#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AKAP9	10142	genome.wustl.edu	37	7	91603204	91603204	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr7:91603204delT	ENST00000359028.2	+	3	489	c.264delT	c.(262-264)actfs	p.T88fs	AKAP9_ENST00000358100.2_Frame_Shift_Del_p.T88fs|AKAP9_ENST00000356239.3_Frame_Shift_Del_p.T76fs|AKAP9_ENST00000394564.1_Frame_Shift_Del_p.T76fs			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	88					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TAGAATCAACTGTGATTCCTG	0.363			T	BRAF	papillary thyroid																																	dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													74.0	71.0	72.0					7																	91603204		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.264delT	7.37:g.91603204delT	ENSP00000351922:p.Thr88fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Frame_Shift_Del	DEL	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.V89fs	ENST00000359028.2	37	c.264		7																																																																																			AKAP9	-	NULL	ENSG00000127914		0.363	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		144	0.00	0	T	NM_005751		91603204	91603204	+1	no_errors	ENST00000359028	ensembl	human	known	69_37n	frame_shift_del	94	34.78	56	DEL	0.000	-
ARHGAP6	395	genome.wustl.edu	37	X	11162146	11162146	+	Silent	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chrX:11162146C>T	ENST00000337414.4	-	11	3002	c.2130G>A	c.(2128-2130)tcG>tcA	p.S710S	ARHGAP6_ENST00000380718.1_Silent_p.S710S|ARHGAP6_ENST00000380736.1_Silent_p.S507S|ARHGAP6_ENST00000303025.6_Silent_p.S507S|ARHGAP6_ENST00000534860.1_Silent_p.S535S|ARHGAP6_ENST00000413512.3_3'UTR	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	710					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						ACTTTGACGACGACAAGTGGC	0.602											OREG0019666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													126.0	120.0	122.0					X																	11162146		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.2130G>A	X.37:g.11162146C>T		Somatic	670	WXS	Illumina GAIIx	Phase_IV	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S710	ENST00000337414.4	37	c.2130	CCDS14140.1	X																																																																																			ARHGAP6	-	NULL	ENSG00000047648		0.602	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP6	HGNC	protein_coding	OTTHUMT00000055760.2	151	0.00	0	C	NM_013427		11162146	11162146	-1	no_errors	ENST00000337414	ensembl	human	known	69_37n	silent	24	68.83	53	SNP	0.173	T
ARHGEF11	9826	genome.wustl.edu	37	1	156907126	156907126	+	Missense_Mutation	SNP	C	C	T	rs201607774		TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr1:156907126C>T	ENST00000361409.2	-	38	4977	c.4235G>A	c.(4234-4236)cGc>cAc	p.R1412H	ARHGEF11_ENST00000368194.3_Missense_Mutation_p.R1452H|ARHGEF11_ENST00000315174.8_Missense_Mutation_p.R828H|MIR765_ENST00000390226.1_RNA|ARHGEF11_ENST00000487682.1_5'UTR	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1412					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R1452H(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TGGAGGAGAGCGGCTGGGGCG	0.627																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											59.0	56.0	57.0					1																	156907126		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.4235G>A	1.37:g.156907126C>T	ENSP00000354644:p.Arg1412His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,pfam_Regulat_G_prot_signal,superfamily_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_Regulat_G_prot_signal,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal,pfscan_DH-domain	p.R1452H	ENST00000361409.2	37	c.4355	CCDS1162.1	1	.	.	.	.	.	.	.	.	.	.	C	0.025	-1.375821	0.01214	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.64991	-0.13;-0.13;-0.03	3.83	-1.29	0.09288	.	1.629770	0.03513	N	0.219885	T	0.18215	0.0437	N	0.19112	0.55	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.03403	-1.1040	10	0.14656	T	0.56	0.9519	4.0284	0.09698	0.2497:0.2662:0.0:0.4841	.	828;1412;1452	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	H	1452;1412;828	ENSP00000357177:R1452H;ENSP00000354644:R1412H;ENSP00000313470:R828H	ENSP00000313470:R828H	R	-	2	0	ARHGEF11	155173750	0.000000	0.05858	0.083000	0.20561	0.010000	0.07245	-2.112000	0.01332	-0.126000	0.11682	-0.224000	0.12420	CGC	ARHGEF11	-	NULL	ENSG00000132694		0.627	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	HGNC	protein_coding	OTTHUMT00000098931.1	53	0.00	0	C	NM_198236		156907126	156907126	-1	no_errors	ENST00000368194	ensembl	human	known	69_37n	missense	38	34.48	20	SNP	0.000	T
ATIC	471	genome.wustl.edu	37	2	216209567	216209568	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr2:216209567_216209568delCT	ENST00000236959.9	+	13	1619_1620	c.1293_1294delCT	c.(1291-1296)aactctfs	p.S432fs	ATIC_ENST00000435675.1_Frame_Shift_Del_p.S431fs|ATIC_ENST00000540518.1_Frame_Shift_Del_p.S373fs	NM_004044.6	NP_004035.2	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase	432					'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|dihydrofolate metabolic process (GO:0046452)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	IMP cyclohydrolase activity (GO:0003937)|phosphoribosylaminoimidazolecarboxamide formyltransferase activity (GO:0004643)|protein homodimerization activity (GO:0042803)		ATIC/ALK(24)	large_intestine(2)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	8		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Methotrexate(DB00563)|Pemetrexed(DB00642)|Tetrahydrofolic acid(DB00116)	CTCAGTCTAACTCTGTGTGCTA	0.495			T	ALK	ALCL																																	dbGAP		Dom	yes		2	2q35	471	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase		L	0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS2398.1	2q35	2010-04-27			ENSG00000138363	ENSG00000138363	2.1.2.3, 3.5.4.10		794	protein-coding gene	gene with protein product	"""phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase"""	601731				8567683, 9378707	Standard	NM_004044		Approved	PURH, AICARFT, IMPCHASE	uc002vex.4	P31939	OTTHUMG00000133023	ENST00000236959.9:c.1293_1294delCT	2.37:g.216209569_216209570delCT	ENSP00000236959:p.Ser432fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K202|E9PBU3|Q13856|Q53S28	Frame_Shift_Del	DEL	pfam_AICARFT_IMPCHas,pfam_MGS-like_dom,superfamily_Cytidine_deaminase-like,superfamily_MGS-like_dom,smart_MGS-like_dom,smart_AICARFT_IMPCHas,pirsf_AICARFT_IMPCHas,tigrfam_AICARFT_IMPCHas	p.S432fs	ENST00000236959.9	37	c.1293_1294	CCDS2398.1	2																																																																																			ATIC	-	pfam_AICARFT_IMPCHas,superfamily_Cytidine_deaminase-like,smart_AICARFT_IMPCHas,pirsf_AICARFT_IMPCHas,tigrfam_AICARFT_IMPCHas	ENSG00000138363		0.495	ATIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATIC	HGNC	protein_coding	OTTHUMT00000256610.1	221	0.00	0	CT	NM_004044		216209567	216209568	+1	no_errors	ENST00000236959	ensembl	human	known	69_37n	frame_shift_del	134	32.32	64	DEL	0.998:1.000	-
ATR	545	genome.wustl.edu	37	3	142176483	142176483	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr3:142176483T>C	ENST00000350721.4	-	45	7739	c.7618A>G	c.(7618-7620)Atg>Gtg	p.M2540V	ATR_ENST00000383101.3_Missense_Mutation_p.M2476V	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	2540	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						ATCAGCCTCATTGTAACTTCA	0.398								Other conserved DNA damage response genes																														dbGAP											0													107.0	99.0	102.0					3																	142176483		2203	4300	6503	-	-	-	SO:0001583	missense	0			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.7618A>G	3.37:g.142176483T>C	ENSP00000343741:p.Met2540Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PIK-rel_kinase_FAT,pfam_UME,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_UME,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_HEAT_type_2,pfscan_PI3/4_kinase_cat_dom	p.M2540V	ENST00000350721.4	37	c.7618	CCDS3124.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.19|10.19	1.283069|1.283069	0.23392|0.23392	.|.	.|.	ENSG00000175054|ENSG00000175054	ENST00000350721;ENST00000383101|ENST00000513291	T;T|.	0.81330|.	-1.48;-1.48|.	5.2|5.2	-0.149|-0.149	0.13420|0.13420	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);|.	0.231431|.	0.45361|.	D|.	0.000364|.	T|T	0.54679|0.54679	0.1873|0.1873	M|M	0.81497|0.81497	2.545|2.545	0.28085|0.28085	N|N	0.932048|0.932048	B|.	0.15930|.	0.015|.	B|.	0.20384|.	0.029|.	T|T	0.52147|0.52147	-0.8614|-0.8614	10|5	0.59425|.	D|.	0.04|.	-3.8692|-3.8692	7.1789|7.1789	0.25761|0.25761	0.2646:0.0:0.3895:0.3458|0.2646:0.0:0.3895:0.3458	.|.	2540|.	Q13535|.	ATR_HUMAN|.	V|S	2540;2476|386	ENSP00000343741:M2540V;ENSP00000372581:M2476V|.	ENSP00000343741:M2540V|.	M|N	-|-	1|2	0|0	ATR|ATR	143659173|143659173	0.171000|0.171000	0.23029|0.23029	0.959000|0.959000	0.39883|0.39883	0.653000|0.653000	0.38743|0.38743	0.347000|0.347000	0.20014|0.20014	-0.184000|-0.184000	0.10567|0.10567	-0.686000|-0.686000	0.03744|0.03744	ATG|AAT	ATR	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000175054		0.398	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATR	HGNC	protein_coding	OTTHUMT00000353995.2	245	0.00	0	T	NM_001184		142176483	142176483	-1	no_errors	ENST00000350721	ensembl	human	known	69_37n	missense	168	40.21	113	SNP	0.069	C
C14orf80	283643	genome.wustl.edu	37	14	105965157	105965157	+	Silent	SNP	G	G	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr14:105965157G>T	ENST00000392523.4	+	9	1483	c.1362G>T	c.(1360-1362)acG>acT	p.T454T	C14orf80_ENST00000392522.3_Silent_p.T385T|C14orf80_ENST00000392527.1_Silent_p.T311T|C14orf80_ENST00000334656.7_Silent_p.T311T|C14orf80_ENST00000450383.1_Silent_p.T207T|C14orf80_ENST00000329886.7_Silent_p.T313T|C14orf80_ENST00000354560.6_Silent_p.T352T			Q86SX3	CN080_HUMAN	chromosome 14 open reading frame 80	454										central_nervous_system(1)	1		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.239)		TGATCAGGACGCTGAGGAGCC	0.701																																						dbGAP											0													36.0	36.0	36.0					14																	105965157		2190	4296	6486	-	-	-	SO:0001819	synonymous_variant	0				CCDS45180.1, CCDS45181.1, CCDS45182.1, CCDS55955.1	14q32.33	2012-09-25			ENSG00000185347	ENSG00000185347			20127	protein-coding gene	gene with protein product							Standard	NM_001134875		Approved		uc001yrn.3	Q86SX3	OTTHUMG00000170426	ENST00000392523.4:c.1362G>T	14.37:g.105965157G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDG3|E9PAQ4|Q86TT3|Q86TT4|Q86TT5|Q96B41|Q9H7H4	Silent	SNP	NULL	p.T454	ENST00000392523.4	37	c.1362		14																																																																																			C14orf80	-	NULL	ENSG00000185347		0.701	C14orf80-017	KNOWN	basic	protein_coding	C14orf80	HGNC	protein_coding	OTTHUMT00000409090.1	45	0.00	0	G	NM_001134875		105965157	105965157	+1	no_errors	ENST00000392523	ensembl	human	known	69_37n	silent	6	57.14	8	SNP	0.000	T
CD1A	909	genome.wustl.edu	37	1	158225973	158225973	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr1:158225973C>T	ENST00000289429.5	+	3	1038	c.505C>T	c.(505-507)Cag>Tag	p.Q169*		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	169					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	CAATCAGAATCAGCATGAAAA	0.463																																						dbGAP											0													151.0	125.0	134.0					1																	158225973		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.505C>T	1.37:g.158225973C>T	ENSP00000289429:p.Gln169*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Nonsense_Mutation	SNP	pfam_Ig_C1-set,pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.Q169*	ENST00000289429.5	37	c.505	CCDS1174.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.740494	0.96873	.	.	ENSG00000158477	ENST00000289429	.	.	.	4.23	-5.0	0.03001	.	1.445670	0.04749	N	0.424165	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	4.8211	5.0413	0.14460	0.2329:0.1782:0.504:0.0849	.	.	.	.	X	169	.	ENSP00000289429:Q169X	Q	+	1	0	CD1A	156492597	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.637000	0.00205	-1.420000	0.02009	0.579000	0.79373	CAG	CD1A	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000158477		0.463	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1A	HGNC	protein_coding	OTTHUMT00000046349.2	229	0.00	0	C	NM_001763		158225973	158225973	+1	no_errors	ENST00000289429	ensembl	human	known	69_37n	nonsense	116	39.27	75	SNP	0.000	T
