#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
APEX2	27301	genome.wustl.edu	37	X	55028014	55028014	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chrX:55028014G>A	ENST00000374987.3	+	2	259	c.193G>A	c.(193-195)Ggt>Agt	p.G65S	APEX2_ENST00000471758.1_3'UTR	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	65					base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						TATCGTTGAGGGTTATAACTC	0.463								Other BER factors																														dbGAP											0													40.0	34.0	36.0					X																	55028014		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.193G>A	X.37:g.55028014G>A	ENSP00000364126:p.Gly65Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5X7	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_Znf_GRF,superfamily_Endo/exonuclease/phosphatase,tigrfam_ExoDNase_III	p.G65S	ENST00000374987.3	37	c.193	CCDS14365.1	X	.	.	.	.	.	.	.	.	.	.	G	22.8	4.336906	0.81801	.	.	ENSG00000169188	ENST00000374987	T	0.71341	-0.56	5.16	5.16	0.70880	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	D	0.85225	0.5648	M	0.85299	2.745	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	D	0.87606	0.2500	10	0.72032	D	0.01	-23.6734	14.8617	0.70387	0.0:0.0:1.0:0.0	.	65	Q9UBZ4	APEX2_HUMAN	S	65	ENSP00000364126:G65S	ENSP00000364126:G65S	G	+	1	0	APEX2	55044739	1.000000	0.71417	0.999000	0.59377	0.469000	0.32828	8.410000	0.90225	2.296000	0.77279	0.544000	0.68410	GGT	APEX2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,tigrfam_ExoDNase_III	ENSG00000169188		0.463	APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEX2	HGNC	protein_coding	OTTHUMT00000056845.1	119	0.00	0	G			55028014	55028014	+1	no_errors	ENST00000374987	ensembl	human	known	69_37n	missense	57	25.00	19	SNP	1.000	A
CD69	969	genome.wustl.edu	37	12	9907274	9907274	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr12:9907274G>A	ENST00000228434.3	-	4	480	c.400C>T	c.(400-402)Cga>Tga	p.R134*	CD69_ENST00000536709.1_Nonsense_Mutation_p.R134*	NM_001781.2	NP_001772.1	Q07108	CD69_HUMAN	CD69 molecule	134	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular response to drug (GO:0035690)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)	10						CCTGCGTATCGTTTTAGAAAG	0.408																																						dbGAP											0													163.0	163.0	163.0					12																	9907274		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Z22576	CCDS8604.1	12p13	2011-08-30	2006-03-28		ENSG00000110848	ENSG00000110848		"""C-type lectin domain containing"", ""CD molecules"""	1694	protein-coding gene	gene with protein product		107273	"""CD69 antigen (p60, early T-cell activation antigen)"""			1612643	Standard	NM_001781		Approved	CLEC2C	uc001qwk.3	Q07108	OTTHUMG00000168481	ENST00000228434.3:c.400C>T	12.37:g.9907274G>A	ENSP00000228434:p.Arg134*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.R134*	ENST00000228434.3	37	c.400	CCDS8604.1	12	.	.	.	.	.	.	.	.	.	.	G	17.88	3.496438	0.64186	.	.	ENSG00000110848	ENST00000228434;ENST00000536709	.	.	.	5.4	4.5	0.54988	.	0.788602	0.10945	N	0.616818	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.7084	11.3329	0.49487	0.0:0.0:0.8189:0.1811	.	.	.	.	X	134	.	.	R	-	1	2	CD69	9798541	0.012000	0.17670	0.011000	0.14972	0.145000	0.21501	1.394000	0.34509	1.481000	0.48307	0.655000	0.94253	CGA	CD69	-	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000110848		0.408	CD69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD69	HGNC	protein_coding	OTTHUMT00000399876.1	406	0.00	0	G			9907274	9907274	-1	no_errors	ENST00000228434	ensembl	human	known	69_37n	nonsense	173	10.36	20	SNP	0.007	A
CNOT1	23019	genome.wustl.edu	37	16	58585042	58585042	+	Silent	SNP	T	T	C			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr16:58585042T>C	ENST00000317147.5	-	24	3668	c.3336A>G	c.(3334-3336)acA>acG	p.T1112T	CNOT1_ENST00000569240.1_Silent_p.T1107T|CNOT1_ENST00000441024.2_Silent_p.T1112T|CNOT1_ENST00000569732.1_5'Flank|SNORA46_ENST00000384762.1_RNA|CNOT1_ENST00000245138.4_Silent_p.T2T	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1112	Interaction with CNOT6, CNOT6L, CNOT7 and CNOT8.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TCACCTTTTGTGTCATATTTG	0.363																																						dbGAP											0													94.0	103.0	100.0					16																	58585042		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.3336A>G	16.37:g.58585042T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.T105A	ENST00000317147.5	37	c.313	CCDS10799.1	16																																																																																			CNOT1	-	superfamily_ARM-type_fold	ENSG00000125107		0.363	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3	233	0.00	0	T	NM_016284		58585042	58585042	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000567285	ensembl	human	putative	69_37n	missense	31	11.43	4	SNP	0.986	C
CUL9	23113	genome.wustl.edu	37	6	43153245	43153245	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr6:43153245A>C	ENST00000252050.4	+	3	731	c.647A>C	c.(646-648)cAg>cCg	p.Q216P	CUL9_ENST00000372647.2_Missense_Mutation_p.Q216P|CUL9_ENST00000354495.3_Missense_Mutation_p.Q216P	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	216					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						GGCATCGAGCAGCACATGGAT	0.493																																						dbGAP											0													145.0	122.0	130.0					6																	43153245		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.647A>C	6.37:g.43153245A>C	ENSP00000252050:p.Gln216Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_Znf_C6HC,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,superfamily_UBA-like,smart_Cullin_neddylation_domain,smart_Znf_C6HC,pfscan_Znf_RING,pfscan_Cullin_homology	p.Q216P	ENST00000252050.4	37	c.647	CCDS4890.1	6	.	.	.	.	.	.	.	.	.	.	A	16.31	3.087576	0.55968	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.53640	0.61;0.61;0.61	4.36	4.36	0.52297	.	0.154623	0.44483	D	0.000443	T	0.56717	0.2004	M	0.63843	1.955	0.39968	D	0.974753	D;D;D	0.76494	0.999;0.999;0.995	D;D;P	0.80764	0.994;0.994;0.888	T	0.63712	-0.6575	10	0.87932	D	0	-19.2201	13.7069	0.62646	1.0:0.0:0.0:0.0	.	216;216;216	E9PEZ1;Q8IWT3;Q05C85	.;CUL9_HUMAN;.	P	216	ENSP00000252050:Q216P;ENSP00000346490:Q216P;ENSP00000361730:Q216P	ENSP00000252050:Q216P	Q	+	2	0	CUL9	43261223	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.097000	0.94193	1.834000	0.53371	0.379000	0.24179	CAG	CUL9	-	NULL	ENSG00000112659		0.493	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL9	HGNC	protein_coding	OTTHUMT00000040582.2	209	0.00	0	A	NM_015089		43153245	43153245	+1	no_errors	ENST00000252050	ensembl	human	known	69_37n	missense	108	28.00	42	SNP	1.000	C
