#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACVR1B	91	genome.wustl.edu	37	12	52377883	52377883	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr12:52377883G>T	ENST00000257963.4	+	5	989	c.912G>T	c.(910-912)atG>atT	p.M304I	ACVR1B_ENST00000563121.1_3'UTR|ACVR1B_ENST00000541224.1_Missense_Mutation_p.M345I|ACVR1B_ENST00000426655.2_Missense_Mutation_p.M304I|ACVR1B_ENST00000542485.1_Missense_Mutation_p.M252I|ACVR1B_ENST00000415850.2_Missense_Mutation_p.M304I	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	304	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	TTGAGGGGATGATTAAGCTGG	0.542																																						dbGAP											0													117.0	91.0	100.0					12																	52377883		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.912G>T	12.37:g.52377883G>T	ENSP00000257963:p.Met304Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.M304I	ENST00000257963.4	37	c.912	CCDS8816.1	12	.	.	.	.	.	.	.	.	.	.	G	26.6	4.751436	0.89753	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	T;T;T;T;T	0.61627	0.09;0.09;0.09;0.09;0.09	5.28	5.28	0.74379	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66597	0.2805	L	0.35644	1.08	0.80722	D	1	P;P;B;P	0.50528	0.529;0.936;0.332;0.587	B;P;B;B	0.59056	0.373;0.851;0.294;0.422	T	0.68838	-0.5303	10	0.72032	D	0.01	.	19.2879	0.94085	0.0:0.0:1.0:0.0	.	345;304;304;304	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	I	304;345;304;304;252	ENSP00000257963:M304I;ENSP00000442656:M345I;ENSP00000390477:M304I;ENSP00000397550:M304I;ENSP00000442885:M252I	ENSP00000257963:M304I	M	+	3	0	ACVR1B	50664150	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	9.869000	0.99810	2.644000	0.89710	0.655000	0.94253	ATG	ACVR1B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000135503		0.542	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1B	HGNC	protein_coding	OTTHUMT00000397000.1	277	0.00	0	G	NM_020328		52377883	52377883	+1	no_errors	ENST00000257963	ensembl	human	known	69_37n	missense	82	41.43	58	SNP	1.000	T
ACVR1B	91	genome.wustl.edu	37	12	52380701	52380701	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr12:52380701G>C	ENST00000257963.4	+	7	1313	c.1236G>C	c.(1234-1236)gaG>gaC	p.E412D	ACVR1B_ENST00000563121.1_Intron|ACVR1B_ENST00000541224.1_Missense_Mutation_p.E453D|ACVR1B_ENST00000426655.2_Missense_Mutation_p.E412D|ACVR1B_ENST00000542485.1_Missense_Mutation_p.E360D|ACVR1B_ENST00000415850.2_Missense_Mutation_p.E412D|RNU6-574P_ENST00000384265.1_RNA	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	412	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	TATATTGGGAGATTGCTCGAA	0.438																																						dbGAP											0													154.0	149.0	150.0					12																	52380701		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.1236G>C	12.37:g.52380701G>C	ENSP00000257963:p.Glu412Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E412D	ENST00000257963.4	37	c.1236	CCDS8816.1	12	.	.	.	.	.	.	.	.	.	.	G	18.20	3.571551	0.65765	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	D;D;D;D;D	0.96073	-3.9;-3.9;-3.9;-3.9;-3.9	4.77	3.87	0.44632	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98394	0.9466	H	0.98426	4.23	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.85130	0.997;0.983;0.992;0.996	D	0.97891	1.0297	10	0.87932	D	0	.	8.4663	0.32958	0.2378:0.0:0.7622:0.0	.	453;412;412;412	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	D	412;453;412;412;360	ENSP00000257963:E412D;ENSP00000442656:E453D;ENSP00000390477:E412D;ENSP00000397550:E412D;ENSP00000442885:E360D	ENSP00000257963:E412D	E	+	3	2	ACVR1B	50666968	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.258000	0.32944	1.373000	0.46208	0.563000	0.77884	GAG	ACVR1B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000135503		0.438	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1B	HGNC	protein_coding	OTTHUMT00000397000.1	517	0.00	0	G	NM_020328		52380701	52380701	+1	no_errors	ENST00000257963	ensembl	human	known	69_37n	missense	240	34.86	129	SNP	1.000	C
AIM1	202	genome.wustl.edu	37	6	106967869	106967869	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr6:106967869G>C	ENST00000369066.3	+	2	2049	c.1562G>C	c.(1561-1563)gGa>gCa	p.G521A		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TTAGAACTTGGAGGAGAAACA	0.478																																						dbGAP											0													76.0	82.0	80.0					6																	106967869		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1562G>C	6.37:g.106967869G>C	ENSP00000358062:p.Gly521Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.G521A	ENST00000369066.3	37	c.1562	CCDS34506.1	6	.	.	.	.	.	.	.	.	.	.	G	10.97	1.502276	0.26949	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.71934	-0.61	6.17	-1.64	0.08318	.	0.819534	0.10253	N	0.696918	T	0.17577	0.0422	N	0.05383	-0.06	0.29572	N	0.849837	B	0.06786	0.001	B	0.04013	0.001	T	0.21552	-1.0242	10	0.02654	T	1	.	7.9	0.29729	0.2263:0.4272:0.3464:0.0	.	521	Q9Y4K1	AIM1_HUMAN	A	929;521	ENSP00000358062:G521A	ENSP00000285105:G929A	G	+	2	0	AIM1	107074562	0.024000	0.19004	0.005000	0.12908	0.027000	0.11550	-0.087000	0.11215	-0.304000	0.08843	-0.137000	0.14449	GGA	AIM1	-	NULL	ENSG00000112297		0.478	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	65	0.00	0	G			106967869	106967869	+1	no_errors	ENST00000369066	ensembl	human	known	69_37n	missense	48	21.31	13	SNP	0.010	C
AK5	26289	genome.wustl.edu	37	1	77748056	77748056	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:77748056G>C	ENST00000354567.2	+	1	321	c.58G>C	c.(58-60)Gag>Cag	p.E20Q	AK5_ENST00000317704.4_3'UTR|AK5_ENST00000344720.5_5'Flank	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	20					ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						TCAGCTTTTTGAGGTAGGGCT	0.667																																						dbGAP											0													40.0	37.0	38.0					1																	77748056		2164	4258	6422	-	-	-	SO:0001583	missense	0			AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.58G>C	1.37:g.77748056G>C	ENSP00000346577:p.Glu20Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_Dpy-30_motif,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,prints_Adenylate_kin,tigrfam_Adenylate_kin1	p.E20Q	ENST00000354567.2	37	c.58	CCDS675.1	1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.921759	0.52653	.	.	ENSG00000154027	ENST00000354567	T	0.77877	-1.13	4.29	3.35	0.38373	Dpy-30 motif (1);cAMP-dependent protein kinase, regulatory subunit, type I/II alpha/beta (1);	0.000000	0.85682	D	0.000000	T	0.77883	0.4197	L	0.43152	1.355	0.80722	D	1	B;D	0.69078	0.034;0.997	B;D	0.81914	0.033;0.995	T	0.79938	-0.1592	10	0.54805	T	0.06	-13.2508	13.253	0.60062	0.0:0.0:0.8396:0.1604	.	20;20	Q9Y6K8;Q8N291	KAD5_HUMAN;.	Q	20	ENSP00000346577:E20Q	ENSP00000346577:E20Q	E	+	1	0	AK5	77520644	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	6.025000	0.70864	1.127000	0.42034	0.561000	0.74099	GAG	AK5	-	pfam_Dpy-30_motif,superfamily_cAMP_dep_PK_reg_su_I/II_a/b	ENSG00000154027		0.667	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK5	HGNC	protein_coding	OTTHUMT00000026993.4	128	0.00	0	G	NM_174858		77748056	77748056	+1	no_errors	ENST00000354567	ensembl	human	known	69_37n	missense	63	31.91	30	SNP	1.000	C
AKAP17A	8227	genome.wustl.edu	37	X	1712954	1712954	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chrX:1712954C>T	ENST00000313871.3	+	2	795	c.599C>T	c.(598-600)aCg>aTg	p.T200M	AKAP17A_ENST00000381261.3_Missense_Mutation_p.T200M	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	200	RRM.				B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						GAGGAGATGACGGGCCGCAAC	0.597																																						dbGAP											0													136.0	124.0	128.0					X																	1712954		2203	4296	6499	-	-	-	SO:0001583	missense	0			L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.599C>T	X.37:g.1712954C>T	ENSP00000324827:p.Thr200Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	SNP	NULL	p.T200M	ENST00000313871.3	37	c.599	CCDS14116.1	X	.	.	.	.	.	.	.	.	.	.	c	1.646	-0.515320	0.04200	.	.	ENSG00000197976	ENST00000313871;ENST00000381261	T;T	0.32988	1.43;1.43	2.04	2.04	0.26737	Nucleotide-binding, alpha-beta plait (1);	0.401878	0.23021	U	0.052851	T	0.26666	0.0652	.	.	.	0.26095	N	0.980895	P;P	0.41188	0.621;0.741	B;B	0.39876	0.116;0.312	T	0.11567	-1.0582	9	0.48119	T	0.1	.	12.5281	0.56098	0.0:1.0:0.0:0.0	.	200;200	Q02040-3;Q02040	.;AK17A_HUMAN	M	200	ENSP00000324827:T200M;ENSP00000370660:T200M	ENSP00000324827:T200M	T	+	2	0	AKAP17A	1672954	0.975000	0.34042	0.014000	0.15608	0.326000	0.28443	1.518000	0.35877	0.822000	0.34565	0.100000	0.15512	ACG	AKAP17A	-	NULL	ENSG00000197976		0.597	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP17A	HGNC	protein_coding	OTTHUMT00000055609.2	139	0.00	0	C	NM_005088		1712954	1712954	+1	no_errors	ENST00000313871	ensembl	human	known	69_37n	missense	90	22.41	26	SNP	0.998	T
ANO9	338440	genome.wustl.edu	37	11	419605	419605	+	Silent	SNP	C	C	G	rs138865475		TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr11:419605C>G	ENST00000332826.6	-	20	1995	c.1911G>C	c.(1909-1911)ctG>ctC	p.L637L	SIGIRR_ENST00000397632.3_5'Flank|SIGIRR_ENST00000332725.3_5'Flank|SIGIRR_ENST00000382520.2_5'Flank	NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	637					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						TGCCTTCTTTCAGGCATGGGC	0.572																																						dbGAP											0													103.0	90.0	94.0					11																	419605		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.1911G>C	11.37:g.419605C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUC4|B4E134|Q8TEN4	Silent	SNP	pfam_Anoctamin	p.L637	ENST00000332826.6	37	c.1911	CCDS31326.1	11																																																																																			ANO9	-	pfam_Anoctamin	ENSG00000185101		0.572	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO9	HGNC	protein_coding	OTTHUMT00000384116.1	154	0.00	0	C	NM_001012302		419605	419605	-1	no_errors	ENST00000332826	ensembl	human	known	69_37n	silent	49	35.90	28	SNP	0.000	G
APOB	338	genome.wustl.edu	37	2	21232419	21232419	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr2:21232419C>T	ENST00000233242.1	-	26	7448	c.7321G>A	c.(7321-7323)Gac>Aac	p.D2441N		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2441					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGGATTTTGTCATTGGTTTCA	0.338																																						dbGAP											0													114.0	111.0	112.0					2																	21232419		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.7321G>A	2.37:g.21232419C>T	ENSP00000233242:p.Asp2441Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.D2441N	ENST00000233242.1	37	c.7321	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	0.114	-1.135054	0.01742	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00653	5.96	5.49	1.78	0.24846	.	0.379769	0.25045	N	0.033576	T	0.00210	0.0006	N	0.00170	-1.935	0.09310	N	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.43458	-0.9390	10	0.02654	T	1	.	6.7923	0.23707	0.0:0.1347:0.1276:0.7377	.	2441	P04114	APOB_HUMAN	N	2441	ENSP00000233242:D2441N	ENSP00000233242:D2441N	D	-	1	0	APOB	21085924	0.000000	0.05858	0.964000	0.40570	0.846000	0.48090	0.294000	0.19047	0.057000	0.16193	-0.415000	0.06103	GAC	APOB	-	NULL	ENSG00000084674		0.338	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	278	0.00	0	C			21232419	21232419	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	255	23.35	78	SNP	0.029	T
ARHGEF19	128272	genome.wustl.edu	37	1	16525668	16525668	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:16525668G>A	ENST00000270747.3	-	15	2364	c.2228C>T	c.(2227-2229)tCa>tTa	p.S743L	ARHGEF19_ENST00000478117.1_5'UTR|ARHGEF19-AS1_ENST00000457809.1_RNA	NM_153213.3	NP_694945.2	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19	743	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)		GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(1)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		GGTCCTCACTGACAGGATGTC	0.572																																						dbGAP											0													132.0	104.0	114.0					1																	16525668		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012982	CCDS170.1	1p36.13	2011-11-16			ENSG00000142632	ENSG00000142632		"""Rho guanine nucleotide exchange factors"""	26604	protein-coding gene	gene with protein product		612496				12477932	Standard	NM_153213		Approved	FLJ33962, WGEF	uc001ayc.1	Q8IW93	OTTHUMG00000002219	ENST00000270747.3:c.2228C>T	1.37:g.16525668G>A	ENSP00000270747:p.Ser743Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ04|Q5TEV2|Q6PJQ4|Q8N244	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.S743L	ENST00000270747.3	37	c.2228	CCDS170.1	1	.	.	.	.	.	.	.	.	.	.	G	9.281	1.048195	0.19827	.	.	ENSG00000142632	ENST00000270747	T	0.40476	1.03	4.57	4.57	0.56435	Src homology-3 domain (4);	0.193235	0.35936	N	0.002894	T	0.12774	0.0310	N	0.01134	-0.995	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21314	-1.0249	10	0.07813	T	0.8	.	8.4743	0.33003	0.1037:0.0:0.8963:0.0	.	743	Q8IW93	ARHGJ_HUMAN	L	743	ENSP00000270747:S743L	ENSP00000270747:S743L	S	-	2	0	ARHGEF19	16398255	0.990000	0.36364	1.000000	0.80357	0.989000	0.77384	2.297000	0.43593	2.395000	0.81488	0.561000	0.74099	TCA	ARHGEF19	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000142632		0.572	ARHGEF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF19	HGNC	protein_coding	OTTHUMT00000006289.1	227	0.00	0	G	NM_153213		16525668	16525668	-1	no_errors	ENST00000270747	ensembl	human	known	69_37n	missense	114	25.00	38	SNP	1.000	A
ARID1B	57492	genome.wustl.edu	37	6	157528895	157528895	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr6:157528895G>A	ENST00000350026.5	+	19	6582	c.6581G>A	c.(6580-6582)aGa>aAa	p.R2194K	ARID1B_ENST00000275248.4_Missense_Mutation_p.R2189K|ARID1B_ENST00000367148.1_Missense_Mutation_p.R2247K|ARID1B_ENST00000346085.5_Missense_Mutation_p.R2207K	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	2194					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GCCATGGCCAGAGTGGACGAA	0.567																																						dbGAP											0													113.0	109.0	110.0					6																	157528895		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.6581G>A	6.37:g.157528895G>A	ENSP00000055163:p.Arg2194Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.R2247K	ENST00000350026.5	37	c.6740	CCDS5251.2	6	.	.	.	.	.	.	.	.	.	.	G	10.09	1.255234	0.22965	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64	5.61	5.61	0.85477	Armadillo-like helical (1);	0.045629	0.85682	D	0.000000	T	0.06508	0.0167	N	0.00864	-1.135	0.39385	D	0.966329	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.12156	0.003;0.007;0.004	T	0.34700	-0.9818	10	0.02654	T	1	.	13.2374	0.59976	0.0725:0.0:0.9275:0.0	.	2194;2207;2189	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	K	2207;2194;2247;2189;1716	ENSP00000344546:R2207K;ENSP00000055163:R2194K;ENSP00000356116:R2247K;ENSP00000275248:R2189K;ENSP00000412835:R1716K	ENSP00000275248:R2189K	R	+	2	0	ARID1B	157570587	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	4.600000	0.61083	2.793000	0.96121	0.655000	0.94253	AGA	ARID1B	-	superfamily_ARM-type_fold	ENSG00000049618		0.567	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	108	0.00	0	G	NM_020732		157528895	157528895	+1	no_errors	ENST00000367148	ensembl	human	known	69_37n	missense	52	25.71	18	SNP	0.995	A
ARID4B	51742	genome.wustl.edu	37	1	235345497	235345497	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:235345497C>G	ENST00000264183.3	-	20	3234	c.2737G>C	c.(2737-2739)Gat>Cat	p.D913H	ARID4B_ENST00000494543.1_5'Flank|ARID4B_ENST00000349213.3_Missense_Mutation_p.D827H|ARID4B_ENST00000366603.2_Missense_Mutation_p.D913H	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	913					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			AGTCTTTCATCAGAGTTATTT	0.373																																						dbGAP											0													75.0	81.0	79.0					1																	235345497		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.2737G>C	1.37:g.235345497C>G	ENSP00000264183:p.Asp913His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	pfam_RBB1NT,pfam_ARID/BRIGHT_DNA-bd,pfam_Tudor-knot,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Chromodomain-like,smart_Tudor,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.D913H	ENST00000264183.3	37	c.2737	CCDS31061.1	1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909527	0.72868	.	.	ENSG00000054267	ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183	T;T;T	0.27557	1.66;1.68;1.68	5.63	5.63	0.86233	.	0.355993	0.35262	N	0.003339	T	0.42337	0.1198	N	0.14661	0.345	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.91635	0.999;0.998;0.999;0.921	T	0.48917	-0.8992	10	0.72032	D	0.01	-20.397	19.6767	0.95936	0.0:1.0:0.0:0.0	.	594;913;827;913	Q4LE39-4;Q4LE39-3;Q4LE39-2;Q4LE39	.;.;.;ARI4B_HUMAN	H	913;827;913;913	ENSP00000264184:D827H;ENSP00000355562:D913H;ENSP00000264183:D913H	ENSP00000264183:D913H	D	-	1	0	ARID4B	233412120	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.757000	0.68766	2.654000	0.90174	0.585000	0.79938	GAT	ARID4B	-	NULL	ENSG00000054267		0.373	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4B	HGNC	protein_coding	OTTHUMT00000095566.3	114	0.00	0	C	NM_016374		235345497	235345497	-1	no_errors	ENST00000264183	ensembl	human	known	69_37n	missense	191	14.35	32	SNP	1.000	G
ATP10B	23120	genome.wustl.edu	37	5	160076224	160076224	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr5:160076224C>T	ENST00000327245.5	-	8	1561	c.715G>A	c.(715-717)Gtg>Atg	p.V239M		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	239					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.V239M(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCTCACACACGATGGTATTG	0.408																																						dbGAP											1	Substitution - Missense(1)	lung(1)											184.0	179.0	180.0					5																	160076224		1875	4104	5979	-	-	-	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.715G>A	5.37:g.160076224C>T	ENSP00000313600:p.Val239Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.V239M	ENST00000327245.5	37	c.715	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566368	0.65651	.	.	ENSG00000118322	ENST00000327245	T	0.74842	-0.88	5.63	4.77	0.60923	ATPase, P-type, ATPase-associated domain (1);	0.072732	0.53938	D	0.000042	D	0.84079	0.5393	M	0.74258	2.255	0.44085	D	0.996848	D;D;D;D	0.89917	0.997;0.987;0.996;1.0	D;P;P;D	0.70227	0.922;0.753;0.872;0.968	D	0.84527	0.0631	9	.	.	.	.	12.418	0.55504	0.0:0.9193:0.0:0.0807	.	283;239;211;239	B4DHG1;O94823-2;O94823-3;O94823	.;.;.;AT10B_HUMAN	M	239	ENSP00000313600:V239M	.	V	-	1	0	ATP10B	160008802	0.990000	0.36364	1.000000	0.80357	0.998000	0.95712	2.887000	0.48586	1.390000	0.46547	0.655000	0.94253	GTG	ATP10B	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000118322		0.408	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	493	0.00	0	C	NM_025153		160076224	160076224	-1	no_errors	ENST00000327245	ensembl	human	known	69_37n	missense	391	21.80	109	SNP	1.000	T
BAIAP2L1	55971	genome.wustl.edu	37	7	97937087	97937087	+	Silent	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr7:97937087G>C	ENST00000005260.8	-	10	1292	c.1077C>G	c.(1075-1077)ctC>ctG	p.L359L	RP4-607J23.2_ENST00000608882.1_RNA|RP4-607J23.2_ENST00000609873.1_RNA|BAIAP2L1_ENST00000462558.1_5'Flank	NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	359	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			GTGCAAAGCTGAGTAAGGTCT	0.537																																						dbGAP											0													208.0	153.0	172.0					7																	97937087		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.1077C>G	7.37:g.97937087G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	Silent	SNP	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.L359	ENST00000005260.8	37	c.1077	CCDS34687.1	7																																																																																			BAIAP2L1	-	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000006453		0.537	BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAIAP2L1	HGNC	protein_coding	OTTHUMT00000334681.1	414	0.00	0	G	NM_018842		97937087	97937087	-1	no_errors	ENST00000005260	ensembl	human	known	69_37n	silent	209	24.73	69	SNP	0.088	C
BANK1	55024	genome.wustl.edu	37	4	102946639	102946639	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr4:102946639C>A	ENST00000322953.4	+	9	1841	c.1567C>A	c.(1567-1569)Ctg>Atg	p.L523M	RP11-498M5.2_ENST00000505091.1_RNA|BANK1_ENST00000510950.1_3'UTR|BANK1_ENST00000504592.1_Missense_Mutation_p.L508M|BANK1_ENST00000428908.1_Missense_Mutation_p.L390M|BANK1_ENST00000444316.2_Missense_Mutation_p.L493M|BANK1_ENST00000508653.1_Missense_Mutation_p.L390M	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	523					B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TGCCTTCCAACTGGAAAGACC	0.443																																						dbGAP											0													54.0	55.0	55.0					4																	102946639		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.1567C>A	4.37:g.102946639C>A	ENSP00000320509:p.Leu523Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.L523M	ENST00000322953.4	37	c.1567	CCDS34038.1	4	.	.	.	.	.	.	.	.	.	.	C	14.73	2.621270	0.46736	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17	4.8	3.89	0.44902	.	0.861744	0.09733	N	0.762903	T	0.54431	0.1858	L	0.50333	1.59	0.09310	N	1	B;B;B	0.32101	0.356;0.356;0.356	B;B;B	0.35182	0.197;0.197;0.197	T	0.49283	-0.8956	10	0.46703	T	0.11	.	11.2381	0.48953	0.1824:0.8176:0.0:0.0	.	390;523;508	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	M	508;523;390;390;493	ENSP00000421443:L508M;ENSP00000320509:L523M;ENSP00000412748:L390M;ENSP00000422314:L390M;ENSP00000388817:L493M	ENSP00000320509:L523M	L	+	1	2	BANK1	103165662	0.001000	0.12720	0.059000	0.19551	0.165000	0.22458	1.164000	0.31810	2.222000	0.72286	0.591000	0.81541	CTG	BANK1	-	NULL	ENSG00000153064		0.443	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BANK1	HGNC	protein_coding	OTTHUMT00000363161.1	142	0.00	0	C	NM_017935		102946639	102946639	+1	no_errors	ENST00000322953	ensembl	human	known	69_37n	missense	61	39.81	41	SNP	0.220	A
BAZ2B	29994	genome.wustl.edu	37	2	160257133	160257133	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr2:160257133G>C	ENST00000392783.2	-	17	3370	c.2875C>G	c.(2875-2877)Ctt>Gtt	p.L959V	BAZ2B_ENST00000355831.2_Missense_Mutation_p.L925V|BAZ2B_ENST00000392782.1_Missense_Mutation_p.L923V|AC008277.1_ENST00000420020.1_RNA|AC008277.1_ENST00000594921.1_RNA|AC008277.1_ENST00000608714.1_RNA|BAZ2B_ENST00000343439.5_Missense_Mutation_p.L859V	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	959	Lys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TGAGCTCGAAGTTCTTTTTCC	0.259																																						dbGAP											0													55.0	48.0	50.0					2																	160257133		1782	4055	5837	-	-	-	SO:0001583	missense	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.2875C>G	2.37:g.160257133G>C	ENSP00000376534:p.Leu959Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_integrase-typ,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.L959V	ENST00000392783.2	37	c.2875	CCDS2209.2	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.1|23.1	4.379683|4.379683	0.82682|0.82682	.|.	.|.	ENSG00000123636|ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439|ENST00000294905	T;T;T;D|.	0.85088|.	1.9;1.9;1.9;-1.94|.	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	0.000000|.	0.33346|.	U|.	0.005020|.	T|T	0.69043|0.69043	0.3067|0.3067	L|L	0.46157|0.46157	1.445|1.445	0.58432|0.58432	D|D	0.999993|0.999993	P;D;D|.	0.67145|.	0.902;0.996;0.968|.	B;D;P|.	0.80764|.	0.439;0.994;0.507|.	T|T	0.65360|0.65360	-0.6187|-0.6187	10|5	0.28530|.	T|.	0.3|.	-8.802|-8.802	18.9988|18.9988	0.92824|0.92824	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	859;923;959|.	Q9UIF8-2;Q9UIF8-5;Q9UIF8|.	.;.;BAZ2B_HUMAN|.	V|S	923;959;925;859|10	ENSP00000376533:L923V;ENSP00000376534:L959V;ENSP00000348087:L925V;ENSP00000339670:L859V|.	ENSP00000339670:L859V|.	L|T	-|-	1|2	0|0	BAZ2B|BAZ2B	159965379|159965379	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.415000|7.415000	0.80131|0.80131	2.465000|2.465000	0.83290|0.83290	0.585000|0.585000	0.79938|0.79938	CTT|ACT	BAZ2B	-	NULL	ENSG00000123636		0.259	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	194	0.00	0	G			160257133	160257133	-1	no_errors	ENST00000392783	ensembl	human	known	69_37n	missense	156	31.44	72	SNP	1.000	C
BRS3	680	genome.wustl.edu	37	X	135570328	135570328	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chrX:135570328G>T	ENST00000370648.3	+	1	283	c.55G>T	c.(55-57)Gac>Tac	p.D19Y	Z97632.1_ENST00000580943.1_RNA	NM_001727.1	NP_001718.1	P32247	BRS3_HUMAN	bombesin-like receptor 3	19					adult feeding behavior (GO:0008343)|glucose metabolic process (GO:0006006)|regulation of blood pressure (GO:0008217)	integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(1)	23	Acute lymphoblastic leukemia(192;0.000127)					AATCACAAATGACACAGAATC	0.388																																						dbGAP											0													90.0	78.0	82.0					X																	135570328		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14656.1	Xq26.3	2014-02-21			ENSG00000102239	ENSG00000102239		"""GPCR / Class A : Bombesin receptors"""	1113	protein-coding gene	gene with protein product		300107				8383682	Standard	NM_001727		Approved	BB3	uc004ezv.1	P32247	OTTHUMG00000022726	ENST00000370648.3:c.55G>T	X.37:g.135570328G>T	ENSP00000359682:p.Asp19Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Bombesin_rcpt_3,prints_Bombsn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.D19Y	ENST00000370648.3	37	c.55	CCDS14656.1	X	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047492	0.55110	.	.	ENSG00000102239	ENST00000370648	T	0.64803	-0.12	5.76	5.76	0.90799	.	0.251832	0.34603	N	0.003829	T	0.52805	0.1757	L	0.36672	1.1	0.35522	D	0.801518	P	0.44195	0.828	B	0.40782	0.34	T	0.65142	-0.6240	10	0.44086	T	0.13	-6.2801	12.3696	0.55248	0.0784:0.0:0.9216:0.0	.	19	P32247	BRS3_HUMAN	Y	19	ENSP00000359682:D19Y	ENSP00000359682:D19Y	D	+	1	0	BRS3	135397994	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.898000	0.48672	2.429000	0.82318	0.600000	0.82982	GAC	BRS3	-	prints_Bombesin_rcpt_3	ENSG00000102239		0.388	BRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRS3	HGNC	protein_coding	OTTHUMT00000059005.1	260	0.00	0	G	NM_001727		135570328	135570328	+1	no_errors	ENST00000370648	ensembl	human	known	69_37n	missense	194	26.79	71	SNP	1.000	T
TEX40	25858	genome.wustl.edu	37	11	64068205	64068205	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr11:64068205C>G	ENST00000328404.6	+	2	118	c.98C>G	c.(97-99)aCg>aGg	p.T33R	TEX40_ENST00000539943.1_5'UTR|RP11-783K16.10_ENST00000539086.1_RNA	NM_001039496.1	NP_001034585.1	Q9NTU4	TEX40_HUMAN	testis expressed 40	33					cell differentiation (GO:0030154)|male meiosis (GO:0007140)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)											CTGTGGACCACGACCACGCTG	0.642											OREG0021050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													14.0	16.0	15.0					11																	64068205		1999	4052	6051	-	-	-	SO:0001583	missense	0					11q13.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000219435	ENSG00000219435			19231	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 20"""	C11orf20			Standard	NM_001039496		Approved	DKFZP566E164	uc009ypm.3	Q9NTU4	OTTHUMG00000167820	ENST00000328404.6:c.98C>G	11.37:g.64068205C>G	ENSP00000330877:p.Thr33Arg	Somatic	1073	WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.T33R	ENST00000328404.6	37	c.98		11	.	.	.	.	.	.	.	.	.	.	C	16.54	3.151603	0.57151	.	.	ENSG00000219435	ENST00000328404	T	0.49139	0.79	4.23	-4.53	0.03462	.	.	.	.	.	T	0.24547	0.0595	N	0.17082	0.46	0.18873	N	0.999988	B	0.29432	0.244	B	0.31390	0.129	T	0.20042	-1.0287	9	0.44086	T	0.13	-4.971	2.1643	0.03833	0.4552:0.2687:0.1213:0.1548	.	33	Q9NTU4	CK020_HUMAN	R	33	ENSP00000330877:T33R	ENSP00000330877:T33R	T	+	2	0	C11orf20	63824781	0.003000	0.15002	0.008000	0.14137	0.109000	0.19521	-0.523000	0.06230	-0.927000	0.03766	0.561000	0.74099	ACG	C11orf20	-	NULL	ENSG00000219435		0.642	TEX40-201	KNOWN	basic|appris_principal	protein_coding	C11orf20	HGNC	protein_coding		53	0.00	0	C	NM_001039496		64068205	64068205	+1	no_errors	ENST00000328404	ensembl	human	known	69_37n	missense	24	33.33	12	SNP	0.063	G
TEX40	25858	genome.wustl.edu	37	11	64072038	64072038	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr11:64072038G>A	ENST00000328404.6	+	5	543	c.523G>A	c.(523-525)Gac>Aac	p.D175N	TEX40_ENST00000539943.1_Missense_Mutation_p.D133N|ESRRA_ENST00000406310.1_5'Flank|RP11-783K16.10_ENST00000539086.1_RNA|ESRRA_ENST00000405666.1_5'Flank|ESRRA_ENST00000000442.6_5'Flank	NM_001039496.1	NP_001034585.1	Q9NTU4	TEX40_HUMAN	testis expressed 40	175					cell differentiation (GO:0030154)|male meiosis (GO:0007140)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)											GATCGGCAGGGACCACTTCCT	0.597											OREG0021051	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													24.0	28.0	27.0					11																	64072038		2010	4170	6180	-	-	-	SO:0001583	missense	0					11q13.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000219435	ENSG00000219435			19231	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 20"""	C11orf20			Standard	NM_001039496		Approved	DKFZP566E164	uc009ypm.3	Q9NTU4	OTTHUMG00000167820	ENST00000328404.6:c.523G>A	11.37:g.64072038G>A	ENSP00000330877:p.Asp175Asn	Somatic	1073	WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.D175N	ENST00000328404.6	37	c.523		11	.	.	.	.	.	.	.	.	.	.	G	7.119	0.577515	0.13686	.	.	ENSG00000219435	ENST00000328404;ENST00000539943	T;T	0.45668	0.9;0.89	4.61	-0.577	0.11727	.	.	.	.	.	T	0.21590	0.0520	N	0.14661	0.345	0.09310	N	1	B	0.30146	0.27	B	0.32533	0.147	T	0.23226	-1.0194	9	0.26408	T	0.33	-9.6947	3.9591	0.09403	0.4286:0.1788:0.3925:0.0	.	175	Q9NTU4	CK020_HUMAN	N	175;133	ENSP00000330877:D175N;ENSP00000443917:D133N	ENSP00000330877:D175N	D	+	1	0	C11orf20	63828614	0.000000	0.05858	0.045000	0.18777	0.031000	0.12232	-0.530000	0.06179	-0.160000	0.11002	-0.305000	0.09177	GAC	C11orf20	-	NULL	ENSG00000219435		0.597	TEX40-201	KNOWN	basic|appris_principal	protein_coding	C11orf20	HGNC	protein_coding		114	0.86	1	G	NM_001039496		64072038	64072038	+1	no_errors	ENST00000328404	ensembl	human	known	69_37n	missense	46	23.33	14	SNP	0.091	A
C1QTNF7	114905	genome.wustl.edu	37	4	15444327	15444327	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr4:15444327C>G	ENST00000444304.2	+	3	1100	c.774C>G	c.(772-774)ttC>ttG	p.F258L	C1QTNF7_ENST00000429690.1_Missense_Mutation_p.F258L|C1QTNF7_ENST00000295297.4_Missense_Mutation_p.F265L			Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7	258	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	16						ATGGCCTCTTCTCAGACCCAG	0.468																																						dbGAP											0													81.0	88.0	85.0					4																	15444327		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF329839	CCDS3414.1, CCDS47025.1	4p15.3	2008-08-29			ENSG00000163145	ENSG00000163145			14342	protein-coding gene	gene with protein product							Standard	NM_001135170		Approved	CTRP7	uc003gnp.3	Q9BXJ2	OTTHUMG00000097095	ENST00000444304.2:c.774C>G	4.37:g.15444327C>G	ENSP00000388914:p.Phe258Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBT3|J3KPW3	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.F258L	ENST00000444304.2	37	c.774	CCDS3414.1	4	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996657	0.74818	.	.	ENSG00000163145	ENST00000295297;ENST00000429690;ENST00000444304	T;T;T	0.74106	-0.81;-0.81;-0.81	6.02	6.02	0.97574	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.056293	0.64402	D	0.000001	T	0.78477	0.4289	L	0.42245	1.32	0.51767	D	0.999939	D	0.69078	0.997	D	0.74348	0.983	T	0.76572	-0.2910	9	.	.	.	.	7.9153	0.29814	0.0:0.8146:0.0:0.1854	.	258	Q9BXJ2	C1QT7_HUMAN	L	265;258;258	ENSP00000295297:F265L;ENSP00000410722:F258L;ENSP00000388914:F258L	.	F	+	3	2	C1QTNF7	15053425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.634000	0.46528	2.865000	0.98341	0.655000	0.94253	TTC	C1QTNF7	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q	ENSG00000163145		0.468	C1QTNF7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	C1QTNF7	HGNC	protein_coding	OTTHUMT00000250891.2	131	0.00	0	C			15444327	15444327	+1	no_errors	ENST00000429690	ensembl	human	known	69_37n	missense	47	31.88	22	SNP	1.000	G