CENPI	2491	genome.wustl.edu	37	X	100382636	100382636	+	Silent	SNP	G	G	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chrX:100382636G>A	ENST00000372927.1	+	10	1333	c.1056G>A	c.(1054-1056)caG>caA	p.Q352Q	CENPI_ENST00000423383.1_Silent_p.Q352Q|CENPI_ENST00000372926.1_Silent_p.Q352Q|CENPI_ENST00000218507.5_Silent_p.Q352Q	NM_006733.2	NP_006724.2	Q92674	CENPI_HUMAN	centromere protein I	352					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|sex differentiation (GO:0007548)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)				breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(19)|prostate(1)|skin(2)	30						AACTTTTACAGAACATCCATT	0.353																																						dbGAP											0													118.0	112.0	114.0					X																	100382636		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X97249	CCDS14479.1	Xq22.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000102384	ENSG00000102384			3968	protein-coding gene	gene with protein product		300065	"""FSH primary response (LRPR1, rat) homolog 1"", ""FSH primary response (LRPR1 homolog, rat) 1"""	FSHPRH1		16622420	Standard	NM_006733		Approved	LRPR1, CENP-I, Mis6	uc004egx.3	Q92674	OTTHUMG00000022018	ENST00000372927.1:c.1056G>A	X.37:g.100382636G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JWZ9|Q96ED0	Silent	SNP	pfam_Centromere_CenpI	p.Q352	ENST00000372927.1	37	c.1056	CCDS14479.1	X																																																																																			CENPI	-	pfam_Centromere_CenpI	ENSG00000102384		0.353	CENPI-004	KNOWN	basic|CCDS	protein_coding	CENPI	HGNC	protein_coding	OTTHUMT00000057519.1	449	0.00	0	G	NM_006733		100382636	100382636	+1	no_errors	ENST00000372927	ensembl	human	known	69_37n	silent	72	73.36	201	SNP	0.868	A
CMYA5	202333	genome.wustl.edu	37	5	79028598	79028598	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr5:79028598C>T	ENST00000446378.2	+	2	4041	c.4010C>T	c.(4009-4011)tCa>tTa	p.S1337L		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1337					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CTAGCATTTTCAGCTTTGTCA	0.373																																						dbGAP											0													48.0	46.0	47.0					5																	79028598		1876	4101	5977	-	-	-	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.4010C>T	5.37:g.79028598C>T	ENSP00000394770:p.Ser1337Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.S1337L	ENST00000446378.2	37	c.4010	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	C	15.44	2.832793	0.50951	.	.	ENSG00000164309	ENST00000446378	T	0.51071	0.72	5.47	5.47	0.80525	.	0.373597	0.20100	N	0.099242	T	0.46151	0.1378	L	0.51422	1.61	0.29251	N	0.871966	B	0.16166	0.016	B	0.10450	0.005	T	0.49194	-0.8965	10	0.87932	D	0	.	16.239	0.82396	0.0:1.0:0.0:0.0	.	1337	Q8N3K9	CMYA5_HUMAN	L	1337	ENSP00000394770:S1337L	ENSP00000394770:S1337L	S	+	2	0	CMYA5	79064354	0.000000	0.05858	0.977000	0.42913	0.984000	0.73092	0.565000	0.23578	2.548000	0.85928	0.655000	0.94253	TCA	CMYA5	-	NULL	ENSG00000164309		0.373	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	128	0.00	0	C	NM_153610		79028598	79028598	+1	no_errors	ENST00000446378	ensembl	human	known	69_37n	missense	21	76.40	68	SNP	0.966	T
CREBRF	153222	genome.wustl.edu	37	5	172517553	172517553	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr5:172517553C>G	ENST00000296953.2	+	4	690	c.371C>G	c.(370-372)tCt>tGt	p.S124C	CREBRF_ENST00000540014.1_Missense_Mutation_p.S124C|CREBRF_ENST00000520420.1_Missense_Mutation_p.S124C|CREBRF_ENST00000522692.1_Missense_Mutation_p.S124C	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	124					negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GATGACTTTTCTAGTCCTTAC	0.393																																						dbGAP											0													93.0	89.0	91.0					5																	172517553		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.371C>G	5.37:g.172517553C>G	ENSP00000296953:p.Ser124Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Missense_Mutation	SNP	NULL	p.S124C	ENST00000296953.2	37	c.371	CCDS34293.1	5	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125634	0.77436	.	.	ENSG00000164463	ENST00000522692;ENST00000296953;ENST00000540014;ENST00000520420;ENST00000538538;ENST00000393776	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.79167	0.4400	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.79706	-0.1691	10	0.72032	D	0.01	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	124;124	Q8IUR6;Q8IUR6-2	CE041_HUMAN;.	C	124	ENSP00000431107:S124C;ENSP00000296953:S124C;ENSP00000440075:S124C;ENSP00000428290:S124C	ENSP00000296953:S124C	S	+	2	0	C5orf41	172450159	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.894000	0.99253	0.655000	0.94253	TCT	CREBRF	-	NULL	ENSG00000164463		0.393	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBRF	HGNC	protein_coding	OTTHUMT00000372667.1	191	0.00	0	C	NM_153607		172517553	172517553	+1	no_errors	ENST00000540014	ensembl	human	known	69_37n	missense	142	40.83	98	SNP	1.000	G
CRMP1	1400	genome.wustl.edu	37	4	5837643	5837643	+	Splice_Site	SNP	G	G	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr4:5837643G>A	ENST00000397890.2	-	11	1494	c.1280C>T	c.(1279-1281)tCg>tTg	p.S427L	CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000324989.7_Splice_Site_p.S541L|CRMP1_ENST00000512574.1_Splice_Site_p.S425L	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	427					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		AGGACTTACCGACTTGTGACT	0.453																																						dbGAP											0													124.0	116.0	119.0					4																	5837643		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1281+1C>T	4.37:g.5837643G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.S541L	ENST00000397890.2	37	c.1622	CCDS43207.1	4	.	.	.	.	.	.	.	.	.	.	G	10.90	1.481188	0.26598	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	T;T;T	0.74209	-0.82;-0.82;-0.82	4.33	4.33	0.51752	Metal-dependent hydrolase, composite domain (1);	0.150078	0.47852	D	0.000202	T	0.68714	0.3031	M	0.71871	2.18	0.80722	D	1	B;B;B;B	0.29862	0.245;0.259;0.053;0.028	B;B;B;B	0.26094	0.066;0.017;0.011;0.017	T	0.66555	-0.5894	10	0.02654	T	1	-7.0117	16.3427	0.83092	0.0:0.0:1.0:0.0	.	541;425;427;364	A0EJG6;E9PD68;Q14194;B3KT07	.;.;DPYL1_HUMAN;.	L	541;427;427;425	ENSP00000321606:S541L;ENSP00000380987:S427L;ENSP00000425742:S425L	ENSP00000321606:S541L	S	-	2	0	CRMP1	5888544	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.338000	0.79269	2.418000	0.82041	0.508000	0.49915	TCG	CRMP1	-	superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000072832		0.453	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1	144	0.00	0	G	NM_001313	Missense_Mutation	5837643	5837643	-1	no_errors	ENST00000324989	ensembl	human	known	69_37n	missense	81	40.88	56	SNP	1.000	A
CRYBG3	131544	genome.wustl.edu	37	3	97614915	97614915	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr3:97614915C>T	ENST00000182096.4	+	9	1907	c.1843C>T	c.(1843-1845)Cgg>Tgg	p.R615W		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2563							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						CTTGTCTTTCCGGTACTTACA	0.368																																						dbGAP											0													146.0	133.0	137.0					3																	97614915		1834	4092	5926	-	-	-	SO:0001583	missense	0					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.1843C>T	3.37:g.97614915C>T	ENSP00000182096:p.Arg615Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.R615W	ENST00000182096.4	37	c.1843		3	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936291	0.73442	.	.	ENSG00000080200	ENST00000182096	D	0.83163	-1.69	5.74	5.74	0.90152	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.098517	0.46442	D	0.000291	D	0.92756	0.7697	M	0.92691	3.335	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93842	0.7137	10	0.87932	D	0	.	13.6343	0.62213	0.1551:0.8449:0.0:0.0	.	615	Q68DQ2	CRBG3_HUMAN	W	615	ENSP00000182096:R615W	ENSP00000182096:R615W	R	+	1	2	CRYBG3	99097605	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.870000	0.39529	2.723000	0.93209	0.655000	0.94253	CGG	CRYBG3	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	ENSG00000080200		0.368	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	HGNC	protein_coding	OTTHUMT00000353751.1	326	0.00	0	C	NM_153605		97614915	97614915	+1	no_errors	ENST00000182096	ensembl	human	known	69_37n	missense	260	34.66	139	SNP	1.000	T
DGKG	1608	genome.wustl.edu	37	3	185990120	185990120	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr3:185990120G>C	ENST00000265022.3	-	11	1462	c.923C>G	c.(922-924)aCt>aGt	p.T308S	DGKG_ENST00000544847.1_Missense_Mutation_p.T308S|DGKG_ENST00000344484.4_Missense_Mutation_p.T308S|DGKG_ENST00000382164.4_Missense_Mutation_p.T308S	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	308					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TTCGTGGACAGTGTATTTACA	0.483																																						dbGAP											0													174.0	145.0	154.0					3																	185990120		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.923C>G	3.37:g.185990120G>C	ENSP00000265022:p.Thr308Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAH4|Q2M1H4|Q5FWG1	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.T308S	ENST00000265022.3	37	c.923	CCDS3274.1	3	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793727	0.70452	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847;ENST00000538691;ENST00000437018	D;D;D;D;D	0.93019	-1.9;-1.9;-1.9;-1.9;-3.15	4.99	4.99	0.66335	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.061148	0.64402	D	0.000004	D	0.95095	0.8411	L	0.56340	1.77	0.80722	D	1	P;P;D;D	0.57899	0.932;0.618;0.976;0.981	P;B;P;P	0.62089	0.894;0.377;0.894;0.898	D	0.95329	0.8428	10	0.87932	D	0	.	16.0367	0.80635	0.0:0.0:1.0:0.0	.	308;308;308;308	F5GX27;P49619-2;P49619-3;P49619	.;.;.;DGKG_HUMAN	S	308;308;308;308;311;59	ENSP00000265022:T308S;ENSP00000339777:T308S;ENSP00000371599:T308S;ENSP00000440507:T308S;ENSP00000395526:T59S	ENSP00000265022:T308S	T	-	2	0	DGKG	187472814	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	7.220000	0.78008	2.709000	0.92574	0.655000	0.94253	ACT	DGKG	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000058866		0.483	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKG	HGNC	protein_coding	OTTHUMT00000344800.3	328	0.00	0	G			185990120	185990120	-1	no_errors	ENST00000265022	ensembl	human	known	69_37n	missense	176	43.09	134	SNP	1.000	C
