#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACE2	59272	genome.wustl.edu	37	X	15610358	15610358	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chrX:15610358C>A	ENST00000252519.3	-	3	535	c.433G>T	c.(433-435)Gaa>Taa	p.E145*	ACE2_ENST00000427411.1_Nonsense_Mutation_p.E145*			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	145					angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	CTACCTGGTTCAAGTAATAAG	0.318																																						dbGAP											0													152.0	153.0	153.0					X																	15610358		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0			AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.433G>T	X.37:g.15610358C>A	ENSP00000252519:p.Glu145*	Somatic		WXS	Illumina GAIIx	Phase_IV	C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Nonsense_Mutation	SNP	pfam_Peptidase_M2,prints_Peptidase_M2	p.E145*	ENST00000252519.3	37	c.433	CCDS14169.1	X	.	.	.	.	.	.	.	.	.	.	C	37	6.085327	0.97271	.	.	ENSG00000130234	ENST00000252519;ENST00000427411	.	.	.	5.77	5.77	0.91146	.	0.109676	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.4793	19.0862	0.93203	0.0:1.0:0.0:0.0	.	.	.	.	X	145	.	ENSP00000252519:E145X	E	-	1	0	ACE2	15520279	1.000000	0.71417	0.998000	0.56505	0.265000	0.26407	4.872000	0.63050	2.458000	0.83093	0.464000	0.42555	GAA	ACE2	-	pfam_Peptidase_M2	ENSG00000130234		0.318	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACE2	HGNC	protein_coding	OTTHUMT00000055867.1	525	0.00	0	C			15610358	15610358	-1	no_errors	ENST00000252519	ensembl	human	known	69_37n	nonsense	286	48.39	270	SNP	1.000	A
MRGBP	55257	genome.wustl.edu	37	20	61427963	61427963	+	Missense_Mutation	SNP	G	G	A	rs376422046		TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	0744c5e3-f044-4c56-b3c6-f8678f69c55a	g.chr20:61427963G>A	ENST00000370487.3	+	1	159	c.88G>A	c.(88-90)Gtg>Atg	p.V30M		NM_018270.4	NP_060740.1	Q9NV56	MRGBP_HUMAN	MRG/MORF4L binding protein	30					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	H4/H2A histone acetyltransferase complex (GO:0043189)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											GGAGACAGTGGTGTGGAGCCC	0.786																																						dbGAP											0													17.0	16.0	16.0					20																	61427963		2094	4126	6220	-	-	-	SO:0001583	missense	0			AK001776	CCDS13503.1	20q13.33	2012-10-29	2012-10-29	2012-10-29	ENSG00000101189	ENSG00000101189			15866	protein-coding gene	gene with protein product		611157	"""chromosome 20 open reading frame 20"""	C20orf20		12963728	Standard	NM_018270		Approved	FLJ10914, MRG15BP, Eaf7	uc002ydi.3	Q9NV56	OTTHUMG00000032940	ENST00000370487.3:c.88G>A	20.37:g.61427963G>A	ENSP00000359518:p.Val30Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8C4L5	Missense_Mutation	SNP	pfam_EAF7	p.V30M	ENST00000370487.3	37	c.88	CCDS13503.1	20	.	.	.	.	.	.	.	.	.	.	G	15.98	2.993718	0.54041	.	.	ENSG00000101189	ENST00000370487	.	.	.	3.03	3.03	0.35002	.	0.153153	0.43110	U	0.000606	T	0.34308	0.0893	N	0.24115	0.695	0.39804	D	0.972614	P	0.37864	0.61	B	0.36808	0.233	T	0.23940	-1.0174	9	0.45353	T	0.12	-15.1973	7.5663	0.27881	0.0:0.1796:0.6359:0.1845	.	30	Q9NV56	MRGBP_HUMAN	M	30	.	ENSP00000359518:V30M	V	+	1	0	C20orf20	60898408	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.775000	0.47702	1.519000	0.48950	0.456000	0.33151	GTG	C20orf20	-	NULL	ENSG00000101189		0.786	MRGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf20	HGNC	protein_coding	OTTHUMT00000080080.1	9	0.00	0	G	NM_018270		61427963	61427963	+1	no_errors	ENST00000370487	ensembl	human	known	69_37n	missense	4	50.00	4	SNP	1.000	A
CCDC8	83987	genome.wustl.edu	37	19	46915828	46915828	+	Silent	SNP	C	C	T			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr19:46915828C>T	ENST00000307522.3	-	1	1013	c.240G>A	c.(238-240)agG>agA	p.R80R		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	80					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		GCTGCACTCTCCTCCTCACTC	0.667																																						dbGAP											0													51.0	54.0	53.0					19																	46915828		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.240G>A	19.37:g.46915828C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB26	Silent	SNP	NULL	p.R80	ENST00000307522.3	37	c.240	CCDS12685.1	19																																																																																			CCDC8	-	NULL	ENSG00000169515		0.667	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC8	HGNC	protein_coding	OTTHUMT00000368598.1	41	0.00	0	C	NM_032040		46915828	46915828	-1	no_errors	ENST00000307522	ensembl	human	known	69_37n	silent	25	39.02	16	SNP	0.965	T
CCNK	8812	genome.wustl.edu	37	14	99968624	99968624	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr14:99968624A>G	ENST00000389879.5	+	7	779	c.656A>G	c.(655-657)aAa>aGa	p.K219R	CCNK_ENST00000555049.1_Missense_Mutation_p.K219R|CCNK_ENST00000557165.1_3'UTR	NM_001099402.1	NP_001092872.1	O75909	CCNK_HUMAN	cyclin K	219					cellular response to DNA damage stimulus (GO:0006974)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of cell cycle arrest (GO:0071157)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cyclin K-CDK12 complex (GO:0002944)|cyclin K-CDK13 complex (GO:0002945)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase binding (GO:0019901)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|endometrium(2)|lung(3)	6		all_cancers(154;0.224)|all_epithelial(191;0.0643)|Melanoma(154;0.0866)				CGTTTGTGCAAATTTGAAATA	0.458																																						dbGAP											0													112.0	106.0	108.0					14																	99968624		1949	4141	6090	-	-	-	SO:0001583	missense	0			AF060515	CCDS45160.1	14q32.2	2014-07-03			ENSG00000090061	ENSG00000090061			1596	protein-coding gene	gene with protein product		603544				9632813, 10574912	Standard	NM_001099402		Approved	CPR4	uc001ygi.4	O75909	OTTHUMG00000171495	ENST00000389879.5:c.656A>G	14.37:g.99968624A>G	ENSP00000374529:p.Lys219Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59FT6|Q86U16|Q96B63|Q9NNY9	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.K219R	ENST00000389879.5	37	c.656	CCDS45160.1	14	.	.	.	.	.	.	.	.	.	.	A	20.1	3.936676	0.73442	.	.	ENSG00000090061	ENST00000437596;ENST00000216279;ENST00000380246;ENST00000389879;ENST00000557441;ENST00000555049	T;T;T	0.47177	0.85;0.85;0.85	5.95	4.82	0.62117	Cyclin-like (2);	0.000000	0.85682	D	0.000000	T	0.48857	0.1523	M	0.70275	2.135	0.80722	D	1	B;P	0.36282	0.411;0.546	B;B	0.37550	0.253;0.236	T	0.49753	-0.8906	10	0.51188	T	0.08	-14.5109	11.9381	0.52884	0.9326:0.0:0.0674:0.0	.	219;219	O75909;O75909-2	CCNK_HUMAN;.	R	219;221;221;219;219;219	ENSP00000374529:K219R;ENSP00000450792:K219R;ENSP00000452307:K219R	ENSP00000216279:K221R	K	+	2	0	CCNK	99038377	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.307000	0.96226	1.086000	0.41228	0.533000	0.62120	AAA	CCNK	-	superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000090061		0.458	CCNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNK	HGNC	protein_coding	OTTHUMT00000413721.1	454	0.00	0	A			99968624	99968624	+1	no_errors	ENST00000389879	ensembl	human	known	69_37n	missense	272	30.79	121	SNP	1.000	G
CIB3	117286	genome.wustl.edu	37	19	16279058	16279058	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr19:16279058G>C	ENST00000269878.4	-	4	285	c.236C>G	c.(235-237)tCt>tGt	p.S79C	CIB3_ENST00000541493.1_Intron|CIB3_ENST00000379859.3_Missense_Mutation_p.S30C	NM_054113.2	NP_473454.1	Q96Q77	CIB3_HUMAN	calcium and integrin binding family member 3	79	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16						CCCATCCTCAGAGAATACCTG	0.552																																						dbGAP											0													63.0	56.0	58.0					19																	16279058		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB050868	CCDS12340.1, CCDS74305.1	19p13.12	2013-01-10						"""EF-hand domain containing"""	24580	protein-coding gene	gene with protein product		610645					Standard	XM_005259728		Approved	KIP3	uc002nds.3	Q96Q77		ENST00000269878.4:c.236C>G	19.37:g.16279058G>C	ENSP00000269878:p.Ser79Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EUX1|Q2M1W0|Q6ISP1	Missense_Mutation	SNP	pfscan_EF_HAND_2	p.S79C	ENST00000269878.4	37	c.236	CCDS12340.1	19	.	.	.	.	.	.	.	.	.	.	G	14.25	2.478511	0.44044	.	.	ENSG00000141977	ENST00000269878;ENST00000379859	T;T	0.68025	-0.3;2.92	4.84	4.84	0.62591	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.82024	0.4947	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.84812	0.0791	10	0.72032	D	0.01	-22.1757	16.9634	0.86279	0.0:0.0:1.0:0.0	.	30;79	E7EUX1;Q96Q77	.;CIB3_HUMAN	C	79;30	ENSP00000269878:S79C;ENSP00000369188:S30C	ENSP00000269878:S79C	S	-	2	0	CIB3	16140058	1.000000	0.71417	0.926000	0.36857	0.032000	0.12392	7.662000	0.83803	2.258000	0.74832	0.448000	0.29417	TCT	CIB3	-	NULL	ENSG00000141977		0.552	CIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIB3	HGNC	protein_coding	OTTHUMT00000460351.1	145	0.00	0	G	NM_054113		16279058	16279058	-1	no_errors	ENST00000269878	ensembl	human	known	69_37n	missense	78	38.58	49	SNP	0.997	C