CFAP61	26074	genome.wustl.edu	37	20	20269469	20269469	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr20:20269469C>T	ENST00000245957.5	+	23	3089	c.3013C>T	c.(3013-3015)Cag>Tag	p.Q1005*	C20orf26_ENST00000377309.2_Intron	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		1005										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		AATTGGCTTTCAGCTGGCAGC	0.498																																						dbGAP											0													78.0	70.0	73.0					20																	20269469		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0																														ENST00000245957.5:c.3013C>T	20.37:g.20269469C>T	ENSP00000245957:p.Gln1005*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Nonsense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.Q1005*	ENST00000245957.5	37	c.3013	CCDS33447.1	20	.	.	.	.	.	.	.	.	.	.	C	40	8.343800	0.98769	.	.	ENSG00000089101	ENST00000343997;ENST00000389655;ENST00000245957	.	.	.	5.75	5.75	0.90469	.	0.215353	0.42964	D	0.000622	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	.	16.4258	0.83814	0.0:0.86:0.14:0.0	.	.	.	.	X	945;971;1005	.	ENSP00000245957:Q1005X	Q	+	1	0	C20orf26	20217469	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	4.053000	0.57427	2.732000	0.93576	0.650000	0.86243	CAG	C20orf26	-	NULL	ENSG00000089101		0.498	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	HGNC	protein_coding	OTTHUMT00000078228.3	193	0.00	0	C			20269469	20269469	+1	no_errors	ENST00000245957	ensembl	human	known	69_37n	nonsense	114	24.00	36	SNP	0.997	T
C2orf50	130813	genome.wustl.edu	37	2	11284204	11284204	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr2:11284204G>C	ENST00000381585.3	+	3	738	c.456G>C	c.(454-456)aaG>aaC	p.K152N	C2orf50_ENST00000405022.3_Missense_Mutation_p.K152N			Q96LR7	CB050_HUMAN	chromosome 2 open reading frame 50	152										breast(1)|large_intestine(1)|upper_aerodigestive_tract(1)	3	all_hematologic(175;0.0797)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.0997)|OV - Ovarian serous cystadenocarcinoma(76;0.134)		GGGCCCGGAAGAAGAAGCTGG	0.612																																						dbGAP											0													42.0	41.0	41.0					2																	11284204		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057872	CCDS1678.1	2p25.1	2012-08-02			ENSG00000150873	ENSG00000150873			26324	protein-coding gene	gene with protein product						12477932	Standard	NM_182500		Approved	FLJ25143	uc010yjj.1	Q96LR7	OTTHUMG00000119057	ENST00000381585.3:c.456G>C	2.37:g.11284204G>C	ENSP00000370997:p.Lys152Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9W3|D6W503	Missense_Mutation	SNP	NULL	p.K152N	ENST00000381585.3	37	c.456	CCDS1678.1	2	.	.	.	.	.	.	.	.	.	.	G	15.44	2.832840	0.50951	.	.	ENSG00000150873	ENST00000381585;ENST00000405022	.	.	.	4.23	3.33	0.38152	.	0.000000	0.64402	D	0.000006	T	0.70316	0.3210	M	0.79475	2.455	0.45439	D	0.998415	D	0.71674	0.998	D	0.66351	0.943	T	0.72858	-0.4165	9	0.72032	D	0.01	-0.8177	7.6818	0.28518	0.1948:0.0:0.8052:0.0	.	152	Q96LR7	CB050_HUMAN	N	152	.	ENSP00000370997:K152N	K	+	3	2	C2orf50	11201655	1.000000	0.71417	0.998000	0.56505	0.493000	0.33554	1.151000	0.31651	1.917000	0.55516	0.561000	0.74099	AAG	C2orf50	-	NULL	ENSG00000150873		0.612	C2orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf50	HGNC	protein_coding	OTTHUMT00000239268.1	78	0.00	0	G	NM_182500		11284204	11284204	+1	no_errors	ENST00000381585	ensembl	human	known	69_37n	missense	50	21.88	14	SNP	1.000	C
CASC3	22794	genome.wustl.edu	37	17	38296935	38296935	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr17:38296935G>C	ENST00000264645.7	+	1	360	c.134G>C	c.(133-135)aGc>aCc	p.S45T		NM_007359.4	NP_031385.2	O15234	CASC3_HUMAN	cancer susceptibility candidate 3	45	Poly-Gly.				gene expression (GO:0010467)|intracellular mRNA localization (GO:0008298)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	16						ggcggcggcagcggcTCTCTG	0.721																																						dbGAP											0													5.0	8.0	7.0					17																	38296935		1990	3957	5947	-	-	-	SO:0001583	missense	0			X80199	CCDS11362.1	17q21.1	2012-09-20			ENSG00000108349	ENSG00000108349			17040	protein-coding gene	gene with protein product		606504				7490069, 18332872	Standard	NM_007359		Approved	MLN51, BTZ	uc002hue.3	O15234	OTTHUMG00000133323	ENST00000264645.7:c.134G>C	17.37:g.38296935G>C	ENSP00000264645:p.Ser45Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8R0	Missense_Mutation	SNP	pfam_Btz_dom	p.S45T	ENST00000264645.7	37	c.134	CCDS11362.1	17	.	.	.	.	.	.	.	.	.	.	g	18.13	3.554531	0.65425	.	.	ENSG00000108349	ENST00000264645;ENST00000418132;ENST00000394114	.	.	.	4.91	3.92	0.45320	.	0.530502	0.18802	N	0.130768	T	0.24198	0.0586	N	0.08118	0	0.24428	N	0.99459	B;B	0.22851	0.076;0.016	B;B	0.24006	0.05;0.021	T	0.16928	-1.0386	9	0.38643	T	0.18	-8.0501	11.763	0.51914	0.0:0.0:0.8233:0.1767	.	45;45	B4DKR6;O15234	.;CASC3_HUMAN	T	45	.	ENSP00000264645:S45T	S	+	2	0	CASC3	35550461	0.960000	0.32886	1.000000	0.80357	0.963000	0.63663	2.493000	0.45320	1.253000	0.44018	0.556000	0.70494	AGC	CASC3	-	NULL	ENSG00000108349		0.721	CASC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASC3	HGNC	protein_coding	OTTHUMT00000257127.3	13	0.00	0	G	NM_007359		38296935	38296935	+1	no_errors	ENST00000264645	ensembl	human	known	69_37n	missense	5	50.00	5	SNP	0.998	C
CCDC84	338657	genome.wustl.edu	37	11	118885784	118885784	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr11:118885784C>G	ENST00000334418.1	+	9	852	c.796C>G	c.(796-798)Ctt>Gtt	p.L266V	RPS25_ENST00000528547.1_5'Flank	NM_198489.1	NP_940891.1	Q86UT8	CCD84_HUMAN	coiled-coil domain containing 84	266										breast(1)|kidney(1)|large_intestine(1)|liver(1)|ovary(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		TGAAGAATTTCTTAAAGAAAG	0.393																																						dbGAP											0													90.0	100.0	97.0					11																	118885784		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB094093	CCDS8405.1	11q23.3	2006-03-13			ENSG00000186166	ENSG00000186166			30460	protein-coding gene	gene with protein product							Standard	NM_198489		Approved	DLNB14	uc001pul.3	Q86UT8	OTTHUMG00000166348	ENST00000334418.1:c.796C>G	11.37:g.118885784C>G	ENSP00000334767:p.Leu266Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.L266V	ENST00000334418.1	37	c.796	CCDS8405.1	11	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347803	0.61183	.	.	ENSG00000186166	ENST00000334418	T	0.45668	0.89	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.61974	0.2390	L	0.51422	1.61	0.49687	D	0.999818	D	0.71674	0.998	D	0.83275	0.996	T	0.56643	-0.7945	10	0.45353	T	0.12	-10.0882	20.3213	0.98679	0.0:1.0:0.0:0.0	.	266	Q86UT8	CCD84_HUMAN	V	266	ENSP00000334767:L266V	ENSP00000334767:L266V	L	+	1	0	CCDC84	118390994	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.296000	0.59055	2.810000	0.96702	0.650000	0.86243	CTT	CCDC84	-	NULL	ENSG00000186166		0.393	CCDC84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC84	HGNC	protein_coding	OTTHUMT00000389315.1	91	0.00	0	C	NM_198489		118885784	118885784	+1	no_errors	ENST00000334418	ensembl	human	known	69_37n	missense	103	25.90	36	SNP	1.000	G
CD1E	913	genome.wustl.edu	37	1	158325653	158325653	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:158325653C>G	ENST00000368167.3	+	4	901	c.662C>G	c.(661-663)cCt>cGt	p.P221R	CD1E_ENST00000368160.3_Missense_Mutation_p.P221R|CD1E_ENST00000368166.3_Missense_Mutation_p.P32R|CD1E_ENST00000452291.2_Missense_Mutation_p.P32R|CD1E_ENST00000434258.1_Missense_Mutation_p.P219R|CD1E_ENST00000368165.3_Missense_Mutation_p.P131R|CD1E_ENST00000368157.1_Missense_Mutation_p.P32R|CD1E_ENST00000368163.3_Missense_Mutation_p.P221R|CD1E_ENST00000444681.2_Missense_Mutation_p.P122R|CD1E_ENST00000368156.1_Missense_Mutation_p.P131R|CD1E_ENST00000368164.3_Missense_Mutation_p.P32R|CD1E_ENST00000368154.1_Missense_Mutation_p.P32R|CD1E_ENST00000368161.3_Missense_Mutation_p.P221R|CD1E_ENST00000368155.3_Missense_Mutation_p.P131R	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	221	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					GGCCCCAGTCCTGGCCCTGGC	0.577																																						dbGAP											0													44.0	45.0	45.0					1																	158325653		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.662C>G	1.37:g.158325653C>G	ENSP00000357149:p.Pro221Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.P221R	ENST00000368167.3	37	c.662	CCDS41417.1	1	.	.	.	.	.	.	.	.	.	.	C	9.259	1.042792	0.19748	.	.	ENSG00000158488	ENST00000434258;ENST00000444681;ENST00000368167;ENST00000452291;ENST00000368165;ENST00000368166;ENST00000368163;ENST00000368164;ENST00000368157;ENST00000368160;ENST00000368161;ENST00000368156;ENST00000368155;ENST00000368154	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.44881	2.6;2.6;2.6;2.6;3.29;2.6;2.6;0.91;2.6;2.6;3.78;3.48;3.62;0.99	4.51	3.58	0.41010	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);	0.147790	0.32055	N	0.006644	T	0.54464	0.1860	M	0.89715	3.055	0.09310	N	1	P;P;P;P;B;D;B;B;B;B;B;B;B;P;D	0.76494	0.554;0.883;0.954;0.536;0.161;0.999;0.053;0.149;0.202;0.393;0.365;0.018;0.062;0.822;0.957	B;P;P;B;B;D;B;B;B;B;B;B;B;B;P	0.66351	0.44;0.659;0.642;0.247;0.177;0.943;0.03;0.105;0.103;0.217;0.203;0.062;0.092;0.287;0.903	T	0.51694	-0.8673	10	0.51188	T	0.08	-10.0152	10.7457	0.46179	0.0:0.8077:0.1923:0.0	.	32;122;219;122;131;131;32;32;221;221;221;32;32;131;221	B4E057;B4E042;E7ET31;E7EP01;P15812-5;P15812-7;P15812-9;P15812-10;P15812-2;P15812;P15812-3;P15812-8;P15812-11;P15812-6;P15812-4	.;.;.;.;.;.;.;.;.;CD1E_HUMAN;.;.;.;.;.	R	219;122;221;32;131;32;221;32;32;221;221;131;131;32	ENSP00000401957:P219R;ENSP00000402906:P122R;ENSP00000357149:P221R;ENSP00000416228:P32R;ENSP00000357147:P131R;ENSP00000357148:P32R;ENSP00000357145:P221R;ENSP00000357146:P32R;ENSP00000357139:P32R;ENSP00000357142:P221R;ENSP00000357143:P221R;ENSP00000357138:P131R;ENSP00000357137:P131R;ENSP00000357136:P32R	ENSP00000357136:P32R	P	+	2	0	CD1E	156592277	0.010000	0.17322	0.035000	0.18076	0.674000	0.39518	2.018000	0.40991	1.246000	0.43901	0.563000	0.77884	CCT	CD1E	-	pfscan_Ig-like	ENSG00000158488		0.577	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD1E	HGNC	protein_coding	OTTHUMT00000046353.3	245	0.00	0	C	NM_030893		158325653	158325653	+1	no_errors	ENST00000368167	ensembl	human	known	69_37n	missense	162	19.00	38	SNP	0.057	G
CDC5L	988	genome.wustl.edu	37	6	44358031	44358031	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr6:44358031G>A	ENST00000371477.3	+	2	371	c.72G>A	c.(70-72)atG>atA	p.M24I		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	24	HTH myb-type 1. {ECO:0000255|PROSITE- ProRule:PRU00625}.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CAGCGGTAATGAAATATGGGA	0.358																																						dbGAP											0													84.0	87.0	86.0					6																	44358031		2203	4300	6503	-	-	-	SO:0001583	missense	0			D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.72G>A	6.37:g.44358031G>A	ENSP00000360532:p.Met24Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q76N46|Q99974	Missense_Mutation	SNP	pfam_DUF3351,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.M24I	ENST00000371477.3	37	c.72	CCDS4912.1	6	.	.	.	.	.	.	.	.	.	.	g	32	5.169138	0.94768	.	.	ENSG00000096401	ENST00000371477	T	0.48522	0.81	5.51	5.51	0.81932	Transcription regulator HTH, Myb-type, DNA-binding (1);Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);	0.000000	0.85682	D	0.000000	T	0.53948	0.1828	L	0.35414	1.06	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.58086	-0.7698	10	0.72032	D	0.01	-16.5234	19.4368	0.94799	0.0:0.0:1.0:0.0	.	24	Q99459	CDC5L_HUMAN	I	24	ENSP00000360532:M24I	ENSP00000360532:M24I	M	+	3	0	CDC5L	44466009	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.758000	0.98927	2.611000	0.88343	0.645000	0.84053	ATG	CDC5L	-	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	ENSG00000096401		0.358	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC5L	HGNC	protein_coding	OTTHUMT00000040743.1	398	0.00	0	G			44358031	44358031	+1	no_errors	ENST00000371477	ensembl	human	known	69_37n	missense	326	22.93	97	SNP	1.000	A
CDHR1	92211	genome.wustl.edu	37	10	85962805	85962805	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr10:85962805G>A	ENST00000372117.3	+	8	812	c.709G>A	c.(709-711)Gag>Aag	p.E237K	CDHR1_ENST00000440770.2_5'UTR|CDHR1_ENST00000332904.3_Missense_Mutation_p.E237K	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	237	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						GGTCAATGTGGAGGATGTTCA	0.607																																						dbGAP											0													260.0	189.0	213.0					10																	85962805		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.709G>A	10.37:g.85962805G>A	ENSP00000361189:p.Glu237Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YZ8|Q8IXY5	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E237K	ENST00000372117.3	37	c.709	CCDS7372.1	10	.	.	.	.	.	.	.	.	.	.	G	9.992	1.231173	0.22626	.	.	ENSG00000148600	ENST00000332904;ENST00000372117	T;T	0.52754	0.65;0.65	4.93	4.93	0.64822	Cadherin (5);Cadherin-like (1);	0.316403	0.33938	N	0.004410	T	0.39358	0.1075	L	0.46157	1.445	0.80722	D	1	B;B	0.33841	0.118;0.428	B;B	0.33254	0.156;0.16	T	0.24512	-1.0158	10	0.06494	T	0.89	-24.8065	17.1298	0.86724	0.0:0.0:1.0:0.0	.	237;237	Q96JP9-2;Q96JP9	.;CDHR1_HUMAN	K	237	ENSP00000331063:E237K;ENSP00000361189:E237K	ENSP00000331063:E237K	E	+	1	0	CDHR1	85952785	1.000000	0.71417	1.000000	0.80357	0.673000	0.39480	3.495000	0.53280	2.581000	0.87130	0.555000	0.69702	GAG	CDHR1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000148600		0.607	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR1	HGNC	protein_coding	OTTHUMT00000049111.1	498	0.20	1	G	NM_033100		85962805	85962805	+1	no_errors	ENST00000372117	ensembl	human	known	69_37n	missense	261	19.38	63	SNP	1.000	A
CEACAM18	729767	genome.wustl.edu	37	19	51983701	51983701	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr19:51983701T>A	ENST00000396477.4	+	2	188	c.167T>A	c.(166-168)gTt>gAt	p.V56D	CEACAM18_ENST00000451626.1_Missense_Mutation_p.V117D	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18	56										breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CCTGAGGATGTTCAGGAATAC	0.562																																						dbGAP											0													59.0	58.0	58.0					19																	51983701		2022	4180	6202	-	-	-	SO:0001583	missense	0					19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.167T>A	19.37:g.51983701T>A	ENSP00000379738:p.Val56Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JN24	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V117D	ENST00000396477.4	37	c.350		19	.	.	.	.	.	.	.	.	.	.	.	12.49	1.954385	0.34471	.	.	ENSG00000213822	ENST00000451626;ENST00000451086;ENST00000396477	T	0.65549	-0.16	2.79	-3.87	0.04218	Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65964	0.2742	M	0.74881	2.28	0.09310	N	0.999997	P	0.42248	0.774	P	0.48873	0.593	T	0.64296	-0.6441	9	0.87932	D	0	-2.777	9.3296	0.38014	0.0:0.6389:0.0:0.3611	.	117	A8MTB9	CEA18_HUMAN	D	117;56;56	ENSP00000402203:V117D	ENSP00000379738:V56D	V	+	2	0	CEACAM18	56675513	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	-0.582000	0.05814	-1.005000	0.03417	-0.296000	0.09543	GTT	CEACAM18	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000213822		0.562	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	CEACAM18	HGNC	protein_coding	OTTHUMT00000323114.2	265	0.00	0	T			51983701	51983701	+1	no_errors	ENST00000451626	ensembl	human	known	69_37n	missense	154	23.38	47	SNP	0.000	A
CENPO	79172	genome.wustl.edu	37	2	25040616	25040616	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr2:25040616C>T	ENST00000380834.2	+	7	1269	c.844C>T	c.(844-846)Caa>Taa	p.Q282*	CENPO_ENST00000395845.2_3'UTR|CENPO_ENST00000473706.1_Nonsense_Mutation_p.Q276*|CENPO_ENST00000260662.1_Nonsense_Mutation_p.Q282*			Q9BU64	CENPO_HUMAN	centromere protein O	282					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GCCCTTGCATCAAGTGTTTGC	0.413																																						dbGAP											0													117.0	112.0	114.0					2																	25040616		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK027859	CCDS1714.1, CCDS56113.1	2p23.3	2013-11-05			ENSG00000138092	ENSG00000138092			28152	protein-coding gene	gene with protein product		611504				16622420, 16622419	Standard	NM_024322		Approved	MGC11266, CENP-O	uc002rfp.2	Q9BU64	OTTHUMG00000125525	ENST00000380834.2:c.844C>T	2.37:g.25040616C>T	ENSP00000370214:p.Gln282*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDC0|D6W536|Q53T55|Q96JV3	Nonsense_Mutation	SNP	pfam_Centromere_CenpO	p.Q282*	ENST00000380834.2	37	c.844	CCDS1714.1	2	.	.	.	.	.	.	.	.	.	.	C	15.86	2.959216	0.53400	.	.	ENSG00000138092	ENST00000380834;ENST00000473706;ENST00000260662	.	.	.	5.27	-0.538	0.11868	.	0.988359	0.08235	N	0.976919	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.1804	12.5404	0.56167	0.6041:0.3959:0.0:0.0	.	.	.	.	X	282;276;282	.	ENSP00000260662:Q282X	Q	+	1	0	CENPO	24894120	0.009000	0.17119	0.211000	0.23655	0.704000	0.40688	0.549000	0.23329	-0.045000	0.13468	0.655000	0.94253	CAA	CENPO	-	NULL	ENSG00000138092		0.413	CENPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPO	HGNC	protein_coding	OTTHUMT00000246856.2	383	0.00	0	C	NM_024322		25040616	25040616	+1	no_errors	ENST00000260662	ensembl	human	known	69_37n	nonsense	242	22.86	72	SNP	0.009	T
COL23A1	91522	genome.wustl.edu	37	5	177669088	177669088	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr5:177669088C>G	ENST00000390654.3	-	27	1893	c.1536G>C	c.(1534-1536)caG>caC	p.Q512H		NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	512	Collagen-like 5.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		GCTCGCCCTTCTGGCCCTTCA	0.657																																						dbGAP											0													15.0	20.0	18.0					5																	177669088		1923	4080	6003	-	-	-	SO:0001583	missense	0			AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.1536G>C	5.37:g.177669088C>G	ENSP00000375069:p.Gln512His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVR4|Q9NT93	Missense_Mutation	SNP	pfam_Collagen	p.Q512H	ENST00000390654.3	37	c.1536	CCDS4436.1	5	.	.	.	.	.	.	.	.	.	.	C	15.05	2.719097	0.48622	.	.	ENSG00000050767	ENST00000390654	D	0.93366	-3.21	4.59	4.59	0.56863	.	0.187316	0.35436	N	0.003213	D	0.88511	0.6456	L	0.29908	0.895	0.35704	D	0.815863	B	0.26483	0.15	B	0.24006	0.05	D	0.89923	0.4060	10	0.72032	D	0.01	-10.7596	12.914	0.58195	0.0:1.0:0.0:0.0	.	512	Q86Y22	CONA1_HUMAN	H	512	ENSP00000375069:Q512H	ENSP00000375069:Q512H	Q	-	3	2	COL23A1	177601694	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	1.966000	0.40481	2.095000	0.63458	0.455000	0.32223	CAG	COL23A1	-	pfam_Collagen	ENSG00000050767		0.657	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL23A1	HGNC	protein_coding	OTTHUMT00000253475.1	105	0.00	0	C	NM_173465		177669088	177669088	-1	no_errors	ENST00000390654	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	1.000	G
CORO2A	7464	genome.wustl.edu	37	9	100890527	100890527	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr9:100890527C>T	ENST00000343933.5	-	10	1353	c.1096G>A	c.(1096-1098)Gag>Aag	p.E366K	CORO2A_ENST00000375077.4_Missense_Mutation_p.E366K	NM_003389.3	NP_003380.3	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	366					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	actin cytoskeleton (GO:0015629)|transcriptional repressor complex (GO:0017053)	actin filament binding (GO:0051015)			endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|skin(4)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				TATATGTCCTCTTGGTAGGAT	0.597																																						dbGAP											0													175.0	184.0	181.0					9																	100890527		2203	4300	6503	-	-	-	SO:0001583	missense	0			U57057	CCDS6735.1	9q22.3	2013-01-10	2001-11-28		ENSG00000106789	ENSG00000106789		"""Coronins"", ""WD repeat domain containing"""	2255	protein-coding gene	gene with protein product	"""coronin 2A"", ""coronin-like protein B"", ""WD protein IR10"", ""WD-repeat protein 2"""	602159	"""coronin, actin-binding protein, 2A"""			8985118	Standard	NM_052820		Approved	IR10, WDR2	uc004aym.3	Q92828	OTTHUMG00000020340	ENST00000343933.5:c.1096G>A	9.37:g.100890527C>T	ENSP00000343746:p.Glu366Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBR5|Q92829|Q9BWS5	Missense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E366K	ENST00000343933.5	37	c.1096	CCDS6735.1	9	.	.	.	.	.	.	.	.	.	.	C	24.3	4.514349	0.85389	.	.	ENSG00000106789	ENST00000343933;ENST00000375077	T;T	0.32023	1.47;1.47	4.74	3.84	0.44239	Domain of unknown function DUF1900 (1);	0.049369	0.85682	D	0.000000	T	0.51958	0.1705	M	0.78223	2.4	0.58432	D	0.999994	D	0.57571	0.98	D	0.64321	0.924	T	0.54833	-0.8234	10	0.46703	T	0.11	-32.5467	12.3552	0.55171	0.0:0.916:0.0:0.084	.	366	Q92828	COR2A_HUMAN	K	366	ENSP00000343746:E366K;ENSP00000364218:E366K	ENSP00000343746:E366K	E	-	1	0	CORO2A	99930348	1.000000	0.71417	0.999000	0.59377	0.859000	0.49053	7.202000	0.77856	1.355000	0.45865	0.561000	0.74099	GAG	CORO2A	-	pfam_DUF1900	ENSG00000106789		0.597	CORO2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO2A	HGNC	protein_coding	OTTHUMT00000053357.1	425	0.23	1	C	NM_003389		100890527	100890527	-1	no_errors	ENST00000343933	ensembl	human	known	69_37n	missense	270	24.09	86	SNP	1.000	T
CPZ	8532	genome.wustl.edu	37	4	8607783	8607783	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr4:8607783C>G	ENST00000360986.4	+	5	951	c.777C>G	c.(775-777)atC>atG	p.I259M	CPZ_ENST00000429646.2_5'UTR|CPZ_ENST00000382480.2_Missense_Mutation_p.I122M|CPZ_ENST00000315782.6_Missense_Mutation_p.I248M	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	259					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						AGATGCTCATCTACCTAGCCC	0.602																																						dbGAP											0													144.0	113.0	124.0					4																	8607783		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.777C>G	4.37:g.8607783C>G	ENSP00000354255:p.Ile259Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O00520|Q96MX2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Frizzled_dom,superfamily_Frizzled_dom,superfamily_CarboxyPept-like_regulatory,smart_Frizzled_dom,smart_Peptidase_M14,pfscan_Frizzled_dom,prints_Peptidase_M14	p.I259M	ENST00000360986.4	37	c.777	CCDS33953.1	4	.	.	.	.	.	.	.	.	.	.	c	14.85	2.657018	0.47467	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782	T;T;T	0.11169	2.8;2.8;2.8	3.41	2.54	0.30619	Peptidase M14, carboxypeptidase A (1);	0.130644	0.48767	N	0.000161	T	0.21509	0.0518	L	0.58302	1.8	0.80722	D	1	P;P	0.52170	0.951;0.931	P;P	0.61003	0.853;0.882	T	0.00597	-1.1652	10	0.87932	D	0	-19.4443	7.2382	0.26082	0.3504:0.4983:0.1513:0.0	.	248;259	Q66K79-2;Q66K79	.;CBPZ_HUMAN	M	259;122;248	ENSP00000354255:I259M;ENSP00000371920:I122M;ENSP00000315074:I248M	ENSP00000315074:I248M	I	+	3	3	CPZ	8658683	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	1.092000	0.30927	0.622000	0.30249	-0.532000	0.04303	ATC	CPZ	-	pfam_Peptidase_M14	ENSG00000109625		0.602	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPZ	HGNC	protein_coding	OTTHUMT00000207001.4	262	0.38	1	C	NM_003652		8607783	8607783	+1	no_errors	ENST00000360986	ensembl	human	known	69_37n	missense	84	40.00	56	SNP	1.000	G
CUBN	8029	genome.wustl.edu	37	10	16955917	16955917	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr10:16955917G>A	ENST00000377833.4	-	48	7491	c.7426C>T	c.(7426-7428)Cgg>Tgg	p.R2476W		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2476	CUB 18. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCGCAGATCCGGCCATGAGGA	0.532																																						dbGAP											0													113.0	107.0	109.0					10																	16955917		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.7426C>T	10.37:g.16955917G>A	ENSP00000367064:p.Arg2476Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.R2476W	ENST00000377833.4	37	c.7426	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	G	13.20	2.165155	0.38217	.	.	ENSG00000107611	ENST00000377833	T	0.28895	1.59	5.42	2.44	0.29823	CUB (5);	0.173875	0.27686	N	0.018262	T	0.32585	0.0834	M	0.76838	2.35	0.80722	D	1	B	0.20988	0.05	B	0.18561	0.022	T	0.11060	-1.0603	10	0.59425	D	0.04	.	8.2013	0.31426	0.0727:0.0:0.5311:0.3961	.	2476	O60494	CUBN_HUMAN	W	2476	ENSP00000367064:R2476W	ENSP00000367064:R2476W	R	-	1	2	CUBN	16995923	1.000000	0.71417	0.175000	0.22980	0.703000	0.40648	1.663000	0.37429	0.219000	0.20840	0.591000	0.81541	CGG	CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000107611		0.532	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	205	0.49	1	G	NM_001081		16955917	16955917	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	missense	172	16.50	34	SNP	0.962	A
DMC1	11144	genome.wustl.edu	37	22	38933603	38933603	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr22:38933603G>A	ENST00000216024.2	-	12	1106	c.830C>T	c.(829-831)aCt>aTt	p.T277I	DMC1_ENST00000428462.2_Missense_Mutation_p.T222I	NM_007068.2	NP_008999.2	Q14565	DMC1_HUMAN	DNA meiotic recombinase 1	277					female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|meiotic nuclear division (GO:0007126)|oocyte maturation (GO:0001556)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome (GO:0005694)|chromosome, telomeric region (GO:0000781)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11	Melanoma(58;0.0286)					TTACGTCATAGTTGCTCCTGG	0.373								Homologous recombination																														dbGAP											0													83.0	84.0	84.0					22																	38933603		2203	4300	6503	-	-	-	SO:0001583	missense	0			D63882	CCDS13973.1, CCDS63477.1	22q13.1	2013-05-02	2013-05-02		ENSG00000100206	ENSG00000100206			2927	protein-coding gene	gene with protein product		602721	"""DMC1 (dosage suppressor of mck1, yeast homolog) meiosis-specific homologous recombination"", ""DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)"""			8602360, 8590282, 17541404	Standard	NM_007068		Approved	LIM15	uc003avz.2	Q14565	OTTHUMG00000151088	ENST00000216024.2:c.830C>T	22.37:g.38933603G>A	ENSP00000216024:p.Thr277Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9A2|B4DMW6|Q08AI1|Q99498|Q9UH11	Missense_Mutation	SNP	pfam_DNA_recomb/repair_Rad51_C,pfam_DNA_recomb/repair_RecA,pfam_Circ_KaiC/RadA,superfamily_DNA_repair_Rad51/TF_NusA_a-hlx,smart_AAA+_ATPase,pirsf_DNA_recomb/repair_RecA-like,pfscan_DNA_recomb_RecA/RadB_ATP-bd,pfscan_RecA_monomer-monomer_interface,tigrfam_DMC1_rcmbase	p.T277I	ENST00000216024.2	37	c.830	CCDS13973.1	22	.	.	.	.	.	.	.	.	.	.	G	17.06	3.293283	0.60086	.	.	ENSG00000100206	ENST00000216024;ENST00000428462	T;T	0.64438	-0.1;-0.1	5.2	5.2	0.72013	ATPase, AAA+ type, core (1);DNA recombination and repair protein Rad51, C-terminal (1);DNA recombination/repair protein RecA, monomer-monomer interface (1);	0.124609	0.56097	D	0.000035	T	0.61763	0.2373	L	0.40543	1.245	0.45035	D	0.998053	B;B	0.17465	0.022;0.022	B;B	0.34779	0.189;0.189	T	0.62378	-0.6867	10	0.87932	D	0	-4.1691	16.9102	0.86139	0.0:0.0:1.0:0.0	.	222;277	B4DMW6;Q14565	.;DMC1_HUMAN	I	277;222	ENSP00000216024:T277I;ENSP00000412703:T222I	ENSP00000216024:T277I	T	-	2	0	DMC1	37263549	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.831000	0.69330	2.424000	0.82194	0.467000	0.42956	ACT	DMC1	-	pfam_DNA_recomb/repair_Rad51_C,pfam_DNA_recomb/repair_RecA,pfam_Circ_KaiC/RadA,smart_AAA+_ATPase,pirsf_DNA_recomb/repair_RecA-like,pfscan_RecA_monomer-monomer_interface,tigrfam_DMC1_rcmbase	ENSG00000100206		0.373	DMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMC1	HGNC	protein_coding	OTTHUMT00000321246.2	280	0.00	0	G	NM_007068		38933603	38933603	-1	no_errors	ENST00000216024	ensembl	human	known	69_37n	missense	154	36.63	89	SNP	1.000	A
DNAH2	146754	genome.wustl.edu	37	17	7667478	7667478	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr17:7667478T>G	ENST00000572933.1	+	20	4683	c.3223T>G	c.(3223-3225)Ttg>Gtg	p.L1075V	DNAH2_ENST00000389173.2_Missense_Mutation_p.L1075V			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	1075	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GGGGGTCAGCTTGCAGCTCGT	0.597																																						dbGAP											0													127.0	113.0	118.0					17																	7667478		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.3223T>G	17.37:g.7667478T>G	ENSP00000458355:p.Leu1075Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.L1075V	ENST00000572933.1	37	c.3223	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	T	1.355	-0.590276	0.03799	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.23754	1.89	4.9	-9.8	0.00490	.	0.809177	0.10347	N	0.685595	T	0.20414	0.0491	L	0.52266	1.64	0.24261	N	0.995285	B	0.18013	0.025	B	0.22753	0.041	T	0.12502	-1.0545	10	0.33940	T	0.23	.	15.2559	0.73585	0.112:0.7481:0.0:0.14	.	1075	Q9P225	DYH2_HUMAN	V	1075	ENSP00000373825:L1075V	ENSP00000353818:L1075V	L	+	1	2	DNAH2	7608203	0.121000	0.22262	0.080000	0.20451	0.228000	0.25075	-0.193000	0.09573	-2.235000	0.00714	-1.294000	0.01345	TTG	DNAH2	-	NULL	ENSG00000183914		0.597	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	305	0.00	0	T	NM_020877		7667478	7667478	+1	no_errors	ENST00000389173	ensembl	human	known	69_37n	missense	146	37.34	87	SNP	0.006	G
DOCK11	139818	genome.wustl.edu	37	X	117679991	117679991	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chrX:117679991C>T	ENST00000276202.7	+	6	533	c.470C>T	c.(469-471)tCt>tTt	p.S157F	DOCK11_ENST00000276204.6_Missense_Mutation_p.S157F	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	157					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						CAGGACTCATCTTCTTTATGT	0.403																																						dbGAP											0													138.0	117.0	124.0					X																	117679991		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.470C>T	X.37:g.117679991C>T	ENSP00000276202:p.Ser157Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S157F	ENST00000276202.7	37	c.470	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	C	20.6	4.010659	0.75046	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.18657	2.2;2.2	5.34	5.34	0.76211	.	0.126503	0.56097	D	0.000034	T	0.20251	0.0487	N	0.19112	0.55	0.49051	D	0.999741	P	0.41159	0.74	P	0.45946	0.498	T	0.04281	-1.0963	10	0.23302	T	0.38	-2.5253	16.7247	0.85418	0.0:1.0:0.0:0.0	.	157	Q5JSL3	DOC11_HUMAN	F	157	ENSP00000276204:S157F;ENSP00000276202:S157F	ENSP00000276202:S157F	S	+	2	0	DOCK11	117564019	0.955000	0.32602	0.874000	0.34290	0.955000	0.61496	5.269000	0.65542	2.207000	0.71202	0.600000	0.82982	TCT	DOCK11	-	NULL	ENSG00000147251		0.403	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	591	0.00	0	C	NM_144658		117679991	117679991	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	missense	451	27.68	173	SNP	0.890	T
DOK3	79930	genome.wustl.edu	37	5	176931433	176931433	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr5:176931433C>G	ENST00000357198.4	-	6	1046	c.1042G>C	c.(1042-1044)Gag>Cag	p.E348Q	DOK3_ENST00000377112.4_Intron|DOK3_ENST00000501403.2_Missense_Mutation_p.E292Q|RP11-1334A24.6_ENST00000506025.1_RNA|DOK3_ENST00000312943.6_Intron	NM_024872.2	NP_079148.2	Q7L591	DOK3_HUMAN	docking protein 3	348	Pro-rich.				Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|lung(7)	13	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			GTGGGTGGCTCAGGTCCTGGT	0.701																																						dbGAP											0													23.0	27.0	25.0					5																	176931433		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK026223	CCDS4426.1, CCDS47349.1, CCDS47350.1	5q35	2008-02-05			ENSG00000146094	ENSG00000146094			24583	protein-coding gene	gene with protein product		611435				10733577, 12595900	Standard	NM_024872		Approved	FLJ22570	uc003mhk.3	Q7L591	OTTHUMG00000130850	ENST00000357198.4:c.1042G>C	5.37:g.176931433C>G	ENSP00000349727:p.Glu348Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PAT0|H7BXS0|Q8N864|Q9BQB3|Q9H666	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.E348Q	ENST00000357198.4	37	c.1042	CCDS4426.1	5	.	.	.	.	.	.	.	.	.	.	c	6.611	0.481177	0.12581	.	.	ENSG00000146094	ENST00000357198;ENST00000501403	T;T	0.32988	2.14;1.43	3.75	1.89	0.25635	.	7741.510000	0.00166	N	0.000000	T	0.25568	0.0622	L	0.32530	0.975	0.09310	N	1	B	0.17465	0.022	B	0.09377	0.004	T	0.14062	-1.0486	10	0.31617	T	0.26	-0.2451	6.5244	0.22293	0.0:0.7143:0.1834:0.1024	.	348	Q7L591	DOK3_HUMAN	Q	348;292	ENSP00000349727:E348Q;ENSP00000421688:E292Q	ENSP00000349727:E348Q	E	-	1	0	DOK3	176864039	0.000000	0.05858	0.001000	0.08648	0.120000	0.20174	0.065000	0.14466	0.249000	0.21456	0.306000	0.20318	GAG	DOK3	-	NULL	ENSG00000146094		0.701	DOK3-001	KNOWN	basic|CCDS	protein_coding	DOK3	HGNC	protein_coding	OTTHUMT00000253420.4	58	0.00	0	C	NM_024872		176931433	176931433	-1	no_errors	ENST00000357198	ensembl	human	known	69_37n	missense	34	26.09	12	SNP	0.001	G
DPY19L4	286148	genome.wustl.edu	37	8	95751734	95751734	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr8:95751734G>C	ENST00000414645.2	+	5	536	c.437G>C	c.(436-438)aGc>aCc	p.S146T		NM_181787.2	NP_861452.2	Q7Z388	D19L4_HUMAN	dpy-19-like 4 (C. elegans)	146						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	21	Breast(36;3.85e-06)					CTTATTGCTAGCATTTTATAT	0.338																																						dbGAP											0													124.0	120.0	121.0					8																	95751734		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS34924.1	8q22.1	2006-11-24			ENSG00000156162	ENSG00000156162			27829	protein-coding gene	gene with protein product		613895					Standard	NM_181787		Approved		uc003ygx.2	Q7Z388	OTTHUMG00000164589	ENST00000414645.2:c.437G>C	8.37:g.95751734G>C	ENSP00000389630:p.Ser146Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZW32|Q6ZW42|Q7Z329	Missense_Mutation	SNP	pfam_Dpy-19	p.S146T	ENST00000414645.2	37	c.437	CCDS34924.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.80|16.80	3.224178|3.224178	0.58668|0.58668	.|.	.|.	ENSG00000156162|ENSG00000156162	ENST00000522422;ENST00000414645;ENST00000519176|ENST00000519353	T;T;T|.	0.56776|.	0.44;0.44;0.44|.	5.98|5.98	5.98|5.98	0.97165|0.97165	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.76040|.	0.3932|.	M|M	0.65498|0.65498	2.005|2.005	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.76494|.	0.992;0.999|.	D;D|.	0.81914|.	0.987;0.995|.	T|.	0.72033|.	-0.4412|.	10|.	0.72032|.	D|.	0.01|.	-14.2838|-14.2838	20.452|20.452	0.99131|0.99131	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	74;146|.	E5RGB7;Q7Z388|.	.;D19L4_HUMAN|.	T|Y	74;146;117|77	ENSP00000428762:S74T;ENSP00000389630:S146T;ENSP00000430417:S117T|.	ENSP00000389630:S146T|.	S|X	+|+	2|3	0|2	DPY19L4|DPY19L4	95820910|95820910	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.092000|0.092000	0.18411|0.18411	5.663000|5.663000	0.68038|0.68038	2.838000|2.838000	0.97847|0.97847	0.591000|0.591000	0.81541|0.81541	AGC|TAG	DPY19L4	-	pfam_Dpy-19	ENSG00000156162		0.338	DPY19L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L4	HGNC	protein_coding	OTTHUMT00000379339.1	350	0.00	0	G	NM_181787		95751734	95751734	+1	no_errors	ENST00000414645	ensembl	human	known	69_37n	missense	381	19.96	95	SNP	1.000	C