DSC2	1824	genome.wustl.edu	37	18	28654837	28654837	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr18:28654837A>G	ENST00000280904.6	-	12	2143	c.1700T>C	c.(1699-1701)cTt>cCt	p.L567P	DSC2_ENST00000251081.6_Missense_Mutation_p.L567P|snoU13_ENST00000459603.1_RNA	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	567	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			CACGTCTTGAAGTATAATGCC	0.393																																						dbGAP											0													146.0	121.0	129.0					18																	28654837		2203	4300	6503	-	-	-	SO:0001583	missense	0			X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1700T>C	18.37:g.28654837A>G	ENSP00000280904:p.Leu567Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmocollin,prints_Desmo_cadherin	p.L567P	ENST00000280904.6	37	c.1700	CCDS11892.1	18	.	.	.	.	.	.	.	.	.	.	A	15.08	2.727227	0.48833	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.62788	-0.0;-0.0	5.32	5.32	0.75619	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.319678	0.17490	N	0.172372	D	0.84871	0.5568	H	0.95114	3.625	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.73708	0.981;0.947	D	0.88777	0.3268	10	0.87932	D	0	.	14.5599	0.68128	1.0:0.0:0.0:0.0	.	567;567	Q02487;Q02487-2	DSC2_HUMAN;.	P	567;567;333;580	ENSP00000251081:L567P;ENSP00000280904:L567P	ENSP00000251081:L567P	L	-	2	0	DSC2	26908835	0.476000	0.25901	0.931000	0.37212	0.149000	0.21700	5.972000	0.70448	2.140000	0.66376	0.459000	0.35465	CTT	DSC2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmo_cadherin	ENSG00000134755		0.393	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC2	HGNC	protein_coding	OTTHUMT00000254943.1	468	0.00	0	A	NM_004949		28654837	28654837	-1	no_errors	ENST00000280904	ensembl	human	known	69_37n	missense	291	40.04	195	SNP	0.860	G
SPATA31D5P	347127	genome.wustl.edu	37	9	84530475	84530475	+	RNA	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr9:84530475C>T	ENST00000527857.1	+	0	497					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		CCTTTGTGTCCCCTTTGGCTT	0.532																																						dbGAP											0																																										-	-	-			0					9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84530475C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000527857.1	37	NULL		9																																																																																			FAM75D5	-	-	ENSG00000240632		0.532	SPATA31D5P-002	KNOWN	basic	processed_transcript	FAM75D5	HGNC	pseudogene	OTTHUMT00000052810.2	426	0.00	0	C	NR_026851		84530475	84530475	+1	no_errors	ENST00000527857	ensembl	human	known	69_37n	rna	287	40.46	195	SNP	0.005	T
FUT5	2527	genome.wustl.edu	37	19	5866890	5866890	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr19:5866890C>T	ENST00000588525.1	-	2	934	c.847G>A	c.(847-849)Gtg>Atg	p.V283M	FUT5_ENST00000252675.5_Missense_Mutation_p.V283M	NM_002034.2	NP_002025.2	Q11128	FUT5_HUMAN	fucosyltransferase 5 (alpha (1,3) fucosyltransferase)	283					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12						ACCACGGGCACGGCCCAGGCC	0.632																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS12154.1	19p13.3	2013-02-26				ENSG00000130383	2.4.1.65	"""Fucosyltransferases"""	4016	protein-coding gene	gene with protein product		136835				1740457	Standard	NM_002034		Approved	FUC-TV	uc002mdo.4	Q11128	OTTHUMG00000180616	ENST00000588525.1:c.847G>A	19.37:g.5866890C>T	ENSP00000466880:p.Val283Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4X2	Missense_Mutation	SNP	pfam_Glyco_trans_10	p.V283M	ENST00000588525.1	37	c.847	CCDS12154.1	19	.	.	.	.	.	.	.	.	.	.	C	16.54	3.151504	0.57151	.	.	ENSG00000130383	ENST00000252675	T	0.45668	0.89	2.17	-0.373	0.12516	.	0.304124	0.22640	U	0.057470	T	0.63838	0.2545	M	0.93241	3.395	0.29695	N	0.840608	D	0.89917	1.0	D	0.74674	0.984	T	0.58978	-0.7540	10	0.87932	D	0	.	3.3145	0.07029	0.252:0.5755:0.0:0.1726	.	283	Q11128	FUT5_HUMAN	M	283	ENSP00000252675:V283M	ENSP00000252675:V283M	V	-	1	0	FUT5	5817890	0.753000	0.28349	0.257000	0.24404	0.974000	0.67602	0.996000	0.29719	-0.189000	0.10482	0.407000	0.27541	GTG	FUT5	-	pfam_Glyco_trans_10	ENSG00000130383		0.632	FUT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT5	HGNC	protein_coding	OTTHUMT00000452213.1	53	0.00	0	C	NM_002034		5866890	5866890	-1	no_errors	ENST00000252675	ensembl	human	known	69_37n	missense	22	37.84	14	SNP	0.993	T
GIN1	54826	genome.wustl.edu	37	5	102432359	102432359	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr5:102432359C>G	ENST00000399004.2	-	7	1274	c.1180G>C	c.(1180-1182)Gac>Cac	p.D394H	GIN1_ENST00000508629.1_Intron	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	394					DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		GTAATATAGTCTATGACACAA	0.403																																						dbGAP											0													247.0	233.0	237.0					5																	102432359		1870	4103	5973	-	-	-	SO:0001583	missense	0			BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.1180G>C	5.37:g.102432359C>G	ENSP00000381970:p.Asp394His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXF7|B4DIV4|Q6AI03|Q96BR2	Missense_Mutation	SNP	pfam_Integrase_cat-core,pfam_Znf_H2C2_histone_UAS-bd,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	p.D394H	ENST00000399004.2	37	c.1180	CCDS43349.1	5	.	.	.	.	.	.	.	.	.	.	C	21.6	4.172460	0.78452	.	.	ENSG00000145723	ENST00000399004	T	0.18338	2.22	5.68	5.68	0.88126	.	0.000000	0.43110	U	0.000610	T	0.29093	0.0723	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.02398	-1.1165	10	0.11794	T	0.64	-17.0316	17.9639	0.89094	0.0:1.0:0.0:0.0	.	394	Q9NXP7	GIN1_HUMAN	H	394	ENSP00000381970:D394H	ENSP00000381970:D394H	D	-	1	0	GIN1	102460258	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.770000	0.62309	2.677000	0.91161	0.655000	0.94253	GAC	GIN1	-	NULL	ENSG00000145723		0.403	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIN1	HGNC	protein_coding	OTTHUMT00000370478.3	482	0.00	0	C	NM_017676		102432359	102432359	-1	no_errors	ENST00000399004	ensembl	human	known	69_37n	missense	97	71.09	241	SNP	1.000	G
GLB1L	79411	genome.wustl.edu	37	2	220102662	220102662	+	Silent	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr2:220102662C>T	ENST00000295759.7	-	15	1672	c.1359G>A	c.(1357-1359)gtG>gtA	p.V453V	GLB1L_ENST00000409640.1_Silent_p.V363V|GLB1L_ENST00000392089.2_Silent_p.V453V|GLB1L_ENST00000356283.3_Silent_p.V363V|GLB1L_ENST00000497855.1_5'UTR			Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like	453					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TATTTCGCTCCACAACACCCT	0.473																																						dbGAP											0													91.0	85.0	87.0					2																	220102662		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2437.1, CCDS74657.1	2q36.1	2008-02-05			ENSG00000163521	ENSG00000163521			28129	protein-coding gene	gene with protein product						12975309	Standard	XM_005246850		Approved	MGC10771	uc002vkm.3	Q6UWU2	OTTHUMG00000133133	ENST00000295759.7:c.1359G>A	2.37:g.220102662C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96DR0	Silent	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.V453	ENST00000295759.7	37	c.1359	CCDS2437.1	2																																																																																			GLB1L	-	NULL	ENSG00000163521		0.473	GLB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLB1L	HGNC	protein_coding	OTTHUMT00000256822.2	175	0.00	0	C	NM_024506		220102662	220102662	-1	no_errors	ENST00000295759	ensembl	human	known	69_37n	silent	159	27.93	62	SNP	1.000	T
HDAC3	8841	genome.wustl.edu	37	5	141005299	141005299	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr5:141005299G>A	ENST00000305264.3	-	13	1091	c.1012C>T	c.(1012-1014)Ctt>Ttt	p.L338F	HDAC3_ENST00000469207.1_Intron|AC008781.7_ENST00000422040.2_RNA	NM_003883.3	NP_003874.2	O15379	HDAC3_HUMAN	histone deacetylase 3	338					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|protein deacetylation (GO:0006476)|regulation of mitotic cell cycle (GO:0007346)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|cyclin binding (GO:0030332)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Vorinostat(DB02546)	TCTGGATGAAGTGTGAAGTCT	0.498																																						dbGAP											0													144.0	128.0	133.0					5																	141005299		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF059650	CCDS4264.1	5q31.1-q31.2	2008-07-18			ENSG00000171720	ENSG00000171720	3.5.1.98		4854	protein-coding gene	gene with protein product		605166				9501169, 9464271	Standard	NM_003883		Approved	RPD3, HD3, RPD3-2	uc003llf.2	O15379	OTTHUMG00000129629	ENST00000305264.3:c.1012C>T	5.37:g.141005299G>A	ENSP00000302967:p.Leu338Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQE1|O43268|Q9UEI5|Q9UEV0	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1,prints_His_deacetylse_1,prints_His_deacetylse	p.L338F	ENST00000305264.3	37	c.1012	CCDS4264.1	5	.	.	.	.	.	.	.	.	.	.	G	34	5.370974	0.95923	.	.	ENSG00000171720	ENST00000305264	T	0.75154	-0.91	5.43	5.43	0.79202	Histone deacetylase domain (1);	0.000000	0.85682	D	0.000000	D	0.89866	0.6839	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91656	0.5338	10	0.87932	D	0	-25.774	19.0206	0.92912	0.0:0.0:1.0:0.0	.	338	O15379	HDAC3_HUMAN	F	338	ENSP00000302967:L338F	ENSP00000302967:L338F	L	-	1	0	HDAC3	140985483	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.560000	0.73950	2.824000	0.97209	0.655000	0.94253	CTT	HDAC3	-	pirsf_His_deacetylse_1	ENSG00000171720		0.498	HDAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC3	HGNC	protein_coding	OTTHUMT00000251824.2	593	0.17	1	G	NM_003883		141005299	141005299	-1	no_errors	ENST00000305264	ensembl	human	known	69_37n	missense	112	67.81	238	SNP	1.000	A
HIF3A	64344	genome.wustl.edu	37	19	46825069	46825069	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr19:46825069C>T	ENST00000377670.4	+	10	1212	c.1181C>T	c.(1180-1182)cCg>cTg	p.P394L	AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000420102.2_Missense_Mutation_p.P343L|HIF3A_ENST00000300862.3_Missense_Mutation_p.P392L|HIF3A_ENST00000244303.6_Missense_Mutation_p.P325L|HIF3A_ENST00000472815.1_Missense_Mutation_p.P325L|HIF3A_ENST00000600383.1_Missense_Mutation_p.P325L|HIF3A_ENST00000339613.2_Missense_Mutation_p.P338L	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	394					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		TTCCTGCACCCGCCTTCCCTG	0.682																																						dbGAP											0													51.0	62.0	59.0					19																	46825069		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1181C>T	19.37:g.46825069C>T	ENSP00000366898:p.Pro394Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HIF_alpha_subunit,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,tigrfam_PAS	p.P394L	ENST00000377670.4	37	c.1181	CCDS12681.2	19	.	.	.	.	.	.	.	.	.	.	C	15.38	2.816737	0.50633	.	.	ENSG00000124440	ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102	T;T;T;T;T	0.72051	0.17;-0.62;0.04;0.17;-0.62	4.45	4.45	0.53987	.	0.162183	0.29767	N	0.011253	T	0.72334	0.3447	N	0.19112	0.55	0.58432	D	0.999996	B;D;B;D;B;B;D	0.89917	0.433;1.0;0.433;1.0;0.307;0.307;1.0	B;D;B;D;B;B;D	0.85130	0.04;0.997;0.044;0.997;0.019;0.019;0.997	T	0.73319	-0.4020	10	0.46703	T	0.11	.	12.8047	0.57607	0.0:1.0:0.0:0.0	.	343;325;392;343;338;394;394	F5H884;B4DNA2;Q9Y2N7-2;B4DSD9;A8MPQ1;Q9Y2N7;B0M185	.;.;.;.;.;HIF3A_HUMAN;.	L	394;394;325;338;338;392;343	ENSP00000366898:P394L;ENSP00000244303:P325L;ENSP00000341877:P338L;ENSP00000300862:P392L;ENSP00000407771:P343L	ENSP00000244302:P394L	P	+	2	0	HIF3A	51516909	0.998000	0.40836	0.980000	0.43619	0.780000	0.44128	3.669000	0.54561	2.484000	0.83849	0.655000	0.94253	CCG	HIF3A	-	NULL	ENSG00000124440		0.682	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIF3A	HGNC	protein_coding	OTTHUMT00000280556.3	30	0.00	0	C			46825069	46825069	+1	no_errors	ENST00000377670	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.991	T