CPM	1368	genome.wustl.edu	37	12	69265694	69265694	+	Missense_Mutation	SNP	C	C	T	rs547105880		TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr12:69265694C>T	ENST00000551568.1	-	4	361	c.301G>A	c.(301-303)Gta>Ata	p.V101I	CPM_ENST00000338356.3_Missense_Mutation_p.V101I|CPM_ENST00000546373.1_Missense_Mutation_p.V101I	NM_001005502.2|NM_198320.3	NP_001005502.1|NP_938079.1	P14384	CBPM_HUMAN	carboxypeptidase M	101					anatomical structure morphogenesis (GO:0009653)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(6)|prostate(2)	9	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TCACTGGTTACGAGATAGTCA	0.443													C|||	1	0.000199681	0.0	0.0	5008	,	,		20634	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													148.0	132.0	138.0					12																	69265694		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF368463	CCDS8987.1	12q15	2012-02-10			ENSG00000135678	ENSG00000135678	3.4.17.12		2311	protein-coding gene	gene with protein product	"""renal carboxypeptidase"", ""urinary carboxypeptidase B"""	114860				8586455	Standard	NM_001874		Approved		uc001suq.3	P14384	OTTHUMG00000169300	ENST00000551568.1:c.301G>A	12.37:g.69265694C>T	ENSP00000448517:p.Val101Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R800|Q9H2K9	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Aste_AspA,superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14,prints_Peptidase_M14	p.V101I	ENST00000551568.1	37	c.301	CCDS8987.1	12	.	.	.	.	.	.	.	.	.	.	C	11.85	1.760985	0.31137	.	.	ENSG00000135678	ENST00000551568;ENST00000338356;ENST00000546373;ENST00000548954;ENST00000548262	T;T;T;T;T	0.11277	2.79;2.79;2.79;2.79;2.79	5.03	5.03	0.67393	Peptidase M14, carboxypeptidase A (2);	0.178393	0.49916	D	0.000138	T	0.17195	0.0413	L	0.53249	1.67	0.27444	N	0.953635	B	0.31209	0.313	B	0.37989	0.262	T	0.06303	-1.0834	9	.	.	.	-16.8007	19.267	0.93990	0.0:1.0:0.0:0.0	.	101	P14384	CBPM_HUMAN	I	101	ENSP00000448517:V101I;ENSP00000339157:V101I;ENSP00000447255:V101I;ENSP00000446799:V101I;ENSP00000449911:V101I	.	V	-	1	0	CPM	67551961	0.008000	0.16893	0.188000	0.23233	0.033000	0.12548	0.887000	0.28254	2.718000	0.92993	0.650000	0.86243	GTA	CPM	-	pfam_Peptidase_M14,pfam_Aste_AspA,smart_Peptidase_M14	ENSG00000135678		0.443	CPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPM	HGNC	protein_coding	OTTHUMT00000403355.1	294	0.00	0	C	NM_198320		69265694	69265694	-1	no_errors	ENST00000338356	ensembl	human	known	69_37n	missense	170	37.04	100	SNP	0.323	T
DMXL1	1657	genome.wustl.edu	37	5	118480270	118480270	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr5:118480270G>A	ENST00000311085.8	+	15	2586	c.2506G>A	c.(2506-2508)Gac>Aac	p.D836N	DMXL1_ENST00000539542.1_Missense_Mutation_p.D836N	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	836										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TTTTGAAGAAGACTTCATTTT	0.318																																						dbGAP											0													109.0	119.0	116.0					5																	118480270		2202	4295	6497	-	-	-	SO:0001583	missense	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.2506G>A	5.37:g.118480270G>A	ENSP00000309690:p.Asp836Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D836N	ENST00000311085.8	37	c.2506	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	15.51	2.854155	0.51270	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.36340	1.26;1.26	5.24	5.24	0.73138	.	0.190563	0.56097	D	0.000037	T	0.34629	0.0904	L	0.41236	1.265	0.47949	D	0.999551	B;B	0.12630	0.006;0.002	B;B	0.16722	0.016;0.007	T	0.07309	-1.0779	10	0.41790	T	0.15	-2.8457	18.8118	0.92061	0.0:0.0:1.0:0.0	.	836;836	F5H269;Q9Y485	.;DMXL1_HUMAN	N	836	ENSP00000309690:D836N;ENSP00000439479:D836N	ENSP00000309690:D836N	D	+	1	0	DMXL1	118508169	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	3.936000	0.56568	2.449000	0.82847	0.313000	0.20887	GAC	DMXL1	-	superfamily_WD40_repeat_dom	ENSG00000172869		0.318	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	170	0.00	0	G	NM_005509		118480270	118480270	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	missense	113	47.44	102	SNP	1.000	A
DNAH1	25981	genome.wustl.edu	37	3	52430731	52430731	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr3:52430731A>G	ENST00000420323.2	+	72	11789	c.11528A>G	c.(11527-11529)tAt>tGt	p.Y3843C		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3908	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AACATCCCCTATGAGTTCACG	0.552																																						dbGAP											0													135.0	136.0	136.0					3																	52430731		2002	4182	6184	-	-	-	SO:0001583	missense	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.11528A>G	3.37:g.52430731A>G	ENSP00000401514:p.Tyr3843Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.Y3843C	ENST00000420323.2	37	c.11528	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	A	20.3	3.961657	0.74016	.	.	ENSG00000114841	ENST00000420323;ENST00000273600	T	0.25579	1.79	4.49	4.49	0.54785	.	0.000000	0.64402	D	0.000007	T	0.67002	0.2847	H	0.98577	4.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.80975	-0.1142	10	0.87932	D	0	.	13.9574	0.64157	1.0:0.0:0.0:0.0	.	3843;3908	C9JXH6;Q9P2D7-2	.;.	C	3843;596	ENSP00000401514:Y3843C	ENSP00000273600:Y596C	Y	+	2	0	DNAH1	52405771	1.000000	0.71417	0.993000	0.49108	0.950000	0.60333	9.002000	0.93572	1.886000	0.54624	0.482000	0.46254	TAT	DNAH1	-	pfam_Dynein_heavy	ENSG00000114841		0.552	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	153	0.00	0	A	NM_015512		52430731	52430731	+1	no_errors	ENST00000420323	ensembl	human	known	69_37n	missense	78	36.29	45	SNP	1.000	G
FAM47C	442444	genome.wustl.edu	37	X	37026638	37026638	+	Missense_Mutation	SNP	C	C	T	rs370862889		TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chrX:37026638C>T	ENST00000358047.3	+	1	207	c.155C>T	c.(154-156)aCg>aTg	p.T52M		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	52										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GTATTTGTGACGGAGGGCATG	0.552																																						dbGAP											0													57.0	51.0	53.0					X																	37026638		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.155C>T	X.37:g.37026638C>T	ENSP00000367913:p.Thr52Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU46	Missense_Mutation	SNP	NULL	p.T52M	ENST00000358047.3	37	c.155	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	A	12.05	1.822924	0.32237	.	.	ENSG00000198173	ENST00000358047	T	0.19394	2.15	0.502	-1.0	0.10196	.	.	.	.	.	T	0.28699	0.0711	L	0.47716	1.5	0.09310	N	1	D	0.76494	0.999	D	0.67103	0.949	T	0.53781	-0.8390	8	0.72032	D	0.01	.	.	.	.	.	52	Q5HY64	FA47C_HUMAN	M	52	ENSP00000367913:T52M	ENSP00000367913:T52M	T	+	2	0	FAM47C	36936559	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.207000	0.00558	-4.129000	0.00071	-4.336000	0.00007	ACG	FAM47C	-	NULL	ENSG00000198173		0.552	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	244	0.40	1	C	NM_001013736		37026638	37026638	+1	no_errors	ENST00000358047	ensembl	human	known	69_37n	missense	201	24.72	66	SNP	0.000	T
