#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACAA2	10449	genome.wustl.edu	37	18	47329199	47329199	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr18:47329199C>A	ENST00000285093.10	-	2	516	c.41G>T	c.(40-42)cGa>cTa	p.R14L	ACAA2_ENST00000587994.1_Missense_Mutation_p.R11L|ACAA2_ENST00000589432.1_5'UTR|RP11-886H22.1_ENST00000590532.2_3'UTR	NM_006111.2	NP_006102.2	P42765	THIM_HUMAN	acetyl-CoA acyltransferase 2	14					cellular response to hypoxia (GO:0071456)|cholesterol biosynthetic process (GO:0006695)|fatty acid metabolic process (GO:0006631)|negative regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902109)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	acetyl-CoA C-acyltransferase activity (GO:0003988)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(7)|ovary(1)	10						AAAGGGCGTTCGCTTAGCAGC	0.448																																						dbGAP											0													102.0	93.0	96.0					18																	47329199		2203	4300	6503	-	-	-	SO:0001583	missense	0			D16294	CCDS11939.1	18q21	2010-04-30	2010-04-30		ENSG00000167315	ENSG00000167315	2.3.1.16		83	protein-coding gene	gene with protein product	"""mitochondrial 3-oxoacyl-Coenzyme A thiolase"""	604770	"""acetyl-Coenzyme A acyltransferase 2"""			8241273	Standard	NM_006111		Approved	DSAEC	uc002ldw.4	P42765	OTTHUMG00000132667	ENST00000285093.10:c.41G>T	18.37:g.47329199C>A	ENSP00000285093:p.Arg14Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUT6	Missense_Mutation	SNP	pfam_Thiolase_N,pfam_Thiolase_C,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	p.R14L	ENST00000285093.10	37	c.41	CCDS11939.1	18	.	.	.	.	.	.	.	.	.	.	C	33	5.281581	0.95489	.	.	ENSG00000167315	ENST00000285093	D	0.97066	-4.23	5.64	5.64	0.86602	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.000000	0.85682	D	0.000000	D	0.99180	0.9716	H	0.98005	4.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.98936	1.0789	10	0.87932	D	0	-15.6347	19.3136	0.94202	0.0:1.0:0.0:0.0	.	14;14	B2RB23;P42765	.;THIM_HUMAN	L	14	ENSP00000285093:R14L	ENSP00000285093:R14L	R	-	2	0	ACAA2	45583197	1.000000	0.71417	0.992000	0.48379	0.807000	0.45602	7.693000	0.84214	2.659000	0.90383	0.655000	0.94253	CGA	ACAA2	-	pfam_Thiolase_N,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	ENSG00000167315		0.448	ACAA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACAA2	HGNC	protein_coding	OTTHUMT00000255921.2	153	0.00	0	C	NM_006111		47329199	47329199	-1	no_errors	ENST00000285093	ensembl	human	known	69_37n	missense	119	11.11	15	SNP	1.000	A
ACAA2	10449	genome.wustl.edu	37	18	47329199	47329199	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr18:47329199C>A	ENST00000285093.10	-	2	516	c.41G>T	c.(40-42)cGa>cTa	p.R14L	ACAA2_ENST00000587994.1_Missense_Mutation_p.R11L|ACAA2_ENST00000589432.1_5'UTR|RP11-886H22.1_ENST00000590532.2_3'UTR	NM_006111.2	NP_006102.2	P42765	THIM_HUMAN	acetyl-CoA acyltransferase 2	14					cellular response to hypoxia (GO:0071456)|cholesterol biosynthetic process (GO:0006695)|fatty acid metabolic process (GO:0006631)|negative regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902109)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	acetyl-CoA C-acyltransferase activity (GO:0003988)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(7)|ovary(1)	10						AAAGGGCGTTCGCTTAGCAGC	0.448																																						dbGAP											0													102.0	93.0	96.0					18																	47329199		2203	4300	6503	-	-	-	SO:0001583	missense	0			D16294	CCDS11939.1	18q21	2010-04-30	2010-04-30		ENSG00000167315	ENSG00000167315	2.3.1.16		83	protein-coding gene	gene with protein product	"""mitochondrial 3-oxoacyl-Coenzyme A thiolase"""	604770	"""acetyl-Coenzyme A acyltransferase 2"""			8241273	Standard	NM_006111		Approved	DSAEC	uc002ldw.4	P42765	OTTHUMG00000132667	ENST00000285093.10:c.41G>T	18.37:g.47329199C>A	ENSP00000285093:p.Arg14Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUT6	Missense_Mutation	SNP	pfam_Thiolase_N,pfam_Thiolase_C,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	p.R14L	ENST00000285093.10	37	c.41	CCDS11939.1	18	.	.	.	.	.	.	.	.	.	.	C	33	5.281581	0.95489	.	.	ENSG00000167315	ENST00000285093	D	0.97066	-4.23	5.64	5.64	0.86602	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.000000	0.85682	D	0.000000	D	0.99180	0.9716	H	0.98005	4.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.98936	1.0789	10	0.87932	D	0	-15.6347	19.3136	0.94202	0.0:1.0:0.0:0.0	.	14;14	B2RB23;P42765	.;THIM_HUMAN	L	14	ENSP00000285093:R14L	ENSP00000285093:R14L	R	-	2	0	ACAA2	45583197	1.000000	0.71417	0.992000	0.48379	0.807000	0.45602	7.693000	0.84214	2.659000	0.90383	0.655000	0.94253	CGA	ACAA2	-	pfam_Thiolase_N,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	ENSG00000167315		0.448	ACAA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACAA2	HGNC	protein_coding	OTTHUMT00000255921.2	149	0.00	0	C	NM_006111		47329199	47329199	-1	no_errors	ENST00000285093	ensembl	human	known	69_37n	missense	119	11.11	15	SNP	1.000	A
ASL	435	genome.wustl.edu	37	7	65551616	65551616	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr7:65551616C>T	ENST00000304874.9	+	7	593	c.491C>T	c.(490-492)gCc>gTc	p.A164V	ASL_ENST00000395332.3_Missense_Mutation_p.A164V|ASL_ENST00000395331.3_Missense_Mutation_p.A164V|ASL_ENST00000380839.4_Missense_Mutation_p.A164V|AC068533.7_ENST00000450043.1_5'Flank	NM_000048.3	NP_000039.2	P04424	ARLY_HUMAN	argininosuccinate lyase	164					arginine biosynthetic process via ornithine (GO:0042450)|arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|internal protein amino acid acetylation (GO:0006475)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	argininosuccinate lyase activity (GO:0004056)			breast(3)|endometrium(3)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	18					L-Arginine(DB00125)	TTGCAGAGGGCCCAGCCCATC	0.652																																						dbGAP											0													54.0	48.0	50.0					7																	65551616		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5531.1, CCDS47597.1, CCDS47598.1	7q11.21	2012-10-02			ENSG00000126522	ENSG00000126522	4.3.2.1		746	protein-coding gene	gene with protein product		608310					Standard	NM_001024943		Approved		uc003tuo.3	P04424	OTTHUMG00000022876	ENST00000304874.9:c.491C>T	7.37:g.65551616C>T	ENSP00000307188:p.Ala164Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EMI0|E9PE48|Q6LDS5|Q96HS2	Missense_Mutation	SNP	pfam_Lyase1_N,superfamily_L-Aspartase-like,prints_D_crystallin,prints_Fumarate_lyase,tigrfam_Argininosuccinate_lyase	p.A164V	ENST00000304874.9	37	c.491	CCDS5531.1	7	.	.	.	.	.	.	.	.	.	.	c	23.3	4.403627	0.83230	.	.	ENSG00000126522	ENST00000304874;ENST00000380839;ENST00000395332;ENST00000362000;ENST00000395331	D;D;D;D;D	0.99905	-7.7;-7.7;-7.7;-7.7;-7.7	5.8	4.91	0.64330	Lyase 1, N-terminal (1);L-Aspartase-like (1);	0.105663	0.64402	D	0.000004	D	0.99939	0.9973	H	0.98833	4.345	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;1.0	D;D;D;D	0.72625	0.978;0.973;0.978;0.978	D	0.95939	0.8945	10	0.87932	D	0	.	14.2348	0.65919	0.0:0.851:0.149:0.0	.	164;164;164;164	B4DU69;E9PE48;E7EMI0;P04424	.;.;.;ARLY_HUMAN	V	164;164;164;99;164	ENSP00000307188:A164V;ENSP00000370219:A164V;ENSP00000378741:A164V;ENSP00000354710:A99V;ENSP00000378740:A164V	ENSP00000307188:A164V	A	+	2	0	ASL	65189051	1.000000	0.71417	0.995000	0.50966	0.519000	0.34347	7.139000	0.77314	1.433000	0.47394	0.655000	0.94253	GCC	ASL	-	pfam_Lyase1_N,superfamily_L-Aspartase-like,prints_D_crystallin,prints_Fumarate_lyase,tigrfam_Argininosuccinate_lyase	ENSG00000126522		0.652	ASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASL	HGNC	protein_coding	OTTHUMT00000251695.2	72	0.00	0	C	NM_000048		65551616	65551616	+1	no_errors	ENST00000304874	ensembl	human	known	69_37n	missense	87	13.00	13	SNP	1.000	T
ASL	435	genome.wustl.edu	37	7	65551616	65551616	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr7:65551616C>T	ENST00000304874.9	+	7	593	c.491C>T	c.(490-492)gCc>gTc	p.A164V	ASL_ENST00000395332.3_Missense_Mutation_p.A164V|ASL_ENST00000395331.3_Missense_Mutation_p.A164V|ASL_ENST00000380839.4_Missense_Mutation_p.A164V|AC068533.7_ENST00000450043.1_5'Flank	NM_000048.3	NP_000039.2	P04424	ARLY_HUMAN	argininosuccinate lyase	164					arginine biosynthetic process via ornithine (GO:0042450)|arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|internal protein amino acid acetylation (GO:0006475)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	argininosuccinate lyase activity (GO:0004056)			breast(3)|endometrium(3)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	18					L-Arginine(DB00125)	TTGCAGAGGGCCCAGCCCATC	0.652																																						dbGAP											0													54.0	48.0	50.0					7																	65551616		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5531.1, CCDS47597.1, CCDS47598.1	7q11.21	2012-10-02			ENSG00000126522	ENSG00000126522	4.3.2.1		746	protein-coding gene	gene with protein product		608310					Standard	NM_001024943		Approved		uc003tuo.3	P04424	OTTHUMG00000022876	ENST00000304874.9:c.491C>T	7.37:g.65551616C>T	ENSP00000307188:p.Ala164Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EMI0|E9PE48|Q6LDS5|Q96HS2	Missense_Mutation	SNP	pfam_Lyase1_N,superfamily_L-Aspartase-like,prints_D_crystallin,prints_Fumarate_lyase,tigrfam_Argininosuccinate_lyase	p.A164V	ENST00000304874.9	37	c.491	CCDS5531.1	7	.	.	.	.	.	.	.	.	.	.	c	23.3	4.403627	0.83230	.	.	ENSG00000126522	ENST00000304874;ENST00000380839;ENST00000395332;ENST00000362000;ENST00000395331	D;D;D;D;D	0.99905	-7.7;-7.7;-7.7;-7.7;-7.7	5.8	4.91	0.64330	Lyase 1, N-terminal (1);L-Aspartase-like (1);	0.105663	0.64402	D	0.000004	D	0.99939	0.9973	H	0.98833	4.345	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;1.0	D;D;D;D	0.72625	0.978;0.973;0.978;0.978	D	0.95939	0.8945	10	0.87932	D	0	.	14.2348	0.65919	0.0:0.851:0.149:0.0	.	164;164;164;164	B4DU69;E9PE48;E7EMI0;P04424	.;.;.;ARLY_HUMAN	V	164;164;164;99;164	ENSP00000307188:A164V;ENSP00000370219:A164V;ENSP00000378741:A164V;ENSP00000354710:A99V;ENSP00000378740:A164V	ENSP00000307188:A164V	A	+	2	0	ASL	65189051	1.000000	0.71417	0.995000	0.50966	0.519000	0.34347	7.139000	0.77314	1.433000	0.47394	0.655000	0.94253	GCC	ASL	-	pfam_Lyase1_N,superfamily_L-Aspartase-like,prints_D_crystallin,prints_Fumarate_lyase,tigrfam_Argininosuccinate_lyase	ENSG00000126522		0.652	ASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASL	HGNC	protein_coding	OTTHUMT00000251695.2	72	0.00	0	C	NM_000048		65551616	65551616	+1	no_errors	ENST00000304874	ensembl	human	known	69_37n	missense	87	13.00	13	SNP	1.000	T
AGK	55750	genome.wustl.edu	37	7	141296374	141296374	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr7:141296374C>G	ENST00000355413.4	+	4	414	c.154C>G	c.(154-156)Caa>Gaa	p.Q52E	AGK_ENST00000495028.1_3'UTR|AGK_ENST00000535825.1_Missense_Mutation_p.Q52E|AGK_ENST00000473247.1_Missense_Mutation_p.Q24E	NM_018238.3	NP_060708.1	Q53H12	AGK_HUMAN	acylglycerol kinase	52					ceramide biosynthetic process (GO:0046513)|glycerolipid metabolic process (GO:0046486)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acylglycerol kinase activity (GO:0047620)|ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(3)	17	Melanoma(164;0.0171)					GTTTGGCAATCAACTCATTCC	0.358																																						dbGAP											0													178.0	163.0	168.0					7																	141296374		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022777	CCDS5865.1	7q34	2010-05-04	2007-01-11	2007-01-11	ENSG00000006530	ENSG00000006530	2.7.1.94		21869	protein-coding gene	gene with protein product		610345	"""multiple substrate lipid kinase"""	MULK		15252046, 15939762, 17135245	Standard	NM_018238		Approved	FLJ10842	uc003vwi.2	Q53H12	OTTHUMG00000157499	ENST00000355413.4:c.154C>G	7.37:g.141296374C>G	ENSP00000347581:p.Gln52Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q75KN1|Q96GC3|Q9NP48	Missense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.Q52E	ENST00000355413.4	37	c.154	CCDS5865.1	7	.	.	.	.	.	.	.	.	.	.	C	11.84	1.759455	0.31137	.	.	ENSG00000006530	ENST00000355413;ENST00000473247;ENST00000535825	T;T;T	0.42513	1.27;1.96;0.97	6.17	6.17	0.99709	.	0.097037	0.64402	D	0.000001	T	0.29749	0.0743	N	0.24115	0.695	0.46927	D	0.999257	B	0.06786	0.001	B	0.08055	0.003	T	0.18587	-1.0332	10	0.02654	T	1	.	19.6509	0.95805	0.0:1.0:0.0:0.0	.	52	Q53H12	AGK_HUMAN	E	52;24;52	ENSP00000347581:Q52E;ENSP00000420776:Q24E;ENSP00000444349:Q52E	ENSP00000347581:Q52E	Q	+	1	0	AGK	140942843	1.000000	0.71417	0.961000	0.40146	0.992000	0.81027	4.053000	0.57427	2.941000	0.99782	0.655000	0.94253	CAA	AGK	-	NULL	ENSG00000006530		0.358	AGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGK	HGNC	protein_coding	OTTHUMT00000348969.1	479	0.00	0	C	NM_018238		141296374	141296374	+1	no_errors	ENST00000355413	ensembl	human	known	69_37n	missense	324	16.28	63	SNP	1.000	G
AGK	55750	genome.wustl.edu	37	7	141296374	141296374	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr7:141296374C>G	ENST00000355413.4	+	4	414	c.154C>G	c.(154-156)Caa>Gaa	p.Q52E	AGK_ENST00000495028.1_3'UTR|AGK_ENST00000535825.1_Missense_Mutation_p.Q52E|AGK_ENST00000473247.1_Missense_Mutation_p.Q24E	NM_018238.3	NP_060708.1	Q53H12	AGK_HUMAN	acylglycerol kinase	52					ceramide biosynthetic process (GO:0046513)|glycerolipid metabolic process (GO:0046486)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acylglycerol kinase activity (GO:0047620)|ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(3)	17	Melanoma(164;0.0171)					GTTTGGCAATCAACTCATTCC	0.358																																						dbGAP											0													178.0	163.0	168.0					7																	141296374		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022777	CCDS5865.1	7q34	2010-05-04	2007-01-11	2007-01-11	ENSG00000006530	ENSG00000006530	2.7.1.94		21869	protein-coding gene	gene with protein product		610345	"""multiple substrate lipid kinase"""	MULK		15252046, 15939762, 17135245	Standard	NM_018238		Approved	FLJ10842	uc003vwi.2	Q53H12	OTTHUMG00000157499	ENST00000355413.4:c.154C>G	7.37:g.141296374C>G	ENSP00000347581:p.Gln52Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q75KN1|Q96GC3|Q9NP48	Missense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.Q52E	ENST00000355413.4	37	c.154	CCDS5865.1	7	.	.	.	.	.	.	.	.	.	.	C	11.84	1.759455	0.31137	.	.	ENSG00000006530	ENST00000355413;ENST00000473247;ENST00000535825	T;T;T	0.42513	1.27;1.96;0.97	6.17	6.17	0.99709	.	0.097037	0.64402	D	0.000001	T	0.29749	0.0743	N	0.24115	0.695	0.46927	D	0.999257	B	0.06786	0.001	B	0.08055	0.003	T	0.18587	-1.0332	10	0.02654	T	1	.	19.6509	0.95805	0.0:1.0:0.0:0.0	.	52	Q53H12	AGK_HUMAN	E	52;24;52	ENSP00000347581:Q52E;ENSP00000420776:Q24E;ENSP00000444349:Q52E	ENSP00000347581:Q52E	Q	+	1	0	AGK	140942843	1.000000	0.71417	0.961000	0.40146	0.992000	0.81027	4.053000	0.57427	2.941000	0.99782	0.655000	0.94253	CAA	AGK	-	NULL	ENSG00000006530		0.358	AGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGK	HGNC	protein_coding	OTTHUMT00000348969.1	608	0.33	2	C	NM_018238		141296374	141296374	+1	no_errors	ENST00000355413	ensembl	human	known	69_37n	missense	324	16.28	63	SNP	1.000	G
ATG4A	115201	genome.wustl.edu	37	X	107396915	107396915	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chrX:107396915delG	ENST00000372232.3	+	13	1329	c.1170delG	c.(1168-1170)gagfs	p.E391fs	COL4A6_ENST00000418180.1_Intron|ATG4A_ENST00000345734.3_Frame_Shift_Del_p.E329fs|ATG4A_ENST00000489247.1_3'UTR|ATG4A_ENST00000372254.3_Frame_Shift_Del_p.E367fs|ATG4A_ENST00000545696.1_Frame_Shift_Del_p.E252fs	NM_052936.3	NP_443168.2	Q8WYN0	ATG4A_HUMAN	autophagy related 4A, cysteine peptidase	391					autophagy (GO:0006914)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)			endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)	11						TTGATCTGGAGGAAGATTTTG	0.398																																						dbGAP											0													166.0	157.0	160.0					X																	107396915		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AJ320508	CCDS14538.1, CCDS14539.1	Xq22.1-q22.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000101844	ENSG00000101844			16489	protein-coding gene	gene with protein product		300663	"""AUT-like 2, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog A (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog A (S. cerevisiae)"""	AUTL2, APG4A		12446702, 12473658	Standard	NM_052936		Approved		uc004enr.3	Q8WYN0	OTTHUMG00000022176	ENST00000372232.3:c.1170delG	X.37:g.107396915delG	ENSP00000361306:p.Glu391fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCH2|B2RAZ7|D3DUY0|O95534|Q5JYY9|Q5JYZ0|Q86VE5|Q96KQ0|Q96KQ1	Frame_Shift_Del	DEL	pfam_Peptidase_C54	p.E391fs	ENST00000372232.3	37	c.1170	CCDS14538.1	X																																																																																			ATG4A	-	NULL	ENSG00000101844		0.398	ATG4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG4A	HGNC	protein_coding	OTTHUMT00000057860.1	764	0.26	2	G	NM_052936		107396915	107396915	+1	no_errors	ENST00000372232	ensembl	human	known	69_37n	frame_shift_del	336	24.44	109	DEL	1.000	-
ATG4A	115201	genome.wustl.edu	37	X	107396915	107396915	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chrX:107396915delG	ENST00000372232.3	+	13	1329	c.1170delG	c.(1168-1170)gagfs	p.E391fs	COL4A6_ENST00000418180.1_Intron|ATG4A_ENST00000345734.3_Frame_Shift_Del_p.E329fs|ATG4A_ENST00000489247.1_3'UTR|ATG4A_ENST00000372254.3_Frame_Shift_Del_p.E367fs|ATG4A_ENST00000545696.1_Frame_Shift_Del_p.E252fs	NM_052936.3	NP_443168.2	Q8WYN0	ATG4A_HUMAN	autophagy related 4A, cysteine peptidase	391					autophagy (GO:0006914)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)			endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)	11						TTGATCTGGAGGAAGATTTTG	0.398																																						dbGAP											0													166.0	157.0	160.0					X																	107396915		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AJ320508	CCDS14538.1, CCDS14539.1	Xq22.1-q22.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000101844	ENSG00000101844			16489	protein-coding gene	gene with protein product		300663	"""AUT-like 2, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog A (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog A (S. cerevisiae)"""	AUTL2, APG4A		12446702, 12473658	Standard	NM_052936		Approved		uc004enr.3	Q8WYN0	OTTHUMG00000022176	ENST00000372232.3:c.1170delG	X.37:g.107396915delG	ENSP00000361306:p.Glu391fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCH2|B2RAZ7|D3DUY0|O95534|Q5JYY9|Q5JYZ0|Q86VE5|Q96KQ0|Q96KQ1	Frame_Shift_Del	DEL	pfam_Peptidase_C54	p.E391fs	ENST00000372232.3	37	c.1170	CCDS14538.1	X																																																																																			ATG4A	-	NULL	ENSG00000101844		0.398	ATG4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG4A	HGNC	protein_coding	OTTHUMT00000057860.1	662	0.00	0	G	NM_052936		107396915	107396915	+1	no_errors	ENST00000372232	ensembl	human	known	69_37n	frame_shift_del	336	24.44	109	DEL	1.000	-
BFAR	51283	genome.wustl.edu	37	16	14738316	14738316	+	Missense_Mutation	SNP	A	A	C	rs79546825	byFrequency	TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr16:14738316A>C	ENST00000261658.2	+	2	390	c.113A>C	c.(112-114)tAc>tCc	p.Y38S	BFAR_ENST00000563971.1_Missense_Mutation_p.Y38S|BFAR_ENST00000426842.2_5'UTR|RNU7-125P_ENST00000458760.1_RNA	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	38					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						CACTGCTGCTACGACATCCTG	0.478																																						dbGAP											0													156.0	148.0	151.0					16																	14738316		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.113A>C	16.37:g.14738316A>C	ENSP00000261658:p.Tyr38Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Z9|B4DUT0|D3DUG8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_Znf_C3HC4_RING-type,pfam_SAM_2,superfamily_SAM/pointed,smart_Znf_RING,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.Y38S	ENST00000261658.2	37	c.113	CCDS10554.1	16	.	.	.	.	.	.	.	.	.	.	A	19.94	3.919360	0.73098	.	.	ENSG00000103429	ENST00000261658	T	0.16597	2.33	5.91	5.91	0.95273	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	T	0.26774	0.0655	N	0.14661	0.345	0.80722	D	1	D;D;D	0.89917	0.969;0.999;1.0	P;D;D	0.87578	0.826;0.996;0.998	T	0.12993	-1.0526	10	0.62326	D	0.03	.	15.5066	0.75745	1.0:0.0:0.0:0.0	.	38;38;38	B2R9R6;Q9NZS9;B4DLM6	.;BFAR_HUMAN;.	S	38	ENSP00000261658:Y38S	ENSP00000261658:Y38S	Y	+	2	0	BFAR	14645817	1.000000	0.71417	0.970000	0.41538	0.985000	0.73830	7.273000	0.78527	2.256000	0.74724	0.533000	0.62120	TAC	BFAR	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000103429		0.478	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BFAR	HGNC	protein_coding	OTTHUMT00000252088.1	254	0.39	1	A	NM_016561		14738316	14738316	+1	no_errors	ENST00000261658	ensembl	human	known	69_37n	missense	184	23.01	55	SNP	0.998	C
BFAR	51283	genome.wustl.edu	37	16	14738316	14738316	+	Missense_Mutation	SNP	A	A	C	rs79546825	byFrequency	TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr16:14738316A>C	ENST00000261658.2	+	2	390	c.113A>C	c.(112-114)tAc>tCc	p.Y38S	BFAR_ENST00000563971.1_Missense_Mutation_p.Y38S|BFAR_ENST00000426842.2_5'UTR|RNU7-125P_ENST00000458760.1_RNA	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	38					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						CACTGCTGCTACGACATCCTG	0.478																																						dbGAP											0													156.0	148.0	151.0					16																	14738316		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.113A>C	16.37:g.14738316A>C	ENSP00000261658:p.Tyr38Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Z9|B4DUT0|D3DUG8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_Znf_C3HC4_RING-type,pfam_SAM_2,superfamily_SAM/pointed,smart_Znf_RING,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.Y38S	ENST00000261658.2	37	c.113	CCDS10554.1	16	.	.	.	.	.	.	.	.	.	.	A	19.94	3.919360	0.73098	.	.	ENSG00000103429	ENST00000261658	T	0.16597	2.33	5.91	5.91	0.95273	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	T	0.26774	0.0655	N	0.14661	0.345	0.80722	D	1	D;D;D	0.89917	0.969;0.999;1.0	P;D;D	0.87578	0.826;0.996;0.998	T	0.12993	-1.0526	10	0.62326	D	0.03	.	15.5066	0.75745	1.0:0.0:0.0:0.0	.	38;38;38	B2R9R6;Q9NZS9;B4DLM6	.;BFAR_HUMAN;.	S	38	ENSP00000261658:Y38S	ENSP00000261658:Y38S	Y	+	2	0	BFAR	14645817	1.000000	0.71417	0.970000	0.41538	0.985000	0.73830	7.273000	0.78527	2.256000	0.74724	0.533000	0.62120	TAC	BFAR	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000103429		0.478	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BFAR	HGNC	protein_coding	OTTHUMT00000252088.1	283	0.35	1	A	NM_016561		14738316	14738316	+1	no_errors	ENST00000261658	ensembl	human	known	69_37n	missense	184	23.01	55	SNP	0.998	C
BRD8	10902	genome.wustl.edu	37	5	137480865	137480865	+	Splice_Site	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr5:137480865C>T	ENST00000254900.5	-	25	3809		c.e25+1			NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8						cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TTTTCACTGACCTTTTCACCA	0.403																																						dbGAP											0													225.0	205.0	212.0					5																	137480865		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.3437+1G>A	5.37:g.137480865C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Splice_Site	SNP	-	e25+1	ENST00000254900.5	37	c.3437+1	CCDS4198.1	5	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018985	0.54576	.	.	ENSG00000112983	ENST00000254900;ENST00000427976	.	.	.	4.96	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0355	0.53423	0.0:0.915:0.0:0.085	.	.	.	.	.	-1	.	.	.	-	.	.	BRD8	137508764	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	6.593000	0.74100	1.086000	0.41228	0.462000	0.41574	.	BRD8	-	-	ENSG00000112983		0.403	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD8	HGNC	protein_coding	OTTHUMT00000251282.3	621	0.00	0	C	NM_006696	Intron	137480865	137480865	-1	no_errors	ENST00000254900	ensembl	human	known	69_37n	splice_site	286	31.74	133	SNP	1.000	T