IGHV3-16	28447	genome.wustl.edu	37	14	106622007	106622007	+	RNA	SNP	C	C	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr14:106622007C>A	ENST00000390604.2	-	0	311									immunoglobulin heavy variable 3-16 (non-functional)																		ACGGAGTCCACATAGTGCGTC	0.537																																						dbGAP											0													190.0	172.0	178.0					14																	106622007		1944	4145	6089	-	-	-			0			M99655		14q32.33	2012-02-08	2008-08-22		ENSG00000211944	ENSG00000211944		"""Immunoglobulins / IGH locus"""	5583	other	immunoglobulin gene			"""immunoglobulin heavy variable 3-16"""				Standard	NG_001019		Approved				OTTHUMG00000152273		14.37:g.106622007C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.V80L	ENST00000390604.2	37	c.238		14																																																																																			IGHV3-16	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211944		0.537	IGHV3-16-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV3-16	HGNC	IG_V_gene	OTTHUMT00000325661.1	201	0.00	0	C	NG_001019		106622007	106622007	-1	no_stop_codon	ENST00000390604	ensembl	human	known	69_37n	missense	26	77.59	90	SNP	0.000	A
KCNG2	26251	genome.wustl.edu	37	18	77659086	77659086	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr18:77659086T>C	ENST00000316249.3	+	2	671	c.671T>C	c.(670-672)gTg>gCg	p.V224A	KCNG2_ENST00000590307.1_3'UTR	NM_012283.1	NP_036415.1	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G, member 2	224					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(2)|endometrium(4)|lung(7)|skin(1)|upper_aerodigestive_tract(4)	18		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		CTGGAGACCGTGTGCGTGGCC	0.682																																						dbGAP											0													49.0	40.0	43.0					18																	77659086		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ011021	CCDS12019.1	18q23	2011-07-05			ENSG00000178342	ENSG00000178342		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6249	protein-coding gene	gene with protein product		605696				10551266, 16382104	Standard	NM_012283		Approved	Kv6.2, KCNF2	uc010xfl.2	Q9UJ96	OTTHUMG00000044541	ENST00000316249.3:c.671T>C	18.37:g.77659086T>C	ENSP00000315654:p.Val224Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv	p.V224A	ENST00000316249.3	37	c.671	CCDS12019.1	18	.	.	.	.	.	.	.	.	.	.	T	21.3	4.122324	0.77436	.	.	ENSG00000178342	ENST00000316249	D	0.98792	-5.14	3.54	3.54	0.40534	Ion transport (1);	0.276251	0.28146	U	0.016433	D	0.98333	0.9447	L	0.45744	1.44	0.47065	D	0.999303	D	0.76494	0.999	D	0.72075	0.976	D	0.98012	1.0366	10	0.45353	T	0.12	.	12.2359	0.54516	0.0:0.0:0.0:1.0	.	224	Q9UJ96	KCNG2_HUMAN	A	224	ENSP00000315654:V224A	ENSP00000315654:V224A	V	+	2	0	KCNG2	75760074	1.000000	0.71417	0.994000	0.49952	0.975000	0.68041	6.983000	0.76180	1.484000	0.48361	0.338000	0.21704	GTG	KCNG2	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000178342		0.682	KCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNG2	HGNC	protein_coding	OTTHUMT00000103906.1	41	0.00	0	T	NM_012283		77659086	77659086	+1	no_errors	ENST00000316249	ensembl	human	known	69_37n	missense	17	34.62	9	SNP	1.000	C
C2CD5	9847	genome.wustl.edu	37	12	22677465	22677465	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr12:22677465C>T	ENST00000333957.4	-	6	797	c.542G>A	c.(541-543)cGa>cAa	p.R181Q	C2CD5_ENST00000396028.2_Missense_Mutation_p.R181Q|C2CD5_ENST00000542676.1_Missense_Mutation_p.R181Q|C2CD5_ENST00000446597.1_Missense_Mutation_p.R181Q|C2CD5_ENST00000536386.1_Missense_Mutation_p.R181Q|C2CD5_ENST00000540703.1_5'UTR|C2CD5_ENST00000545552.1_Missense_Mutation_p.R181Q|C2CD5_ENST00000544930.1_5'UTR	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	181					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)	p.R181Q(2)									TGTGCGAATTCGATCAATCCA	0.368																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											134.0	120.0	125.0					12																	22677465		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.542G>A	12.37:g.22677465C>T	ENSP00000334229:p.Arg181Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.R181Q	ENST00000333957.4	37	c.542	CCDS31758.1	12	.	.	.	.	.	.	.	.	.	.	C	28.7	4.939001	0.92526	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	4.95	4.02	0.46733	.	0.000000	0.64402	D	0.000001	T	0.48484	0.1502	L	0.48642	1.525	0.80722	D	1	D;P;P;D;P	0.69078	0.963;0.827;0.899;0.997;0.719	B;B;B;P;B	0.53722	0.432;0.119;0.17;0.733;0.119	T	0.51340	-0.8718	10	0.54805	T	0.06	-8.7416	14.6419	0.68732	0.146:0.854:0.0:0.0	.	181;181;181;181;181	F5H2A1;B4DRN7;B7ZLL0;Q86YS7-2;Q86YS7	.;.;.;.;K0528_HUMAN	Q	181	ENSP00000334229:R181Q;ENSP00000388756:R181Q;ENSP00000439392:R181Q;ENSP00000379345:R181Q;ENSP00000441951:R181Q;ENSP00000443204:R181Q	ENSP00000334229:R181Q	R	-	2	0	KIAA0528	22568732	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.985000	0.70556	2.306000	0.77630	0.585000	0.79938	CGA	KIAA0528	-	NULL	ENSG00000111731		0.368	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0528	HGNC	protein_coding	OTTHUMT00000402257.1	448	0.00	0	C	NM_014802		22677465	22677465	-1	no_errors	ENST00000333957	ensembl	human	known	69_37n	missense	83	71.38	207	SNP	1.000	T
LYN	4067	genome.wustl.edu	37	8	56912024	56912024	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr8:56912024G>A	ENST00000519728.1	+	12	1548	c.1252G>A	c.(1252-1254)Gga>Aga	p.G418R	LYN_ENST00000520220.2_Missense_Mutation_p.G397R	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase	418	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	AATCAACTTTGGATGTTTCAC	0.388																																						dbGAP											0													131.0	126.0	128.0					8																	56912024		2203	4300	6503	-	-	-	SO:0001583	missense	0			M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.1252G>A	8.37:g.56912024G>A	ENSP00000428924:p.Gly418Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVQ5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.G418R	ENST00000519728.1	37	c.1252	CCDS6162.1	8	.	.	.	.	.	.	.	.	.	.	G	29.2	4.987919	0.93106	.	.	ENSG00000254087	ENST00000519728;ENST00000520220	D;D	0.82526	-1.62;-1.62	4.89	4.89	0.63831	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87712	0.6246	L	0.35793	1.09	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89253	0.3592	10	0.87932	D	0	.	18.4446	0.90680	0.0:0.0:1.0:0.0	.	488;418	Q6NUK7;P07948	.;LYN_HUMAN	R	418;397	ENSP00000428924:G418R;ENSP00000428424:G397R	ENSP00000428924:G418R	G	+	1	0	LYN	57074578	1.000000	0.71417	0.981000	0.43875	0.995000	0.86356	9.813000	0.99286	2.431000	0.82371	0.591000	0.81541	GGA	LYN	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000254087		0.388	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LYN	HGNC	protein_coding	OTTHUMT00000378155.1	429	0.00	0	G	NM_002350		56912024	56912024	+1	no_errors	ENST00000519728	ensembl	human	known	69_37n	missense	327	34.60	173	SNP	1.000	A
MFAP3L	9848	genome.wustl.edu	37	4	170912804	170912804	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr4:170912804C>T	ENST00000361618.3	-	3	1262	c.955G>A	c.(955-957)Gtg>Atg	p.V319M	RP11-6E9.4_ENST00000508955.1_RNA|MFAP3L_ENST00000393704.3_Missense_Mutation_p.V216M	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	319						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		TGAACTGACACCTTGATGGCA	0.542																																						dbGAP											0													94.0	79.0	84.0					4																	170912804		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.955G>A	4.37:g.170912804C>T	ENSP00000354583:p.Val319Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V319M	ENST00000361618.3	37	c.955	CCDS34103.1	4	.	.	.	.	.	.	.	.	.	.	C	20.8	4.055846	0.76074	.	.	ENSG00000198948	ENST00000393704;ENST00000361618	D;D	0.99023	-5.34;-2.44	5.53	5.53	0.82687	.	0.054098	0.64402	D	0.000001	D	0.99099	0.9690	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99911	1.1201	10	0.87932	D	0	-35.5499	19.4624	0.94922	0.0:1.0:0.0:0.0	.	319	O75121	MFA3L_HUMAN	M	216;319	ENSP00000377307:V216M;ENSP00000354583:V319M	ENSP00000354583:V319M	V	-	1	0	MFAP3L	171149379	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	7.768000	0.85345	2.591000	0.87537	0.650000	0.86243	GTG	MFAP3L	-	NULL	ENSG00000198948		0.542	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP3L	HGNC	protein_coding	OTTHUMT00000363043.2	208	0.00	0	C	NM_021647		170912804	170912804	-1	no_errors	ENST00000361618	ensembl	human	known	69_37n	missense	125	42.92	94	SNP	1.000	T
KMT2B	9757	genome.wustl.edu	37	19	36211899	36211899	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr19:36211899delC	ENST00000222270.7	+	3	1650	c.1650delC	c.(1648-1650)gacfs	p.D550fs	KMT2B_ENST00000420124.1_Frame_Shift_Del_p.D550fs|KMT2B_ENST00000341701.1_Intron|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	550	Pro-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TGGATGAAGACCCCCCCAAAC	0.592																																						dbGAP											0													34.0	39.0	37.0					19																	36211899		1935	4130	6065	-	-	-	SO:0001589	frameshift_variant	0			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.1650delC	19.37:g.36211899delC	ENSP00000222270:p.Asp550fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Frame_Shift_Del	DEL	pirsf_MeTrfase_trithorax,pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.K553fs	ENST00000222270.7	37	c.1650	CCDS46055.1	19																																																																																			MLL4	-	pirsf_MeTrfase_trithorax	ENSG00000105663		0.592	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL4	Clone_based_vega_gene	protein_coding		98	0.00	0	C	NM_014727		36211899	36211899	+1	no_errors	ENST00000222270	ensembl	human	known	69_37n	frame_shift_del	60	38.38	38	DEL	0.252	-
MRFAP1L1	114932	genome.wustl.edu	37	4	6711321	6711321	+	Silent	SNP	A	A	G			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr4:6711321A>G	ENST00000320848.6	-	1	286	c.36T>C	c.(34-36)ccT>ccC	p.P12P		NM_203462.2	NP_982287.1	Q96HT8	MR1L1_HUMAN	Morf4 family associated protein 1-like 1	12																	CCACTTCCTCAGGCGCTTCCA	0.607																																						dbGAP											0													37.0	39.0	39.0					4																	6711321		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF258591	CCDS3392.1	4p16.1	2008-02-05			ENSG00000178988	ENSG00000178988			28796	protein-coding gene	gene with protein product						12477932	Standard	NM_203462		Approved	MGC9651	uc003gjo.3	Q96HT8	OTTHUMG00000125507	ENST00000320848.6:c.36T>C	4.37:g.6711321A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6R0|Q6NXT8|Q9P0J5	Silent	SNP	NULL	p.P12	ENST00000320848.6	37	c.36	CCDS3392.1	4																																																																																			MRFAP1L1	-	NULL	ENSG00000178988		0.607	MRFAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRFAP1L1	HGNC	protein_coding	OTTHUMT00000246834.1	75	0.00	0	A	NM_152301		6711321	6711321	-1	no_errors	ENST00000320848	ensembl	human	known	69_37n	silent	64	31.91	30	SNP	0.007	G
MRPS11	64963	genome.wustl.edu	37	15	89020270	89020270	+	Silent	SNP	G	G	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr15:89020270G>A	ENST00000325844.4	+	5	727	c.462G>A	c.(460-462)ctG>ctA	p.L154L	MRPS11_ENST00000353598.6_Silent_p.L121L|MRPS11_ENST00000557974.1_3'UTR	NM_022839.3	NP_073750.2	P82912	RT11_HUMAN	mitochondrial ribosomal protein S11	154					DNA damage response, detection of DNA damage (GO:0042769)|translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(3)	3	Lung NSC(78;0.203)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TGAAAGGCCTGGGGCCAGGAC	0.512											OREG0023439	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													114.0	93.0	100.0					15																	89020270		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AB051349	CCDS10342.1, CCDS10343.1	15q25	2012-09-13			ENSG00000181991	ENSG00000181991		"""Mitochondrial ribosomal proteins / small subunits"""	14050	protein-coding gene	gene with protein product	"""cervical cancer proto-oncogene 2"""	611977				11402041	Standard	NM_022839		Approved	FLJ23406, HCC-2, FLJ22512	uc002bml.3	P82912	OTTHUMG00000148678	ENST00000325844.4:c.462G>A	15.37:g.89020270G>A		Somatic	1264	WXS	Illumina GAIIx	Phase_IV	B2RD52|Q969D7|Q96GI3|Q9BYC3	Silent	SNP	pfam_Ribosomal_S11	p.L154	ENST00000325844.4	37	c.462	CCDS10342.1	15																																																																																			MRPS11	-	pfam_Ribosomal_S11	ENSG00000181991		0.512	MRPS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS11	HGNC	protein_coding	OTTHUMT00000309067.2	346	0.00	0	G	NM_022839		89020270	89020270	+1	no_errors	ENST00000325844	ensembl	human	known	69_37n	silent	184	39.07	118	SNP	1.000	A