DLL1	28514	genome.wustl.edu	37	6	170592575	170592575	+	Missense_Mutation	SNP	G	G	T	rs368185917		TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr6:170592575G>T	ENST00000366756.3	-	9	2125	c.1792C>A	c.(1792-1794)Cgt>Agt	p.R598S		NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	598					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|cell-cell signaling (GO:0007267)|compartment pattern specification (GO:0007386)|determination of left/right symmetry (GO:0007368)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|inner ear development (GO:0048839)|left/right axis specification (GO:0070986)|loop of Henle development (GO:0072070)|negative regulation of auditory receptor cell differentiation (GO:0045608)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of myeloid cell differentiation (GO:0045638)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|regulation of cell adhesion (GO:0030155)|somite specification (GO:0001757)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		TCCTTCTCACGCTGGCAGTTG	0.632																																						dbGAP											0													182.0	162.0	169.0					6																	170592575		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719			2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""				Standard	NM_005618		Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.1792C>A	6.37:g.170592575G>T	ENSP00000355718:p.Arg598Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAK7|B5M0B3|Q9NU41|Q9UJV2	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Notch_ligand_N,pfam_DSL,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,smart_DSL,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_DSL,pfscan_EG-like_dom	p.R598S	ENST00000366756.3	37	c.1792	CCDS5313.1	6	.	.	.	.	.	.	.	.	.	.	G	17.44	3.391107	0.62066	.	.	ENSG00000198719	ENST00000366756	D	0.86230	-2.09	5.38	4.45	0.53987	.	0.097389	0.64402	D	0.000002	D	0.91723	0.7383	M	0.80847	2.515	0.52099	D	0.999949	D	0.89917	1.0	D	0.91635	0.999	D	0.90807	0.4698	10	0.45353	T	0.12	.	13.1706	0.59595	0.0:0.0:0.6716:0.3283	.	598	O00548	DLL1_HUMAN	S	598	ENSP00000355718:R598S	ENSP00000355718:R598S	R	-	1	0	DLL1	170434500	0.991000	0.36638	1.000000	0.80357	0.997000	0.91878	1.992000	0.40737	2.689000	0.91719	0.655000	0.94253	CGT	DLL1	-	NULL	ENSG00000198719		0.632	DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLL1	HGNC	protein_coding	OTTHUMT00000043254.1	221	0.00	0	G			170592575	170592575	-1	no_errors	ENST00000366756	ensembl	human	known	69_37n	missense	137	16.46	27	SNP	1.000	T
EIF3B	8662	genome.wustl.edu	37	7	2418800	2418800	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr7:2418800A>G	ENST00000360876.4	+	17	2320	c.2264A>G	c.(2263-2265)gAa>gGa	p.E755G	EIF3B_ENST00000397011.2_Missense_Mutation_p.E755G	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		ACCATGATGGAAGATTTCCGG	0.532																																						dbGAP											0													59.0	55.0	56.0					7																	2418800		2203	4300	6503	-	-	-	SO:0001583	missense	0			U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.2264A>G	7.37:g.2418800A>G	ENSP00000354125:p.Glu755Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_TIF2A_beta_prop-like,pfam_RRM_dom,smart_RRM_dom,pirsf_eIF3b,pfscan_RRM_dom	p.E755G	ENST00000360876.4	37	c.2264	CCDS5332.1	7	.	.	.	.	.	.	.	.	.	.	A	18.89	3.720011	0.68844	.	.	ENSG00000106263	ENST00000314800;ENST00000360876;ENST00000397011;ENST00000489558	T;T	0.26518	1.73;1.73	5.82	5.82	0.92795	.	0.043067	0.85682	D	0.000000	T	0.31827	0.0809	M	0.73962	2.25	0.80722	D	1	P	0.41313	0.745	B	0.36134	0.218	T	0.18366	-1.0339	10	0.52906	T	0.07	-44.0231	16.1832	0.81925	1.0:0.0:0.0:0.0	.	755	P55884	EIF3B_HUMAN	G	755;755;755;679	ENSP00000354125:E755G;ENSP00000380206:E755G	ENSP00000316638:E755G	E	+	2	0	EIF3B	2385326	1.000000	0.71417	0.998000	0.56505	0.752000	0.42762	9.162000	0.94745	2.218000	0.71995	0.533000	0.62120	GAA	EIF3B	-	pirsf_eIF3b	ENSG00000106263		0.532	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	EIF3B	HGNC	protein_coding	OTTHUMT00000207006.1	106	0.00	0	A			2418800	2418800	+1	no_errors	ENST00000360876	ensembl	human	known	69_37n	missense	78	22.00	22	SNP	1.000	G
FHIT	2272	genome.wustl.edu	37	3	60522632	60522632	+	Missense_Mutation	SNP	A	A	G	rs141483349	byFrequency	TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr3:60522632A>G	ENST00000468189.1	-	5	434	c.64T>C	c.(64-66)Tcc>Ccc	p.S22P	FHIT_ENST00000492590.1_Missense_Mutation_p.S22P|FHIT_ENST00000476844.1_Missense_Mutation_p.S22P|FHIT_ENST00000341848.4_Missense_Mutation_p.S22P			P49789	FHIT_HUMAN	fragile histidine triad	22	HIT. {ECO:0000255|PROSITE- ProRule:PRU00464}.				DNA replication (GO:0006260)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide metabolic process (GO:0009117)|purine nucleotide metabolic process (GO:0006163)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|catalytic activity (GO:0003824)|hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)	12		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		AGAGCGAAGGACAGTTCTGTT	0.413			T	HMGA2	pleomorphic salivary gland adenoma				Renal Cell Cancer associated with constitutional translocation of chromosome 3																													dbGAP		Dom	yes		3	3p14.2	2272	fragile histidine triad gene		E	0													102.0	94.0	97.0					3																	60522632		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		BC032336	CCDS2894.1	3p14.2	2012-02-27	2012-02-27		ENSG00000189283	ENSG00000189283			3701	protein-coding gene	gene with protein product		601153	"""fragile histidine triad gene"""			8598045, 9671749	Standard	NM_002012		Approved	FRA3B, AP3Aase	uc003dky.3	P49789	OTTHUMG00000158591	ENST00000468189.1:c.64T>C	3.37:g.60522632A>G	ENSP00000417480:p.Ser22Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A2IAS9|A2IAT0|A2IAT6|A8K1A9|Q45QG9|Q6IU12	Missense_Mutation	SNP	pfam_Histidine_triad_HIT,superfamily_HIT-like,pfscan_Histidine_triad_HIT	p.S22P	ENST00000468189.1	37	c.64	CCDS2894.1	3	.	.	.	.	.	.	.	.	.	.	A	24.0	4.483416	0.84854	.	.	ENSG00000189283	ENST00000492590;ENST00000476844;ENST00000468189;ENST00000341848;ENST00000488467	D;D;D;D;D	0.91843	-2.92;-2.92;-2.92;-2.92;-2.92	6.17	6.17	0.99709	Histidine triad motif (1);Histidine triad-like motif (1);	0.275503	0.35378	N	0.003241	D	0.96892	0.8985	M	0.93062	3.375	0.51482	D	0.999927	D	0.63880	0.993	D	0.71414	0.973	D	0.97631	1.0142	9	.	.	.	-5.8446	15.3933	0.74767	1.0:0.0:0.0:0.0	.	22	P49789	FHIT_HUMAN	P	22	ENSP00000418582:S22P;ENSP00000417557:S22P;ENSP00000417480:S22P;ENSP00000342087:S22P;ENSP00000418596:S22P	.	S	-	1	0	FHIT	60497672	1.000000	0.71417	0.997000	0.53966	0.586000	0.36452	4.806000	0.62569	2.371000	0.80710	0.533000	0.62120	TCC	FHIT	-	pfam_Histidine_triad_HIT,superfamily_HIT-like,pfscan_Histidine_triad_HIT	ENSG00000189283		0.413	FHIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FHIT	HGNC	protein_coding	OTTHUMT00000351648.1	206	0.00	0	A	NM_002012		60522632	60522632	-1	no_errors	ENST00000341848	ensembl	human	known	69_37n	missense	77	30.63	34	SNP	1.000	G