BRD8	10902	genome.wustl.edu	37	5	137480865	137480865	+	Splice_Site	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr5:137480865C>T	ENST00000254900.5	-	25	3809		c.e25+1			NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8						cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TTTTCACTGACCTTTTCACCA	0.403																																						dbGAP											0													225.0	205.0	212.0					5																	137480865		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.3437+1G>A	5.37:g.137480865C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Splice_Site	SNP	-	e25+1	ENST00000254900.5	37	c.3437+1	CCDS4198.1	5	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018985	0.54576	.	.	ENSG00000112983	ENST00000254900;ENST00000427976	.	.	.	4.96	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0355	0.53423	0.0:0.915:0.0:0.085	.	.	.	.	.	-1	.	.	.	-	.	.	BRD8	137508764	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	6.593000	0.74100	1.086000	0.41228	0.462000	0.41574	.	BRD8	-	-	ENSG00000112983		0.403	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD8	HGNC	protein_coding	OTTHUMT00000251282.3	701	0.42	3	C	NM_006696	Intron	137480865	137480865	-1	no_errors	ENST00000254900	ensembl	human	known	69_37n	splice_site	286	31.74	133	SNP	1.000	T
C11orf84	144097	genome.wustl.edu	37	11	63585290	63585290	+	Silent	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr11:63585290G>A	ENST00000294244.4	+	2	440	c.141G>A	c.(139-141)gaG>gaA	p.E47E		NM_138471.1	NP_612480.1	Q9BUA3	CK084_HUMAN	chromosome 11 open reading frame 84	47										endometrium(3)|kidney(1)|lung(3)|skin(1)	8						CCCAACAGGAGAAGACCCCAC	0.592																																						dbGAP											0													35.0	30.0	32.0					11																	63585290		2197	4293	6490	-	-	-	SO:0001819	synonymous_variant	0			BC007540	CCDS31594.1	11q13.1	2014-02-10			ENSG00000168005	ENSG00000168005			25115	protein-coding gene	gene with protein product						12477932	Standard	NM_138471		Approved		uc001nxt.3	Q9BUA3	OTTHUMG00000167746	ENST00000294244.4:c.141G>A	11.37:g.63585290G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68CV7|Q6PHS2|Q96IH0	Silent	SNP	NULL	p.E47	ENST00000294244.4	37	c.141	CCDS31594.1	11																																																																																			C11orf84	-	NULL	ENSG00000168005		0.592	C11orf84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf84	HGNC	protein_coding	OTTHUMT00000396084.1	96	0.00	0	G	NM_138471		63585290	63585290	+1	no_errors	ENST00000294244	ensembl	human	known	69_37n	silent	205	22.26	59	SNP	0.953	A
C11orf84	144097	genome.wustl.edu	37	11	63585290	63585290	+	Silent	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr11:63585290G>A	ENST00000294244.4	+	2	440	c.141G>A	c.(139-141)gaG>gaA	p.E47E		NM_138471.1	NP_612480.1	Q9BUA3	CK084_HUMAN	chromosome 11 open reading frame 84	47										endometrium(3)|kidney(1)|lung(3)|skin(1)	8						CCCAACAGGAGAAGACCCCAC	0.592																																						dbGAP											0													35.0	30.0	32.0					11																	63585290		2197	4293	6490	-	-	-	SO:0001819	synonymous_variant	0			BC007540	CCDS31594.1	11q13.1	2014-02-10			ENSG00000168005	ENSG00000168005			25115	protein-coding gene	gene with protein product						12477932	Standard	NM_138471		Approved		uc001nxt.3	Q9BUA3	OTTHUMG00000167746	ENST00000294244.4:c.141G>A	11.37:g.63585290G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68CV7|Q6PHS2|Q96IH0	Silent	SNP	NULL	p.E47	ENST00000294244.4	37	c.141	CCDS31594.1	11																																																																																			C11orf84	-	NULL	ENSG00000168005		0.592	C11orf84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf84	HGNC	protein_coding	OTTHUMT00000396084.1	78	0.00	0	G	NM_138471		63585290	63585290	+1	no_errors	ENST00000294244	ensembl	human	known	69_37n	silent	205	22.26	59	SNP	0.953	A
CCDC33	80125	genome.wustl.edu	37	15	74623630	74623630	+	Silent	SNP	C	C	T	rs137878325	byFrequency	TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr15:74623630C>T	ENST00000398814.3	+	15	2195	c.1764C>T	c.(1762-1764)ccC>ccT	p.P588P	CCDC33_ENST00000268082.4_Silent_p.P181P|CCDC33_ENST00000321288.5_Silent_p.P791P|CCDC33_ENST00000558821.1_Silent_p.P181P	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	791										breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						AGGGAAAGCCCTACACGGGTG	0.627																																						dbGAP											0													34.0	43.0	40.0					15																	74623630		2042	4199	6241	-	-	-	SO:0001819	synonymous_variant	0			BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.1764C>T	15.37:g.74623630C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.P791	ENST00000398814.3	37	c.2373	CCDS42058.1	15																																																																																			CCDC33	-	NULL	ENSG00000140481		0.627	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC33	HGNC	protein_coding	OTTHUMT00000419491.2	56	0.00	0	C	NM_182791		74623630	74623630	+1	no_errors	ENST00000321288	ensembl	human	known	69_37n	silent	75	10.59	9	SNP	0.005	T
CCDC33	80125	genome.wustl.edu	37	15	74623630	74623630	+	Silent	SNP	C	C	T	rs137878325	byFrequency	TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr15:74623630C>T	ENST00000398814.3	+	15	2195	c.1764C>T	c.(1762-1764)ccC>ccT	p.P588P	CCDC33_ENST00000268082.4_Silent_p.P181P|CCDC33_ENST00000321288.5_Silent_p.P791P|CCDC33_ENST00000558821.1_Silent_p.P181P	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	791										breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						AGGGAAAGCCCTACACGGGTG	0.627																																						dbGAP											0													34.0	43.0	40.0					15																	74623630		2042	4199	6241	-	-	-	SO:0001819	synonymous_variant	0			BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.1764C>T	15.37:g.74623630C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.P791	ENST00000398814.3	37	c.2373	CCDS42058.1	15																																																																																			CCDC33	-	NULL	ENSG00000140481		0.627	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC33	HGNC	protein_coding	OTTHUMT00000419491.2	55	0.00	0	C	NM_182791		74623630	74623630	+1	no_errors	ENST00000321288	ensembl	human	known	69_37n	silent	75	10.59	9	SNP	0.005	T
CCDC66	285331	genome.wustl.edu	37	3	56653393	56653393	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr3:56653393G>A	ENST00000394672.3	+	16	2543	c.2473G>A	c.(2473-2475)Gag>Aag	p.E825K	CCDC66_ENST00000436465.2_Missense_Mutation_p.E825K|CCDC66_ENST00000326595.7_Missense_Mutation_p.E791K	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	825					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		CTATGAGAGAGAGAATTTGAT	0.343																																						dbGAP											0													83.0	92.0	89.0					3																	56653393		2203	4299	6502	-	-	-	SO:0001583	missense	0			AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.2473G>A	3.37:g.56653393G>A	ENSP00000378167:p.Glu825Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWL8|Q4VC34|Q8N949	Missense_Mutation	SNP	NULL	p.E825K	ENST00000394672.3	37	c.2473	CCDS46852.1	3	.	.	.	.	.	.	.	.	.	.	G	17.13	3.309936	0.60414	.	.	ENSG00000180376	ENST00000394672;ENST00000326595;ENST00000436465	T;T;T	0.23950	1.88;1.88;1.88	4.9	4.01	0.46588	.	0.301500	0.31949	N	0.006805	T	0.30885	0.0779	L	0.41027	1.25	0.80722	D	1	P	0.51351	0.944	P	0.50825	0.651	T	0.02713	-1.1120	10	0.27785	T	0.31	-4.3925	15.8948	0.79326	0.0:0.1364:0.8636:0.0	.	825	A2RUB6	CCD66_HUMAN	K	825;791;825	ENSP00000378167:E825K;ENSP00000326050:E791K;ENSP00000404320:E825K	ENSP00000326050:E791K	E	+	1	0	CCDC66	56628433	1.000000	0.71417	0.148000	0.22405	0.027000	0.11550	3.409000	0.52657	1.356000	0.45884	-0.274000	0.10170	GAG	CCDC66	-	NULL	ENSG00000180376		0.343	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC66	HGNC	protein_coding	OTTHUMT00000341473.1	274	0.72	2	G	NM_001012506		56653393	56653393	+1	no_errors	ENST00000394672	ensembl	human	known	69_37n	missense	126	11.27	16	SNP	0.970	A
CCDC66	285331	genome.wustl.edu	37	3	56653393	56653393	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr3:56653393G>A	ENST00000394672.3	+	16	2543	c.2473G>A	c.(2473-2475)Gag>Aag	p.E825K	CCDC66_ENST00000436465.2_Missense_Mutation_p.E825K|CCDC66_ENST00000326595.7_Missense_Mutation_p.E791K	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	825					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		CTATGAGAGAGAGAATTTGAT	0.343																																						dbGAP											0													83.0	92.0	89.0					3																	56653393		2203	4299	6502	-	-	-	SO:0001583	missense	0			AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.2473G>A	3.37:g.56653393G>A	ENSP00000378167:p.Glu825Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWL8|Q4VC34|Q8N949	Missense_Mutation	SNP	NULL	p.E825K	ENST00000394672.3	37	c.2473	CCDS46852.1	3	.	.	.	.	.	.	.	.	.	.	G	17.13	3.309936	0.60414	.	.	ENSG00000180376	ENST00000394672;ENST00000326595;ENST00000436465	T;T;T	0.23950	1.88;1.88;1.88	4.9	4.01	0.46588	.	0.301500	0.31949	N	0.006805	T	0.30885	0.0779	L	0.41027	1.25	0.80722	D	1	P	0.51351	0.944	P	0.50825	0.651	T	0.02713	-1.1120	10	0.27785	T	0.31	-4.3925	15.8948	0.79326	0.0:0.1364:0.8636:0.0	.	825	A2RUB6	CCD66_HUMAN	K	825;791;825	ENSP00000378167:E825K;ENSP00000326050:E791K;ENSP00000404320:E825K	ENSP00000326050:E791K	E	+	1	0	CCDC66	56628433	1.000000	0.71417	0.148000	0.22405	0.027000	0.11550	3.409000	0.52657	1.356000	0.45884	-0.274000	0.10170	GAG	CCDC66	-	NULL	ENSG00000180376		0.343	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC66	HGNC	protein_coding	OTTHUMT00000341473.1	319	0.62	2	G	NM_001012506		56653393	56653393	+1	no_errors	ENST00000394672	ensembl	human	known	69_37n	missense	126	11.27	16	SNP	0.970	A
CDC25C	995	genome.wustl.edu	37	5	137666884	137666884	+	5'UTR	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr5:137666884C>T	ENST00000323760.6	-	0	264				CDC25C_ENST00000415130.2_5'UTR|CDC25C_ENST00000357274.3_5'UTR|CDC25C_ENST00000348983.3_5'UTR|CDC25C_ENST00000356505.3_5'UTR|CDC25C_ENST00000514555.1_5'Flank|CDC25C_ENST00000513970.1_5'UTR	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C						cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)			endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			TTCGAATTCTCACCAGGAGAA	0.453																																						dbGAP											0													48.0	48.0	48.0					5																	137666884		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.-15G>A	5.37:g.137666884C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Missense_Mutation	SNP	pfam_MPI_Phosphatase	p.E13K	ENST00000323760.6	37	c.37	CCDS4202.1	5	.	.	.	.	.	.	.	.	.	.	C	16.73	3.204796	0.58234	.	.	ENSG00000158402	ENST00000534892;ENST00000510119	T	0.24151	1.87	3.92	0.96	0.19631	.	.	.	.	.	T	0.15089	0.0364	.	.	.	0.58432	D	0.999998	B	0.11235	0.004	B	0.12156	0.007	T	0.08848	-1.0702	8	0.27082	T	0.32	.	5.5855	0.17272	0.0:0.6199:0.0:0.3801	.	13	G3V1P6	.	K	13	ENSP00000427105:E13K	ENSP00000427105:E13K	E	-	1	0	CDC25C	137694783	0.002000	0.14202	0.600000	0.28864	0.386000	0.30323	-0.118000	0.10692	0.349000	0.23975	-0.302000	0.09304	GAG	CDC25C	-	NULL	ENSG00000158402		0.453	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25C	HGNC	protein_coding	OTTHUMT00000251280.1	113	0.00	0	C			137666884	137666884	-1	no_stop_codon	ENST00000510119	ensembl	human	putative	69_37n	missense	101	14.41	17	SNP	0.734	T
CDC25C	995	genome.wustl.edu	37	5	137666884	137666884	+	5'UTR	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr5:137666884C>T	ENST00000323760.6	-	0	264				CDC25C_ENST00000415130.2_5'UTR|CDC25C_ENST00000357274.3_5'UTR|CDC25C_ENST00000348983.3_5'UTR|CDC25C_ENST00000356505.3_5'UTR|CDC25C_ENST00000514555.1_5'Flank|CDC25C_ENST00000513970.1_5'UTR	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C						cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)			endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			TTCGAATTCTCACCAGGAGAA	0.453																																						dbGAP											0													48.0	48.0	48.0					5																	137666884		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.-15G>A	5.37:g.137666884C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Missense_Mutation	SNP	pfam_MPI_Phosphatase	p.E13K	ENST00000323760.6	37	c.37	CCDS4202.1	5	.	.	.	.	.	.	.	.	.	.	C	16.73	3.204796	0.58234	.	.	ENSG00000158402	ENST00000534892;ENST00000510119	T	0.24151	1.87	3.92	0.96	0.19631	.	.	.	.	.	T	0.15089	0.0364	.	.	.	0.58432	D	0.999998	B	0.11235	0.004	B	0.12156	0.007	T	0.08848	-1.0702	8	0.27082	T	0.32	.	5.5855	0.17272	0.0:0.6199:0.0:0.3801	.	13	G3V1P6	.	K	13	ENSP00000427105:E13K	ENSP00000427105:E13K	E	-	1	0	CDC25C	137694783	0.002000	0.14202	0.600000	0.28864	0.386000	0.30323	-0.118000	0.10692	0.349000	0.23975	-0.302000	0.09304	GAG	CDC25C	-	NULL	ENSG00000158402		0.453	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25C	HGNC	protein_coding	OTTHUMT00000251280.1	143	0.69	1	C			137666884	137666884	-1	no_stop_codon	ENST00000510119	ensembl	human	putative	69_37n	missense	101	14.41	17	SNP	0.734	T
CENPE	1062	genome.wustl.edu	37	4	104084638	104084638	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr4:104084638C>G	ENST00000265148.3	-	17	1809	c.1720G>C	c.(1720-1722)Gag>Cag	p.E574Q	CENPE_ENST00000380026.3_Intron	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	574					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		ATGCTCACCTCAAGATCTTGA	0.313																																						dbGAP											0													73.0	66.0	69.0					4																	104084638		2202	4296	6498	-	-	-	SO:0001583	missense	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.1720G>C	4.37:g.104084638C>G	ENSP00000265148:p.Glu574Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.E574Q	ENST00000265148.3	37	c.1720	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	C	16.83	3.232552	0.58777	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000503705	T;T	0.55760	0.5;0.5	5.34	3.45	0.39498	.	.	.	.	.	T	0.48750	0.1517	L	0.34521	1.04	0.31918	N	0.613815	P	0.48503	0.911	P	0.49387	0.609	T	0.55237	-0.8172	9	0.37606	T	0.19	.	11.3479	0.49571	0.246:0.6344:0.1197:0.0	.	574	Q02224	CENPE_HUMAN	Q	574	ENSP00000265148:E574Q;ENSP00000423981:E574Q	ENSP00000265148:E574Q	E	-	1	0	CENPE	104304087	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.076000	0.50081	1.580000	0.49851	0.650000	0.86243	GAG	CENPE	-	NULL	ENSG00000138778		0.313	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		248	0.00	0	C			104084638	104084638	-1	no_errors	ENST00000265148	ensembl	human	known	69_37n	missense	96	27.27	36	SNP	1.000	G
CENPE	1062	genome.wustl.edu	37	4	104084638	104084638	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr4:104084638C>G	ENST00000265148.3	-	17	1809	c.1720G>C	c.(1720-1722)Gag>Cag	p.E574Q	CENPE_ENST00000380026.3_Intron	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	574					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		ATGCTCACCTCAAGATCTTGA	0.313																																						dbGAP											0													73.0	66.0	69.0					4																	104084638		2202	4296	6498	-	-	-	SO:0001583	missense	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.1720G>C	4.37:g.104084638C>G	ENSP00000265148:p.Glu574Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.E574Q	ENST00000265148.3	37	c.1720	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	C	16.83	3.232552	0.58777	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000503705	T;T	0.55760	0.5;0.5	5.34	3.45	0.39498	.	.	.	.	.	T	0.48750	0.1517	L	0.34521	1.04	0.31918	N	0.613815	P	0.48503	0.911	P	0.49387	0.609	T	0.55237	-0.8172	9	0.37606	T	0.19	.	11.3479	0.49571	0.246:0.6344:0.1197:0.0	.	574	Q02224	CENPE_HUMAN	Q	574	ENSP00000265148:E574Q;ENSP00000423981:E574Q	ENSP00000265148:E574Q	E	-	1	0	CENPE	104304087	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.076000	0.50081	1.580000	0.49851	0.650000	0.86243	GAG	CENPE	-	NULL	ENSG00000138778		0.313	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		271	0.00	0	C			104084638	104084638	-1	no_errors	ENST00000265148	ensembl	human	known	69_37n	missense	96	27.27	36	SNP	1.000	G
CIRH1A	84916	genome.wustl.edu	37	16	69202749	69202749	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr16:69202749A>C	ENST00000314423.7	+	17	2147	c.1970A>C	c.(1969-1971)gAt>gCt	p.D657A	CIRH1A_ENST00000352319.4_Missense_Mutation_p.D542A			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	657					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		GATCTTTTGGATGAAAGAACA	0.448																																					Melanoma(69;1156 1278 4951 8715 52012)	dbGAP											0													129.0	115.0	120.0					16																	69202749		2198	4300	6498	-	-	-	SO:0001583	missense	0			AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.1970A>C	16.37:g.69202749A>C	ENSP00000327179:p.Asp657Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.D657A	ENST00000314423.7	37	c.1970	CCDS10872.1	16	.	.	.	.	.	.	.	.	.	.	A	19.14	3.769739	0.69992	.	.	ENSG00000141076	ENST00000314423;ENST00000352319	T;T	0.38722	1.64;1.12	5.8	5.8	0.92144	.	0.200880	0.52532	D	0.000076	T	0.34716	0.0907	M	0.63843	1.955	0.80722	D	1	P	0.49185	0.92	B	0.42386	0.386	T	0.37174	-0.9717	10	0.06365	T	0.9	.	7.32	0.26521	0.8428:0.0:0.1571:0.0	.	657	Q969X6	CIR1A_HUMAN	A	657;542	ENSP00000327179:D657A;ENSP00000339164:D542A	ENSP00000327179:D657A	D	+	2	0	CIRH1A	67760250	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.064000	0.64338	2.209000	0.71365	0.460000	0.39030	GAT	CIRH1A	-	NULL	ENSG00000141076		0.448	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIRH1A	HGNC	protein_coding	OTTHUMT00000268950.2	259	0.00	0	A	NM_032830		69202749	69202749	+1	no_errors	ENST00000314423	ensembl	human	known	69_37n	missense	154	27.36	58	SNP	1.000	C
CIRH1A	84916	genome.wustl.edu	37	16	69202749	69202749	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr16:69202749A>C	ENST00000314423.7	+	17	2147	c.1970A>C	c.(1969-1971)gAt>gCt	p.D657A	CIRH1A_ENST00000352319.4_Missense_Mutation_p.D542A			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	657					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		GATCTTTTGGATGAAAGAACA	0.448																																					Melanoma(69;1156 1278 4951 8715 52012)	dbGAP											0													129.0	115.0	120.0					16																	69202749		2198	4300	6498	-	-	-	SO:0001583	missense	0			AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.1970A>C	16.37:g.69202749A>C	ENSP00000327179:p.Asp657Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.D657A	ENST00000314423.7	37	c.1970	CCDS10872.1	16	.	.	.	.	.	.	.	.	.	.	A	19.14	3.769739	0.69992	.	.	ENSG00000141076	ENST00000314423;ENST00000352319	T;T	0.38722	1.64;1.12	5.8	5.8	0.92144	.	0.200880	0.52532	D	0.000076	T	0.34716	0.0907	M	0.63843	1.955	0.80722	D	1	P	0.49185	0.92	B	0.42386	0.386	T	0.37174	-0.9717	10	0.06365	T	0.9	.	7.32	0.26521	0.8428:0.0:0.1571:0.0	.	657	Q969X6	CIR1A_HUMAN	A	657;542	ENSP00000327179:D657A;ENSP00000339164:D542A	ENSP00000327179:D657A	D	+	2	0	CIRH1A	67760250	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.064000	0.64338	2.209000	0.71365	0.460000	0.39030	GAT	CIRH1A	-	NULL	ENSG00000141076		0.448	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIRH1A	HGNC	protein_coding	OTTHUMT00000268950.2	325	0.61	2	A	NM_032830		69202749	69202749	+1	no_errors	ENST00000314423	ensembl	human	known	69_37n	missense	154	27.36	58	SNP	1.000	C
CMYA5	202333	genome.wustl.edu	37	5	79032493	79032493	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr5:79032493C>A	ENST00000446378.2	+	2	7936	c.7905C>A	c.(7903-7905)ttC>ttA	p.F2635L		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2635					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CCAAGACTTTCCTGCCGGTGG	0.433																																						dbGAP											0													48.0	50.0	50.0					5																	79032493		1817	4076	5893	-	-	-	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.7905C>A	5.37:g.79032493C>A	ENSP00000394770:p.Phe2635Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.F2635L	ENST00000446378.2	37	c.7905	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	C	0.024	-1.393085	0.01185	.	.	ENSG00000164309	ENST00000446378	T	0.32272	1.46	3.62	1.6	0.23607	.	.	.	.	.	T	0.17619	0.0423	N	0.24115	0.695	0.09310	N	1	B	0.12630	0.006	B	0.13407	0.009	T	0.24870	-1.0148	9	0.23891	T	0.37	.	6.0647	0.19856	0.2141:0.5775:0.2084:0.0	.	2635	Q8N3K9	CMYA5_HUMAN	L	2635	ENSP00000394770:F2635L	ENSP00000394770:F2635L	F	+	3	2	CMYA5	79068249	0.000000	0.05858	0.380000	0.26093	0.559000	0.35586	0.147000	0.16202	0.686000	0.31488	0.393000	0.25936	TTC	CMYA5	-	NULL	ENSG00000164309		0.433	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	103	0.00	0	C	NM_153610		79032493	79032493	+1	no_errors	ENST00000446378	ensembl	human	known	69_37n	missense	75	21.88	21	SNP	0.007	A
CMYA5	202333	genome.wustl.edu	37	5	79032493	79032493	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr5:79032493C>A	ENST00000446378.2	+	2	7936	c.7905C>A	c.(7903-7905)ttC>ttA	p.F2635L		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2635					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CCAAGACTTTCCTGCCGGTGG	0.433																																						dbGAP											0													48.0	50.0	50.0					5																	79032493		1817	4076	5893	-	-	-	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.7905C>A	5.37:g.79032493C>A	ENSP00000394770:p.Phe2635Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.F2635L	ENST00000446378.2	37	c.7905	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	C	0.024	-1.393085	0.01185	.	.	ENSG00000164309	ENST00000446378	T	0.32272	1.46	3.62	1.6	0.23607	.	.	.	.	.	T	0.17619	0.0423	N	0.24115	0.695	0.09310	N	1	B	0.12630	0.006	B	0.13407	0.009	T	0.24870	-1.0148	9	0.23891	T	0.37	.	6.0647	0.19856	0.2141:0.5775:0.2084:0.0	.	2635	Q8N3K9	CMYA5_HUMAN	L	2635	ENSP00000394770:F2635L	ENSP00000394770:F2635L	F	+	3	2	CMYA5	79068249	0.000000	0.05858	0.380000	0.26093	0.559000	0.35586	0.147000	0.16202	0.686000	0.31488	0.393000	0.25936	TTC	CMYA5	-	NULL	ENSG00000164309		0.433	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	142	0.70	1	C	NM_153610		79032493	79032493	+1	no_errors	ENST00000446378	ensembl	human	known	69_37n	missense	75	21.88	21	SNP	0.007	A
COX17	10063	genome.wustl.edu	37	3	119396062	119396062	+	Silent	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr3:119396062C>T	ENST00000261070.2	-	1	188	c.96G>A	c.(94-96)gcG>gcA	p.A32A	COX17_ENST00000497116.1_Silent_p.A32A|COX17_ENST00000484810.1_Silent_p.A32A	NM_005694.1	NP_005685.1	Q14061	COX17_HUMAN	COX17 cytochrome c oxidase copper chaperone	32					brain development (GO:0007420)|copper ion transport (GO:0006825)|generation of precursor metabolites and energy (GO:0006091)|heart development (GO:0007507)	cytoplasm (GO:0005737)|mitochondrial intermembrane space (GO:0005758)	copper chaperone activity (GO:0016531)|copper ion binding (GO:0005507)			central_nervous_system(1)|kidney(1)|large_intestine(1)	3				GBM - Glioblastoma multiforme(114;0.227)		ACGCATCGCGCGCCTTCTTGG	0.697																																						dbGAP											0													13.0	14.0	13.0					3																	119396062		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			L77701	CCDS2993.1	3q13.33	2013-05-23	2013-05-23		ENSG00000138495	ENSG00000138495		"""Mitochondrial respiratory chain complex assembly factors"""	2264	protein-coding gene	gene with protein product		604813	"""COX17 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX17 homolog, cytochrome c oxidase assembly protein (yeast)"", ""COX17 homolog, cytochrome c oxidase assembly protein (S. cerevisiae)"", ""COX17 cytochrome c oxidase assembly homolog (S. cerevisiae)"", ""cytochrome c oxidase assembly homolog 17 (yeast)"""			9050918, 21816817	Standard	NM_005694		Approved		uc003ecz.1	Q14061	OTTHUMG00000159433	ENST00000261070.2:c.96G>A	3.37:g.119396062C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5D2|D3DN84|Q3MHD6	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_Cu-chaperone,superfamily_MTCP1	p.R27H	ENST00000261070.2	37	c.80	CCDS2993.1	3																																																																																			COX17	-	pfam_Cyt_c_oxidase_Cu-chaperone,superfamily_MTCP1	ENSG00000138495		0.697	COX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX17	HGNC	protein_coding	OTTHUMT00000355297.2	27	0.00	0	C	NM_005694		119396062	119396062	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000486606	ensembl	human	known	69_37n	missense	104	14.05	17	SNP	1.000	T
