00000171497	ENST00000307720	T	0.19394	2.15	4.38	1.83	0.25207	Cyclophilin-like (1);	0.382247	0.19148	N	0.121524	T	0.10895	0.0266	N	0.19112	0.55	0.19945	N	0.99994	B	0.02656	0.0	B	0.08055	0.003	T	0.23583	-1.0184	10	0.31617	T	0.26	-1.2589	5.0383	0.14445	0.3846:0.3124:0.0:0.303	.	5	Q08752	PPID_HUMAN	A	5	ENSP00000303754:S5A	ENSP00000303754:S5A	S	-	1	0	PPID	159863878	0.908000	0.30866	0.193000	0.23327	0.003000	0.03518	1.677000	0.37576	0.412000	0.25729	-0.333000	0.08304	TCC	PPID	-	superfamily_Cyclophilin-like_PPIase_dom	ENSG00000171497		0.607	PPID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPID	HGNC	protein_coding	OTTHUMT00000366436.1	154	0.65	1	A	NM_005038		159644428	159644428	-1	no_errors	ENST00000307720	ensembl	human	known	69_37n	missense	139	29.44	58	SNP	0.189	C
PRRX1	5396	genome.wustl.edu	37	1	170695377	170695377	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr1:170695377G>A	ENST00000239461.6	+	3	747	c.434G>A	c.(433-435)cGa>cAa	p.R145Q	PRRX1_ENST00000476867.2_3'UTR|PRRX1_ENST00000367760.3_Missense_Mutation_p.R145Q|PRRX1_ENST00000497230.2_Missense_Mutation_p.R145Q	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1	145					artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTTCAGAACCGAAGAGCCAAG	0.478																																						dbGAP											0													60.0	56.0	58.0					1																	170695377		2203	4300	6503	-	-	-	SO:0001583	missense	0			M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.434G>A	1.37:g.170695377G>A	ENSP00000239461:p.Arg145Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BUM7|O60807	Missense_Mutation	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.R145Q	ENST00000239461.6	37	c.434	CCDS1290.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.300341	0.95574	.	.	ENSG00000116132	ENST00000367760;ENST00000239461;ENST00000497230	D;D;D	0.97378	-4.36;-4.36;-4.36	5.63	5.63	0.86233	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.134805	0.49916	D	0.000134	D	0.98836	0.9607	M	0.92219	3.285	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.76575	0.988;0.947	D	0.99723	1.1010	10	0.87932	D	0	.	18.2616	0.90038	0.0:0.0:1.0:0.0	.	145;145	P54821;P54821-2	PRRX1_HUMAN;.	Q	145	ENSP00000356734:R145Q;ENSP00000239461:R145Q;ENSP00000450762:R145Q	ENSP00000239461:R145Q	R	+	2	0	PRRX1	168962001	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.168000	0.94781	2.649000	0.89929	0.650000	0.86243	CGA	PRRX1	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000116132		0.478	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRX1	HGNC	protein_coding	OTTHUMT00000085236.3	60	0.00	0	G	NM_006902		170695377	170695377	+1	no_errors	ENST00000239461	ensembl	human	known	69_37n	missense	53	39.77	35	SNP	1.000	A
RNF113A	7737	genome.wustl.edu	37	X	119005097	119005097	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chrX:119005097C>A	ENST00000371442.2	-	1	694	c.480G>T	c.(478-480)caG>caT	p.Q160H	NDUFA1_ENST00000371437.4_5'Flank	NM_006978.2	NP_008909.1	O15541	R113A_HUMAN	ring finger protein 113A	160							zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(6)	15						TCATGTATTTCTGATAATTGT	0.557																																						dbGAP											0													322.0	289.0	300.0					X																	119005097		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98253	CCDS14589.1	Xq24	2013-10-22	2005-03-22	2005-03-22	ENSG00000125352	ENSG00000125352		"""RING-type (C3HC4) zinc fingers"""	12974	protein-coding gene	gene with protein product			"""zinc finger protein 183 (RING finger, C3HC4 type)"""	ZNF183		9224902	Standard	NM_006978		Approved	RNF113, Cwc24	uc004esb.3	O15541	OTTHUMG00000022283	ENST00000371442.2:c.480G>T	X.37:g.119005097C>A	ENSP00000360497:p.Gln160His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBR7	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.Q160H	ENST00000371442.2	37	c.480	CCDS14589.1	X	.	