ECM1	1893	genome.wustl.edu	37	1	150484178	150484178	+	Silent	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:150484178C>T	ENST00000369047.4	+	7	1079	c.954C>T	c.(952-954)ttC>ttT	p.F318F	ECM1_ENST00000470432.1_3'UTR|ECM1_ENST00000369049.4_Silent_p.F345F|ECM1_ENST00000346569.6_Intron	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1	318	2 X approximate repeats.				angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TGAGGCGCTTCCGCTCTGTGC	0.602																																					Melanoma(156;1696 2560 11093 19685)	dbGAP											0													59.0	53.0	55.0					1																	150484178		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.954C>T	1.37:g.150484178C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	Silent	SNP	pfam_ECM1,superfamily_Serum_albumin-like	p.F345	ENST00000369047.4	37	c.1035	CCDS953.1	1																																																																																			ECM1	-	pfam_ECM1	ENSG00000143369		0.602	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	ECM1	HGNC	protein_coding	OTTHUMT00000035832.2	72	0.00	0	C	NM_004425		150484178	150484178	+1	no_errors	ENST00000369049	ensembl	human	known	69_37n	silent	40	25.93	14	SNP	0.966	T
EML2	24139	genome.wustl.edu	37	19	46128000	46128000	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr19:46128000C>A	ENST00000245925.3	-	9	868	c.818G>T	c.(817-819)gGg>gTg	p.G273V	EML2_ENST00000536630.1_Missense_Mutation_p.G420V|EML2_ENST00000589876.1_Missense_Mutation_p.G273V|EML2_ENST00000586902.1_5'UTR|EML2_ENST00000587152.1_Missense_Mutation_p.G474V	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	273	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		ATAGAGGTTCCCCCCAGAGTC	0.532																																						dbGAP											0													85.0	63.0	71.0					19																	46128000		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.818G>T	19.37:g.46128000C>A	ENSP00000245925:p.Gly273Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_Quinoprot_gluc/sorb_DH,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G474V	ENST00000245925.3	37	c.1421	CCDS12670.1	19	.	.	.	.	.	.	.	.	.	.	C	21.8	4.203743	0.79127	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055;ENST00000399594	T;T;T	0.58358	0.34;0.34;4.23	4.09	4.09	0.47781	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.79834	0.4514	H	0.95850	3.73	0.80722	D	1	D;D;P;D	0.76494	0.999;0.992;0.943;0.985	D;D;P;P	0.73380	0.98;0.922;0.57;0.896	D	0.86438	0.1765	10	0.87932	D	0	-9.6124	13.819	0.63309	0.0:1.0:0.0:0.0	.	273;439;420;273	B7Z918;B7Z3Q9;B7Z3I2;O95834	.;.;.;EMAL2_HUMAN	V	420;273;474;431	ENSP00000442365:G420V;ENSP00000245925:G273V;ENSP00000382503:G431V	ENSP00000245925:G273V	G	-	2	0	EML2	50819840	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.169000	0.77578	2.117000	0.64856	0.650000	0.86243	GGG	EML2	-	superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000125746		0.532	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	EML2	HGNC	protein_coding	OTTHUMT00000459608.1	139	0.00	0	C	NM_012155		46128000	46128000	-1	no_errors	ENST00000587152	ensembl	human	known	69_37n	missense	48	31.43	22	SNP	1.000	A
EPS8L1	54869	genome.wustl.edu	37	19	55591557	55591557	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr19:55591557G>A	ENST00000201647.6	+	6	396	c.340G>A	c.(340-342)Ggc>Agc	p.G114S	EPS8L1_ENST00000592824.1_3'UTR|EPS8L1_ENST00000586329.1_Missense_Mutation_p.G96S|EPS8L1_ENST00000245618.5_5'Flank|EPS8L1_ENST00000540810.1_Missense_Mutation_p.G50S|EPS8L1_ENST00000588359.1_5'Flank	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	114					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GATGCCACCCGGCAGGAGCCG	0.687																																					Ovarian(149;255 1863 3636 27051 29647)	dbGAP											0													8.0	7.0	7.0					19																	55591557		2102	4112	6214	-	-	-	SO:0001583	missense	0			AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.340G>A	19.37:g.55591557G>A	ENSP00000201647:p.Gly114Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Missense_Mutation	SNP	pfam_PTB,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_PTyr_interaction_dom,smart_SH3_domain,pfscan_SH3_domain	p.G114S	ENST00000201647.6	37	c.340	CCDS12914.1	19	.	.	.	.	.	.	.	.	.	.	G	11.56	1.675378	0.29783	.	.	ENSG00000131037	ENST00000310075;ENST00000201647;ENST00000540810	T;T	0.29397	1.57;1.57	3.87	2.82	0.32997	Pleckstrin homology-type (1);Tensin phosphotyrosine-binding domain (1);	0.700151	0.13551	N	0.379469	T	0.22742	0.0549	L	0.37630	1.12	0.80722	D	1	D;B;P	0.62365	0.991;0.147;0.935	P;B;B	0.46758	0.526;0.016;0.197	T	0.13255	-1.0516	10	0.08837	T	0.75	-18.9676	5.8011	0.18414	0.1096:0.2009:0.6896:0.0	.	50;96;114	B4DKV7;Q8TE68-3;Q8TE68	.;.;ES8L1_HUMAN	S	96;114;50	ENSP00000201647:G114S;ENSP00000437541:G50S	ENSP00000201647:G114S	G	+	1	0	EPS8L1	60283369	0.743000	0.28239	0.529000	0.27951	0.480000	0.33159	1.500000	0.35682	0.762000	0.33152	-0.336000	0.08194	GGC	EPS8L1	-	pfam_PTB,smart_PTyr_interaction_dom	ENSG00000131037		0.687	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS8L1	HGNC	protein_coding	OTTHUMT00000451713.1	36	0.00	0	G	NM_017729		55591557	55591557	+1	no_errors	ENST00000201647	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	0.713	A
ERG	2078	genome.wustl.edu	37	21	39817464	39817464	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr21:39817464C>T	ENST00000417133.2	-	4	305	c.120G>A	c.(118-120)atG>atA	p.M40I	ERG_ENST00000398905.1_Missense_Mutation_p.M33I|ERG_ENST00000398907.1_Missense_Mutation_p.M33I|ERG_ENST00000288319.7_Missense_Mutation_p.M33I|ERG_ENST00000442448.1_Missense_Mutation_p.M40I|ERG_ENST00000398919.2_Missense_Mutation_p.M40I|ERG_ENST00000398911.1_Missense_Mutation_p.M40I|ERG_ENST00000453032.2_Intron|ERG_ENST00000398910.1_Missense_Mutation_p.M40I|ERG_ENST00000398897.1_Intron|ERG_ENST00000429727.2_Missense_Mutation_p.M33I	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	0					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)		EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	AGGACGCGGTCATCTCTGTCT	0.557			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																Esophageal Squamous(130;336 1700 3010 3083 40589)	dbGAP		Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	0													122.0	92.0	102.0					21																	39817464		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.120G>A	21.37:g.39817464C>T	ENSP00000414150:p.Met40Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,prints_Ets,pfscan_Ets	p.M40I	ENST00000417133.2	37	c.120	CCDS46648.1	21	.	.	.	.	.	.	.	.	.	.	C	20.7	4.031796	0.75504	.	.	ENSG00000157554	ENST00000398905;ENST00000398907;ENST00000288319;ENST00000398911;ENST00000417133;ENST00000398910;ENST00000442448;ENST00000398919;ENST00000429727	T;T;T;T;T;T;T;T	0.15603	2.45;2.42;2.44;2.44;2.41;2.43;2.44;2.41	5.77	5.77	0.91146	.	0.056176	0.64402	D	0.000001	T	0.40956	0.1138	L	0.59436	1.845	0.80722	D	1	D;P;P;B;D	0.58268	0.982;0.613;0.941;0.285;0.964	D;B;P;B;P	0.68943	0.961;0.358;0.804;0.155;0.62	T	0.03750	-1.1007	10	0.54805	T	0.06	.	19.9855	0.97347	0.0:1.0:0.0:0.0	.	33;40;40;40;33	B4E3C5;P11308;P11308-6;P11308-1;P11308-4	.;ERG_HUMAN;.;.;.	I	33;33;33;40;40;40;40;40;33	ENSP00000381877:M33I;ENSP00000381879:M33I;ENSP00000288319:M33I;ENSP00000381882:M40I;ENSP00000414150:M40I;ENSP00000381881:M40I;ENSP00000394694:M40I;ENSP00000381891:M40I	ENSP00000288319:M33I	M	-	3	0	ERG	38739334	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.715000	0.92844	0.655000	0.94253	ATG	ERG	-	NULL	ENSG00000157554		0.557	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ERG	HGNC	protein_coding	OTTHUMT00000207532.2	184	0.00	0	C	NM_182918		39817464	39817464	-1	no_errors	ENST00000398919	ensembl	human	known	69_37n	missense	89	33.08	44	SNP	1.000	T
FAM114A2	10827	genome.wustl.edu	37	5	153409057	153409057	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr5:153409057G>C	ENST00000351797.4	-	5	563	c.487C>G	c.(487-489)Cag>Gag	p.Q163E	FAM114A2_ENST00000522858.1_Missense_Mutation_p.Q163E|FAM114A2_ENST00000520667.1_Missense_Mutation_p.Q163E|FAM114A2_ENST00000520313.1_Missense_Mutation_p.Q93E	NM_018691.2	NP_061161.2	Q9NRY5	F1142_HUMAN	family with sequence similarity 114, member A2	163							purine nucleotide binding (GO:0017076)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)|urinary_tract(1)	18						ACTGTGCTCTGAACAGCAGTA	0.438																																						dbGAP											0													105.0	97.0	99.0					5																	153409057		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF159700	CCDS4323.1	5q31-q33	2008-06-13	2008-06-13	2008-06-13	ENSG00000055147	ENSG00000055147			1333	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 3"""	C5orf3		10843801	Standard	XM_005268359		Approved	133K02	uc003lvc.3	Q9NRY5	OTTHUMG00000130147	ENST00000351797.4:c.487C>G	5.37:g.153409057G>C	ENSP00000341597:p.Gln163Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8D8|Q9H7E0	Missense_Mutation	SNP	pfam_DUF719	p.Q163E	ENST00000351797.4	37	c.487	CCDS4323.1	5	.	.	.	.	.	.	.	.	.	.	G	13.99	2.401853	0.42613	.	.	ENSG00000055147	ENST00000351797;ENST00000522858;ENST00000520667;ENST00000433795;ENST00000520313;ENST00000522395;ENST00000523705	T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86	5.48	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.62036	0.2395	L	0.47716	1.5	0.58432	D	0.999994	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.60979	-0.7155	10	0.38643	T	0.18	-8.7229	16.1339	0.81465	0.0:0.1339:0.8661:0.0	.	93;163	E7ESJ7;Q9NRY5	.;F1142_HUMAN	E	163;163;163;163;93;163;163	ENSP00000341597:Q163E;ENSP00000430489:Q163E;ENSP00000430384:Q163E;ENSP00000429088:Q93E;ENSP00000430186:Q163E;ENSP00000428827:Q163E	ENSP00000341597:Q163E	Q	-	1	0	FAM114A2	153389250	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	8.193000	0.89719	1.282000	0.44496	0.313000	0.20887	CAG	FAM114A2	-	pfam_DUF719	ENSG00000055147		0.438	FAM114A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM114A2	HGNC	protein_coding	OTTHUMT00000252455.1	285	0.00	0	G	NM_018691		153409057	153409057	-1	no_errors	ENST00000351797	ensembl	human	known	69_37n	missense	192	20.33	49	SNP	1.000	C
NUTM2F	54754	genome.wustl.edu	37	9	97082696	97082696	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr9:97082696C>T	ENST00000253262.4	-	5	1182	c.1162G>A	c.(1162-1164)Gag>Aag	p.E388K	NUTM2F_ENST00000335456.7_Missense_Mutation_p.E373K|NUTM2F_ENST00000341207.4_Missense_Mutation_p.E373K	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	388	Pro-rich.																GGGATCTCCTCAGGGACCTTG	0.672																																						dbGAP											0													49.0	59.0	55.0					9																	97082696		1947	4131	6078	-	-	-	SO:0001583	missense	0				CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.1162G>A	9.37:g.97082696C>T	ENSP00000253262:p.Glu388Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Missense_Mutation	SNP	NULL	p.E388K	ENST00000253262.4	37	c.1162	CCDS47994.1	9	.	.	.	.	.	.	.	.	.	.	.	0.011	-1.702962	0.00719	.	.	ENSG00000130950	ENST00000335456;ENST00000253262;ENST00000341207	T;T;T	0.19806	2.12;2.92;2.94	1.2	-1.54	0.08584	Nuclear Testis protein, C-terminal (1);	1.383510	0.04359	N	0.357042	T	0.08133	0.0203	N	0.04508	-0.205	0.09310	N	0.999997	B	0.06786	0.001	B	0.10450	0.005	T	0.29731	-1.0002	10	0.02654	T	1	.	6.4717	0.22011	0.0:0.6762:0.0:0.3238	.	388	A1L443	FA22F_HUMAN	K	373;388;373	ENSP00000335067:E373K;ENSP00000253262:E388K;ENSP00000343865:E373K	ENSP00000253262:E388K	E	-	1	0	FAM22F	96122517	0.014000	0.17966	0.056000	0.19401	0.012000	0.07955	-0.797000	0.04570	-0.481000	0.06792	-0.391000	0.06502	GAG	FAM22F	-	NULL	ENSG00000130950		0.672	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM22F	HGNC	protein_coding	OTTHUMT00000053173.2	335	0.00	0	C	NM_017561		97082696	97082696	-1	no_errors	ENST00000253262	ensembl	human	known	69_37n	missense	172	22.52	50	SNP	0.469	T
FAM83F	113828	genome.wustl.edu	37	22	40425538	40425538	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr22:40425538C>A	ENST00000333407.6	+	5	1566	c.1472C>A	c.(1471-1473)tCt>tAt	p.S491Y	FAM83F_ENST00000473717.1_Missense_Mutation_p.S323Y	NM_138435.2	NP_612444.2	Q8NEG4	FA83F_HUMAN	family with sequence similarity 83, member F	491										breast(1)|endometrium(2)|large_intestine(1)|lung(4)|skin(4)|urinary_tract(2)	14						AGTCCCAGTTCTGCCAAGCCT	0.577																																						dbGAP											0													189.0	127.0	148.0					22																	40425538		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14000.2	22q13.1	2006-03-22			ENSG00000133477	ENSG00000133477			25148	protein-coding gene	gene with protein product						12477932	Standard	NM_138435		Approved		uc003ayk.1	Q8NEG4	OTTHUMG00000150688	ENST00000333407.6:c.1472C>A	22.37:g.40425538C>A	ENSP00000330432:p.Ser491Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96FD6	Missense_Mutation	SNP	pfam_DUF1669	p.S491Y	ENST00000333407.6	37	c.1472	CCDS14000.2	22	.	.	.	.	.	.	.	.	.	.	C	4.672	0.124949	0.08931	.	.	ENSG00000133477	ENST00000333407	T	0.09073	3.02	4.5	3.48	0.39840	.	1.744920	0.03098	N	0.160644	T	0.04861	0.0131	N	0.08118	0	0.09310	N	1	P	0.36438	0.553	B	0.29440	0.102	T	0.29701	-1.0003	10	0.28530	T	0.3	4.1539	7.7515	0.28901	0.0:0.8831:0.0:0.1169	.	491	Q8NEG4	FA83F_HUMAN	Y	491	ENSP00000330432:S491Y	ENSP00000330432:S491Y	S	+	2	0	FAM83F	38755484	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	0.672000	0.25187	1.226000	0.43582	0.561000	0.74099	TCT	FAM83F	-	NULL	ENSG00000133477		0.577	FAM83F-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83F	HGNC	protein_coding	OTTHUMT00000319624.3	404	0.00	0	C	NM_138435		40425538	40425538	+1	no_errors	ENST00000333407	ensembl	human	known	69_37n	missense	139	37.67	84	SNP	0.002	A
FASTK	10922	genome.wustl.edu	37	7	150774081	150774081	+	Silent	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr7:150774081G>A	ENST00000297532.6	-	9	1538	c.1461C>T	c.(1459-1461)ttC>ttT	p.F487F	FASTK_ENST00000353841.2_Silent_p.F346F|FASTK_ENST00000489884.1_5'UTR|FASTK_ENST00000482571.1_Silent_p.F460F|FASTK_ENST00000540185.1_3'UTR|RP11-148K1.12_ENST00000485974.1_RNA	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	487	RAP. {ECO:0000255|PROSITE- ProRule:PRU00619}.				apoptotic signaling pathway (GO:0097190)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|Fas-activated serine/threonine kinase activity (GO:0033867)|protein serine/threonine kinase activity (GO:0004674)			lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		CGTCCCGGCAGAAATGCCAGC	0.721																																						dbGAP											0													25.0	30.0	28.0					7																	150774081		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0				CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896			24676	protein-coding gene	gene with protein product		606965				7544399, 15572676	Standard	NM_006712		Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.1461C>T	7.37:g.150774081G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K867|F8VTW9|Q59EM8|Q8IVA0	Silent	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.F487	ENST00000297532.6	37	c.1461	CCDS5918.1	7																																																																																			FASTK	-	pfam_RAP,smart_RAP	ENSG00000164896		0.721	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTK	HGNC	protein_coding	OTTHUMT00000351832.2	67	0.00	0	G	NM_006712		150774081	150774081	-1	no_errors	ENST00000297532	ensembl	human	known	69_37n	silent	51	23.53	16	SNP	1.000	A
FBXO15	201456	genome.wustl.edu	37	18	71740747	71740747	+	Silent	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr18:71740747G>A	ENST00000419743.2	-	10	1561	c.1482C>T	c.(1480-1482)gtC>gtT	p.V494V	FBXO15_ENST00000269500.5_Silent_p.V418V|FBXO15_ENST00000580806.1_5'UTR	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	494						SCF ubiquitin ligase complex (GO:0019005)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		TAAGATAAAGGACCAGGTTGA	0.413																																						dbGAP											0													200.0	196.0	197.0					18																	71740747		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.1482C>T	18.37:g.71740747G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KST3	Silent	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.V494	ENST00000419743.2	37	c.1482	CCDS45884.1	18																																																																																			FBXO15	-	NULL	ENSG00000141665		0.413	FBXO15-002	KNOWN	basic|CCDS	protein_coding	FBXO15	HGNC	protein_coding	OTTHUMT00000444223.1	367	0.00	0	G	NM_152676		71740747	71740747	-1	no_errors	ENST00000419743	ensembl	human	known	69_37n	silent	182	30.15	79	SNP	0.167	A
MROH5	389690	genome.wustl.edu	37	8	142506533	142506533	+	RNA	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr8:142506533C>T	ENST00000430863.1	-	0	229					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		TCTGTCCCTGCGGGCAGAGTC	0.577																																						dbGAP											0													95.0	102.0	100.0					8																	142506533		2142	4249	6391	-	-	-			0					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142506533C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R15H	ENST00000430863.1	37	c.44		8	.	.	.	.	.	.	.	.	.	.	C	2.471	-0.321870	0.05386	.	.	ENSG00000226807	ENST00000521161	.	.	.	4.07	-8.14	0.01069	.	.	.	.	.	T	0.17450	0.0419	N	0.08118	0	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.23332	-1.0191	7	0.23302	T	0.38	.	8.93	0.35663	0.0:0.4434:0.3091:0.2475	.	50	Q6ZUA9	.	H	15	.	ENSP00000431031:R50H	R	-	2	0	AC100803.1	142575715	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.018000	0.01444	-2.786000	0.00358	-2.075000	0.00382	CGC	AC100803.1	-	NULL	ENSG00000226807		0.577	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	FLJ43860	Clone_based_vega_gene	polymorphic_pseudogene	OTTHUMT00000342412.4	462	0.00	0	C	NM_207414		142506533	142506533	-1	no_stop_codon	ENST00000521161	ensembl	human	putative	69_37n	missense	236	30.81	106	SNP	0.000	T
G3BP1	10146	genome.wustl.edu	37	5	151178806	151178806	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr5:151178806C>G	ENST00000394123.3	+	8	920	c.775C>G	c.(775-777)Ctt>Gtt	p.L259V	G3BP1_ENST00000356245.3_Missense_Mutation_p.L259V|G3BP1_ENST00000543466.1_Missense_Mutation_p.L77V			Q13283	G3BP1_HUMAN	GTPase activating protein (SH3 domain) binding protein 1	259					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Ras protein signal transduction (GO:0007265)|transport (GO:0006810)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|skin(3)|urinary_tract(2)	29		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			CAGTAAGAATCTTCCACCCAG	0.393																																						dbGAP											0													97.0	91.0	93.0					5																	151178806		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006997	CCDS4319.1	5q33.1	2013-02-12	2006-11-01		ENSG00000145907	ENSG00000145907		"""RNA binding motif (RRM) containing"""	30292	protein-coding gene	gene with protein product	"""Ras-GTPase-activating protein SH3-domain-binding protein"""	608431				8649363, 9889278	Standard	NM_005754		Approved	HDH-VIII, G3BP	uc003lum.3	Q13283	OTTHUMG00000130123	ENST00000394123.3:c.775C>G	5.37:g.151178806C>G	ENSP00000377681:p.Leu259Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5HYE9	Missense_Mutation	SNP	pfam_NTF2,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Nuclear_transport_factor_2_euk	p.L259V	ENST00000394123.3	37	c.775	CCDS4319.1	5	.	.	.	.	.	.	.	.	.	.	C	26.2	4.719345	0.89205	.	.	ENSG00000145907	ENST00000394123;ENST00000543466;ENST00000356245	T;T;T	0.74632	-0.65;-0.86;-0.65	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.84365	0.5456	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	P	0.61070	0.883	T	0.81090	-0.1090	10	0.15066	T	0.55	0.1422	19.1084	0.93307	0.0:1.0:0.0:0.0	.	259	Q13283	G3BP1_HUMAN	V	259;77;259	ENSP00000377681:L259V;ENSP00000445035:L77V;ENSP00000348578:L259V	ENSP00000348578:L259V	L	+	1	0	G3BP1	151158999	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.253000	0.78320	2.579000	0.87056	0.655000	0.94253	CTT	G3BP1	-	NULL	ENSG00000145907		0.393	G3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G3BP1	HGNC	protein_coding	OTTHUMT00000252431.1	237	0.00	0	C	NM_005754		151178806	151178806	+1	no_errors	ENST00000356245	ensembl	human	known	69_37n	missense	161	19.90	40	SNP	1.000	G
GPATCH3	63906	genome.wustl.edu	37	1	27216558	27216558	+	IGR	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:27216558G>A	ENST00000361720.5	-	0	2123				GPN2_ENST00000374135.4_Silent_p.F10F|GPN2_ENST00000461282.1_5'Flank	NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3								nucleic acid binding (GO:0003676)			endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		CCGCCTGCCCGAAGGCCGTGG	0.726																																						dbGAP											0													6.0	7.0	7.0					1																	27216558		1962	3985	5947	-	-	-	SO:0001628	intergenic_variant	0			BC007767	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746		"""G patch domain containing"""	25720	protein-coding gene	gene with protein product				GPATC3			Standard	NM_022078		Approved	FLJ12455	uc001bne.3	Q96I76	OTTHUMG00000004229		1.37:g.27216558G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYH2|Q8NDJ2|Q9H9Z3	Silent	SNP	pfam_Uncharacterised_ATP-bd	p.F10	ENST00000361720.5	37	c.30	CCDS290.1	1																																																																																			GPN2	-	NULL	ENSG00000142751		0.726	GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPN2	HGNC	protein_coding	OTTHUMT00000012181.1	8	0.00	0	G	NM_022078		27216558	27216558	-1	no_errors	ENST00000374135	ensembl	human	known	69_37n	silent	7	36.36	4	SNP	0.971	A
GPR179	440435	genome.wustl.edu	37	17	36482587	36482587	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr17:36482587C>T	ENST00000342292.4	-	11	6885	c.6865G>A	c.(6865-6867)Gaa>Aaa	p.E2289K	GPR179_ENST00000584976.1_Intron	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	2289					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				ATTTTGCTTTCTGGAAAGAAG	0.502																																						dbGAP											0													133.0	125.0	128.0					17																	36482587		1856	4100	5956	-	-	-	SO:0001583	missense	0				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.6865G>A	17.37:g.36482587C>T	ENSP00000345060:p.Glu2289Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C	p.E2289K	ENST00000342292.4	37	c.6865	CCDS42308.1	17	.	.	.	.	.	.	.	.	.	.	C	14.62	2.590526	0.46214	.	.	ENSG00000188888	ENST00000342292	T	0.58210	0.35	5.16	3.13	0.36017	.	0.496416	0.16995	N	0.191152	T	0.45377	0.1339	L	0.54323	1.7	0.34184	D	0.671282	B	0.32918	0.39	B	0.31290	0.127	T	0.57499	-0.7801	10	0.72032	D	0.01	-1.8813	8.3677	0.32397	0.0:0.6184:0.3019:0.0796	.	2289	Q6PRD1	GP179_HUMAN	K	2289	ENSP00000345060:E2289K	ENSP00000345060:E2289K	E	-	1	0	GPR179	33736113	0.370000	0.25047	0.973000	0.42090	0.510000	0.34073	0.487000	0.22356	0.723000	0.32274	0.585000	0.79938	GAA	GPR179	-	NULL	ENSG00000188888		0.502	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	183	0.00	0	C			36482587	36482587	-1	no_errors	ENST00000342292	ensembl	human	known	69_37n	missense	86	33.85	44	SNP	0.997	T
GREB1	9687	genome.wustl.edu	37	2	11702668	11702668	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr2:11702668C>A	ENST00000381486.2	+	3	537	c.237C>A	c.(235-237)ttC>ttA	p.F79L	RNA5SP85_ENST00000365378.1_RNA|GREB1_ENST00000234142.5_Missense_Mutation_p.F79L|GREB1_ENST00000389825.3_5'UTR|RNU2-13P_ENST00000515909.1_RNA|GREB1_ENST00000263834.5_Missense_Mutation_p.F79L|GREB1_ENST00000381483.2_Missense_Mutation_p.F79L	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	79						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CAAACCCTTTCCAGCTGCACC	0.607																																					Ovarian(39;850 945 2785 23371 33093)	dbGAP											0													146.0	120.0	129.0					2																	11702668		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.237C>A	2.37:g.11702668C>A	ENSP00000370896:p.Phe79Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	NULL	p.F79L	ENST00000381486.2	37	c.237	CCDS42655.1	2	.	.	.	.	.	.	.	.	.	.	C	15.73	2.919788	0.52653	.	.	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000381483;ENST00000234142	T;T;T;T	0.17691	3.29;2.26;2.28;3.29	5.36	4.36	0.52297	.	0.146969	0.47455	D	0.000228	T	0.09598	0.0236	N	0.08118	0	0.28094	N	0.9317	B;B;B	0.28233	0.204;0.167;0.015	B;B;B	0.31101	0.124;0.085;0.013	T	0.12578	-1.0542	10	0.72032	D	0.01	-15.2033	9.8867	0.41266	0.0:0.8279:0.0:0.1721	.	79;79;79	Q4ZG55-2;Q4ZG55-3;Q4ZG55	.;.;GREB1_HUMAN	L	79	ENSP00000370896:F79L;ENSP00000263834:F79L;ENSP00000370892:F79L;ENSP00000234142:F79L	ENSP00000234142:F79L	F	+	3	2	GREB1	11620119	0.996000	0.38824	1.000000	0.80357	0.832000	0.47134	0.344000	0.19962	2.520000	0.84964	0.555000	0.69702	TTC	GREB1	-	NULL	ENSG00000196208		0.607	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	203	0.00	0	C	NM_014668		11702668	11702668	+1	no_errors	ENST00000234142	ensembl	human	known	69_37n	missense	102	27.97	40	SNP	1.000	A
POMGNT2	84892	genome.wustl.edu	37	3	43122777	43122777	+	Silent	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr3:43122777C>T	ENST00000344697.2	-	2	492	c.147G>A	c.(145-147)ctG>ctA	p.L49L	POMGNT2_ENST00000441964.1_Silent_p.L49L	NM_032806.5	NP_116195.2	Q8NAT1	PMGT2_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)	49					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein O-GlcNAc transferase activity (GO:0097363)										AGTCGATCCTCAGTGCTGGGG	0.647																																						dbGAP											0													54.0	46.0	49.0					3																	43122777		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK092147	CCDS2709.1	3p22.1	2014-07-15	2013-08-22	2013-08-22	ENSG00000144647	ENSG00000144647			25902	protein-coding gene	gene with protein product		614828	"""chromosome 3 open reading frame 39"", ""glycosyltransferase-like domain containing 2"""	C3orf39, GTDC2		12477932	Standard	NM_032806		Approved	FLJ14566, AGO61	uc003cmr.2	Q8NAT1	OTTHUMG00000133038	ENST00000344697.2:c.147G>A	3.37:g.43122777C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWC3|Q96SY3	Silent	SNP	pfam_Glycosyltransferase_AER61,superfamily_Fibronectin_type3	p.L49	ENST00000344697.2	37	c.147	CCDS2709.1	3																																																																																			GTDC2	-	NULL	ENSG00000144647		0.647	POMGNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTDC2	HGNC	protein_coding	OTTHUMT00000256643.1	84	0.00	0	C	NM_032806		43122777	43122777	-1	no_errors	ENST00000344697	ensembl	human	known	69_37n	silent	27	30.00	12	SNP	0.000	T
HIST1H2BC	8347	genome.wustl.edu	37	6	26123759	26123759	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr6:26123759G>A	ENST00000314332.5	-	1	379	c.374C>T	c.(373-375)tCc>tTc	p.S125F	HIST1H2BC_ENST00000396984.1_Missense_Mutation_p.S125F|HIST1H2AC_ENST00000377791.2_5'Flank|HIST1H2AC_ENST00000602637.1_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	125					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						TGTTTACTTGGAGCTGGTGTA	0.567																																						dbGAP											0													86.0	88.0	87.0					6																	26123759		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.374C>T	6.37:g.26123759G>A	ENSP00000321744:p.Ser125Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.S125F	ENST00000314332.5	37	c.374	CCDS4584.1	6	.	.	.	.	.	.	.	.	.	.	.	24.1	4.495384	0.85069	.	.	ENSG00000180596	ENST00000314332;ENST00000396984	T;T	0.26660	1.72;1.72	5.61	4.74	0.60224	Histone-fold (2);	0.000000	0.40554	U	0.001075	T	0.40767	0.1130	.	.	.	0.37124	D	0.900953	D	0.63046	0.992	D	0.67231	0.95	T	0.50996	-0.8761	9	0.87932	D	0	.	13.801	0.63199	0.0738:0.0:0.9262:0.0	.	125	P62807	H2B1C_HUMAN	F	125	ENSP00000321744:S125F;ENSP00000380180:S125F	ENSP00000321744:S125F	S	-	2	0	HIST1H2BC	26231738	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.967000	0.87967	1.494000	0.48533	0.650000	0.86243	TCC	HIST1H2BC	-	superfamily_Histone-fold	ENSG00000180596		0.567	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BC	HGNC	protein_coding	OTTHUMT00000468022.1	356	0.00	0	G	NM_003526		26123759	26123759	-1	no_errors	ENST00000314332	ensembl	human	known	69_37n	missense	282	22.10	80	SNP	1.000	A
HIST2H3D	653604	genome.wustl.edu	37	1	149785205	149785205	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:149785205G>A	ENST00000331491.1	-	1	31	c.32C>T	c.(31-33)tCg>tTg	p.S11L	HIST2H2BF_ENST00000427880.2_5'Flank|HIST2H2BF_ENST00000469483.1_5'Flank|RP11-196G18.21_ENST00000420462.1_RNA|HIST2H2BF_ENST00000545683.1_5'Flank|HIST2H2BF_ENST00000369167.1_5'Flank	NM_001123375.2	NP_001116847.1	Q71DI3	H32_HUMAN	histone cluster 2, H3d	11					blood coagulation (GO:0007596)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			biliary_tract(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(3)	7						GCCGCCGGTCGACTTGCGGGC	0.622																																						dbGAP											0													25.0	26.0	26.0					1																	149785205		1515	3490	5005	-	-	-	SO:0001583	missense	0			AL591493	CCDS41388.1	1q21.2	2012-03-08	2006-10-11		ENSG00000183598	ENSG00000183598		"""Histones / Replication-dependent"""	25311	protein-coding gene	gene with protein product			"""histone 2, H3d"""				Standard	NM_001123375		Approved		uc010pbl.2	Q71DI3	OTTHUMG00000012092	ENST00000331491.1:c.32C>T	1.37:g.149785205G>A	ENSP00000333277:p.Ser11Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDF6|A6NFS4|Q6B053	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.S11L	ENST00000331491.1	37	c.32	CCDS41388.1	1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.823876	0.32237	.	.	ENSG00000183598	ENST00000331491	T	0.47528	0.84	4.13	4.13	0.48395	.	0.000000	0.52532	U	0.000072	T	0.55832	0.1945	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	T	0.62558	-0.6829	7	0.87932	D	0	.	15.4963	0.75653	0.0:0.0:1.0:0.0	.	.	.	.	L	11	ENSP00000333277:S11L	ENSP00000333277:S11L	S	-	2	0	HIST2H3D	148051829	1.000000	0.71417	1.000000	0.80357	0.133000	0.20885	6.780000	0.75063	2.302000	0.77476	0.436000	0.28706	TCG	HIST2H3D	-	superfamily_Histone-fold,prints_Histone_H3	ENSG00000183598		0.622	HIST2H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H3D	HGNC	protein_coding	OTTHUMT00000033452.1	87	0.00	0	G	NM_001123375		149785205	149785205	-1	no_errors	ENST00000331491	ensembl	human	known	69_37n	missense	65	16.67	13	SNP	1.000	A
HORMAD1	84072	genome.wustl.edu	37	1	150684035	150684035	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:150684035G>C	ENST00000361824.2	-	7	418	c.313C>G	c.(313-315)Cca>Gca	p.P105A	HORMAD1_ENST00000368995.4_Intron|HORMAD1_ENST00000476530.1_5'Flank|HORMAD1_ENST00000322343.7_Missense_Mutation_p.P98A|HORMAD1_ENST00000368993.2_Missense_Mutation_p.P105A	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1	105	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.				blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)		p.P105S(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			GGATCTTCTGGGTTTGTGTAT	0.289																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											95.0	100.0	98.0					1																	150684035		2201	4289	6490	-	-	-	SO:0001583	missense	0			AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.313C>G	1.37:g.150684035G>C	ENSP00000355167:p.Pro105Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	Missense_Mutation	SNP	pfam_HORMA_DNA-bd,superfamily_HORMA_DNA-bd,pfscan_HORMA_DNA-bd	p.P105A	ENST00000361824.2	37	c.313	CCDS967.1	1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628230	0.66901	.	.	ENSG00000143452	ENST00000368993;ENST00000368992;ENST00000322343;ENST00000361824;ENST00000368987;ENST00000442853	T;T;T	0.32988	1.44;1.43;1.43	5.4	4.48	0.54585	DNA-binding HORMA (4);	0.051146	0.85682	D	0.000000	T	0.38719	0.1051	M	0.82517	2.595	0.50813	D	0.999896	D;P	0.63046	0.992;0.935	P;P	0.57620	0.822;0.824	T	0.21245	-1.0251	10	0.21540	T	0.41	-12.7613	12.2777	0.54747	0.0823:0.0:0.9177:0.0	.	98;105	Q86X24-2;Q86X24	.;HORM1_HUMAN	A	105;34;98;105;34;27	ENSP00000357989:P105A;ENSP00000326489:P98A;ENSP00000355167:P105A	ENSP00000326489:P98A	P	-	1	0	HORMAD1	148950659	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.974000	0.49272	2.547000	0.85894	0.585000	0.79938	CCA	HORMAD1	-	pfam_HORMA_DNA-bd,superfamily_HORMA_DNA-bd,pfscan_HORMA_DNA-bd	ENSG00000143452		0.289	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HORMAD1	HGNC	protein_coding	OTTHUMT00000084722.1	354	0.00	0	G	NM_032132		150684035	150684035	-1	no_errors	ENST00000361824	ensembl	human	known	69_37n	missense	327	22.70	96	SNP	1.000	C