FBXW7	55294	genome.wustl.edu	37	4	153244156	153244156	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr4:153244156delC	ENST00000281708.4	-	12	3230	c.2001delG	c.(1999-2001)gggfs	p.G667fs	FBXW7_ENST00000603548.1_Frame_Shift_Del_p.G667fs|FBXW7_ENST00000296555.5_Frame_Shift_Del_p.G549fs|FBXW7_ENST00000263981.5_Frame_Shift_Del_p.G587fs|RP11-461L13.3_ENST00000603766.1_lincRNA|FBXW7_ENST00000393956.3_Frame_Shift_Del_p.G491fs|FBXW7_ENST00000603841.1_Frame_Shift_Del_p.G667fs	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	667					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.S668fs*39(1)|p.S668fs*26(1)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CTCCCCCACTCCCCCCACTCT	0.488			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	dbGAP		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	3	Unknown(1)|Insertion - Frameshift(1)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)											173.0	174.0	174.0					4																	153244156		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.2001delG	4.37:g.153244156delC	ENSP00000281708:p.Gly667fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Frame_Shift_Del	DEL	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S668fs	ENST00000281708.4	37	c.2001	CCDS3777.1	4																																																																																			FBXW7	-	smart_WD40_repeat	ENSG00000109670		0.488	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	615	0.00	0	C			153244156	153244156	-1	no_errors	ENST00000281708	ensembl	human	known	69_37n	frame_shift_del	313	35.69	177	DEL	0.990	-
FOSL2	2355	genome.wustl.edu	37	2	28631710	28631710	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr2:28631710G>C	ENST00000264716.4	+	3	1302	c.439G>C	c.(439-441)Gag>Cag	p.E147Q	FOSL2_ENST00000545753.1_Missense_Mutation_p.E108Q|FOSL2_ENST00000379619.1_Missense_Mutation_p.E122Q	NM_005253.3	NP_005244.1	P15408	FOSL2_HUMAN	FOS-like antigen 2	147	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cell death (GO:0008219)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)					CCGACGCCGGGAGCTGACAGA	0.647																																						dbGAP											0													26.0	29.0	28.0					2																	28631710		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS1766.1	2p23.3	2013-01-10			ENSG00000075426	ENSG00000075426		"""basic leucine zipper proteins"""	3798	protein-coding gene	gene with protein product		601575					Standard	NM_005253		Approved	FRA2, FLJ23306	uc002rma.3	P15408	OTTHUMG00000097832	ENST00000264716.4:c.439G>C	2.37:g.28631710G>C	ENSP00000264716:p.Glu147Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD58|B3KP27|B4DYV4|Q6FG46	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.E147Q	ENST00000264716.4	37	c.439	CCDS1766.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.435128	0.96150	.	.	ENSG00000075426	ENST00000379619;ENST00000264716;ENST00000436647;ENST00000545753	T;T;T;T	0.71103	-0.54;0.52;0.52;0.52	5.45	5.45	0.79879	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	D	0.82742	0.5103	M	0.65320	2	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.81705	-0.0811	9	.	.	.	-6.055	19.2653	0.93983	0.0:0.0:1.0:0.0	.	147	P15408	FOSL2_HUMAN	Q	122;147;108;108	ENSP00000368939:E122Q;ENSP00000264716:E147Q;ENSP00000396497:E108Q;ENSP00000439303:E108Q	.	E	+	1	0	FOSL2	28485214	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.790000	0.99075	2.554000	0.86153	0.655000	0.94253	GAG	FOSL2	-	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	ENSG00000075426		0.647	FOSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOSL2	HGNC	protein_coding	OTTHUMT00000215116.2	58	0.00	0	G	NM_005253		28631710	28631710	+1	no_errors	ENST00000264716	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	1.000	C
GPSM2	29899	genome.wustl.edu	37	1	109466799	109466799	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr1:109466799C>A	ENST00000406462.2	+	15	2551	c.1778C>A	c.(1777-1779)gCt>gAt	p.A593D	AKNAD1_ENST00000357393.4_Intron|GPSM2_ENST00000264126.3_Missense_Mutation_p.A593D			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	593					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		AACAAAGAGGCTGATGAAGAT	0.408																																						dbGAP											0													100.0	89.0	93.0					1																	109466799		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.1778C>A	1.37:g.109466799C>A	ENSP00000385510:p.Ala593Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1N8|Q6IBL7|Q8N0Z5	Missense_Mutation	SNP	pfam_GoLoco_motif,pfam_TPR-1,pfam_TPR-4,smart_TPR_repeat,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A593D	ENST00000406462.2	37	c.1778	CCDS792.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.05|13.05	2.122509|2.122509	0.37436|0.37436	.|.	.|.	ENSG00000121957|ENSG00000121957	ENST00000406462;ENST00000264126|ENST00000441735	D;D|.	0.93366|.	-3.21;-3.21|.	5.62|5.62	4.71|4.71	0.59529|0.59529	.|.	0.288557|.	0.39274|.	N|.	0.001406|.	T|T	0.10165|0.10165	0.0249|0.0249	N|N	0.05280|0.05280	-0.08|-0.08	0.29706|0.29706	N|N	0.839804|0.839804	B|.	0.24823|.	0.112|.	B|.	0.27262|.	0.078|.	T|T	0.22765|0.22765	-1.0207|-1.0207	10|5	0.66056|.	D|.	0.02|.	-2.8453|-2.8453	11.5177|11.5177	0.50532|0.50532	0.0:0.8452:0.0:0.1548|0.0:0.8452:0.0:0.1548	.|.	593|.	P81274|.	GPSM2_HUMAN|.	D|M	593|183	ENSP00000385510:A593D;ENSP00000264126:A593D|.	ENSP00000264126:A593D|.	A|L	+|+	2|1	0|2	GPSM2|GPSM2	109268322|109268322	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.283000|0.283000	0.27025|0.27025	4.696000|4.696000	0.61774|0.61774	1.388000|1.388000	0.46506|0.46506	-0.126000|-0.126000	0.14955|0.14955	GCT|CTG	GPSM2	-	NULL	ENSG00000121957		0.408	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPSM2	HGNC	protein_coding	OTTHUMT00000032400.3	228	0.00	0	C	NM_013296		109466799	109466799	+1	no_errors	ENST00000264126	ensembl	human	known	69_37n	missense	139	35.94	78	SNP	1.000	A
GRHL2	79977	genome.wustl.edu	37	8	102571029	102571029	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr8:102571029G>A	ENST00000251808.3	+	4	1005	c.667G>A	c.(667-669)Gca>Aca	p.A223T	GRHL2_ENST00000395927.1_Missense_Mutation_p.A207T	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	223					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			CTTCAAGGACGCAGCCACAGA	0.542																																						dbGAP											0													22.0	20.0	21.0					8																	102571029		2203	4297	6500	-	-	-	SO:0001583	missense	0			AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.667G>A	8.37:g.102571029G>A	ENSP00000251808:p.Ala223Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L303|Q6NT03|Q9H8B8	Missense_Mutation	SNP	pfam_CP2	p.A223T	ENST00000251808.3	37	c.667	CCDS34931.1	8	.	.	.	.	.	.	.	.	.	.	G	15.42	2.829109	0.50845	.	.	ENSG00000083307	ENST00000251808;ENST00000395927;ENST00000395928	T;T	0.17370	2.28;2.28	5.33	5.33	0.75918	CP2 transcription factor (1);	0.123924	0.53938	D	0.000044	T	0.11324	0.0276	N	0.14661	0.345	0.26383	N	0.976693	B;B	0.21452	0.056;0.042	B;B	0.21151	0.033;0.01	T	0.17868	-1.0355	10	0.13853	T	0.58	-9.4435	17.2084	0.86924	0.0:0.0:1.0:0.0	.	223;223	B4DL28;Q6ISB3	.;GRHL2_HUMAN	T	223;207;223	ENSP00000251808:A223T;ENSP00000379260:A207T	ENSP00000251808:A223T	A	+	1	0	GRHL2	102640205	1.000000	0.71417	0.925000	0.36789	0.857000	0.48899	3.631000	0.54280	2.489000	0.83994	0.643000	0.83706	GCA	GRHL2	-	pfam_CP2	ENSG00000083307		0.542	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHL2	HGNC	protein_coding	OTTHUMT00000313882.1	37	0.00	0	G	NM_024915		102571029	102571029	+1	no_errors	ENST00000251808	ensembl	human	known	69_37n	missense	21	35.29	12	SNP	0.995	A
MSMP	692094	genome.wustl.edu	37	9	35753714	35753714	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr9:35753714C>T	ENST00000436428.2	-	2	321	c.182G>A	c.(181-183)cGc>cAc	p.R61H	MSMP_ENST00000414286.1_5'UTR|RP11-112J3.15_ENST00000425499.2_RNA|RGP1_ENST00000378078.4_3'UTR	NM_001044264.2	NP_001037729.1	Q1L6U9	MSMP_HUMAN	microseminoprotein, prostate associated	61						cytoplasm (GO:0005737)|extracellular space (GO:0005615)				endometrium(2)|kidney(1)|lung(3)|prostate(3)	9						ACAGTCCTTGCGGAGCCAAGA	0.517																																						dbGAP											0													45.0	46.0	46.0					9																	35753714		2057	4212	6269	-	-	-	SO:0001583	missense	0			DQ012170	CCDS43797.1	9p13.3	2012-10-02			ENSG00000215183	ENSG00000215183			29663	protein-coding gene	gene with protein product		612191				17338636	Standard	NM_001044264		Approved	PC-3, PSMP	uc003zyb.2	Q1L6U9	OTTHUMG00000019882	ENST00000436428.2:c.182G>A	9.37:g.35753714C>T	ENSP00000419194:p.Arg61His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PSP94	p.R61H	ENST00000436428.2	37	c.182	CCDS43797.1	9	.	.	.	.	.	.	.	.	.	.	C	16.87	3.241474	0.58995	.	.	ENSG00000215183	ENST00000436428	T	0.08008	3.14	5.5	5.5	0.81552	.	0.553633	0.12806	U	0.437628	T	0.13072	0.0317	N	0.08118	0	0.40109	D	0.976462	D	0.71674	0.998	P	0.61201	0.885	T	0.46610	-0.9179	10	0.38643	T	0.18	-11.4429	17.577	0.87953	0.0:1.0:0.0:0.0	.	61	Q1L6U9	MSMP_HUMAN	H	61	ENSP00000419194:R61H	ENSP00000419194:R61H	R	-	2	0	MSMP	35743714	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.939000	0.56591	2.576000	0.86940	0.655000	0.94253	CGC	MSMP	-	pfam_PSP94	ENSG00000215183		0.517	MSMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSMP	HGNC	protein_coding	OTTHUMT00000052384.2	135	0.00	0	C	NM_001044264		35753714	35753714	-1	no_errors	ENST00000436428	ensembl	human	known	69_37n	missense	52	44.68	42	SNP	1.000	T