.	.	.	.	.	.	.	.	.	C	11.66	1.703770	0.30232	.	.	ENSG00000125352	ENST00000371442	T	0.31769	1.48	5.49	3.66	0.41972	.	0.264809	0.37095	N	0.002243	T	0.22781	0.0550	L	0.41415	1.275	0.40000	D	0.975154	B	0.16166	0.016	B	0.14023	0.01	T	0.06075	-1.0847	10	0.30854	T	0.27	-28.3452	8.5442	0.33410	0.0:0.7624:0.1495:0.088	.	160	O15541	R113A_HUMAN	H	160	ENSP00000360497:Q160H	ENSP00000360497:Q160H	Q	-	3	2	RNF113A	118889125	0.990000	0.36364	0.994000	0.49952	0.992000	0.81027	0.256000	0.18351	1.108000	0.41662	0.600000	0.82982	CAG	RNF113A	-	NULL	ENSG00000125352		0.557	RNF113A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF113A	HGNC	protein_coding	OTTHUMT00000058071.1	216	0.00	0	C	NM_006978		119005097	119005097	-1	no_errors	ENST00000371442	ensembl	human	known	69_37n	missense	228	13.64	36	SNP	0.998	A
RP1	6101	genome.wustl.edu	37	8	55533917	55533917	+	Missense_Mutation	SNP	C	C	T	rs560343398		TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr8:55533917C>T	ENST00000220676.1	+	2	539	c.391C>T	c.(391-393)Cgg>Tgg	p.R131W		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	131					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GCTCAGCAGCCGGGCCATTAG	0.701																																					Colon(91;1014 1389 7634 14542 40420)	dbGAP											0													26.0	33.0	31.0					8																	55533917		2193	4290	6483	-	-	-	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.391C>T	8.37:g.55533917C>T	ENSP00000220676:p.Arg131Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.R131W	ENST00000220676.1	37	c.391	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	21.6	4.179940	0.78564	.	.	ENSG00000104237	ENST00000220676	D	0.86694	-2.16	4.9	3.93	0.45458	Doublecortin domain (1);	0.259218	0.26553	N	0.023724	D	0.92084	0.7491	M	0.78049	2.395	0.43603	D	0.995965	D	0.89917	1.0	D	0.75484	0.986	D	0.92301	0.5849	10	0.87932	D	0	-0.3458	10.1594	0.42842	0.465:0.535:0.0:0.0	.	131	P56715	RP1_HUMAN	W	131	ENSP00000220676:R131W	ENSP00000220676:R131W	R	+	1	2	RP1	55696470	1.000000	0.71417	0.946000	0.38457	0.672000	0.39443	3.010000	0.49559	2.273000	0.75805	0.650000	0.86243	CGG	RP1	-	superfamily_Doublecortin_dom	ENSG00000104237		0.701	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	15	0.00	0	C	NM_006269		55533917	55533917	+1	no_errors	ENST00000220676	ensembl	human	known	69_37n	missense	10	58.33	14	SNP	1.000	T
SF1	7536	genome.wustl.edu	37	11	64534720	64534720	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr11:64534720T>G	ENST00000377390.3	-	11	1683	c.1346A>C	c.(1345-1347)cAg>cCg	p.Q449P	SF1_ENST00000489544.1_5'Flank|SF1_ENST00000227503.9_Missense_Mutation_p.Q449P|SF1_ENST00000377394.3_Silent_p.S450S|SF1_ENST00000422298.2_Missense_Mutation_p.Q334P|SF1_ENST00000433274.2_Missense_Mutation_p.Q423P|SF1_ENST00000334944.5_Missense_Mutation_p.Q449P|SF1_ENST00000377387.1_Missense_Mutation_p.Q574P	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	449	Pro-rich.				Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						TCCCAGGTACTGATCTTGATG	0.542											OREG0021062	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													136.0	118.0	124.0					11																	64534720		2201	4297	6498	-	-	-	SO:0001583	missense	0			D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.1346A>C	11.37:g.64534720T>G	ENSP00000366607:p.Gln449Pro	Somatic	1077	WXS	Illumina GAIIx	Phase_IV	B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Splice_Site	SNP	-	e4-2	ENST00000377390.3	37	c.506-2	CCDS31599.1	11	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	14.01|14.01|14.01	2.407699|2.407699|2.407699	0.42715|0.42715|0.42715	.