FRAS1	80144	genome.wustl.edu	37	4	79432509	79432509	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr4:79432509delA	ENST00000264895.6	+	64	10302	c.9862delA	c.(9862-9864)accfs	p.T3288fs		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3284					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CCATGTGGGGACCCCCTTAAG	0.537																																						dbGAP											0													119.0	118.0	119.0					4																	79432509		2070	4243	6313	-	-	-	SO:0001589	frameshift_variant	0			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.9862delA	4.37:g.79432509delA	ENSP00000264895:p.Thr3288fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Frame_Shift_Del	DEL	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EGF-like,smart_Calx_beta,pfscan_VWF_C	p.T3288fs	ENST00000264895.6	37	c.9862	CCDS54771.1	4																																																																																			FRAS1	-	NULL	ENSG00000138759		0.537	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FRAS1	HGNC	protein_coding		249	0.00	0	A			79432509	79432509	+1	no_errors	ENST00000264895	ensembl	human	known	69_37n	frame_shift_del	140	24.08	46	DEL	1.000	-
GATA3	2625	genome.wustl.edu	37	10	8115701	8115701	+	Splice_Site	SNP	G	G	C	rs112417755		TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr10:8115701G>C	ENST00000346208.3	+	6	1502		c.e6-1		GATA3_ENST00000379328.3_Splice_Site|GATA3_ENST00000461472.1_Splice_Site			P23771	GATA3_HUMAN	GATA binding protein 3						anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.?(3)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TCTTTGTTTAGATTAACAGAC	0.418			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	3	Unknown(3)	breast(3)	GRCh37	CS043935	GATA3	S	rs112417755						32.0	35.0	34.0					10																	8115701		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1048-1G>C	10.37:g.8115701G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Splice_Site	SNP	-	e5-1	ENST00000346208.3	37	c.1051-1	CCDS7083.1	10	.	.	.	.	.	.	.	.	.	.	G	17.29	3.353289	0.61293	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2824	0.90102	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GATA3	8155707	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.869000	0.99810	2.305000	0.77605	0.462000	0.41574	.	GATA3	-	-	ENSG00000107485		0.418	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	69	0.00	0	G	NM_001002295	Intron	8115701	8115701	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	splice_site	24	29.41	10	SNP	1.000	C
GSX1	219409	genome.wustl.edu	37	13	28367816	28367816	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr13:28367816C>T	ENST00000302945.2	+	2	574	c.526C>T	c.(526-528)Cgt>Tgt	p.R176C		NM_145657.1	NP_663632.1	Q9H4S2	GSX1_HUMAN	GS homeobox 1	176					adenohypophysis development (GO:0021984)|hypothalamus development (GO:0021854)|neuron fate commitment (GO:0048663)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		GTCCCGCCTACGTCGCATCGA	0.582																																						dbGAP											0													96.0	90.0	92.0					13																	28367816		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB044157	CCDS9326.1	13q12.2	2012-03-09		2007-07-26	ENSG00000169840	ENSG00000169840		"""Homeoboxes / ANTP class : HOXL subclass"""	20374	protein-coding gene	gene with protein product				GSH1			Standard	NM_145657		Approved	Gsh-1	uc001urr.1	Q9H4S2	OTTHUMG00000016637	ENST00000302945.2:c.526C>T	13.37:g.28367816C>T	ENSP00000304331:p.Arg176Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UD62	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.R176C	ENST00000302945.2	37	c.526	CCDS9326.1	13	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529284	0.64860	.	.	ENSG00000169840	ENST00000302945	D	0.96200	-3.94	4.86	4.86	0.63082	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98283	0.9431	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98914	1.0781	10	0.87932	D	0	.	11.6442	0.51250	0.306:0.694:0.0:0.0	.	176	Q9H4S2	GSX1_HUMAN	C	176	ENSP00000304331:R176C	ENSP00000304331:R176C	R	+	1	0	GSX1	27265816	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	1.789000	0.38724	2.250000	0.74265	0.561000	0.74099	CGT	GSX1	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	ENSG00000169840		0.582	GSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSX1	HGNC	protein_coding	OTTHUMT00000044309.2	69	0.00	0	C	NM_145657		28367816	28367816	+1	no_errors	ENST00000302945	ensembl	human	known	69_37n	missense	72	10.00	8	SNP	1.000	T
MAP1A	4130	genome.wustl.edu	37	15	43814971	43814971	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr15:43814971G>T	ENST00000300231.5	+	4	1750	c.1300G>T	c.(1300-1302)Gaa>Taa	p.E434*	MAP1A_ENST00000399453.1_Nonsense_Mutation_p.E434*|MAP1A_ENST00000382031.1_Nonsense_Mutation_p.E672*			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	434	9 X 3 AA repeats of K-K-[DE].|Lys-rich (basic).				microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	caagaaggatgaaggaaggaa	0.413																																						dbGAP											0													34.0	34.0	34.0					15																	43814971		1881	4102	5983	-	-	-	SO:0001587	stop_gained	0			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.1300G>T	15.37:g.43814971G>T	ENSP00000300231:p.Glu434*	Somatic		WXS	Illumina GAIIx	Phase_IV	O95643|Q12973|Q15882|Q9UJT4	Nonsense_Mutation	SNP	NULL	p.E434*	ENST00000300231.5	37	c.1300	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	G	39	7.880103	0.98539	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	.	.	.	5.4	5.4	0.78164	.	0.000000	0.34853	N	0.003634	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-13.2238	10.9329	0.47228	0.1434:0.0:0.8566:0.0	.	.	.	.	X	672;434;434;434	.	ENSP00000300231:E434X	E	+	1	0	MAP1A	41602263	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.646000	0.74348	2.833000	0.97629	0.650000	0.86243	GAA	MAP1A	-	NULL	ENSG00000166963		0.413	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	137	0.00	0	G	NM_002373		43814971	43814971	+1	no_errors	ENST00000399453	ensembl	human	known	69_37n	nonsense	77	16.13	15	SNP	0.993	T