CRB1	23418	genome.wustl.edu	37	1	197397057	197397057	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr1:197397057C>T	ENST00000367400.3	+	7	2737	c.2602C>T	c.(2602-2604)Cca>Tca	p.P868S	CRB1_ENST00000544212.1_Missense_Mutation_p.P349S|CRB1_ENST00000367399.2_Missense_Mutation_p.P756S|CRB1_ENST00000535699.1_Missense_Mutation_p.P799S|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000367397.1_Missense_Mutation_p.P249S	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	868	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						CTTTCCAAATCCAACAAACAA	0.403																																						dbGAP											0													89.0	83.0	85.0					1																	197397057		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2602C>T	1.37:g.197397057C>T	ENSP00000356370:p.Pro868Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.P868S	ENST00000367400.3	37	c.2602	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.325275	0.00229	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T	0.78707	-1.2;-0.91;-0.91;-0.91;-0.91	4.98	-0.186	0.13272	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	T	0.39332	0.1074	N	0.00885	-1.115	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.43988	-0.9357	9	0.05436	T	0.98	.	5.7976	0.18396	0.1174:0.2803:0.0:0.6023	.	799;756;517;868	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	S	799;868;756;349;249;517	ENSP00000438786:P799S;ENSP00000356370:P868S;ENSP00000356369:P756S;ENSP00000444556:P349S;ENSP00000356367:P249S	ENSP00000356367:P249S	P	+	1	0	CRB1	195663680	0.371000	0.25056	0.944000	0.38274	0.041000	0.13682	0.414000	0.21164	0.330000	0.23485	-0.351000	0.07748	CCA	CRB1	-	superfamily_ConA-like_lec_gl,pfscan_Laminin_G	ENSG00000134376		0.403	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	168	0.00	0	C	NM_201253		197397057	197397057	+1	no_errors	ENST00000367400	ensembl	human	known	69_37n	missense	108	36.84	63	SNP	0.013	T
CR1	1378	genome.wustl.edu	37	1	207753648	207753648	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr1:207753648C>T	ENST00000367049.4	+	30	5000	c.5000C>T	c.(4999-5001)tCa>tTa	p.S1667L	CR1_ENST00000367051.1_Missense_Mutation_p.S1217L|CR1_ENST00000367052.1_Missense_Mutation_p.S1217L|CR1_ENST00000367053.1_Missense_Mutation_p.S1217L|RP11-78B10.2_ENST00000597497.1_RNA|RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000400960.2_Missense_Mutation_p.S1217L	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1217	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GACAACTTTTCACCTGGGCAG	0.552																																						dbGAP											0													126.0	128.0	127.0					1																	207753648		1974	4166	6140	-	-	-	SO:0001583	missense	0			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.5000C>T	1.37:g.207753648C>T	ENSP00000356016:p.Ser1667Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.S1667L	ENST00000367049.4	37	c.5000	CCDS44308.1	1	.	.	.	.	.	.	.	.	.	.	C	0.525	-0.860607	0.02610	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049	T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18	4.38	1.43	0.22495	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.61489	0.2351	L	0.48174	1.505	0.09310	N	1	B;P;D	0.53312	0.014;0.851;0.959	B;B;P	0.54499	0.085;0.38;0.754	T	0.48990	-0.8985	9	0.37606	T	0.19	.	5.9241	0.19099	0.0:0.6637:0.0:0.3363	.	1217;1217;1667	Q5SR44;P17927;E9PDY4	.;CR1_HUMAN;.	L	1217;1217;1217;1217;767;1667	ENSP00000356019:S1217L;ENSP00000356018:S1217L;ENSP00000356020:S1217L;ENSP00000383744:S1217L;ENSP00000436139:S767L;ENSP00000356016:S1667L	ENSP00000356016:S1667L	S	+	2	0	CR1	205820271	0.000000	0.05858	0.017000	0.16124	0.040000	0.13550	-0.021000	0.12504	0.419000	0.25927	-0.136000	0.14681	TCA	CR1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000203710		0.552	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	HGNC	protein_coding	OTTHUMT00000382527.1	266	0.00	0	C	NM_000573		207753648	207753648	+1	no_errors	ENST00000367049	ensembl	human	known	69_37n	missense	325	33.94	167	SNP	0.003	T
CRYBG3	131544	genome.wustl.edu	37	3	97607255	97607255	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr3:97607255G>C	ENST00000182096.4	+	6	1580	c.1516G>C	c.(1516-1518)Gag>Cag	p.E506Q		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2454							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						TGGGCTCTTTGAGATTTCTAC	0.348																																						dbGAP											0													63.0	58.0	59.0					3																	97607255		1823	4073	5896	-	-	-	SO:0001583	missense	0					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.1516G>C	3.37:g.97607255G>C	ENSP00000182096:p.Glu506Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.E506Q	ENST00000182096.4	37	c.1516		3	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041583	0.75732	.	.	ENSG00000080200	ENST00000182096	T	0.76578	-1.03	5.54	5.54	0.83059	Beta/gamma crystallin (2);Gamma-crystallin-related (1);	0.171029	0.41294	D	0.000918	D	0.84192	0.5418	L	0.47716	1.5	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	T	0.83060	-0.0148	10	0.40728	T	0.16	.	17.2706	0.87101	0.0:0.0:1.0:0.0	.	506	Q68DQ2	CRBG3_HUMAN	Q	506	ENSP00000182096:E506Q	ENSP00000182096:E506Q	E	+	1	0	CRYBG3	99089945	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.501000	0.60393	2.611000	0.88343	0.655000	0.94253	GAG	CRYBG3	-	superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin	ENSG00000080200		0.348	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	HGNC	protein_coding	OTTHUMT00000353751.1	200	0.00	0	G	NM_153605		97607255	97607255	+1	no_errors	ENST00000182096	ensembl	human	known	69_37n	missense	61	15.28	11	SNP	1.000	C
CRYBG3	131544	genome.wustl.edu	37	3	97607255	97607255	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr3:97607255G>C	ENST00000182096.4	+	6	1580	c.1516G>C	c.(1516-1518)Gag>Cag	p.E506Q		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2454							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						TGGGCTCTTTGAGATTTCTAC	0.348																																						dbGAP											0													63.0	58.0	59.0					3																	97607255		1823	4073	5896	-	-	-	SO:0001583	missense	0					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.1516G>C	3.37:g.97607255G>C	ENSP00000182096:p.Glu506Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.E506Q	ENST00000182096.4	37	c.1516		3	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041583	0.75732	.	.	ENSG00000080200	ENST00000182096	T	0.76578	-1.03	5.54	5.54	0.83059	Beta/gamma crystallin (2);Gamma-crystallin-related (1);	0.171029	0.41294	D	0.000918	D	0.84192	0.5418	L	0.47716	1.5	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	T	0.83060	-0.0148	10	0.40728	T	0.16	.	17.2706	0.87101	0.0:0.0:1.0:0.0	.	506	Q68DQ2	CRBG3_HUMAN	Q	506	ENSP00000182096:E506Q	ENSP00000182096:E506Q	E	+	1	0	CRYBG3	99089945	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.501000	0.60393	2.611000	0.88343	0.655000	0.94253	GAG	CRYBG3	-	superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin	ENSG00000080200		0.348	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	HGNC	protein_coding	OTTHUMT00000353751.1	225	0.00	0	G	NM_153605		97607255	97607255	+1	no_errors	ENST00000182096	ensembl	human	known	69_37n	missense	61	15.28	11	SNP	1.000	C
DMD	1756	genome.wustl.edu	37	X	31525555	31525555	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chrX:31525555delT	ENST00000357033.4	-	56	8439	c.8233delA	c.(8233-8235)attfs	p.I2745fs	DMD_ENST00000541735.1_Frame_Shift_Del_p.I285fs|DMD_ENST00000445312.1_5'UTR|DMD_ENST00000378677.2_Frame_Shift_Del_p.I2741fs|DMD_ENST00000474231.1_Frame_Shift_Del_p.I285fs|DMD_ENST00000359836.1_Frame_Shift_Del_p.I285fs|DMD_ENST00000378707.3_Frame_Shift_Del_p.I285fs|DMD_ENST00000343523.2_Frame_Shift_Del_p.I285fs	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2745					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGAGCTTCAATTTCACCTTGG	0.413																																						dbGAP											0													106.0	89.0	94.0					X																	31525555		2202	4300	6502	-	-	-	SO:0001589	frameshift_variant	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8233delA	X.37:g.31525555delT	ENSP00000354923:p.Ile2745fs	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Frame_Shift_Del	DEL	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.I2745fs	ENST00000357033.4	37	c.8233	CCDS14233.1	X																																																																																			DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.413	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	794	0.13	1	T	NM_004006		31525555	31525555	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	frame_shift_del	533	10.22	61	DEL	1.000	-
DMD	1756	genome.wustl.edu	37	X	31525555	31525555	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chrX:31525555delT	ENST00000357033.4	-	56	8439	c.8233delA	c.(8233-8235)attfs	p.I2745fs	DMD_ENST00000541735.1_Frame_Shift_Del_p.I285fs|DMD_ENST00000445312.1_5'UTR|DMD_ENST00000378677.2_Frame_Shift_Del_p.I2741fs|DMD_ENST00000474231.1_Frame_Shift_Del_p.I285fs|DMD_ENST00000359836.1_Frame_Shift_Del_p.I285fs|DMD_ENST00000378707.3_Frame_Shift_Del_p.I285fs|DMD_ENST00000343523.2_Frame_Shift_Del_p.I285fs	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2745					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGAGCTTCAATTTCACCTTGG	0.413																																						dbGAP											0													106.0	89.0	94.0					X																	31525555		2202	4300	6502	-	-	-	SO:0001589	frameshift_variant	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8233delA	X.37:g.31525555delT	ENSP00000354923:p.Ile2745fs	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Frame_Shift_Del	DEL	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.I2745fs	ENST00000357033.4	37	c.8233	CCDS14233.1	X																																																																																			DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.413	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	638	0.00	0	T	NM_004006		31525555	31525555	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	frame_shift_del	533	10.22	61	DEL	1.000	-
DSP	1832	genome.wustl.edu	37	6	7583848	7583848	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr6:7583848G>C	ENST00000379802.3	+	24	6694	c.6353G>C	c.(6352-6354)aGa>aCa	p.R2118T	DSP_ENST00000418664.2_Missense_Mutation_p.R1519T	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2118	4.5 X 38 AA tandem repeats (Domain A).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TTGATTGATAGAGAAACCGGA	0.453																																						dbGAP											0													67.0	75.0	72.0					6																	7583848		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.6353G>C	6.37:g.7583848G>C	ENSP00000369129:p.Arg2118Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.R2118T	ENST00000379802.3	37	c.6353	CCDS4501.1	6	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293565	0.23564	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.69306	-0.39;-0.39	5.18	4.3	0.51218	.	0.095021	0.45126	D	0.000391	T	0.49643	0.1569	L	0.48642	1.525	0.21325	N	0.999723	D;B	0.54207	0.965;0.181	P;B	0.46758	0.526;0.051	T	0.41875	-0.9484	10	0.27785	T	0.31	.	13.473	0.61292	0.0757:0.0:0.9243:0.0	.	1566;2118	Q4LE79;P15924	.;DESP_HUMAN	T	2118;1519	ENSP00000369129:R2118T;ENSP00000396591:R1519T	ENSP00000369129:R2118T	R	+	2	0	DSP	7528847	0.983000	0.35010	0.983000	0.44433	0.996000	0.88848	4.753000	0.62183	2.595000	0.87683	0.655000	0.94253	AGA	DSP	-	smart_Plectin_repeat	ENSG00000096696		0.453	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	88	0.00	0	G	NM_004415		7583848	7583848	+1	no_errors	ENST00000379802	ensembl	human	known	69_37n	missense	52	10.34	6	SNP	0.996	C
DSP	1832	genome.wustl.edu	37	6	7583848	7583848	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr6:7583848G>C	ENST00000379802.3	+	24	6694	c.6353G>C	c.(6352-6354)aGa>aCa	p.R2118T	DSP_ENST00000418664.2_Missense_Mutation_p.R1519T	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2118	4.5 X 38 AA tandem repeats (Domain A).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TTGATTGATAGAGAAACCGGA	0.453																																						dbGAP											0													67.0	75.0	72.0					6																	7583848		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.6353G>C	6.37:g.7583848G>C	ENSP00000369129:p.Arg2118Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.R2118T	ENST00000379802.3	37	c.6353	CCDS4501.1	6	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293565	0.23564	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.69306	-0.39;-0.39	5.18	4.3	0.51218	.	0.095021	0.45126	D	0.000391	T	0.49643	0.1569	L	0.48642	1.525	0.21325	N	0.999723	D;B	0.54207	0.965;0.181	P;B	0.46758	0.526;0.051	T	0.41875	-0.9484	10	0.27785	T	0.31	.	13.473	0.61292	0.0757:0.0:0.9243:0.0	.	1566;2118	Q4LE79;P15924	.;DESP_HUMAN	T	2118;1519	ENSP00000369129:R2118T;ENSP00000396591:R1519T	ENSP00000369129:R2118T	R	+	2	0	DSP	7528847	0.983000	0.35010	0.983000	0.44433	0.996000	0.88848	4.753000	0.62183	2.595000	0.87683	0.655000	0.94253	AGA	DSP	-	smart_Plectin_repeat	ENSG00000096696		0.453	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	118	0.00	0	G	NM_004415		7583848	7583848	+1	no_errors	ENST00000379802	ensembl	human	known	69_37n	missense	52	10.34	6	SNP	0.996	C
AGO2	27161	genome.wustl.edu	37	8	141549423	141549423	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr8:141549423T>A	ENST00000220592.5	-	16	2277	c.2165A>T	c.(2164-2166)gAg>gTg	p.E722V	AGO2_ENST00000519980.1_Missense_Mutation_p.E722V	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	722	Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										ACTCACCCGCTCGTTCTTGTC	0.597																																						dbGAP											0													81.0	81.0	81.0					8																	141549423		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.2165A>T	8.37:g.141549423T>A	ENSP00000220592:p.Glu722Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.E722V	ENST00000220592.5	37	c.2165	CCDS6380.1	8	.	.	.	.	.	.	.	.	.	.	T	22.7	4.327069	0.81690	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.33216	1.42;1.42	5.09	5.09	0.68999	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.47210	0.1433	L	0.60455	1.87	0.80722	D	1	P;P	0.52316	0.752;0.952	P;P	0.57009	0.791;0.811	T	0.49560	-0.8927	10	0.87932	D	0	-39.7862	15.1618	0.72791	0.0:0.0:0.0:1.0	.	722;722	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	V	722	ENSP00000220592:E722V;ENSP00000430176:E722V	ENSP00000220592:E722V	E	-	2	0	EIF2C2	141618605	1.000000	0.71417	0.999000	0.59377	0.648000	0.38561	7.975000	0.88055	2.032000	0.59987	0.533000	0.62120	GAG	EIF2C2	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi	ENSG00000123908		0.597	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C2	HGNC	protein_coding	OTTHUMT00000377866.4	111	0.89	1	T			141549423	141549423	-1	no_errors	ENST00000220592	ensembl	human	known	69_37n	missense	186	12.26	26	SNP	1.000	A
AGO2	27161	genome.wustl.edu	37	8	141549423	141549423	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr8:141549423T>A	ENST00000220592.5	-	16	2277	c.2165A>T	c.(2164-2166)gAg>gTg	p.E722V	AGO2_ENST00000519980.1_Missense_Mutation_p.E722V	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	722	Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										ACTCACCCGCTCGTTCTTGTC	0.597																																						dbGAP											0													81.0	81.0	81.0					8																	141549423		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.2165A>T	8.37:g.141549423T>A	ENSP00000220592:p.Glu722Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.E722V	ENST00000220592.5	37	c.2165	CCDS6380.1	8	.	.	.	.	.	.	.	.	.	.	T	22.7	4.327069	0.81690	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.33216	1.42;1.42	5.09	5.09	0.68999	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.47210	0.1433	L	0.60455	1.87	0.80722	D	1	P;P	0.52316	0.752;0.952	P;P	0.57009	0.791;0.811	T	0.49560	-0.8927	10	0.87932	D	0	-39.7862	15.1618	0.72791	0.0:0.0:0.0:1.0	.	722;722	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	V	722	ENSP00000220592:E722V;ENSP00000430176:E722V	ENSP00000220592:E722V	E	-	2	0	EIF2C2	141618605	1.000000	0.71417	0.999000	0.59377	0.648000	0.38561	7.975000	0.88055	2.032000	0.59987	0.533000	0.62120	GAG	EIF2C2	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi	ENSG00000123908		0.597	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C2	HGNC	protein_coding	OTTHUMT00000377866.4	115	0.00	0	T			141549423	141549423	-1	no_errors	ENST00000220592	ensembl	human	known	69_37n	missense	186	12.26	26	SNP	1.000	A
EPOR	2057	genome.wustl.edu	37	19	11493879	11493879	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr19:11493879C>T	ENST00000222139.6	-	2	249	c.145G>A	c.(145-147)Gag>Aag	p.E49K	EPOR_ENST00000592375.2_Missense_Mutation_p.E49K	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	49					brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	CACAGAAGCTCTTCGGGCCCC	0.662																																						dbGAP											0													30.0	35.0	33.0					19																	11493879		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.145G>A	19.37:g.11493879C>T	ENSP00000222139:p.Glu49Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCG4|Q15443|Q2M205	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pirsf_Erythropoietin_rcpt,pfscan_Fibronectin_type3	p.E49K	ENST00000222139.6	37	c.145	CCDS12260.1	19	.	.	.	.	.	.	.	.	.	.	c	8.984	0.975959	0.18736	.	.	ENSG00000187266	ENST00000222139	T	0.67345	-0.26	4.93	0.975	0.19721	Fibronectin, type III (1);Growth hormone/erythropoietin receptor, ligand binding (1);Immunoglobulin-like fold (1);	0.488521	0.20021	N	0.100901	T	0.48223	0.1488	L	0.46157	1.445	0.09310	N	1	B	0.12013	0.005	B	0.13407	0.009	T	0.27571	-1.0070	10	0.06494	T	0.89	-4.3822	5.3077	0.15813	0.0:0.6076:0.1732:0.2192	.	49	P19235	EPOR_HUMAN	K	49	ENSP00000222139:E49K	ENSP00000222139:E49K	E	-	1	0	EPOR	11354879	0.054000	0.20591	0.006000	0.13384	0.112000	0.19704	0.880000	0.28159	0.449000	0.26747	-0.648000	0.03929	GAG	EPOR	-	pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,pirsf_Erythropoietin_rcpt	ENSG00000187266		0.662	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPOR	HGNC	protein_coding	OTTHUMT00000458791.1	54	0.00	0	C			11493879	11493879	-1	no_errors	ENST00000222139	ensembl	human	known	69_37n	missense	85	14.14	14	SNP	0.002	T
EPOR	2057	genome.wustl.edu	37	19	11493879	11493879	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr19:11493879C>T	ENST00000222139.6	-	2	249	c.145G>A	c.(145-147)Gag>Aag	p.E49K	EPOR_ENST00000592375.2_Missense_Mutation_p.E49K	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	49					brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	CACAGAAGCTCTTCGGGCCCC	0.662																																						dbGAP											0													30.0	35.0	33.0					19																	11493879		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.145G>A	19.37:g.11493879C>T	ENSP00000222139:p.Glu49Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCG4|Q15443|Q2M205	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pirsf_Erythropoietin_rcpt,pfscan_Fibronectin_type3	p.E49K	ENST00000222139.6	37	c.145	CCDS12260.1	19	.	.	.	.	.	.	.	.	.	.	c	8.984	0.975959	0.18736	.	.	ENSG00000187266	ENST00000222139	T	0.67345	-0.26	4.93	0.975	0.19721	Fibronectin, type III (1);Growth hormone/erythropoietin receptor, ligand binding (1);Immunoglobulin-like fold (1);	0.488521	0.20021	N	0.100901	T	0.48223	0.1488	L	0.46157	1.445	0.09310	N	1	B	0.12013	0.005	B	0.13407	0.009	T	0.27571	-1.0070	10	0.06494	T	0.89	-4.3822	5.3077	0.15813	0.0:0.6076:0.1732:0.2192	.	49	P19235	EPOR_HUMAN	K	49	ENSP00000222139:E49K	ENSP00000222139:E49K	E	-	1	0	EPOR	11354879	0.054000	0.20591	0.006000	0.13384	0.112000	0.19704	0.880000	0.28159	0.449000	0.26747	-0.648000	0.03929	GAG	EPOR	-	pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,pirsf_Erythropoietin_rcpt	ENSG00000187266		0.662	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPOR	HGNC	protein_coding	OTTHUMT00000458791.1	33	0.00	0	C			11493879	11493879	-1	no_errors	ENST00000222139	ensembl	human	known	69_37n	missense	85	14.14	14	SNP	0.002	T
FAM114A1	92689	genome.wustl.edu	37	4	38910268	38910268	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr4:38910268C>A	ENST00000358869.2	+	7	889	c.713C>A	c.(712-714)aCc>aAc	p.T238N	FAM114A1_ENST00000515037.1_Missense_Mutation_p.T31N	NM_138389.2	NP_612398.2	Q8IWE2	NXP20_HUMAN	family with sequence similarity 114, member A1	238						cytoplasm (GO:0005737)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	20						GGCAAGAAAACCATGAATGTC	0.443																																						dbGAP											0													108.0	99.0	102.0					4																	38910268		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3447.1	4p14	2006-09-21			ENSG00000197712	ENSG00000197712			25087	protein-coding gene	gene with protein product							Standard	NM_138389		Approved	Noxp20	uc003gtn.3	Q8IWE2	OTTHUMG00000128583	ENST00000358869.2:c.713C>A	4.37:g.38910268C>A	ENSP00000351740:p.Thr238Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9W6|Q6MZV4|Q9BVL6	Missense_Mutation	SNP	pfam_DUF719	p.T238N	ENST00000358869.2	37	c.713	CCDS3447.1	4	.	.	.	.	.	.	.	.	.	.	C	34	5.399497	0.96030	.	.	ENSG00000197712	ENST00000515037;ENST00000358869;ENST00000355404	T;T	0.60424	0.19;0.19	6.17	6.17	0.99709	.	0.087086	0.85682	D	0.000000	T	0.72061	0.3414	M	0.84948	2.725	0.80722	D	1	P	0.48998	0.918	P	0.47673	0.554	T	0.76195	-0.3048	10	0.87932	D	0	-15.9174	20.8794	0.99867	0.0:1.0:0.0:0.0	.	238	Q8IWE2	NXP20_HUMAN	N	31;238;31	ENSP00000424115:T31N;ENSP00000351740:T238N	ENSP00000347569:T31N	T	+	2	0	FAM114A1	38586663	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	ACC	FAM114A1	-	pfam_DUF719	ENSG00000197712		0.443	FAM114A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM114A1	HGNC	protein_coding	OTTHUMT00000250436.1	270	0.00	0	C	NM_138389		38910268	38910268	+1	no_errors	ENST00000358869	ensembl	human	known	69_37n	missense	171	22.07	49	SNP	1.000	A
FAM114A1	92689	genome.wustl.edu	37	4	38910268	38910268	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr4:38910268C>A	ENST00000358869.2	+	7	889	c.713C>A	c.(712-714)aCc>aAc	p.T238N	FAM114A1_ENST00000515037.1_Missense_Mutation_p.T31N	NM_138389.2	NP_612398.2	Q8IWE2	NXP20_HUMAN	family with sequence similarity 114, member A1	238						cytoplasm (GO:0005737)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	20						GGCAAGAAAACCATGAATGTC	0.443																																						dbGAP											0													108.0	99.0	102.0					4																	38910268		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3447.1	4p14	2006-09-21			ENSG00000197712	ENSG00000197712			25087	protein-coding gene	gene with protein product							Standard	NM_138389		Approved	Noxp20	uc003gtn.3	Q8IWE2	OTTHUMG00000128583	ENST00000358869.2:c.713C>A	4.37:g.38910268C>A	ENSP00000351740:p.Thr238Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9W6|Q6MZV4|Q9BVL6	Missense_Mutation	SNP	pfam_DUF719	p.T238N	ENST00000358869.2	37	c.713	CCDS3447.1	4	.	.	.	.	.	.	.	.	.	.	C	34	5.399497	0.96030	.	.	ENSG00000197712	ENST00000515037;ENST00000358869;ENST00000355404	T;T	0.60424	0.19;0.19	6.17	6.17	0.99709	.	0.087086	0.85682	D	0.000000	T	0.72061	0.3414	M	0.84948	2.725	0.80722	D	1	P	0.48998	0.918	P	0.47673	0.554	T	0.76195	-0.3048	10	0.87932	D	0	-15.9174	20.8794	0.99867	0.0:1.0:0.0:0.0	.	238	Q8IWE2	NXP20_HUMAN	N	31;238;31	ENSP00000424115:T31N;ENSP00000351740:T238N	ENSP00000347569:T31N	T	+	2	0	FAM114A1	38586663	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	ACC	FAM114A1	-	pfam_DUF719	ENSG00000197712		0.443	FAM114A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM114A1	HGNC	protein_coding	OTTHUMT00000250436.1	289	0.69	2	C	NM_138389		38910268	38910268	+1	no_errors	ENST00000358869	ensembl	human	known	69_37n	missense	171	22.07	49	SNP	1.000	A