IGDCC3	9543	genome.wustl.edu	37	15	65628154	65628154	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr15:65628154C>G	ENST00000327987.4	-	3	801	c.550G>C	c.(550-552)Gag>Cag	p.E184Q	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	184	Ig-like C2-type 2.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GCTCACCTCTCATTGTCCGTG	0.582																																						dbGAP											0													173.0	162.0	166.0					15																	65628154		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.550G>C	15.37:g.65628154C>G	ENSP00000332773:p.Glu184Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O95215	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E184Q	ENST00000327987.4	37	c.550	CCDS10205.1	15	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856532	0.71834	.	.	ENSG00000174498	ENST00000327987;ENST00000443278	T	0.40476	1.03	5.06	5.06	0.68205	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.211078	0.39834	N	0.001243	T	0.51143	0.1657	L	0.50993	1.605	0.47245	D	0.999367	P	0.41624	0.757	P	0.53809	0.735	T	0.44513	-0.9323	10	0.37606	T	0.19	.	13.0306	0.58840	0.0:0.8377:0.1623:0.0	.	184	Q8IVU1	IGDC3_HUMAN	Q	184;47	ENSP00000332773:E184Q	ENSP00000332773:E184Q	E	-	1	0	IGDCC3	63415207	0.978000	0.34361	0.945000	0.38365	0.809000	0.45718	2.468000	0.45102	2.340000	0.79590	0.655000	0.94253	GAG	IGDCC3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000174498		0.582	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	HGNC	protein_coding	OTTHUMT00000256826.1	403	0.00	0	C	NM_004884		65628154	65628154	-1	no_errors	ENST00000327987	ensembl	human	known	69_37n	missense	143	34.10	74	SNP	1.000	G
IQGAP3	128239	genome.wustl.edu	37	1	156531792	156531792	+	Splice_Site	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:156531792G>C	ENST00000361170.2	-	10	889	c.879C>G	c.(877-879)gtC>gtG	p.V293V		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	293					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GAGCCCCATGGACTGAAAAAA	0.537																																						dbGAP											0													48.0	46.0	47.0					1																	156531792		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.878-1C>G	1.37:g.156531792G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3H8	Silent	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.V293	ENST00000361170.2	37	c.879	CCDS1144.1	1																																																																																			IQGAP3	-	NULL	ENSG00000183856		0.537	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	123	0.00	0	G	NM_178229	Silent	156531792	156531792	-1	no_errors	ENST00000361170	ensembl	human	known	69_37n	silent	83	12.63	12	SNP	0.993	C
ITSN2	50618	genome.wustl.edu	37	2	24484608	24484608	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr2:24484608C>T	ENST00000355123.4	-	21	2802	c.2359G>A	c.(2359-2361)Gat>Aat	p.D787N	ITSN2_ENST00000406921.3_Missense_Mutation_p.D787N|ITSN2_ENST00000361999.3_Missense_Mutation_p.D760N	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	787	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTTTTTCATCAACCTACGGA	0.333																																						dbGAP											0													51.0	50.0	50.0					2																	24484608		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.2359G>A	2.37:g.24484608C>T	ENSP00000347244:p.Asp787Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,pfam_C2_Ca-dep,superfamily_DH-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_p67phox	p.D787N	ENST00000355123.4	37	c.2359	CCDS1710.2	2	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294993	0.60086	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000406921	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.92	4.92	0.64577	Src homology-3 domain (4);	0.584663	0.12968	U	0.424405	T	0.43322	0.1242	L	0.43701	1.375	0.40880	D	0.983987	D;D;D	0.63880	0.992;0.992;0.993	P;P;P	0.58266	0.813;0.747;0.836	T	0.23476	-1.0187	10	0.56958	D	0.05	.	12.9586	0.58444	0.0:0.9214:0.0:0.0786	.	787;760;787	Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;ITSN2_HUMAN	N	760;787;760;787	ENSP00000354561:D760N;ENSP00000347244:D787N;ENSP00000370250:D760N;ENSP00000384499:D787N	ENSP00000347244:D787N	D	-	1	0	ITSN2	24338112	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	5.774000	0.68906	2.489000	0.83994	0.555000	0.69702	GAT	ITSN2	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000198399		0.333	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ITSN2	HGNC	protein_coding	OTTHUMT00000207620.2	193	0.00	0	C	NM_006277		24484608	24484608	-1	no_errors	ENST00000355123	ensembl	human	known	69_37n	missense	217	24.39	70	SNP	1.000	T
IVD	3712	genome.wustl.edu	37	15	40710373	40710373	+	Nonsense_Mutation	SNP	C	C	T	rs398123681		TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr15:40710373C>T	ENST00000249760.2	+	12	1526	c.1183C>T	c.(1183-1185)Cga>Tga	p.R395*	IVD_ENST00000487418.2_Nonsense_Mutation_p.R398*|IVD_ENST00000479013.2_Nonsense_Mutation_p.R368*	NM_002225.3	NP_002216.2	P26440	IVD_HUMAN	isovaleryl-CoA dehydrogenase	395					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	flavin adenine dinucleotide binding (GO:0050660)|isovaleryl-CoA dehydrogenase activity (GO:0008470)			kidney(1)|lung(5)|ovary(2)|prostate(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;1.52e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0808)	Flavin adenine dinucleotide(DB03147)	CCGCTTTCTTCGAGATGCCAA	0.527																																					GBM(31;293 617 7486 32527 34655)	dbGAP											0													98.0	92.0	94.0					15																	40710373		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF038317	CCDS10057.1, CCDS10057.2, CCDS53930.1	15q14-q15	2010-05-11	2010-05-11		ENSG00000128928	ENSG00000128928	1.3.99.10		6186	protein-coding gene	gene with protein product		607036	"""isovaleryl Coenzyme A dehydrogenase"", ""isovaleryl CoA dehydrogenase"""			2063866	Standard	NM_002225		Approved	ACAD2	uc001zls.3	P26440	OTTHUMG00000129984	ENST00000249760.2:c.1183C>T	15.37:g.40710373C>T	ENSP00000249760:p.Arg395*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCV5|B3KVI7|J3KR54|Q53XZ9|Q96AF6	Nonsense_Mutation	SNP	pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_DH_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C	p.R398*	ENST00000249760.2	37	c.1192		15	.	.	.	.	.	.	.	.	.	.	C	38	7.053465	0.98029	.	.	ENSG00000128928	ENST00000249760;ENST00000479013;ENST00000487418	.	.	.	5.15	4.22	0.49857	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7401	0.69448	0.1522:0.8478:0.0:0.0	.	.	.	.	X	395;368;398	.	ENSP00000249760:R395X	R	+	1	2	IVD	38497665	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.710000	0.54860	1.121000	0.41925	0.491000	0.48974	CGA	IVD	-	pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCo_DH/oxidase_C	ENSG00000128928		0.527	IVD-201	KNOWN	basic|appris_candidate	protein_coding	IVD	HGNC	protein_coding		250	0.00	0	C			40710373	40710373	+1	no_errors	ENST00000487418	ensembl	human	known	69_37n	nonsense	80	34.43	42	SNP	1.000	T
KLK15	55554	genome.wustl.edu	37	19	51330233	51330233	+	Missense_Mutation	SNP	G	G	T	rs7247190		TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr19:51330233G>T	ENST00000598239.1	-	3	412	c.382C>A	c.(382-384)Ccc>Acc	p.P128T	KLK15_ENST00000301421.2_Missense_Mutation_p.P128T|KLK15_ENST00000326856.4_Missense_Mutation_p.P127T|KLK15_ENST00000596931.1_Missense_Mutation_p.P127T|KLK15_ENST00000416184.1_Intron	NM_017509.2	NP_059979.2	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15	128	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.P128T(2)		breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		CAACGCGTGGGTAGCACCGCG	0.711																																					Pancreas(140;10 2513 7143 9246)	dbGAP											2	Substitution - Missense(2)	lung(2)											34.0	36.0	35.0					19																	51330233		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF242195	CCDS12805.1, CCDS12806.1, CCDS12806.2, CCDS62766.1	19q13.4	2008-02-05	2006-10-27			ENSG00000174562		"""Kallikreins"""	20453	protein-coding gene	gene with protein product		610601	"""kallikrein 15"""			11010966, 12439720, 16800724, 16800723	Standard	NM_017509		Approved	HSRNASPH, ACO, prostinogen	uc002ptl.3	Q9H2R5		ENST00000598239.1:c.382C>A	19.37:g.51330233G>T	ENSP00000469315:p.Pro128Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUY8|Q15358|Q6ISI0|Q9H2R3|Q9H2R4|Q9H2R6|Q9HBG9	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.P128T	ENST00000598239.1	37	c.382	CCDS12805.1	19	.	.	.	.	.	.	.	.	.	.	g	19.99	3.929208	0.73327	.	.	ENSG00000174562	ENST00000326856;ENST00000301421;ENST00000544946	D	0.95103	-3.61	4.5	4.5	0.54988	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.46145	D	0.000308	D	0.97353	0.9134	M	0.89353	3.025	0.48135	D	0.999596	D;P;P	0.89917	1.0;0.767;0.793	D;P;P	0.71414	0.973;0.549;0.53	D	0.97799	1.0243	10	0.66056	D	0.02	.	15.0875	0.72165	0.0:0.0:1.0:0.0	.	128;127;128	Q6UBM2;Q6ISI0;Q9H2R5	.;.;KLK15_HUMAN	T	128	ENSP00000301421:P128T	ENSP00000301421:P128T	P	-	1	0	KLK15	56022045	1.000000	0.71417	0.127000	0.21898	0.021000	0.10359	3.573000	0.53856	2.514000	0.84764	0.555000	0.69702	CCC	KLK15	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000174562		0.711	KLK15-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK15	HGNC	protein_coding	OTTHUMT00000465160.1	42	0.00	0	G	NM_017509		51330233	51330233	-1	no_errors	ENST00000326856	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	1.000	T
MACC1	346389	genome.wustl.edu	37	7	20199737	20199737	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr7:20199737G>C	ENST00000400331.5	-	5	555	c.247C>G	c.(247-249)Caa>Gaa	p.Q83E	MACC1_ENST00000332878.4_Missense_Mutation_p.Q83E|MACC1_ENST00000589011.1_Missense_Mutation_p.Q83E	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	83					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Q83K(1)		endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						TTTCTTAGTTGAGTTATGTCA	0.353																																						dbGAP											1	Substitution - Missense(1)	lung(1)											49.0	51.0	50.0					7																	20199737		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.247C>G	7.37:g.20199737G>C	ENSP00000383185:p.Gln83Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	pfam_SH3_2,superfamily_DEATH-like	p.Q83E	ENST00000400331.5	37	c.247	CCDS5369.1	7	.	.	.	.	.	.	.	.	.	.	G	8.066	0.769226	0.15983	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.09723	2.95;2.95	5.82	4.94	0.65067	.	0.597682	0.18553	N	0.137846	T	0.14270	0.0345	M	0.64997	1.995	0.30941	N	0.725866	B	0.23937	0.094	B	0.22386	0.039	T	0.03112	-1.1071	10	0.56958	D	0.05	-1.4836	11.7002	0.51567	0.0694:0.1314:0.7992:0.0	.	83	Q6ZN28	MACC1_HUMAN	E	83	ENSP00000383185:Q83E;ENSP00000328410:Q83E	ENSP00000328410:Q83E	Q	-	1	0	MACC1	20166262	1.000000	0.71417	0.834000	0.33040	0.644000	0.38419	2.373000	0.44266	1.473000	0.48159	0.585000	0.79938	CAA	MACC1	-	NULL	ENSG00000183742		0.353	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MACC1	HGNC	protein_coding	OTTHUMT00000250202.5	134	0.00	0	G	NM_182762		20199737	20199737	-1	no_errors	ENST00000332878	ensembl	human	known	69_37n	missense	104	26.76	38	SNP	0.962	C
LAMB1	3912	genome.wustl.edu	37	7	107594139	107594139	+	Nonsense_Mutation	SNP	G	G	T	rs547247575		TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr7:107594139G>T	ENST00000222399.6	-	22	3145	c.2915C>A	c.(2914-2916)tCg>tAg	p.S972*	LAMB1_ENST00000393561.1_Nonsense_Mutation_p.S996*	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	972	Laminin EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						AGGCTGACACGACCCCCCAAC	0.502																																						dbGAP											0													139.0	117.0	124.0					7																	107594139		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.2915C>A	7.37:g.107594139G>T	ENSP00000222399:p.Ser972*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14D91	Nonsense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.S972*	ENST00000222399.6	37	c.2915	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	G	40	8.480511	0.98829	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	.	.	.	4.91	-1.13	0.09775	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	11.8069	0.52161	0.401:0.0:0.599:0.0	.	.	.	.	X	996;972	.	ENSP00000222399:S972X	S	-	2	0	LAMB1	107381375	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.018000	0.13422	-0.112000	0.11979	-0.961000	0.02630	TCG	LAMB1	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000091136		0.502	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	HGNC	protein_coding	OTTHUMT00000314584.1	180	0.00	0	G	NM_002291		107594139	107594139	-1	no_errors	ENST00000222399	ensembl	human	known	69_37n	nonsense	116	28.40	46	SNP	0.000	T
MACF1	23499	genome.wustl.edu	37	1	39797744	39797744	+	Silent	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:39797744G>A	ENST00000372915.3	+	36	5586	c.5499G>A	c.(5497-5499)gtG>gtA	p.V1833V	MACF1_ENST00000289893.4_Silent_p.V268V|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000567887.1_Silent_p.V1865V|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000564288.1_Silent_p.V1828V			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1833					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATGAAGCAGTGAGCAATGATC	0.498																																						dbGAP											0													142.0	121.0	128.0					1																	39797744		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.5499G>A	1.37:g.39797744G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.V1865	ENST00000372915.3	37	c.5595		1																																																																																			MACF1	-	pfam_Plectin_repeat,superfamily_RNaseH-like_dom,smart_Plectin_repeat	ENSG00000127603		0.498	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	247	0.00	0	G	NM_033044		39797744	39797744	+1	no_errors	ENST00000567887	ensembl	human	putative	69_37n	silent	133	22.22	38	SNP	0.023	A
MACF1	23499	genome.wustl.edu	37	1	39798309	39798309	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:39798309G>C	ENST00000372915.3	+	36	6151	c.6064G>C	c.(6064-6066)Gag>Cag	p.E2022Q	MACF1_ENST00000289893.4_Missense_Mutation_p.E457Q|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000567887.1_Missense_Mutation_p.E2054Q|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000564288.1_Missense_Mutation_p.E2017Q			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	2022					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AAAAACTCCTGAGGGATTGCA	0.428																																						dbGAP											0													88.0	94.0	92.0					1																	39798309		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.6064G>C	1.37:g.39798309G>C	ENSP00000362006:p.Glu2022Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.E2054Q	ENST00000372915.3	37	c.6160		1	.	.	.	.	.	.	.	.	.	.	G	0.061	-1.223495	0.01530	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.63580	-0.05;1.0	5.88	-2.5	0.06384	.	0.737825	0.12503	N	0.463210	T	0.44912	0.1316	N	0.24115	0.695	0.09310	N	1	B	0.32010	0.351	B	0.35182	0.197	T	0.41627	-0.9498	10	0.56958	D	0.05	.	8.775	0.34756	0.4372:0.096:0.4668:0.0	.	2022	Q9UPN3	MACF1_HUMAN	Q	2022;457	ENSP00000362006:E2022Q;ENSP00000289893:E457Q	ENSP00000289893:E457Q	E	+	1	0	MACF1	39570896	0.010000	0.17322	0.006000	0.13384	0.019000	0.09904	0.228000	0.17814	-0.329000	0.08527	-0.266000	0.10368	GAG	MACF1	-	superfamily_RNaseH-like_dom	ENSG00000127603		0.428	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	217	0.00	0	G	NM_033044		39798309	39798309	+1	no_errors	ENST00000567887	ensembl	human	putative	69_37n	missense	184	23.33	56	SNP	0.000	C
MAGEB10	139422	genome.wustl.edu	37	X	27839536	27839536	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chrX:27839536C>T	ENST00000356790.2	+	3	358	c.113C>T	c.(112-114)tCt>tTt	p.S38F		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	38										NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						GAGGAAGAATCTCCCCCCTCT	0.522																																						dbGAP											0													56.0	53.0	54.0					X																	27839536		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.113C>T	X.37:g.27839536C>T	ENSP00000368304:p.Ser38Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q494Y6|Q494Y7|Q9BZ78	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.S38F	ENST00000356790.2	37	c.113	CCDS35221.1	X	.	.	.	.	.	.	.	.	.	.	c	1.766	-0.485606	0.04352	.	.	ENSG00000177689	ENST00000356790	T	0.06528	3.29	2.52	-5.04	0.02964	Melanoma associated antigen, MAGE, N-terminal (1);	0.621647	0.13826	U	0.360067	T	0.03477	0.0100	L	0.43152	1.355	0.09310	N	1	B	0.12013	0.005	B	0.14023	0.01	T	0.48969	-0.8987	10	0.08381	T	0.77	.	1.8853	0.03237	0.1967:0.4476:0.151:0.2048	.	38	Q96LZ2	MAGBA_HUMAN	F	38	ENSP00000368304:S38F	ENSP00000368304:S38F	S	+	2	0	MAGEB10	27749457	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.759000	0.01808	-1.775000	0.01287	-0.623000	0.04022	TCT	MAGEB10	-	pfam_Melanoma_ass_antigen_N	ENSG00000177689		0.522	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB10	HGNC	protein_coding	OTTHUMT00000106216.1	159	0.00	0	C	NM_182506		27839536	27839536	+1	no_errors	ENST00000356790	ensembl	human	known	69_37n	missense	107	21.17	29	SNP	0.000	T
MAGEB1	4112	genome.wustl.edu	37	X	30269315	30269315	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chrX:30269315C>A	ENST00000378981.3	+	4	1026	c.705C>A	c.(703-705)caC>caA	p.H235Q	MAGEB1_ENST00000397550.1_Missense_Mutation_p.H235Q|MAGEB1_ENST00000397548.2_Missense_Mutation_p.H235Q	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	235	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						GAGAGGAGCACTTAATCTATG	0.498																																						dbGAP											0													76.0	63.0	68.0					X																	30269315		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.705C>A	X.37:g.30269315C>A	ENSP00000368264:p.His235Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.H235Q	ENST00000378981.3	37	c.705	CCDS14222.1	X	.	.	.	.	.	.	.	.	.	.	C	13.60	2.285768	0.40394	.	.	ENSG00000214107	ENST00000378981;ENST00000397550;ENST00000397548	T;T;T	0.05513	3.43;3.43;3.43	3.99	-0.711	0.11230	.	0.000000	0.85682	D	0.000000	T	0.32102	0.0818	H	0.97415	4	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.12889	-1.0530	10	0.87932	D	0	.	8.3979	0.32568	0.0:0.8349:0.0:0.1651	.	235	P43366	MAGB1_HUMAN	Q	235	ENSP00000368264:H235Q;ENSP00000380683:H235Q;ENSP00000380681:H235Q	ENSP00000368264:H235Q	H	+	3	2	MAGEB1	30179236	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.947000	0.03901	-0.326000	0.08564	0.600000	0.82982	CAC	MAGEB1	-	pfam_MAGE,pfscan_MAGE	ENSG00000214107		0.498	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB1	HGNC	protein_coding	OTTHUMT00000056160.1	309	0.32	1	C	NM_002363		30269315	30269315	+1	no_errors	ENST00000378981	ensembl	human	known	69_37n	missense	269	20.88	71	SNP	0.001	A
MAN1B1	11253	genome.wustl.edu	37	9	139995528	139995528	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr9:139995528G>C	ENST00000371589.4	+	7	1061	c.988G>C	c.(988-990)Gag>Cag	p.E330Q	MAN1B1_ENST00000474902.1_Missense_Mutation_p.E33Q	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	330					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		CAACCTGTTTGAGAGCACGAT	0.517																																						dbGAP											0													110.0	107.0	108.0					9																	139995528		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.988G>C	9.37:g.139995528G>C	ENSP00000360645:p.Glu330Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSG3|Q9BRS9|Q9Y5K7	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.E330Q	ENST00000371589.4	37	c.988	CCDS7029.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.8|23.8	4.461381|4.461381	0.84317|0.84317	.|.	.|.	ENSG00000177239|ENSG00000177239	ENST00000371589;ENST00000474902|ENST00000535144	D;D|.	0.85171|.	-1.95;-1.95|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	0.000000|.	0.64402|.	U|.	0.000001|.	D|.	0.91526|.	0.7324|.	H|H	0.99211|0.99211	4.47|4.47	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	0.998;0.999;1.0;0.999|.	D|.	0.94800|.	0.7970|.	9|.	.|.	.|.	.|.	-13.6814|-13.6814	18.7128|18.7128	0.91664|0.91664	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	231;294;330;231|.	B4DPS9;B4DR05;Q9UKM7;Q68D80|.	.;.;MA1B1_HUMAN;.|.	Q|S	330;33|303	ENSP00000360645:E330Q;ENSP00000447256:E33Q|.	.|.	E|X	+|+	1|2	0|2	MAN1B1|MAN1B1	139115349|139115349	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.369000|0.369000	0.29798|0.29798	9.461000|9.461000	0.97646|0.97646	2.667000|2.667000	0.90743|0.90743	0.655000|0.655000	0.94253|0.94253	GAG|TGA	MAN1B1	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	ENSG00000177239		0.517	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	HGNC	protein_coding	OTTHUMT00000055294.2	235	0.00	0	G	NM_016219		139995528	139995528	+1	no_errors	ENST00000371589	ensembl	human	known	69_37n	missense	106	28.38	42	SNP	1.000	C
MAP2K1	5604	genome.wustl.edu	37	15	66774131	66774131	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr15:66774131G>A	ENST00000307102.5	+	6	1138	c.607G>A	c.(607-609)Gag>Aag	p.E203K	MAP2K1_ENST00000566326.1_Missense_Mutation_p.E27K	NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	203	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)	p.E203K(4)		endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	CTCCCGTGGGGAGATCAAGCT	0.522																																						dbGAP											4	Substitution - Missense(4)	skin(4)	GRCh37	CM083720	MAP2K1	M							134.0	119.0	124.0					15																	66774131		2201	4299	6500	-	-	-	SO:0001583	missense	0			L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.607G>A	15.37:g.66774131G>A	ENSP00000302486:p.Glu203Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E203K	ENST00000307102.5	37	c.607	CCDS10216.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.925761|5.925761	0.97110|0.97110	.|.	.|.	ENSG00000169032|ENSG00000169032	ENST00000307102|ENST00000425818	T|.	0.65916|.	-0.18|.	5.52|5.52	5.52|5.52	0.82312|0.82312	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.60830|0.60830	0.2299|0.2299	L|L	0.28054|0.28054	0.825|0.825	0.80722|0.80722	D|D	1|1	D;D|.	0.54601|.	0.967;0.967|.	P;P|.	0.58391|.	0.838;0.838|.	T|T	0.64381|0.64381	-0.6421|-0.6421	10|6	0.54805|0.87932	T|D	0.06|0	-33.6509|-33.6509	19.0394|19.0394	0.92992|0.92992	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	181;203|.	B4DFY5;Q02750|.	.;MP2K1_HUMAN|.	K|E	203|116	ENSP00000302486:E203K|.	ENSP00000302486:E203K|ENSP00000400158:G116E	E|G	+|+	1|2	0|0	MAP2K1|MAP2K1	64561185|64561185	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.751000|9.751000	0.98889|0.98889	2.615000|2.615000	0.88500|0.88500	0.591000|0.591000	0.81541|0.81541	GAG|GGA	MAP2K1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169032		0.522	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K1	HGNC	protein_coding	OTTHUMT00000256906.4	526	0.00	0	G			66774131	66774131	+1	no_errors	ENST00000307102	ensembl	human	known	69_37n	missense	185	31.99	87	SNP	1.000	A
METTL5	29081	genome.wustl.edu	37	2	170668867	170668867	+	Intron	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr2:170668867C>G	ENST00000260953.5	-	6	908				METTL5_ENST00000409965.1_Intron|METTL5_ENST00000410097.1_Missense_Mutation_p.E231Q|METTL5_ENST00000409837.1_Intron|METTL5_ENST00000308099.3_Intron|METTL5_ENST00000392640.2_Intron|METTL5_ENST00000409340.1_Intron	NM_014168.2	NP_054887.2	Q9NRN9	METL5_HUMAN	methyltransferase like 5								methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			breast(2)|central_nervous_system(1)|large_intestine(5)|lung(1)|prostate(1)	10						tctcttgcctcagcctcccga	0.522																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF201938	CCDS33320.1	2q31.1	2011-01-28			ENSG00000138382	ENSG00000138382			25006	protein-coding gene	gene with protein product						11042152	Standard	XM_005246478		Approved	HSPC133	uc002ufn.3	Q9NRN9	OTTHUMG00000154117	ENST00000260953.5:c.591+99G>C	2.37:g.170668867C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPC9|Q9NVX1	Missense_Mutation	SNP	pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_RNA_methylase_dom,pfam_RNA_MeTrfase_RsmD,pfam_RNA_cap_Gua-N2-MeTrfase,pfam_Methyltransf_11	p.E231Q	ENST00000260953.5	37	c.691	CCDS33320.1	2	.	.	.	.	.	.	.	.	.	.	C	9.403	1.078529	0.20227	.	.	ENSG00000138382	ENST00000410097	.	.	.	1.3	1.3	0.21679	.	.	.	.	.	T	0.28962	0.0719	.	.	.	0.09310	N	1	P	0.39094	0.659	B	0.42959	0.403	T	0.13818	-1.0495	7	0.30854	T	0.27	.	6.3507	0.21375	0.0:1.0:0.0:0.0	.	231	B8ZZC8	.	Q	231	.	ENSP00000387056:E231Q	E	-	1	0	METTL5	170377113	0.000000	0.05858	0.008000	0.14137	0.022000	0.10575	0.266000	0.18534	0.567000	0.29293	0.313000	0.20887	GAG	METTL5	-	NULL	ENSG00000138382		0.522	METTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	METTL5	HGNC	protein_coding	OTTHUMT00000333957.1	190	0.00	0	C	NM_014168		170668867	170668867	-1	no_errors	ENST00000410097	ensembl	human	putative	69_37n	missense	97	32.41	47	SNP	0.022	G
MLXIP	22877	genome.wustl.edu	37	12	122516984	122516984	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr12:122516984G>C	ENST00000319080.7	+	1	357	c.225G>C	c.(223-225)caG>caC	p.Q75H						MLX interacting protein											NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		GCCGCCAGCAGATCATCCACA	0.736																																					Esophageal Squamous(105;787 1493 16200 18566 52466)	dbGAP											0													32.0	32.0	32.0					12																	122516984		692	1591	2283	-	-	-	SO:0001583	missense	0			AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.225G>C	12.37:g.122516984G>C	ENSP00000312834:p.Gln75His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.Q75H	ENST00000319080.7	37	c.225		12	.	.	.	.	.	.	.	.	.	.	G	20.2	3.941803	0.73557	.	.	ENSG00000175727	ENST00000319080	T	0.22539	1.95	4.1	2.22	0.28083	.	0.000000	0.64402	D	0.000001	T	0.42268	0.1195	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.20240	-1.0281	9	0.87932	D	0	-16.9753	7.6671	0.28437	0.0909:0.0:0.7472:0.162	.	75	Q9HAP2	MLXIP_HUMAN	H	75	ENSP00000312834:Q75H	ENSP00000312834:Q75H	Q	+	3	2	MLXIP	121001367	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	3.813000	0.55636	0.295000	0.22570	-0.448000	0.05591	CAG	MLXIP	-	NULL	ENSG00000175727		0.736	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	MLXIP	HGNC	protein_coding	OTTHUMT00000401718.2	46	0.00	0	G	NM_014938		122516984	122516984	+1	no_errors	ENST00000319080	ensembl	human	known	69_37n	missense	9	30.77	4	SNP	1.000	C
MYT1L	23040	genome.wustl.edu	37	2	1805566	1805566	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr2:1805566C>G	ENST00000399161.2	-	23	3925	c.3178G>C	c.(3178-3180)Gaa>Caa	p.E1060Q	MYT1L_ENST00000428368.2_Missense_Mutation_p.E1058Q|MYT1L_ENST00000407844.1_Missense_Mutation_p.E56Q	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1060					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCATCATTTTCTATACCTGTA	0.294																																						dbGAP											0													143.0	135.0	137.0					2																	1805566		1791	4059	5850	-	-	-	SO:0001583	missense	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3178G>C	2.37:g.1805566C>G	ENSP00000382114:p.Glu1060Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.E1060Q	ENST00000399161.2	37	c.3178		2	.	.	.	.	.	.	.	.	.	.	C	27.6	4.849126	0.91277	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000407844;ENST00000399157;ENST00000428368	T;T;T	0.51817	0.69;1.96;0.69	4.92	4.92	0.64577	.	0.046798	0.85682	D	0.000000	T	0.63954	0.2555	M	0.64404	1.975	0.80722	D	1	P;D;D	0.67145	0.906;0.993;0.996	P;P;P	0.60886	0.677;0.761;0.88	T	0.65096	-0.6251	10	0.49607	T	0.09	-16.2427	18.3225	0.90243	0.0:1.0:0.0:0.0	.	56;1060;1058	Q9UL68-3;Q9UL68;Q9UL68-4	.;MYT1L_HUMAN;.	Q	1060;1006;56;114;1058	ENSP00000382114:E1060Q;ENSP00000382111:E114Q;ENSP00000396103:E1058Q	ENSP00000295067:E1006Q	E	-	1	0	MYT1L	1784573	1.000000	0.71417	0.995000	0.50966	0.922000	0.55478	7.578000	0.82498	2.523000	0.85059	0.655000	0.94253	GAA	MYT1L	-	NULL	ENSG00000186487		0.294	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	430	0.00	0	C	NM_015025		1805566	1805566	-1	no_errors	ENST00000399161	ensembl	human	known	69_37n	missense	1028	13.32	158	SNP	1.000	G
NALCN	259232	genome.wustl.edu	37	13	102030929	102030929	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr13:102030929C>A	ENST00000251127.6	-	4	448	c.367G>T	c.(367-369)Gtg>Ttg	p.V123L	NALCN_ENST00000376196.3_Missense_Mutation_p.V123L|NALCN_ENST00000376200.5_Missense_Mutation_p.V123L|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	123					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					aCCTGTAGCACCAAAGAAACC	0.294																																						dbGAP											0													81.0	83.0	82.0					13																	102030929		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.367G>T	13.37:g.102030929C>A	ENSP00000251127:p.Val123Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.V123L	ENST00000251127.6	37	c.367	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	C	12.36	1.914058	0.33815	.	.	ENSG00000102452	ENST00000251127;ENST00000376196;ENST00000376200;ENST00000449582	D;D;D	0.98474	-4.95;-4.95;-4.95	5.18	5.18	0.71444	Ion transport (1);	0.127232	0.52532	D	0.000063	D	0.94961	0.8370	N	0.11789	0.175	0.80722	D	1	B;B	0.27166	0.084;0.17	B;B	0.30401	0.055;0.115	D	0.92847	0.6294	10	0.25106	T	0.35	.	18.6879	0.91571	0.0:1.0:0.0:0.0	.	123;123	F2Z323;Q8IZF0	.;NALCN_HUMAN	L	123	ENSP00000251127:V123L;ENSP00000365367:V123L;ENSP00000365373:V123L	ENSP00000251127:V123L	V	-	1	0	NALCN	100828930	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	7.351000	0.79395	2.424000	0.82194	0.591000	0.81541	GTG	NALCN	-	pfam_Ion_trans_dom	ENSG00000102452		0.294	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	229	0.00	0	C	NM_052867		102030929	102030929	-1	no_errors	ENST00000251127	ensembl	human	known	69_37n	missense	212	26.13	75	SNP	1.000	A
NCKAP5	344148	genome.wustl.edu	37	2	133636435	133636435	+	Silent	SNP	G	G	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr2:133636435G>T	ENST00000409261.1	-	9	1007	c.634C>A	c.(634-636)Cga>Aga	p.R212R	NCKAP5_ENST00000409213.1_Silent_p.R212R|NCKAP5_ENST00000317721.6_Silent_p.R212R|NCKAP5_ENST00000405974.3_Silent_p.R212R	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	212										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TCAAGACATCGCTCATATTGT	0.418																																						dbGAP											0													185.0	177.0	180.0					2																	133636435		1987	4155	6142	-	-	-	SO:0001819	synonymous_variant	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.634C>A	2.37:g.133636435G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Silent	SNP	NULL	p.R212	ENST00000409261.1	37	c.634	CCDS46418.1	2																																																																																			NCKAP5	-	NULL	ENSG00000176771		0.418	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	691	0.00	0	G	NM_207481		133636435	133636435	-1	no_errors	ENST00000317721	ensembl	human	known	69_37n	silent	323	29.87	138	SNP	0.721	T