MED13L	23389	genome.wustl.edu	37	12	116429370	116429370	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr12:116429370C>T	ENST00000281928.3	-	17	3595	c.3389G>A	c.(3388-3390)aGc>aAc	p.S1130N		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1130						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GATGCAACAGCTGTCAAAGTT	0.512																																						dbGAP											0													68.0	67.0	67.0					12																	116429370		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.3389G>A	12.37:g.116429370C>T	ENSP00000281928:p.Ser1130Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.S1130N	ENST00000281928.3	37	c.3389	CCDS9177.1	12	.	.	.	.	.	.	.	.	.	.	C	18.72	3.685072	0.68157	.	.	ENSG00000123066	ENST00000281928	D	0.85629	-2.01	5.18	5.18	0.71444	.	0.077534	0.85682	D	0.000000	D	0.91680	0.7370	M	0.67700	2.07	0.80722	D	1	D	0.63880	0.993	D	0.72982	0.979	D	0.92210	0.5775	10	0.87932	D	0	.	18.8897	0.92395	0.0:1.0:0.0:0.0	.	1130	Q71F56	MD13L_HUMAN	N	1130	ENSP00000281928:S1130N	ENSP00000281928:S1130N	S	-	2	0	MED13L	114913753	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.320000	0.79064	2.699000	0.92147	0.460000	0.39030	AGC	MED13L	-	NULL	ENSG00000123066		0.512	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13L	HGNC	protein_coding	OTTHUMT00000403879.3	161	0.00	0	C			116429370	116429370	-1	no_errors	ENST00000281928	ensembl	human	known	69_37n	missense	56	26.32	20	SNP	1.000	T
MMACHC	25974	genome.wustl.edu	37	1	45974590	45974590	+	Silent	SNP	T	T	A			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr1:45974590T>A	ENST00000401061.4	+	4	832	c.552T>A	c.(550-552)ccT>ccA	p.P184P		NM_015506.2	NP_056321.2	Q9Y4U1	MMAC_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria	184					cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	8	Acute lymphoblastic leukemia(166;0.155)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACTGTGTACCTACAAGAGCTG	0.567																																						dbGAP											0													113.0	122.0	119.0					1																	45974590		2071	4203	6274	-	-	-	SO:0001819	synonymous_variant	0				CCDS41324.1	1p34.1	2011-05-12			ENSG00000132763	ENSG00000132763			24525	protein-coding gene	gene with protein product		609831				16311595	Standard	NM_015506		Approved	DKFZP564I122, cblC	uc009vxv.3	Q9Y4U1	OTTHUMG00000007742	ENST00000401061.4:c.552T>A	1.37:g.45974590T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T157|Q9BRQ7	Silent	SNP	NULL	p.P184	ENST00000401061.4	37	c.552	CCDS41324.1	1																																																																																			MMACHC	-	NULL	ENSG00000132763		0.567	MMACHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMACHC	HGNC	protein_coding	OTTHUMT00000020864.2	190	0.00	0	T	NM_015506		45974590	45974590	+1	no_errors	ENST00000401061	ensembl	human	known	69_37n	silent	128	22.89	38	SNP	0.017	A
MPC1	51660	genome.wustl.edu	37	6	166779514	166779514	+	Missense_Mutation	SNP	C	C	T	rs139776186		TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr6:166779514C>T	ENST00000360961.6	-	4	374	c.253G>A	c.(253-255)Gca>Aca	p.A85T	MPC1_ENST00000487218.1_5'UTR|MPC1_ENST00000341756.6_Missense_Mutation_p.A85T	NM_001270879.1|NM_016098.3	NP_001257808.1|NP_057182.1	Q9Y5U8	MPC1_HUMAN	mitochondrial pyruvate carrier 1	85					cellular metabolic process (GO:0044237)|mitochondrial pyruvate transport (GO:0006850)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	pyruvate transmembrane transporter activity (GO:0050833)	p.A85S(1)									TCATTTGTTGCGTGGCATGCA	0.443													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18747	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	lung(1)											91.0	83.0	86.0					6																	166779514		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF125101	CCDS5293.1, CCDS75547.1	6q27	2012-08-01	2012-07-30	2012-07-30	ENSG00000060762	ENSG00000060762			21606	protein-coding gene	gene with protein product		614738	"""brain protein 44-like"""	BRP44L		22628558	Standard	NM_016098		Approved	dJ68L15.3, CGI-129	uc031sra.1	Q9Y5U8	OTTHUMG00000015999	ENST00000360961.6:c.253G>A	6.37:g.166779514C>T	ENSP00000354223:p.Ala85Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5I7|Q5TI66|Q9HB67|Q9UQN4	Missense_Mutation	SNP	pfam_UPF0041	p.A85T	ENST00000360961.6	37	c.253	CCDS5293.1	6	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	13.94	2.387717	0.42308	.	.	ENSG00000060762	ENST00000360961;ENST00000341756;ENST00000392123	T;T	0.71817	-0.6;-0.6	6.17	5.31	0.75309	.	0.400279	0.30649	N	0.009168	T	0.44561	0.1299	L	0.51914	1.62	0.20403	N	0.999909	B	0.11235	0.004	B	0.19946	0.027	T	0.30446	-0.9978	10	0.32370	T	0.25	-2.1928	8.2911	0.31958	0.1544:0.768:0.0:0.0776	.	85	Q9Y5U8	BR44L_HUMAN	T	85;85;42	ENSP00000354223:A85T;ENSP00000340784:A85T	ENSP00000340784:A85T	A	-	1	0	BRP44L	166699504	0.908000	0.30866	0.012000	0.15200	0.578000	0.36192	1.653000	0.37323	1.632000	0.50472	0.655000	0.94253	GCA	MPC1	-	pfam_UPF0041	ENSG00000060762		0.443	MPC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MPC1	HGNC	protein_coding	OTTHUMT00000043052.1	233	0.00	0	C	NM_016098		166779514	166779514	-1	no_errors	ENST00000341756	ensembl	human	known	69_37n	missense	100	28.06	39	SNP	0.076	T
MUC17	140453	genome.wustl.edu	37	7	100677246	100677246	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr7:100677246C>T	ENST00000306151.4	+	3	2613	c.2549C>T	c.(2548-2550)gCt>gTt	p.A850V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	850	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCTACACCTGCTGAAGGTACC	0.502																																						dbGAP											0													281.0	276.0	278.0					7																	100677246		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2549C>T	7.37:g.100677246C>T	ENSP00000302716:p.Ala850Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.A850V	ENST00000306151.4	37	c.2549	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	4.403	0.074532	0.08485	.	.	ENSG00000169876	ENST00000306151	T	0.02656	4.21	1.14	0.177	0.15054	.	.	.	.	.	T	0.01695	0.0054	N	0.14661	0.345	0.09310	N	1	B	0.21225	0.053	B	0.11329	0.006	T	0.49532	-0.8930	9	0.19147	T	0.46	.	5.3266	0.15910	0.0:0.7723:0.0:0.2276	.	850	Q685J3	MUC17_HUMAN	V	850	ENSP00000302716:A850V	ENSP00000302716:A850V	A	+	2	0	MUC17	100463966	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	1.424000	0.34848	0.052000	0.16007	0.196000	0.17591	GCT	MUC17	-	NULL	ENSG00000169876		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	559	0.00	0	C	NM_001040105		100677246	100677246	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	389	11.59	51	SNP	0.006	T