MTMR8	55613	genome.wustl.edu	37	X	63488612	63488612	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chrX:63488612C>T	ENST00000374852.3	-	14	1987	c.1920G>A	c.(1918-1920)atG>atA	p.M640I	MTMR8_ENST00000453546.1_Intron	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	640						nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.0?(2)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						CAAAGGTGCACATGTCTCCAG	0.522																																						dbGAP											2	Whole gene deletion(2)	ovary(1)|large_intestine(1)											89.0	75.0	79.0					X																	63488612		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.1920G>A	X.37:g.63488612C>T	ENSP00000363985:p.Met640Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JT99|Q9NXP6	Missense_Mutation	SNP	pfam_Myotub-related,smart_Tyr_Pase_cat	p.M640I	ENST00000374852.3	37	c.1920	CCDS14379.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.30|10.30	1.311298|1.311298	0.23821|0.23821	.|.	.|.	ENSG00000102043|ENSG00000102043	ENST00000374852;ENST00000247400|ENST00000442913	D|.	0.93906|.	-3.31|.	3.72|3.72	-0.289|-0.289	0.12851|0.12851	.|.	.|.	.|.	.|.	.|.	T|T	0.14399|0.14399	0.0348|0.0348	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.19331|.	0.035|.	B|.	0.12837|.	0.008|.	T|T	0.24870|0.24870	-1.0148|-1.0148	9|5	0.59425|.	D|.	0.04|.	.|.	3.5585|3.5585	0.07873|0.07873	0.1812:0.495:0.0:0.3238|0.1812:0.495:0.0:0.3238	.|.	640|.	Q96EF0|.	MTMR8_HUMAN|.	I|M	640;526|444	ENSP00000363985:M640I|.	ENSP00000247400:M526I|.	M|V	-|-	3|1	0|0	MTMR8|MTMR8	63405337|63405337	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.009000|0.009000	0.06853|0.06853	0.031000|0.031000	0.13710|0.13710	-0.344000|-0.344000	0.08338|0.08338	0.513000|0.513000	0.50165|0.50165	ATG|GTG	MTMR8	-	NULL	ENSG00000102043		0.522	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR8	HGNC	protein_coding	OTTHUMT00000056949.2	256	0.00	0	C	NM_017677		63488612	63488612	-1	no_errors	ENST00000374852	ensembl	human	known	69_37n	missense	44	75.00	132	SNP	0.000	T
NAALADL2	254827	genome.wustl.edu	37	3	175042047	175042047	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr3:175042047C>G	ENST00000454872.1	+	5	1151	c.1023C>G	c.(1021-1023)agC>agG	p.S341R	NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	341						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		TGAATCCTAGCCATGATACCT	0.433																																						dbGAP											0													199.0	194.0	195.0					3																	175042047		1904	4118	6022	-	-	-	SO:0001583	missense	0				CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.1023C>G	3.37:g.175042047C>G	ENSP00000404705:p.Ser341Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	superfamily_TFR-like_dimer_dom	p.S341R	ENST00000454872.1	37	c.1023	CCDS46960.1	3	.	.	.	.	.	.	.	.	.	.	C	10.63	1.404537	0.25378	.	.	ENSG00000177694	ENST00000454872	T	0.41758	0.99	5.79	0.975	0.19721	.	0.602066	0.17731	N	0.163896	T	0.29556	0.0737	M	0.64997	1.995	0.09310	N	1	P	0.39216	0.664	B	0.33690	0.168	T	0.19192	-1.0313	10	0.14656	T	0.56	-0.2578	5.0843	0.14673	0.1317:0.492:0.0:0.3763	.	341	Q58DX5	NADL2_HUMAN	R	341	ENSP00000404705:S341R	ENSP00000404705:S341R	S	+	3	2	NAALADL2	176524741	0.001000	0.12720	0.000000	0.03702	0.983000	0.72400	0.022000	0.13511	-0.100000	0.12241	0.563000	0.77884	AGC	NAALADL2	-	NULL	ENSG00000177694		0.433	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALADL2	HGNC	protein_coding	OTTHUMT00000347390.2	386	0.00	0	C	NM_207015		175042047	175042047	+1	no_errors	ENST00000454872	ensembl	human	known	69_37n	missense	271	41.09	189	SNP	0.000	G
NLRC4	58484	genome.wustl.edu	37	2	32476278	32476278	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr2:32476278G>A	ENST00000404025.2	-	5	1143	c.655C>T	c.(655-657)Caa>Taa	p.Q219*	NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000402280.1_Nonsense_Mutation_p.Q219*|NLRC4_ENST00000360906.5_Nonsense_Mutation_p.Q219*			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	219	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.|Nucleotide-binding domain (NBD). {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TCCAGGAGTTGATCACAGAGG	0.517																																						dbGAP											0													70.0	74.0	72.0					2																	32476278		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.655C>T	2.37:g.32476278G>A	ENSP00000385090:p.Gln219*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Nonsense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_NACHT_NTPase,pfscan_CARD	p.Q219*	ENST00000404025.2	37	c.655	CCDS33174.1	2	.	.	.	.	.	.	.	.	.	.	G	15.77	2.931486	0.52866	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000404025	.	.	.	3.27	2.27	0.28462	.	0.000000	0.46145	D	0.000303	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-9.7894	11.0522	0.47896	0.0:0.0:0.8143:0.1857	.	.	.	.	X	219	.	ENSP00000354159:Q219X	Q	-	1	0	NLRC4	32329782	1.000000	0.71417	0.032000	0.17829	0.142000	0.21351	3.633000	0.54295	1.836000	0.53414	0.543000	0.68304	CAA	NLRC4	-	pfscan_NACHT_NTPase	ENSG00000091106		0.517	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	NLRC4	HGNC	protein_coding	OTTHUMT00000325222.2	150	0.00	0	G	NM_021209		32476278	32476278	-1	no_errors	ENST00000360906	ensembl	human	known	69_37n	nonsense	104	36.20	59	SNP	0.102	A
NPAP1	23742	genome.wustl.edu	37	15	24921813	24921813	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr15:24921813G>T	ENST00000329468.2	+	1	1273	c.799G>T	c.(799-801)Gtt>Ttt	p.V267F		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	267					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											TGAGCCAGCCGTTGGCTGCTC	0.632																																						dbGAP											0													33.0	36.0	35.0					15																	24921813		2198	4293	6491	-	-	-	SO:0001583	missense	0			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.799G>T	15.37:g.24921813G>T	ENSP00000333735:p.Val267Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.V267F	ENST00000329468.2	37	c.799	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	7.948	0.744175	0.15710	.	.	ENSG00000185823	ENST00000329468	T	0.12039	2.72	1.39	0.392	0.16288	.	1.238710	0.06258	N	0.693365	T	0.07593	0.0191	N	0.08118	0	0.09310	N	1	P	0.34757	0.467	B	0.35182	0.197	T	0.36065	-0.9763	10	0.72032	D	0.01	.	5.3252	0.15903	0.0:0.6174:0.3826:0.0	.	267	Q9NZP6	CO002_HUMAN	F	267	ENSP00000333735:V267F	ENSP00000333735:V267F	V	+	1	0	C15orf2	22472906	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.832000	0.01696	0.143000	0.18926	-0.662000	0.03851	GTT	NPAP1	-	NULL	ENSG00000185823		0.632	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	22	0.00	0	G	NM_018958		24921813	24921813	+1	no_errors	ENST00000329468	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	0.000	T
OR11G2	390439	genome.wustl.edu	37	14	20665593	20665593	+	Silent	SNP	G	G	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr14:20665593G>A	ENST00000357366.3	+	1	99	c.99G>A	c.(97-99)agG>agA	p.R33R		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		CAATTCACAGGCACATGAAAA	0.453																																						dbGAP											0													50.0	45.0	47.0					14																	20665593		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.99G>A	14.37:g.20665593G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF09|Q96R33	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R33	ENST00000357366.3	37	c.99	CCDS32032.1	14																																																																																			OR11G2	-	NULL	ENSG00000196832		0.453	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR11G2	HGNC	protein_coding	OTTHUMT00000395722.1	135	0.00	0	G			20665593	20665593	+1	no_errors	ENST00000357366	ensembl	human	known	69_37n	silent	36	63.64	63	SNP	0.000	A
OR4F6	390648	genome.wustl.edu	37	15	102346324	102346324	+	Silent	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr15:102346324C>T	ENST00000328882.4	+	1	423	c.402C>T	c.(400-402)acC>acT	p.T134T		NM_001005326.1	NP_001005326.1	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F, member 6	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(1)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			ACTACCTGACCATCATGAACC	0.433																																						dbGAP											0													264.0	234.0	244.0					15																	102346324		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AC025234	CCDS32341.1	15q26.3	2014-02-19	2002-02-28		ENSG00000184140	ENSG00000184140		"""GPCR / Class A : Olfactory receptors"""	15372	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily F, member 12"""	OR4F12			Standard	NM_001005326		Approved		uc010utr.2	Q8NGB9	OTTHUMG00000172267	ENST00000328882.4:c.402C>T	15.37:g.102346324C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH28|Q6IF95	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T134	ENST00000328882.4	37	c.402	CCDS32341.1	15																																																																																			OR4F6	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000184140		0.433	OR4F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F6	HGNC	protein_coding	OTTHUMT00000417593.1	350	0.00	0	C			102346324	102346324	+1	no_errors	ENST00000328882	ensembl	human	known	69_37n	silent	395	28.78	160	SNP	0.070	T
OR4F15	390649	genome.wustl.edu	37	15	102358597	102358597	+	Missense_Mutation	SNP	G	G	A	rs201467448		TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr15:102358597G>A	ENST00000332238.4	+	1	232	c.208G>A	c.(208-210)Gat>Aat	p.D70N		NM_001001674.1	NP_001001674.1	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F, member 15	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(10)	19	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			CTCAATCATTGATATGGCATT	0.428													G|||	1	0.000199681	0.0	0.0	5008	,	,		21991	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													240.0	208.0	219.0					15																	102358597		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004405	CCDS32342.1	15q26.3	2012-08-09				ENSG00000182854		"""GPCR / Class A : Olfactory receptors"""	15078	protein-coding gene	gene with protein product							Standard	NM_001001674		Approved		uc010uts.2	Q8NGB8		ENST00000332238.4:c.208G>A	15.37:g.102358597G>A	ENSP00000333184:p.Asp70Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNQ5|Q6IF57|Q96R70	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.D70N	ENST00000332238.4	37	c.208	CCDS32342.1	15	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	.	22.1	4.248018	0.80024	.	.	ENSG00000182854	ENST00000332238	T	0.01165	5.24	5.57	5.57	0.84162	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000007	T	0.07279	0.0184	M	0.93197	3.39	0.38461	D	0.947204	P	0.45531	0.86	P	0.50192	0.634	T	0.00394	-1.1767	9	.	.	.	.	17.0978	0.86641	0.0:0.0:1.0:0.0	.	70	Q8NGB8	O4F15_HUMAN	N	70	ENSP00000333184:D70N	.	D	+	1	0	OR4F15	100176120	0.999000	0.42202	0.994000	0.49952	0.993000	0.82548	6.860000	0.75473	2.902000	0.99343	0.650000	0.86243	GAT	OR4F15	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000182854		0.428	OR4F15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F15	HGNC	protein_coding	OTTHUMT00000417594.1	449	0.00	0	G	NM_001001674		102358597	102358597	+1	no_errors	ENST00000332238	ensembl	human	known	69_37n	missense	250	44.20	198	SNP	1.000	A