NFIB	4781	genome.wustl.edu	37	9	14146751	14146751	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr9:14146751C>G	ENST00000380959.3	-	6	1335	c.862G>C	c.(862-864)Gac>Cac	p.D288H	NFIB_ENST00000397581.2_Missense_Mutation_p.D288H|NFIB_ENST00000380924.1_Missense_Mutation_p.D36H|NFIB_ENST00000380934.4_Missense_Mutation_p.D314H|NFIB_ENST00000397579.2_Missense_Mutation_p.D288H|NFIB_ENST00000543693.1_Missense_Mutation_p.D36H|NFIB_ENST00000380953.1_Missense_Mutation_p.D288H|NFIB_ENST00000397575.3_Missense_Mutation_p.D288H	NM_005596.3	NP_005587.2	O00712	NFIB_HUMAN	nuclear factor I/B	288					anterior commissure morphogenesis (GO:0021960)|chondrocyte differentiation (GO:0002062)|Clara cell differentiation (GO:0060486)|commissural neuron axon guidance (GO:0071679)|DNA replication (GO:0006260)|glial cell differentiation (GO:0010001)|hindbrain development (GO:0030902)|lung ciliated cell differentiation (GO:0061141)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000795)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|principal sensory nucleus of trigeminal nerve development (GO:0021740)|transcription from RNA polymerase II promoter (GO:0006366)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)	cerebellar mossy fiber (GO:0044300)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		GGGTAAAAGTCTCCTGTAGGA	0.408			T	"""MYB, HGMA2"""	"""adenoid cystic carcinoma, lipoma"""																																Esophageal Squamous(132;921 1730 14828 40753 46471)	dbGAP		Dom	yes		9	9p24.1	4781	nuclear factor I/B		E	0													209.0	206.0	207.0					9																	14146751		2203	4300	6503	-	-	-	SO:0001583	missense	0			U07810	CCDS6474.1, CCDS55291.1, CCDS55292.1, CCDS65007.1	9p24.1	2008-02-05			ENSG00000147862	ENSG00000147862			7785	protein-coding gene	gene with protein product		600728				7590749	Standard	NM_001190737		Approved	NFI-RED, NFIB2, NFIB3	uc003zlf.3	O00712	OTTHUMG00000021027	ENST00000380959.3:c.862G>C	9.37:g.14146751C>G	ENSP00000370346:p.Asp288His	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V1P1|H7BYE8|O00166|Q12858|Q5VW29|Q63HM5|Q6ZNF9|Q96J45	Missense_Mutation	SNP	pfam_CTF/NFI,pfam_CTF/NFI_DNA-bd_N,pfam_MAD_homology1_Dwarfin-type,smart_MAD_homology1_Dwarfin-type,pfscan_CTF/NFI_DNA-bd-dom	p.D288H	ENST00000380959.3	37	c.862	CCDS6474.1	9	.	.	.	.	.	.	.	.	.	.	C	24.5	4.533268	0.85812	.	.	ENSG00000147862	ENST00000380934;ENST00000380959;ENST00000380953;ENST00000397575;ENST00000397581;ENST00000397579;ENST00000543693;ENST00000380924	T;T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.68622	0.3021	M	0.61703	1.905	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;0.995;1.0;0.999	D;D;D;D	0.87578	0.998;0.956;0.998;0.979	T	0.69731	-0.5066	10	0.87932	D	0	-5.6735	19.8413	0.96690	0.0:1.0:0.0:0.0	.	288;288;288;36	Q5VW27;Q5VW29;O00712;G3V1P1	.;.;NFIB_HUMAN;.	H	314;288;288;288;288;288;36;36	ENSP00000370321:D314H;ENSP00000370346:D288H;ENSP00000370340:D288H;ENSP00000380705:D288H;ENSP00000380711:D288H;ENSP00000380709:D288H;ENSP00000442888:D36H;ENSP00000370311:D36H	ENSP00000370311:D36H	D	-	1	0	NFIB	14136751	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.457000	0.73505	2.779000	0.95612	0.655000	0.94253	GAC	NFIB	-	pfam_CTF/NFI	ENSG00000147862		0.408	NFIB-001	KNOWN	basic|CCDS	protein_coding	NFIB	HGNC	protein_coding	OTTHUMT00000055468.1	653	0.15	1	C	NM_005596		14146751	14146751	-1	no_errors	ENST00000397581	ensembl	human	known	69_37n	missense	535	21.44	146	SNP	1.000	G
NFKBIA	4792	genome.wustl.edu	37	14	35873760	35873760	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr14:35873760C>T	ENST00000216797.5	-	1	192	c.91G>A	c.(91-93)Gac>Aac	p.D31N	NFKBIA_ENST00000557100.1_5'UTR|NFKBIA_ENST00000557389.1_5'Flank|NFKBIA_ENST00000557140.1_Missense_Mutation_p.D31N	NM_020529.2	NP_065390.1	P25963	IKBA_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	31					apoptotic process (GO:0006915)|cellular response to cold (GO:0070417)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|cytoplasmic sequestering of transcription factor (GO:0042994)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein import into nucleus, translocation (GO:0000060)|regulation of cell proliferation (GO:0042127)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to exogenous dsRNA (GO:0043330)|response to muramyl dipeptide (GO:0032495)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|nuclear localization sequence binding (GO:0008139)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(1)|large_intestine(2)|liver(1)	7	Breast(36;0.0484)|Hepatocellular(127;0.158)		Lung(238;9.25e-06)|LUAD - Lung adenocarcinoma(48;1.53e-05)|Epithelial(34;0.00314)|all cancers(34;0.00891)	GBM - Glioblastoma multiforme(112;0.0222)	Acetylsalicylic acid(DB00945)	AGGCCGCTGTCGTGGCGGTCG	0.697																																						dbGAP											0													15.0	14.0	14.0					14																	35873760		2193	4284	6477	-	-	-	SO:0001583	missense	0				CCDS9656.1	14q13	2014-09-17			ENSG00000100906	ENSG00000100906		"""Ankyrin repeat domain containing"""	7797	protein-coding gene	gene with protein product		164008		NFKBI		1829648	Standard	NM_020529		Approved	IKBA, MAD-3, IkappaBalpha	uc001wtf.4	P25963	OTTHUMG00000140220	ENST00000216797.5:c.91G>A	14.37:g.35873760C>T	ENSP00000216797:p.Asp31Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8L6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D31N	ENST00000216797.5	37	c.91	CCDS9656.1	14	.	.	.	.	.	.	.	.	.	.	C	31	5.079003	0.94050	.	.	ENSG00000100906	ENST00000216797;ENST00000557140;ENST00000553342	D;D;D	0.90563	-2.69;-2.69;-2.69	3.87	3.87	0.44632	.	.	.	.	.	D	0.94716	0.8295	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.95024	0.8163	9	0.52906	T	0.07	-1.0578	16.1623	0.81730	0.0:1.0:0.0:0.0	.	31;31	G3V3I4;P25963	.;IKBA_HUMAN	N	31	ENSP00000216797:D31N;ENSP00000451257:D31N;ENSP00000451281:D31N	ENSP00000216797:D31N	D	-	1	0	NFKBIA	34943511	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.035000	0.76517	1.853000	0.53794	0.313000	0.20887	GAC	NFKBIA	-	NULL	ENSG00000100906		0.697	NFKBIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFKBIA	HGNC	protein_coding	OTTHUMT00000276683.1	37	0.00	0	C	NM_020529		35873760	35873760	-1	no_errors	ENST00000216797	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	T
NOTCH4	4855	genome.wustl.edu	37	6	32190561	32190561	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr6:32190561C>G	ENST00000375023.3	-	3	316	c.178G>C	c.(178-180)Gag>Cag	p.E60Q		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	60	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TGGCACGTCTCACCCAGGAAG	0.617																																						dbGAP											0													38.0	41.0	40.0					6																	32190561		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.178G>C	6.37:g.32190561C>G	ENSP00000364163:p.Glu60Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_4,prints_Notch_dom	p.E60Q	ENST00000375023.3	37	c.178	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	C	11.36	1.616532	0.28801	.	.	ENSG00000204301	ENST00000375023	T	0.75938	-0.98	4.13	4.13	0.48395	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.157458	0.29722	N	0.011379	T	0.58694	0.2140	N	0.16743	0.435	0.80722	D	1	D;B	0.61080	0.989;0.165	D;B	0.63957	0.92;0.033	T	0.60136	-0.7322	10	0.06365	T	0.9	.	13.9161	0.63899	0.0:1.0:0.0:0.0	.	60;60	Q6P3V5;Q99466	.;NOTC4_HUMAN	Q	60	ENSP00000364163:E60Q	ENSP00000364163:E60Q	E	-	1	0	NOTCH4	32298539	0.593000	0.26840	1.000000	0.80357	0.997000	0.91878	2.439000	0.44846	2.129000	0.65627	0.555000	0.69702	GAG	NOTCH4	-	smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Notch,pfscan_EG-like_dom	ENSG00000204301		0.617	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	104	0.00	0	C			32190561	32190561	-1	no_errors	ENST00000375023	ensembl	human	known	69_37n	missense	60	24.05	19	SNP	1.000	G
NPAT	4863	genome.wustl.edu	37	11	108031617	108031617	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr11:108031617T>C	ENST00000278612.8	-	17	4301	c.4196A>G	c.(4195-4197)aAg>aGg	p.K1399R		NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	1399					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		CTTAATTTTCTTCTTTTTCAT	0.338																																						dbGAP											0													61.0	58.0	59.0					11																	108031617		1820	4070	5890	-	-	-	SO:0001583	missense	0			X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.4196A>G	11.37:g.108031617T>C	ENSP00000278612:p.Lys1399Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.K1399R	ENST00000278612.8	37	c.4196	CCDS41710.1	11	.	.	.	.	.	.	.	.	.	.	T	19.20	3.782079	0.70222	.	.	ENSG00000149308	ENST00000278612	T	0.13538	2.58	5.37	4.23	0.50019	.	0.112759	0.64402	D	0.000014	T	0.33818	0.0876	M	0.72894	2.215	0.46564	D	0.999107	D	0.89917	1.0	D	0.76575	0.988	T	0.02805	-1.1108	10	0.46703	T	0.11	-6.4726	11.4981	0.50422	0.0:0.071:0.0:0.929	.	1399	Q14207	NPAT_HUMAN	R	1399	ENSP00000278612:K1399R	ENSP00000278612:K1399R	K	-	2	0	NPAT	107536827	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.493000	0.60341	0.971000	0.38288	0.528000	0.53228	AAG	NPAT	-	NULL	ENSG00000149308		0.338	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAT	HGNC	protein_coding	OTTHUMT00000389506.2	339	0.00	0	T	NM_002519		108031617	108031617	-1	no_errors	ENST00000278612	ensembl	human	known	69_37n	missense	250	25.82	87	SNP	1.000	C
NPAT	4863	genome.wustl.edu	37	11	108032049	108032049	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr11:108032049G>C	ENST00000278612.8	-	17	3869	c.3764C>G	c.(3763-3765)tCa>tGa	p.S1255*		NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	1255					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		CCTACTTACTGAGCTGTGCCT	0.428																																						dbGAP											0													137.0	136.0	137.0					11																	108032049		1861	4098	5959	-	-	-	SO:0001587	stop_gained	0			X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.3764C>G	11.37:g.108032049G>C	ENSP00000278612:p.Ser1255*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Nonsense_Mutation	SNP	smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.S1255*	ENST00000278612.8	37	c.3764	CCDS41710.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.410048|6.410048	0.97546|0.97546	.|.	.|.	ENSG00000149308|ENSG00000149308	ENST00000527296|ENST00000278612	.|.	.|.	.|.	4.74|4.74	4.74|4.74	0.60224|0.60224	.|.	.|0.230535	.|0.37437	.|N	.|0.002081	T|.	0.77418|.	0.4127|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.80589|.	-0.1315|.	3|.	.|0.87932	.|D	.|0	-10.0645|-10.0645	18.2768|18.2768	0.90087|0.90087	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|X	254|1255	.|.	.|ENSP00000278612:S1255X	Q|S	-|-	1|2	0|0	NPAT|NPAT	107537259|107537259	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.055000|0.055000	0.15305|0.15305	8.343000|8.343000	0.90052|0.90052	2.628000|2.628000	0.89032|0.89032	0.650000|0.650000	0.86243|0.86243	CAG|TCA	NPAT	-	NULL	ENSG00000149308		0.428	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAT	HGNC	protein_coding	OTTHUMT00000389506.2	256	0.00	0	G	NM_002519		108032049	108032049	-1	no_errors	ENST00000278612	ensembl	human	known	69_37n	nonsense	209	26.57	76	SNP	0.998	C
NPDC1	56654	genome.wustl.edu	37	9	139934476	139934476	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr9:139934476C>G	ENST00000371601.4	-	8	1045	c.832G>C	c.(832-834)Gag>Cag	p.E278Q	RP11-229P13.20_ENST00000457302.2_lincRNA|NPDC1_ENST00000371600.3_Missense_Mutation_p.E356Q|NPDC1_ENST00000488145.1_5'Flank	NM_015392.3	NP_056207.3	Q9NQX5	NPDC1_HUMAN	neural proliferation, differentiation and control, 1	278						integral component of membrane (GO:0016021)				NS(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	5	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		TCATTCTCCTCATCCGAGGAG	0.672																																						dbGAP											0													63.0	61.0	61.0					9																	139934476		2200	4299	6499	-	-	-	SO:0001583	missense	0			AF285836	CCDS7024.1	9q34.3	2008-07-21			ENSG00000107281	ENSG00000107281			7899	protein-coding gene	gene with protein product		605798				11245976	Standard	NM_015392		Approved	DKFZp586J0523, CAB-, CAB1	uc004ckt.2	Q9NQX5	OTTHUMG00000020956	ENST00000371601.4:c.832G>C	9.37:g.139934476C>G	ENSP00000360660:p.Glu278Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SPY8|Q9BTD6|Q9BXT3|Q9NQS2|Q9Y434	Missense_Mutation	SNP	pfam_NPDC1	p.E356Q	ENST00000371601.4	37	c.1066	CCDS7024.1	9	.	.	.	.	.	.	.	.	.	.	c	11.98	1.799752	0.31869	.	.	ENSG00000107281	ENST00000371600;ENST00000371601	.	.	.	3.43	3.43	0.39272	.	0.238428	0.24879	U	0.034875	T	0.62245	0.2412	M	0.64997	1.995	0.25621	N	0.986404	D;D;P;D	0.71674	0.998;0.998;0.945;0.998	D;D;P;D	0.64595	0.927;0.911;0.821;0.911	T	0.56062	-0.8041	9	0.66056	D	0.02	-18.9346	13.5648	0.61810	0.0:1.0:0.0:0.0	.	278;278;356;278	Q8WXX4;Q9NQX5;Q5SPY9;Q8NCE1	.;NPDC1_HUMAN;.;.	Q	356;278	.	ENSP00000360659:E356Q	E	-	1	0	NPDC1	139054297	0.984000	0.35163	0.365000	0.25901	0.070000	0.16714	2.751000	0.47508	1.729000	0.51567	0.486000	0.48141	GAG	NPDC1	-	pfam_NPDC1	ENSG00000107281		0.672	NPDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPDC1	HGNC	protein_coding	OTTHUMT00000055182.1	175	0.00	0	C	NM_015392		139934476	139934476	-1	no_errors	ENST00000371600	ensembl	human	known	69_37n	missense	66	29.79	28	SNP	0.867	G
NT5C1B	93034	genome.wustl.edu	37	2	18757611	18757611	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr2:18757611C>G	ENST00000359846.2	-	9	1425	c.1348G>C	c.(1348-1350)Gat>Cat	p.D450H	NT5C1B_ENST00000600945.1_Missense_Mutation_p.D450H|NT5C1B-RDH14_ENST00000532967.1_Missense_Mutation_p.D450H|NT5C1B_ENST00000304081.4_Missense_Mutation_p.D390H	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	450					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				TTGGCTCCATCAAACATTGTC	0.413																																						dbGAP											0													94.0	86.0	89.0					2																	18757611		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.1348G>C	2.37:g.18757611C>G	ENSP00000352904:p.Asp450His	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	pfam_5-nucleotidase	p.D450H	ENST00000359846.2	37	c.1348	CCDS33150.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.44|18.44	3.624697|3.624697	0.66901|0.66901	.|.	.|.	ENSG00000250741;ENSG00000250741;ENSG00000185013;ENSG00000185013|ENSG00000185013	ENST00000532967;ENST00000444297;ENST00000304081;ENST00000359846|ENST00000418427	D|.	0.89746|.	-2.56|.	5.42|5.42	3.52|3.52	0.40303|0.40303	.|.	0.509027|.	0.23987|.	N|.	0.042618|.	T|.	0.37812|.	0.1017|.	L|L	0.52011|0.52011	1.625|1.625	0.23669|0.23669	N|N	0.997151|0.997151	P;P;P;P;P;P;P;P|.	0.51057|.	0.923;0.923;0.923;0.923;0.873;0.905;0.923;0.941|.	P;P;P;P;P;P;P;P|.	0.56343|.	0.796;0.796;0.796;0.796;0.601;0.693;0.796;0.735|.	T|.	0.33675|.	-0.9859|.	10|.	0.54805|.	T|.	0.06|.	-28.5975|-28.5975	2.4008|2.4008	0.04400|0.04400	0.2667:0.4967:0.0:0.2366|0.2667:0.4967:0.0:0.2366	.|.	433;467;390;433;392;390;450;450|.	E7EXB7;B4DZ86;B4DXQ9;B4DXZ9;C9J2C7;Q96P26-2;Q96P26;Q96P26-4|.	.;.;.;.;.;.;5NT1B_HUMAN;.|.	H|S	450;392;390;450|104	ENSP00000412639:D392H|.	ENSP00000305979:D390H|.	D|X	-|-	1|2	0|2	NT5C1B-RDH14;NT5C1B|NT5C1B	18621092|18621092	0.996000|0.996000	0.38824|0.38824	0.998000|0.998000	0.56505|0.56505	0.914000|0.914000	0.54420|0.54420	1.294000|1.294000	0.33365|0.33365	2.711000|2.711000	0.92665|0.92665	0.655000|0.655000	0.94253|0.94253	GAT|TGA	NT5C1B	-	pfam_5-nucleotidase	ENSG00000185013		0.413	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NT5C1B	HGNC	protein_coding	OTTHUMT00000323822.1	207	0.00	0	C			18757611	18757611	-1	no_errors	ENST00000359846	ensembl	human	known	69_37n	missense	125	17.76	27	SNP	0.766	G
OR10J1	26476	genome.wustl.edu	37	1	159409770	159409770	+	Silent	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:159409770G>C	ENST00000423932.3	+	1	259	c.222G>C	c.(220-222)ctG>ctC	p.L74L	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	74					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					ACTTCTTCCTGAGCATGCTGT	0.453																																						dbGAP											0													151.0	137.0	142.0					1																	159409770		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.222G>C	1.37:g.159409770G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L74	ENST00000423932.3	37	c.222	CCDS1185.1	1																																																																																			OR10J1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000196184		0.453	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J1	HGNC	protein_coding	OTTHUMT00000059020.1	384	0.00	0	G	NM_012351		159409770	159409770	+1	no_errors	ENST00000423932	ensembl	human	known	69_37n	silent	248	19.16	59	SNP	0.077	C
OR2G3	81469	genome.wustl.edu	37	1	247769442	247769442	+	Silent	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:247769442C>G	ENST00000320002.2	+	1	587	c.555C>G	c.(553-555)ctC>ctG	p.L185L	RP11-978I15.10_ENST00000446347.1_RNA|RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	185						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CAGCTCTTCTCAAGTTGGCTT	0.443																																						dbGAP											0													207.0	184.0	192.0					1																	247769442		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.555C>G	1.37:g.247769442C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN64|Q5JQT1|Q6IF45	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L185	ENST00000320002.2	37	c.555	CCDS31093.1	1																																																																																			OR2G3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000177476		0.443	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G3	HGNC	protein_coding	OTTHUMT00000097624.1	664	0.00	0	C			247769442	247769442	+1	no_errors	ENST00000320002	ensembl	human	known	69_37n	silent	629	12.76	92	SNP	0.541	G
OR2T35	403244	genome.wustl.edu	37	1	248801684	248801684	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:248801684C>G	ENST00000317450.3	-	1	875	c.876G>C	c.(874-876)ttG>ttC	p.L292F		NM_001001827.1	NP_001001827.1	Q8NGX2	O2T35_HUMAN	olfactory receptor, family 2, subfamily T, member 35	292						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	6	all_cancers(71;2.04e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTTTATTCCTCAAGCTGTAGA	0.537																																						dbGAP											0													9.0	4.0	6.0					1																	248801684		1914	3235	5149	-	-	-	SO:0001583	missense	0			BK004475	CCDS31123.1	1q44	2012-08-09			ENSG00000177151	ENSG00000177151		"""GPCR / Class A : Olfactory receptors"""	31257	protein-coding gene	gene with protein product							Standard	NM_001001827		Approved		uc001ies.1	Q8NGX2	OTTHUMG00000040380	ENST00000317450.3:c.876G>C	1.37:g.248801684C>G	ENSP00000324369:p.Leu292Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEY7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L292F	ENST00000317450.3	37	c.876	CCDS31123.1	1	.	.	.	.	.	.	.	.	.	.	.	2.498	-0.315906	0.05422	.	.	ENSG00000177151	ENST00000317450	T	0.39787	1.06	2.75	-0.94	0.10405	.	0.000000	0.31145	N	0.008172	T	0.22205	0.0535	L	0.31120	0.905	0.32975	D	0.522861	P	0.51653	0.947	B	0.40134	0.32	T	0.31943	-0.9925	10	0.54805	T	0.06	.	3.1344	0.06434	0.1575:0.4251:0.3102:0.1071	.	292	Q8NGX2	O2T35_HUMAN	F	292	ENSP00000324369:L292F	ENSP00000324369:L292F	L	-	3	2	OR2T35	246868307	0.462000	0.25791	0.751000	0.31187	0.059000	0.15707	-0.385000	0.07379	0.030000	0.15379	-0.610000	0.04054	TTG	OR2T35	-	prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000177151		0.537	OR2T35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T35	HGNC	protein_coding	OTTHUMT00000097130.1	110	0.90	1	C	NM_001001827		248801684	248801684	-1	no_errors	ENST00000317450	ensembl	human	known	69_37n	missense	102	19.05	24	SNP	0.960	G
OS9	10956	genome.wustl.edu	37	12	58112055	58112055	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr12:58112055G>A	ENST00000315970.7	+	11	1302	c.1261G>A	c.(1261-1263)Gag>Aag	p.E421K	OS9_ENST00000257966.8_Missense_Mutation_p.E422K|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000435406.2_Missense_Mutation_p.E369K|OS9_ENST00000413095.2_Missense_Mutation_p.E215K|OS9_ENST00000551035.1_Missense_Mutation_p.E389K|OS9_ENST00000439210.2_Missense_Mutation_p.E362K|OS9_ENST00000552285.1_Missense_Mutation_p.E421K|OS9_ENST00000389146.6_Missense_Mutation_p.E421K|OS9_ENST00000389142.5_Missense_Mutation_p.E421K	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	421	Asp/Glu-rich (acidic).				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			ggatgaggatgaggatgagga	0.537																																						dbGAP											0													250.0	209.0	223.0					12																	58112055		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.1261G>A	12.37:g.58112055G>A	ENSP00000318165:p.Glu421Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Missense_Mutation	SNP	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom	p.E421K	ENST00000315970.7	37	c.1261	CCDS31843.1	12	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619306	0.66787	.	.	ENSG00000135506	ENST00000552285;ENST00000315970;ENST00000439210;ENST00000389146;ENST00000413095;ENST00000551035;ENST00000257966;ENST00000435406;ENST00000389142	T;T;T;T;T;T;T;T;T	0.32272	1.91;1.91;1.85;1.84;1.46;1.89;1.91;1.88;1.86	5.32	5.32	0.75619	.	1.619920	0.03523	N	0.221374	T	0.34745	0.0908	L	0.29908	0.895	0.28500	N	0.914071	P;P;D;B;B;B;B;B	0.57257	0.651;0.557;0.979;0.341;0.421;0.231;0.144;0.224	B;B;P;B;B;B;B;B	0.52343	0.15;0.234;0.696;0.104;0.118;0.035;0.021;0.034	T	0.12243	-1.0555	10	0.07644	T	0.81	.	11.3544	0.49607	0.0831:0.0:0.9169:0.0	.	362;389;215;422;421;421;421;421	E7EW91;F8VUH2;B4E321;G3XA88;E9PEY5;Q9BW99;A6NLB2;Q13438	.;.;.;.;.;.;.;OS9_HUMAN	K	421;421;362;421;215;389;422;369;421	ENSP00000450010:E421K;ENSP00000318165:E421K;ENSP00000407360:E362K;ENSP00000373798:E421K;ENSP00000413112:E215K;ENSP00000447866:E389K;ENSP00000257966:E422K;ENSP00000389632:E369K;ENSP00000373794:E421K	ENSP00000257966:E422K	E	+	1	0	OS9	56398322	1.000000	0.71417	0.553000	0.28255	0.364000	0.29643	3.850000	0.55918	2.771000	0.95319	0.655000	0.94253	GAG	OS9	-	NULL	ENSG00000135506		0.537	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OS9	HGNC	protein_coding	OTTHUMT00000408344.1	1098	0.00	0	G	NM_006812		58112055	58112055	+1	no_errors	ENST00000315970	ensembl	human	known	69_37n	missense	454	28.23	179	SNP	0.648	A
OTOP2	92736	genome.wustl.edu	37	17	72926762	72926762	+	Silent	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr17:72926762G>C	ENST00000580223.1	+	5	1062	c.1032G>C	c.(1030-1032)ctG>ctC	p.L344L	OTOP2_ENST00000331427.4_Silent_p.L344L			Q7RTS6	OTOP2_HUMAN	otopetrin 2	344						integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					TGGTCAGCCTGAGCGGCTCCA	0.622																																						dbGAP											0													55.0	51.0	52.0					17																	72926762		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.1032G>C	17.37:g.72926762G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Otopetrin	p.L344	ENST00000580223.1	37	c.1032	CCDS11708.1	17																																																																																			OTOP2	-	pfam_Otopetrin	ENSG00000183034		0.622	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP2	HGNC	protein_coding	OTTHUMT00000445306.1	86	0.00	0	G	NM_178160		72926762	72926762	+1	no_errors	ENST00000331427	ensembl	human	known	69_37n	silent	23	42.50	17	SNP	0.478	C
PDE4D	5144	genome.wustl.edu	37	5	58270700	58270700	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr5:58270700C>G	ENST00000340635.6	-	15	2396	c.2221G>C	c.(2221-2223)Gag>Cag	p.E741Q	PDE4D_ENST00000503258.1_Missense_Mutation_p.E611Q|PDE4D_ENST00000360047.5_Missense_Mutation_p.E605Q|PDE4D_ENST00000546160.1_Missense_Mutation_p.E680Q|PDE4D_ENST00000502484.2_Missense_Mutation_p.E680Q|PDE4D_ENST00000317118.8_Missense_Mutation_p.E450Q|PDE4D_ENST00000358923.6_Missense_Mutation_p.E439Q|PDE4D_ENST00000405755.2_Missense_Mutation_p.E619Q|PDE4D_ENST00000507116.1_Missense_Mutation_p.E677Q	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	741					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	CCATCTTCCTCTAAAGTTAGT	0.507																																						dbGAP											0													204.0	205.0	205.0					5																	58270700		1960	4149	6109	-	-	-	SO:0001583	missense	0				CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.2221G>C	5.37:g.58270700C>G	ENSP00000345502:p.Glu741Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,prints_PDEase	p.E741Q	ENST00000340635.6	37	c.2221	CCDS47213.1	5	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244123	0.79912	.	.	ENSG00000113448	ENST00000340635;ENST00000356665;ENST00000360047;ENST00000507116;ENST00000358923;ENST00000317118;ENST00000503258;ENST00000405755;ENST00000502484;ENST00000546160	T;T;T;T;T;T;T;T;T	0.70631	-0.5;-0.47;-0.5;-0.27;-0.28;-0.47;-0.48;-0.5;-0.5	5.22	5.22	0.72569	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.242293	0.39615	N	0.001310	T	0.81317	0.4797	L	0.51853	1.615	0.80722	D	1	D;D;D;D;D;D;P;P	0.61080	0.989;0.981;0.989;0.989;0.989;0.989;0.481;0.481	D;D;D;P;P;D;B;B	0.72982	0.979;0.954;0.979;0.836;0.836;0.979;0.335;0.267	T	0.82092	-0.0628	10	0.66056	D	0.02	.	18.9581	0.92668	0.0:1.0:0.0:0.0	.	680;741;677;604;619;611;516;450	Q08499-11;Q08499;Q08499-6;Q08499-2;Q08499-9;Q08499-10;Q08499-4;Q08499-8	.;PDE4D_HUMAN;.;.;.;.;.;.	Q	741;610;605;677;439;450;611;619;680;680	ENSP00000345502:E741Q;ENSP00000353152:E605Q;ENSP00000424852:E677Q;ENSP00000351800:E439Q;ENSP00000321739:E450Q;ENSP00000425605:E611Q;ENSP00000384806:E619Q;ENSP00000423094:E680Q;ENSP00000442734:E680Q	ENSP00000321739:E450Q	E	-	1	0	PDE4D	58306457	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.320000	0.79064	2.728000	0.93425	0.655000	0.94253	GAG	PDE4D	-	NULL	ENSG00000113448		0.507	PDE4D-001	KNOWN	basic|CCDS	protein_coding	PDE4D	HGNC	protein_coding	OTTHUMT00000367940.3	344	0.00	0	C			58270700	58270700	-1	no_errors	ENST00000340635	ensembl	human	known	69_37n	missense	137	34.13	71	SNP	1.000	G
PCDHB1	29930	genome.wustl.edu	37	5	140431703	140431703	+	Silent	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr5:140431703C>T	ENST00000306549.3	+	1	725	c.648C>T	c.(646-648)gaC>gaT	p.D216D		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	216	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGCGGTGGACGGCGGGTCCC	0.597																																						dbGAP											0													16.0	18.0	17.0					5																	140431703		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.648C>T	5.37:g.140431703C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M257	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D216	ENST00000306549.3	37	c.648	CCDS4243.1	5																																																																																			PCDHB1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000171815		0.597	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	HGNC	protein_coding	OTTHUMT00000251822.2	48	0.00	0	C	NM_013340		140431703	140431703	+1	no_errors	ENST00000306549	ensembl	human	known	69_37n	silent	21	22.22	6	SNP	0.339	T
PHACTR1	221692	genome.wustl.edu	37	6	13283675	13283675	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr6:13283675G>A	ENST00000379335.3	+	3	328	c.223G>A	c.(223-225)Gaa>Aaa	p.E75K	PHACTR1_ENST00000332995.7_Missense_Mutation_p.E511K|PHACTR1_ENST00000379329.1_Missense_Mutation_p.E75K|RP1-257A7.4_ENST00000399446.2_RNA|RP1-257A7.4_ENST00000606150.1_RNA|PHACTR1_ENST00000457702.2_Missense_Mutation_p.E366K			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	511					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			GCCCACGGTGGAAGAGCTTCG	0.582																																						dbGAP											0													124.0	137.0	133.0					6																	13283675		2037	4203	6240	-	-	-	SO:0001583	missense	0			AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379335.3:c.223G>A	6.37:g.13283675G>A	ENSP00000368639:p.Glu75Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V2|Q3MJ93|Q5JSJ2	Nonsense_Mutation	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.W345*	ENST00000379335.3	37	c.1035		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.852685|5.852685	0.97030|0.97030	.|.	.|.	ENSG00000112137|ENSG00000112137	ENST00000332995;ENST00000457702;ENST00000379335;ENST00000379329|ENST00000415087	T;T|.	0.33654|.	1.4;1.41|.	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.48114|.	0.1482|.	L|L	0.31065|0.31065	0.9|0.9	0.80722|0.80722	D|D	1|1	D|.	0.63046|.	0.992|.	D|.	0.67548|.	0.952|.	T|.	0.37686|.	-0.9695|.	10|.	0.38643|.	T|.	0.18|.	-15.6552|-15.6552	19.0064|19.0064	0.92852|0.92852	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	511|.	Q9C0D0|.	PHAR1_HUMAN|.	K|X	511;366;75;75|345	ENSP00000329880:E511K;ENSP00000397669:E366K|.	ENSP00000329880:E511K|.	E|W	+|+	1|3	0|0	PHACTR1|PHACTR1	13391654|13391654	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	9.869000|9.869000	0.99810|0.99810	2.738000|2.738000	0.93877|0.93877	0.655000|0.655000	0.94253|0.94253	GAA|TGG	PHACTR1	-	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	ENSG00000112137		0.582	PHACTR1-003	KNOWN	basic|appris_candidate	protein_coding	PHACTR1	HGNC	protein_coding	OTTHUMT00000039878.1	173	0.00	0	G	XM_166420		13283675	13283675	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000415087	ensembl	human	known	69_37n	nonsense	103	22.56	30	SNP	1.000	A
PHB2	11331	genome.wustl.edu	37	12	7076337	7076337	+	Silent	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr12:7076337C>T	ENST00000535923.1	-	7	1067	c.786G>A	c.(784-786)aaG>aaA	p.K262K	SCARNA12_ENST00000459155.1_RNA|PHB2_ENST00000544134.1_5'Flank|MIR141_ENST00000384975.1_RNA|PHB2_ENST00000399433.2_Silent_p.K262K|PHB2_ENST00000546111.1_Intron|PHB2_ENST00000440277.1_Silent_p.K224K|U47924.29_ENST00000606539.1_RNA|U47924.27_ENST00000537269.1_lincRNA|PHB2_ENST00000542912.1_Silent_p.K262K	NM_001144831.1	NP_001138303.1			prohibitin 2											ovary(2)|pancreas(1)	3						CACTCACCGTCTTGGAGATAT	0.512																																						dbGAP											0													87.0	93.0	91.0					12																	7076337		1972	4146	6118	-	-	-	SO:0001819	synonymous_variant	0			AF126021	CCDS53741.1, CCDS58207.1	12p13	2013-03-11			ENSG00000215021	ENSG00000215021			30306	protein-coding gene	gene with protein product		610704				11302691, 9259555	Standard	NM_001144831		Approved	REA, BCAP37, Bap37, p22	uc021quf.1	Q99623	OTTHUMG00000168519	ENST00000535923.1:c.786G>A	12.37:g.7076337C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Band_7,smart_Band_7,prints_Prohibitin	p.K262	ENST00000535923.1	37	c.786	CCDS53741.1	12																																																																																			PHB2	-	NULL	ENSG00000215021		0.512	PHB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHB2	HGNC	protein_coding	OTTHUMT00000400040.3	348	0.00	0	C	NM_007273		7076337	7076337	-1	no_errors	ENST00000399433	ensembl	human	known	69_37n	silent	127	28.57	52	SNP	1.000	T
PKD1	5310	genome.wustl.edu	37	16	2140301	2140301	+	Silent	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr16:2140301G>C	ENST00000262304.4	-	45	12637	c.12429C>G	c.(12427-12429)ctC>ctG	p.L4143L	PKD1_ENST00000423118.1_Silent_p.L4142L|RP11-304L19.1_ENST00000570072.1_RNA|MIR1225_ENST00000408729.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	4143					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TGACCTTGCTGAGGCCCATCC	0.692																																						dbGAP											0													43.0	51.0	48.0					16																	2140301		2196	4296	6492	-	-	-	SO:0001819	synonymous_variant	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.12429C>G	16.37:g.2140301G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15140|Q15141	Silent	SNP	pfam_PKD_dom,pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_LipOase_LH2,pfam_C-type_lectin,pfam_WSC_carb-bd,pfam_GPS_dom,superfamily_C-type_lectin_fold,superfamily_Lipase_LipOase,superfamily_PKD_dom,superfamily_Fe_hydrogenase,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_WSC_carb-bd_subgr,smart_PKD/Chitinase_dom,smart_C-type_lectin,smart_GPS_dom,smart_LipOase_LH2,pfscan_GPS_dom,pfscan_C-type_lectin,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like,pfscan_WSC_carb-bd,prints_PKD_1,tigrfam_Polycystin_cat	p.L4143	ENST00000262304.4	37	c.12429	CCDS32369.1	16																																																																																			PKD1	-	NULL	ENSG00000008710		0.692	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1	82	0.00	0	G			2140301	2140301	-1	no_errors	ENST00000262304	ensembl	human	known	69_37n	silent	30	33.33	15	SNP	1.000	C
PRDM5	11107	genome.wustl.edu	37	4	121616407	121616407	+	Silent	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr4:121616407C>T	ENST00000264808.3	-	16	1992	c.1752G>A	c.(1750-1752)ctG>ctA	p.L584L	PRDM5_ENST00000515109.1_3'UTR|PRDM5_ENST00000428209.2_Silent_p.L553L|PRDM5_ENST00000506065.1_5'UTR	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	584					histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GCATTTTCTTCAGGCTAAAAG	0.358																																						dbGAP											0													93.0	91.0	92.0					4																	121616407		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.1752G>A	4.37:g.121616407C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAI9|Q0VAJ0|Q6NXQ7	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM5,pfscan_SET_dom,pfscan_Znf_C2H2	p.L584	ENST00000264808.3	37	c.1752	CCDS3716.1	4																																																																																			PRDM5	-	smart_Znf_C2H2-like,pirsf_Znf_PRDM5,pfscan_Znf_C2H2	ENSG00000138738		0.358	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM5	HGNC	protein_coding	OTTHUMT00000256528.2	259	0.00	0	C			121616407	121616407	-1	no_errors	ENST00000264808	ensembl	human	known	69_37n	silent	152	29.95	65	SNP	1.000	T
PRMT9	90826	genome.wustl.edu	37	4	148575483	148575483	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr4:148575483G>C	ENST00000322396.6	-	9	1807	c.1565C>G	c.(1564-1566)tCt>tGt	p.S522C	PRMT10_ENST00000541232.1_Missense_Mutation_p.S409C|TMEM184C_ENST00000508208.1_Intron	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		522						cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						AATTTCTGTAGATTCCAATAT	0.403																																						dbGAP											0													166.0	157.0	160.0					4																	148575483		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000322396.6:c.1565C>G	4.37:g.148575483G>C	ENSP00000314396:p.Ser522Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Missense_Mutation	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S522C	ENST00000322396.6	37	c.1565	CCDS3771.1	4	.	.	.	.	.	.	.	.	.	.	G	10.14	1.269376	0.23221	.	.	ENSG00000164169	ENST00000322396;ENST00000541232	T;T	0.29397	1.57;1.57	6.04	5.18	0.71444	.	0.212066	0.50627	N	0.000106	T	0.33265	0.0857	L	0.55103	1.725	0.35803	D	0.823252	B	0.12013	0.005	B	0.08055	0.003	T	0.31696	-0.9934	10	0.51188	T	0.08	-4.002	17.134	0.86734	0.0:0.1265:0.8735:0.0	.	522	Q6P2P2	ANM10_HUMAN	C	522;409	ENSP00000314396:S522C;ENSP00000439508:S409C	ENSP00000314396:S522C	S	-	2	0	PRMT10	148794933	1.000000	0.71417	0.991000	0.47740	0.557000	0.35523	3.714000	0.54889	1.506000	0.48736	0.561000	0.74099	TCT	PRMT10	-	NULL	ENSG00000164169		0.403	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT10	HGNC	protein_coding	OTTHUMT00000364650.1	358	0.00	0	G			148575483	148575483	-1	no_errors	ENST00000322396	ensembl	human	known	69_37n	missense	193	31.69	90	SNP	1.000	C