MYCBP2	23077	genome.wustl.edu	37	13	77636761	77636761	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr13:77636761C>A	ENST00000544440.2	-	74	12647	c.12630G>T	c.(12628-12630)tgG>tgT	p.W4210C	MYCBP2_ENST00000357337.6_Missense_Mutation_p.W4210C|MYCBP2_ENST00000407578.2_Missense_Mutation_p.W4248C					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CCTTTCCCATCCATCTCCCCG	0.423																																						dbGAP											0													199.0	173.0	182.0					13																	77636761		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.12630G>T	13.37:g.77636761C>A	ENSP00000444596:p.Trp4210Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,prints_Reg_chr_condens,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens	p.W4248C	ENST00000544440.2	37	c.12744		13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.8|29.8	5.036990|5.036990	0.93630|0.93630	.|.	.|.	ENSG00000005810|ENSG00000005810	ENST00000429715|ENST00000357337;ENST00000407578;ENST00000544440	.|T;T;T	.|0.34472	.|1.36;1.36;1.36	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.61714|0.61714	0.2369|0.2369	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	.|D	.|0.69078	.|0.997	.|D	.|0.75020	.|0.985	T|T	0.60895|0.60895	-0.7172|-0.7172	5|10	.|0.87932	.|D	.|0	.|.	20.5827|20.5827	0.99408|0.99408	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|4210	.|O75592	.|MYCB2_HUMAN	Y|C	631|4210;4248;4210	.|ENSP00000349892:W4210C;ENSP00000384288:W4248C;ENSP00000444596:W4210C	.|ENSP00000349892:W4210C	D|W	-|-	1|3	0|0	MYCBP2|MYCBP2	76534762|76534762	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.752000|7.752000	0.85141|0.85141	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAT|TGG	MYCBP2	-	NULL	ENSG00000005810		0.423	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	518	0.00	0	C	NM_015057		77636761	77636761	-1	no_errors	ENST00000407578	ensembl	human	known	69_37n	missense	188	25.69	65	SNP	1.000	A
PAEP	5047	genome.wustl.edu	37	9	138454702	138454702	+	Silent	SNP	A	A	G			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr9:138454702A>G	ENST00000479141.1	+	3	317	c.273A>G	c.(271-273)ggA>ggG	p.G91G	PAEP_ENST00000371766.2_Silent_p.G91G|PAEP_ENST00000277508.5_Silent_p.G91G	NM_002571.2	NP_002562.2	P09466	PAEP_HUMAN	progestagen-associated endometrial protein	91					multicellular organismal development (GO:0007275)|transport (GO:0006810)	extracellular region (GO:0005576)	small molecule binding (GO:0036094)			cervix(1)|endometrium(1)|lung(1)|prostate(1)|skin(1)|stomach(1)	6				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		AGGTCCTTGGAGAGAAGACTG	0.522																																						dbGAP											0													205.0	195.0	198.0					9																	138454702		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS35173.1	9q34	2011-11-15	2008-07-31		ENSG00000122133	ENSG00000122133		"""Lipocalins"""	8573	protein-coding gene	gene with protein product	"""glycodelin-A"", ""glycodelin-S"", ""glycodelin-F"", ""progesterone-associated endometrial protein"", ""glycodelin"", ""PP14 protein (placental protein 14)"", ""pregnancy-associated endometrial alpha-2-globulin"", ""alpha uterine protein"""	173310				3320533, 2016092	Standard	XM_005263405		Approved	PEP, PP14, GdA, GdS, GdF, PAEG, GD, MGC138509, MGC142288	uc004cgd.1	P09466	OTTHUMG00000020914	ENST00000479141.1:c.273A>G	9.37:g.138454702A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T6T1|Q9UG92	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Blactoglobulin	p.R55G	ENST00000479141.1	37	c.163	CCDS35173.1	9	.	.	.	.	.	.	.	.	.	.	A	6.316	0.426333	0.11987	.	.	ENSG00000122133	ENST00000433563;ENST00000454923	.	.	.	1.33	-2.65	0.06095	.	.	.	.	.	T	0.20700	0.0498	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21109	-1.0255	4	.	.	.	.	3.5842	0.07965	0.4388:0.3534:0.2077:0.0	.	.	.	.	G	55;37	.	.	R	+	1	2	PAEP	137594523	0.000000	0.05858	0.000000	0.03702	0.393000	0.30537	-1.525000	0.02231	-1.606000	0.01591	0.260000	0.18958	AGA	PAEP	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Blactoglobulin	ENSG00000122133		0.522	PAEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAEP	HGNC	protein_coding	OTTHUMT00000055010.1	192	0.00	0	A	NM_001018049		138454702	138454702	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000433563	ensembl	human	known	69_37n	missense	98	30.77	44	SNP	0.000	G
PRDM1	639	genome.wustl.edu	37	6	106547367	106547367	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr6:106547367C>T	ENST00000369096.4	+	4	838	c.604C>T	c.(604-606)Cgg>Tgg	p.R202W	RP1-134E15.3_ENST00000602426.1_RNA|PRDM1_ENST00000369091.2_Missense_Mutation_p.R166W|PRDM1_ENST00000369089.3_Missense_Mutation_p.R68W	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	202					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		GTGGTATTGTCGGGACTTTGC	0.458			"""D, N, Mis, F, S"""		DLBCL																																	dbGAP		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	0													99.0	85.0	90.0					6																	106547367		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.604C>T	6.37:g.106547367C>T	ENSP00000358092:p.Arg202Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM1,pfscan_SET_dom,pfscan_Znf_C2H2	p.R202W	ENST00000369096.4	37	c.604	CCDS5054.2	6	.	.	.	.	.	.	.	.	.	.	C	28.4	4.915584	0.92178	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000450060;ENST00000369089	D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49	5.94	5.94	0.96194	SET domain (2);	0.260617	0.38663	N	0.001612	D	0.91768	0.7396	M	0.69358	2.11	0.58432	D	0.999999	D;D	0.76494	0.998;0.999	P;P	0.55749	0.65;0.783	D	0.91813	0.5461	10	0.87932	D	0	-21.577	20.3736	0.98901	0.0:1.0:0.0:0.0	.	68;202	Q86WM7;O75626	.;PRDM1_HUMAN	W	166;202;166;81;68	ENSP00000358087:R166W;ENSP00000358092:R202W;ENSP00000399772:R81W;ENSP00000358085:R68W	ENSP00000358085:R68W	R	+	1	2	PRDM1	106654060	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.644000	0.61397	2.820000	0.97059	0.650000	0.86243	CGG	PRDM1	-	smart_SET_dom,pirsf_Znf_PRDM1,pfscan_SET_dom	ENSG00000057657		0.458	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM1	HGNC	protein_coding	OTTHUMT00000041661.3	234	0.00	0	C			106547367	106547367	+1	no_errors	ENST00000369096	ensembl	human	known	69_37n	missense	100	33.33	50	SNP	1.000	T