NIN	51199	genome.wustl.edu	37	14	51237222	51237222	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr14:51237222C>G	ENST00000382041.3	-	12	1508	c.1318G>C	c.(1318-1320)Gag>Cag	p.E440Q	NIN_ENST00000245441.5_Missense_Mutation_p.E440Q|NIN_ENST00000324330.9_Missense_Mutation_p.E440Q|NIN_ENST00000530997.2_Missense_Mutation_p.E440Q|NIN_ENST00000382043.4_Missense_Mutation_p.E440Q|NIN_ENST00000453196.1_Missense_Mutation_p.E440Q|NIN_ENST00000389868.3_Missense_Mutation_p.E440Q	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	440					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					TGCTCTCTCTCTTTTCGGAGT	0.448			T	PDGFRB	MPD																																	dbGAP		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													174.0	153.0	160.0					14																	51237222		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.1318G>C	14.37:g.51237222C>G	ENSP00000371472:p.Glu440Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_HAND_2	p.E440Q	ENST00000382041.3	37	c.1318	CCDS32079.1	14	.	.	.	.	.	.	.	.	.	.	C	21.4	4.138206	0.77775	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196	T;T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14;2.14	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.50531	0.1621	M	0.78637	2.42	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.998	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.996;0.994	T	0.51325	-0.8720	10	0.66056	D	0.02	-18.9462	18.6203	0.91318	0.0:1.0:0.0:0.0	.	446;440;440;440;440	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	Q	440;440;440;440;446;440;440;440	ENSP00000245441:E440Q;ENSP00000374518:E440Q;ENSP00000371474:E440Q;ENSP00000371472:E440Q;ENSP00000324210:E440Q;ENSP00000412391:E440Q	ENSP00000245441:E440Q	E	-	1	0	NIN	50306972	1.000000	0.71417	0.969000	0.41365	0.323000	0.28346	7.487000	0.81328	2.658000	0.90341	0.650000	0.86243	GAG	NIN	-	NULL	ENSG00000100503		0.448	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	541	0.00	0	C	NM_182946		51237222	51237222	-1	no_errors	ENST00000245441	ensembl	human	known	69_37n	missense	347	32.16	165	SNP	1.000	G
NLN	57486	genome.wustl.edu	37	5	65088425	65088425	+	Silent	SNP	C	C	T			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr5:65088425C>T	ENST00000380985.5	+	9	1648	c.1470C>T	c.(1468-1470)gaC>gaT	p.D490D	NLN_ENST00000502464.1_Silent_p.D386D	NM_020726.4	NP_065777.1	Q9BYT8	NEUL_HUMAN	neurolysin (metallopeptidase M3 family)	490						mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		TGAGACACGACGAGGTGAGGA	0.512																																						dbGAP											0													130.0	117.0	121.0					5																	65088425		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ300837	CCDS3989.1	5q12.3	2008-02-05	2005-03-31		ENSG00000123213	ENSG00000123213	3.4.24.16		16058	protein-coding gene	gene with protein product		611530	"""angiotensin binding protein"""	AGTBP		10574462	Standard	NM_020726		Approved	KIAA1226	uc003juf.3	Q9BYT8	OTTHUMG00000097803	ENST00000380985.5:c.1470C>T	5.37:g.65088425C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULJ4	Nonsense_Mutation	SNP	pfam_Pept_M3A_M3B	p.R87*	ENST00000380985.5	37	c.259	CCDS3989.1	5	.	.	.	.	.	.	.	.	.	.	C	9.596	1.127555	0.20959	.	.	ENSG00000123213	ENST00000509935	.	.	.	5.88	-4.07	0.03975	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.1214	12.7504	0.57306	0.0:0.419:0.0:0.581	.	.	.	.	X	87	.	.	R	+	1	2	NLN	65124181	0.819000	0.29175	0.923000	0.36655	0.944000	0.59088	-0.113000	0.10774	-0.715000	0.04968	-0.126000	0.14955	CGA	NLN	-	pfam_Pept_M3A_M3B	ENSG00000123213		0.512	NLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLN	HGNC	protein_coding	OTTHUMT00000215060.1	210	0.00	0	C			65088425	65088425	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000509935	ensembl	human	putative	69_37n	nonsense	219	42.60	164	SNP	0.978	T
OXR1	55074	genome.wustl.edu	37	8	107715146	107715146	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr8:107715146G>A	ENST00000442977.2	+	7	790	c.691G>A	c.(691-693)Ggt>Agt	p.G231S	OXR1_ENST00000445937.1_Missense_Mutation_p.G230S|OXR1_ENST00000497705.1_Missense_Mutation_p.G163S|OXR1_ENST00000452423.2_De_novo_Start_OutOfFrame|OXR1_ENST00000517566.2_Missense_Mutation_p.G230S|OXR1_ENST00000531443.1_Missense_Mutation_p.G230S|OXR1_ENST00000312046.6_Missense_Mutation_p.G223S	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	231	GRAM.				adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			CACAGTCAGTGGTGTGCTGCT	0.348																																						dbGAP											0													86.0	83.0	84.0					8																	107715146		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.691G>A	8.37:g.107715146G>A	ENSP00000405424:p.Gly231Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Missense_Mutation	SNP	pfam_TLDc,pfam_Peptidoglycan-bd_lysin,pfam_GRAM,smart_Peptidoglycan-bd_Lysin_subgr,smart_TLDc	p.G231S	ENST00000442977.2	37	c.691	CCDS56548.1	8	.	.	.	.	.	.	.	.	.	.	G	34	5.359811	0.95854	.	.	ENSG00000164830	ENST00000445937;ENST00000531443;ENST00000517566;ENST00000442977;ENST00000497705;ENST00000312046	T;T;T;T;D;T	0.87334	-1.33;-1.33;-1.45;-1.45;-2.24;-1.24	5.27	5.27	0.74061	GRAM (1);	0.000000	0.85682	D	0.000000	D	0.93485	0.7921	M	0.76170	2.325	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93915	0.7200	10	0.87932	D	0	-31.1294	19.2462	0.93904	0.0:0.0:1.0:0.0	.	223;231;163;230	Q8N573-2;Q8N573;Q8N573-3;Q8N573-5	.;OXR1_HUMAN;.;.	S	230;230;230;231;163;223	ENSP00000402918:G230S;ENSP00000431966:G230S;ENSP00000429205:G230S;ENSP00000405424:G231S;ENSP00000431014:G163S;ENSP00000311026:G223S	ENSP00000311026:G223S	G	+	1	0	OXR1	107784322	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.747000	0.98863	2.619000	0.88677	0.650000	0.86243	GGT	OXR1	-	pfam_GRAM	ENSG00000164830		0.348	OXR1-201	KNOWN	basic|CCDS	protein_coding	OXR1	HGNC	protein_coding		233	0.00	0	G	NM_181354		107715146	107715146	+1	no_errors	ENST00000442977	ensembl	human	known	69_37n	missense	137	34.76	73	SNP	1.000	A
C19orf25	148223	genome.wustl.edu	37	19	1482437	1482437	+	5'Flank	SNP	C	C	T			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr19:1482437C>T	ENST00000436106.2	-	0	0				CTB-25B13.6_ENST00000585643.1_RNA|PCSK4_ENST00000300954.5_Silent_p.T578T			Q9UFG5	CS025_HUMAN	chromosome 19 open reading frame 25														Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTCCTCGGCCGTCCCATAGA	0.682																																						dbGAP											0													34.0	36.0	36.0					19																	1482437		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AK075267	CCDS45898.1	19p13.3	2012-10-24			ENSG00000119559	ENSG00000119559			26711	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_152482		Approved	FLJ36666	uc010dsk.3	Q9UFG5	OTTHUMG00000180092		19.37:g.1482437C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQN6|Q8N9R7|Q8WV94	Silent	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,superfamily_Growth_fac_rcpt,smart_Furin_repeat,prints_Peptidase_S8_subtilisin-rel	p.T578	ENST00000436106.2	37	c.1734	CCDS45898.1	19	.	.	.	.	.	.	.	.	.	.	c	15.82	2.947286	0.53186	.	.	ENSG00000115257	ENST00000441747	.	.	.	4.33	-4.49	0.03504	.	.	.	.	.	T	0.40815	0.1132	.	.	.	0.58432	D	0.999996	B	0.09022	0.002	B	0.04013	0.001	T	0.03231	-1.1058	7	0.62326	D	0.03	.	6.0823	0.19948	0.1221:0.4495:0.0:0.4284	.	349	B3KQ28	.	S	349	.	ENSP00000402772:G349S	G	-	1	0	PCSK4	1433437	0.000000	0.05858	0.535000	0.28026	0.274000	0.26718	-2.631000	0.00871	-1.069000	0.03153	-1.634000	0.00779	GGC	PCSK4	-	superfamily_Galactose-bd-like	ENSG00000115257		0.682	C19orf25-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCSK4	HGNC	protein_coding	OTTHUMT00000449694.1	25	0.00	0	C	NM_152482		1482437	1482437	-1	no_errors	ENST00000300954	ensembl	human	known	69_37n	silent	7	50.00	7	SNP	0.304	T