PRPF8	10594	genome.wustl.edu	37	17	1554097	1554097	+	Silent	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr17:1554097C>T	ENST00000572621.1	-	42	7272	c.7007G>A	c.(7006-7008)tGa>tAa	p.*2336*	RILP_ENST00000301336.6_5'Flank|PRPF8_ENST00000575116.1_5'Flank|PRPF8_ENST00000304992.6_Silent_p.*2336*			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	0					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GGGAAACGGTCAGGCATACAG	0.602																																						dbGAP											0													107.0	88.0	95.0					17																	1554097		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.7007G>A	17.37:g.1554097C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O14547|O75965	Silent	SNP	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_Pre-mRNA-splicing_factor-8,pfam_Prp8_U5-snRNA-bd,pfam_PRO_C,pfam_RRM_spliceosomal_PrP8,pfam_JAB1_Mov34_MPN_PAD1,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB1_Mov34_MPN_PAD1	p.*2336	ENST00000572621.1	37	c.7007	CCDS11010.1	17																																																																																			PRPF8	-	NULL	ENSG00000174231		0.602	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	HGNC	protein_coding	OTTHUMT00000438412.2	152	0.00	0	C			1554097	1554097	-1	no_errors	ENST00000304992	ensembl	human	known	69_37n	silent	48	36.00	27	SNP	0.823	T
PTPRH	5794	genome.wustl.edu	37	19	55716783	55716783	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr19:55716783C>T	ENST00000376350.3	-	4	552	c.530G>A	c.(529-531)gGa>gAa	p.G177E	PTPRH_ENST00000588559.1_5'UTR|PTPRH_ENST00000263434.5_Intron	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	177	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		GGGTTCAAGTCCATCCACGGT	0.557																																						dbGAP											0													168.0	152.0	157.0					19																	55716783		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.530G>A	19.37:g.55716783C>T	ENSP00000365528:p.Gly177Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.G177E	ENST00000376350.3	37	c.530	CCDS33110.1	19	.	.	.	.	.	.	.	.	.	.	C	8.181	0.793914	0.16327	.	.	ENSG00000080031	ENST00000376350	T	0.61274	0.12	3.93	-4.3	0.03710	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.33553	N	0.004797	T	0.49184	0.1542	M	0.80616	2.505	0.09310	N	1	B	0.31383	0.321	B	0.31442	0.13	T	0.46317	-0.9200	10	0.49607	T	0.09	.	5.5113	0.16882	0.0:0.2863:0.1576:0.5561	.	177	Q9HD43	PTPRH_HUMAN	E	177	ENSP00000365528:G177E	ENSP00000365528:G177E	G	-	2	0	PTPRH	60408595	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.515000	0.06290	-0.566000	0.06054	-1.959000	0.00480	GGA	PTPRH	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000080031		0.557	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	HGNC	protein_coding	OTTHUMT00000452649.1	508	0.00	0	C			55716783	55716783	-1	no_errors	ENST00000376350	ensembl	human	known	69_37n	missense	323	24.48	105	SNP	0.000	T
PUM1	9698	genome.wustl.edu	37	1	31437562	31437562	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:31437562G>A	ENST00000257075.5	-	14	2375	c.2282C>T	c.(2281-2283)cCt>cTt	p.P761L	PUM1_ENST00000373747.3_Missense_Mutation_p.P762L|PUM1_ENST00000424085.2_Missense_Mutation_p.P519L|PUM1_ENST00000373741.4_Missense_Mutation_p.P797L|PUM1_ENST00000423018.2_Missense_Mutation_p.P617L|PUM1_ENST00000490546.1_5'Flank|PUM1_ENST00000440538.2_Missense_Mutation_p.P735L|PUM1_ENST00000373742.2_Missense_Mutation_p.P702L|PUM1_ENST00000426105.2_Missense_Mutation_p.P761L	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	761	Ser-rich.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		AGAGAGGGAAGGAGGTGGTGT	0.502																																						dbGAP											0													249.0	228.0	235.0					1																	31437562		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.2282C>T	1.37:g.31437562G>A	ENSP00000257075:p.Pro761Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.P761L	ENST00000257075.5	37	c.2282	CCDS338.1	1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.426485	0.83667	.	.	ENSG00000134644	ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742	T;T;T;T;T;T;T;T	0.22539	2.05;1.95;2.22;2.21;2.3;2.2;2.32;1.99	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.49321	0.1550	M	0.71036	2.16	0.80722	D	1	D;D;D;D;D;B;D	0.89917	1.0;0.983;0.997;1.0;1.0;0.402;0.999	D;P;D;D;D;B;D	0.97110	0.999;0.824;0.946;1.0;0.999;0.201;0.96	T	0.31223	-0.9951	10	0.48119	T	0.1	-8.3092	20.2963	0.98556	0.0:0.0:1.0:0.0	.	702;617;797;735;761;761;761	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q53HH5	.;.;.;.;PUM1_HUMAN;.;.	L	519;761;762;499;761;735;797;617;702	ENSP00000400141:P519L;ENSP00000257075:P761L;ENSP00000362852:P762L;ENSP00000391723:P761L;ENSP00000401777:P735L;ENSP00000362846:P797L;ENSP00000399440:P617L;ENSP00000362847:P702L	ENSP00000257075:P761L	P	-	2	0	PUM1	31210149	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.813000	0.96785	0.655000	0.94253	CCT	PUM1	-	NULL	ENSG00000134644		0.502	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PUM1	HGNC	protein_coding	OTTHUMT00000010671.1	553	0.00	0	G			31437562	31437562	-1	no_errors	ENST00000426105	ensembl	human	known	69_37n	missense	350	21.12	94	SNP	1.000	A
RAET1G	353091	genome.wustl.edu	37	6	150240756	150240756	+	Silent	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr6:150240756C>T	ENST00000367360.2	-	2	349	c.282G>A	c.(280-282)ctG>ctA	p.L94L	RAET1G_ENST00000479265.1_Silent_p.L94L|RP11-244K5.8_ENST00000606915.1_RNA|RAET1E-AS1_ENST00000446954.2_RNA|RAET1E-AS1_ENST00000605899.1_RNA	NM_001001788.2	NP_001001788.2			retinoic acid early transcript 1G											NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|urinary_tract(1)	13		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.73e-12)		CCACCTCTCTCAGTACTGGGT	0.507																																						dbGAP											0													216.0	213.0	214.0					6																	150240756		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AY172579	CCDS43514.1	6q24.1-25.1	2009-04-29	2004-11-22		ENSG00000203722	ENSG00000203722			16795	protein-coding gene	gene with protein product		609244	"""retinoic acid early transcript 1G pseudogene"""			11827464, 15240696	Standard	NM_001001788		Approved	ULBP5	uc010kii.1	Q6H3X3	OTTHUMG00000015802	ENST00000367360.2:c.282G>A	6.37:g.150240756C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.L94	ENST00000367360.2	37	c.282	CCDS43514.1	6																																																																																			RAET1G	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000203722		0.507	RAET1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAET1G	HGNC	protein_coding	OTTHUMT00000042668.2	1414	0.00	0	C			150240756	150240756	-1	no_errors	ENST00000367360	ensembl	human	known	69_37n	silent	892	18.91	208	SNP	0.016	T
RB1	5925	genome.wustl.edu	37	13	48955532	48955532	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr13:48955532T>A	ENST00000267163.4	+	17	1786	c.1648T>A	c.(1648-1650)Tta>Ata	p.L550I		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	550	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GATAAAACATTTAGAACGATG	0.328		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												dbGAP	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	23	Whole gene deletion(15)|Unknown(8)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)											84.0	79.0	81.0					13																	48955532		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1648T>A	13.37:g.48955532T>A	ENSP00000267163:p.Leu550Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	SNP	pfam_Rb_C,pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,superfamily_Cyclin-like,superfamily_FH2_actin-bd,smart_Cyclin-like	p.L550I	ENST00000267163.4	37	c.1648	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	T	21.7	4.189356	0.78789	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	D	0.92752	-3.1	5.34	5.34	0.76211	Retinoblastoma-associated protein, A-box (1);Cyclin-like (2);	0.000000	0.64402	D	0.000002	D	0.95912	0.8669	M	0.88181	2.935	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.95945	0.8950	10	0.87932	D	0	.	8.0706	0.30687	0.0:0.1228:0.0:0.8772	.	550	P06400	RB_HUMAN	I	529;550	ENSP00000267163:L550I	ENSP00000267163:L550I	L	+	1	2	RB1	47853533	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.752000	0.55172	2.012000	0.59069	0.528000	0.53228	TTA	RB1	-	pfam_RB_A,superfamily_Cyclin-like	ENSG00000139687		0.328	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	226	0.00	0	T			48955532	48955532	+1	no_errors	ENST00000267163	ensembl	human	known	69_37n	missense	115	26.75	42	SNP	1.000	A
RB1	5925	genome.wustl.edu	37	13	48955534	48955534	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr13:48955534delA	ENST00000267163.4	+	17	1788	c.1650delA	c.(1648-1650)ttafs	p.L550fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	550	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TAAAACATTTAGAACGATGTG	0.323		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												dbGAP	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	23	Whole gene deletion(15)|Unknown(8)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)											84.0	78.0	80.0					13																	48955534		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1650delA	13.37:g.48955534delA	ENSP00000267163:p.Leu550fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	pfam_Rb_C,pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,superfamily_Cyclin-like,superfamily_FH2_actin-bd,smart_Cyclin-like	p.E551fs	ENST00000267163.4	37	c.1650	CCDS31973.1	13																																																																																			RB1	-	pfam_RB_A,superfamily_Cyclin-like	ENSG00000139687		0.323	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	222	0.00	0	A			48955534	48955534	+1	no_errors	ENST00000267163	ensembl	human	known	69_37n	frame_shift_del	113	24.84	38	DEL	1.000	-
RBM14	10432	genome.wustl.edu	37	11	66392812	66392812	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr11:66392812C>T	ENST00000310137.4	+	2	1604	c.1465C>T	c.(1465-1467)Cag>Tag	p.Q489*	RBM14_ENST00000409738.4_Intron|RBM4_ENST00000514361.3_Intron|RBM14_ENST00000393979.3_Intron|RBM4_ENST00000503028.2_Intron|RBM14-RBM4_ENST00000511114.1_Intron|RBM14-RBM4_ENST00000412278.2_Intron|RBM14-RBM4_ENST00000500635.2_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	489	Ala-rich.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CTATGGGGCTCAGTCGGCTGC	0.637																																						dbGAP											0													44.0	52.0	49.0					11																	66392812		2197	4294	6491	-	-	-	SO:0001587	stop_gained	0			AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.1465C>T	11.37:g.66392812C>T	ENSP00000311747:p.Gln489*	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Q489*	ENST00000310137.4	37	c.1465	CCDS8147.1	11	.	.	.	.	.	.	.	.	.	.	C	28.5	4.927398	0.92389	.	.	ENSG00000239306	ENST00000310137	.	.	.	5.75	5.75	0.90469	.	0.060479	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-3.4214	15.4418	0.75190	0.0:1.0:0.0:0.0	.	.	.	.	X	489	.	ENSP00000311747:Q489X	Q	+	1	0	RBM14	66149388	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.793000	0.62474	2.720000	0.93068	0.655000	0.94253	CAG	RBM14	-	NULL	ENSG00000239306		0.637	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM14	HGNC	protein_coding	OTTHUMT00000277128.1	54	0.00	0	C	NM_006328		66392812	66392812	+1	no_errors	ENST00000310137	ensembl	human	known	69_37n	nonsense	25	26.47	9	SNP	1.000	T
RFX3	5991	genome.wustl.edu	37	9	3263041	3263041	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr9:3263041G>T	ENST00000382004.3	-	14	1810	c.1499C>A	c.(1498-1500)aCg>aAg	p.T500K	RFX3_ENST00000358730.2_Missense_Mutation_p.T500K|RFX3_ENST00000302303.1_Missense_Mutation_p.T500K	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	500					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		ATTAAGCGACGTGTATCTTCG	0.493																																						dbGAP											0													165.0	141.0	149.0					9																	3263041		2203	4300	6503	-	-	-	SO:0001583	missense	0			AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.1499C>A	9.37:g.3263041G>T	ENSP00000371434:p.Thr500Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.T500K	ENST00000382004.3	37	c.1499	CCDS6449.1	9	.	.	.	.	.	.	.	.	.	.	G	35	5.491168	0.96339	.	.	ENSG00000080298	ENST00000382004;ENST00000358730;ENST00000302303;ENST00000458034	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.74527	0.3728	M	0.92026	3.265	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.985	T	0.78038	-0.2360	10	0.72032	D	0.01	-12.3973	20.8598	0.99761	0.0:0.0:1.0:0.0	.	500;500	P48380-2;P48380	.;RFX3_HUMAN	K	500;500;500;73	ENSP00000371434:T500K;ENSP00000351574:T500K;ENSP00000303847:T500K;ENSP00000400026:T73K	ENSP00000303847:T500K	T	-	2	0	RFX3	3253041	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	ACG	RFX3	-	NULL	ENSG00000080298		0.493	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX3	HGNC	protein_coding	OTTHUMT00000051545.1	320	0.31	1	G	NM_002919		3263041	3263041	-1	no_errors	ENST00000382004	ensembl	human	known	69_37n	missense	146	23.56	45	SNP	1.000	T
RLTPR	146206	genome.wustl.edu	37	16	67682005	67682005	+	Silent	SNP	C	C	T	rs375905851		TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr16:67682005C>T	ENST00000334583.6	+	14	1450	c.1122C>T	c.(1120-1122)ctC>ctT	p.L374L	RLTPR_ENST00000545661.1_Silent_p.L374L	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	374					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		TCCTGAATCTCGCAGGCACCG	0.672													C|||	1	0.000199681	0.0	0.0	5008	,	,		10691	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													41.0	45.0	44.0					16																	67682005		2078	4181	6259	-	-	-	SO:0001819	synonymous_variant	0			AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.1122C>T	16.37:g.67682005C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B8X2Z3	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L374	ENST00000334583.6	37	c.1122	CCDS45513.1	16																																																																																			RLTPR	-	NULL	ENSG00000159753		0.672	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RLTPR	HGNC	protein_coding	OTTHUMT00000467858.1	154	0.00	0	C	NM_001013838		67682005	67682005	+1	no_errors	ENST00000334583	ensembl	human	known	69_37n	silent	71	29.70	30	SNP	0.995	T
RNF6	6049	genome.wustl.edu	37	13	26793693	26793693	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr13:26793693C>T	ENST00000381588.4	-	3	846	c.94G>A	c.(94-96)Gag>Aag	p.E32K	RNF6_ENST00000399762.2_5'UTR|RNF6_ENST00000381570.3_Missense_Mutation_p.E32K|RNF6_ENST00000468480.1_5'UTR|RNF6_ENST00000346166.3_Missense_Mutation_p.E32K	NM_005977.3	NP_005968.1	Q9Y252	RNF6_HUMAN	ring finger protein (C3H2C3 type) 6	32					negative regulation of axon extension (GO:0030517)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K27-linked ubiquitination (GO:0044314)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(3)|ovary(2)|prostate(2)|skin(2)	23	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		TGGAGACGCTCTTGCTGCCAT	0.418																																						dbGAP											0													192.0	183.0	186.0					13																	26793693		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010346	CCDS9316.1	13q12.2	2013-01-09			ENSG00000127870	ENSG00000127870		"""RING-type (C3HC4) zinc fingers"""	10069	protein-coding gene	gene with protein product	"""RING-H2 protein RNF-6"""	604242				10331950	Standard	NM_005977		Approved	DKFZp686P0776	uc001uqq.3	Q9Y252	OTTHUMG00000016614	ENST00000381588.4:c.94G>A	13.37:g.26793693C>T	ENSP00000371000:p.Glu32Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDP0|Q5W0H0|Q9BZP5|Q9UF41	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.E32K	ENST00000381588.4	37	c.94	CCDS9316.1	13	.	.	.	.	.	.	.	.	.	.	C	32	5.130528	0.94473	.	.	ENSG00000127870	ENST00000346166;ENST00000381588;ENST00000381570	T;T;T	0.08720	3.06;3.06;3.06	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.28400	0.0702	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.00529	-1.1687	10	0.72032	D	0.01	-18.5647	16.8229	0.85923	0.0:1.0:0.0:0.0	.	32;32	Q9Y252;Q9BZP5	RNF6_HUMAN;.	K	32	ENSP00000342121:E32K;ENSP00000371000:E32K;ENSP00000370982:E32K	ENSP00000342121:E32K	E	-	1	0	RNF6	25691693	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.260000	0.78391	2.640000	0.89533	0.655000	0.94253	GAG	RNF6	-	NULL	ENSG00000127870		0.418	RNF6-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF6	HGNC	protein_coding	OTTHUMT00000044246.2	507	0.00	0	C	NM_005977		26793693	26793693	-1	no_errors	ENST00000346166	ensembl	human	known	69_37n	missense	241	29.53	101	SNP	1.000	T
SAGE1	55511	genome.wustl.edu	37	X	134995026	134995026	+	Silent	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chrX:134995026C>G	ENST00000370709.3	+	19	2685	c.2685C>G	c.(2683-2685)ctC>ctG	p.L895L	SAGE1_ENST00000537770.1_Silent_p.L519L|SAGE1_ENST00000535938.1_Silent_p.L895L|SAGE1_ENST00000324447.3_Silent_p.L895L			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	895						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					ACTGCCATCTCAGAAAAGTTA	0.378																																						dbGAP											0													45.0	39.0	41.0					X																	134995026		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.2685C>G	X.37:g.134995026C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JNW0	Silent	SNP	NULL	p.L895	ENST00000370709.3	37	c.2685	CCDS14652.1	X																																																																																			SAGE1	-	NULL	ENSG00000181433		0.378	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAGE1	HGNC	protein_coding	OTTHUMT00000058448.1	195	0.00	0	C	NM_018666		134995026	134995026	+1	no_errors	ENST00000324447	ensembl	human	known	69_37n	silent	160	25.58	55	SNP	0.001	G
SCARA3	51435	genome.wustl.edu	37	8	27528720	27528720	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr8:27528720C>T	ENST00000301904.3	+	6	1693	c.1673C>T	c.(1672-1674)tCa>tTa	p.S558L	SCARA3_ENST00000337221.4_Intron	NM_016240.2	NP_057324.2	Q6AZY7	SCAR3_HUMAN	scavenger receptor class A, member 3	558	Collagen-like 2.				receptor-mediated endocytosis (GO:0006898)|response to oxidative stress (GO:0006979)|UV protection (GO:0009650)	collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)			breast(1)|large_intestine(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	9		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Colorectal(74;0.148)		CCAGGGCCCTCAGGGCCTCAG	0.677																																						dbGAP											0													5.0	6.0	5.0					8																	27528720		2045	3973	6018	-	-	-	SO:0001583	missense	0			AB007829	CCDS34870.1, CCDS34871.1	8p21	2010-03-24			ENSG00000168077	ENSG00000168077			19000	protein-coding gene	gene with protein product	"""macrophage scavenger receptor-like 1"""	602728				9747040, 9580669	Standard	NM_182826		Approved	CSR1, CSR, MSLR1, APC7, MSRL1	uc003xga.1	Q6AZY7	OTTHUMG00000163898	ENST00000301904.3:c.1673C>T	8.37:g.27528720C>T	ENSP00000301904:p.Ser558Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UM15|Q9UM16	Missense_Mutation	SNP	pfam_Collagen	p.S558L	ENST00000301904.3	37	c.1673	CCDS34871.1	8	.	.	.	.	.	.	.	.	.	.	C	10.12	1.262746	0.23051	.	.	ENSG00000168077	ENST00000301904	D	0.93712	-3.27	5.36	1.36	0.22044	.	1.479250	0.03995	N	0.295597	D	0.89945	0.6862	L	0.43152	1.355	0.20489	N	0.999897	B	0.02656	0.0	B	0.04013	0.001	T	0.74250	-0.3726	10	0.31617	T	0.26	15.5211	7.7728	0.29019	0.439:0.4847:0.0:0.0763	.	558	Q6AZY7	SCAR3_HUMAN	L	558	ENSP00000301904:S558L	ENSP00000301904:S558L	S	+	2	0	SCARA3	27584639	0.004000	0.15560	0.002000	0.10522	0.156000	0.22039	2.140000	0.42159	-0.042000	0.13535	-0.397000	0.06425	TCA	SCARA3	-	pfam_Collagen	ENSG00000168077		0.677	SCARA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARA3	HGNC	protein_coding	OTTHUMT00000376258.2	12	0.00	0	C	NM_016240		27528720	27528720	+1	no_errors	ENST00000301904	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	0.317	T
SFTPB	6439	genome.wustl.edu	37	2	85893784	85893784	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr2:85893784C>G	ENST00000519937.2	-	4	368	c.349G>C	c.(349-351)Gac>Cac	p.D117H	SFTPB_ENST00000393822.3_Missense_Mutation_p.D129H|SFTPB_ENST00000342375.3_Missense_Mutation_p.D117H|SFTPB_ENST00000409383.1_Missense_Mutation_p.D129H			P07988	PSPB_HUMAN	surfactant protein B	117	Saposin B-type 1. {ECO:0000255|PROSITE- ProRule:PRU00415}.				organ morphogenesis (GO:0009887)|respiratory gaseous exchange (GO:0007585)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)	16						AAGTAGTCGTCAAGCACTTGG	0.622																																						dbGAP											0													176.0	143.0	154.0					2																	85893784		2203	4300	6503	-	-	-	SO:0001583	missense	0			J02761	CCDS1983.1, CCDS1983.2	2p12-p11.2	2008-08-26	2008-08-26		ENSG00000168878	ENSG00000168878			10801	protein-coding gene	gene with protein product		178640	"""surfactant, pulmonary-associated protein B"""	SFTP3		2924687, 1346779	Standard	NM_198843		Approved	SP-B	uc002sqh.3	P07988	OTTHUMG00000130181	ENST00000519937.2:c.349G>C	2.37:g.85893784C>G	ENSP00000428719:p.Asp117His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96R04	Missense_Mutation	SNP	pfam_SapB_2,pfam_SapA,pfam_SapB_1,superfamily_Saposin-like,smart_SapA,smart_SaposinB,pfscan_SapA,pfscan_SaposinB,prints_Saposin	p.D129H	ENST00000519937.2	37	c.385		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.642|9.642	1.139224|1.139224	0.21205|0.21205	.|.	.|.	ENSG00000168878|ENSG00000168878	ENST00000519937;ENST00000393822;ENST00000342375;ENST00000409383;ENST00000441838|ENST00000428225	T;T;T;T|.	0.77358|.	-1.09;-1.09;-1.09;-1.09|.	4.34|4.34	2.52|2.52	0.30459|0.30459	Saposin-like (2);Saposin-like type B, 2 (1);Saposin B (2);|.	0.283555|.	0.24801|.	N|.	0.035485|.	T|.	0.41442|.	0.1159|.	L|L	0.53249|0.53249	1.67|1.67	0.09310|0.09310	N|N	1|1	D;D|.	0.71674|.	0.998;0.998|.	D;D|.	0.67900|.	0.954;0.954|.	T|.	0.27054|.	-1.0085|.	10|.	0.59425|.	D|.	0.04|.	-2.4928|-2.4928	7.0339|7.0339	0.24983|0.24983	0.0:0.8007:0.0:0.1993|0.0:0.8007:0.0:0.1993	.|.	129;117|.	D6W5L6;P07988|.	.;PSPB_HUMAN|.	H|S	119;129;117;129;85|113	ENSP00000428719:D119H;ENSP00000377409:D129H;ENSP00000345161:D117H;ENSP00000386346:D129H|.	ENSP00000345161:D117H|.	D|X	-|-	1|2	0|2	SFTPB|SFTPB	85747295|85747295	0.089000|0.089000	0.21612|0.21612	0.001000|0.001000	0.08648|0.08648	0.004000|0.004000	0.04260|0.04260	0.730000|0.730000	0.26043|0.26043	0.283000|0.283000	0.22279|0.22279	0.462000|0.462000	0.41574|0.41574	GAC|TGA	SFTPB	-	pfam_SapB_2,superfamily_Saposin-like,smart_SaposinB,pfscan_SaposinB	ENSG00000168878		0.622	SFTPB-001	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	SFTPB	HGNC	protein_coding	OTTHUMT00000252499.3	231	0.43	1	C	NM_198843		85893784	85893784	-1	no_errors	ENST00000393822	ensembl	human	known	69_37n	missense	123	21.66	34	SNP	0.003	G
SIGLEC7	27036	genome.wustl.edu	37	19	51649165	51649165	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr19:51649165C>G	ENST00000317643.6	+	4	883	c.814C>G	c.(814-816)Ctg>Gtg	p.L272V	SIGLEC7_ENST00000305628.7_Missense_Mutation_p.L179V|SIGLEC7_ENST00000600577.1_Intron	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	272	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		GGGCCAGTCTCTGCGCTTGGT	0.537																																						dbGAP											0													152.0	147.0	149.0					19																	51649165		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.814C>G	19.37:g.51649165C>G	ENSP00000323328:p.Leu272Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L272V	ENST00000317643.6	37	c.814	CCDS12826.1	19	.	.	.	.	.	.	.	.	.	.	.	15.78	2.934484	0.52866	.	.	ENSG00000168995	ENST00000317643;ENST00000305628	T;T	0.09538	2.97;2.97	2.32	1.19	0.21007	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.300941	0.17859	N	0.159583	T	0.17662	0.0424	L	0.41236	1.265	0.09310	N	0.999999	P;D	0.60575	0.7;0.988	B;D	0.63877	0.174;0.919	T	0.04373	-1.0956	10	0.72032	D	0.01	.	6.8402	0.23959	0.0:0.7065:0.2935:0.0	.	179;272	Q9Y286-2;Q9Y286	.;SIGL7_HUMAN	V	272;179	ENSP00000323328:L272V;ENSP00000306757:L179V	ENSP00000306757:L179V	L	+	1	2	SIGLEC7	56340977	0.003000	0.15002	0.009000	0.14445	0.920000	0.55202	0.087000	0.14958	0.307000	0.22880	0.420000	0.28162	CTG	SIGLEC7	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000168995		0.537	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC7	HGNC	protein_coding	OTTHUMT00000464226.2	349	0.00	0	C	NM_016543		51649165	51649165	+1	no_errors	ENST00000317643	ensembl	human	known	69_37n	missense	184	21.85	52	SNP	0.009	G
SLC15A5	729025	genome.wustl.edu	37	12	16377519	16377519	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr12:16377519C>G	ENST00000344941.3	-	6	1179	c.1180G>C	c.(1180-1182)Gct>Cct	p.A394P		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	394					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(2)|lung(1)	3						GACAATGCAGCAAAAAGATTT	0.383																																						dbGAP											0													64.0	57.0	59.0					12																	16377519		692	1591	2283	-	-	-	SO:0001583	missense	0					12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.1180G>C	12.37:g.16377519C>G	ENSP00000340402:p.Ala394Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt	p.A394P	ENST00000344941.3	37	c.1180		12	.	.	.	.	.	.	.	.	.	.	C	19.72	3.879493	0.72294	.	.	ENSG00000188991	ENST00000344941	T	0.60040	0.22	4.74	4.74	0.60224	.	0.056988	0.64402	D	0.000001	T	0.72716	0.3495	M	0.71581	2.175	0.58432	D	0.999996	.	.	.	.	.	.	T	0.76580	-0.2907	8	0.72032	D	0.01	.	17.9076	0.88923	0.0:1.0:0.0:0.0	.	.	.	.	P	394	ENSP00000340402:A394P	ENSP00000340402:A394P	A	-	1	0	SLC15A5	16268786	1.000000	0.71417	0.649000	0.29536	0.631000	0.37964	6.714000	0.74692	2.461000	0.83175	0.585000	0.79938	GCT	SLC15A5	-	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt	ENSG00000188991		0.383	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	SLC15A5	HGNC	protein_coding	OTTHUMT00000401119.2	173	0.00	0	C	XM_001129090		16377519	16377519	-1	no_errors	ENST00000344941	ensembl	human	novel	69_37n	missense	70	32.04	33	SNP	1.000	G
SLC35B2	347734	genome.wustl.edu	37	6	44223268	44223268	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr6:44223268C>T	ENST00000393812.3	-	4	617	c.474G>A	c.(472-474)atG>atA	p.M158I	SLC35B2_ENST00000537814.1_Missense_Mutation_p.M25I|SLC35B2_ENST00000393810.1_3'UTR|SLC35B2_ENST00000538577.1_Missense_Mutation_p.M65I|SLC35B2_ENST00000495706.1_5'UTR|MIR4647_ENST00000583964.1_RNA	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	158					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GCACTCGGTTCATTAGCACCA	0.602																																						dbGAP											0													100.0	100.0	100.0					6																	44223268		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.474G>A	6.37:g.44223268C>T	ENSP00000377401:p.Met158Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Missense_Mutation	SNP	pfam_UAA,pfam_DMT	p.M158I	ENST00000393812.3	37	c.474	CCDS34462.1	6	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725523	0.48833	.	.	ENSG00000157593	ENST00000393812;ENST00000537814;ENST00000538577;ENST00000341553	T;T;T	0.26810	1.71;1.71;1.71	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.08403	0.0209	N	0.10809	0.05	0.80722	D	1	B;B	0.25904	0.113;0.137	B;B	0.30401	0.07;0.115	T	0.20806	-1.0264	10	0.12430	T	0.62	-12.674	20.0049	0.97433	0.0:1.0:0.0:0.0	.	65;158	F5H7Y9;Q8TB61	.;S35B2_HUMAN	I	158;25;65;158	ENSP00000377401:M158I;ENSP00000440340:M25I;ENSP00000443845:M65I	ENSP00000342455:M158I	M	-	3	0	SLC35B2	44331246	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.784000	0.85713	2.745000	0.94114	0.555000	0.69702	ATG	SLC35B2	-	pfam_UAA	ENSG00000157593		0.602	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35B2	HGNC	protein_coding	OTTHUMT00000040724.2	199	0.00	0	C			44223268	44223268	-1	no_errors	ENST00000393812	ensembl	human	known	69_37n	missense	87	26.27	31	SNP	1.000	T
SLC2A12	154091	genome.wustl.edu	37	6	134349970	134349970	+	Silent	SNP	G	G	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr6:134349970G>T	ENST00000275230.5	-	2	1148	c.993C>A	c.(991-993)acC>acA	p.T331T		NM_145176.2	NP_660159.1	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 12	331					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	17	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		TGGCAGGGATGGTGCTAATGA	0.502																																					Melanoma(122;1663 1672 14489 35294 41228)	dbGAP											0													80.0	66.0	71.0					6																	134349970		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL035699	CCDS5169.1	6q23.2	2013-05-22			ENSG00000146411	ENSG00000146411		"""Solute carriers"""	18067	protein-coding gene	gene with protein product		610372				11780753, 11832379	Standard	XM_006715349		Approved	GLUT12, GLUT8	uc003qem.1	Q8TD20	OTTHUMG00000015611	ENST00000275230.5:c.993C>A	6.37:g.134349970G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV17|Q7Z6U3|Q96MR8	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt	p.T331	ENST00000275230.5	37	c.993	CCDS5169.1	6																																																																																			SLC2A12	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000146411		0.502	SLC2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A12	HGNC	protein_coding	OTTHUMT00000042302.1	166	0.60	1	G			134349970	134349970	-1	no_errors	ENST00000275230	ensembl	human	known	69_37n	silent	102	26.62	37	SNP	0.997	T
SLC7A1	6541	genome.wustl.edu	37	13	30091320	30091320	+	Silent	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr13:30091320G>A	ENST00000380752.5	-	11	2024	c.1638C>T	c.(1636-1638)atC>atT	p.I546I	SLC7A1_ENST00000473577.1_5'UTR	NM_003045.4	NP_003036.1	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 1	546					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|stomach(1)|urinary_tract(2)	24		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GCTGCCTCCAGATGACGCCCG	0.622																																						dbGAP											0													38.0	37.0	37.0					13																	30091320		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF078107	CCDS9333.1	13q12.3	2013-05-22			ENSG00000139514	ENSG00000139514		"""Solute carriers"""	11057	protein-coding gene	gene with protein product	"""ecotropic retroviral receptor"", ""amino acid transporter, cationic 1"""	104615		ERR, ATRC1		1348489	Standard	NM_003045		Approved	CAT-1, HCAT1, REC1L	uc001uso.3	P30825	OTTHUMG00000016658	ENST00000380752.5:c.1638C>T	13.37:g.30091320G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JR50	Silent	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	p.I546	ENST00000380752.5	37	c.1638	CCDS9333.1	13																																																																																			SLC7A1	-	pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	ENSG00000139514		0.622	SLC7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A1	HGNC	protein_coding	OTTHUMT00000044337.2	67	0.00	0	G	NM_003045		30091320	30091320	-1	no_errors	ENST00000380752	ensembl	human	known	69_37n	silent	21	25.00	7	SNP	0.997	A
SNURFL	727686	genome.wustl.edu	37	X	138444474	138444474	+	IGR	SNP	G	G	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chrX:138444474G>T								FGF13 (158205 upstream) : F9 (168442 downstream)																							GTGGTAAAAAGCCGTACTGGA	0.458																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															X.37:g.138444474G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_SNURF	p.K72N		37	c.216		X	.	.	.	.	.	.	.	.	.	.	G	3.690	-0.063758	0.07273	.	.	ENSG00000173954	ENST00000309296	.	.	.	3.06	2.19	0.27852	.	.	.	.	.	T	0.32793	0.0841	.	.	.	0.09310	N	1.0	.	.	.	.	.	.	T	0.37753	-0.9692	4	0.15066	T	0.55	.	7.4944	0.27481	0.0:0.2615:0.7385:0.0	.	.	.	.	N	72	.	ENSP00000311181:K72N	K	+	3	2	SNURFL	138272140	0.079000	0.21365	0.040000	0.18447	0.000000	0.00434	-0.031000	0.12287	0.716000	0.32124	-0.293000	0.09583	AAG	SNURFL	-	NULL	ENSG00000173954	0	0.458					SNURFL	HGNC			77	0.00	0	G			138444474	138444474	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000309296	ensembl	human	known	69_37n	missense	55	21.43	15	SNP	0.039	T