QRICH2	84074	genome.wustl.edu	37	17	74274115	74274115	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr17:74274115C>T	ENST00000262765.5	-	15	4753	c.4574G>A	c.(4573-4575)cGc>cAc	p.R1525H		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1525										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						CAGCAGCTCGCGGATTATCTG	0.642																																						dbGAP											0													62.0	65.0	64.0					17																	74274115		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.4574G>A	17.37:g.74274115C>T	ENSP00000262765:p.Arg1525His	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRE1|Q96LM3	Missense_Mutation	SNP	NULL	p.R1525H	ENST00000262765.5	37	c.4574	CCDS32741.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.73|10.73	1.432660|1.432660	0.25813|0.25813	.|.	.|.	ENSG00000129646|ENSG00000129646	ENST00000532549|ENST00000262765	.|T	.|0.11495	.|2.77	5.51|5.51	3.53|3.53	0.40419|0.40419	.|.	.|.	.|.	.|.	.|.	T|T	0.13543|0.13543	0.0328|0.0328	M|M	0.72118|0.72118	2.19|2.19	0.26423|0.26423	N|N	0.976066|0.976066	.|B	.|0.29805	.|0.257	.|B	.|0.20577	.|0.03	T|T	0.10497|0.10497	-1.0627|-1.0627	5|9	.|0.72032	.|D	.|0.01	-12.3008|-12.3008	9.7466|9.7466	0.40451|0.40451	0.0:0.8498:0.0:0.1502|0.0:0.8498:0.0:0.1502	.|.	.|1525	.|Q9H0J4	.|QRIC2_HUMAN	T|H	173|1525	.|ENSP00000262765:R1525H	.|ENSP00000262765:R1525H	A|R	-|-	1|2	0|0	QRICH2|QRICH2	71785710|71785710	0.433000|0.433000	0.25562|0.25562	0.946000|0.946000	0.38457|0.38457	0.448000|0.448000	0.32197|0.32197	0.712000|0.712000	0.25779|0.25779	0.692000|0.692000	0.31613|0.31613	0.491000|0.491000	0.48974|0.48974	GCG|CGC	QRICH2	-	NULL	ENSG00000129646		0.642	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	QRICH2	HGNC	protein_coding	OTTHUMT00000395140.1	77	0.00	0	C	NM_032134		74274115	74274115	-1	no_errors	ENST00000262765	ensembl	human	known	69_37n	missense	57	13.64	9	SNP	0.986	T
REG1A	5967	genome.wustl.edu	37	2	79350038	79350038	+	Silent	SNP	T	T	C			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr2:79350038T>C	ENST00000233735.1	+	5	496	c.393T>C	c.(391-393)agT>agC	p.S131S		NM_002909.4	NP_002900.2	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha	131	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(26)|prostate(1)|upper_aerodigestive_tract(1)	39						CCCCAAGCAGTGTTAATCCTG	0.577																																						dbGAP											0													110.0	105.0	107.0					2																	79350038		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1964.1	2p12	2008-09-04	2008-06-04		ENSG00000115386	ENSG00000115386			9951	protein-coding gene	gene with protein product	"""pancreatic stone protein"", ""pancreatic thread protein"""	167770	"""regenerating islet-derived 1 alpha (pancreatic stone protein, pancreatic thread protein)"""	REG		2332435, 8333731	Standard	NM_002909		Approved	PSP, PTP, PSPS, PSPS1	uc002snz.3	P05451	OTTHUMG00000130016	ENST00000233735.1:c.393T>C	2.37:g.79350038T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	P11379|Q4ZG28	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_Pancreatis_ac,prints_AntifreezeII	p.S131	ENST00000233735.1	37	c.393	CCDS1964.1	2																																																																																			REG1A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	ENSG00000115386		0.577	REG1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REG1A	HGNC	protein_coding	OTTHUMT00000252289.1	223	0.00	0	T	NM_002909		79350038	79350038	+1	no_errors	ENST00000233735	ensembl	human	known	69_37n	silent	93	27.34	35	SNP	0.000	C
RMND1	55005	genome.wustl.edu	37	6	151766672	151766672	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr6:151766672T>C	ENST00000367303.4	-	2	397	c.275A>G	c.(274-276)aAg>aGg	p.K92R	RMND1_ENST00000336451.3_5'Flank|RMND1_ENST00000491268.1_5'UTR	NM_017909.2	NP_060379.2	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog (S. cerevisiae)	92					translation (GO:0006412)	mitochondrion (GO:0005739)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		AAGGTGTGCCTTTTCATCTTG	0.403																																						dbGAP											0													205.0	191.0	196.0					6																	151766672		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000634	CCDS5232.1, CCDS75539.1	6q25.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000155906	ENSG00000155906			21176	protein-coding gene	gene with protein product		614917	"""chromosome 6 open reading frame 96"""	C6orf96			Standard	NM_001271937		Approved	bA351K16.3, FLJ20627, RMD1	uc003qoi.3	Q9NWS8	OTTHUMG00000015837	ENST00000367303.4:c.275A>G	6.37:g.151766672T>C	ENSP00000356272:p.Lys92Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8H4|Q0VDG6|Q5SZ48|Q5SZ83|Q6NSC5|Q96EN7	Missense_Mutation	SNP	pfam_DUF155	p.K92R	ENST00000367303.4	37	c.275	CCDS5232.1	6	.	.	.	.	.	.	.	.	.	.	T	8.557	0.876921	0.17395	.	.	ENSG00000155906	ENST00000367303	T	0.46063	0.88	5.13	1.37	0.22104	.	0.820678	0.11131	N	0.596335	T	0.10208	0.0250	L	0.32530	0.975	0.09310	N	0.999999	B;B	0.14012	0.009;0.0	B;B	0.14023	0.01;0.001	T	0.36335	-0.9752	10	0.20519	T	0.43	-2.1408	4.9473	0.13997	0.0:0.1636:0.1567:0.6798	.	92;92	Q9NWS8-3;Q9NWS8	.;RMND1_HUMAN	R	92	ENSP00000356272:K92R	ENSP00000356272:K92R	K	-	2	0	RMND1	151808365	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.132000	0.15891	0.003000	0.14656	0.460000	0.39030	AAG	RMND1	-	NULL	ENSG00000155906		0.403	RMND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RMND1	HGNC	protein_coding	OTTHUMT00000042718.2	452	0.22	1	T	NM_017909		151766672	151766672	-1	no_errors	ENST00000367303	ensembl	human	known	69_37n	missense	172	26.50	62	SNP	0.000	C