FBXO10	26267	genome.wustl.edu	37	9	37537587	37537587	+	Silent	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr9:37537587G>A	ENST00000432825.2	-	3	987	c.939C>T	c.(937-939)atC>atT	p.I313I	FBXO10_ENST00000541829.1_Intron|RP11-613M10.8_ENST00000544475.1_5'UTR|FBXO10_ENST00000543968.1_5'Flank	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	313					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		GGCTGCCCTCGATAACAATGT	0.587																																						dbGAP											0													31.0	34.0	33.0					9																	37537587		1955	4130	6085	-	-	-	SO:0001819	synonymous_variant	0			AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.939C>T	9.37:g.37537587G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Silent	SNP	pfam_F-box_dom_cyclin-like,superfamily_Pectin_lyase_fold/virulence,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_PbH1,smart_Carb-bd_sugar_hydrolysis-dom,pfscan_F-box_dom_cyclin-like,tigrfam_Para_beta_helix_rpt-2	p.I313	ENST00000432825.2	37	c.939	CCDS47966.1	9																																																																																			FBXO10	-	NULL	ENSG00000147912		0.587	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO10	HGNC	protein_coding	OTTHUMT00000052472.3	111	0.00	0	G			37537587	37537587	-1	no_errors	ENST00000432825	ensembl	human	known	69_37n	silent	116	17.61	25	SNP	0.117	A
FBXO41	150726	genome.wustl.edu	37	2	73487592	73487592	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr2:73487592C>T	ENST00000521871.1	-	11	2789	c.2374G>A	c.(2374-2376)Gaa>Aaa	p.E792K	FBXO41_ENST00000295133.5_Missense_Mutation_p.E853K|FBXO41_ENST00000520530.2_Missense_Mutation_p.E792K			Q8TF61	FBX41_HUMAN	F-box protein 41	792										breast(2)|central_nervous_system(1)|endometrium(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)	13						TTCAGGCCTTCCCGGCAGACC	0.607																																						dbGAP											0													39.0	42.0	41.0					2																	73487592		2153	4266	6419	-	-	-	SO:0001583	missense	0			AB075820	CCDS46337.1, CCDS46337.2	2p13.2	2004-08-24				ENSG00000163013		"""F-boxes /  ""other"""""	29409	protein-coding gene	gene with protein product		609108				11853319	Standard	NM_001080410		Approved	KIAA1940, Fbx41	uc021vjh.1	Q8TF61		ENST00000521871.1:c.2374G>A	2.37:g.73487592C>T	ENSP00000428646:p.Glu792Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V0Z7|Q2M1V8	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like	p.E853K	ENST00000521871.1	37	c.2557	CCDS46337.2	2	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113818	0.77210	.	.	ENSG00000163013	ENST00000295133;ENST00000521871	T;T	0.52983	0.64;0.64	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.53367	0.1792	N	0.22421	0.69	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.49624	-0.8920	10	0.29301	T	0.29	.	16.3508	0.83204	0.0:1.0:0.0:0.0	.	792	Q8TF61	FBX41_HUMAN	K	853;792	ENSP00000295133:E853K;ENSP00000428646:E792K	ENSP00000295133:E853K	E	-	1	0	FBXO41	73341100	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.237000	0.78164	2.458000	0.83093	0.561000	0.74099	GAA	FBXO41	-	NULL	ENSG00000163013		0.607	FBXO41-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FBXO41	HGNC	protein_coding	OTTHUMT00000377381.1	87	0.00	0	C			73487592	73487592	-1	no_errors	ENST00000295133	ensembl	human	known	69_37n	missense	144	21.31	39	SNP	1.000	T
FBXO41	150726	genome.wustl.edu	37	2	73487592	73487592	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr2:73487592C>T	ENST00000521871.1	-	11	2789	c.2374G>A	c.(2374-2376)Gaa>Aaa	p.E792K	FBXO41_ENST00000295133.5_Missense_Mutation_p.E853K|FBXO41_ENST00000520530.2_Missense_Mutation_p.E792K			Q8TF61	FBX41_HUMAN	F-box protein 41	792										breast(2)|central_nervous_system(1)|endometrium(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)	13						TTCAGGCCTTCCCGGCAGACC	0.607																																						dbGAP											0													39.0	42.0	41.0					2																	73487592		2153	4266	6419	-	-	-	SO:0001583	missense	0			AB075820	CCDS46337.1, CCDS46337.2	2p13.2	2004-08-24				ENSG00000163013		"""F-boxes /  ""other"""""	29409	protein-coding gene	gene with protein product		609108				11853319	Standard	NM_001080410		Approved	KIAA1940, Fbx41	uc021vjh.1	Q8TF61		ENST00000521871.1:c.2374G>A	2.37:g.73487592C>T	ENSP00000428646:p.Glu792Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V0Z7|Q2M1V8	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like	p.E853K	ENST00000521871.1	37	c.2557	CCDS46337.2	2	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113818	0.77210	.	.	ENSG00000163013	ENST00000295133;ENST00000521871	T;T	0.52983	0.64;0.64	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.53367	0.1792	N	0.22421	0.69	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.49624	-0.8920	10	0.29301	T	0.29	.	16.3508	0.83204	0.0:1.0:0.0:0.0	.	792	Q8TF61	FBX41_HUMAN	K	853;792	ENSP00000295133:E853K;ENSP00000428646:E792K	ENSP00000295133:E853K	E	-	1	0	FBXO41	73341100	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.237000	0.78164	2.458000	0.83093	0.561000	0.74099	GAA	FBXO41	-	NULL	ENSG00000163013		0.607	FBXO41-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FBXO41	HGNC	protein_coding	OTTHUMT00000377381.1	96	0.00	0	C			73487592	73487592	-1	no_errors	ENST00000295133	ensembl	human	known	69_37n	missense	144	21.31	39	SNP	1.000	T
FBXW2	26190	genome.wustl.edu	37	9	123550286	123550286	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr9:123550286G>C	ENST00000608872.1	-	3	438	c.251C>G	c.(250-252)tCt>tGt	p.S84C	FBXW2_ENST00000340778.5_Missense_Mutation_p.S84C	NM_012164.3	NP_036296.2	Q9UKT8	FBXW2_HUMAN	F-box and WD repeat domain containing 2	84	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cellular protein modification process (GO:0006464)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)			ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	4						CCACTGTTTAGAGACGAGGCA	0.463																																						dbGAP											0													109.0	104.0	105.0					9																	123550286		1939	4152	6091	-	-	-	SO:0001583	missense	0			AF129531	CCDS43872.1	9q34	2013-01-09	2007-02-08		ENSG00000119402	ENSG00000119402		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13608	protein-coding gene	gene with protein product		609071	"""F-box and WD-40 domain protein 2"""			10531035, 10828603	Standard	NM_012164		Approved	FBW2, Md6, Fwd2	uc004bkm.1	Q9UKT8	OTTHUMG00000020576	ENST00000608872.1:c.251C>G	9.37:g.123550286G>C	ENSP00000476369:p.Ser84Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRL8|Q4VXH2|Q7Z4V6|Q8WV51|Q9HA09|Q9UKA3	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S84C	ENST00000608872.1	37	c.251	CCDS43872.1	9	.	.	.	.	.	.	.	.	.	.	G	9.610	1.130994	0.21041	.	.	ENSG00000119402	ENST00000373926;ENST00000340778;ENST00000444833	T;T	0.16457	2.34;2.34	5.95	5.95	0.96441	F-box domain, cyclin-like (3);F-box domain, Skp2-like (1);	0.049584	0.85682	D	0.000000	T	0.10423	0.0255	N	0.13299	0.325	0.52501	D	0.999958	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.06405	0.001;0.002;0.001	T	0.08166	-1.0735	10	0.02654	T	1	-7.5316	17.887	0.88858	0.0:0.0:1.0:0.0	.	84;84;84	Q9UKT8-2;B2RAW3;Q9UKT8	.;.;FBXW2_HUMAN	C	84	ENSP00000363036:S84C;ENSP00000341161:S84C	ENSP00000341161:S84C	S	-	2	0	FBXW2	122590107	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.594000	0.67557	2.824000	0.97209	0.655000	0.94253	TCT	FBXW2	-	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	ENSG00000119402		0.463	FBXW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW2	HGNC	protein_coding	OTTHUMT00000053834.2	306	0.00	0	G			123550286	123550286	-1	no_errors	ENST00000373926	ensembl	human	known	69_37n	missense	160	30.74	71	SNP	1.000	C
FBXW2	26190	genome.wustl.edu	37	9	123550286	123550286	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr9:123550286G>C	ENST00000608872.1	-	3	438	c.251C>G	c.(250-252)tCt>tGt	p.S84C	FBXW2_ENST00000340778.5_Missense_Mutation_p.S84C	NM_012164.3	NP_036296.2	Q9UKT8	FBXW2_HUMAN	F-box and WD repeat domain containing 2	84	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cellular protein modification process (GO:0006464)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)			ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	4						CCACTGTTTAGAGACGAGGCA	0.463																																						dbGAP											0													109.0	104.0	105.0					9																	123550286		1939	4152	6091	-	-	-	SO:0001583	missense	0			AF129531	CCDS43872.1	9q34	2013-01-09	2007-02-08		ENSG00000119402	ENSG00000119402		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13608	protein-coding gene	gene with protein product		609071	"""F-box and WD-40 domain protein 2"""			10531035, 10828603	Standard	NM_012164		Approved	FBW2, Md6, Fwd2	uc004bkm.1	Q9UKT8	OTTHUMG00000020576	ENST00000608872.1:c.251C>G	9.37:g.123550286G>C	ENSP00000476369:p.Ser84Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRL8|Q4VXH2|Q7Z4V6|Q8WV51|Q9HA09|Q9UKA3	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S84C	ENST00000608872.1	37	c.251	CCDS43872.1	9	.	.	.	.	.	.	.	.	.	.	G	9.610	1.130994	0.21041	.	.	ENSG00000119402	ENST00000373926;ENST00000340778;ENST00000444833	T;T	0.16457	2.34;2.34	5.95	5.95	0.96441	F-box domain, cyclin-like (3);F-box domain, Skp2-like (1);	0.049584	0.85682	D	0.000000	T	0.10423	0.0255	N	0.13299	0.325	0.52501	D	0.999958	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.06405	0.001;0.002;0.001	T	0.08166	-1.0735	10	0.02654	T	1	-7.5316	17.887	0.88858	0.0:0.0:1.0:0.0	.	84;84;84	Q9UKT8-2;B2RAW3;Q9UKT8	.;.;FBXW2_HUMAN	C	84	ENSP00000363036:S84C;ENSP00000341161:S84C	ENSP00000341161:S84C	S	-	2	0	FBXW2	122590107	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.594000	0.67557	2.824000	0.97209	0.655000	0.94253	TCT	FBXW2	-	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	ENSG00000119402		0.463	FBXW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW2	HGNC	protein_coding	OTTHUMT00000053834.2	269	0.73	2	G			123550286	123550286	-1	no_errors	ENST00000373926	ensembl	human	known	69_37n	missense	160	30.74	71	SNP	1.000	C
FLNC	2318	genome.wustl.edu	37	7	128491585	128491585	+	Silent	SNP	C	C	A	rs369449907		TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr7:128491585C>A	ENST00000325888.8	+	35	6006	c.5745C>A	c.(5743-5745)acC>acA	p.T1915T	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Silent_p.T1882T	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1915					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GCACCTGCACCGTGTCCTATC	0.597																																						dbGAP											0													93.0	110.0	104.0					7																	128491585		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5745C>A	7.37:g.128491585C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.T1915	ENST00000325888.8	37	c.5745	CCDS43644.1	7																																																																																			FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.597	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	77	0.00	0	C			128491585	128491585	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	silent	149	13.37	23	SNP	0.034	A
FLNC	2318	genome.wustl.edu	37	7	128491585	128491585	+	Silent	SNP	C	C	A	rs369449907		TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr7:128491585C>A	ENST00000325888.8	+	35	6006	c.5745C>A	c.(5743-5745)acC>acA	p.T1915T	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Silent_p.T1882T	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1915					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GCACCTGCACCGTGTCCTATC	0.597																																						dbGAP											0													93.0	110.0	104.0					7																	128491585		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5745C>A	7.37:g.128491585C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.T1915	ENST00000325888.8	37	c.5745	CCDS43644.1	7																																																																																			FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.597	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	77	0.00	0	C			128491585	128491585	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	silent	149	13.37	23	SNP	0.034	A
FN1	2335	genome.wustl.edu	37	2	216262561	216262561	+	Missense_Mutation	SNP	C	C	G	rs371672247		TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr2:216262561C>G	ENST00000359671.1	-	22	3624	c.3359G>C	c.(3358-3360)cGa>cCa	p.R1120P	FN1_ENST00000346544.3_Missense_Mutation_p.R1120P|FN1_ENST00000443816.1_Missense_Mutation_p.R1120P|FN1_ENST00000336916.4_Missense_Mutation_p.R1120P|FN1_ENST00000357009.2_Missense_Mutation_p.R1120P|FN1_ENST00000421182.1_Missense_Mutation_p.R1120P|FN1_ENST00000345488.5_Missense_Mutation_p.R1120P|FN1_ENST00000357867.4_Missense_Mutation_p.R1120P|FN1_ENST00000446046.1_Missense_Mutation_p.R1120P|FN1_ENST00000432072.2_Missense_Mutation_p.R1120P|FN1_ENST00000354785.4_Missense_Mutation_p.R1120P|FN1_ENST00000323926.6_Missense_Mutation_p.R1120P|FN1_ENST00000356005.4_Missense_Mutation_p.R1120P			P02751	FINC_HUMAN	fibronectin 1	1120	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.		R -> P (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.R1120P(1)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CTGGCTTGGTCGTACACCCAG	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	94.0	102.0					2																	216262561		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3359G>C	2.37:g.216262561C>G	ENSP00000352696:p.Arg1120Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.R1120P	ENST00000359671.1	37	c.3359		2	.	.	.	.	.	.	.	.	.	.	C	18.91	3.722643	0.68959	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27	5.36	5.36	0.76844	.	0.000000	0.56097	D	0.000034	T	0.73776	0.3630	L	0.53249	1.67	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;0.999;0.999;1.0;0.999;0.999;0.999	D;D;D;D;D;D;D;D;D;D	0.97110	0.998;0.991;0.994;0.998;0.999;0.991;1.0;0.998;0.998;0.998	T	0.75169	-0.3412	10	0.72032	D	0.01	.	19.4485	0.94857	0.0:1.0:0.0:0.0	.	1120;1120;1120;1120;1120;1120;1120;1120;1120;1120	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	P	1120	ENSP00000394423:R1120P;ENSP00000323534:R1120P;ENSP00000338200:R1120P;ENSP00000350534:R1120P;ENSP00000346839:R1120P;ENSP00000352696:R1120P;ENSP00000265312:R1120P;ENSP00000273049:R1120P;ENSP00000349509:R1120P;ENSP00000410422:R1120P;ENSP00000415018:R1120P;ENSP00000399538:R1120P;ENSP00000348285:R1120P	ENSP00000265313:R1120P	R	-	2	0	FN1	215970806	0.995000	0.38212	1.000000	0.80357	0.947000	0.59692	2.895000	0.48648	2.672000	0.90937	0.591000	0.81541	CGA	FN1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000115414		0.478	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding		201	0.00	0	C	NM_212476		216262561	216262561	-1	no_errors	ENST00000354785	ensembl	human	known	69_37n	missense	225	21.33	61	SNP	0.991	G
FN1	2335	genome.wustl.edu	37	2	216262561	216262561	+	Missense_Mutation	SNP	C	C	G	rs371672247		TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr2:216262561C>G	ENST00000359671.1	-	22	3624	c.3359G>C	c.(3358-3360)cGa>cCa	p.R1120P	FN1_ENST00000346544.3_Missense_Mutation_p.R1120P|FN1_ENST00000443816.1_Missense_Mutation_p.R1120P|FN1_ENST00000336916.4_Missense_Mutation_p.R1120P|FN1_ENST00000357009.2_Missense_Mutation_p.R1120P|FN1_ENST00000421182.1_Missense_Mutation_p.R1120P|FN1_ENST00000345488.5_Missense_Mutation_p.R1120P|FN1_ENST00000357867.4_Missense_Mutation_p.R1120P|FN1_ENST00000446046.1_Missense_Mutation_p.R1120P|FN1_ENST00000432072.2_Missense_Mutation_p.R1120P|FN1_ENST00000354785.4_Missense_Mutation_p.R1120P|FN1_ENST00000323926.6_Missense_Mutation_p.R1120P|FN1_ENST00000356005.4_Missense_Mutation_p.R1120P			P02751	FINC_HUMAN	fibronectin 1	1120	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.		R -> P (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.R1120P(1)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CTGGCTTGGTCGTACACCCAG	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	94.0	102.0					2																	216262561		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3359G>C	2.37:g.216262561C>G	ENSP00000352696:p.Arg1120Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.R1120P	ENST00000359671.1	37	c.3359		2	.	.	.	.	.	.	.	.	.	.	C	18.91	3.722643	0.68959	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27	5.36	5.36	0.76844	.	0.000000	0.56097	D	0.000034	T	0.73776	0.3630	L	0.53249	1.67	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;0.999;0.999;1.0;0.999;0.999;0.999	D;D;D;D;D;D;D;D;D;D	0.97110	0.998;0.991;0.994;0.998;0.999;0.991;1.0;0.998;0.998;0.998	T	0.75169	-0.3412	10	0.72032	D	0.01	.	19.4485	0.94857	0.0:1.0:0.0:0.0	.	1120;1120;1120;1120;1120;1120;1120;1120;1120;1120	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	P	1120	ENSP00000394423:R1120P;ENSP00000323534:R1120P;ENSP00000338200:R1120P;ENSP00000350534:R1120P;ENSP00000346839:R1120P;ENSP00000352696:R1120P;ENSP00000265312:R1120P;ENSP00000273049:R1120P;ENSP00000349509:R1120P;ENSP00000410422:R1120P;ENSP00000415018:R1120P;ENSP00000399538:R1120P;ENSP00000348285:R1120P	ENSP00000265313:R1120P	R	-	2	0	FN1	215970806	0.995000	0.38212	1.000000	0.80357	0.947000	0.59692	2.895000	0.48648	2.672000	0.90937	0.591000	0.81541	CGA	FN1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000115414		0.478	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding		202	0.00	0	C	NM_212476		216262561	216262561	-1	no_errors	ENST00000354785	ensembl	human	known	69_37n	missense	225	21.33	61	SNP	0.991	G
GPR125	166647	genome.wustl.edu	37	4	22390713	22390713	+	Silent	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr4:22390713G>C	ENST00000334304.5	-	18	2990	c.2721C>G	c.(2719-2721)ccC>ccG	p.P907P	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	907					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				ATACTCACTAGGGTGCGTTTG	0.398																																						dbGAP											0													194.0	206.0	202.0					4																	22390713		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.2721C>G	4.37:g.22390713G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_GPCR_2_extracellular_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like	p.P907	ENST00000334304.5	37	c.2721	CCDS33964.1	4																																																																																			GPR125	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000152990		0.398	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR125	HGNC	protein_coding	OTTHUMT00000362960.3	240	0.00	0	G			22390713	22390713	-1	no_errors	ENST00000334304	ensembl	human	known	69_37n	silent	179	12.25	25	SNP	0.911	C
GPR125	166647	genome.wustl.edu	37	4	22390713	22390713	+	Silent	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr4:22390713G>C	ENST00000334304.5	-	18	2990	c.2721C>G	c.(2719-2721)ccC>ccG	p.P907P	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	907					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				ATACTCACTAGGGTGCGTTTG	0.398																																						dbGAP											0													194.0	206.0	202.0					4																	22390713		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.2721C>G	4.37:g.22390713G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_GPCR_2_extracellular_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like	p.P907	ENST00000334304.5	37	c.2721	CCDS33964.1	4																																																																																			GPR125	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000152990		0.398	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR125	HGNC	protein_coding	OTTHUMT00000362960.3	246	0.00	0	G			22390713	22390713	-1	no_errors	ENST00000334304	ensembl	human	known	69_37n	silent	179	12.25	25	SNP	0.911	C
GPR149	344758	genome.wustl.edu	37	3	154138885	154138885	+	Silent	SNP	T	T	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr3:154138885T>C	ENST00000389740.2	-	3	1665	c.1566A>G	c.(1564-1566)aaA>aaG	p.K522K		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	522					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			AAAGATCTGGTTTCTGACTCT	0.403																																						dbGAP											0													93.0	84.0	87.0					3																	154138885		1826	4077	5903	-	-	-	SO:0001819	synonymous_variant	0			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1566A>G	3.37:g.154138885T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K522	ENST00000389740.2	37	c.1566	CCDS43162.1	3																																																																																			GPR149	-	NULL	ENSG00000174948		0.403	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	HGNC	protein_coding	OTTHUMT00000353430.1	296	0.00	0	T	XM_293580		154138885	154138885	-1	no_errors	ENST00000389740	ensembl	human	known	69_37n	silent	341	12.79	50	SNP	1.000	C
GPR149	344758	genome.wustl.edu	37	3	154138885	154138885	+	Silent	SNP	T	T	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr3:154138885T>C	ENST00000389740.2	-	3	1665	c.1566A>G	c.(1564-1566)aaA>aaG	p.K522K		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	522					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			AAAGATCTGGTTTCTGACTCT	0.403																																						dbGAP											0													93.0	84.0	87.0					3																	154138885		1826	4077	5903	-	-	-	SO:0001819	synonymous_variant	0			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1566A>G	3.37:g.154138885T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K522	ENST00000389740.2	37	c.1566	CCDS43162.1	3																																																																																			GPR149	-	NULL	ENSG00000174948		0.403	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	HGNC	protein_coding	OTTHUMT00000353430.1	360	0.28	1	T	XM_293580		154138885	154138885	-1	no_errors	ENST00000389740	ensembl	human	known	69_37n	silent	341	12.79	50	SNP	1.000	C
HECW1	23072	genome.wustl.edu	37	7	43351515	43351515	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr7:43351515G>A	ENST00000395891.2	+	4	786	c.181G>A	c.(181-183)Gtc>Atc	p.V61I	HECW1_ENST00000453890.1_Missense_Mutation_p.V61I	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	61					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CCACGATGGCGTCACCATTCC	0.632																																						dbGAP											0													51.0	60.0	57.0					7																	43351515		2093	4214	6307	-	-	-	SO:0001583	missense	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.181G>A	7.37:g.43351515G>A	ENSP00000379228:p.Val61Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.V61I	ENST00000395891.2	37	c.181	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569073	0.45798	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.34472	1.36;1.36	5.76	3.25	0.37280	.	0.282052	0.34853	N	0.003623	T	0.23611	0.0571	L	0.33485	1.01	0.27752	N	0.944118	B;B;B	0.13594	0.008;0.002;0.008	B;B;B	0.06405	0.002;0.002;0.002	T	0.20140	-1.0284	10	0.17832	T	0.49	.	8.7123	0.34391	0.115:0.1339:0.7511:0.0	.	61;93;61	B4DH42;B3KR18;Q76N89	.;.;HECW1_HUMAN	I	61;61;60	ENSP00000379228:V61I;ENSP00000407774:V61I	ENSP00000265522:V60I	V	+	1	0	HECW1	43318040	0.994000	0.37717	0.203000	0.23512	0.907000	0.53573	2.812000	0.47994	0.405000	0.25532	0.655000	0.94253	GTC	HECW1	-	NULL	ENSG00000002746		0.632	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	88	0.00	0	G	NM_015052		43351515	43351515	+1	no_errors	ENST00000395891	ensembl	human	known	69_37n	missense	125	24.40	41	SNP	0.933	A