C19orf25	148223	genome.wustl.edu	37	19	1482437	1482437	+	5'Flank	SNP	C	C	T			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	0744c5e3-f044-4c56-b3c6-f8678f69c55a	g.chr19:1482437C>T	ENST00000436106.2	-	0	0				CTB-25B13.6_ENST00000585643.1_RNA|PCSK4_ENST00000300954.5_Silent_p.T578T			Q9UFG5	CS025_HUMAN	chromosome 19 open reading frame 25														Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTCCTCGGCCGTCCCATAGA	0.682																																						dbGAP											0													34.0	36.0	36.0					19																	1482437		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AK075267	CCDS45898.1	19p13.3	2012-10-24			ENSG00000119559	ENSG00000119559			26711	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_152482		Approved	FLJ36666	uc010dsk.3	Q9UFG5	OTTHUMG00000180092		19.37:g.1482437C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQN6|Q8N9R7|Q8WV94	Silent	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,superfamily_Growth_fac_rcpt,smart_Furin_repeat,prints_Peptidase_S8_subtilisin-rel	p.T578	ENST00000436106.2	37	c.1734	CCDS45898.1	19	.	.	.	.	.	.	.	.	.	.	c	15.82	2.947286	0.53186	.	.	ENSG00000115257	ENST00000441747	.	.	.	4.33	-4.49	0.03504	.	.	.	.	.	T	0.40815	0.1132	.	.	.	0.58432	D	0.999996	B	0.09022	0.002	B	0.04013	0.001	T	0.03231	-1.1058	7	0.62326	D	0.03	.	6.0823	0.19948	0.1221:0.4495:0.0:0.4284	.	349	B3KQ28	.	S	349	.	ENSP00000402772:G349S	G	-	1	0	PCSK4	1433437	0.000000	0.05858	0.535000	0.28026	0.274000	0.26718	-2.631000	0.00871	-1.069000	0.03153	-1.634000	0.00779	GGC	PCSK4	-	superfamily_Galactose-bd-like	ENSG00000115257		0.682	C19orf25-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCSK4	HGNC	protein_coding	OTTHUMT00000449694.1	21	0.00	0	C	NM_152482		1482437	1482437	-1	no_errors	ENST00000300954	ensembl	human	known	69_37n	silent	7	50.00	7	SNP	0.304	T
PIEZO1	9780	genome.wustl.edu	37	16	88789682	88789683	+	In_Frame_Ins	INS	-	-	CTC			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	0744c5e3-f044-4c56-b3c6-f8678f69c55a	g.chr16:88789682_88789683insCTC	ENST00000301015.9	-	32	4635_4636	c.4389_4390insGAG	c.(4387-4392)cagcag>cagGAGcag	p.1463_1464QQ>QEQ	RP5-1142A6.9_ENST00000564984.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1463					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						TCCTGCTCCTGCTGCCGCCGCC	0.698																																						dbGAP											0										282,308,2700		27,4,224,47,210,1133						0.7	0.0			25	299,357,5668		31,6,231,45,261,2588	no	codingComplex	PIEZO1	NM_001142864.2		58,10,455,92,471,3721	A1A1,A1A2,A1R,A2A2,A2R,RR		10.3732,17.9331,12.9603				581,665,8368				-	-	-	SO:0001652	inframe_insertion	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.4389_4390insGAG	16.37:g.88789682_88789683insCTC	ENSP00000301015:p.Gln1463_Gln1464insGlu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHT9|A7E2B7|Q0KKZ9	In_Frame_Ins	INS	pfam_DUF3595	p.1463in_frame_insE	ENST00000301015.9	37	c.4390_4389	CCDS54058.1	16																																																																																			PIEZO1	-	NULL	ENSG00000103335		0.698	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	30	0.00	0	-	NM_014745		88789682	88789683	-1	no_errors	ENST00000301015	ensembl	human	novel	69_37n	in_frame_ins	22	12.00	3	INS	0.645:0.803	CTC
PIEZO1	9780	genome.wustl.edu	37	16	88789682	88789683	+	In_Frame_Ins	INS	-	-	CTC			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr16:88789682_88789683insCTC	ENST00000301015.9	-	32	4635_4636	c.4389_4390insGAG	c.(4387-4392)cagcag>cagGAGcag	p.1463_1464QQ>QEQ	RP5-1142A6.9_ENST00000564984.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1463					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						TCCTGCTCCTGCTGCCGCCGCC	0.698																																						dbGAP											0										282,308,2700		27,4,224,47,210,1133						0.7	0.0			25	299,357,5668		31,6,231,45,261,2588	no	codingComplex	PIEZO1	NM_001142864.2		58,10,455,92,471,3721	A1A1,A1A2,A1R,A2A2,A2R,RR		10.3732,17.9331,12.9603				581,665,8368				-	-	-	SO:0001652	inframe_insertion	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.4389_4390insGAG	16.37:g.88789682_88789683insCTC	ENSP00000301015:p.Gln1463_Gln1464insGlu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHT9|A7E2B7|Q0KKZ9	In_Frame_Ins	INS	pfam_DUF3595	p.1463in_frame_insE	ENST00000301015.9	37	c.4390_4389	CCDS54058.1	16																																																																																			PIEZO1	-	NULL	ENSG00000103335		0.698	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	49	0.00	0	-	NM_014745		88789682	88789683	-1	no_errors	ENST00000301015	ensembl	human	novel	69_37n	in_frame_ins	22	12.00	3	INS	0.645:0.803	CTC
PRICKLE2	166336	genome.wustl.edu	37	3	64133124	64133124	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr3:64133124C>A	ENST00000295902.6	-	7	1627	c.1042G>T	c.(1042-1044)Gag>Tag	p.E348*	PRICKLE2_ENST00000564377.1_Nonsense_Mutation_p.E404*	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	348					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		ATGGGCTCCTCCGTCTTGCCC	0.587																																						dbGAP											0													108.0	123.0	118.0					3																	64133124		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.1042G>T	3.37:g.64133124C>A	ENSP00000295902:p.Glu348*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VF44	Nonsense_Mutation	SNP	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.E348*	ENST00000295902.6	37	c.1042	CCDS2902.1	3	.	.	.	.	.	.	.	.	.	.	C	43	10.375014	0.99393	.	.	ENSG00000163637	ENST00000295902	.	.	.	6.08	6.08	0.98989	.	0.072138	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-41.1497	20.6634	0.99662	0.0:1.0:0.0:0.0	.	.	.	.	X	348	.	ENSP00000295902:E348X	E	-	1	0	PRICKLE2	64108164	0.971000	0.33674	0.971000	0.41717	0.864000	0.49448	2.971000	0.49248	2.894000	0.99253	0.655000	0.94253	GAG	PRICKLE2	-	NULL	ENSG00000163637		0.587	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	PRICKLE2	HGNC	protein_coding	OTTHUMT00000352219.1	188	0.00	0	C	NM_198859		64133124	64133124	-1	no_errors	ENST00000295902	ensembl	human	known	69_37n	nonsense	108	34.34	57	SNP	0.999	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	297	0.33	1	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	140	37.78	85	SNP	1.000	G
PRKACA	5566	genome.wustl.edu	37	19	14213716	14213716	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr19:14213716A>G	ENST00000308677.4	-	4	444	c.248T>C	c.(247-249)cTg>cCg	p.L83P	PRKACA_ENST00000350356.3_5'UTR|PRKACA_ENST00000590853.1_Intron|PRKACA_ENST00000589994.1_Missense_Mutation_p.L75P	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha	83	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						GATCTGTTTCAGTTTCACCAC	0.562																																						dbGAP											0													163.0	134.0	144.0					19																	14213716		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.248T>C	19.37:g.14213716A>G	ENSP00000309591:p.Leu83Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L83P	ENST00000308677.4	37	c.248	CCDS12304.1	19	.	.	.	.	.	.	.	.	.	.	A	15.52	2.858172	0.51376	.	.	ENSG00000072062	ENST00000308677;ENST00000350356;ENST00000535695;ENST00000536649	T	0.65916	-0.18	5.64	5.64	0.86602	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.37530	N	0.002058	T	0.64638	0.2616	N	0.17474	0.49	0.80722	D	1	D;D;P;D	0.65815	0.995;0.981;0.929;0.98	D;D;D;D	0.66084	0.918;0.92;0.941;0.921	T	0.70303	-0.4909	10	0.87932	D	0	.	13.814	0.63281	1.0:0.0:0.0:0.0	.	25;66;83;75	B7Z708;Q15136;P17612;P17612-2	.;.;KAPCA_HUMAN;.	P	83;75;83;25	ENSP00000309591:L83P	ENSP00000309591:L83P	L	-	2	0	PRKACA	14074716	1.000000	0.71417	1.000000	0.80357	0.020000	0.10135	9.272000	0.95707	2.145000	0.66743	0.460000	0.39030	CTG	PRKACA	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000072062		0.562	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACA	HGNC	protein_coding	OTTHUMT00000459004.1	506	0.00	0	A	NM_002730		14213716	14213716	-1	no_errors	ENST00000308677	ensembl	human	known	69_37n	missense	282	34.72	150	SNP	1.000	G