|.|.	.|.|.	ENSG00000168066|ENSG00000168066|ENSG00000168066	ENST00000486867|ENST00000377387;ENST00000377390;ENST00000227503;ENST00000334944;ENST00000422298;ENST00000443908;ENST00000433274|ENST00000413725	.|T;T;T;T;T;T;T|.	.|0.48201|.	.|0.84;0.83;0.88;0.83;0.89;0.82;0.84|.	5.34|5.34|5.34	5.34|5.34|5.34	0.76211|0.76211|0.76211	.|.|.	.|0.000000|.	.|0.52532|.	.|D|.	.|0.000074|.	.|T|T	.|0.72471|0.72471	.|0.3464|0.3464	.|.|.	.|.|.	.|.|.	0.41904|0.41904|0.41904	D|D|D	0.990432|0.990432|0.990432	.|P;P;P;P;D|.	.|0.53462|.	.|0.462;0.597;0.462;0.597;0.96|.	.|B;B;B;B;D|.	.|0.64237|.	.|0.153;0.293;0.153;0.293;0.923|.	.|T|T	.|0.76427|0.76427	.|-0.2963|-0.2963	.|9|5	.|0.21014|0.87932	.|T|D	.|0.42|0	.|.|.	11.7172|11.7172|11.7172	0.51661|0.51661|0.51661	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|334;449;449;449;574|.	.|B4DX42;Q15637-4;Q15637;Q15637-2;Q15637-5|.	.|.;.;SF01_HUMAN;.;.|.	.|P|R	-1|574;449;449;449;334;101;423|19	.|ENSP00000366604:Q574P;ENSP00000366607:Q449P;ENSP00000227503:Q449P;ENSP00000334414:Q449P;ENSP00000413084:Q334P;ENSP00000391198:Q101P;ENSP00000396793:Q423P|.	.|ENSP00000227503:Q449P|ENSP00000395927:S19R	.|Q|S	-|-|-	.|2|1	.|0|0	SF1|SF1|SF1	64291296|64291296|64291296	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	4.463000|4.463000|4.463000	0.60128|0.60128|0.60128	2.035000|2.035000|2.035000	0.60131|0.60131|0.60131	0.459000|0.459000|0.459000	0.35465|0.35465|0.35465	.|CAG|AGT	SF1	-	-	ENSG00000168066		0.542	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SF1	HGNC	protein_coding	OTTHUMT00000143242.1	145	0.00	0	T	NM_004630		64534720	64534720	-1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000486867	ensembl	human	putative	69_37n	splice_site	121	29.65	51	SNP	1.000	G
SLC12A9	56996	genome.wustl.edu	37	7	100456724	100456724	+	Silent	SNP	C	C	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr7:100456724C>T	ENST00000354161.3	+	7	1043	c.918C>T	c.(916-918)gtC>gtT	p.V306V	SLC12A9_ENST00000475623.1_3'UTR|SLC12A9_ENST00000415287.1_Silent_p.V217V|SLC12A9_ENST00000540482.1_Silent_p.V306V|SLC12A9_ENST00000275729.3_Silent_p.V217V|SLC12A9_ENST00000428758.1_Silent_p.V306V	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	306					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					TCGTCGCCGTCGCCTACACCT	0.612																																						dbGAP											0													226.0	209.0	215.0					7																	100456724		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.918C>T	7.37:g.100456724C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	Silent	SNP	pfam_AA-permease_dom	p.V306	ENST00000354161.3	37	c.918	CCDS5707.1	7																																																																																			SLC12A9	-	pfam_AA-permease_dom	ENSG00000146828		0.612	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A9	HGNC	protein_coding	OTTHUMT00000342837.1	195	0.51	1	C	NM_020246		100456724	100456724	+1	no_errors	ENST00000354161	ensembl	human	known	69_37n	silent	319	11.14	40	SNP	0.000	T