OTUD7B	56957	genome.wustl.edu	37	1	149939428	149939428	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr1:149939428C>A	ENST00000369135.4	-	4	587	c.293G>T	c.(292-294)gGc>gTc	p.G98V	OTUD7B_ENST00000479905.1_Intron	NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	98					mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			GTGGGAGATGCCCCTAGACAG	0.552																																						dbGAP											0													46.0	51.0	49.0					1																	149939428		1958	4155	6113	-	-	-	SO:0001583	missense	0			AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.293G>T	1.37:g.149939428C>A	ENSP00000358131:p.Gly98Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Missense_Mutation	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.G98V	ENST00000369135.4	37	c.293	CCDS41389.1	1	.	.	.	.	.	.	.	.	.	.	C	19.97	3.924479	0.73213	.	.	ENSG00000163113	ENST00000369135;ENST00000543330;ENST00000417191	T;T	0.38560	1.13;1.34	5.25	4.34	0.51931	.	0.000000	0.85682	D	0.000000	T	0.52500	0.1738	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.56232	-0.8013	9	.	.	.	-35.5759	13.1151	0.59295	0.0:0.9234:0.0:0.0766	.	98	Q6GQQ9	OTU7B_HUMAN	V	98	ENSP00000358131:G98V;ENSP00000408231:G98V	.	G	-	2	0	OTUD7B	148206052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.294000	0.78760	1.454000	0.47793	0.557000	0.71058	GGC	OTUD7B	-	NULL	ENSG00000163113		0.552	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7B	HGNC	protein_coding	OTTHUMT00000034146.3	70	0.00	0	C	NM_020205		149939428	149939428	-1	no_errors	ENST00000369135	ensembl	human	known	69_37n	missense	31	50.79	32	SNP	1.000	A
PHYH	5264	genome.wustl.edu	37	10	13325695	13325695	+	Silent	SNP	G	G	T	rs104894178	byFrequency	TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr10:13325695G>T	ENST00000263038.4	-	7	881	c.823C>A	c.(823-825)Cgg>Agg	p.R275R	PHYH_ENST00000396920.3_Silent_p.R258R|PHYH_ENST00000396913.2_Silent_p.R175R	NM_006214.3	NP_006205.1	O14832	PAHX_HUMAN	phytanoyl-CoA 2-hydroxylase	275			R -> Q (in RD; total loss of activity; dbSNP:rs28939674). {ECO:0000269|PubMed:10767344}.|R -> W (in RD; total loss of activity; dbSNP:rs28939671). {ECO:0000269|PubMed:10767344, ECO:0000269|PubMed:9326939}.		cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|isoprenoid metabolic process (GO:0006720)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|electron carrier activity (GO:0009055)|L-ascorbic acid binding (GO:0031418)|metal ion binding (GO:0046872)|phytanoyl-CoA dioxygenase activity (GO:0048244)			NS(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	25		Ovarian(717;0.0448)			Antihemophilic Factor(DB00025)|Vitamin C(DB00126)	CTTACCTTCCGGAATCCCTGG	0.423																																						dbGAP											0			GRCh37	CM971176	PHYH	M	rs104894178						122.0	120.0	120.0					10																	13325695		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS7097.1, CCDS41489.1	10p13	2010-04-27	2006-01-09		ENSG00000107537	ENSG00000107537	1.14.11.18		8940	protein-coding gene	gene with protein product	"""Refsum disease"", ""phytanoyl-CoA dioxygenase"""	602026	"""phytanoyl-CoA hydroxylase (Refsum disease)"", ""phytanoyl-CoA hydroxylase"""			9326939	Standard	XM_005252469		Approved	PAHX, RD, PHYH1	uc001imf.3	O14832	OTTHUMG00000017693	ENST00000263038.4:c.823C>A	10.37:g.13325695G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTS8|B1ALH5	Silent	SNP	pfam_Phytyl_CoA_dOase	p.R275	ENST00000263038.4	37	c.823	CCDS7097.1	10																																																																																			PHYH	-	pfam_Phytyl_CoA_dOase	ENSG00000107537		0.423	PHYH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHYH	HGNC	protein_coding	OTTHUMT00000046845.2	177	0.00	0	G			13325695	13325695	-1	no_errors	ENST00000263038	ensembl	human	known	69_37n	silent	84	41.38	60	SNP	1.000	T
PIPOX	51268	genome.wustl.edu	37	17	27380585	27380585	+	Missense_Mutation	SNP	G	G	A	rs76753427	byFrequency	TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr17:27380585G>A	ENST00000323372.4	+	4	958	c.632G>A	c.(631-633)cGt>cAt	p.R211H	PIPOX_ENST00000583215.1_3'UTR	NM_016518.2	NP_057602.2	Q9P0Z9	SOX_HUMAN	pipecolic acid oxidase	211					L-lysine catabolic process to acetyl-CoA via L-pipecolate (GO:0033514)|oxidation-reduction process (GO:0055114)|tetrahydrofolate metabolic process (GO:0046653)	peroxisome (GO:0005777)	L-pipecolate oxidase activity (GO:0050031)|receptor binding (GO:0005102)|sarcosine oxidase activity (GO:0008115)			endometrium(2)|large_intestine(4)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10	Lung NSC(42;0.015)		Epithelial(11;9.87e-06)|BRCA - Breast invasive adenocarcinoma(11;3.92e-05)|all cancers(11;5.59e-05)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)		Glycine(DB00145)	CAGCTCCTCCGTCCCCTGGGC	0.542													G|||	5	0.000998403	0.0	0.0	5008	,	,		17941	0.005		0.0	False		,,,				2504	0.0					dbGAP											0													69.0	65.0	67.0					17																	27380585		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF134593	CCDS11248.1	17p13.2	2008-07-18			ENSG00000179761	ENSG00000179761			17804	protein-coding gene	gene with protein product	"""L-pipecolic acid oxidase"""					10772957, 10642506	Standard	NM_016518		Approved	LPIPOX	uc002hdr.1	Q9P0Z9	OTTHUMG00000132679	ENST00000323372.4:c.632G>A	17.37:g.27380585G>A	ENSP00000317721:p.Arg211His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNH0|Q96H28|Q9C070	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,tigrfam_SoxA_mon	p.R211H	ENST00000323372.4	37	c.632	CCDS11248.1	17	5	0.0022893772893772895	0	0.0	0	0.0	5	0.008741258741258742	0	0.0	G	15.01	2.706008	0.48412	.	.	ENSG00000179761	ENST00000323372	D	0.82433	-1.61	5.77	-3.96	0.04106	FAD dependent oxidoreductase (1);	0.626201	0.17977	N	0.155648	T	0.63674	0.2531	L	0.51914	1.62	0.09310	N	1	B	0.20052	0.041	B	0.23018	0.043	T	0.55976	-0.8055	10	0.44086	T	0.13	-13.7798	3.1025	0.06330	0.4436:0.1065:0.3413:0.1085	.	211	Q9P0Z9	SOX_HUMAN	H	211	ENSP00000317721:R211H	ENSP00000317721:R211H	R	+	2	0	PIPOX	24404711	0.000000	0.05858	0.860000	0.33809	0.988000	0.76386	-0.564000	0.05936	-0.440000	0.07211	0.655000	0.94253	CGT	PIPOX	-	pfam_FAD-dep_OxRdtase,tigrfam_SoxA_mon	ENSG00000179761		0.542	PIPOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIPOX	HGNC	protein_coding	OTTHUMT00000255954.1	107	0.00	0	G	NM_016518		27380585	27380585	+1	no_errors	ENST00000323372	ensembl	human	known	69_37n	missense	52	45.26	43	SNP	0.004	A
PLEKHA6	22874	genome.wustl.edu	37	1	204214761	204214761	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr1:204214761C>T	ENST00000272203.3	-	14	2330	c.2014G>A	c.(2014-2016)Gac>Aac	p.D672N	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.D692N	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	672										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			TTGGCGGTGTCCGTGCCCCGG	0.602																																						dbGAP											0													104.0	90.0	95.0					1																	204214761		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2014G>A	1.37:g.204214761C>T	ENSP00000272203:p.Asp672Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD51|Q5VTI6	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D672N	ENST00000272203.3	37	c.2014	CCDS1444.1	1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.740913	0.89573	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.33216	1.42;1.42	5.13	5.13	0.70059	.	0.467399	0.21922	N	0.067158	T	0.31040	0.0784	L	0.48362	1.52	0.58432	D	0.999999	B	0.31383	0.321	B	0.31016	0.123	T	0.05716	-1.0868	10	0.33940	T	0.23	-26.6362	18.1807	0.89777	0.0:1.0:0.0:0.0	.	672	Q9Y2H5	PKHA6_HUMAN	N	672;692	ENSP00000272203:D672N;ENSP00000402046:D692N	ENSP00000272203:D672N	D	-	1	0	PLEKHA6	202481384	1.000000	0.71417	0.982000	0.44146	0.848000	0.48234	4.366000	0.59492	2.406000	0.81754	0.563000	0.77884	GAC	PLEKHA6	-	NULL	ENSG00000143850		0.602	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA6	HGNC	protein_coding	OTTHUMT00000087889.3	101	0.00	0	C	NM_014935		204214761	204214761	-1	no_errors	ENST00000272203	ensembl	human	known	69_37n	missense	53	45.36	44	SNP	1.000	T
PSG3	5671	genome.wustl.edu	37	19	43233453	43233453	+	Silent	SNP	G	G	A	rs200069263		TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr19:43233453G>A	ENST00000327495.5	-	5	1249	c.1065C>T	c.(1063-1065)ttC>ttT	p.F355F	PSG3_ENST00000595140.1_Silent_p.F355F	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	355	Ig-like C2-type 3.			Missing (in Ref. 9). {ECO:0000305}.	defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				TAGAGTCCGCGAAGCAGGACA	0.438																																						dbGAP											0													152.0	163.0	159.0					19																	43233453		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.1065C>T	19.37:g.43233453G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.F355	ENST00000327495.5	37	c.1065	CCDS12611.1	19																																																																																			PSG3	-	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000221826		0.438	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	PSG3	HGNC	protein_coding	OTTHUMT00000321423.2	495	0.00	0	G	NM_021016		43233453	43233453	-1	no_errors	ENST00000327495	ensembl	human	known	69_37n	silent	414	40.63	284	SNP	0.000	A
RBM19	9904	genome.wustl.edu	37	12	114380175	114380175	+	Missense_Mutation	SNP	C	C	T	rs202108762		TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr12:114380175C>T	ENST00000545145.2	-	14	1769	c.1691G>A	c.(1690-1692)cGg>cAg	p.R564Q	RBM19_ENST00000261741.5_Missense_Mutation_p.R564Q|RBM19_ENST00000392561.3_Missense_Mutation_p.R564Q	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	564					multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					GAGAAAACGCCGCACTTCCTG	0.612																																						dbGAP											0													45.0	42.0	43.0					12																	114380175		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.1691G>A	12.37:g.114380175C>T	ENSP00000442053:p.Arg564Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.R564Q	ENST00000545145.2	37	c.1691	CCDS9172.1	12	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611592	0.66558	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.06528	3.29;3.29;3.29	4.48	3.57	0.40892	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.09905	0.0243	M	0.62723	1.935	0.33686	D	0.612742	P	0.51933	0.949	B	0.43867	0.434	T	0.23226	-1.0194	10	0.45353	T	0.12	-22.956	12.7652	0.57388	0.0:0.9175:0.0:0.0824	.	564	Q9Y4C8	RBM19_HUMAN	Q	564	ENSP00000442053:R564Q;ENSP00000376344:R564Q;ENSP00000261741:R564Q	ENSP00000261741:R564Q	R	-	2	0	RBM19	112864558	1.000000	0.71417	0.544000	0.28141	0.762000	0.43233	7.375000	0.79646	2.046000	0.60703	0.484000	0.47621	CGG	RBM19	-	NULL	ENSG00000122965		0.612	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	RBM19	HGNC	protein_coding	OTTHUMT00000405251.1	67	0.00	0	C	NM_016196		114380175	114380175	-1	no_errors	ENST00000261741	ensembl	human	known	69_37n	missense	31	27.91	12	SNP	0.294	T