SP7	121340	genome.wustl.edu	37	12	53722021	53722021	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr12:53722021G>A	ENST00000536324.2	-	3	1488	c.1205C>T	c.(1204-1206)gCc>gTc	p.A402V	SP7_ENST00000537210.2_Missense_Mutation_p.A384V|SP7_ENST00000303846.3_Missense_Mutation_p.A402V	NM_001173467.1	NP_001166938.1	Q8TDD2	SP7_HUMAN	Sp7 transcription factor	402					hematopoietic stem cell differentiation (GO:0060218)|osteoblast differentiation (GO:0001649)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(2)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	14						CGTCTGACTGGCCTCCTCTTC	0.682											OREG0021867	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													21.0	25.0	24.0					12																	53722021		1962	4131	6093	-	-	-	SO:0001583	missense	0			AF477981	CCDS44897.1, CCDS73475.1	12q13.13	2013-01-08				ENSG00000170374		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	17321	protein-coding gene	gene with protein product		606633				11792318	Standard	NM_152860		Approved	osterix, OSX	uc001sct.3	Q8TDD2		ENST00000536324.2:c.1205C>T	12.37:g.53722021G>A	ENSP00000443827:p.Ala402Val	Somatic	994	WXS	Illumina GAIIx	Phase_IV	B3KY26|Q3MJ72|Q7Z718	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A402V	ENST00000536324.2	37	c.1205	CCDS44897.1	12	.	.	.	.	.	.	.	.	.	.	G	9.951	1.220104	0.22373	.	.	ENSG00000170374	ENST00000536324;ENST00000303846;ENST00000537210	T;T;T	0.07688	3.17;3.17;3.18	4.56	4.56	0.56223	.	0.340286	0.25575	N	0.029725	T	0.05914	0.0154	N	0.19112	0.55	0.35731	D	0.817956	B	0.09022	0.002	B	0.06405	0.002	T	0.27773	-1.0064	10	0.31617	T	0.26	.	10.8035	0.46502	0.0:0.0:0.8103:0.1897	.	402	Q8TDD2	SP7_HUMAN	V	402;402;384	ENSP00000443827:A402V;ENSP00000302812:A402V;ENSP00000441367:A384V	ENSP00000302812:A402V	A	-	2	0	SP7	52008288	0.000000	0.05858	1.000000	0.80357	0.303000	0.27691	0.066000	0.14489	2.461000	0.83175	0.561000	0.74099	GCC	SP7	-	NULL	ENSG00000170374		0.682	SP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP7	HGNC	protein_coding	OTTHUMT00000406917.1	45	0.00	0	G			53722021	53722021	-1	no_errors	ENST00000303846	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	0.980	A
TRPS1	7227	genome.wustl.edu	37	8	116426295	116426295	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr8:116426295T>C	ENST00000220888.5	-	6	3961	c.3802A>G	c.(3802-3804)Agg>Ggg	p.R1268G	TRPS1_ENST00000395715.3_Missense_Mutation_p.R1281G|TRPS1_ENST00000519076.1_Missense_Mutation_p.R1022G|TRPS1_ENST00000520276.1_Missense_Mutation_p.R1272G			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1268	Transcriptional repressor domain. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GCATTGTTCCTATGCAGGCCC	0.408									Langer-Giedion syndrome																													dbGAP											0													178.0	166.0	170.0					8																	116426295		1865	4099	5964	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3802A>G	8.37:g.116426295T>C	ENSP00000220888:p.Arg1268Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_C2H2-like,smart_Znf_GATA,pfscan_Znf_C2H2,pfscan_Znf_GATA,prints_Znf_GATA	p.R1281G	ENST00000220888.5	37	c.3841		8	.	.	.	.	.	.	.	.	.	.	T	15.62	2.887216	0.52014	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	D;D;D;D	0.98701	-5.08;-5.06;-5.03;-5.06	5.43	5.43	0.79202	.	0.048017	0.85682	D	0.000000	D	0.98501	0.9500	L	0.40543	1.245	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.991;0.996	D	0.99918	1.1236	10	0.87932	D	0	-7.6957	15.4829	0.75542	0.0:0.0:0.0:1.0	.	1272;1268;1281	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	G	1281;1268;1022;1272	ENSP00000379065:R1281G;ENSP00000220888:R1268G;ENSP00000428910:R1022G;ENSP00000428680:R1272G	ENSP00000220888:R1268G	R	-	1	2	TRPS1	116495471	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.921000	0.63397	2.043000	0.60533	0.533000	0.62120	AGG	TRPS1	-	NULL	ENSG00000104447		0.408	TRPS1-002	KNOWN	basic	protein_coding	TRPS1	HGNC	protein_coding	OTTHUMT00000286436.3	380	0.00	0	T	NM_014112		116426295	116426295	-1	no_errors	ENST00000395715	ensembl	human	known	69_37n	missense	218	22.14	62	SNP	1.000	C
UNC79	57578	genome.wustl.edu	37	14	94088576	94088576	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr14:94088576C>A	ENST00000393151.2	+	30	4997	c.4997C>A	c.(4996-4998)tCt>tAt	p.S1666Y	UNC79_ENST00000256339.4_Missense_Mutation_p.S1489Y|UNC79_ENST00000553484.1_Missense_Mutation_p.S1688Y|UNC79_ENST00000555664.1_Missense_Mutation_p.S1666Y			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1666					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AATGCTGCCTCTTCTCCCTCC	0.532																																						dbGAP											0													84.0	92.0	89.0					14																	94088576		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.4997C>A	14.37:g.94088576C>A	ENSP00000376858:p.Ser1666Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S1688Y	ENST00000393151.2	37	c.5063		14	.	.	.	.	.	.	.	.	.	.	C	10.38	1.333233	0.24167	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.21191	2.05;2.02;2.05;2.05	5.46	5.46	0.80206	.	0.178035	0.50627	D	0.000119	T	0.37839	0.1018	L	0.29908	0.895	0.28604	N	0.909009	D	0.76494	0.999	D	0.83275	0.996	T	0.17992	-1.0351	10	0.72032	D	0.01	-11.6266	19.2983	0.94132	0.0:1.0:0.0:0.0	.	1688	C9JQL1	.	Y	1489;1666;1688;1666;1688	ENSP00000256339:S1489Y;ENSP00000450868:S1666Y;ENSP00000451360:S1688Y;ENSP00000376858:S1666Y	ENSP00000256339:S1489Y	S	+	2	0	KIAA1409	93158329	0.995000	0.38212	0.268000	0.24571	0.023000	0.10783	5.336000	0.65935	2.571000	0.86741	0.313000	0.20887	TCT	UNC79	-	superfamily_ARM-type_fold	ENSG00000133958		0.532	UNC79-006	KNOWN	basic	protein_coding	UNC79	HGNC	protein_coding	OTTHUMT00000412766.1	158	0.00	0	C	XM_028395		94088576	94088576	+1	no_errors	ENST00000553484	ensembl	human	known	69_37n	missense	80	28.57	32	SNP	0.559	A
USP34	9736	genome.wustl.edu	37	2	61622023	61622023	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr2:61622023G>T	ENST00000398571.2	-	5	794	c.718C>A	c.(718-720)Ctt>Att	p.L240I		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	240					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TGTGCTATAAGAAATGGCAAA	0.333																																						dbGAP											0													95.0	83.0	87.0					2																	61622023		1848	4090	5938	-	-	-	SO:0001583	missense	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.718C>A	2.37:g.61622023G>T	ENSP00000381577:p.Leu240Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.L240I	ENST00000398571.2	37	c.718	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199719	0.58126	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.03413	3.94	5.05	4.17	0.49024	.	0.127081	0.56097	D	0.000028	T	0.02610	0.0079	N	0.08118	0	0.38034	D	0.935243	B	0.23650	0.089	B	0.17433	0.018	T	0.52845	-0.8521	10	0.45353	T	0.12	.	13.764	0.62983	0.0747:0.0:0.9253:0.0	.	240	Q70CQ2	UBP34_HUMAN	I	88;88;240	ENSP00000381577:L240I	ENSP00000263989:L88I	L	-	1	0	USP34	61475527	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.925000	0.87563	1.269000	0.44280	0.591000	0.81541	CTT	USP34	-	NULL	ENSG00000115464		0.333	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	273	0.00	0	G			61622023	61622023	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	missense	93	21.85	26	SNP	1.000	T