HECW1	23072	genome.wustl.edu	37	7	43351515	43351515	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr7:43351515G>A	ENST00000395891.2	+	4	786	c.181G>A	c.(181-183)Gtc>Atc	p.V61I	HECW1_ENST00000453890.1_Missense_Mutation_p.V61I	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	61					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CCACGATGGCGTCACCATTCC	0.632																																						dbGAP											0													51.0	60.0	57.0					7																	43351515		2093	4214	6307	-	-	-	SO:0001583	missense	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.181G>A	7.37:g.43351515G>A	ENSP00000379228:p.Val61Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.V61I	ENST00000395891.2	37	c.181	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569073	0.45798	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.34472	1.36;1.36	5.76	3.25	0.37280	.	0.282052	0.34853	N	0.003623	T	0.23611	0.0571	L	0.33485	1.01	0.27752	N	0.944118	B;B;B	0.13594	0.008;0.002;0.008	B;B;B	0.06405	0.002;0.002;0.002	T	0.20140	-1.0284	10	0.17832	T	0.49	.	8.7123	0.34391	0.115:0.1339:0.7511:0.0	.	61;93;61	B4DH42;B3KR18;Q76N89	.;.;HECW1_HUMAN	I	61;61;60	ENSP00000379228:V61I;ENSP00000407774:V61I	ENSP00000265522:V60I	V	+	1	0	HECW1	43318040	0.994000	0.37717	0.203000	0.23512	0.907000	0.53573	2.812000	0.47994	0.405000	0.25532	0.655000	0.94253	GTC	HECW1	-	NULL	ENSG00000002746		0.632	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	69	0.00	0	G	NM_015052		43351515	43351515	+1	no_errors	ENST00000395891	ensembl	human	known	69_37n	missense	125	24.40	41	SNP	0.933	A
HEY1	23462	genome.wustl.edu	37	8	80679523	80679523	+	Silent	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr8:80679523C>T	ENST00000354724.3	-	2	295	c.96G>A	c.(94-96)ttG>ttA	p.L32L	RP11-27N21.3_ENST00000607172.1_lincRNA|RP11-26J3.1_ENST00000502766.2_lincRNA|HEY1_ENST00000523976.1_5'Flank|HEY1_ENST00000337919.5_Silent_p.L32L|HEY1_ENST00000435063.2_5'Flank	NM_012258.3	NP_036390.3	Q9Y5J3	HEY1_HUMAN	hes-related family bHLH transcription factor with YRPW motif 1	32					angiogenesis (GO:0001525)|anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular valve formation (GO:0003190)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac septum morphogenesis (GO:0060411)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to glucocorticoid stimulus (GO:0071385)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion morphogenesis (GO:0003203)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve morphogenesis (GO:0003184)|regulation of vasculogenesis (GO:2001212)|transcription from RNA polymerase II promoter (GO:0006366)|umbilical cord morphogenesis (GO:0036304)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		HEY1/NCOA2(10)	cervix(1)|kidney(2)|large_intestine(5)|lung(14)	22	all_lung(9;5.1e-05)		Epithelial(68;0.076)|all cancers(69;0.179)			GAGCCGAACTCAAGTTTCTGA	0.463			T	NCOA2	mesenchymal chondrosarcoma																																	dbGAP		Dom	yes		8	8q21	23462	hairy/enhancer-of-split related with YRPW motif 1		M	0													109.0	128.0	121.0					8																	80679523		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF151522	CCDS6225.1, CCDS43749.1, CCDS64915.1	8q21	2013-10-17	2013-10-17					"""Basic helix-loop-helix proteins"""	4880	protein-coding gene	gene with protein product		602953	"""hairy/enhancer-of-split related with YRPW motif 1"""			10415358, 10403790	Standard	NM_001040708		Approved	HESR-1, CHF2, HESR1, HRT-1, CHF-2, HERP2, BHLHb31	uc003ybl.3	Q9Y5J3		ENST00000354724.3:c.96G>A	8.37:g.80679523C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R883|Q5TZS3|Q8NAM2|Q9NYP4	Silent	SNP	pfam_HLH_DNA-bd,pfam_Orange,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_Orange_subgr,pfscan_Orange,pfscan_HLH_DNA-bd	p.L32	ENST00000354724.3	37	c.96	CCDS6225.1	8																																																																																			HEY1	-	NULL	ENSG00000164683		0.463	HEY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HEY1	HGNC	protein_coding	OTTHUMT00000379516.1	162	0.00	0	C	NM_012258		80679523	80679523	-1	no_errors	ENST00000337919	ensembl	human	known	69_37n	silent	61	45.05	50	SNP	1.000	T
HEY1	23462	genome.wustl.edu	37	8	80679523	80679523	+	Silent	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr8:80679523C>T	ENST00000354724.3	-	2	295	c.96G>A	c.(94-96)ttG>ttA	p.L32L	RP11-27N21.3_ENST00000607172.1_lincRNA|RP11-26J3.1_ENST00000502766.2_lincRNA|HEY1_ENST00000523976.1_5'Flank|HEY1_ENST00000337919.5_Silent_p.L32L|HEY1_ENST00000435063.2_5'Flank	NM_012258.3	NP_036390.3	Q9Y5J3	HEY1_HUMAN	hes-related family bHLH transcription factor with YRPW motif 1	32					angiogenesis (GO:0001525)|anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular valve formation (GO:0003190)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac septum morphogenesis (GO:0060411)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to glucocorticoid stimulus (GO:0071385)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion morphogenesis (GO:0003203)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve morphogenesis (GO:0003184)|regulation of vasculogenesis (GO:2001212)|transcription from RNA polymerase II promoter (GO:0006366)|umbilical cord morphogenesis (GO:0036304)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		HEY1/NCOA2(10)	cervix(1)|kidney(2)|large_intestine(5)|lung(14)	22	all_lung(9;5.1e-05)		Epithelial(68;0.076)|all cancers(69;0.179)			GAGCCGAACTCAAGTTTCTGA	0.463			T	NCOA2	mesenchymal chondrosarcoma																																	dbGAP		Dom	yes		8	8q21	23462	hairy/enhancer-of-split related with YRPW motif 1		M	0													109.0	128.0	121.0					8																	80679523		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF151522	CCDS6225.1, CCDS43749.1, CCDS64915.1	8q21	2013-10-17	2013-10-17					"""Basic helix-loop-helix proteins"""	4880	protein-coding gene	gene with protein product		602953	"""hairy/enhancer-of-split related with YRPW motif 1"""			10415358, 10403790	Standard	NM_001040708		Approved	HESR-1, CHF2, HESR1, HRT-1, CHF-2, HERP2, BHLHb31	uc003ybl.3	Q9Y5J3		ENST00000354724.3:c.96G>A	8.37:g.80679523C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R883|Q5TZS3|Q8NAM2|Q9NYP4	Silent	SNP	pfam_HLH_DNA-bd,pfam_Orange,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_Orange_subgr,pfscan_Orange,pfscan_HLH_DNA-bd	p.L32	ENST00000354724.3	37	c.96	CCDS6225.1	8																																																																																			HEY1	-	NULL	ENSG00000164683		0.463	HEY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HEY1	HGNC	protein_coding	OTTHUMT00000379516.1	181	0.55	1	C	NM_012258		80679523	80679523	-1	no_errors	ENST00000337919	ensembl	human	known	69_37n	silent	61	45.05	50	SNP	1.000	T
HOXA5	3202	genome.wustl.edu	37	7	27182735	27182735	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr7:27182735G>T	ENST00000222726.3	-	1	552	c.492C>A	c.(490-492)agC>agA	p.S164R	HOXA6_ENST00000521478.1_5'Flank|HOXA-AS3_ENST00000521197.1_RNA|HOXA5_ENST00000520854.1_5'Flank|HOXA-AS3_ENST00000518848.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA3_ENST00000521401.1_5'Flank	NM_019102.3	NP_061975.2	P20719	HXA5_HUMAN	homeobox A5	164					anterior/posterior pattern specification (GO:0009952)|bronchiole development (GO:0060435)|cell migration (GO:0016477)|cell-cell signaling involved in mammary gland development (GO:0060764)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|intestinal epithelial cell maturation (GO:0060574)|lung alveolus development (GO:0048286)|lung goblet cell differentiation (GO:0060480)|lung-associated mesenchyme development (GO:0060484)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal-epithelial cell signaling (GO:0060638)|multicellular organism growth (GO:0035264)|negative regulation of angiogenesis (GO:0016525)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of apoptotic process (GO:0043065)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|respiratory system process (GO:0003016)|thyroid gland development (GO:0030878)|trachea cartilage morphogenesis (GO:0060535)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(12)|skin(1)	16						GGCTCGGCTCGCTCTGCGCAC	0.667																																					Colon(119;75 2200 7557 42868)	dbGAP											0													63.0	78.0	73.0					7																	27182735		2200	4296	6496	-	-	-	SO:0001583	missense	0				CCDS5406.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106004	ENSG00000106004		"""Homeoboxes / ANTP class : HOXL subclass"""	5106	protein-coding gene	gene with protein product		142952	"""homeo box A5"""	HOX1C, HOX1		1973146, 1358459	Standard	NM_019102		Approved		uc003syn.2	P20719	OTTHUMG00000023214	ENST00000222726.3:c.492C>A	7.37:g.27182735G>T	ENSP00000222726:p.Ser164Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D179|O43367|Q96CY6	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.S164R	ENST00000222726.3	37	c.492	CCDS5406.1	7	.	.	.	.	.	.	.	.	.	.	G	12.38	1.921254	0.33908	.	.	ENSG00000106004	ENST00000222726	D	0.91945	-2.94	5.53	3.73	0.42828	.	0.044446	0.85682	D	0.000000	D	0.86826	0.6026	L	0.45352	1.415	0.38537	D	0.949117	P	0.35401	0.499	B	0.28709	0.093	D	0.84639	0.0694	10	0.45353	T	0.12	.	12.4518	0.55681	0.1254:0.0:0.8746:0.0	.	164	P20719	HXA5_HUMAN	R	164	ENSP00000222726:S164R	ENSP00000222726:S164R	S	-	3	2	HOXA5	27149260	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.201000	0.58439	0.696000	0.31696	0.591000	0.81541	AGC	HOXA5	-	NULL	ENSG00000106004		0.667	HOXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA5	HGNC	protein_coding	OTTHUMT00000358705.1	57	0.00	0	G			27182735	27182735	-1	no_errors	ENST00000222726	ensembl	human	known	69_37n	missense	56	25.33	19	SNP	1.000	T
IFI35	3430	genome.wustl.edu	37	17	41158967	41158967	+	Start_Codon_Del	DEL	G	G	-			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr17:41158967delG	ENST00000415816.2	+	0	226				IFI35_ENST00000536969.1_3'UTR|IFI35_ENST00000438323.2_Start_Codon_Del	NM_005533.4	NP_005524.2	P80217	IN35_HUMAN	interferon-induced protein 35						cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		CGAGACCCATGTCAGCCCCAC	0.552																																						dbGAP											0													153.0	143.0	146.0					17																	41158967		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			BC001356	CCDS11450.1	17q21	2006-04-05			ENSG00000068079	ENSG00000068079			5399	protein-coding gene	gene with protein product		600735					Standard	NM_005533		Approved	IFP35	uc021txx.1	P80217	OTTHUMG00000167720		17.37:g.41158967delG		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JGX1|Q92984|Q99537|Q9BV98	Frame_Shift_Del	DEL	pfam_Nmi/IFP35,pfam_Interferon_induced_35kDa_N	p.M1fs	ENST00000415816.2	37	c.3		17																																																																																			IFI35	-	NULL	ENSG00000068079		0.552	IFI35-002	KNOWN	basic|appris_candidate	protein_coding	IFI35	HGNC	protein_coding	OTTHUMT00000395851.1	517	0.19	1	G	NM_005533		41158967	41158967	+1	no_errors	ENST00000438323	ensembl	human	known	69_37n	frame_shift_del	331	10.48	39	DEL	0.049	-
IFI35	3430	genome.wustl.edu	37	17	41158967	41158967	+	Start_Codon_Del	DEL	G	G	-			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr17:41158967delG	ENST00000415816.2	+	0	226				IFI35_ENST00000536969.1_3'UTR|IFI35_ENST00000438323.2_Start_Codon_Del	NM_005533.4	NP_005524.2	P80217	IN35_HUMAN	interferon-induced protein 35						cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		CGAGACCCATGTCAGCCCCAC	0.552																																						dbGAP											0													153.0	143.0	146.0					17																	41158967		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			BC001356	CCDS11450.1	17q21	2006-04-05			ENSG00000068079	ENSG00000068079			5399	protein-coding gene	gene with protein product		600735					Standard	NM_005533		Approved	IFP35	uc021txx.1	P80217	OTTHUMG00000167720		17.37:g.41158967delG		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JGX1|Q92984|Q99537|Q9BV98	Frame_Shift_Del	DEL	pfam_Nmi/IFP35,pfam_Interferon_induced_35kDa_N	p.M1fs	ENST00000415816.2	37	c.3		17																																																																																			IFI35	-	NULL	ENSG00000068079		0.552	IFI35-002	KNOWN	basic|appris_candidate	protein_coding	IFI35	HGNC	protein_coding	OTTHUMT00000395851.1	514	0.00	0	G	NM_005533		41158967	41158967	+1	no_errors	ENST00000438323	ensembl	human	known	69_37n	frame_shift_del	331	10.48	39	DEL	0.049	-
IPO8	10526	genome.wustl.edu	37	12	30823923	30823923	+	Silent	SNP	G	G	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr12:30823923G>T	ENST00000256079.4	-	9	1355	c.1017C>A	c.(1015-1017)acC>acA	p.T339T	IPO8_ENST00000544829.1_Silent_p.T134T	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	339					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TCTGCTTCCAGGTTATAGAAT	0.373																																						dbGAP											0													145.0	146.0	146.0					12																	30823923		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.1017C>A	12.37:g.30823923G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7M3	Silent	SNP	pfam_Importin-beta_N,pfam_Exportin/Importin_Cse1-like,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.T339	ENST00000256079.4	37	c.1017	CCDS8719.1	12																																																																																			IPO8	-	pfam_Exportin/Importin_Cse1-like,superfamily_ARM-type_fold	ENSG00000133704		0.373	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO8	HGNC	protein_coding	OTTHUMT00000402700.2	485	0.00	0	G	NM_006390		30823923	30823923	-1	no_errors	ENST00000256079	ensembl	human	known	69_37n	silent	185	16.52	37	SNP	0.979	T
IPO8	10526	genome.wustl.edu	37	12	30823923	30823923	+	Silent	SNP	G	G	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr12:30823923G>T	ENST00000256079.4	-	9	1355	c.1017C>A	c.(1015-1017)acC>acA	p.T339T	IPO8_ENST00000544829.1_Silent_p.T134T	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	339					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TCTGCTTCCAGGTTATAGAAT	0.373																																						dbGAP											0													145.0	146.0	146.0					12																	30823923		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.1017C>A	12.37:g.30823923G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7M3	Silent	SNP	pfam_Importin-beta_N,pfam_Exportin/Importin_Cse1-like,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.T339	ENST00000256079.4	37	c.1017	CCDS8719.1	12																																																																																			IPO8	-	pfam_Exportin/Importin_Cse1-like,superfamily_ARM-type_fold	ENSG00000133704		0.373	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO8	HGNC	protein_coding	OTTHUMT00000402700.2	520	0.38	2	G	NM_006390		30823923	30823923	-1	no_errors	ENST00000256079	ensembl	human	known	69_37n	silent	185	16.52	37	SNP	0.979	T
ISX	91464	genome.wustl.edu	37	22	35478527	35478527	+	Silent	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr22:35478527G>A	ENST00000308700.6	+	2	1198	c.246G>A	c.(244-246)aaG>aaA	p.K82K	ISX_ENST00000404699.2_Silent_p.K82K	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	82					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						GGAAGAGCAAGCGGAGGGTTC	0.552																																						dbGAP											0													137.0	112.0	121.0					22																	35478527		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.246G>A	22.37:g.35478527G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DJ5	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.K82	ENST00000308700.6	37	c.246	CCDS33640.1	22																																																																																			ISX	-	superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000175329		0.552	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISX	HGNC	protein_coding	OTTHUMT00000320662.1	110	0.00	0	G	NM_001008494		35478527	35478527	+1	no_errors	ENST00000308700	ensembl	human	known	69_37n	silent	164	26.13	58	SNP	0.669	A
ISX	91464	genome.wustl.edu	37	22	35478527	35478527	+	Silent	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr22:35478527G>A	ENST00000308700.6	+	2	1198	c.246G>A	c.(244-246)aaG>aaA	p.K82K	ISX_ENST00000404699.2_Silent_p.K82K	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	82					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						GGAAGAGCAAGCGGAGGGTTC	0.552																																						dbGAP											0													137.0	112.0	121.0					22																	35478527		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.246G>A	22.37:g.35478527G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DJ5	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.K82	ENST00000308700.6	37	c.246	CCDS33640.1	22																																																																																			ISX	-	superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000175329		0.552	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISX	HGNC	protein_coding	OTTHUMT00000320662.1	129	0.77	1	G	NM_001008494		35478527	35478527	+1	no_errors	ENST00000308700	ensembl	human	known	69_37n	silent	164	26.13	58	SNP	0.669	A
ITGA1	3672	genome.wustl.edu	37	5	52243219	52243219	+	Silent	SNP	A	A	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr5:52243219A>T	ENST00000282588.6	+	28	3881	c.3423A>T	c.(3421-3423)ccA>ccT	p.P1141P	CTD-2175A23.1_ENST00000503559.1_RNA|CTD-2175A23.1_ENST00000505701.1_RNA	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	1141					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				GCAGAGTGCCATTATGGGTCA	0.398																																						dbGAP											0													207.0	192.0	197.0					5																	52243219		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.3423A>T	5.37:g.52243219A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNU0	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.P1141	ENST00000282588.6	37	c.3423	CCDS3955.1	5																																																																																			ITGA1	-	NULL	ENSG00000213949		0.398	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA1	HGNC	protein_coding	OTTHUMT00000253855.3	707	0.00	0	A	NM_181501		52243219	52243219	+1	no_errors	ENST00000282588	ensembl	human	known	69_37n	silent	632	20.30	161	SNP	0.176	T
ITGA1	3672	genome.wustl.edu	37	5	52243219	52243219	+	Silent	SNP	A	A	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr5:52243219A>T	ENST00000282588.6	+	28	3881	c.3423A>T	c.(3421-3423)ccA>ccT	p.P1141P	CTD-2175A23.1_ENST00000503559.1_RNA|CTD-2175A23.1_ENST00000505701.1_RNA	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	1141					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				GCAGAGTGCCATTATGGGTCA	0.398																																						dbGAP											0													207.0	192.0	197.0					5																	52243219		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.3423A>T	5.37:g.52243219A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNU0	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.P1141	ENST00000282588.6	37	c.3423	CCDS3955.1	5																																																																																			ITGA1	-	NULL	ENSG00000213949		0.398	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA1	HGNC	protein_coding	OTTHUMT00000253855.3	742	0.40	3	A	NM_181501		52243219	52243219	+1	no_errors	ENST00000282588	ensembl	human	known	69_37n	silent	632	20.30	161	SNP	0.176	T
KCNH5	27133	genome.wustl.edu	37	14	63174802	63174802	+	Silent	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr14:63174802G>A	ENST00000322893.7	-	11	2659	c.2391C>T	c.(2389-2391)gtC>gtT	p.V797V	KCNH5_ENST00000420622.2_3'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	797					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TTGGGCTGTTGACTTTGAGAC	0.458																																						dbGAP											0													112.0	112.0	112.0					14																	63174802		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2391C>T	14.37:g.63174802G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JP98	Silent	SNP	pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_cNMP-bd_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,tigrfam_PAS	p.V797	ENST00000322893.7	37	c.2391	CCDS9756.1	14																																																																																			KCNH5	-	NULL	ENSG00000140015		0.458	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH5	HGNC	protein_coding	OTTHUMT00000411747.1	250	0.00	0	G	NM_139318		63174802	63174802	-1	no_errors	ENST00000322893	ensembl	human	known	69_37n	silent	365	11.84	49	SNP	1.000	A
KCNH5	27133	genome.wustl.edu	37	14	63174802	63174802	+	Silent	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr14:63174802G>A	ENST00000322893.7	-	11	2659	c.2391C>T	c.(2389-2391)gtC>gtT	p.V797V	KCNH5_ENST00000420622.2_3'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	797					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TTGGGCTGTTGACTTTGAGAC	0.458																																						dbGAP											0													112.0	112.0	112.0					14																	63174802		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2391C>T	14.37:g.63174802G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JP98	Silent	SNP	pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_cNMP-bd_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,tigrfam_PAS	p.V797	ENST00000322893.7	37	c.2391	CCDS9756.1	14																																																																																			KCNH5	-	NULL	ENSG00000140015		0.458	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH5	HGNC	protein_coding	OTTHUMT00000411747.1	297	0.00	0	G	NM_139318		63174802	63174802	-1	no_errors	ENST00000322893	ensembl	human	known	69_37n	silent	365	11.84	49	SNP	1.000	A
KLRC1	3821	genome.wustl.edu	37	12	10602545	10602545	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr12:10602545delT	ENST00000359151.3	-	4	486	c.305delA	c.(304-306)aacfs	p.N103fs	KLRC1_ENST00000536188.1_Frame_Shift_Del_p.N103fs|KLRC1_ENST00000408006.3_Intron|KLRC1_ENST00000544822.1_Frame_Shift_Del_p.N103fs|KLRC1_ENST00000347831.5_Intron	NM_002259.4	NP_002250	P26715	NKG2A_HUMAN	killer cell lectin-like receptor subfamily C, member 1	103					cell surface receptor signaling pathway (GO:0007166)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16						GGAAGAATTGTTGTGCCTCTG	0.229																																						dbGAP											0													14.0	15.0	15.0					12																	10602545		2109	4171	6280	-	-	-	SO:0001589	frameshift_variant	0			U54782	CCDS8625.1, CCDS8626.1	12p13	2010-06-30			ENSG00000134545	ENSG00000134545		"""Killer cell lectin-like receptors"", ""CD molecules"""	6374	protein-coding gene	gene with protein product	"""NKG2-1/B activating NK receptor"""	161555		NKG2		9598306	Standard	NM_002259		Approved	NKG2-A, NKG2-B, CD159a	uc001qyl.3	P26715		ENST00000359151.3:c.305delA	12.37:g.10602545delT	ENSP00000352064:p.Asn103fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.N102fs	ENST00000359151.3	37	c.305	CCDS8625.1	12																																																																																			KLRC1	-	pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold	ENSG00000134545		0.229	KLRC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KLRC1	HGNC	protein_coding	OTTHUMT00000400115.1	92	0.00	0	T	NM_002259		10602545	10602545	-1	no_errors	ENST00000359151	ensembl	human	known	69_37n	frame_shift_del	12	14.29	2	DEL	0.004	-