SOX11	6664	genome.wustl.edu	37	2	5833196	5833196	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr2:5833196G>T	ENST00000322002.3	+	1	398	c.343G>T	c.(343-345)Gac>Tac	p.D115Y	AC108025.2_ENST00000453678.1_RNA|AC108025.2_ENST00000420221.1_RNA|AC107057.2_ENST00000458264.1_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	115					cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		CGACTACCCCGACTACAAGTA	0.672																																						dbGAP											0													22.0	28.0	26.0					2																	5833196		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.343G>T	2.37:g.5833196G>T	ENSP00000322568:p.Asp115Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFV8	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pirsf_SOX-12/11/4a,pfscan_HMG_superfamily	p.D115Y	ENST00000322002.3	37	c.343	CCDS1654.1	2	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112918	0.77210	.	.	ENSG00000176887	ENST00000322002	D	0.98090	-4.71	2.82	2.82	0.32997	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.64402	U	0.000001	D	0.98902	0.9628	M	0.93808	3.46	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99346	1.0913	10	0.87932	D	0	.	14.0543	0.64756	0.0:0.0:1.0:0.0	.	115	P35716	SOX11_HUMAN	Y	115	ENSP00000322568:D115Y	ENSP00000322568:D115Y	D	+	1	0	SOX11	5750647	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.337000	0.79256	1.552000	0.49463	0.478000	0.44815	GAC	SOX11	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pirsf_SOX-12/11/4a,pfscan_HMG_superfamily	ENSG00000176887		0.672	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX11	HGNC	protein_coding	OTTHUMT00000206698.1	56	0.00	0	G	NM_003108		5833196	5833196	+1	no_errors	ENST00000322002	ensembl	human	known	69_37n	missense	52	11.86	7	SNP	1.000	T
SPARC	6678	genome.wustl.edu	37	5	151047100	151047100	+	Silent	SNP	G	G	C	rs2304049	byFrequency	TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr5:151047100G>C	ENST00000231061.4	-	7	826	c.513C>G	c.(511-513)ctC>ctG	p.L171L	SPARC_ENST00000537849.1_5'UTR	NM_003118.3	NP_003109.1	P09486	SPRC_HUMAN	secreted protein, acidic, cysteine-rich (osteonectin)	171					blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|inner ear development (GO:0048839)|lung development (GO:0030324)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|regulation of cell morphogenesis (GO:0022604)|response to cadmium ion (GO:0046686)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to L-ascorbic acid (GO:0033591)|response to lead ion (GO:0010288)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nuclear matrix (GO:0016363)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|platelet alpha granule membrane (GO:0031092)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)			central_nervous_system(3)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)		GGACGTTCTTGAGCCAGTCCC	0.587													G|||	3	0.000599042	0.0	0.0	5008	,	,		16818	0.003		0.0	False		,,,				2504	0.0					dbGAP											0													99.0	79.0	86.0					5																	151047100		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4318.1	5q31-q33	2012-10-02			ENSG00000113140	ENSG00000113140			11219	protein-coding gene	gene with protein product	"""cysteine-rich protein"", ""osteonectin"""	182120		ON		2838412, 3410046	Standard	NM_003118		Approved		uc003lui.4	P09486	OTTHUMG00000130122	ENST00000231061.4:c.513C>G	5.37:g.151047100G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQH9|Q6IBK4	Silent	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Follistatin/Osteonectin_EGF,pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,smart_Fol_N,smart_Prot_inh_Kazal	p.L171	ENST00000231061.4	37	c.513	CCDS4318.1	5																																																																																			SPARC	-	pfam_SPARC/Testican_Ca-bd-dom	ENSG00000113140		0.587	SPARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPARC	HGNC	protein_coding	OTTHUMT00000252430.1	178	0.00	0	G	NM_003118		151047100	151047100	-1	no_errors	ENST00000231061	ensembl	human	known	69_37n	silent	77	22.22	22	SNP	0.996	C
STAG3	10734	genome.wustl.edu	37	7	99799582	99799582	+	Nonsense_Mutation	SNP	C	C	A	rs147534964		TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr7:99799582C>A	ENST00000426455.1	+	23	2719	c.2312C>A	c.(2311-2313)tCg>tAg	p.S771*	STAG3_ENST00000394018.2_Nonsense_Mutation_p.S713*|STAG3_ENST00000440830.1_3'UTR|GATS_ENST00000543273.1_RNA|GATS_ENST00000436886.2_3'UTR|STAG3_ENST00000317296.5_Nonsense_Mutation_p.S771*	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	771				S -> W (in Ref. 3; BAG63922). {ECO:0000305}.	chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AAGCAGCTGTCGAGTTTGAGG	0.517																																						dbGAP											0													109.0	101.0	103.0					7																	99799582		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.2312C>A	7.37:g.99799582C>A	ENSP00000400359:p.Ser771*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Nonsense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.S771*	ENST00000426455.1	37	c.2312	CCDS34703.1	7	.	.	.	.	.	.	.	.	.	.	.	38	6.941548	0.97952	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000317296	.	.	.	5.45	4.31	0.51392	.	0.576030	0.14131	N	0.339392	.	.	.	.	.	.	0.23391	N	0.997772	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-0.9857	7.5251	0.27650	0.0:0.1004:0.0:0.8996	.	.	.	.	X	771;713;771	.	ENSP00000319318:S771X	S	+	2	0	STAG3	99637518	0.996000	0.38824	0.378000	0.26068	0.478000	0.33099	3.314000	0.51943	0.921000	0.36994	-0.471000	0.05019	TCG	STAG3	-	superfamily_ARM-type_fold	ENSG00000066923		0.517	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	STAG3	HGNC	protein_coding	OTTHUMT00000338734.2	307	0.00	0	C	NM_012447		99799582	99799582	+1	no_errors	ENST00000317296	ensembl	human	known	69_37n	nonsense	240	22.83	71	SNP	0.050	A
SYBU	55638	genome.wustl.edu	37	8	110587700	110587700	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr8:110587700C>T	ENST00000422135.1	-	8	1942	c.1427G>A	c.(1426-1428)gGt>gAt	p.G476D	SYBU_ENST00000419099.1_Missense_Mutation_p.G475D|SYBU_ENST00000408908.2_Missense_Mutation_p.G476D|SYBU_ENST00000532779.1_Missense_Mutation_p.G408D|SYBU_ENST00000276646.9_Missense_Mutation_p.G476D|SYBU_ENST00000527707.1_5'Flank|SYBU_ENST00000528647.1_Missense_Mutation_p.G475D|SYBU_ENST00000529175.1_Missense_Mutation_p.G270D|SYBU_ENST00000529690.1_Missense_Mutation_p.G346D|SYBU_ENST00000424158.2_Missense_Mutation_p.G481D|SYBU_ENST00000533065.1_Missense_Mutation_p.G357D|SYBU_ENST00000528331.1_Missense_Mutation_p.G357D|SYBU_ENST00000533895.1_Missense_Mutation_p.G475D|SYBU_ENST00000440310.1_Missense_Mutation_p.G476D|SYBU_ENST00000533171.1_Missense_Mutation_p.G476D|SYBU_ENST00000446070.2_Missense_Mutation_p.G475D|SYBU_ENST00000408889.3_Missense_Mutation_p.G357D|SYBU_ENST00000399066.3_Missense_Mutation_p.G473D|SYBU_ENST00000433638.1_Missense_Mutation_p.G476D	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	476					regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						CTCCTCCTGACCCATGACTAT	0.592																																						dbGAP											0													92.0	95.0	94.0					8																	110587700		2112	4220	6332	-	-	-	SO:0001583	missense	0			AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.1427G>A	8.37:g.110587700C>T	ENSP00000407118:p.Gly476Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Missense_Mutation	SNP	NULL	p.G476D	ENST00000422135.1	37	c.1427	CCDS47912.1	8	.	.	.	.	.	.	.	.	.	.	C	0.488	-0.876546	0.02550	.	.	ENSG00000147642	ENST00000533895;ENST00000424158;ENST00000532779;ENST00000399066;ENST00000446070;ENST00000528331;ENST00000529175;ENST00000276646;ENST00000528647;ENST00000422135;ENST00000419099;ENST00000433638;ENST00000408908;ENST00000440310;ENST00000408889;ENST00000533065;ENST00000529690;ENST00000533171	.	.	.	4.14	-3.0	0.05480	.	1.858910	0.02090	N	0.053085	T	0.29524	0.0736	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.001;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.002;0.001;0.002;0.001;0.001	T	0.26326	-1.0106	9	0.39692	T	0.17	-0.1673	10.075	0.42355	0.0:0.3284:0.0:0.6716	.	346;408;475;476;473	B7Z4D2;Q9NX95-2;Q9NX95-3;Q9NX95;Q9NX95-4	.;.;.;SYBU_HUMAN;.	D	475;481;408;473;475;357;270;476;475;476;475;476;476;476;357;357;346;476	.	ENSP00000276646:G476D	G	-	2	0	SYBU	110656876	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.816000	0.04477	-0.719000	0.04942	0.591000	0.81541	GGT	SYBU	-	NULL	ENSG00000147642		0.592	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYBU	HGNC	protein_coding	OTTHUMT00000385501.1	336	0.00	0	C	NM_017786		110587700	110587700	-1	no_errors	ENST00000276646	ensembl	human	known	69_37n	missense	193	26.24	69	SNP	0.000	T
SYCP2	10388	genome.wustl.edu	37	20	58494610	58494610	+	Missense_Mutation	SNP	G	G	C	rs184420704		TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr20:58494610G>C	ENST00000357552.3	-	6	565	c.340C>G	c.(340-342)Caa>Gaa	p.Q114E	SYCP2_ENST00000371001.2_Missense_Mutation_p.Q114E|SYCP2_ENST00000476314.1_5'UTR			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	114					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			GAATTTCCTTGACTCTGAATA	0.289																																						dbGAP											0													79.0	80.0	80.0					20																	58494610		2202	4298	6500	-	-	-	SO:0001583	missense	0			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.340C>G	20.37:g.58494610G>C	ENSP00000350162:p.Gln114Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	NULL	p.Q114E	ENST00000357552.3	37	c.340	CCDS13482.1	20	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	2.595	-0.294312	0.05568	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834;ENST00000425931	T;T;T;T	0.42131	3.6;3.6;3.6;0.98	5.79	2.64	0.31445	.	1.562160	0.03393	N	0.202208	T	0.25791	0.0628	N	0.20766	0.605	0.09310	N	1	B;P	0.36837	0.241;0.571	B;B	0.30855	0.058;0.121	T	0.12811	-1.0533	10	0.07325	T	0.83	3.4674	9.4654	0.38809	0.0:0.1304:0.4687:0.4009	.	114;114	A2A341;Q9BX26	.;SYCP2_HUMAN	E	114;114;114;113	ENSP00000360040:Q114E;ENSP00000350162:Q114E;ENSP00000402456:Q114E;ENSP00000399300:Q113E	ENSP00000350162:Q114E	Q	-	1	0	SYCP2	57928005	0.000000	0.05858	0.009000	0.14445	0.736000	0.42039	0.010000	0.13242	0.773000	0.33404	0.655000	0.94253	CAA	SYCP2	-	NULL	ENSG00000196074		0.289	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	273	0.00	0	G	NM_014258		58494610	58494610	-1	no_errors	ENST00000357552	ensembl	human	known	69_37n	missense	291	19.11	69	SNP	0.004	C
SYNE1	23345	genome.wustl.edu	37	6	152599233	152599233	+	Silent	SNP	G	G	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr6:152599233G>T	ENST00000367255.5	-	98	19165	c.18564C>A	c.(18562-18564)ctC>ctA	p.L6188L	SYNE1_ENST00000448038.1_Silent_p.L6117L|SYNE1_ENST00000341594.5_Silent_p.L5800L|SYNE1_ENST00000265368.4_Silent_p.L6188L|SYNE1_ENST00000423061.1_Silent_p.L6117L|SYNE1_ENST00000356820.4_Silent_p.L712L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6188					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.L6188L(2)|p.L6117L(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTGCATGTTGAGCTGCTTAT	0.577										HNSCC(10;0.0054)																												dbGAP											3	Substitution - coding silent(3)	lung(3)											94.0	96.0	95.0					6																	152599233		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.18564C>A	6.37:g.152599233G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L6188	ENST00000367255.5	37	c.18564	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.577	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	100	0.00	0	G	NM_182961		152599233	152599233	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	silent	54	25.00	18	SNP	0.998	T
MAP3K12	7786	genome.wustl.edu	37	12	53895943	53895943	+	5'Flank	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr12:53895943C>T	ENST00000267079.2	-	0	0				TARBP2_ENST00000549028.1_3'UTR|MAP3K12_ENST00000547488.1_5'Flank|TARBP2_ENST00000456234.2_Silent_p.V45V|MAP3K12_ENST00000547151.1_5'Flank|TARBP2_ENST00000552857.1_Intron|RP11-793H13.11_ENST00000602306.1_RNA|TARBP2_ENST00000266987.2_Silent_p.V66V|TARBP2_ENST00000394357.2_Silent_p.V45V	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12						histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						CCTTCCGGGTCACCGTTGGCG	0.582																																						dbGAP											0													67.0	58.0	61.0					12																	53895943		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854		12.37:g.53895943C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	pfam_Ds-RNA-bd,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	p.H37Y	ENST00000267079.2	37	c.109	CCDS8860.1	12																																																																																			TARBP2	-	pfam_Ds-RNA-bd,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	ENSG00000139546		0.582	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	TARBP2	HGNC	protein_coding	OTTHUMT00000406267.1	194	0.00	0	C	NM_006301		53895943	53895943	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000550407	ensembl	human	putative	69_37n	missense	60	24.05	19	SNP	1.000	T
TCHH	7062	genome.wustl.edu	37	1	152083125	152083125	+	Silent	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:152083125G>C	ENST00000368804.1	-	2	2567	c.2568C>G	c.(2566-2568)ctC>ctG	p.L856L		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	856					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GATCCTCCTGGAGGCCGTCCT	0.627																																						dbGAP											0													59.0	66.0	63.0					1																	152083125		2039	4172	6211	-	-	-	SO:0001819	synonymous_variant	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.2568C>G	1.37:g.152083125G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUI3	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.L856	ENST00000368804.1	37	c.2568	CCDS41396.1	1																																																																																			TCHH	-	NULL	ENSG00000159450		0.627	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	121	0.00	0	G	NM_007113		152083125	152083125	-1	no_errors	ENST00000368804	ensembl	human	known	69_37n	silent	83	10.64	10	SNP	0.000	C
TFR2	7036	genome.wustl.edu	37	7	100238598	100238598	+	Splice_Site	SNP	C	C	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr7:100238598C>A	ENST00000462107.1	-	3	574		c.e3+1		TFR2_ENST00000431692.1_Splice_Site|TFR2_ENST00000223051.3_Splice_Site			Q9UP52	TFR2_HUMAN	transferrin receptor 2						cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	ACGGCTCTCACCCCCAGTGAA	0.647																																						dbGAP											0													19.0	22.0	21.0					7																	100238598		2199	4299	6498	-	-	-	SO:0001630	splice_region_variant	0			AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.286+1G>T	7.37:g.100238598C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Splice_Site	SNP	-	e2+1	ENST00000462107.1	37	c.286+1	CCDS34707.1	7	.	.	.	.	.	.	.	.	.	.	C	17.98	3.520088	0.64747	.	.	ENSG00000106327	ENST00000223051;ENST00000431692;ENST00000462107	.	.	.	4.44	4.44	0.53790	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7526	0.57316	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TFR2	100076534	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	4.160000	0.58164	2.472000	0.83506	0.484000	0.47621	.	TFR2	-	-	ENSG00000106327		0.647	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFR2	HGNC	protein_coding	OTTHUMT00000356392.3	38	0.00	0	C	NM_003227	Intron	100238598	100238598	-1	no_errors	ENST00000223051	ensembl	human	known	69_37n	splice_site	23	32.35	11	SNP	1.000	A
TGM5	9333	genome.wustl.edu	37	15	43545083	43545083	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr15:43545083A>G	ENST00000220420.5	-	6	743	c.736T>C	c.(736-738)Tac>Cac	p.Y246H	TGM5_ENST00000349114.4_Missense_Mutation_p.Y164H	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	246					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	CCGTCTGTGTAATTCTCACTC	0.537																																						dbGAP											0													89.0	77.0	81.0					15																	43545083		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.736T>C	15.37:g.43545083A>G	ENSP00000220420:p.Tyr246His	Somatic		WXS	Illumina GAIIx	Phase_IV	O43549|Q0VF40|Q9UEZ4	Missense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.Y246H	ENST00000220420.5	37	c.736	CCDS32212.1	15	.	.	.	.	.	.	.	.	.	.	A	19.64	3.864976	0.71949	.	.	ENSG00000104055	ENST00000220420;ENST00000349114;ENST00000396996	T;T	0.56103	0.48;0.48	4.64	4.64	0.57946	.	0.294417	0.32918	N	0.005491	T	0.74966	0.3786	M	0.88979	2.995	0.35326	D	0.785177	D;D	0.89917	1.0;0.993	D;D	0.80764	0.994;0.975	D	0.84908	0.0846	10	0.87932	D	0	-14.7715	12.2989	0.54864	1.0:0.0:0.0:0.0	.	164;246	O43548-2;O43548	.;TGM5_HUMAN	H	246;164;245	ENSP00000220420:Y246H;ENSP00000220419:Y164H	ENSP00000220420:Y246H	Y	-	1	0	TGM5	41332375	1.000000	0.71417	0.918000	0.36340	0.616000	0.37450	8.916000	0.92745	1.850000	0.53721	0.459000	0.35465	TAC	TGM5	-	NULL	ENSG00000104055		0.537	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM5	HGNC	protein_coding	OTTHUMT00000432257.1	155	0.63	1	A	NM_004245		43545083	43545083	-1	no_errors	ENST00000220420	ensembl	human	known	69_37n	missense	70	29.29	29	SNP	0.982	G
THRSP	7069	genome.wustl.edu	37	11	77775298	77775298	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr11:77775298T>C	ENST00000281030.2	+	1	392	c.371T>C	c.(370-372)cTc>cCc	p.L124P	NDUFC2-KCTD14_ENST00000530054.1_Intron|NDUFC2-KCTD14_ENST00000528251.1_Intron	NM_003251.3	NP_003242.1	Q92748	THRSP_HUMAN	thyroid hormone responsive	124					lipid metabolic process (GO:0006629)|regulation of lipid biosynthetic process (GO:0046890)|regulation of transcription, DNA-templated (GO:0006355)|regulation of triglyceride biosynthetic process (GO:0010866)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7	all_cancers(14;2.23e-19)|all_epithelial(13;7.49e-22)|Breast(9;6.38e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;2.15e-25)			CATCACATCCTCATGCACCTC	0.557																																						dbGAP											0													77.0	75.0	75.0					11																	77775298		2200	4292	6492	-	-	-	SO:0001583	missense	0			Y08409	CCDS8256.1	11q14.1	2012-06-19	2010-06-25		ENSG00000151365	ENSG00000151365			11800	protein-coding gene	gene with protein product	"""SPOT14 homolog (rat)"""	601926	"""thyroid hormone responsive SPOT14 (rat) homolog"", ""lipogenic protein 1"""	LPGP1		9003802	Standard	NM_003251		Approved	SPOT14, Lpgp, S14, THRP	uc001oyx.3	Q92748	OTTHUMG00000166632	ENST00000281030.2:c.371T>C	11.37:g.77775298T>C	ENSP00000281030:p.Leu124Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4W7	Missense_Mutation	SNP	pfam_Spot_14	p.L124P	ENST00000281030.2	37	c.371	CCDS8256.1	11	.	.	.	.	.	.	.	.	.	.	T	16.73	3.204785	0.58234	.	.	ENSG00000151365	ENST00000281030	.	.	.	5.2	5.2	0.72013	.	1.288670	0.05269	N	0.517155	T	0.81327	0.4799	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.68625	-0.5359	8	0.87932	D	0	-8.5905	14.1846	0.65598	0.0:0.0:0.0:1.0	.	124	Q92748	THRSP_HUMAN	P	124	.	ENSP00000281030:L124P	L	+	2	0	THRSP	77452946	0.999000	0.42202	1.000000	0.80357	0.358000	0.29455	6.525000	0.73795	2.189000	0.69895	0.459000	0.35465	CTC	THRSP	-	pfam_Spot_14	ENSG00000151365		0.557	THRSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THRSP	HGNC	protein_coding	OTTHUMT00000390939.1	235	0.00	0	T	NM_003251		77775298	77775298	+1	no_errors	ENST00000281030	ensembl	human	known	69_37n	missense	167	15.23	30	SNP	1.000	C
TIGIT	201633	genome.wustl.edu	37	3	114014431	114014431	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr3:114014431C>T	ENST00000486257.1	+	3	358	c.101C>T	c.(100-102)tCt>tTt	p.S34F	TIGIT_ENST00000383671.3_Missense_Mutation_p.S34F|TIGIT_ENST00000481065.1_Missense_Mutation_p.S101F			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	34	Homodimerization.|Ig-like V-type.				negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						GGGAACATTTCTGCAGAGAAA	0.532																																						dbGAP											0													156.0	157.0	157.0					3																	114014431		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.101C>T	3.37:g.114014431C>T	ENSP00000419085:p.Ser34Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495A3|Q5JPD8|Q6MZS2|Q8N877	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.S34F	ENST00000486257.1	37	c.101	CCDS2980.1	3	.	.	.	.	.	.	.	.	.	.	C	12.55	1.972347	0.34754	.	.	ENSG00000181847	ENST00000461158;ENST00000481065;ENST00000486257;ENST00000383671;ENST00000484319	T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25	4.45	3.58	0.41010	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000079	T	0.75004	0.3791	M	0.62723	1.935	0.35836	D	0.825696	D	0.76494	0.999	D	0.72075	0.976	T	0.78152	-0.2315	10	0.40728	T	0.16	-6.837	8.3035	0.32027	0.0:0.8918:0.0:0.1082	.	34	Q495A1	TIGIT_HUMAN	F	13;101;34;34;13	ENSP00000418917:S13F;ENSP00000420552:S101F;ENSP00000419085:S34F;ENSP00000373167:S34F;ENSP00000419706:S13F	ENSP00000373167:S34F	S	+	2	0	TIGIT	115497121	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	2.126000	0.42026	1.246000	0.43901	0.561000	0.74099	TCT	TIGIT	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000181847		0.532	TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGIT	HGNC	protein_coding	OTTHUMT00000354690.1	144	0.00	0	C	NM_173799		114014431	114014431	+1	no_errors	ENST00000383671	ensembl	human	known	69_37n	missense	77	23.00	23	SNP	1.000	T
TMA16	55319	genome.wustl.edu	37	4	164436573	164436573	+	Silent	SNP	G	G	A	rs140046746		TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr4:164436573G>A	ENST00000358572.5	+	5	689	c.348G>A	c.(346-348)acG>acA	p.T116T	TMA16_ENST00000513272.1_Intron|TMA16_ENST00000513134.1_Intron|TMA16_ENST00000508268.1_Silent_p.T116T|TMA16_ENST00000511562.1_3'UTR	NM_018352.2	NP_060822.2	Q96EY4	TMA16_HUMAN	translation machinery associated 16 homolog (S. cerevisiae)	116						nucleus (GO:0005634)											TCAAGCAGACGATGGAGCGGG	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		16947	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													143.0	154.0	150.0					4																	164436573		1972	4150	6122	-	-	-	SO:0001819	synonymous_variant	0				CCDS43278.1	4q32.3	2012-03-02	2012-03-02	2012-03-02	ENSG00000198498	ENSG00000198498			25638	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 43"""	C4orf43		12477932	Standard	NM_018352		Approved	FLJ11184	uc003iqq.4	Q96EY4	OTTHUMG00000161528	ENST00000358572.5:c.348G>A	4.37:g.164436573G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P6E4|Q0P6J1|Q9NUR7	Missense_Mutation	SNP	pfam_DUF2962	p.D155N	ENST00000358572.5	37	c.463	CCDS43278.1	4	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	3.323	-0.138398	0.06669	.	.	ENSG00000198498	ENST00000509657	.	.	.	5.43	-3.23	0.05109	.	.	.	.	.	T	0.49406	0.1555	.	.	.	0.51233	D	0.999911	.	.	.	.	.	.	T	0.41645	-0.9497	4	.	.	.	-10.3881	6.0283	0.19667	0.1979:0.4684:0.2524:0.0812	.	.	.	.	N	155	.	.	D	+	1	0	C4orf43	164656023	0.000000	0.05858	0.002000	0.10522	0.559000	0.35586	-1.342000	0.02645	-0.924000	0.03780	-0.810000	0.03169	GAT	TMA16	-	pfam_DUF2962	ENSG00000198498		0.483	TMA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMA16	HGNC	protein_coding	OTTHUMT00000365208.1	261	0.38	1	G	NM_018352		164436573	164436573	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000509657	ensembl	human	putative	69_37n	missense	105	31.37	48	SNP	0.002	A
SCTR	6344	genome.wustl.edu	37	2	120194851	120194851	+	IGR	SNP	C	C	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr2:120194851C>A	ENST00000019103.5	-	0	1865				TMEM37_ENST00000306406.4_Silent_p.V136V|TMEM37_ENST00000409826.1_Silent_p.V148V|TMEM37_ENST00000465296.1_3'UTR	NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor						digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	TGTCTTTCGTCCTCTCCTCCG	0.542																																						dbGAP											0													179.0	178.0	179.0					2																	120194851		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0				CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407		2.37:g.120194851C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q12961|Q13213|Q53T00	Silent	SNP	NULL	p.V136	ENST00000019103.5	37	c.408	CCDS2127.1	2																																																																																			TMEM37	-	NULL	ENSG00000171227		0.542	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM37	HGNC	protein_coding	OTTHUMT00000254198.2	222	0.00	0	C			120194851	120194851	+1	no_errors	ENST00000306406	ensembl	human	known	69_37n	silent	89	18.35	20	SNP	0.040	A
TMTC1	83857	genome.wustl.edu	37	12	29709801	29709801	+	Silent	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr12:29709801C>T	ENST00000539277.1	-	10	1723	c.1665G>A	c.(1663-1665)ggG>ggA	p.G555G	TMTC1_ENST00000319685.8_5'UTR|TMTC1_ENST00000552618.1_Silent_p.G579G|TMTC1_ENST00000256062.5_Silent_p.G447G|TMTC1_ENST00000381224.2_Silent_p.G509G|TMTC1_ENST00000551659.1_Silent_p.G617G	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	555						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					TGAGGAGATTCCCCAGATTGA	0.488																																						dbGAP											0													191.0	163.0	172.0					12																	29709801		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.1665G>A	12.37:g.29709801C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Silent	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DUF1736,pfam_PIK-rel_kinase_FAT,pfam_TPR-3,smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G447	ENST00000539277.1	37	c.1341	CCDS53772.1	12																																																																																			TMTC1	-	pfam_PIK-rel_kinase_FAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000133687		0.488	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	HGNC	protein_coding	OTTHUMT00000403509.1	436	0.00	0	C	NM_031920		29709801	29709801	-1	no_errors	ENST00000256062	ensembl	human	known	69_37n	silent	162	28.00	63	SNP	0.811	T
TNKS2	80351	genome.wustl.edu	37	10	93572805	93572805	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr10:93572805G>A	ENST00000371627.4	+	2	644	c.265G>A	c.(265-267)Gat>Aat	p.D89N		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	89					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				AGCACGTGATGATGGGGGCCT	0.433																																						dbGAP											0													209.0	180.0	190.0					10																	93572805		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.265G>A	10.37:g.93572805G>A	ENSP00000360689:p.Asp89Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_Poly(ADP-ribose)pol_cat_dom,prints_Ankyrin_rpt	p.D89N	ENST00000371627.4	37	c.265	CCDS7417.1	10	.	.	.	.	.	.	.	.	.	.	G	34	5.366557	0.95900	.	.	ENSG00000107854	ENST00000371627	T	0.13901	2.55	5.93	5.93	0.95920	Ankyrin repeat-containing domain (4);	0.000000	0.56097	D	0.000024	T	0.14485	0.0350	N	0.01202	-0.96	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.56486	-0.7971	10	0.18276	T	0.48	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	89	Q9H2K2	TNKS2_HUMAN	N	89	ENSP00000360689:D89N	ENSP00000360689:D89N	D	+	1	0	TNKS2	93562785	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.722000	0.98770	2.826000	0.97356	0.655000	0.94253	GAT	TNKS2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000107854		0.433	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS2	HGNC	protein_coding	OTTHUMT00000049374.1	474	0.00	0	G	NM_025235		93572805	93572805	+1	no_errors	ENST00000371627	ensembl	human	known	69_37n	missense	233	32.27	111	SNP	1.000	A
TOPBP1	11073	genome.wustl.edu	37	3	133339115	133339115	+	Silent	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr3:133339115C>T	ENST00000260810.5	-	20	3386	c.3255G>A	c.(3253-3255)gtG>gtA	p.V1085V		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1085					cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						CTTGGGGTTTCACTATTGATG	0.463								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)	dbGAP											0													179.0	175.0	177.0					3																	133339115		1955	4155	6110	-	-	-	SO:0001819	synonymous_variant	0			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.3255G>A	3.37:g.133339115C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7W8|Q7LGC1|Q9UEB9	Silent	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_Secretoglobin,smart_BRCT_dom,pfscan_BRCT_dom	p.V1085	ENST00000260810.5	37	c.3255	CCDS46919.1	3																																																																																			TOPBP1	-	NULL	ENSG00000163781		0.463	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1	480	0.00	0	C	NM_007027		133339115	133339115	-1	no_errors	ENST00000260810	ensembl	human	known	69_37n	silent	367	20.52	95	SNP	0.975	T
TP53	7157	genome.wustl.edu	37	17	7578203	7578203	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr17:7578203C>T	ENST00000269305.4	-	6	835	c.646G>A	c.(646-648)Gtg>Atg	p.V216M	TP53_ENST00000413465.2_Missense_Mutation_p.V216M|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.V216M|TP53_ENST00000455263.2_Missense_Mutation_p.V216M|TP53_ENST00000359597.4_Missense_Mutation_p.V216M|TP53_ENST00000445888.2_Missense_Mutation_p.V216M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	216	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V216M(61)|p.V216del(8)|p.0?(8)|p.V216L(7)|p.?(5)|p.V84M(3)|p.V123M(3)|p.V216fs*6(2)|p.H214fs*5(2)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215fs*29(1)|p.V216fs*5(1)|p.V216_Y220delVVVPY(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.S215fs*31(1)|p.S215_V216insX(1)|p.T211fs*28(1)|p.D207_V216del10(1)|p.S215_V218>R(1)|p.S215_V218>M(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACCACCACACTATGTCGA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	113	Substitution - Missense(74)|Deletion - In frame(11)|Deletion - Frameshift(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(4)|Complex - deletion inframe(2)|Insertion - In frame(1)	breast(17)|lung(14)|haematopoietic_and_lymphoid_tissue(12)|ovary(12)|upper_aerodigestive_tract(10)|large_intestine(9)|oesophagus(9)|biliary_tract(5)|central_nervous_system(5)|bone(5)|stomach(4)|liver(4)|pancreas(3)|soft_tissue(2)|urinary_tract(1)|skin(1)	GRCh37	CX952222	TP53	X							123.0	111.0	115.0					17																	7578203		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.646G>A	17.37:g.7578203C>T	ENSP00000269305:p.Val216Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V216M	ENST00000269305.4	37	c.646	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958421	0.92726	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99889	0.9947	M	0.92169	3.28	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.996;1.0;1.0;1.0;1.0	D	0.96411	0.9304	10	0.87932	D	0	-12.2832	16.7921	0.85592	0.0:1.0:0.0:0.0	.	177;216;216;123;216;216;216	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	M	216;216;216;216;216;216;205;123;84;123;84	ENSP00000410739:V216M;ENSP00000352610:V216M;ENSP00000269305:V216M;ENSP00000398846:V216M;ENSP00000391127:V216M;ENSP00000391478:V216M;ENSP00000425104:V84M;ENSP00000423862:V123M	ENSP00000269305:V216M	V	-	1	0	TP53	7518928	1.000000	0.71417	0.978000	0.43139	0.971000	0.66376	7.775000	0.85489	2.634000	0.89283	0.563000	0.77884	GTG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	454	0.00	0	C	NM_000546		7578203	7578203	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	210	32.04	99	SNP	1.000	T
TPM3	7170	genome.wustl.edu	37	1	154163705	154163705	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:154163705T>A	ENST00000368530.2	-	2	392	c.200A>T	c.(199-201)gAt>gTt	p.D67V	TPM3_ENST00000271850.7_Missense_Mutation_p.D67V|MIR190B_ENST00000401119.1_RNA	NM_152263.2	NP_689476.2	P06753	TPM3_HUMAN	tropomyosin 3	67					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle thin filament tropomyosin (GO:0005862)|stress fiber (GO:0001725)			TPM3/NTRK1_ENST00000392302(70)|TPM3/ALK(33)	breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					CTCCTGGGCATCCTTCAAAGC	0.473			T	"""NTRK1, ALK, ROS1"""	"""papillary thyroid, ALCL, NSCLC"""																																	dbGAP		Dom	yes		1	1q22-q23	7170	tropomyosin 3		"""E, L"""	0													142.0	146.0	145.0					1																	154163705		2190	4290	6480	-	-	-	SO:0001583	missense	0			BC008425	CCDS1060.1, CCDS41400.1, CCDS41401.1, CCDS41402.1, CCDS41403.1, CCDS60274.1, CCDS60275.1, CCDS72922.1	1q21.2	2014-09-17			ENSG00000143549	ENSG00000143549		"""Tropomyosins"""	12012	protein-coding gene	gene with protein product		191030		NEM1		1829807	Standard	NM_153649		Approved	TRK	uc001fec.2	P06753	OTTHUMG00000035853	ENST00000368530.2:c.200A>T	1.37:g.154163705T>A	ENSP00000357516:p.Asp67Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV71|P12324|Q2QD06|Q5VU58|Q5VU63|Q5VU66|Q5VU71|Q5VU72|Q8TCG3|Q969Q2|Q9NQH8	Missense_Mutation	SNP	pfam_Tropomyosin,prints_Tropomyosin	p.D67V	ENST00000368530.2	37	c.200	CCDS41403.1	1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.299020	0.81025	.	.	ENSG00000143549	ENST00000271850;ENST00000368530;ENST00000515609	D;D;D	0.97352	-4.35;-4.35;-3.99	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	D	0.95809	0.8636	M	0.66939	2.045	0.80722	D	1	B	0.25850	0.136	B	0.38194	0.267	D	0.94488	0.7699	10	0.45353	T	0.12	-6.8638	15.7232	0.77732	0.0:0.0:0.0:1.0	.	66	P06753	TPM3_HUMAN	V	67	ENSP00000271850:D67V;ENSP00000357516:D67V;ENSP00000426306:D67V	ENSP00000271850:D67V	D	-	2	0	TPM3	152430329	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.942000	0.87708	2.304000	0.77564	0.528000	0.53228	GAT	TPM3	-	pfam_Tropomyosin	ENSG00000143549		0.473	TPM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPM3	HGNC	protein_coding	OTTHUMT00000087271.2	556	0.00	0	T	NM_152263		154163705	154163705	-1	no_errors	ENST00000368530	ensembl	human	known	69_37n	missense	499	18.20	111	SNP	1.000	A