RUVBL1	8607	genome.wustl.edu	37	3	127800192	127800192	+	Silent	SNP	G	G	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr3:127800192G>A	ENST00000322623.5	-	11	1371	c.1272C>T	c.(1270-1272)agC>agT	p.S424S	RUVBL1_ENST00000480616.1_5'Flank|RUVBL1_ENST00000417360.1_3'UTR|RUVBL1_ENST00000464873.1_Intron|RUVBL1-AS1_ENST00000485218.1_RNA	NM_003707.2	NP_003698.1	Q9Y265	RUVB1_HUMAN	RuvB-like AAA ATPase 1	424					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Ino80 complex (GO:0031011)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)			endometrium(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26				GBM - Glioblastoma multiforme(114;0.181)		CTTTCTCAATGCTGTCCTTCC	0.522																																						dbGAP											0													150.0	134.0	140.0					3																	127800192		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF070735	CCDS3047.1	3q21	2013-09-12	2013-09-12		ENSG00000175792	ENSG00000175792		"""INO80 complex subunits"", ""ATPases / AAA-type"""	10474	protein-coding gene	gene with protein product	"""pontin"", ""INO80 complex subunit H"""	603449	"""RuvB (E coli homolog)-like 1"", ""RuvB-like 1 (E. coli)"", ""RuvB-like AAA ATPase"""			9774387, 9588198	Standard	NM_003707		Approved	TIP49, NMP238, RVB1, TIP49a, Pontin52, ECP54, TIH1, Rvb1, INO80H	uc003ekh.3	Q9Y265	OTTHUMG00000159658	ENST00000322623.5:c.1272C>T	3.37:g.127800192G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5S0|P82276|Q1KMR0|Q53HK5|Q53HL7|Q53Y27|Q9BSX9	Silent	SNP	pfam_TIP49_C,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_ATPase_AAA_core,superfamily_NA-bd_OB-fold-like,smart_AAA+_ATPase	p.S424	ENST00000322623.5	37	c.1272	CCDS3047.1	3																																																																																			RUVBL1	-	NULL	ENSG00000175792		0.522	RUVBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUVBL1	HGNC	protein_coding	OTTHUMT00000356728.2	446	0.00	0	G			127800192	127800192	-1	no_errors	ENST00000322623	ensembl	human	known	69_37n	silent	265	36.52	153	SNP	0.995	A
RYR2	6262	genome.wustl.edu	37	1	237863760	237863760	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr1:237863760C>G	ENST00000366574.2	+	65	9677	c.9360C>G	c.(9358-9360)gaC>gaG	p.D3120E	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.D3118E|RYR2_ENST00000542537.1_Missense_Mutation_p.D3104E	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3120					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCGGAGAAGACCTAATATGTA	0.363																																						dbGAP											0													37.0	34.0	35.0					1																	237863760		1843	4084	5927	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.9360C>G	1.37:g.237863760C>G	ENSP00000355533:p.Asp3120Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.D3118E	ENST00000366574.2	37	c.9354	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.340752	0.60963	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288;ENST00000540213	T;T;T	0.66638	-0.22;1.63;-0.22	4.88	1.27	0.21489	.	0.000000	0.64402	U	0.000013	T	0.72645	0.3486	M	0.86953	2.85	0.80722	D	1	D	0.54397	0.966	P	0.49752	0.621	T	0.73588	-0.3935	10	0.62326	D	0.03	.	8.4322	0.32764	0.0:0.2622:0.0:0.7378	.	3120	Q92736	RYR2_HUMAN	E	3120;3118;3104;75;115	ENSP00000355533:D3120E;ENSP00000353174:D3118E;ENSP00000443798:D3104E	ENSP00000353174:D3118E	D	+	3	2	RYR2	235930383	0.997000	0.39634	0.998000	0.56505	0.942000	0.58702	1.181000	0.32017	0.319000	0.23209	0.563000	0.77884	GAC	RYR2	-	NULL	ENSG00000198626		0.363	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	141	0.00	0	C	NM_001035		237863760	237863760	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	111	39.01	71	SNP	0.998	G
SATB2	23314	genome.wustl.edu	37	2	200137283	200137283	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr2:200137283C>T	ENST00000417098.1	-	11	2669	c.1853G>A	c.(1852-1854)cGc>cAc	p.R618H	SATB2_ENST00000428695.1_Missense_Mutation_p.R500H|SATB2_ENST00000260926.5_Missense_Mutation_p.R618H|SATB2_ENST00000457245.1_Missense_Mutation_p.R618H|SATB2_ENST00000443023.1_Missense_Mutation_p.R559H	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	618					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GATCTTTGTGCGAGACCGGGG	0.562																																					Colon(30;262 767 11040 24421 36230)	dbGAP											0													70.0	75.0	73.0					2																	200137283		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.1853G>A	2.37:g.200137283C>T	ENSP00000401112:p.Arg618His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.R618H	ENST00000417098.1	37	c.1853	CCDS2327.1	2	.	.	.	.	.	.	.	.	.	.	C	20.8	4.054981	0.75960	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	D;D;D;D;D	0.99167	-5.51;-5.51;-5.51;-5.51;-5.51	5.47	5.47	0.80525	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98513	0.9504	N	0.19112	0.55	0.54753	D	0.999982	D;D	0.76494	0.999;0.985	D;P	0.78314	0.991;0.703	D	0.99917	1.1229	10	0.54805	T	0.06	-14.3378	19.7423	0.96237	0.0:1.0:0.0:0.0	.	500;618	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	H	618;559;618;500;618	ENSP00000401112:R618H;ENSP00000388764:R559H;ENSP00000260926:R618H;ENSP00000388581:R500H;ENSP00000405420:R618H	ENSP00000260926:R618H	R	-	2	0	SATB2	199845528	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.541000	0.67212	2.737000	0.93849	0.644000	0.83932	CGC	SATB2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000119042		0.562	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB2	HGNC	protein_coding	OTTHUMT00000256140.1	150	0.66	1	C	NM_015265		200137283	200137283	-1	no_errors	ENST00000260926	ensembl	human	known	69_37n	missense	65	46.28	56	SNP	1.000	T
SGIP1	84251	genome.wustl.edu	37	1	67206375	67206375	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr1:67206375C>A	ENST00000371037.4	+	23	2346	c.2269C>A	c.(2269-2271)Cct>Act	p.P757T	SGIP1_ENST00000371036.3_Missense_Mutation_p.P559T|SGIP1_ENST00000371039.1_Missense_Mutation_p.P560T|SGIP1_ENST00000435165.2_Missense_Mutation_p.P262T|SGIP1_ENST00000237247.6_Missense_Mutation_p.P788T|SGIP1_ENST00000371035.3_Missense_Mutation_p.P547T	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	757	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.|Necessary and sufficient to mediate interaction with CANX. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						GTGGAAGATTCCTGATATCTC	0.313																																						dbGAP											0													51.0	52.0	52.0					1																	67206375		2203	4294	6497	-	-	-	SO:0001583	missense	0			AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.2269C>A	1.37:g.67206375C>A	ENSP00000360076:p.Pro757Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C	p.P788T	ENST00000371037.4	37	c.2362	CCDS30744.1	1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.865693	0.51588	.	.	ENSG00000118473	ENST00000237247;ENST00000371039;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371036;ENST00000371037;ENST00000435165	T;T;T;T;T;T	0.21031	2.03;2.03;2.03;2.03;2.03;2.03	5.86	5.86	0.93980	Muniscin C-terminal mu homology domain (1);	0.000000	0.85682	D	0.000000	T	0.14614	0.0353	N	0.21194	0.64	0.58432	D	0.999998	B;B;B;B;B	0.30326	0.213;0.103;0.276;0.276;0.041	B;B;B;B;B	0.44224	0.444;0.038;0.145;0.223;0.127	T	0.19353	-1.0308	10	0.16896	T	0.51	-11.8806	20.5632	0.99335	0.0:1.0:0.0:0.0	.	787;262;359;547;757	A6NEV3;Q6ZV33;B3KR01;B7Z5H8;Q9BQI5	.;.;.;.;SGIP1_HUMAN	T	788;560;547;787;760;559;757;262	ENSP00000237247:P788T;ENSP00000360078:P560T;ENSP00000360074:P547T;ENSP00000360075:P559T;ENSP00000360076:P757T;ENSP00000395525:P262T	ENSP00000237247:P788T	P	+	1	0	SGIP1	66978963	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.599000	0.54045	2.937000	0.99478	0.650000	0.86243	CCT	SGIP1	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C	ENSG00000118473		0.313	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGIP1	HGNC	protein_coding	OTTHUMT00000025395.4	215	0.00	0	C	NM_032291		67206375	67206375	+1	no_errors	ENST00000237247	ensembl	human	known	69_37n	missense	193	41.16	135	SNP	1.000	A
TMEM80	283232	genome.wustl.edu	37	11	700171	700171	+	Silent	SNP	T	T	C			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr11:700171T>C	ENST00000608174.1	+	3	281	c.144T>C	c.(142-144)ttT>ttC	p.F48F	TMEM80_ENST00000397512.3_Silent_p.F40F|TMEM80_ENST00000397510.3_Silent_p.F96F	NM_001042463.1|NM_174940.2	NP_001035928.2|NP_777600.3	Q96HE8	TMM80_HUMAN	transmembrane protein 80	48						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5		all_cancers(49;5.11e-06)|all_epithelial(84;0.00143)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.44e-27)|Epithelial(43;2.29e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.19e-20)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AAATGCTGTTTTATCTCAGCG	0.532																																						dbGAP											0													181.0	136.0	151.0					11																	700171		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS41587.1, CCDS41587.2, CCDS73231.1	11p15.5	2005-10-18			ENSG00000177042	ENSG00000177042			27453	protein-coding gene	gene with protein product						12477932	Standard	NM_001042463		Approved	FLJ38216	uc010qwi.2	Q96HE8	OTTHUMG00000133307	ENST00000608174.1:c.144T>C	11.37:g.700171T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQ01|A8MXY8|B7WNU5	Silent	SNP	pfam_Uncharacterised_TM-17	p.F48	ENST00000608174.1	37	c.144	CCDS41587.1	11																																																																																			TMEM80	-	pfam_Uncharacterised_TM-17	ENSG00000177042		0.532	TMEM80-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	TMEM80	HGNC	protein_coding	OTTHUMT00000257104.2	274	0.00	0	T	NM_174940		700171	700171	+1	no_errors	ENST00000397510	ensembl	human	known	69_37n	silent	161	39.02	103	SNP	0.088	C
TP53	7157	genome.wustl.edu	37	17	7579591	7579591	+	Splice_Site	SNP	C	C	G			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr17:7579591C>G	ENST00000269305.4	-	4	286		c.e4-1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(8)|p.0?(8)|p.L35fs*10(3)|p.S33fs*10(1)|p.P13fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAAGGGGGACTGTAGATGGG	0.592		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	21	Unknown(11)|Whole gene deletion(8)|Insertion - Frameshift(1)|Deletion - Frameshift(1)	bone(4)|large_intestine(3)|central_nervous_system(3)|lung(3)|pancreas(3)|upper_aerodigestive_tract(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)	GRCh37	CS971912	TP53	S							141.0	137.0	138.0					17																	7579591		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.97-1G>C	17.37:g.7579591C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e3-1	ENST00000269305.4	37	c.97-1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	6.036	0.374935	0.11409	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	2.49	2.49	0.30216	.	.	.	.	.	.	.	.	.	.	.	0.40870	D	0.9839	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.6143	0.33822	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7520316	0.879000	0.30193	0.021000	0.16686	0.027000	0.11550	1.937000	0.40193	1.730000	0.51580	0.561000	0.74099	.	TP53	-	-	ENSG00000141510		0.592	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	88	0.00	0	C	NM_000546	Intron	7579591	7579591	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	splice_site	8	82.98	39	SNP	0.023	G
TROVE2	6738	genome.wustl.edu	37	1	193045697	193045697	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr1:193045697G>T	ENST00000367446.3	+	4	1078	c.868G>T	c.(868-870)Gct>Tct	p.A290S	TROVE2_ENST00000460715.2_3'UTR|TROVE2_ENST00000432079.1_Missense_Mutation_p.A15S|TROVE2_ENST00000367445.3_Missense_Mutation_p.A290S|TROVE2_ENST00000416058.2_Missense_Mutation_p.A15S|TROVE2_ENST00000400968.2_Missense_Mutation_p.A290S|TROVE2_ENST00000367443.1_Missense_Mutation_p.A290S|TROVE2_ENST00000367444.3_Missense_Mutation_p.A290S|TROVE2_ENST00000367441.1_Missense_Mutation_p.A290S	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2	290	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)			biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						AAAGATGACTGCTAATTCAGT	0.333																																						dbGAP											0													115.0	110.0	111.0					1																	193045697		1824	4085	5909	-	-	-	SO:0001583	missense	0			BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.868G>T	1.37:g.193045697G>T	ENSP00000356416:p.Ala290Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	Missense_Mutation	SNP	pfam_TROVE,pfscan_TROVE	p.A290S	ENST00000367446.3	37	c.868	CCDS1379.1	1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305951	0.60305	.	.	ENSG00000116747	ENST00000400968;ENST00000416058;ENST00000367446;ENST00000367443;ENST00000367445;ENST00000367444;ENST00000367441	T;T;T;T;T;T;T	0.14391	2.51;2.51;2.51;2.51;2.51;2.51;2.51	5.38	5.38	0.77491	TROVE (2);	0.000000	0.85682	D	0.000000	T	0.18676	0.0448	L	0.54323	1.7	0.80722	D	1	B;B;B;B	0.28667	0.012;0.012;0.038;0.219	B;B;B;B	0.35278	0.106;0.106;0.08;0.199	T	0.06110	-1.0845	10	0.11485	T	0.65	-34.2517	19.5625	0.95378	0.0:0.0:1.0:0.0	.	290;290;290;290	Q5LJ99;Q5LJ98;Q5LJA0;P10155	.;.;.;RO60_HUMAN	S	290;15;290;290;290;290;290	ENSP00000383752:A290S;ENSP00000411421:A15S;ENSP00000356416:A290S;ENSP00000356413:A290S;ENSP00000356415:A290S;ENSP00000356414:A290S;ENSP00000356411:A290S	ENSP00000356411:A290S	A	+	1	0	TROVE2	191312320	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.724000	0.61972	2.700000	0.92200	0.558000	0.71614	GCT	TROVE2	-	pfam_TROVE,pfscan_TROVE	ENSG00000116747		0.333	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROVE2	HGNC	protein_coding	OTTHUMT00000086688.1	330	0.00	0	G	NM_004600		193045697	193045697	+1	no_errors	ENST00000367441	ensembl	human	known	69_37n	missense	258	41.89	186	SNP	1.000	T