KLRC1	3821	genome.wustl.edu	37	12	10602545	10602545	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr12:10602545delT	ENST00000359151.3	-	4	486	c.305delA	c.(304-306)aacfs	p.N103fs	KLRC1_ENST00000536188.1_Frame_Shift_Del_p.N103fs|KLRC1_ENST00000408006.3_Intron|KLRC1_ENST00000544822.1_Frame_Shift_Del_p.N103fs|KLRC1_ENST00000347831.5_Intron	NM_002259.4	NP_002250	P26715	NKG2A_HUMAN	killer cell lectin-like receptor subfamily C, member 1	103					cell surface receptor signaling pathway (GO:0007166)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16						GGAAGAATTGTTGTGCCTCTG	0.229																																						dbGAP											0													14.0	15.0	15.0					12																	10602545		2109	4171	6280	-	-	-	SO:0001589	frameshift_variant	0			U54782	CCDS8625.1, CCDS8626.1	12p13	2010-06-30			ENSG00000134545	ENSG00000134545		"""Killer cell lectin-like receptors"", ""CD molecules"""	6374	protein-coding gene	gene with protein product	"""NKG2-1/B activating NK receptor"""	161555		NKG2		9598306	Standard	NM_002259		Approved	NKG2-A, NKG2-B, CD159a	uc001qyl.3	P26715		ENST00000359151.3:c.305delA	12.37:g.10602545delT	ENSP00000352064:p.Asn103fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.N102fs	ENST00000359151.3	37	c.305	CCDS8625.1	12																																																																																			KLRC1	-	pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold	ENSG00000134545		0.229	KLRC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KLRC1	HGNC	protein_coding	OTTHUMT00000400115.1	72	0.00	0	T	NM_002259		10602545	10602545	-1	no_errors	ENST00000359151	ensembl	human	known	69_37n	frame_shift_del	12	14.29	2	DEL	0.004	-
KSR2	283455	genome.wustl.edu	37	12	118293372	118293372	+	Silent	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr12:118293372G>A	ENST00000339824.5	-	3	1060	c.333C>T	c.(331-333)ccC>ccT	p.P111P	KSR2_ENST00000425217.1_Silent_p.P82P			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	111					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCAGCTGGCCGGGGGAGATTT	0.597																																						dbGAP											0													39.0	44.0	43.0					12																	118293372		2015	4198	6213	-	-	-	SO:0001819	synonymous_variant	0			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.333C>T	12.37:g.118293372G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJT2|Q3B828|Q8N775	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.P111	ENST00000339824.5	37	c.333		12																																																																																			KSR2	-	NULL	ENSG00000171435		0.597	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	HGNC	protein_coding	OTTHUMT00000401987.2	157	0.63	1	G	NM_173598		118293372	118293372	-1	no_errors	ENST00000339824	ensembl	human	known	69_37n	silent	192	35.33	106	SNP	0.000	A
KSR2	283455	genome.wustl.edu	37	12	118293372	118293372	+	Silent	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr12:118293372G>A	ENST00000339824.5	-	3	1060	c.333C>T	c.(331-333)ccC>ccT	p.P111P	KSR2_ENST00000425217.1_Silent_p.P82P			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	111					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCAGCTGGCCGGGGGAGATTT	0.597																																						dbGAP											0													39.0	44.0	43.0					12																	118293372		2015	4198	6213	-	-	-	SO:0001819	synonymous_variant	0			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.333C>T	12.37:g.118293372G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJT2|Q3B828|Q8N775	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.P111	ENST00000339824.5	37	c.333		12																																																																																			KSR2	-	NULL	ENSG00000171435		0.597	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	HGNC	protein_coding	OTTHUMT00000401987.2	138	0.00	0	G	NM_173598		118293372	118293372	-1	no_errors	ENST00000339824	ensembl	human	known	69_37n	silent	192	35.33	106	SNP	0.000	A
LAMA5	3911	genome.wustl.edu	37	20	60889977	60889977	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr20:60889977G>A	ENST00000252999.3	-	60	8140	c.8074C>T	c.(8074-8076)Cag>Tag	p.Q2692*		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2692	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCCAGCAGCTGGGGCAGCGTC	0.677																																						dbGAP											0													54.0	66.0	62.0					20																	60889977		2203	4296	6499	-	-	-	SO:0001587	stop_gained	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.8074C>T	20.37:g.60889977G>A	ENSP00000252999:p.Gln2692*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TDF8|Q8WZA7|Q9H1P1	Nonsense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.Q2692*	ENST00000252999.3	37	c.8074	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	g	49	15.627181	0.99840	.	.	ENSG00000130702	ENST00000252999	.	.	.	3.56	3.56	0.40772	.	0.499609	0.18890	U	0.128336	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0891	0.72180	0.0:0.0:1.0:0.0	.	.	.	.	X	2692	.	ENSP00000252999:Q2692X	Q	-	1	0	LAMA5	60323372	0.599000	0.26891	0.998000	0.56505	0.806000	0.45545	1.262000	0.32992	1.707000	0.51288	0.457000	0.33378	CAG	LAMA5	-	pfam_Laminin_II	ENSG00000130702		0.677	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	55	0.00	0	G	NM_005560		60889977	60889977	-1	no_errors	ENST00000252999	ensembl	human	known	69_37n	nonsense	121	30.29	53	SNP	0.904	A
LAMA5	3911	genome.wustl.edu	37	20	60889977	60889977	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr20:60889977G>A	ENST00000252999.3	-	60	8140	c.8074C>T	c.(8074-8076)Cag>Tag	p.Q2692*		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2692	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCCAGCAGCTGGGGCAGCGTC	0.677																																						dbGAP											0													54.0	66.0	62.0					20																	60889977		2203	4296	6499	-	-	-	SO:0001587	stop_gained	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.8074C>T	20.37:g.60889977G>A	ENSP00000252999:p.Gln2692*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TDF8|Q8WZA7|Q9H1P1	Nonsense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.Q2692*	ENST00000252999.3	37	c.8074	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	g	49	15.627181	0.99840	.	.	ENSG00000130702	ENST00000252999	.	.	.	3.56	3.56	0.40772	.	0.499609	0.18890	U	0.128336	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0891	0.72180	0.0:0.0:1.0:0.0	.	.	.	.	X	2692	.	ENSP00000252999:Q2692X	Q	-	1	0	LAMA5	60323372	0.599000	0.26891	0.998000	0.56505	0.806000	0.45545	1.262000	0.32992	1.707000	0.51288	0.457000	0.33378	CAG	LAMA5	-	pfam_Laminin_II	ENSG00000130702		0.677	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	50	0.00	0	G	NM_005560		60889977	60889977	-1	no_errors	ENST00000252999	ensembl	human	known	69_37n	nonsense	121	30.29	53	SNP	0.904	A
LCP2	3937	genome.wustl.edu	37	5	169697879	169697879	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr5:169697879C>T	ENST00000046794.5	-	7	982	c.367G>A	c.(367-369)Gag>Aag	p.E123K		NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	123					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		CCATCATCCTCCCCATCCTGG	0.542																																						dbGAP											0													64.0	77.0	73.0					5																	169697879		2123	4234	6357	-	-	-	SO:0001583	missense	0				CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.367G>A	5.37:g.169697879C>T	ENSP00000046794:p.Glu123Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA25|Q53XV4	Missense_Mutation	SNP	pfam_SH2,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,smart_SH2,pfscan_SH2	p.E123K	ENST00000046794.5	37	c.367	CCDS47339.1	5	.	.	.	.	.	.	.	.	.	.	C	18.04	3.534890	0.64972	.	.	ENSG00000043462	ENST00000046794	T	0.49720	0.77	5.4	5.4	0.78164	.	0.165679	0.42420	D	0.000706	T	0.47948	0.1473	M	0.62723	1.935	0.80722	D	1	P	0.40066	0.701	B	0.39771	0.309	T	0.45190	-0.9278	9	.	.	.	-23.8347	15.0367	0.71754	0.0:1.0:0.0:0.0	.	123	Q13094	LCP2_HUMAN	K	123	ENSP00000046794:E123K	.	E	-	1	0	LCP2	169630457	0.982000	0.34865	0.951000	0.38953	0.733000	0.41908	2.649000	0.46656	2.679000	0.91253	0.655000	0.94253	GAG	LCP2	-	NULL	ENSG00000043462		0.542	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP2	HGNC	protein_coding	OTTHUMT00000371727.1	214	0.00	0	C	NM_005565		169697879	169697879	-1	no_errors	ENST00000046794	ensembl	human	known	69_37n	missense	244	32.97	120	SNP	0.982	T
LCP2	3937	genome.wustl.edu	37	5	169697879	169697879	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr5:169697879C>T	ENST00000046794.5	-	7	982	c.367G>A	c.(367-369)Gag>Aag	p.E123K		NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	123					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		CCATCATCCTCCCCATCCTGG	0.542																																						dbGAP											0													64.0	77.0	73.0					5																	169697879		2123	4234	6357	-	-	-	SO:0001583	missense	0				CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.367G>A	5.37:g.169697879C>T	ENSP00000046794:p.Glu123Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA25|Q53XV4	Missense_Mutation	SNP	pfam_SH2,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,smart_SH2,pfscan_SH2	p.E123K	ENST00000046794.5	37	c.367	CCDS47339.1	5	.	.	.	.	.	.	.	.	.	.	C	18.04	3.534890	0.64972	.	.	ENSG00000043462	ENST00000046794	T	0.49720	0.77	5.4	5.4	0.78164	.	0.165679	0.42420	D	0.000706	T	0.47948	0.1473	M	0.62723	1.935	0.80722	D	1	P	0.40066	0.701	B	0.39771	0.309	T	0.45190	-0.9278	9	.	.	.	-23.8347	15.0367	0.71754	0.0:1.0:0.0:0.0	.	123	Q13094	LCP2_HUMAN	K	123	ENSP00000046794:E123K	.	E	-	1	0	LCP2	169630457	0.982000	0.34865	0.951000	0.38953	0.733000	0.41908	2.649000	0.46656	2.679000	0.91253	0.655000	0.94253	GAG	LCP2	-	NULL	ENSG00000043462		0.542	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP2	HGNC	protein_coding	OTTHUMT00000371727.1	193	0.00	0	C	NM_005565		169697879	169697879	-1	no_errors	ENST00000046794	ensembl	human	known	69_37n	missense	244	32.97	120	SNP	0.982	T
LRP12	29967	genome.wustl.edu	37	8	105509599	105509599	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr8:105509599C>T	ENST00000276654.5	-	5	1289	c.1181G>A	c.(1180-1182)cGt>cAt	p.R394H	LRP12_ENST00000424843.2_Missense_Mutation_p.R375H|LRP12_ENST00000518375.1_5'Flank	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	394	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CCCATCACAACGCTGCTGCTC	0.463																																						dbGAP											0													114.0	106.0	109.0					8																	105509599		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1181G>A	8.37:g.105509599C>T	ENSP00000276654:p.Arg394His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K137|B4DRQ2	Missense_Mutation	SNP	pfam_CUB,pfam_LDrepeatLR_classA_rpt,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt	p.R375H	ENST00000276654.5	37	c.1124	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402227	0.83230	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	T;T	0.59906	0.23;0.23	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.67496	0.2899	L	0.42744	1.35	0.80722	D	1	D;D	0.69078	0.997;0.995	P;P	0.59288	0.855;0.719	T	0.65084	-0.6254	10	0.42905	T	0.14	-20.9763	19.7495	0.96261	0.0:1.0:0.0:0.0	.	375;394	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	H	375;394	ENSP00000399148:R375H;ENSP00000276654:R394H	ENSP00000276654:R394H	R	-	2	0	LRP12	105578775	1.000000	0.71417	0.968000	0.41197	0.942000	0.58702	7.456000	0.80751	2.685000	0.91497	0.455000	0.32223	CGT	LRP12	-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000147650		0.463	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	319	0.00	0	C	NM_013437		105509599	105509599	-1	no_errors	ENST00000424843	ensembl	human	known	69_37n	missense	204	41.55	145	SNP	1.000	T
LRP12	29967	genome.wustl.edu	37	8	105509599	105509599	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr8:105509599C>T	ENST00000276654.5	-	5	1289	c.1181G>A	c.(1180-1182)cGt>cAt	p.R394H	LRP12_ENST00000424843.2_Missense_Mutation_p.R375H|LRP12_ENST00000518375.1_5'Flank	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	394	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CCCATCACAACGCTGCTGCTC	0.463																																						dbGAP											0													114.0	106.0	109.0					8																	105509599		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1181G>A	8.37:g.105509599C>T	ENSP00000276654:p.Arg394His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K137|B4DRQ2	Missense_Mutation	SNP	pfam_CUB,pfam_LDrepeatLR_classA_rpt,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt	p.R375H	ENST00000276654.5	37	c.1124	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402227	0.83230	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	T;T	0.59906	0.23;0.23	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.67496	0.2899	L	0.42744	1.35	0.80722	D	1	D;D	0.69078	0.997;0.995	P;P	0.59288	0.855;0.719	T	0.65084	-0.6254	10	0.42905	T	0.14	-20.9763	19.7495	0.96261	0.0:1.0:0.0:0.0	.	375;394	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	H	375;394	ENSP00000399148:R375H;ENSP00000276654:R394H	ENSP00000276654:R394H	R	-	2	0	LRP12	105578775	1.000000	0.71417	0.968000	0.41197	0.942000	0.58702	7.456000	0.80751	2.685000	0.91497	0.455000	0.32223	CGT	LRP12	-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000147650		0.463	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	336	0.30	1	C	NM_013437		105509599	105509599	-1	no_errors	ENST00000424843	ensembl	human	known	69_37n	missense	204	41.55	145	SNP	1.000	T
MIA2	117153	genome.wustl.edu	37	14	39722059	39722059	+	Missense_Mutation	SNP	G	G	A	rs146422472	byFrequency	TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr14:39722059G>A	ENST00000280082.3	+	5	1874	c.1675G>A	c.(1675-1677)Gaa>Aaa	p.E559K	RP11-407N17.3_ENST00000553728.1_Intron	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	0					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)		p.E559K(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		AGTAGACACCGAAGGGCCTGC	0.378													G|||	2	0.000399361	0.0015	0.0	5008	,	,		16485	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	96.0	93.0					14																	39722059		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.1675G>A	14.37:g.39722059G>A	ENSP00000280082:p.Glu559Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4H0|Q9H6C1	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain	p.E559K	ENST00000280082.3	37	c.1675	CCDS9672.1	14	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	11.29	1.595012	0.28445	.	.	ENSG00000150526	ENST00000280082	T	0.59224	0.28	4.86	3.97	0.46021	.	0.219617	0.23039	N	0.052626	T	0.38161	0.1030	.	.	.	0.09310	N	0.999996	B	0.18968	0.032	B	0.18263	0.021	T	0.15065	-1.0450	8	.	.	.	.	7.0253	0.24936	0.0914:0.0:0.7381:0.1705	.	559	Q96PC5-2	.	K	559	ENSP00000280082:E559K	.	E	+	1	0	MIA2	38791810	0.003000	0.15002	0.029000	0.17559	0.464000	0.32679	0.946000	0.29069	1.376000	0.46267	0.585000	0.79938	GAA	MIA2	-	NULL	ENSG00000150526		0.378	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MIA2	HGNC	protein_coding	OTTHUMT00000276768.3	313	0.00	0	G	NM_054024		39722059	39722059	+1	no_errors	ENST00000280082	ensembl	human	novel	69_37n	missense	138	27.75	53	SNP	0.037	A
MIA2	117153	genome.wustl.edu	37	14	39722059	39722059	+	Missense_Mutation	SNP	G	G	A	rs146422472	byFrequency	TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr14:39722059G>A	ENST00000280082.3	+	5	1874	c.1675G>A	c.(1675-1677)Gaa>Aaa	p.E559K	RP11-407N17.3_ENST00000553728.1_Intron	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	0					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)		p.E559K(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		AGTAGACACCGAAGGGCCTGC	0.378													G|||	2	0.000399361	0.0015	0.0	5008	,	,		16485	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	96.0	93.0					14																	39722059		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.1675G>A	14.37:g.39722059G>A	ENSP00000280082:p.Glu559Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4H0|Q9H6C1	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain	p.E559K	ENST00000280082.3	37	c.1675	CCDS9672.1	14	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	11.29	1.595012	0.28445	.	.	ENSG00000150526	ENST00000280082	T	0.59224	0.28	4.86	3.97	0.46021	.	0.219617	0.23039	N	0.052626	T	0.38161	0.1030	.	.	.	0.09310	N	0.999996	B	0.18968	0.032	B	0.18263	0.021	T	0.15065	-1.0450	8	.	.	.	.	7.0253	0.24936	0.0914:0.0:0.7381:0.1705	.	559	Q96PC5-2	.	K	559	ENSP00000280082:E559K	.	E	+	1	0	MIA2	38791810	0.003000	0.15002	0.029000	0.17559	0.464000	0.32679	0.946000	0.29069	1.376000	0.46267	0.585000	0.79938	GAA	MIA2	-	NULL	ENSG00000150526		0.378	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MIA2	HGNC	protein_coding	OTTHUMT00000276768.3	412	0.24	1	G	NM_054024		39722059	39722059	+1	no_errors	ENST00000280082	ensembl	human	novel	69_37n	missense	138	27.75	53	SNP	0.037	A
MUC16	94025	genome.wustl.edu	37	19	9076968	9076968	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr19:9076968A>G	ENST00000397910.4	-	3	10681	c.10478T>C	c.(10477-10479)aTa>aCa	p.I3493T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3494	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTCAAGCCCTATTGAAGGAGA	0.507																																						dbGAP											0													117.0	112.0	114.0					19																	9076968		2081	4214	6295	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.10478T>C	19.37:g.9076968A>G	ENSP00000381008:p.Ile3493Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.I3493T	ENST00000397910.4	37	c.10478	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	2.173	-0.389367	0.04932	.	.	ENSG00000181143	ENST00000397910	T	0.02709	4.19	2.03	-1.9	0.07665	.	.	.	.	.	T	0.01421	0.0046	N	0.08118	0	.	.	.	B	0.10296	0.003	B	0.06405	0.002	T	0.47674	-0.9099	8	0.87932	D	0	.	0.309	0.00285	0.4032:0.2255:0.1505:0.2207	.	3493	B5ME49	.	T	3493	ENSP00000381008:I3493T	ENSP00000381008:I3493T	I	-	2	0	MUC16	8937968	0.002000	0.14202	0.000000	0.03702	0.111000	0.19643	1.120000	0.31271	-0.627000	0.05589	-0.779000	0.03376	ATA	MUC16	-	NULL	ENSG00000181143		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	318	0.00	0	A	NM_024690		9076968	9076968	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	581	17.82	126	SNP	0.000	G
MUC16	94025	genome.wustl.edu	37	19	9076968	9076968	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr19:9076968A>G	ENST00000397910.4	-	3	10681	c.10478T>C	c.(10477-10479)aTa>aCa	p.I3493T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3494	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTCAAGCCCTATTGAAGGAGA	0.507																																						dbGAP											0													117.0	112.0	114.0					19																	9076968		2081	4214	6295	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.10478T>C	19.37:g.9076968A>G	ENSP00000381008:p.Ile3493Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.I3493T	ENST00000397910.4	37	c.10478	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	2.173	-0.389367	0.04932	.	.	ENSG00000181143	ENST00000397910	T	0.02709	4.19	2.03	-1.9	0.07665	.	.	.	.	.	T	0.01421	0.0046	N	0.08118	0	.	.	.	B	0.10296	0.003	B	0.06405	0.002	T	0.47674	-0.9099	8	0.87932	D	0	.	0.309	0.00285	0.4032:0.2255:0.1505:0.2207	.	3493	B5ME49	.	T	3493	ENSP00000381008:I3493T	ENSP00000381008:I3493T	I	-	2	0	MUC16	8937968	0.002000	0.14202	0.000000	0.03702	0.111000	0.19643	1.120000	0.31271	-0.627000	0.05589	-0.779000	0.03376	ATA	MUC16	-	NULL	ENSG00000181143		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	383	0.52	2	A	NM_024690		9076968	9076968	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	581	17.82	126	SNP	0.000	G
NLRP7	199713	genome.wustl.edu	37	19	55450823	55450823	+	Missense_Mutation	SNP	C	C	T	rs377023716		TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr19:55450823C>T	ENST00000590030.1	-	3	1404	c.1364G>A	c.(1363-1365)cGc>cAc	p.R455H	NLRP7_ENST00000446217.1_Missense_Mutation_p.R483H|NLRP7_ENST00000592784.1_Missense_Mutation_p.R455H|NLRP7_ENST00000448121.2_Missense_Mutation_p.R455H|NLRP7_ENST00000588756.1_Missense_Mutation_p.R455H|NLRP7_ENST00000340844.2_Missense_Mutation_p.R455H|NLRP7_ENST00000328092.5_Missense_Mutation_p.R455H			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	455	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TCTGTCCTGGCGGAGGATGTC	0.617																																						dbGAP											0													34.0	33.0	33.0					19																	55450823		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1364G>A	19.37:g.55450823C>T	ENSP00000465520:p.Arg455His	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R483H	ENST00000590030.1	37	c.1448	CCDS33109.1	19	.	.	.	.	.	.	.	.	.	.	C	12.38	1.919270	0.33908	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.74632	-0.79;-0.79;-0.86;-0.83	1.92	-1.9	0.07665	.	2.234570	0.02607	N	0.101652	T	0.76751	0.4031	L	0.46885	1.475	0.09310	N	1	D;D;D;D	0.71674	0.997;0.994;0.997;0.998	P;P;P;P	0.62740	0.808;0.808;0.808;0.906	T	0.60919	-0.7167	10	0.33940	T	0.23	.	2.2675	0.04082	0.2486:0.3674:0.0:0.384	.	483;455;455;455	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	H	455;455;455;483;222	ENSP00000329568:R455H;ENSP00000409137:R455H;ENSP00000339491:R455H;ENSP00000414273:R483H	ENSP00000329568:R455H	R	-	2	0	NLRP7	60142635	0.000000	0.05858	0.001000	0.08648	0.046000	0.14306	-1.226000	0.02953	-0.626000	0.05596	-0.379000	0.06801	CGC	NLRP7	-	NULL	ENSG00000167634		0.617	NLRP7-003	KNOWN	basic|CCDS	protein_coding	NLRP7	HGNC	protein_coding	OTTHUMT00000451396.1	70	0.00	0	C	NM_139176		55450823	55450823	-1	no_errors	ENST00000446217	ensembl	human	known	69_37n	missense	75	24.24	24	SNP	0.000	T
NLRP7	199713	genome.wustl.edu	37	19	55450823	55450823	+	Missense_Mutation	SNP	C	C	T	rs377023716		TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr19:55450823C>T	ENST00000590030.1	-	3	1404	c.1364G>A	c.(1363-1365)cGc>cAc	p.R455H	NLRP7_ENST00000446217.1_Missense_Mutation_p.R483H|NLRP7_ENST00000592784.1_Missense_Mutation_p.R455H|NLRP7_ENST00000448121.2_Missense_Mutation_p.R455H|NLRP7_ENST00000588756.1_Missense_Mutation_p.R455H|NLRP7_ENST00000340844.2_Missense_Mutation_p.R455H|NLRP7_ENST00000328092.5_Missense_Mutation_p.R455H			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	455	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TCTGTCCTGGCGGAGGATGTC	0.617																																						dbGAP											0													34.0	33.0	33.0					19																	55450823		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1364G>A	19.37:g.55450823C>T	ENSP00000465520:p.Arg455His	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R483H	ENST00000590030.1	37	c.1448	CCDS33109.1	19	.	.	.	.	.	.	.	.	.	.	C	12.38	1.919270	0.33908	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.74632	-0.79;-0.79;-0.86;-0.83	1.92	-1.9	0.07665	.	2.234570	0.02607	N	0.101652	T	0.76751	0.4031	L	0.46885	1.475	0.09310	N	1	D;D;D;D	0.71674	0.997;0.994;0.997;0.998	P;P;P;P	0.62740	0.808;0.808;0.808;0.906	T	0.60919	-0.7167	10	0.33940	T	0.23	.	2.2675	0.04082	0.2486:0.3674:0.0:0.384	.	483;455;455;455	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	H	455;455;455;483;222	ENSP00000329568:R455H;ENSP00000409137:R455H;ENSP00000339491:R455H;ENSP00000414273:R483H	ENSP00000329568:R455H	R	-	2	0	NLRP7	60142635	0.000000	0.05858	0.001000	0.08648	0.046000	0.14306	-1.226000	0.02953	-0.626000	0.05596	-0.379000	0.06801	CGC	NLRP7	-	NULL	ENSG00000167634		0.617	NLRP7-003	KNOWN	basic|CCDS	protein_coding	NLRP7	HGNC	protein_coding	OTTHUMT00000451396.1	49	0.00	0	C	NM_139176		55450823	55450823	-1	no_errors	ENST00000446217	ensembl	human	known	69_37n	missense	75	24.24	24	SNP	0.000	T
OR2M5	127059	genome.wustl.edu	37	1	248308750	248308750	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr1:248308750A>G	ENST00000366476.1	+	1	301	c.301A>G	c.(301-303)Att>Gtt	p.I101V		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			TGCCACACAAATTTTCTTCTA	0.463																																						dbGAP											0													292.0	289.0	290.0					1																	248308750		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.301A>G	1.37:g.248308750A>G	ENSP00000355432:p.Ile101Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I101V	ENST00000366476.1	37	c.301	CCDS31105.1	1	.	.	.	.	.	.	.	.	.	.	a	16.53	3.148068	0.57151	.	.	ENSG00000162727	ENST00000366476	T	0.00486	7.06	3.28	1.99	0.26369	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32218	U	0.006408	T	0.00328	0.0010	L	0.31476	0.935	0.21473	N	0.999672	P	0.45768	0.866	P	0.46585	0.521	T	0.52388	-0.8582	10	0.54805	T	0.06	.	0.5626	0.00681	0.4494:0.195:0.1648:0.1908	.	101	A3KFT3	OR2M5_HUMAN	V	101	ENSP00000355432:I101V	ENSP00000355432:I101V	I	+	1	0	OR2M5	246375373	0.000000	0.05858	0.147000	0.22382	0.641000	0.38312	-0.533000	0.06157	1.250000	0.43966	0.403000	0.27427	ATT	OR2M5	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000162727		0.463	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M5	HGNC	protein_coding	OTTHUMT00000097343.1	706	0.00	0	A	NM_001004690		248308750	248308750	+1	no_errors	ENST00000366476	ensembl	human	known	69_37n	missense	1119	17.71	241	SNP	0.992	G