SLC40A1	30061	genome.wustl.edu	37	2	190428591	190428591	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr2:190428591A>C	ENST00000261024.2	-	7	1547	c.1121T>G	c.(1120-1122)cTg>cGg	p.L374R		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	374					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			TCCTGAGATCAGACCTGTCCG	0.448																																						dbGAP											0													94.0	84.0	88.0					2																	190428591		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.1121T>G	2.37:g.190428591A>C	ENSP00000261024:p.Leu374Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Missense_Mutation	SNP	pfam_Ferroportin-1,superfamily_MFS_dom_general_subst_transpt	p.L374R	ENST00000261024.2	37	c.1121	CCDS2299.1	2	.	.	.	.	.	.	.	.	.	.	A	26.0	4.694542	0.88830	.	.	ENSG00000138449	ENST00000261024;ENST00000544056	D	0.95103	-3.61	6.16	5.0	0.66597	Major facilitator superfamily domain, general substrate transporter (1);	0.225061	0.47093	D	0.000257	D	0.95667	0.8591	M	0.73430	2.235	0.46222	D	0.998938	P	0.40619	0.724	P	0.51866	0.682	D	0.95336	0.8434	10	0.51188	T	0.08	-3.1691	12.6615	0.56815	0.9349:0.0:0.0651:0.0	.	374	Q9NP59	S40A1_HUMAN	R	374;109	ENSP00000261024:L374R	ENSP00000261024:L374R	L	-	2	0	SLC40A1	190136836	0.998000	0.40836	0.837000	0.33122	0.996000	0.88848	7.498000	0.81546	2.367000	0.80283	0.528000	0.53228	CTG	SLC40A1	-	pfam_Ferroportin-1,superfamily_MFS_dom_general_subst_transpt	ENSG00000138449		0.448	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC40A1	HGNC	protein_coding	OTTHUMT00000255916.2	102	0.00	0	A			190428591	190428591	-1	no_errors	ENST00000261024	ensembl	human	known	69_37n	missense	67	42.86	51	SNP	0.978	C
SLIT1	6585	genome.wustl.edu	37	10	98816176	98816176	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr10:98816176G>T	ENST00000266058.4	-	13	1448	c.1203C>A	c.(1201-1203)ttC>ttA	p.F401L	SLIT1_ENST00000371070.4_Missense_Mutation_p.F401L|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	401					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		GCAGGTCCTGGAAGGCATCGG	0.587																																						dbGAP											0													173.0	169.0	170.0					10																	98816176		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.1203C>A	10.37:g.98816176G>T	ENSP00000266058:p.Phe401Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_EGF-like_dom,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.F401L	ENST00000266058.4	37	c.1203	CCDS7453.1	10	.	.	.	.	.	.	.	.	.	.	g	24.6	4.548240	0.86127	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371054;ENST00000371070;ENST00000314867;ENST00000456008	T;T;T	0.51325	1.96;1.96;0.71	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.57844	0.2081	L	0.37466	1.105	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.81914	0.968;0.995	T	0.59883	-0.7370	10	0.87932	D	0	.	13.0187	0.58773	0.0771:0.0:0.9229:0.0	.	411;401	E7EWQ8;O75093	.;SLIT1_HUMAN	L	401;411;377;401;394;377	ENSP00000266058:F401L;ENSP00000360109:F401L;ENSP00000315005:F394L	ENSP00000266058:F401L	F	-	3	2	SLIT1	98806166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.250000	0.51445	2.635000	0.89317	0.556000	0.70494	TTC	SLIT1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000187122		0.587	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT1	HGNC	protein_coding	OTTHUMT00000049636.1	213	0.00	0	G	NM_003061		98816176	98816176	-1	no_errors	ENST00000266058	ensembl	human	known	69_37n	missense	153	44.57	123	SNP	1.000	T