PTPRA	5786	genome.wustl.edu	37	20	3016449	3016449	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr20:3016449G>A	ENST00000216877.6	+	21	2433	c.2033G>A	c.(2032-2034)cGg>cAg	p.R678Q	PTPRA_ENST00000318266.5_Missense_Mutation_p.R678Q|PTPRA_ENST00000356147.3_Missense_Mutation_p.R678Q|PTPRA_ENST00000358719.4_Missense_Mutation_p.R543Q|PTPRA_ENST00000399903.2_Missense_Mutation_p.R687Q|PTPRA_ENST00000380393.3_Missense_Mutation_p.R687Q|PTPRA_ENST00000425918.2_Missense_Mutation_p.R698Q	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	687	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AATAAGAGCCGGCAGATCCGG	0.582																																						dbGAP											0													44.0	47.0	46.0					20																	3016449		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.2033G>A	20.37:g.3016449G>A	ENSP00000216877:p.Arg678Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.R698Q	ENST00000216877.6	37	c.2093	CCDS13039.1	20	.	.	.	.	.	.	.	.	.	.	G	35	5.431317	0.96150	.	.	ENSG00000132670	ENST00000380393;ENST00000216877;ENST00000399903;ENST00000358719;ENST00000542217;ENST00000425918;ENST00000318266;ENST00000356147	T;T;T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48;2.48;2.48	5.57	5.57	0.84162	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.64402	U	0.000001	T	0.44350	0.1289	M	0.84082	2.675	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;P	0.85130	0.956;0.997;0.896	T	0.43261	-0.9402	10	0.66056	D	0.02	.	19.5578	0.95358	0.0:0.0:1.0:0.0	.	698;687;678	B7Z2A4;P18433;P18433-4	.;PTPRA_HUMAN;.	Q	687;678;687;543;297;698;678;678	ENSP00000369756:R687Q;ENSP00000216877:R678Q;ENSP00000382787:R687Q;ENSP00000351559:R543Q;ENSP00000393553:R698Q;ENSP00000314568:R678Q;ENSP00000348468:R678Q	ENSP00000216877:R678Q	R	+	2	0	PTPRA	2964449	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.604000	0.88044	0.563000	0.77884	CGG	PTPRA	-	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000132670		0.582	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTPRA	HGNC	protein_coding	OTTHUMT00000077682.3	62	0.00	0	G			3016449	3016449	+1	no_errors	ENST00000425918	ensembl	human	known	69_37n	missense	39	47.30	35	SNP	1.000	A
RPS16	6217	genome.wustl.edu	37	19	39926258	39926258	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr19:39926258G>C	ENST00000251453.3	-	2	191	c.139C>G	c.(139-141)Cta>Gta	p.L47V	RPS16_ENST00000601655.1_Intron|RPS16_ENST00000599539.1_Missense_Mutation_p.L47V|RPS16_ENST00000339471.4_Missense_Mutation_p.L47V	NM_001020.4	NP_001011.1	P62249	RS16_HUMAN	ribosomal protein S16	47					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|large_intestine(2)|lung(2)|skin(2)	7	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;4.14e-26)|all cancers(26;2.68e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TTGTACTGTAGCGTGCGCGGC	0.582																																						dbGAP											0													46.0	44.0	45.0					19																	39926258		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60854	CCDS12535.1	19q13.1	2011-04-05				ENSG00000105193		"""S ribosomal proteins"""	10396	protein-coding gene	gene with protein product	"""40S ribosomal protein S16"""	603675				2016298, 9582194	Standard	XM_005259137		Approved	S16	uc002olk.3	P62249		ENST00000251453.3:c.139C>G	19.37:g.39926258G>C	ENSP00000251453:p.Leu47Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDD5|P17008	Missense_Mutation	SNP	pfam_Ribosomal_S9,superfamily_Ribosomal_S5_D2-typ_fold	p.L47V	ENST00000251453.3	37	c.139	CCDS12535.1	19	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886094	0.51908	.	.	ENSG00000105193	ENST00000251453;ENST00000339471	.	.	.	6.17	4.07	0.47477	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.82360	0.5020	H	0.94462	3.54	0.80722	D	1	D;B	0.76494	0.999;0.308	D;P	0.75484	0.986;0.706	D	0.84272	0.0489	8	.	.	.	-7.6974	9.2298	0.37430	0.1986:0.0:0.8013:0.0	.	47;47	Q6IPX4;P62249	.;RS16_HUMAN	V	47	.	.	L	-	1	2	RPS16	44618098	0.999000	0.42202	1.000000	0.80357	0.511000	0.34104	2.722000	0.47269	0.945000	0.37605	0.655000	0.94253	CTA	RPS16	-	pfam_Ribosomal_S9,superfamily_Ribosomal_S5_D2-typ_fold	ENSG00000105193		0.582	RPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS16	HGNC	protein_coding	OTTHUMT00000464511.1	101	0.00	0	G	NM_001020		39926258	39926258	-1	no_errors	ENST00000339471	ensembl	human	known	69_37n	missense	64	45.83	55	SNP	1.000	C
RASIP1	54922	genome.wustl.edu	37	19	49225113	49225113	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr19:49225113G>A	ENST00000222145.4	-	11	2894	c.2690C>T	c.(2689-2691)aCa>aTa	p.T897I	MAMSTR_ENST00000377367.3_5'Flank|MAMSTR_ENST00000318083.6_5'Flank|MAMSTR_ENST00000419611.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	897	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		CTCCTCACCTGTGTCCACAGC	0.642																																						dbGAP											0													49.0	57.0	54.0					19																	49225113		2201	4296	6497	-	-	-	SO:0001583	missense	0			BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.2690C>T	19.37:g.49225113G>A	ENSP00000222145:p.Thr897Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6U676	Missense_Mutation	SNP	pfam_Dil_domain,pfam_Ras-assoc,superfamily_SMAD_FHA_domain,smart_Ras-assoc,pfscan_Dilute,pfscan_Ras-assoc	p.T897I	ENST00000222145.4	37	c.2690	CCDS12731.1	19	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810281	0.50421	.	.	ENSG00000105538	ENST00000222145	T	0.26957	1.7	4.36	4.36	0.52297	Dilute (1);	0.665333	0.13757	N	0.364895	T	0.29783	0.0744	N	0.22421	0.69	0.28519	N	0.913153	D	0.65815	0.995	P	0.53185	0.72	T	0.10753	-1.0616	10	0.72032	D	0.01	-8.9952	14.774	0.69703	0.0:0.0:1.0:0.0	.	897	Q5U651	RAIN_HUMAN	I	897	ENSP00000222145:T897I	ENSP00000222145:T897I	T	-	2	0	RASIP1	53916925	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	2.293000	0.43558	2.429000	0.82318	0.484000	0.47621	ACA	RASIP1	-	pfscan_Dilute	ENSG00000105538		0.642	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASIP1	HGNC	protein_coding	OTTHUMT00000466185.1	55	0.00	0	G	NM_017805		49225113	49225113	-1	no_errors	ENST00000222145	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	A
RASIP1	54922	genome.wustl.edu	37	19	49225113	49225113	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	0744c5e3-f044-4c56-b3c6-f8678f69c55a	g.chr19:49225113G>A	ENST00000222145.4	-	11	2894	c.2690C>T	c.(2689-2691)aCa>aTa	p.T897I	MAMSTR_ENST00000377367.3_5'Flank|MAMSTR_ENST00000318083.6_5'Flank|MAMSTR_ENST00000419611.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	897	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		CTCCTCACCTGTGTCCACAGC	0.642																																						dbGAP											0													49.0	57.0	54.0					19																	49225113		2201	4296	6497	-	-	-	SO:0001583	missense	0			BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.2690C>T	19.37:g.49225113G>A	ENSP00000222145:p.Thr897Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6U676	Missense_Mutation	SNP	pfam_Dil_domain,pfam_Ras-assoc,superfamily_SMAD_FHA_domain,smart_Ras-assoc,pfscan_Dilute,pfscan_Ras-assoc	p.T897I	ENST00000222145.4	37	c.2690	CCDS12731.1	19	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810281	0.50421	.	.	ENSG00000105538	ENST00000222145	T	0.26957	1.7	4.36	4.36	0.52297	Dilute (1);	0.665333	0.13757	N	0.364895	T	0.29783	0.0744	N	0.22421	0.69	0.28519	N	0.913153	D	0.65815	0.995	P	0.53185	0.72	T	0.10753	-1.0616	10	0.72032	D	0.01	-8.9952	14.774	0.69703	0.0:0.0:1.0:0.0	.	897	Q5U651	RAIN_HUMAN	I	897	ENSP00000222145:T897I	ENSP00000222145:T897I	T	-	2	0	RASIP1	53916925	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	2.293000	0.43558	2.429000	0.82318	0.484000	0.47621	ACA	RASIP1	-	pfscan_Dilute	ENSG00000105538		0.642	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASIP1	HGNC	protein_coding	OTTHUMT00000466185.1	58	0.00	0	G	NM_017805		49225113	49225113	-1	no_errors	ENST00000222145	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	A