OR2M5	127059	genome.wustl.edu	37	1	248308750	248308750	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr1:248308750A>G	ENST00000366476.1	+	1	301	c.301A>G	c.(301-303)Att>Gtt	p.I101V		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			TGCCACACAAATTTTCTTCTA	0.463																																						dbGAP											0													292.0	289.0	290.0					1																	248308750		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.301A>G	1.37:g.248308750A>G	ENSP00000355432:p.Ile101Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I101V	ENST00000366476.1	37	c.301	CCDS31105.1	1	.	.	.	.	.	.	.	.	.	.	a	16.53	3.148068	0.57151	.	.	ENSG00000162727	ENST00000366476	T	0.00486	7.06	3.28	1.99	0.26369	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32218	U	0.006408	T	0.00328	0.0010	L	0.31476	0.935	0.21473	N	0.999672	P	0.45768	0.866	P	0.46585	0.521	T	0.52388	-0.8582	10	0.54805	T	0.06	.	0.5626	0.00681	0.4494:0.195:0.1648:0.1908	.	101	A3KFT3	OR2M5_HUMAN	V	101	ENSP00000355432:I101V	ENSP00000355432:I101V	I	+	1	0	OR2M5	246375373	0.000000	0.05858	0.147000	0.22382	0.641000	0.38312	-0.533000	0.06157	1.250000	0.43966	0.403000	0.27427	ATT	OR2M5	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000162727		0.463	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M5	HGNC	protein_coding	OTTHUMT00000097343.1	720	0.28	2	A	NM_001004690		248308750	248308750	+1	no_errors	ENST00000366476	ensembl	human	known	69_37n	missense	1119	17.71	241	SNP	0.992	G
OR2T3	343173	genome.wustl.edu	37	1	248637013	248637013	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr1:248637013C>A	ENST00000359594.2	+	1	387	c.362C>A	c.(361-363)gCt>gAt	p.A121D		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	121						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTCCTCCTGGCTGCCATGGCC	0.572																																						dbGAP											0													75.0	71.0	72.0					1																	248637013		2195	4298	6493	-	-	-	SO:0001583	missense	0				CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.362C>A	1.37:g.248637013C>A	ENSP00000352604:p.Ala121Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A121D	ENST00000359594.2	37	c.362	CCDS31117.1	1	.	.	.	.	.	.	.	.	.	.	c	17.00	3.275792	0.59649	.	.	ENSG00000196539	ENST00000359594	T	0.01369	4.97	2.65	-5.3	0.02738	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.06826	0.0174	H	0.94808	3.585	0.09310	N	1	P	0.52692	0.955	P	0.52710	0.707	T	0.00007	-1.2492	9	0.87932	D	0	.	9.8642	0.41134	0.0:0.7238:0.1655:0.1107	.	121	Q8NH03	OR2T3_HUMAN	D	121	ENSP00000352604:A121D	ENSP00000352604:A121D	A	+	2	0	OR2T3	246703636	0.000000	0.05858	0.000000	0.03702	0.572000	0.35998	0.412000	0.21131	-2.045000	0.00910	0.186000	0.17326	GCT	OR2T3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196539		0.572	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T3	HGNC	protein_coding	OTTHUMT00000097348.1	283	0.00	0	C	NM_001005495		248637013	248637013	+1	no_errors	ENST00000359594	ensembl	human	known	69_37n	missense	488	31.75	227	SNP	0.000	A
OR2T3	343173	genome.wustl.edu	37	1	248637013	248637013	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr1:248637013C>A	ENST00000359594.2	+	1	387	c.362C>A	c.(361-363)gCt>gAt	p.A121D		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	121						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTCCTCCTGGCTGCCATGGCC	0.572																																						dbGAP											0													75.0	71.0	72.0					1																	248637013		2195	4298	6493	-	-	-	SO:0001583	missense	0				CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.362C>A	1.37:g.248637013C>A	ENSP00000352604:p.Ala121Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A121D	ENST00000359594.2	37	c.362	CCDS31117.1	1	.	.	.	.	.	.	.	.	.	.	c	17.00	3.275792	0.59649	.	.	ENSG00000196539	ENST00000359594	T	0.01369	4.97	2.65	-5.3	0.02738	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.06826	0.0174	H	0.94808	3.585	0.09310	N	1	P	0.52692	0.955	P	0.52710	0.707	T	0.00007	-1.2492	9	0.87932	D	0	.	9.8642	0.41134	0.0:0.7238:0.1655:0.1107	.	121	Q8NH03	OR2T3_HUMAN	D	121	ENSP00000352604:A121D	ENSP00000352604:A121D	A	+	2	0	OR2T3	246703636	0.000000	0.05858	0.000000	0.03702	0.572000	0.35998	0.412000	0.21131	-2.045000	0.00910	0.186000	0.17326	GCT	OR2T3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196539		0.572	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T3	HGNC	protein_coding	OTTHUMT00000097348.1	245	0.40	1	C	NM_001005495		248637013	248637013	+1	no_errors	ENST00000359594	ensembl	human	known	69_37n	missense	488	31.75	227	SNP	0.000	A
OR56A1	120796	genome.wustl.edu	37	11	6048719	6048719	+	Silent	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr11:6048719G>C	ENST00000316650.5	-	1	252	c.216C>G	c.(214-216)ctC>ctG	p.L72L		NM_001001917.2	NP_001001917.2	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A, member 1	72						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(22)|ovary(2)	33		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCAGGGAGAGGAGGCTGAGCA	0.597																																						dbGAP											0													78.0	74.0	75.0					11																	6048719		2201	4293	6494	-	-	-	SO:0001819	synonymous_variant	0			AB065821	CCDS31405.1	11p15.4	2012-08-09			ENSG00000180934	ENSG00000180934		"""GPCR / Class A : Olfactory receptors"""	14781	protein-coding gene	gene with protein product							Standard	NM_001001917		Approved		uc010qzw.2	Q8NGH5	OTTHUMG00000165377	ENST00000316650.5:c.216C>G	11.37:g.6048719G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNI2|Q6IFL0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L72	ENST00000316650.5	37	c.216	CCDS31405.1	11																																																																																			OR56A1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000180934		0.597	OR56A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56A1	HGNC	protein_coding	OTTHUMT00000383757.1	371	0.00	0	G	NM_001001917		6048719	6048719	-1	no_errors	ENST00000316650	ensembl	human	known	69_37n	silent	617	18.90	144	SNP	0.072	C
OR56A1	120796	genome.wustl.edu	37	11	6048719	6048719	+	Silent	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr11:6048719G>C	ENST00000316650.5	-	1	252	c.216C>G	c.(214-216)ctC>ctG	p.L72L		NM_001001917.2	NP_001001917.2	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A, member 1	72						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(22)|ovary(2)	33		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCAGGGAGAGGAGGCTGAGCA	0.597																																						dbGAP											0													78.0	74.0	75.0					11																	6048719		2201	4293	6494	-	-	-	SO:0001819	synonymous_variant	0			AB065821	CCDS31405.1	11p15.4	2012-08-09			ENSG00000180934	ENSG00000180934		"""GPCR / Class A : Olfactory receptors"""	14781	protein-coding gene	gene with protein product							Standard	NM_001001917		Approved		uc010qzw.2	Q8NGH5	OTTHUMG00000165377	ENST00000316650.5:c.216C>G	11.37:g.6048719G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNI2|Q6IFL0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L72	ENST00000316650.5	37	c.216	CCDS31405.1	11																																																																																			OR56A1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000180934		0.597	OR56A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56A1	HGNC	protein_coding	OTTHUMT00000383757.1	339	0.29	1	G	NM_001001917		6048719	6048719	-1	no_errors	ENST00000316650	ensembl	human	known	69_37n	silent	617	18.90	144	SNP	0.072	C
OR6C70	390327	genome.wustl.edu	37	12	55862990	55862990	+	Missense_Mutation	SNP	G	G	T	rs7295538	byFrequency	TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr12:55862990G>T	ENST00000327335.4	-	1	932	c.933C>A	c.(931-933)gaC>gaA	p.D311E	RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA	NM_001005499.1	NP_001005499.1	A6NIJ9	O6C70_HUMAN	olfactory receptor, family 6, subfamily C, member 70	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	18						TGTATTACTTGTCTGAAGCAG	0.308																																						dbGAP											0													35.0	36.0	36.0					12																	55862990		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS31825.1	12q13.2	2013-09-23			ENSG00000184954	ENSG00000184954		"""GPCR / Class A : Olfactory receptors"""	31299	protein-coding gene	gene with protein product							Standard	NM_001005499		Approved		uc010spn.2	A6NIJ9	OTTHUMG00000171127	ENST00000327335.4:c.933C>A	12.37:g.55862990G>T	ENSP00000329153:p.Asp311Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.D311E	ENST00000327335.4	37	c.933	CCDS31825.1	12	.	.	.	.	.	.	.	.	.	.	G	8.935	0.964419	0.18583	.	.	ENSG00000184954	ENST00000327335	T	0.09073	3.02	4.0	0.674	0.17946	.	2.007490	0.02548	N	0.095358	T	0.05686	0.0149	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37150	-0.9718	10	0.56958	D	0.05	.	2.8194	0.05467	0.0952:0.1427:0.2839:0.4781	.	311	A6NIJ9	O6C70_HUMAN	E	311	ENSP00000329153:D311E	ENSP00000329153:D311E	D	-	3	2	OR6C70	54149257	0.000000	0.05858	0.030000	0.17652	0.144000	0.21451	-1.363000	0.02592	0.432000	0.26286	0.633000	0.83428	GAC	OR6C70	-	NULL	ENSG00000184954		0.308	OR6C70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C70	HGNC	protein_coding	OTTHUMT00000411820.1	85	0.00	0	G			55862990	55862990	-1	no_errors	ENST00000327335	ensembl	human	known	69_37n	missense	46	16.36	9	SNP	0.002	T
OR6C70	390327	genome.wustl.edu	37	12	55862990	55862990	+	Missense_Mutation	SNP	G	G	T	rs7295538	byFrequency	TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr12:55862990G>T	ENST00000327335.4	-	1	932	c.933C>A	c.(931-933)gaC>gaA	p.D311E	RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA	NM_001005499.1	NP_001005499.1	A6NIJ9	O6C70_HUMAN	olfactory receptor, family 6, subfamily C, member 70	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	18						TGTATTACTTGTCTGAAGCAG	0.308																																						dbGAP											0													35.0	36.0	36.0					12																	55862990		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS31825.1	12q13.2	2013-09-23			ENSG00000184954	ENSG00000184954		"""GPCR / Class A : Olfactory receptors"""	31299	protein-coding gene	gene with protein product							Standard	NM_001005499		Approved		uc010spn.2	A6NIJ9	OTTHUMG00000171127	ENST00000327335.4:c.933C>A	12.37:g.55862990G>T	ENSP00000329153:p.Asp311Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.D311E	ENST00000327335.4	37	c.933	CCDS31825.1	12	.	.	.	.	.	.	.	.	.	.	G	8.935	0.964419	0.18583	.	.	ENSG00000184954	ENST00000327335	T	0.09073	3.02	4.0	0.674	0.17946	.	2.007490	0.02548	N	0.095358	T	0.05686	0.0149	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37150	-0.9718	10	0.56958	D	0.05	.	2.8194	0.05467	0.0952:0.1427:0.2839:0.4781	.	311	A6NIJ9	O6C70_HUMAN	E	311	ENSP00000329153:D311E	ENSP00000329153:D311E	D	-	3	2	OR6C70	54149257	0.000000	0.05858	0.030000	0.17652	0.144000	0.21451	-1.363000	0.02592	0.432000	0.26286	0.633000	0.83428	GAC	OR6C70	-	NULL	ENSG00000184954		0.308	OR6C70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C70	HGNC	protein_coding	OTTHUMT00000411820.1	97	0.00	0	G			55862990	55862990	-1	no_errors	ENST00000327335	ensembl	human	known	69_37n	missense	46	16.36	9	SNP	0.002	T
OR9G4	283189	genome.wustl.edu	37	11	56510936	56510936	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr11:56510936A>G	ENST00000302957.3	-	1	351	c.352T>C	c.(352-354)Ttt>Ctt	p.F118L		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						ACACAGGAAAAAAACAGCTGA	0.473																																						dbGAP											0													100.0	105.0	103.0					11																	56510936		2201	4296	6497	-	-	-	SO:0001583	missense	0			BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.352T>C	11.37:g.56510936A>G	ENSP00000307515:p.Phe118Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF62|Q96RA9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F118L	ENST00000302957.3	37	c.352	CCDS31537.1	11	.	.	.	.	.	.	.	.	.	.	A	21.0	4.075121	0.76415	.	.	ENSG00000172457	ENST00000302957	T	0.00495	6.99	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40554	N	0.001073	T	0.00815	0.0027	L	0.31065	0.9	0.42207	D	0.991799	D	0.69078	0.997	D	0.70716	0.97	D	0.83757	0.0212	10	0.41790	T	0.15	-37.8028	9.2577	0.37593	0.839:0.0:0.0:0.1609	.	118	Q8NGQ1	OR9G4_HUMAN	L	118	ENSP00000307515:F118L	ENSP00000307515:F118L	F	-	1	0	OR9G4	56267512	0.188000	0.23250	0.961000	0.40146	0.939000	0.58152	1.999000	0.40806	2.131000	0.65755	0.523000	0.50628	TTT	OR9G4	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172457		0.473	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9G4	HGNC	protein_coding	OTTHUMT00000391945.1	95	0.00	0	A	NM_001005284		56510936	56510936	-1	no_errors	ENST00000302957	ensembl	human	known	69_37n	missense	123	20.65	32	SNP	0.999	G
PALLD	23022	genome.wustl.edu	37	4	169433082	169433082	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr4:169433082C>T	ENST00000505667.1	+	2	600	c.427C>T	c.(427-429)Cgt>Tgt	p.R143C	PALLD_ENST00000335742.7_5'UTR|PALLD_ENST00000261509.6_Missense_Mutation_p.R143C|PALLD_ENST00000333488.4_Missense_Mutation_p.R20C			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	143					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		GGCTGAAAAGCGTGGTGCAAA	0.512									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)	dbGAP											0													42.0	49.0	47.0					4																	169433082		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.427C>T	4.37:g.169433082C>T	ENSP00000425556:p.Arg143Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R143C	ENST00000505667.1	37	c.427	CCDS54818.1	4	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150066	0.37923	.	.	ENSG00000129116	ENST00000261509;ENST00000505667;ENST00000508898;ENST00000333488	T;T;T;T	0.65916	-0.04;0.23;-0.18;-0.08	5.55	4.71	0.59529	.	0.000000	0.31963	U	0.006784	T	0.53433	0.1796	L	0.54323	1.7	0.27516	N	0.95154	B;B	0.11235	0.004;0.004	B;B	0.04013	0.001;0.001	T	0.53408	-0.8443	10	0.66056	D	0.02	.	6.2537	0.20861	0.0:0.6476:0.1371:0.2153	.	143;143	B7ZMM5;B2RTX2	.;.	C	143;143;122;20	ENSP00000261509:R143C;ENSP00000425556:R143C;ENSP00000423063:R122C;ENSP00000328945:R20C	ENSP00000261509:R143C	R	+	1	0	PALLD	169669657	0.000000	0.05858	0.011000	0.14972	0.026000	0.11368	0.011000	0.13264	1.350000	0.45770	0.591000	0.81541	CGT	PALLD	-	NULL	ENSG00000129116		0.512	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PALLD	HGNC	protein_coding	OTTHUMT00000363762.1	54	0.00	0	C	NM_016081		169433082	169433082	+1	no_errors	ENST00000261509	ensembl	human	known	69_37n	missense	32	34.69	17	SNP	0.016	T
PER2	8864	genome.wustl.edu	37	2	239164504	239164504	+	Missense_Mutation	SNP	G	G	A	rs563977205	byFrequency	TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr2:239164504G>A	ENST00000254657.3	-	18	2393	c.2114C>T	c.(2113-2115)gCg>gTg	p.A705V	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	705	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		GGCAGGGCCCGCCAGGCAGTC	0.582													G|||	9	0.00179712	0.0008	0.0	5008	,	,		15763	0.0		0.0	False		,,,				2504	0.0082					dbGAP											0													75.0	84.0	81.0					2																	239164504		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2114C>T	2.37:g.239164504G>A	ENSP00000254657:p.Ala705Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.A705V	ENST00000254657.3	37	c.2114	CCDS2528.1	2	.	.	.	.	.	.	.	.	.	.	G	9.723	1.160278	0.21454	.	.	ENSG00000132326	ENST00000254657	T	0.11495	2.77	3.78	-7.57	0.01318	.	25.511700	0.00166	N	0.000000	T	0.09818	0.0241	L	0.45581	1.43	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.14587	-1.0467	10	0.24483	T	0.36	-0.0418	9.0848	0.36574	0.2385:0.0:0.6531:0.1084	.	705	O15055	PER2_HUMAN	V	705	ENSP00000254657:A705V	ENSP00000254657:A705V	A	-	2	0	PER2	238829243	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.087000	0.11215	-2.316000	0.00645	-1.159000	0.01794	GCG	PER2	-	NULL	ENSG00000132326		0.582	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER2	HGNC	protein_coding	OTTHUMT00000257167.1	100	0.00	0	G	NM_022817		239164504	239164504	-1	no_errors	ENST00000254657	ensembl	human	known	69_37n	missense	142	12.27	20	SNP	0.000	A
PER2	8864	genome.wustl.edu	37	2	239164504	239164504	+	Missense_Mutation	SNP	G	G	A	rs563977205	byFrequency	TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr2:239164504G>A	ENST00000254657.3	-	18	2393	c.2114C>T	c.(2113-2115)gCg>gTg	p.A705V	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	705	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		GGCAGGGCCCGCCAGGCAGTC	0.582													G|||	9	0.00179712	0.0008	0.0	5008	,	,		15763	0.0		0.0	False		,,,				2504	0.0082					dbGAP											0													75.0	84.0	81.0					2																	239164504		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2114C>T	2.37:g.239164504G>A	ENSP00000254657:p.Ala705Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.A705V	ENST00000254657.3	37	c.2114	CCDS2528.1	2	.	.	.	.	.	.	.	.	.	.	G	9.723	1.160278	0.21454	.	.	ENSG00000132326	ENST00000254657	T	0.11495	2.77	3.78	-7.57	0.01318	.	25.511700	0.00166	N	0.000000	T	0.09818	0.0241	L	0.45581	1.43	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.14587	-1.0467	10	0.24483	T	0.36	-0.0418	9.0848	0.36574	0.2385:0.0:0.6531:0.1084	.	705	O15055	PER2_HUMAN	V	705	ENSP00000254657:A705V	ENSP00000254657:A705V	A	-	2	0	PER2	238829243	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.087000	0.11215	-2.316000	0.00645	-1.159000	0.01794	GCG	PER2	-	NULL	ENSG00000132326		0.582	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER2	HGNC	protein_coding	OTTHUMT00000257167.1	106	0.93	1	G	NM_022817		239164504	239164504	-1	no_errors	ENST00000254657	ensembl	human	known	69_37n	missense	142	12.27	20	SNP	0.000	A
PLIN1	5346	genome.wustl.edu	37	15	90210242	90210242	+	Silent	SNP	C	C	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr15:90210242C>G	ENST00000300055.5	-	8	1299	c.1134G>C	c.(1132-1134)ggG>ggC	p.G378G	PLIN1_ENST00000430628.2_Silent_p.G378G	NM_002666.4	NP_002657.3	O60240	PLIN1_HUMAN	perilipin 1	378					lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)	lipid binding (GO:0008289)	p.G378G(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(2)	13						ACATGGCCCTCCCCTTGGTTG	0.612																																						dbGAP											1	Substitution - coding silent(1)	central_nervous_system(1)											72.0	59.0	63.0					15																	90210242		2200	4299	6499	-	-	-	SO:0001819	synonymous_variant	0			AB005293	CCDS10353.1	15q26	2009-08-12	2009-08-12	2009-08-12	ENSG00000166819	ENSG00000166819		"""Perilipins"""	9076	protein-coding gene	gene with protein product		170290	"""perilipin"""	PLIN		9521880, 19638644	Standard	NM_002666		Approved		uc010upx.1	O60240	OTTHUMG00000149813	ENST00000300055.5:c.1134G>C	15.37:g.90210242C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5Y6	Silent	SNP	pfam_Perilipin,pirsf_Perilipin	p.G378	ENST00000300055.5	37	c.1134	CCDS10353.1	15																																																																																			PLIN1	-	pfam_Perilipin,pirsf_Perilipin	ENSG00000166819		0.612	PLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLIN1	HGNC	protein_coding	OTTHUMT00000313424.2	66	0.00	0	C	NM_002666		90210242	90210242	-1	no_errors	ENST00000300055	ensembl	human	known	69_37n	silent	79	27.52	30	SNP	0.007	G
PLIN1	5346	genome.wustl.edu	37	15	90210242	90210242	+	Silent	SNP	C	C	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr15:90210242C>G	ENST00000300055.5	-	8	1299	c.1134G>C	c.(1132-1134)ggG>ggC	p.G378G	PLIN1_ENST00000430628.2_Silent_p.G378G	NM_002666.4	NP_002657.3	O60240	PLIN1_HUMAN	perilipin 1	378					lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)	lipid binding (GO:0008289)	p.G378G(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(2)	13						ACATGGCCCTCCCCTTGGTTG	0.612																																						dbGAP											1	Substitution - coding silent(1)	central_nervous_system(1)											72.0	59.0	63.0					15																	90210242		2200	4299	6499	-	-	-	SO:0001819	synonymous_variant	0			AB005293	CCDS10353.1	15q26	2009-08-12	2009-08-12	2009-08-12	ENSG00000166819	ENSG00000166819		"""Perilipins"""	9076	protein-coding gene	gene with protein product		170290	"""perilipin"""	PLIN		9521880, 19638644	Standard	NM_002666		Approved		uc010upx.1	O60240	OTTHUMG00000149813	ENST00000300055.5:c.1134G>C	15.37:g.90210242C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5Y6	Silent	SNP	pfam_Perilipin,pirsf_Perilipin	p.G378	ENST00000300055.5	37	c.1134	CCDS10353.1	15																																																																																			PLIN1	-	pfam_Perilipin,pirsf_Perilipin	ENSG00000166819		0.612	PLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLIN1	HGNC	protein_coding	OTTHUMT00000313424.2	50	0.00	0	C	NM_002666		90210242	90210242	-1	no_errors	ENST00000300055	ensembl	human	known	69_37n	silent	79	27.52	30	SNP	0.007	G
POU6F2	11281	genome.wustl.edu	37	7	39379419	39379419	+	Silent	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr7:39379419C>T	ENST00000403058.1	+	6	844	c.690C>T	c.(688-690)ccC>ccT	p.P230P	POU6F2_ENST00000518318.2_Silent_p.P230P|POU6F2_ENST00000559001.1_Silent_p.P222P|POU6F2_ENST00000517348.1_3'UTR	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	230	Gln-rich.|Pro-rich.				central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						agccaccacccgcctctcagc	0.682																																						dbGAP											0													43.0	48.0	47.0					7																	39379419		2176	4249	6425	-	-	-	SO:0001819	synonymous_variant	0			U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.690C>T	7.37:g.39379419C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Silent	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Lambda_DNA-bd_dom,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.P230	ENST00000403058.1	37	c.690	CCDS34620.2	7																																																																																			POU6F2	-	NULL	ENSG00000106536		0.682	POU6F2-002	KNOWN	basic|CCDS	protein_coding	POU6F2	HGNC	protein_coding	OTTHUMT00000320146.3	224	0.44	1	C	NM_007252		39379419	39379419	+1	no_errors	ENST00000403058	ensembl	human	known	69_37n	silent	352	23.92	111	SNP	0.119	T
RAPGEF1	2889	genome.wustl.edu	37	9	134514093	134514093	+	Missense_Mutation	SNP	C	C	T	rs537239858		TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr9:134514093C>T	ENST00000372189.3	-	5	652	c.529G>A	c.(529-531)Gtg>Atg	p.V177M	RAPGEF1_ENST00000372190.3_Missense_Mutation_p.V195M|RAPGEF1_ENST00000481260.1_5'UTR|RAPGEF1_ENST00000372195.1_Missense_Mutation_p.V194M	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	177					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		TCTGAGTTCACGCCTTCCAGC	0.552																																						dbGAP											0													94.0	97.0	96.0					9																	134514093		2118	4225	6343	-	-	-	SO:0001583	missense	0			BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.529G>A	9.37:g.134514093C>T	ENSP00000361263:p.Val177Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JUE4|Q8IV73	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.V195M	ENST00000372189.3	37	c.583	CCDS48047.1	9	.	.	.	.	.	.	.	.	.	.	C	25.3	4.619501	0.87460	.	.	ENSG00000107263	ENST00000266110;ENST00000372195;ENST00000429421;ENST00000372189;ENST00000372190;ENST00000411834;ENST00000337036;ENST00000357686;ENST00000438647	T;T;T	0.37915	1.17;1.17;1.17	5.79	5.79	0.91817	.	0.395702	0.27513	N	0.019032	T	0.57213	0.2038	L	0.60455	1.87	0.51767	D	0.999934	D;D;D	0.76494	0.998;0.998;0.999	P;P;D	0.64595	0.847;0.847;0.927	T	0.55811	-0.8082	10	0.62326	D	0.03	.	19.0153	0.92892	0.0:1.0:0.0:0.0	.	194;177;195	Q68DL3;Q13905;Q13905-3	.;RPGF1_HUMAN;.	M	177;194;71;177;195;157;103;194;156	ENSP00000361269:V194M;ENSP00000361263:V177M;ENSP00000361264:V195M	ENSP00000266110:V177M	V	-	1	0	RAPGEF1	133503914	1.000000	0.71417	0.969000	0.41365	0.968000	0.65278	4.320000	0.59203	2.744000	0.94065	0.650000	0.86243	GTG	RAPGEF1	-	NULL	ENSG00000107263		0.552	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	RAPGEF1	HGNC	protein_coding	OTTHUMT00000054759.2	335	0.00	0	C	NM_005312		134514093	134514093	-1	no_errors	ENST00000372190	ensembl	human	known	69_37n	missense	297	21.64	82	SNP	0.997	T