UBA1	7317	genome.wustl.edu	37	X	47065655	47065655	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chrX:47065655A>T	ENST00000335972.6	+	16	1933	c.1750A>T	c.(1750-1752)Atg>Ttg	p.M584L	UBA1_ENST00000377269.3_5'Flank|INE1_ENST00000456273.1_RNA|UBA1_ENST00000490869.1_3'UTR|UBA1_ENST00000377351.4_Missense_Mutation_p.M584L	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	584	2 approximate repeats.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AGGCATGTACATGGACCGCCG	0.547																																						dbGAP											0													43.0	28.0	33.0					X																	47065655		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.1750A>T	X.37:g.47065655A>T	ENSP00000338413:p.Met584Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRR8|Q96E13	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.M584L	ENST00000335972.6	37	c.1750	CCDS14275.1	X	.	.	.	.	.	.	.	.	.	.	A	16.47	3.133079	0.56828	.	.	ENSG00000130985	ENST00000377351;ENST00000335972	T;T	0.35421	1.31;1.31	5.01	5.01	0.66863	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.084777	0.85682	D	0.000000	T	0.36468	0.0968	L	0.38531	1.155	0.80722	D	1	B	0.31227	0.314	B	0.41666	0.363	T	0.27226	-1.0080	10	0.49607	T	0.09	-19.3027	11.5702	0.50829	1.0:0.0:0.0:0.0	.	584	P22314	UBA1_HUMAN	L	584	ENSP00000366568:M584L;ENSP00000338413:M584L	ENSP00000338413:M584L	M	+	1	0	UBA1	46950599	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	3.393000	0.52544	1.784000	0.52394	0.483000	0.47432	ATG	UBA1	-	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000130985		0.547	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	HGNC	protein_coding	OTTHUMT00000056389.1	59	0.00	0	A	NM_003334		47065655	47065655	+1	no_errors	ENST00000335972	ensembl	human	known	69_37n	missense	33	50.75	34	SNP	1.000	T
SMC1A	8243	genome.wustl.edu	37	X	53439174	53439174	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chrX:53439174C>T	ENST00000322213.4	-	6	1011	c.884G>A	c.(883-885)cGg>cAg	p.R295Q	SMC1A_ENST00000375340.6_Intron	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	295					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						GTACTGAGGCCGCTTCTGGTT	0.507																																						dbGAP											0													88.0	76.0	80.0					X																	53439174		2203	4300	6503	-	-	-	SO:0001583	missense	0			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.884G>A	X.37:g.53439174C>T	ENSP00000323421:p.Arg295Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O14995|Q16351|Q2M228	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge,prints_Tropomyosin	p.R295Q	ENST00000322213.4	37	c.884	CCDS14352.1	X	.	.	.	.	.	.	.	.	.	.	C	16.14	3.039809	0.55003	.	.	ENSG00000072501	ENST00000322213	T	0.77358	-1.09	4.65	4.65	0.58169	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.68513	0.3009	L	0.42744	1.35	0.80722	D	1	P;B	0.38978	0.652;0.075	B;B	0.29716	0.106;0.031	T	0.73020	-0.4114	10	0.51188	T	0.08	.	15.7658	0.78126	0.0:1.0:0.0:0.0	.	273;295	Q6MZR8;Q14683	.;SMC1A_HUMAN	Q	295	ENSP00000323421:R295Q	ENSP00000323421:R295Q	R	-	2	0	SMC1A	53455899	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	4.736000	0.62059	2.053000	0.61076	0.600000	0.82982	CGG	SMC1A	-	pfam_RecF/RecN/SMC	ENSG00000072501		0.507	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	HGNC	protein_coding	OTTHUMT00000056756.2	271	0.00	0	C	NM_006306		53439174	53439174	-1	no_errors	ENST00000322213	ensembl	human	known	69_37n	missense	207	37.46	124	SNP	1.000	T