TTBK2	146057	genome.wustl.edu	37	15	43122137	43122137	+	Splice_Site	SNP	G	G	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr15:43122137G>A	ENST00000267890.6	-	5	539	c.431C>T	c.(430-432)cCg>cTg	p.P144L	TTBK2_ENST00000567840.1_Splice_Site_p.P144L|TTBK2_ENST00000567274.1_Splice_Site_p.P144L	NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	144	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		GGTCCCTACCGGTTTGATGTC	0.403																																						dbGAP											0													114.0	105.0	108.0					15																	43122137		1872	4126	5998	-	-	-	SO:0001630	splice_region_variant	0			AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.432+1C>T	15.37:g.43122137G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O94932|Q6ZN52|Q8IVV1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P144L	ENST00000267890.6	37	c.431	CCDS42029.1	15	.	.	.	.	.	.	.	.	.	.	G	17.64	3.438602	0.62955	.	.	ENSG00000128881	ENST00000267890;ENST00000399479;ENST00000263802	T	0.30182	1.54	5.88	5.88	0.94601	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.65396	0.2687	M	0.89478	3.035	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.97110	0.954;1.0;1.0;1.0	T	0.70317	-0.4905	10	0.87932	D	0	.	20.2405	0.98372	0.0:0.0:1.0:0.0	.	159;75;144;144	Q8IWY7;Q6IQ55-2;Q6IQ55-3;Q6IQ55	.;.;.;TTBK2_HUMAN	L	144;74;124	ENSP00000267890:P144L	ENSP00000263802:P124L	P	-	2	0	TTBK2	40909429	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.797000	0.96272	0.561000	0.74099	CCG	TTBK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000128881		0.403	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK2	HGNC	protein_coding	OTTHUMT00000431106.2	278	0.00	0	G	NM_173500	Missense_Mutation	43122137	43122137	-1	no_errors	ENST00000267890	ensembl	human	known	69_37n	missense	152	45.16	126	SNP	1.000	A
USP36	57602	genome.wustl.edu	37	17	76831512	76831512	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr17:76831512G>A	ENST00000542802.3	-	4	768	c.325C>T	c.(325-327)Cga>Tga	p.R109*	USP36_ENST00000312010.6_Nonsense_Mutation_p.R109*|USP36_ENST00000590546.2_Nonsense_Mutation_p.R109*|USP36_ENST00000589424.1_Nonsense_Mutation_p.R109*			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	109					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			AGAGACAGTCGCTCCGTGGGG	0.577																																						dbGAP											0													99.0	72.0	82.0					17																	76831512		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.325C>T	17.37:g.76831512G>A	ENSP00000441214:p.Arg109*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Nonsense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.R109*	ENST00000542802.3	37	c.325	CCDS32755.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.102766	0.97286	.	.	ENSG00000055483	ENST00000312010;ENST00000542802;ENST00000432878	.	.	.	5.4	5.4	0.78164	.	0.182969	0.47455	D	0.000222	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.1349	12.9875	0.58599	0.0:0.0:0.8382:0.1618	.	.	.	.	X	109	.	ENSP00000310590:R109X	R	-	1	2	USP36	74343107	0.916000	0.31088	0.866000	0.34008	0.051000	0.14879	1.609000	0.36858	2.526000	0.85167	0.561000	0.74099	CGA	USP36	-	NULL	ENSG00000055483		0.577	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP36	HGNC	protein_coding	OTTHUMT00000437472.3	107	0.00	0	G	NM_025090		76831512	76831512	-1	no_errors	ENST00000312010	ensembl	human	known	69_37n	nonsense	57	38.30	36	SNP	0.999	A
WDR90	197335	genome.wustl.edu	37	16	708527	708527	+	Silent	SNP	G	G	A			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr16:708527G>A	ENST00000293879.4	+	23	2769	c.2769G>A	c.(2767-2769)ctG>ctA	p.L923L	LA16c-349E10.1_ENST00000573609.1_RNA|WDR90_ENST00000549091.1_Silent_p.L923L			Q96KV7	WDR90_HUMAN	WD repeat domain 90	923										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				TGTTCCAGCTGCCCGGTGTCC	0.667																																						dbGAP											0													63.0	73.0	70.0					16																	708527		2157	4249	6406	-	-	-	SO:0001819	synonymous_variant	0			AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.2769G>A	16.37:g.708527G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Silent	SNP	pfam_WD40_repeat,pfam_DUF667,pfam_Nucleoporin_Nup160,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L923	ENST00000293879.4	37	c.2769	CCDS42092.1	16																																																																																			WDR90	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000161996		0.667	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	WDR90	HGNC	protein_coding	OTTHUMT00000404335.1	30	0.00	0	G	NM_145294		708527	708527	+1	no_errors	ENST00000549091	ensembl	human	novel	69_37n	silent	12	45.45	10	SNP	0.178	A
ZNF217	7764	genome.wustl.edu	37	20	52193283	52193283	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr20:52193283A>G	ENST00000371471.2	-	4	2445	c.2020T>C	c.(2020-2022)Tgc>Cgc	p.C674R	ZNF217_ENST00000302342.3_Missense_Mutation_p.C674R|RP4-724E16.2_ENST00000424252.1_RNA			O75362	ZN217_HUMAN	zinc finger protein 217	674					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			CTGTATCTGCAGTCAGCTGCG	0.478																																						dbGAP											0													153.0	158.0	157.0					20																	52193283		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.2020T>C	20.37:g.52193283A>G	ENSP00000360526:p.Cys674Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Y6|Q14DB8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C674R	ENST00000371471.2	37	c.2020	CCDS13443.1	20	.	.	.	.	.	.	.	.	.	.	A	10.60	1.395815	0.25205	.	.	ENSG00000171940	ENST00000371471;ENST00000302342	T;T	0.09723	2.95;2.95	4.97	-9.93	0.00452	.	0.874058	0.10024	N	0.725675	T	0.06005	0.0156	L	0.38175	1.15	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.23013	-1.0200	10	0.24483	T	0.36	-1.2708	7.7571	0.28930	0.1726:0.5867:0.061:0.1798	.	674	O75362	ZN217_HUMAN	R	674	ENSP00000360526:C674R;ENSP00000304308:C674R	ENSP00000304308:C674R	C	-	1	0	ZNF217	51626690	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.508000	0.06344	-2.625000	0.00437	-0.440000	0.05779	TGC	ZNF217	-	NULL	ENSG00000171940		0.478	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF217	HGNC	protein_coding	OTTHUMT00000079757.2	228	0.00	0	A	NM_006526		52193283	52193283	-1	no_errors	ENST00000302342	ensembl	human	known	69_37n	missense	169	41.92	122	SNP	0.000	G
ZNF597	146434	genome.wustl.edu	37	16	3486606	3486606	+	Nonsense_Mutation	SNP	C	C	A	rs536364792		TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr16:3486606C>A	ENST00000301744.4	-	4	1328	c.1093G>T	c.(1093-1095)Gag>Tag	p.E365*		NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						GGCCTTTCCTCTGTATGAATG	0.433																																						dbGAP											0													51.0	45.0	47.0					16																	3486606		2196	4300	6496	-	-	-	SO:0001587	stop_gained	0			AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.1093G>T	16.37:g.3486606C>A	ENSP00000301744:p.Glu365*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E365*	ENST00000301744.4	37	c.1093	CCDS10505.1	16	.	.	.	.	.	.	.	.	.	.	C	14.82	2.648057	0.47258	.	.	ENSG00000167981	ENST00000301744	.	.	.	4.64	-3.8	0.04307	.	1.399700	0.05143	N	0.494535	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	0.5175	1.5784	0.02629	0.1188:0.3404:0.2334:0.3074	.	.	.	.	X	365	.	ENSP00000301744:E365X	E	-	1	0	ZNF597	3426607	0.000000	0.05858	0.000000	0.03702	0.111000	0.19643	0.790000	0.26900	-0.528000	0.06366	-0.142000	0.14014	GAG	ZNF597	-	pfscan_Znf_C2H2	ENSG00000167981		0.433	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF597	HGNC	protein_coding	OTTHUMT00000251511.2	249	0.00	0	C	NM_152457		3486606	3486606	-1	no_errors	ENST00000301744	ensembl	human	known	69_37n	nonsense	121	38.81	78	SNP	0.000	A
ZNF646	9726	genome.wustl.edu	37	16	31092215	31092215	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr16:31092215C>T	ENST00000394979.2	+	1	4993	c.4570C>T	c.(4570-4572)Cag>Tag	p.Q1524*	ZNF646_ENST00000300850.5_Nonsense_Mutation_p.Q1524*			O15015	ZN646_HUMAN	zinc finger protein 646	1524					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CAACAGCTCTCAGCTGCAGCC	0.562																																						dbGAP											0													59.0	66.0	64.0					16																	31092215		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.4570C>T	16.37:g.31092215C>T	ENSP00000378429:p.Gln1524*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVD8	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q1524*	ENST00000394979.2	37	c.4570		16	.	.	.	.	.	.	.	.	.	.	C	41	8.977639	0.99023	.	.	ENSG00000167395	ENST00000300850;ENST00000394979	.	.	.	5.1	3.09	0.35607	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.0996	13.3377	0.60526	0.0:0.6968:0.3032:0.0	.	.	.	.	X	1524	.	ENSP00000300850:Q1524X	Q	+	1	0	ZNF646	30999716	0.000000	0.05858	0.007000	0.13788	0.082000	0.17680	0.639000	0.24690	0.519000	0.28406	0.650000	0.86243	CAG	ZNF646	-	NULL	ENSG00000167395		0.562	ZNF646-003	KNOWN	basic	protein_coding	ZNF646	HGNC	protein_coding	OTTHUMT00000108510.2	89	0.00	0	C	NM_014699		31092215	31092215	+1	no_errors	ENST00000300850	ensembl	human	known	69_37n	nonsense	36	47.06	32	SNP	0.273	T
ZNF684	127396	genome.wustl.edu	37	1	41006377	41006377	+	Silent	SNP	C	C	T			TCGA-E2-A155-01A-11D-A12B-09	TCGA-E2-A155-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a966904f-e8dd-473c-8626-84c25d7e0d6c	ff422b83-8a29-41b3-8e73-2909fe3521da	g.chr1:41006377C>T	ENST00000372699.3	+	3	386	c.135C>T	c.(133-135)atC>atT	p.I45I	ZNF684_ENST00000493756.1_Intron|ZNF684_ENST00000372696.3_Silent_p.I45I|ZNF684_ENST00000372697.3_Silent_p.I45I	NM_152373.3	NP_689586.3	Q5T5D7	ZN684_HUMAN	zinc finger protein 684	45	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(2)|lung(3)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;5.42e-18)			GAAACCTCATCTCAGTGGGTA	0.428																																						dbGAP											0													173.0	152.0	159.0					1																	41006377		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS454.1	1p34.2	2013-01-08			ENSG00000117010	ENSG00000117010		"""Zinc fingers, C2H2-type"", ""-"""	28418	protein-coding gene	gene with protein product	"""hypothetical protein MGC27466"""					12477932	Standard	NM_152373		Approved	MGC27466	uc001cft.2	Q5T5D7	OTTHUMG00000007359	ENST00000372699.3:c.135C>T	1.37:g.41006377C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKY4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I45	ENST00000372699.3	37	c.135	CCDS454.1	1																																																																																			ZNF684	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000117010		0.428	ZNF684-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF684	HGNC	protein_coding	OTTHUMT00000019260.3	436	0.00	0	C	NM_152373		41006377	41006377	+1	no_errors	ENST00000372699	ensembl	human	known	69_37n	silent	306	35.03	165	SNP	0.970	T