TRIM23	373	genome.wustl.edu	37	5	64892251	64892251	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr5:64892251G>C	ENST00000231524.9	-	9	1788	c.1417C>G	c.(1417-1419)Caa>Gaa	p.Q473E	TRIM23_ENST00000274327.7_Missense_Mutation_p.Q473E|TRIM23_ENST00000381018.3_Missense_Mutation_p.Q473E	NM_001656.3	NP_001647.1	P36406	TRI23_HUMAN	tripartite motif containing 23	473	ARF-like.				GTP catabolic process (GO:0006184)|positive regulation of catalytic activity (GO:0043085)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	28		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		CTCTCACCTTGAGTATTGAGG	0.303																																						dbGAP											0													98.0	97.0	97.0					5																	64892251		2203	4296	6499	-	-	-	SO:0001583	missense	0			L04510	CCDS3986.1, CCDS3987.1, CCDS43322.1	5q12.3	2013-01-09	2011-01-25	2004-06-04	ENSG00000113595	ENSG00000113595		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	660	protein-coding gene	gene with protein product		601747	"""ADP-ribosylation factor domain protein 1, 64kDa"", ""tripartite motif-containing 23"""	ARFD1		8473324	Standard	NM_001656		Approved	ARD1, RNF46	uc003jty.3	P36406	OTTHUMG00000097802	ENST00000231524.9:c.1417C>G	5.37:g.64892251G>C	ENSP00000231524:p.Gln473Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BZY4|Q9BZY5	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,pfam_Znf_B-box,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_Znf_C2H2,tigrfam_Small_GTP-bd_dom	p.Q473E	ENST00000231524.9	37	c.1417	CCDS3987.1	5	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724889	0.89298	.	.	ENSG00000113595	ENST00000231524;ENST00000381018;ENST00000274327	D;D;D	0.82081	-1.57;-1.57;-1.57	5.84	5.84	0.93424	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.88418	0.6431	L	0.43701	1.375	0.80722	D	1	D;D;D	0.65815	0.968;0.995;0.987	D;P;P	0.66602	0.945;0.866;0.814	D	0.88548	0.3114	10	0.72032	D	0.01	.	20.1322	0.98003	0.0:0.0:1.0:0.0	.	473;473;473	P36406;P36406-2;P36406-3	TRI23_HUMAN;.;.	E	473	ENSP00000231524:Q473E;ENSP00000370406:Q473E;ENSP00000274327:Q473E	ENSP00000231524:Q473E	Q	-	1	0	TRIM23	64928007	1.000000	0.71417	0.992000	0.48379	0.931000	0.56810	9.869000	0.99810	2.765000	0.95021	0.484000	0.47621	CAA	TRIM23	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	ENSG00000113595		0.303	TRIM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM23	HGNC	protein_coding	OTTHUMT00000215058.2	342	0.00	0	G	NM_001656		64892251	64892251	-1	no_errors	ENST00000231524	ensembl	human	known	69_37n	missense	208	26.50	75	SNP	1.000	C
TRIM46	80128	genome.wustl.edu	37	1	155150660	155150660	+	Silent	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:155150660C>G	ENST00000334634.4	+	6	1092	c.1092C>G	c.(1090-1092)ggC>ggG	p.G364G	TRIM46_ENST00000368383.3_Silent_p.G364G|TRIM46_ENST00000545012.1_Silent_p.G238G|TRIM46_ENST00000543729.1_Silent_p.G371G|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000368385.4_Silent_p.G364G|TRIM46_ENST00000368382.1_Silent_p.G341G|TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000392451.2_Silent_p.G364G	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	364						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTCTGGTGGGCTATGCCCAGG	0.612																																						dbGAP											0													33.0	36.0	35.0					1																	155150660		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.1092C>G	1.37:g.155150660C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Silent	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Fibronectin_type3,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.G364	ENST00000334634.4	37	c.1092	CCDS1097.1	1																																																																																			TRIM46	-	NULL	ENSG00000163462		0.612	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM46	HGNC	protein_coding	OTTHUMT00000086728.1	80	0.00	0	C	NM_025058		155150660	155150660	+1	no_errors	ENST00000334634	ensembl	human	known	69_37n	silent	52	16.13	10	SNP	1.000	G
TRIO	7204	genome.wustl.edu	37	5	14399162	14399162	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr5:14399162T>C	ENST00000344204.4	+	30	4621	c.4597T>C	c.(4597-4599)Tat>Cat	p.Y1533H	TRIO_ENST00000509967.2_Missense_Mutation_p.Y1484H|TRIO_ENST00000537187.1_Missense_Mutation_p.Y1533H	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1533	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CAAGTACCTTTATAAAAGCAA	0.353																																						dbGAP											0													91.0	98.0	96.0					5																	14399162		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.4597T>C	5.37:g.14399162T>C	ENSP00000339299:p.Tyr1533His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.Y1533H	ENST00000344204.4	37	c.4597	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	T	17.26	3.344893	0.61073	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.32988	1.43;1.43;2.54	5.48	5.48	0.80851	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.60547	0.2277	M	0.85299	2.745	0.80722	D	1	D;D;D	0.76494	0.997;0.996;0.999	D;D;D	0.81914	0.974;0.944;0.995	T	0.67837	-0.5567	10	0.87932	D	0	.	15.6059	0.76672	0.0:0.0:0.0:1.0	.	1484;1533;1533	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	H	1533;1533;1484;1220	ENSP00000339299:Y1533H;ENSP00000446348:Y1533H;ENSP00000445592:Y1484H	ENSP00000339299:Y1533H	Y	+	1	0	TRIO	14452162	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.997000	0.88414	2.081000	0.62600	0.533000	0.62120	TAT	TRIO	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000038382		0.353	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	306	0.00	0	T	NM_007118		14399162	14399162	+1	no_errors	ENST00000344204	ensembl	human	known	69_37n	missense	193	30.82	86	SNP	1.000	C
TSGA10IP	254187	genome.wustl.edu	37	11	65714666	65714666	+	RNA	SNP	C	C	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr11:65714666C>A	ENST00000532620.1	+	0	601				TSGA10IP_ENST00000608857.1_RNA			Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein											endometrium(2)|kidney(3)|lung(9)	14						GGCTGTGCTTCAGCCAAGCTC	0.637																																						dbGAP											0													17.0	19.0	18.0					11																	65714666		2123	4231	6354	-	-	-			0			AK057442	CCDS66138.1	11q13.1	2014-03-25			ENSG00000175513	ENSG00000175513			26555	protein-coding gene	gene with protein product						14702039	Standard	NM_152762		Approved	FLJ32880, FAM161C	uc001ogk.1	Q3SY00	OTTHUMG00000166753		11.37:g.65714666C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SXZ9|Q3SY01|Q96M26	RNA	SNP	-	NULL	ENST00000532620.1	37	NULL		11																																																																																			TSGA10IP	-	-	ENSG00000175513		0.637	TSGA10IP-001	KNOWN	basic	processed_transcript	TSGA10IP	HGNC	polymorphic_pseudogene	OTTHUMT00000391373.2	48	0.00	0	C	NM_152762		65714666	65714666	+1	no_errors	ENST00000528291	ensembl	human	known	69_37n	rna	62	16.22	12	SNP	0.002	A
TSNARE1	203062	genome.wustl.edu	37	8	143356182	143356182	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr8:143356182T>G	ENST00000307180.3	-	12	1523	c.1406A>C	c.(1405-1407)gAg>gCg	p.E469A	TSNARE1_ENST00000519651.1_Missense_Mutation_p.E250A|TSNARE1_ENST00000524325.1_Missense_Mutation_p.E468A|TSNARE1_ENST00000520166.1_Missense_Mutation_p.E469A	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	469	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GCGGGCTGCCTCCGCATGCGA	0.647																																						dbGAP											0													11.0	14.0	13.0					8																	143356182		2184	4280	6464	-	-	-	SO:0001583	missense	0					8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.1406A>C	8.37:g.143356182T>G	ENSP00000303437:p.Glu469Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLB0|Q14D03	Missense_Mutation	SNP	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.E469A	ENST00000307180.3	37	c.1406	CCDS6384.1	8	.	.	.	.	.	.	.	.	.	.	T	6.106	0.387755	0.11581	.	.	ENSG00000171045	ENST00000524325;ENST00000307180;ENST00000520166;ENST00000519651	T;T;T;T	0.26373	1.74;1.74;1.74;1.74	2.25	2.25	0.28309	t-SNARE (1);Target SNARE coiled-coil domain (3);	.	.	.	.	T	0.25121	0.0610	L	0.52823	1.66	0.30698	N	0.750585	B;P;P;P	0.45348	0.393;0.856;0.77;0.77	B;B;B;B	0.42555	0.14;0.391;0.255;0.255	T	0.17899	-1.0354	9	0.46703	T	0.11	.	8.357	0.32335	0.0:0.0:0.0:1.0	.	468;250;469;470	B7ZLB0;E5RHT3;Q96NA8;A0AVG3	.;.;TSNA1_HUMAN;.	A	468;469;469;250	ENSP00000428763:E468A;ENSP00000303437:E469A;ENSP00000427770:E469A;ENSP00000429679:E250A	ENSP00000303437:E469A	E	-	2	0	TSNARE1	143354089	0.875000	0.30112	0.462000	0.27118	0.036000	0.12997	2.103000	0.41806	0.978000	0.38470	0.334000	0.21626	GAG	TSNARE1	-	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	ENSG00000171045		0.647	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSNARE1	HGNC	protein_coding		34	0.00	0	T	NM_145003		143356182	143356182	-1	no_errors	ENST00000307180	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	0.997	G
TTC37	9652	genome.wustl.edu	37	5	94863730	94863730	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr5:94863730C>G	ENST00000358746.2	-	13	1419	c.1121G>C	c.(1120-1122)cGt>cCt	p.R374P		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	374						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						ATCAAGCGTACGAATTGCTTC	0.388																																						dbGAP											0													88.0	87.0	88.0					5																	94863730		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.1121G>C	5.37:g.94863730C>G	ENSP00000351596:p.Arg374Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O15077|Q6PJI3	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R374P	ENST00000358746.2	37	c.1121	CCDS4072.1	5	.	.	.	.	.	.	.	.	.	.	C	9.657	1.143166	0.21205	.	.	ENSG00000198677	ENST00000358746;ENST00000514952	T;T	0.76839	-0.89;-1.05	5.22	2.15	0.27550	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.777035	0.12795	N	0.438534	T	0.59335	0.2186	N	0.19112	0.55	0.09310	N	1	B;B	0.25955	0.135;0.138	B;B	0.23275	0.029;0.045	T	0.49399	-0.8944	10	0.45353	T	0.12	.	4.4993	0.11856	0.0:0.4188:0.1581:0.4231	.	326;374	D6RCE2;Q6PGP7	.;TTC37_HUMAN	P	374;326	ENSP00000351596:R374P;ENSP00000423742:R326P	ENSP00000351596:R374P	R	-	2	0	TTC37	94889486	0.001000	0.12720	0.309000	0.25155	0.925000	0.55904	-0.323000	0.07997	0.482000	0.27582	0.484000	0.47621	CGT	TTC37	-	pfscan_TPR-contain_dom	ENSG00000198677		0.388	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC37	HGNC	protein_coding	OTTHUMT00000241651.1	172	0.00	0	C	NM_014639		94863730	94863730	-1	no_errors	ENST00000358746	ensembl	human	known	69_37n	missense	122	24.69	40	SNP	0.008	G
TUBAL3	79861	genome.wustl.edu	37	10	5436386	5436386	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr10:5436386G>T	ENST00000380419.3	-	4	472	c.435C>A	c.(433-435)ttC>ttA	p.F145L	TUBAL3_ENST00000479328.1_Missense_Mutation_p.F105L	NM_024803.2	NP_079079.1	A6NHL2	TBAL3_HUMAN	tubulin, alpha-like 3	145					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(7)|prostate(2)|skin(3)	25						CAAAGCTTCGGAAAATCAAAA	0.448																																						dbGAP											0													48.0	53.0	51.0					10																	5436386		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025318	CCDS7066.2, CCDS53491.1	10p15.1	2007-03-15			ENSG00000178462	ENSG00000178462		"""Tubulins"""	23534	protein-coding gene	gene with protein product							Standard	NM_024803		Approved	FLJ21665	uc001ihy.3	A6NHL2	OTTHUMG00000017595	ENST00000380419.3:c.435C>A	10.37:g.5436386G>T	ENSP00000369784:p.Phe145Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKL2|Q4QQJ5|Q9H6Z0	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.F145L	ENST00000380419.3	37	c.435	CCDS7066.2	10	.	.	.	.	.	.	.	.	.	.	G	18.50	3.636910	0.67130	.	.	ENSG00000178462	ENST00000380419;ENST00000479328	T;T	0.67865	-0.29;-0.29	4.55	2.7	0.31948	Tubulin/FtsZ, GTPase domain (4);	0.139559	0.33650	N	0.004698	T	0.68495	0.3007	L	0.51422	1.61	0.37075	D	0.898695	D;D	0.56035	0.974;0.959	P;P	0.53912	0.737;0.564	T	0.73515	-0.3958	10	0.87932	D	0	.	10.035	0.42122	0.1694:0.0:0.8306:0.0	.	105;145	A6NHL2-2;A6NHL2	.;TBAL3_HUMAN	L	145;105	ENSP00000369784:F145L;ENSP00000418799:F105L	ENSP00000369784:F145L	F	-	3	2	TUBAL3	5426386	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	2.851000	0.48302	0.631000	0.30412	-0.145000	0.13849	TTC	TUBAL3	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Tubulin,prints_Epsilon_tubulin	ENSG00000178462		0.448	TUBAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBAL3	HGNC	protein_coding	OTTHUMT00000046548.2	90	0.00	0	G	NM_024803		5436386	5436386	-1	no_errors	ENST00000380419	ensembl	human	known	69_37n	missense	112	18.25	25	SNP	1.000	T
TXNDC8	255220	genome.wustl.edu	37	9	113065819	113065819	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr9:113065819C>G	ENST00000374511.3	-	6	414	c.366G>C	c.(364-366)aaG>aaC	p.K122N				Q6A555	TXND8_HUMAN	thioredoxin domain containing 8 (spermatozoa)	122					acrosome assembly (GO:0001675)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|sperm flagellum (GO:0036126)				endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						ATTCTTGAGTCTTGGCTTCCA	0.363																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC035743	CCDS35104.1, CCDS69639.1, CCDS75872.1	9q31.3	2007-08-16	2007-08-16	2007-08-16	ENSG00000204193	ENSG00000204193			31454	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 3"""						Standard	XM_005251879		Approved	bA427L11.2, TRX6, SPTRX-3	uc004bes.3	Q6A555	OTTHUMG00000020481	ENST00000374511.3:c.366G>C	9.37:g.113065819C>G	ENSP00000363635:p.Lys122Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4I2|A6NDK7|Q5T934	Missense_Mutation	SNP	pfam_Thioredoxin_domain	p.K122N	ENST00000374511.3	37	c.366		9	.	.	.	.	.	.	.	.	.	.	C	12.87	2.068977	0.36470	.	.	ENSG00000204193	ENST00000374511	T	0.21361	2.01	4.84	4.84	0.62591	.	0.167420	0.40728	N	0.001040	T	0.30947	0.0781	.	.	.	0.35212	D	0.775226	.	.	.	.	.	.	T	0.23404	-1.0189	7	0.35671	T	0.21	-7.9665	13.6417	0.62255	0.0:1.0:0.0:0.0	.	.	.	.	N	122	ENSP00000363635:K122N	ENSP00000363635:K122N	K	-	3	2	TXNDC8	112105640	1.000000	0.71417	1.000000	0.80357	0.056000	0.15407	3.462000	0.53042	2.649000	0.89929	0.650000	0.86243	AAG	TXNDC8	-	NULL	ENSG00000204193		0.363	TXNDC8-201	KNOWN	basic|appris_candidate_longest	protein_coding	TXNDC8	HGNC	protein_coding		96	0.00	0	C	NM_001003936		113065819	113065819	-1	no_errors	ENST00000374511	ensembl	human	known	69_37n	missense	76	28.30	30	SNP	1.000	G
UBR4	23352	genome.wustl.edu	37	1	19407923	19407923	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:19407923C>G	ENST00000375254.3	-	103	15180	c.15153G>C	c.(15151-15153)tgG>tgC	p.W5051C	UBR4_ENST00000429347.2_Missense_Mutation_p.W574C|UBR4_ENST00000375267.2_Missense_Mutation_p.W5051C|UBR4_ENST00000375226.2_Missense_Mutation_p.W5027C|UBR4_ENST00000375217.2_Missense_Mutation_p.W5044C|UBR4_ENST00000375224.1_Missense_Mutation_p.W758C|AL137127.1_ENST00000582644.1_RNA|UBR4_ENST00000375225.3_Missense_Mutation_p.W126C|UBR4_ENST00000543981.1_Missense_Mutation_p.W715C	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	5051					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GTGTGGCTCTCCACTGCTCAG	0.597																																						dbGAP											0													128.0	133.0	131.0					1																	19407923		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.15153G>C	1.37:g.19407923C>G	ENSP00000364403:p.Trp5051Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.W5051C	ENST00000375254.3	37	c.15153	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.250322	0.80024	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000375225;ENST00000375224;ENST00000429347;ENST00000543981	T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.74520	0.3727	M	0.89287	3.02	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.80764	0.994;0.994;0.994;0.99	T	0.79507	-0.1775	10	0.87932	D	0	.	18.0747	0.89423	0.0:1.0:0.0:0.0	.	715;574;5051;5027	B4DYV5;B4DPF6;Q5T4S7;Q5T4S7-3	.;.;UBR4_HUMAN;.	C	5051;5051;5044;5027;126;758;574;715	ENSP00000364403:W5051C;ENSP00000364416:W5051C;ENSP00000364365:W5044C;ENSP00000364374:W5027C;ENSP00000364373:W126C;ENSP00000364372:W758C;ENSP00000394173:W574C;ENSP00000444070:W715C	ENSP00000364365:W5044C	W	-	3	0	UBR4	19280510	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.399000	0.79935	2.687000	0.91594	0.462000	0.41574	TGG	UBR4	-	NULL	ENSG00000127481		0.597	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	194	0.00	0	C	NM_020765		19407923	19407923	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	missense	96	25.58	33	SNP	1.000	G
UPB1	51733	genome.wustl.edu	37	22	24919738	24919738	+	Silent	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr22:24919738C>T	ENST00000326010.5	+	9	1412	c.1068C>T	c.(1066-1068)ttC>ttT	p.F356F	UPB1_ENST00000413389.2_Silent_p.F288F|UPB1_ENST00000498140.1_3'UTR	NM_016327.2	NP_057411.1	Q9UBR1	BUP1_HUMAN	ureidopropionase, beta	356	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	beta-ureidopropionase activity (GO:0003837)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	22	Colorectal(2;0.0339)					TCTGGAACTTCAAGGTAGGTC	0.587																																						dbGAP											0													113.0	113.0	113.0					22																	24919738		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB013885	CCDS13827.1	22q11.2	2008-04-11			ENSG00000100024	ENSG00000100024			16297	protein-coding gene	gene with protein product		606673				10542323	Standard	XR_244378		Approved	BUP1	uc003aaf.3	Q9UBR1	OTTHUMG00000150749	ENST00000326010.5:c.1068C>T	22.37:g.24919738C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A3KMF8|Q9UIR3	Silent	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.F356	ENST00000326010.5	37	c.1068	CCDS13827.1	22																																																																																			UPB1	-	superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	ENSG00000100024		0.587	UPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPB1	HGNC	protein_coding	OTTHUMT00000319869.1	218	0.00	0	C			24919738	24919738	+1	no_errors	ENST00000326010	ensembl	human	known	69_37n	silent	75	34.21	39	SNP	1.000	T
UTRN	7402	genome.wustl.edu	37	6	144761487	144761487	+	Splice_Site	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr6:144761487G>C	ENST00000367545.3	+	12	1392		c.e12-1			NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin						aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTTTTCTCTAGAGTTTGCAAA	0.348																																						dbGAP											0													88.0	90.0	89.0					6																	144761487		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.1393-1G>C	6.37:g.144761487G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYY1|Q5SZ57|Q9UJ40	Splice_Site	SNP	-	e12-1	ENST00000367545.3	37	c.1393-1	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573841	0.86542	.	.	ENSG00000152818	ENST00000367529;ENST00000367545	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.773	0.96379	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UTRN	144803180	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.009000	0.76347	2.756000	0.94617	0.650000	0.86243	.	UTRN	-	-	ENSG00000152818		0.348	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	348	0.00	0	G		Intron	144761487	144761487	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	splice_site	281	19.71	69	SNP	1.000	C
UVRAG	7405	genome.wustl.edu	37	11	75590926	75590926	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr11:75590926C>T	ENST00000356136.3	+	4	515	c.274C>T	c.(274-276)Ccc>Tcc	p.P92S	UVRAG_ENST00000528420.1_5'UTR	NM_003369.3	NP_003360.2	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated	92	C2.				DNA repair (GO:0006281)|positive regulation of autophagy (GO:0010508)|SNARE complex assembly (GO:0035493)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)				central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(15)|skin(5)|urinary_tract(2)	32						TGAGCAGAATCCCACGTGGCG	0.378																																						dbGAP											0													214.0	207.0	209.0					11																	75590926		2200	4293	6493	-	-	-	SO:0001583	missense	0			X99050, AB012958	CCDS8241.1	11q13	2012-11-15	2012-11-15		ENSG00000198382	ENSG00000198382			12640	protein-coding gene	gene with protein product	"""beclin 1 binding protein"""	602493	"""UV radiation resistance associated gene"""			9169138, 16799551, 18843052	Standard	NM_003369		Approved	VPS38	uc001oxc.3	Q9P2Y5	OTTHUMG00000165319	ENST00000356136.3:c.274C>T	11.37:g.75590926C>T	ENSP00000348455:p.Pro92Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTC1|O00392	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	p.P92S	ENST00000356136.3	37	c.274	CCDS8241.1	11	.	.	.	.	.	.	.	.	.	.	C	28.0	4.883837	0.91814	.	.	ENSG00000198382	ENST00000356136	D	0.82711	-1.64	5.65	5.65	0.86999	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.91129	0.7207	M	0.74647	2.275	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91676	0.5354	10	0.87932	D	0	-9.7331	18.3143	0.90213	0.0:1.0:0.0:0.0	.	92	Q9P2Y5	UVRAG_HUMAN	S	92	ENSP00000348455:P92S	ENSP00000348455:P92S	P	+	1	0	UVRAG	75268574	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.437000	0.80417	2.678000	0.91216	0.655000	0.94253	CCC	UVRAG	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	ENSG00000198382		0.378	UVRAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UVRAG	HGNC	protein_coding	OTTHUMT00000383430.1	363	0.00	0	C	NM_003369		75590926	75590926	+1	no_errors	ENST00000356136	ensembl	human	known	69_37n	missense	275	15.64	51	SNP	1.000	T
WDR17	116966	genome.wustl.edu	37	4	177049888	177049888	+	Splice_Site	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr4:177049888G>C	ENST00000280190.4	+	7	1018		c.e7-1		WDR17_ENST00000393643.2_Splice_Site|WDR17_ENST00000508596.1_Splice_Site|WDR17_ENST00000507824.2_Splice_Site			Q8IZU2	WDR17_HUMAN	WD repeat domain 17											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GATCTGACTAGATTCTCAAGT	0.303																																						dbGAP											0													52.0	50.0	51.0					4																	177049888		2201	4291	6492	-	-	-	SO:0001630	splice_region_variant	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.863-1G>C	4.37:g.177049888G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQX0|Q0QD35	Splice_Site	SNP	-	e6-1	ENST00000280190.4	37	c.863-1	CCDS3825.1	4	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617890	0.66787	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8954	0.92421	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WDR17	177286882	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	8.976000	0.93442	2.555000	0.86185	0.650000	0.86243	.	WDR17	-	-	ENSG00000150627		0.303	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	180	0.00	0	G		Intron	177049888	177049888	+1	no_errors	ENST00000280190	ensembl	human	known	69_37n	splice_site	120	30.64	53	SNP	1.000	C
WDR46	9277	genome.wustl.edu	37	6	33247580	33247580	+	Silent	SNP	G	G	A			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr6:33247580G>A	ENST00000374617.4	-	13	1937	c.1581C>T	c.(1579-1581)atC>atT	p.I527I	B3GALT4_ENST00000606990.1_Intron	NM_001164267.1|NM_005452.5	NP_001157739.1|NP_005443.3	O15213	WDR46_HUMAN	WD repeat domain 46	527							poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	20						GCTCCAGGGAGATGACATCCA	0.607																																						dbGAP											0													68.0	65.0	66.0					6																	33247580		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z97184	CCDS4772.1	6p21.3	2013-01-09	2005-05-31	2005-05-31	ENSG00000227057	ENSG00000227057		"""WD repeat domain containing"""	13923	protein-coding gene	gene with protein product		611440	"""chromosome 6 open reading frame 11"""	C6orf11		9545376, 9521053	Standard	NM_005452		Approved	BING4, UTP7	uc003ods.3	O15213	OTTHUMG00000031192	ENST00000374617.4:c.1581C>T	6.37:g.33247580G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDP5|Q5HYZ0|Q5STK5|Q5STR3	Silent	SNP	pfam_BING4_C_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I527	ENST00000374617.4	37	c.1581	CCDS4772.1	6																																																																																			WDR46	-	NULL	ENSG00000227057		0.607	WDR46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR46	HGNC	protein_coding	OTTHUMT00000076382.2	163	0.00	0	G	NM_005452		33247580	33247580	-1	no_errors	ENST00000374617	ensembl	human	known	69_37n	silent	101	25.19	34	SNP	0.999	A
XIRP1	165904	genome.wustl.edu	37	3	39228203	39228203	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr3:39228203G>C	ENST00000340369.3	-	2	2962	c.2734C>G	c.(2734-2736)Ctg>Gtg	p.L912V	XIRP1_ENST00000396251.1_Missense_Mutation_p.L912V|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	912					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)	p.L912M(1)		breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CGGGGCTGCAGAGAGTAGGCA	0.622																																						dbGAP											1	Substitution - Missense(1)	lung(1)											34.0	33.0	33.0					3																	39228203		2203	4300	6503	-	-	-	SO:0001583	missense	0			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.2734C>G	3.37:g.39228203G>C	ENSP00000343140:p.Leu912Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.L912V	ENST00000340369.3	37	c.2734	CCDS2683.1	3	.	.	.	.	.	.	.	.	.	.	G	11.33	1.607151	0.28623	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.14766	2.48;2.74	5.03	4.15	0.48705	.	0.076329	0.53938	U	0.000045	T	0.30916	0.0780	M	0.68952	2.095	0.80722	D	1	D;D	0.76494	0.999;0.989	D;P	0.78314	0.991;0.804	T	0.02646	-1.1129	10	0.72032	D	0.01	.	7.6026	0.28085	0.0897:0.1653:0.745:0.0	.	912;912	Q702N8;Q702N8-2	XIRP1_HUMAN;.	V	912	ENSP00000379550:L912V;ENSP00000343140:L912V	ENSP00000343140:L912V	L	-	1	2	XIRP1	39203207	1.000000	0.71417	1.000000	0.80357	0.207000	0.24258	4.349000	0.59385	1.278000	0.44430	-0.150000	0.13652	CTG	XIRP1	-	NULL	ENSG00000168334		0.622	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XIRP1	HGNC	protein_coding	OTTHUMT00000254065.1	56	0.00	0	G	XM_093522		39228203	39228203	-1	no_errors	ENST00000340369	ensembl	human	known	69_37n	missense	24	33.33	12	SNP	0.984	C
ZMYM4	9202	genome.wustl.edu	37	1	35873661	35873661	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr1:35873661G>C	ENST00000314607.6	+	26	3929	c.3849G>C	c.(3847-3849)ttG>ttC	p.L1283F	ZMYM4_ENST00000373297.2_Missense_Mutation_p.L1194F	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	1283					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTGCTGAGTTGAGTTTGGGCT	0.403																																						dbGAP											0													195.0	179.0	184.0					1																	35873661		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.3849G>C	1.37:g.35873661G>C	ENSP00000322915:p.Leu1283Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	pfam_DUF3504,pfam_Znf_MYM,smart_TRASH	p.L1283F	ENST00000314607.6	37	c.3849	CCDS389.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.50|19.50	3.839690|3.839690	0.71488|0.71488	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000457946|ENST00000314607;ENST00000373297	.|T;T	.|0.49432	.|0.78;0.84	5.79|5.79	3.92|3.92	0.45320|0.45320	.|.	.|0.079395	.|0.52532	.|D	.|0.000075	T|T	0.66117|0.66117	0.2757|0.2757	M|M	0.77616|0.77616	2.38|2.38	0.49130|0.49130	D|D	0.999758|0.999758	.|D	.|0.65815	.|0.995	.|D	.|0.67231	.|0.95	T|T	0.70956|0.70956	-0.4731|-0.4731	5|10	.|0.87932	.|D	.|0	-6.5599|-6.5599	11.9534|11.9534	0.52968|0.52968	0.1395:0.0:0.8605:0.0|0.1395:0.0:0.8605:0.0	.|.	.|1283	.|Q5VZL5	.|ZMYM4_HUMAN	Q|F	942|1283;1194	.|ENSP00000322915:L1283F;ENSP00000362394:L1194F	.|ENSP00000322915:L1283F	E|L	+|+	1|3	0|2	ZMYM4|ZMYM4	35646248|35646248	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.938000|0.938000	0.57974|0.57974	2.782000|2.782000	0.47758|0.47758	1.440000|1.440000	0.47531|0.47531	-0.140000|-0.140000	0.14226|0.14226	GAG|TTG	ZMYM4	-	NULL	ENSG00000146463		0.403	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM4	HGNC	protein_coding	OTTHUMT00000012207.3	323	0.00	0	G	NM_005095		35873661	35873661	+1	no_errors	ENST00000314607	ensembl	human	known	69_37n	missense	258	20.86	68	SNP	1.000	C
ZNF318	24149	genome.wustl.edu	37	6	43306894	43306894	+	Silent	SNP	A	A	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr6:43306894A>C	ENST00000361428.2	-	10	4919	c.4842T>G	c.(4840-4842)tcT>tcG	p.S1614S	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1614					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			AAGGAGAAGTAGAAGAGGTGT	0.483																																						dbGAP											0													130.0	133.0	132.0					6																	43306894		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.4842T>G	6.37:g.43306894A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Silent	SNP	smart_Znf_U1	p.S1614	ENST00000361428.2	37	c.4842	CCDS4895.2	6																																																																																			ZNF318	-	NULL	ENSG00000171467		0.483	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF318	HGNC	protein_coding	OTTHUMT00000040601.2	321	0.00	0	A	NM_014345		43306894	43306894	-1	no_errors	ENST00000361428	ensembl	human	known	69_37n	silent	237	19.93	59	SNP	0.000	C
ZNF681	148213	genome.wustl.edu	37	19	23926992	23926992	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chr19:23926992C>G	ENST00000402377.3	-	4	1501	c.1360G>C	c.(1360-1362)Gaa>Caa	p.E454Q	ZNF681_ENST00000395385.3_Missense_Mutation_p.E385Q	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	454					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTCCCACATTCTTCACATTTG	0.368																																						dbGAP											0													52.0	54.0	54.0					19																	23926992		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1360G>C	19.37:g.23926992C>G	ENSP00000384000:p.Glu454Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVF7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E454Q	ENST00000402377.3	37	c.1360	CCDS12414.2	19	.	.	.	.	.	.	.	.	.	.	.	12.90	2.076491	0.36662	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.07444	3.19;3.19	1.51	1.51	0.23008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09202	0.0227	N	0.11284	0.12	0.22240	N	0.999266	D	0.63880	0.993	P	0.58873	0.847	T	0.36939	-0.9727	9	0.38643	T	0.18	.	8.4797	0.33034	0.0:1.0:0.0:0.0	.	454	Q96N22	ZN681_HUMAN	Q	454;385	ENSP00000384000:E454Q;ENSP00000378783:E385Q	ENSP00000378783:E385Q	E	-	1	0	ZNF681	23718832	0.000000	0.05858	0.364000	0.25888	0.052000	0.14988	-0.563000	0.05943	0.798000	0.33994	0.313000	0.20887	GAA	ZNF681	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196172		0.368	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF681	HGNC	protein_coding	OTTHUMT00000320248.2	157	0.00	0	C	NM_138286		23926992	23926992	-1	no_errors	ENST00000402377	ensembl	human	known	69_37n	missense	99	37.34	59	SNP	0.828	G
ZNF75D	7626	genome.wustl.edu	37	X	134427939	134427939	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A159-01A-11D-A10Y-09	TCGA-E2-A159-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb	deb6d361-2e35-4b88-8f3b-db1382e05f18	g.chrX:134427939A>C	ENST00000370766.3	-	3	2837	c.128T>G	c.(127-129)cTt>cGt	p.L43R	ZNF75D_ENST00000494295.1_Intron|ZNF75D_ENST00000370764.1_Missense_Mutation_p.L43R	NM_007131.3	NP_009062.2	P51815	ZN75D_HUMAN	zinc finger protein 75D	43					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						CTCAGGACCAAGATTCTCTAT	0.493																																						dbGAP											0													101.0	94.0	96.0					X																	134427939		2203	4300	6503	-	-	-	SO:0001583	missense	0			S43109	CCDS14648.1, CCDS55503.1	Xq26	2013-01-09	2008-06-11	2008-06-11	ENSG00000186376	ENSG00000186376		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13145	protein-coding gene	gene with protein product		314997	"""zinc finger protein 75 (D8C6)"""	ZNF82, ZNF75		1505955	Standard	XM_005262469		Approved	ZKSCAN24, D8C6, ZSCAN28	uc004eyo.3	P51815	OTTHUMG00000022482	ENST00000370766.3:c.128T>G	X.37:g.134427939A>C	ENSP00000359802:p.Leu43Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK62|B3KRI7|Q5JPG0|Q6LDE0	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L43R	ENST00000370766.3	37	c.128	CCDS14648.1	X	.	.	.	.	.	.	.	.	.	.	A	9.348	1.064734	0.20067	.	.	ENSG00000186376	ENST00000370766;ENST00000370764	T;T	0.06608	3.28;3.28	3.13	1.92	0.25849	Retrovirus capsid, C-terminal (1);	.	.	.	.	T	0.09730	0.0239	M	0.72894	2.215	0.09310	N	1	P;P	0.52316	0.871;0.952	P;P	0.48141	0.568;0.568	T	0.18618	-1.0331	9	0.12103	T	0.63	.	5.6872	0.17809	0.7217:0.2783:0.0:0.0	.	43;43	P51815;A6NK62	ZN75D_HUMAN;.	R	43	ENSP00000359802:L43R;ENSP00000359800:L43R	ENSP00000359800:L43R	L	-	2	0	ZNF75D	134255605	0.006000	0.16342	0.007000	0.13788	0.102000	0.19082	1.115000	0.31209	0.431000	0.26258	0.414000	0.27820	CTT	ZNF75D	-	superfamily_Retrov_capsid_C	ENSG00000186376		0.493	ZNF75D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF75D	HGNC	protein_coding	OTTHUMT00000058415.1	105	0.00	0	A	NM_007131		134427939	134427939	-1	no_errors	ENST00000370766	ensembl	human	known	69_37n	missense	74	24.49	24	SNP	0.007	C