RRAD	6236	genome.wustl.edu	37	16	66957813	66957813	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr16:66957813T>C	ENST00000299759.6	-	3	630	c.380A>G	c.(379-381)tAt>tGt	p.Y127C	RRAD_ENST00000420652.1_Missense_Mutation_p.Y127C			P55042	RAD_HUMAN	Ras-related associated with diabetes	127					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		GGAGCGATCATAGGTGTGCCC	0.572																																						dbGAP											0													175.0	165.0	168.0					16																	66957813		2200	4300	6500	-	-	-	SO:0001583	missense	0			L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.380A>G	16.37:g.66957813T>C	ENSP00000299759:p.Tyr127Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96F39	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,pirsf_Small_GTPase_GEM/REM/Rad,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Y127C	ENST00000299759.6	37	c.380	CCDS10824.1	16	.	.	.	.	.	.	.	.	.	.	T	14.13	2.444830	0.43429	.	.	ENSG00000166592	ENST00000420652;ENST00000299759	T;T	0.80738	-1.41;-1.41	4.11	4.11	0.48088	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90601	0.7053	M	0.90019	3.08	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.92467	0.5982	10	0.87932	D	0	.	13.2577	0.60089	0.0:0.0:0.0:1.0	.	127	P55042	RAD_HUMAN	C	127	ENSP00000388744:Y127C;ENSP00000299759:Y127C	ENSP00000299759:Y127C	Y	-	2	0	RRAD	65515314	1.000000	0.71417	0.971000	0.41717	0.448000	0.32197	7.558000	0.82253	1.861000	0.53984	0.459000	0.35465	TAT	RRAD	-	pfam_Small_GTPase,pfam_MIRO-like,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,pirsf_Small_GTPase_GEM/REM/Rad,tigrfam_Small_GTP-bd_dom	ENSG00000166592		0.572	RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRAD	HGNC	protein_coding	OTTHUMT00000268830.1	319	0.31	1	T	NM_004165		66957813	66957813	-1	no_errors	ENST00000299759	ensembl	human	known	69_37n	missense	88	45.06	73	SNP	1.000	C
RRAD	6236	genome.wustl.edu	37	16	66957813	66957813	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	0744c5e3-f044-4c56-b3c6-f8678f69c55a	g.chr16:66957813T>C	ENST00000299759.6	-	3	630	c.380A>G	c.(379-381)tAt>tGt	p.Y127C	RRAD_ENST00000420652.1_Missense_Mutation_p.Y127C			P55042	RAD_HUMAN	Ras-related associated with diabetes	127					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		GGAGCGATCATAGGTGTGCCC	0.572																																						dbGAP											0													175.0	165.0	168.0					16																	66957813		2200	4300	6500	-	-	-	SO:0001583	missense	0			L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.380A>G	16.37:g.66957813T>C	ENSP00000299759:p.Tyr127Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96F39	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,pirsf_Small_GTPase_GEM/REM/Rad,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Y127C	ENST00000299759.6	37	c.380	CCDS10824.1	16	.	.	.	.	.	.	.	.	.	.	T	14.13	2.444830	0.43429	.	.	ENSG00000166592	ENST00000420652;ENST00000299759	T;T	0.80738	-1.41;-1.41	4.11	4.11	0.48088	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90601	0.7053	M	0.90019	3.08	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.92467	0.5982	10	0.87932	D	0	.	13.2577	0.60089	0.0:0.0:0.0:1.0	.	127	P55042	RAD_HUMAN	C	127	ENSP00000388744:Y127C;ENSP00000299759:Y127C	ENSP00000299759:Y127C	Y	-	2	0	RRAD	65515314	1.000000	0.71417	0.971000	0.41717	0.448000	0.32197	7.558000	0.82253	1.861000	0.53984	0.459000	0.35465	TAT	RRAD	-	pfam_Small_GTPase,pfam_MIRO-like,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,pirsf_Small_GTPase_GEM/REM/Rad,tigrfam_Small_GTP-bd_dom	ENSG00000166592		0.572	RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRAD	HGNC	protein_coding	OTTHUMT00000268830.1	282	0.35	1	T	NM_004165		66957813	66957813	-1	no_errors	ENST00000299759	ensembl	human	known	69_37n	missense	88	45.06	73	SNP	1.000	C
RYR2	6262	genome.wustl.edu	37	1	237947353	237947353	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr1:237947353G>A	ENST00000366574.2	+	90	12658	c.12341G>A	c.(12340-12342)cGa>cAa	p.R4114Q	RYR2_ENST00000542537.1_Missense_Mutation_p.R4098Q|RYR2_ENST00000360064.6_Missense_Mutation_p.R4120Q|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4114					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AACGATACCCGACTTCAGACT	0.527																																						dbGAP											0													58.0	57.0	57.0					1																	237947353		1933	4160	6093	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12341G>A	1.37:g.237947353G>A	ENSP00000355533:p.Arg4114Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.R4120Q	ENST00000366574.2	37	c.12359	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.547408	0.86022	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.99176	-5.52;-5.52;-5.52	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000019	D	0.99227	0.9731	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.81914	0.99;0.995	D	0.99831	1.1054	10	0.87932	D	0	.	19.1841	0.93635	0.0:0.0:1.0:0.0	.	1088;4114	B4DGV4;Q92736	.;RYR2_HUMAN	Q	4114;4120;4098;1088	ENSP00000355533:R4114Q;ENSP00000353174:R4120Q;ENSP00000443798:R4098Q	ENSP00000353174:R4120Q	R	+	2	0	RYR2	236013976	1.000000	0.71417	0.023000	0.16930	0.679000	0.39708	9.813000	0.99286	2.541000	0.85698	0.561000	0.74099	CGA	RYR2	-	NULL	ENSG00000198626		0.527	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	157	0.00	0	G	NM_001035		237947353	237947353	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	134	27.03	50	SNP	0.938	A
TAOK2	9344	genome.wustl.edu	37	16	29994166	29994166	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr16:29994166A>T	ENST00000308893.4	+	11	1986	c.943A>T	c.(943-945)Atc>Ttc	p.I315F	TAOK2_ENST00000543033.1_Missense_Mutation_p.I315F|TAOK2_ENST00000416441.2_Missense_Mutation_p.I142F|TAOK2_ENST00000279394.3_Missense_Mutation_p.I315F	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	315					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						GATGAAGAAGATCCTGTTCCA	0.607																																						dbGAP											0													108.0	95.0	99.0					16																	29994166		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.943A>T	16.37:g.29994166A>T	ENSP00000310094:p.Ile315Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I315F	ENST00000308893.4	37	c.943	CCDS10663.1	16	.	.	.	.	.	.	.	.	.	.	A	22.8	4.334804	0.81801	.	.	ENSG00000149930	ENST00000416441;ENST00000308893;ENST00000543033;ENST00000279394	D;D;D	0.84070	-1.8;-1.8;-1.8	5.51	5.51	0.81932	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.91157	0.7215	M	0.83223	2.63	0.80722	D	1	B;D;P;B;D	0.71674	0.141;0.998;0.847;0.007;0.974	B;D;P;B;P	0.76575	0.065;0.988;0.519;0.015;0.749	D	0.91809	0.5458	9	.	.	.	.	14.6186	0.68569	1.0:0.0:0.0:0.0	.	499;142;315;315;315	Q86V37;Q9UL54-3;Q9UL54-2;A0PJ48;Q9UL54	.;.;.;.;TAOK2_HUMAN	F	315	ENSP00000310094:I315F;ENSP00000440336:I315F;ENSP00000279394:I315F	.	I	+	1	0	TAOK2	29901667	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	4.962000	0.63687	2.098000	0.63641	0.460000	0.39030	ATC	TAOK2	-	superfamily_Kinase-like_dom	ENSG00000149930		0.607	TAOK2-002	KNOWN	basic|CCDS	protein_coding	TAOK2	HGNC	protein_coding	OTTHUMT00000255152.2	58	0.00	0	A	NM_016151		29994166	29994166	+1	no_errors	ENST00000308893	ensembl	human	known	69_37n	missense	30	41.18	21	SNP	1.000	T
TAOK2	9344	genome.wustl.edu	37	16	29994166	29994166	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	0744c5e3-f044-4c56-b3c6-f8678f69c55a	g.chr16:29994166A>T	ENST00000308893.4	+	11	1986	c.943A>T	c.(943-945)Atc>Ttc	p.I315F	TAOK2_ENST00000543033.1_Missense_Mutation_p.I315F|TAOK2_ENST00000416441.2_Missense_Mutation_p.I142F|TAOK2_ENST00000279394.3_Missense_Mutation_p.I315F	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	315					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						GATGAAGAAGATCCTGTTCCA	0.607																																						dbGAP											0													108.0	95.0	99.0					16																	29994166		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.943A>T	16.37:g.29994166A>T	ENSP00000310094:p.Ile315Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I315F	ENST00000308893.4	37	c.943	CCDS10663.1	16	.	.	.	.	.	.	.	.	.	.	A	22.8	4.334804	0.81801	.	.	ENSG00000149930	ENST00000416441;ENST00000308893;ENST00000543033;ENST00000279394	D;D;D	0.84070	-1.8;-1.8;-1.8	5.51	5.51	0.81932	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.91157	0.7215	M	0.83223	2.63	0.80722	D	1	B;D;P;B;D	0.71674	0.141;0.998;0.847;0.007;0.974	B;D;P;B;P	0.76575	0.065;0.988;0.519;0.015;0.749	D	0.91809	0.5458	9	.	.	.	.	14.6186	0.68569	1.0:0.0:0.0:0.0	.	499;142;315;315;315	Q86V37;Q9UL54-3;Q9UL54-2;A0PJ48;Q9UL54	.;.;.;.;TAOK2_HUMAN	F	315	ENSP00000310094:I315F;ENSP00000440336:I315F;ENSP00000279394:I315F	.	I	+	1	0	TAOK2	29901667	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	4.962000	0.63687	2.098000	0.63641	0.460000	0.39030	ATC	TAOK2	-	superfamily_Kinase-like_dom	ENSG00000149930		0.607	TAOK2-002	KNOWN	basic|CCDS	protein_coding	TAOK2	HGNC	protein_coding	OTTHUMT00000255152.2	66	0.00	0	A	NM_016151		29994166	29994166	+1	no_errors	ENST00000308893	ensembl	human	known	69_37n	missense	30	41.18	21	SNP	1.000	T