WLS	79971	genome.wustl.edu	37	1	68624888	68624888	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr1:68624888C>T	ENST00000262348.4	-	3	675	c.422G>A	c.(421-423)cGt>cAt	p.R141H	WLS_ENST00000370976.3_Missense_Mutation_p.R50H|WLS_ENST00000354777.2_Missense_Mutation_p.R139H|GNG12-AS1_ENST00000413628.1_RNA|WLS_ENST00000540432.1_Missense_Mutation_p.R141H|GNG12-AS1_ENST00000420587.1_RNA	NM_024911.6	NP_079187.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator	141	Interacts with Wnt proteins. {ECO:0000250}.				anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						CGCGTCATCACGGTAAGCCAG	0.458																																						dbGAP											0													150.0	122.0	131.0					1																	68624888		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000262348.4:c.422G>A	1.37:g.68624888C>T	ENSP00000262348:p.Arg141His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	Missense_Mutation	SNP	NULL	p.R141H	ENST00000262348.4	37	c.422	CCDS642.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.219358|5.219358	0.95139|0.95139	.|.	.|.	ENSG00000116729|ENSG00000116729	ENST00000540432;ENST00000354777;ENST00000262348;ENST00000370976;ENST00000533537;ENST00000530486;ENST00000370973;ENST00000471243|ENST00000534713	T;T;T;T|.	0.56776|.	0.45;0.49;0.48;0.44|.	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80433|0.80433	0.4622|0.4622	M|M	0.82823|0.82823	2.61|2.61	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.999;0.999;1.0|.	D;D;P;D|.	0.72625|.	0.978;0.91;0.869;0.978|.	T|T	0.79701|0.79701	-0.1693|-0.1693	10|5	0.87932|.	D|.	0|.	-28.5419|-28.5419	20.3736|20.3736	0.98901|0.98901	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	141;50;141;139|.	F5H4K0;Q5JRS7;Q5T9L3;Q5T9L3-2|.	.;.;WLS_HUMAN;.|.	H|M	141;139;141;50;8;96;8;96|44	ENSP00000446112:R141H;ENSP00000346829:R139H;ENSP00000262348:R141H;ENSP00000360015:R50H|.	ENSP00000262348:R141H|.	R|V	-|-	2|1	0|0	WLS|WLS	68397476|68397476	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.530000|0.530000	0.34684|0.34684	7.206000|7.206000	0.77891|0.77891	2.820000|2.820000	0.97059|0.97059	0.650000|0.650000	0.86243|0.86243	CGT|GTG	WLS	-	NULL	ENSG00000116729		0.458	WLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WLS	HGNC	protein_coding	OTTHUMT00000025368.1	229	0.43	1	C	NM_024911		68624888	68624888	-1	no_errors	ENST00000540432	ensembl	human	known	69_37n	missense	89	25.21	30	SNP	1.000	T
WWP2	11060	genome.wustl.edu	37	16	69969793	69969793	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr16:69969793C>T	ENST00000359154.2	+	18	1981	c.1880C>T	c.(1879-1881)aCc>aTc	p.T627I	WWP2_ENST00000448661.1_Missense_Mutation_p.T627I|WWP2_ENST00000568684.1_Missense_Mutation_p.T188I|WWP2_ENST00000542271.1_Missense_Mutation_p.T511I|MIR140_ENST00000385282.1_RNA|WWP2_ENST00000356003.2_Missense_Mutation_p.T627I|WWP2_ENST00000544162.1_3'UTR	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	627	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ACGGGCTTCACCCTCCCTTTC	0.532																																						dbGAP											0													188.0	179.0	182.0					16																	69969793		2198	4300	6498	-	-	-	SO:0001583	missense	0			BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.1880C>T	16.37:g.69969793C>T	ENSP00000352069:p.Thr627Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_WW_Rsp5_WWP	p.T627I	ENST00000359154.2	37	c.1880	CCDS10885.1	16	.	.	.	.	.	.	.	.	.	.	C	21.8	4.202195	0.79127	.	.	ENSG00000198373	ENST00000359154;ENST00000545099;ENST00000448661;ENST00000356003;ENST00000544162;ENST00000542271	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	5.81	5.81	0.92471	HECT (4);	0.000000	0.85682	D	0.000000	T	0.74382	0.3709	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.70960	-0.4730	9	.	.	.	.	20.0826	0.97783	0.0:1.0:0.0:0.0	.	627	O00308	WWP2_HUMAN	I	627;188;627;627;514;511	ENSP00000352069:T627I;ENSP00000396871:T627I;ENSP00000348283:T627I;ENSP00000445616:T511I	.	T	+	2	0	WWP2	68527294	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.818000	0.86416	2.746000	0.94184	0.655000	0.94253	ACC	WWP2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000198373		0.532	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP2	HGNC	protein_coding	OTTHUMT00000268954.1	186	0.00	0	C	NM_007014		69969793	69969793	+1	no_errors	ENST00000356003	ensembl	human	known	69_37n	missense	65	30.11	28	SNP	1.000	T
ZCCHC7	84186	genome.wustl.edu	37	9	37354798	37354798	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15D-01A-11D-A10Y-09	TCGA-E2-A15D-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	891295d6-4dd0-4ab4-bbce-13da7f3c30d0	41e1ad36-7a9b-4046-b493-742e462fde54	g.chr9:37354798A>G	ENST00000336755.5	+	8	1281	c.1175A>G	c.(1174-1176)aAg>aGg	p.K392R	ZCCHC7_ENST00000461038.1_3'UTR|ZCCHC7_ENST00000534928.1_Missense_Mutation_p.K102R	NM_032226.2	NP_115602.2	Q8N3Z6	ZCHC7_HUMAN	zinc finger, CCHC domain containing 7	392						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	30				GBM - Glioblastoma multiforme(29;0.0137)		GAGAGAGAAAAGAGACTAAAA	0.343																																						dbGAP											0													48.0	49.0	49.0					9																	37354798		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK026264	CCDS6608.2	9p13.1	2008-05-02			ENSG00000147905	ENSG00000147905		"""Zinc fingers, CCHC domain containing"""	26209	protein-coding gene	gene with protein product							Standard	NM_032226		Approved	FLJ22611, AIR1	uc003zzq.3	Q8N3Z6	OTTHUMG00000019915	ENST00000336755.5:c.1175A>G	9.37:g.37354798A>G	ENSP00000337839:p.Lys392Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCI4|D3DRQ0|Q5T0Q8|Q5T0Q9|Q5T0R0|Q8N2M1|Q8N4J2|Q8TBK8|Q9H648|Q9P0F0	Missense_Mutation	SNP	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.K392R	ENST00000336755.5	37	c.1175	CCDS6608.2	9	.	.	.	.	.	.	.	.	.	.	A	5.638	0.302434	0.10678	.	.	ENSG00000147905	ENST00000336755;ENST00000534928	T;T	0.43294	1.54;0.95	6.15	-0.0854	0.13686	.	1.108070	0.06492	N	0.734846	T	0.17365	0.0417	N	0.02011	-0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.24404	-1.0161	10	0.17369	T	0.5	-0.1106	8.9125	0.35561	0.5848:0.0:0.4152:0.0	.	392	Q8N3Z6	ZCHC7_HUMAN	R	392;102	ENSP00000337839:K392R;ENSP00000443113:K102R	ENSP00000337839:K392R	K	+	2	0	ZCCHC7	37344798	0.374000	0.25081	0.461000	0.27105	0.740000	0.42216	0.156000	0.16382	-0.231000	0.09825	0.523000	0.50628	AAG	ZCCHC7	-	NULL	ENSG00000147905		0.343	ZCCHC7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC7	HGNC	protein_coding	OTTHUMT00000052453.2	180	0.00	0	A	NM_032226		37354798	37354798	+1	no_errors	ENST00000336755	ensembl	human	known	69_37n	missense	68	31.31	31	SNP	0.221	G