VPS13B	157680	genome.wustl.edu	37	8	100883111	100883111	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr8:100883111G>A	ENST00000358544.2	+	60	11677	c.11566G>A	c.(11566-11568)Gtc>Atc	p.V3856I	VPS13B_ENST00000357162.2_Missense_Mutation_p.V3831I|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3856					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TGTCAAATATGTCTGGTAAAA	0.448																																					Colon(161;2205 2542 7338 31318)	dbGAP											0													69.0	67.0	68.0					8																	100883111		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.11566G>A	8.37:g.100883111G>A	ENSP00000351346:p.Val3856Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.V3856I	ENST00000358544.2	37	c.11566	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	G	29.8	5.036925	0.93630	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.69685	-0.42;-0.42	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.74129	0.3676	L	0.32530	0.975	0.80722	D	1	D;D	0.67145	0.996;0.994	P;D	0.72625	0.875;0.978	T	0.68002	-0.5524	10	0.21540	T	0.41	.	19.8959	0.96958	0.0:0.0:1.0:0.0	.	3831;3856	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	I	3831;3856	ENSP00000349685:V3831I;ENSP00000351346:V3856I	ENSP00000349685:V3831I	V	+	1	0	VPS13B	100952287	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.199000	0.95003	2.704000	0.92352	0.655000	0.94253	GTC	VPS13B	-	NULL	ENSG00000132549		0.448	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	115	0.00	0	G	NM_184042		100883111	100883111	+1	no_errors	ENST00000358544	ensembl	human	known	69_37n	missense	83	35.66	46	SNP	1.000	A
VPS28	51160	genome.wustl.edu	37	8	145649475	145649475	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A154-01A-11D-A10Y-09	TCGA-E2-A154-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	336e39fb-d407-4ced-b7bb-e8ff5329abdb	2a64a2d9-2683-40fb-9e22-43cb3185321c	g.chr8:145649475C>T	ENST00000526054.1	-	8	534	c.497G>A	c.(496-498)cGc>cAc	p.R166H	VPS28_ENST00000526734.1_5'Flank|VPS28_ENST00000377348.2_Missense_Mutation_p.R166H|VPS28_ENST00000529182.1_Missense_Mutation_p.R166H|VPS28_ENST00000292510.4_Missense_Mutation_p.R166H			Q9UK41	VPS28_HUMAN	vacuolar protein sorting 28 homolog (S. cerevisiae)	166	VPS28 C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00642}.				endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|negative regulation of protein ubiquitination (GO:0031397)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GTGGCTCATGCGGTGCATGGT	0.692																																						dbGAP											0													53.0	59.0	57.0					8																	145649475		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF316887	CCDS6425.1, CCDS34967.1	8q24.3	2014-08-12	2006-04-04		ENSG00000160948	ENSG00000160948			18178	protein-coding gene	gene with protein product		611952	"""vacuolar protein sorting 28 (yeast)"""				Standard	NM_183057		Approved		uc003zct.1	Q9UK41	OTTHUMG00000165209	ENST00000526054.1:c.497G>A	8.37:g.145649475C>T	ENSP00000434064:p.Arg166His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VK0	Missense_Mutation	SNP	pfam_VPS28,pirsf_VPS28	p.R166H	ENST00000526054.1	37	c.497	CCDS6425.1	8	.	.	.	.	.	.	.	.	.	.	c	19.14	3.770276	0.69992	.	.	ENSG00000160948	ENST00000529182;ENST00000526054;ENST00000292510;ENST00000377348;ENST00000533806	.	.	.	5.32	3.5	0.40072	Vacuolar protein sorting-associated, VPS28, C-terminal (1);	0.049523	0.64402	D	0.000001	T	0.78039	0.4221	M	0.93150	3.385	0.58432	D	0.999997	D;P	0.58268	0.982;0.89	P;P	0.54759	0.76;0.614	T	0.83080	-0.0138	9	0.87932	D	0	.	10.4447	0.44486	0.0:0.8359:0.0:0.1641	.	166;166	Q9UK41-2;Q9UK41	.;VPS28_HUMAN	H	166;166;166;166;149	.	ENSP00000292510:R166H	R	-	2	0	VPS28	145620283	1.000000	0.71417	0.973000	0.42090	0.187000	0.23431	3.575000	0.53870	1.490000	0.48466	-0.137000	0.14449	CGC	VPS28	-	pfam_VPS28,pirsf_VPS28	ENSG00000160948		0.692	VPS28-003	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS28	HGNC	protein_coding	OTTHUMT00000382694.1	29	0.00	0	C			145649475	145649475	-1	no_errors	ENST00000377348	ensembl	human	known	69_37n	missense	35	46.15	30	SNP	0.996	T