TCAM1P	146771	genome.wustl.edu	37	17	61937269	61937270	+	RNA	INS	-	-	T			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr17:61937269_61937270insT	ENST00000478379.1	+	0	765_766					NR_002947.2				testicular cell adhesion molecule 1, pseudogene																		GGTCTCTTCCCTTTTGGAGGCT	0.49																																						dbGAP											0																																										-	-	-			0			AB026156		17q23.3	2013-09-26	2012-12-07	2010-03-12	ENSG00000240280	ENSG00000240280			30707	pseudogene	pseudogene		612756	"""testicular cell adhesion molecule 1 homolog (mouse)"", ""testicular cell adhesion molecule 1 homolog (mouse), pseudogene"""	TCAM1		11195349, 2744760, 19766163	Standard	NR_002947		Approved		uc031rdl.1		OTTHUMG00000154404		17.37:g.61937273_61937273dupT		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000478379.1	37	NULL		17																																																																																			TCAM1P	-	-	ENSG00000240280		0.490	TCAM1P-002	KNOWN	basic	processed_transcript	TCAM1P	HGNC	pseudogene	OTTHUMT00000335083.1	10	0.00	0	-			61937269	61937270	+1	no_errors	ENST00000478379	ensembl	human	known	69_37n	rna	4	33.33	2	INS	0.603:0.593	T
TMEM132B	114795	genome.wustl.edu	37	12	126137027	126137027	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr12:126137027C>T	ENST00000299308.3	+	8	1948	c.1940C>T	c.(1939-1941)aCg>aTg	p.T647M	TMEM132B_ENST00000535886.1_Missense_Mutation_p.T159M	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	647						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GCTGAGAAGACGGTGATTGTC	0.567																																						dbGAP											0													32.0	34.0	34.0					12																	126137027		2073	4228	6301	-	-	-	SO:0001583	missense	0			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1940C>T	12.37:g.126137027C>T	ENSP00000299308:p.Thr647Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	NULL	p.T647M	ENST00000299308.3	37	c.1940	CCDS41859.1	12	.	.	.	.	.	.	.	.	.	.	C	20.4	3.988608	0.74589	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.54866	0.55;0.55	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000002	T	0.69260	0.3091	L	0.54965	1.715	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.69146	-0.5222	10	0.49607	T	0.09	.	19.0468	0.93022	0.0:1.0:0.0:0.0	.	647	Q14DG7	T132B_HUMAN	M	647;159	ENSP00000299308:T647M;ENSP00000440436:T159M	ENSP00000299308:T647M	T	+	2	0	TMEM132B	124702980	1.000000	0.71417	0.947000	0.38551	0.510000	0.34073	4.569000	0.60865	2.471000	0.83476	0.655000	0.94253	ACG	TMEM132B	-	NULL	ENSG00000139364		0.567	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM132B	HGNC	protein_coding	OTTHUMT00000400043.1	77	0.00	0	C	NM_052907		126137027	126137027	+1	no_errors	ENST00000299308	ensembl	human	known	69_37n	missense	40	34.43	21	SNP	1.000	T
UNC5B	219699	genome.wustl.edu	37	10	73039667	73039667	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr10:73039667G>A	ENST00000335350.6	+	2	585	c.169G>A	c.(169-171)Gcc>Acc	p.A57T	UNC5B_ENST00000373192.4_Missense_Mutation_p.A57T	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	57	Ig-like.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GCCACAGGACGCCTACATTGT	0.617																																						dbGAP											0													69.0	66.0	67.0					10																	73039667		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.169G>A	10.37:g.73039667G>A	ENSP00000334329:p.Ala57Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Death,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.A57T	ENST00000335350.6	37	c.169	CCDS7309.1	10	.	.	.	.	.	.	.	.	.	.	G	34	5.333512	0.95758	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.25414	1.8;1.8	4.52	4.52	0.55395	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.45074	0.1324	L	0.52011	1.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.25152	-1.0140	10	0.29301	T	0.29	-32.4997	17.2464	0.87029	0.0:0.0:1.0:0.0	.	57;57	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	T	57	ENSP00000334329:A57T;ENSP00000362288:A57T	ENSP00000334329:A57T	A	+	1	0	UNC5B	72709673	1.000000	0.71417	0.992000	0.48379	0.905000	0.53344	9.869000	0.99810	2.051000	0.60960	0.561000	0.74099	GCC	UNC5B	-	smart_Ig_sub	ENSG00000107731		0.617	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5B	HGNC	protein_coding	OTTHUMT00000048541.1	24	0.00	0	G	NM_170744		73039667	73039667	+1	no_errors	ENST00000335350	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	1.000	A
UNC5B	219699	genome.wustl.edu	37	10	73039667	73039667	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	0744c5e3-f044-4c56-b3c6-f8678f69c55a	g.chr10:73039667G>A	ENST00000335350.6	+	2	585	c.169G>A	c.(169-171)Gcc>Acc	p.A57T	UNC5B_ENST00000373192.4_Missense_Mutation_p.A57T	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	57	Ig-like.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GCCACAGGACGCCTACATTGT	0.617																																						dbGAP											0													69.0	66.0	67.0					10																	73039667		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.169G>A	10.37:g.73039667G>A	ENSP00000334329:p.Ala57Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Death,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.A57T	ENST00000335350.6	37	c.169	CCDS7309.1	10	.	.	.	.	.	.	.	.	.	.	G	34	5.333512	0.95758	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.25414	1.8;1.8	4.52	4.52	0.55395	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.45074	0.1324	L	0.52011	1.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.25152	-1.0140	10	0.29301	T	0.29	-32.4997	17.2464	0.87029	0.0:0.0:1.0:0.0	.	57;57	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	T	57	ENSP00000334329:A57T;ENSP00000362288:A57T	ENSP00000334329:A57T	A	+	1	0	UNC5B	72709673	1.000000	0.71417	0.992000	0.48379	0.905000	0.53344	9.869000	0.99810	2.051000	0.60960	0.561000	0.74099	GCC	UNC5B	-	smart_Ig_sub	ENSG00000107731		0.617	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5B	HGNC	protein_coding	OTTHUMT00000048541.1	22	0.00	0	G	NM_170744		73039667	73039667	+1	no_errors	ENST00000335350	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	1.000	A
ZFPM1	161882	genome.wustl.edu	37	16	88593275	88593276	+	Frame_Shift_Ins	INS	-	-	C			TCGA-E2-A15L-01A-11D-A12B-09	TCGA-E2-A15L-11A-31D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0e86ae11-0b76-43ac-b0b8-664a59c3aa6a	f7f1f468-a589-4593-82e4-abbf09d26fcc	g.chr16:88593275_88593276insC	ENST00000319555.3	+	5	778_779	c.456_457insC	c.(457-459)cccfs	p.P153fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	153					atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		TGAGGACGCTGCCCCAGGCCCT	0.683																																					Pancreas(49;850 1106 29641 32847 38344)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.460dupC	16.37:g.88593279_88593279dupC	ENSP00000326630:p.Pro153fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q153fs	ENST00000319555.3	37	c.456_457	CCDS32502.1	16																																																																																			ZFPM1	-	NULL	ENSG00000179588		0.683	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM1	HGNC	protein_coding	OTTHUMT00000422270.2	56	0.00	0	-			88593275	88593276	+1	no_errors	ENST00000319555	ensembl	human	known	69_37n	frame_shift_ins	21	32.26	10	INS	0.992:1.000	C