RAPGEF1	2889	genome.wustl.edu	37	9	134514093	134514093	+	Missense_Mutation	SNP	C	C	T	rs537239858		TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr9:134514093C>T	ENST00000372189.3	-	5	652	c.529G>A	c.(529-531)Gtg>Atg	p.V177M	RAPGEF1_ENST00000372190.3_Missense_Mutation_p.V195M|RAPGEF1_ENST00000481260.1_5'UTR|RAPGEF1_ENST00000372195.1_Missense_Mutation_p.V194M	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	177					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		TCTGAGTTCACGCCTTCCAGC	0.552																																						dbGAP											0													94.0	97.0	96.0					9																	134514093		2118	4225	6343	-	-	-	SO:0001583	missense	0			BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.529G>A	9.37:g.134514093C>T	ENSP00000361263:p.Val177Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JUE4|Q8IV73	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.V195M	ENST00000372189.3	37	c.583	CCDS48047.1	9	.	.	.	.	.	.	.	.	.	.	C	25.3	4.619501	0.87460	.	.	ENSG00000107263	ENST00000266110;ENST00000372195;ENST00000429421;ENST00000372189;ENST00000372190;ENST00000411834;ENST00000337036;ENST00000357686;ENST00000438647	T;T;T	0.37915	1.17;1.17;1.17	5.79	5.79	0.91817	.	0.395702	0.27513	N	0.019032	T	0.57213	0.2038	L	0.60455	1.87	0.51767	D	0.999934	D;D;D	0.76494	0.998;0.998;0.999	P;P;D	0.64595	0.847;0.847;0.927	T	0.55811	-0.8082	10	0.62326	D	0.03	.	19.0153	0.92892	0.0:1.0:0.0:0.0	.	194;177;195	Q68DL3;Q13905;Q13905-3	.;RPGF1_HUMAN;.	M	177;194;71;177;195;157;103;194;156	ENSP00000361269:V194M;ENSP00000361263:V177M;ENSP00000361264:V195M	ENSP00000266110:V177M	V	-	1	0	RAPGEF1	133503914	1.000000	0.71417	0.969000	0.41365	0.968000	0.65278	4.320000	0.59203	2.744000	0.94065	0.650000	0.86243	GTG	RAPGEF1	-	NULL	ENSG00000107263		0.552	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	RAPGEF1	HGNC	protein_coding	OTTHUMT00000054759.2	338	0.59	2	C	NM_005312		134514093	134514093	-1	no_errors	ENST00000372190	ensembl	human	known	69_37n	missense	297	21.64	82	SNP	0.997	T
RPP30	10556	genome.wustl.edu	37	10	92638822	92638822	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr10:92638822A>T	ENST00000371703.3	+	5	544	c.273A>T	c.(271-273)agA>agT	p.R91S	RPP30_ENST00000413330.1_Missense_Mutation_p.R91S|Y_RNA_ENST00000410373.1_RNA	NM_006413.4	NP_006404.1	P78346	RPP30_HUMAN	ribonuclease P/MRP 30kDa subunit	91					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ribonuclease P activity (GO:0004526)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	8						ATTCCTAGAGAGCAACTTCTT	0.343																																						dbGAP											0													90.0	93.0	92.0					10																	92638822		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC006991	CCDS7411.1, CCDS44458.1	10q23.32-q23.33	2012-05-21			ENSG00000148688	ENSG00000148688			17688	protein-coding gene	gene with protein product		606115				9037013, 9308968	Standard	NM_006413		Approved	TSG15	uc001khd.2	P78346	OTTHUMG00000018733	ENST00000371703.3:c.273A>T	10.37:g.92638822A>T	ENSP00000360768:p.Arg91Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R799|E9PB02	Missense_Mutation	SNP	pfam_RNase_P_p30,superfamily_Pol/histidinol_Pase-like	p.R91S	ENST00000371703.3	37	c.273	CCDS7411.1	10	.	.	.	.	.	.	.	.	.	.	A	16.48	3.134870	0.56828	.	.	ENSG00000148688	ENST00000371703;ENST00000413330;ENST00000371705;ENST00000277882;ENST00000414836	T;T;T	0.44083	0.93;0.93;0.95	5.64	4.52	0.55395	Polymerase/histidinol phosphatase-like (1);	0.000000	0.85682	D	0.000000	T	0.49795	0.1578	L	0.28694	0.88	0.53005	D	0.999963	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.984;0.998;0.993	T	0.47548	-0.9109	10	0.51188	T	0.08	-17.5082	10.4936	0.44764	0.9227:0.0:0.0773:0.0	.	91;91;91	B4DJR3;P78346;E9PB02	.;RPP30_HUMAN;.	S	91;91;91;113;45	ENSP00000360768:R91S;ENSP00000389182:R91S;ENSP00000277882:R113S	ENSP00000277882:R113S	R	+	3	2	RPP30	92628802	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.747000	0.47475	0.983000	0.38602	0.528000	0.53228	AGA	RPP30	-	pfam_RNase_P_p30,superfamily_Pol/histidinol_Pase-like	ENSG00000148688		0.343	RPP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPP30	HGNC	protein_coding	OTTHUMT00000049347.1	373	0.00	0	A	NM_006413		92638822	92638822	+1	no_errors	ENST00000413330	ensembl	human	known	69_37n	missense	188	18.97	44	SNP	1.000	T
RPP30	10556	genome.wustl.edu	37	10	92638822	92638822	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr10:92638822A>T	ENST00000371703.3	+	5	544	c.273A>T	c.(271-273)agA>agT	p.R91S	RPP30_ENST00000413330.1_Missense_Mutation_p.R91S|Y_RNA_ENST00000410373.1_RNA	NM_006413.4	NP_006404.1	P78346	RPP30_HUMAN	ribonuclease P/MRP 30kDa subunit	91					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ribonuclease P activity (GO:0004526)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	8						ATTCCTAGAGAGCAACTTCTT	0.343																																						dbGAP											0													90.0	93.0	92.0					10																	92638822		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC006991	CCDS7411.1, CCDS44458.1	10q23.32-q23.33	2012-05-21			ENSG00000148688	ENSG00000148688			17688	protein-coding gene	gene with protein product		606115				9037013, 9308968	Standard	NM_006413		Approved	TSG15	uc001khd.2	P78346	OTTHUMG00000018733	ENST00000371703.3:c.273A>T	10.37:g.92638822A>T	ENSP00000360768:p.Arg91Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R799|E9PB02	Missense_Mutation	SNP	pfam_RNase_P_p30,superfamily_Pol/histidinol_Pase-like	p.R91S	ENST00000371703.3	37	c.273	CCDS7411.1	10	.	.	.	.	.	.	.	.	.	.	A	16.48	3.134870	0.56828	.	.	ENSG00000148688	ENST00000371703;ENST00000413330;ENST00000371705;ENST00000277882;ENST00000414836	T;T;T	0.44083	0.93;0.93;0.95	5.64	4.52	0.55395	Polymerase/histidinol phosphatase-like (1);	0.000000	0.85682	D	0.000000	T	0.49795	0.1578	L	0.28694	0.88	0.53005	D	0.999963	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.984;0.998;0.993	T	0.47548	-0.9109	10	0.51188	T	0.08	-17.5082	10.4936	0.44764	0.9227:0.0:0.0773:0.0	.	91;91;91	B4DJR3;P78346;E9PB02	.;RPP30_HUMAN;.	S	91;91;91;113;45	ENSP00000360768:R91S;ENSP00000389182:R91S;ENSP00000277882:R113S	ENSP00000277882:R113S	R	+	3	2	RPP30	92628802	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.747000	0.47475	0.983000	0.38602	0.528000	0.53228	AGA	RPP30	-	pfam_RNase_P_p30,superfamily_Pol/histidinol_Pase-like	ENSG00000148688		0.343	RPP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPP30	HGNC	protein_coding	OTTHUMT00000049347.1	466	0.85	4	A	NM_006413		92638822	92638822	+1	no_errors	ENST00000413330	ensembl	human	known	69_37n	missense	188	18.97	44	SNP	1.000	T
SCLT1	132320	genome.wustl.edu	37	4	129964598	129964598	+	Silent	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr4:129964598C>T	ENST00000281142.5	-	4	689	c.186G>A	c.(184-186)gaG>gaA	p.E62E	SCLT1_ENST00000503401.1_Silent_p.E39E|SCLT1_ENST00000511426.1_Silent_p.E62E|SCLT1_ENST00000439369.2_Silent_p.E62E|SCLT1_ENST00000503215.1_Silent_p.E39E|SCLT1_ENST00000506368.1_Silent_p.E62E|SCLT1_ENST00000434680.1_Silent_p.E62E	NM_144643.2	NP_653244.2	Q96NL6	SCLT1_HUMAN	sodium channel and clathrin linker 1	62					cilium assembly (GO:0042384)|clustering of voltage-gated sodium channels (GO:0045162)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|clathrin complex (GO:0071439)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)	sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	29						GTTTATCATACTCAGTAACAA	0.259																																						dbGAP											0													38.0	39.0	39.0					4																	129964598		2203	4289	6492	-	-	-	SO:0001819	synonymous_variant	0			AK055217	CCDS3740.1	4q28.2	2008-05-02			ENSG00000151466	ENSG00000151466			26406	protein-coding gene	gene with protein product		611399				15797711	Standard	XM_005262732		Approved	hCAP-1A, FLJ30655	uc003igp.2	Q96NL6	OTTHUMG00000133346	ENST00000281142.5:c.186G>A	4.37:g.129964598C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4QN04|Q0VAH2|Q6P2M4	Silent	SNP	NULL	p.E62	ENST00000281142.5	37	c.186	CCDS3740.1	4																																																																																			SCLT1	-	NULL	ENSG00000151466		0.259	SCLT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCLT1	HGNC	protein_coding	OTTHUMT00000257176.2	226	0.00	0	C	NM_144643		129964598	129964598	-1	no_errors	ENST00000281142	ensembl	human	known	69_37n	silent	38	11.63	5	SNP	1.000	T
SCLT1	132320	genome.wustl.edu	37	4	129964598	129964598	+	Silent	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr4:129964598C>T	ENST00000281142.5	-	4	689	c.186G>A	c.(184-186)gaG>gaA	p.E62E	SCLT1_ENST00000503401.1_Silent_p.E39E|SCLT1_ENST00000511426.1_Silent_p.E62E|SCLT1_ENST00000439369.2_Silent_p.E62E|SCLT1_ENST00000503215.1_Silent_p.E39E|SCLT1_ENST00000506368.1_Silent_p.E62E|SCLT1_ENST00000434680.1_Silent_p.E62E	NM_144643.2	NP_653244.2	Q96NL6	SCLT1_HUMAN	sodium channel and clathrin linker 1	62					cilium assembly (GO:0042384)|clustering of voltage-gated sodium channels (GO:0045162)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|clathrin complex (GO:0071439)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)	sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	29						GTTTATCATACTCAGTAACAA	0.259																																						dbGAP											0													38.0	39.0	39.0					4																	129964598		2203	4289	6492	-	-	-	SO:0001819	synonymous_variant	0			AK055217	CCDS3740.1	4q28.2	2008-05-02			ENSG00000151466	ENSG00000151466			26406	protein-coding gene	gene with protein product		611399				15797711	Standard	XM_005262732		Approved	hCAP-1A, FLJ30655	uc003igp.2	Q96NL6	OTTHUMG00000133346	ENST00000281142.5:c.186G>A	4.37:g.129964598C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4QN04|Q0VAH2|Q6P2M4	Silent	SNP	NULL	p.E62	ENST00000281142.5	37	c.186	CCDS3740.1	4																																																																																			SCLT1	-	NULL	ENSG00000151466		0.259	SCLT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCLT1	HGNC	protein_coding	OTTHUMT00000257176.2	285	0.00	0	C	NM_144643		129964598	129964598	-1	no_errors	ENST00000281142	ensembl	human	known	69_37n	silent	38	11.63	5	SNP	1.000	T
SIGLEC9	27180	genome.wustl.edu	37	19	51629007	51629007	+	Missense_Mutation	SNP	C	C	T	rs141623843	byFrequency	TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr19:51629007C>T	ENST00000250360.3	+	2	642	c.575C>T	c.(574-576)aCc>aTc	p.T192I	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.T192I	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	192	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GACCCCTCCACCACCCGCTCC	0.662													.|||	2	0.000399361	0.0	0.0014	5008	,	,		16509	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													69.0	69.0	69.0					19																	51629007		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.575C>T	19.37:g.51629007C>T	ENSP00000250360:p.Thr192Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GTU4|Q9BYI9	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.T192I	ENST00000250360.3	37	c.575	CCDS12825.1	19	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	.	7.817	0.716892	0.15306	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.02916	4.11;4.11	2.88	-3.13	0.05266	Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.966181	0.08456	N	0.943138	T	0.03220	0.0094	L	0.52905	1.665	0.09310	N	1	B	0.31790	0.34	B	0.33750	0.169	T	0.42565	-0.9444	10	0.38643	T	0.18	.	3.9711	0.09454	0.0:0.3508:0.384:0.2652	.	192	Q9Y336	SIGL9_HUMAN	I	192	ENSP00000413861:T192I;ENSP00000250360:T192I	ENSP00000250360:T192I	T	+	2	0	SIGLEC9	56320819	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.462000	0.06704	-0.337000	0.08426	-0.413000	0.06143	ACC	SIGLEC9	-	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	ENSG00000129450		0.662	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIGLEC9	HGNC	protein_coding	OTTHUMT00000464224.1	182	0.00	0	C	NM_014441		51629007	51629007	+1	no_errors	ENST00000440804	ensembl	human	known	69_37n	missense	117	37.70	72	SNP	0.000	T
SIGLEC9	27180	genome.wustl.edu	37	19	51629007	51629007	+	Missense_Mutation	SNP	C	C	T	rs141623843	byFrequency	TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr19:51629007C>T	ENST00000250360.3	+	2	642	c.575C>T	c.(574-576)aCc>aTc	p.T192I	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.T192I	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	192	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GACCCCTCCACCACCCGCTCC	0.662													.|||	2	0.000399361	0.0	0.0014	5008	,	,		16509	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													69.0	69.0	69.0					19																	51629007		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.575C>T	19.37:g.51629007C>T	ENSP00000250360:p.Thr192Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GTU4|Q9BYI9	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.T192I	ENST00000250360.3	37	c.575	CCDS12825.1	19	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	.	7.817	0.716892	0.15306	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.02916	4.11;4.11	2.88	-3.13	0.05266	Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.966181	0.08456	N	0.943138	T	0.03220	0.0094	L	0.52905	1.665	0.09310	N	1	B	0.31790	0.34	B	0.33750	0.169	T	0.42565	-0.9444	10	0.38643	T	0.18	.	3.9711	0.09454	0.0:0.3508:0.384:0.2652	.	192	Q9Y336	SIGL9_HUMAN	I	192	ENSP00000413861:T192I;ENSP00000250360:T192I	ENSP00000250360:T192I	T	+	2	0	SIGLEC9	56320819	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.462000	0.06704	-0.337000	0.08426	-0.413000	0.06143	ACC	SIGLEC9	-	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	ENSG00000129450		0.662	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIGLEC9	HGNC	protein_coding	OTTHUMT00000464224.1	97	0.00	0	C	NM_014441		51629007	51629007	+1	no_errors	ENST00000440804	ensembl	human	known	69_37n	missense	117	37.70	72	SNP	0.000	T
SORCS1	114815	genome.wustl.edu	37	10	108434901	108434901	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr10:108434901C>T	ENST00000263054.6	-	14	1853	c.1846G>A	c.(1846-1848)Gaa>Aaa	p.E616K	SORCS1_ENST00000344440.6_Missense_Mutation_p.E616K|SORCS1_ENST00000369698.1_Missense_Mutation_p.E151K	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	616					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GATCTCCCTTCATCAAAACTC	0.378																																						dbGAP											0													94.0	90.0	92.0					10																	108434901		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1846G>A	10.37:g.108434901C>T	ENSP00000263054:p.Glu616Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.E616K	ENST00000263054.6	37	c.1846	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	C	28.3	4.904948	0.92035	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.39229	1.09;1.09;1.09	5.92	5.02	0.67125	VPS10 (1);	0.048853	0.85682	N	0.000000	T	0.70613	0.3244	M	0.90309	3.105	0.48452	D	0.999656	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	T	0.77686	-0.2495	9	.	.	.	-17.4375	15.0633	0.71973	0.0:0.9322:0.0:0.0678	.	616;616;616;616;616	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	K	151;616;616	ENSP00000358712:E151K;ENSP00000263054:E616K;ENSP00000345964:E616K	.	E	-	1	0	SORCS1	108424891	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	1.521000	0.48983	0.655000	0.94253	GAA	SORCS1	-	smart_VPS10	ENSG00000108018		0.378	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	HGNC	protein_coding	OTTHUMT00000050232.4	303	0.00	0	C	NM_052918		108434901	108434901	-1	no_errors	ENST00000344440	ensembl	human	known	69_37n	missense	139	19.19	33	SNP	1.000	T
SORCS1	114815	genome.wustl.edu	37	10	108434901	108434901	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr10:108434901C>T	ENST00000263054.6	-	14	1853	c.1846G>A	c.(1846-1848)Gaa>Aaa	p.E616K	SORCS1_ENST00000344440.6_Missense_Mutation_p.E616K|SORCS1_ENST00000369698.1_Missense_Mutation_p.E151K	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	616					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GATCTCCCTTCATCAAAACTC	0.378																																						dbGAP											0													94.0	90.0	92.0					10																	108434901		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1846G>A	10.37:g.108434901C>T	ENSP00000263054:p.Glu616Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.E616K	ENST00000263054.6	37	c.1846	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	C	28.3	4.904948	0.92035	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.39229	1.09;1.09;1.09	5.92	5.02	0.67125	VPS10 (1);	0.048853	0.85682	N	0.000000	T	0.70613	0.3244	M	0.90309	3.105	0.48452	D	0.999656	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	T	0.77686	-0.2495	9	.	.	.	-17.4375	15.0633	0.71973	0.0:0.9322:0.0:0.0678	.	616;616;616;616;616	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	K	151;616;616	ENSP00000358712:E151K;ENSP00000263054:E616K;ENSP00000345964:E616K	.	E	-	1	0	SORCS1	108424891	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	1.521000	0.48983	0.655000	0.94253	GAA	SORCS1	-	smart_VPS10	ENSG00000108018		0.378	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	HGNC	protein_coding	OTTHUMT00000050232.4	371	0.80	3	C	NM_052918		108434901	108434901	-1	no_errors	ENST00000344440	ensembl	human	known	69_37n	missense	139	19.19	33	SNP	1.000	T
TAS1R2	80834	genome.wustl.edu	37	1	19186120	19186120	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr1:19186120A>T	ENST00000375371.3	-	1	56	c.35T>A	c.(34-36)tTc>tAc	p.F12Y	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	12					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TAGGAGGAAGAACAGGGAGGA	0.592																																						dbGAP											0													113.0	106.0	108.0					1																	19186120		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.35T>A	1.37:g.19186120A>T	ENSP00000364520:p.Phe12Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TZ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.F12Y	ENST00000375371.3	37	c.35	CCDS187.1	1	.	.	.	.	.	.	.	.	.	.	a	14.26	2.481996	0.44147	.	.	ENSG00000179002	ENST00000375371	D	0.88741	-2.42	4.46	0.549	0.17213	.	.	.	.	.	T	0.79986	0.4541	L	0.36672	1.1	0.09310	N	1	P	0.47106	0.89	B	0.40410	0.328	T	0.68375	-0.5425	9	0.32370	T	0.25	.	4.2659	0.10763	0.6336:0.1717:0.1947:0.0	.	12	Q8TE23	TS1R2_HUMAN	Y	12	ENSP00000364520:F12Y	ENSP00000364520:F12Y	F	-	2	0	TAS1R2	19058707	0.035000	0.19736	0.002000	0.10522	0.071000	0.16799	0.759000	0.26461	-0.100000	0.12241	0.255000	0.18592	TTC	TAS1R2	-	NULL	ENSG00000179002		0.592	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	HGNC	protein_coding	OTTHUMT00000006953.1	278	0.00	0	A			19186120	19186120	-1	no_errors	ENST00000375371	ensembl	human	novel	69_37n	missense	270	11.48	35	SNP	0.035	T
TAS1R2	80834	genome.wustl.edu	37	1	19186120	19186120	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr1:19186120A>T	ENST00000375371.3	-	1	56	c.35T>A	c.(34-36)tTc>tAc	p.F12Y	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	12					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TAGGAGGAAGAACAGGGAGGA	0.592																																						dbGAP											0													113.0	106.0	108.0					1																	19186120		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.35T>A	1.37:g.19186120A>T	ENSP00000364520:p.Phe12Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TZ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.F12Y	ENST00000375371.3	37	c.35	CCDS187.1	1	.	.	.	.	.	.	.	.	.	.	a	14.26	2.481996	0.44147	.	.	ENSG00000179002	ENST00000375371	D	0.88741	-2.42	4.46	0.549	0.17213	.	.	.	.	.	T	0.79986	0.4541	L	0.36672	1.1	0.09310	N	1	P	0.47106	0.89	B	0.40410	0.328	T	0.68375	-0.5425	9	0.32370	T	0.25	.	4.2659	0.10763	0.6336:0.1717:0.1947:0.0	.	12	Q8TE23	TS1R2_HUMAN	Y	12	ENSP00000364520:F12Y	ENSP00000364520:F12Y	F	-	2	0	TAS1R2	19058707	0.035000	0.19736	0.002000	0.10522	0.071000	0.16799	0.759000	0.26461	-0.100000	0.12241	0.255000	0.18592	TTC	TAS1R2	-	NULL	ENSG00000179002		0.592	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	HGNC	protein_coding	OTTHUMT00000006953.1	275	0.36	1	A			19186120	19186120	-1	no_errors	ENST00000375371	ensembl	human	novel	69_37n	missense	270	11.48	35	SNP	0.035	T
TBX3	6926	genome.wustl.edu	37	12	115114129	115114129	+	Missense_Mutation	SNP	G	G	C	rs374337915		TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr12:115114129G>C	ENST00000257566.3	-	6	1477	c.1088C>G	c.(1087-1089)tCg>tGg	p.S363W	TBX3_ENST00000349155.2_Missense_Mutation_p.S343W	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	363					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		TTTGAGGTTCGATGTCCCTAC	0.542																																						dbGAP											0													113.0	108.0	109.0					12																	115114129		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.1088C>G	12.37:g.115114129G>C	ENSP00000257566:p.Ser363Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB20|Q9UKF8	Missense_Mutation	SNP	pfam_TF_T-box,pfam_TBX,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.S363W	ENST00000257566.3	37	c.1088	CCDS9176.1	12	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721626	0.68959	.	.	ENSG00000135111	ENST00000349155;ENST00000257566;ENST00000361100	D;D	0.89485	-2.52;-2.51	4.69	4.69	0.59074	Transcription factor, T-box, region of unknown function (1);	1.602410	0.03021	N	0.150778	D	0.94125	0.8116	L	0.50333	1.59	0.58432	D	0.999991	D;D	0.69078	0.968;0.997	P;D	0.71870	0.883;0.975	D	0.84590	0.0666	10	0.87932	D	0	.	16.9525	0.86249	0.0:0.0:1.0:0.0	.	343;363	O15119-2;O15119	.;TBX3_HUMAN	W	343;363;363	ENSP00000257567:S343W;ENSP00000257566:S363W	ENSP00000257566:S363W	S	-	2	0	TBX3	113598512	1.000000	0.71417	0.421000	0.26609	0.955000	0.61496	7.109000	0.77062	2.297000	0.77311	0.655000	0.94253	TCG	TBX3	-	pfam_TBX	ENSG00000135111		0.542	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBX3	HGNC	protein_coding	OTTHUMT00000404947.2	247	0.00	0	G	NM_016569, NM_005996		115114129	115114129	-1	no_errors	ENST00000257566	ensembl	human	known	69_37n	missense	145	32.56	70	SNP	0.892	C
TP53	7157	genome.wustl.edu	37	17	7578542	7578542	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr17:7578542G>C	ENST00000269305.4	-	5	577	c.388C>G	c.(388-390)Ctc>Gtc	p.L130V	TP53_ENST00000420246.2_Missense_Mutation_p.L130V|TP53_ENST00000455263.2_Missense_Mutation_p.L130V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.L130V|TP53_ENST00000413465.2_Missense_Mutation_p.L130V|TP53_ENST00000359597.4_Missense_Mutation_p.L130V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	130	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> I (in a sporadic cancer; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L130F(16)|p.L130V(11)|p.0?(8)|p.Y126_K132delYSPALNK(6)|p.L37F(3)|p.Y126_N131delYSPALN(3)|p.L130fs*19(2)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.A129_L130insXX(1)|p.A129_N131delALN(1)|p.V73fs*9(1)|p.Y126fs*18(1)|p.L130fs*39(1)|p.L130fs*16(1)|p.A129_K132delALNK(1)|p.L130_M133delLNKM(1)|p.N131fs*27(1)|p.P13fs*18(1)|p.S127fs*36(1)|p.L130del(1)|p.L130fs*40(1)|p.L130fs*41(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATCTTGTTGAGGGCAGGGGAG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	65	Substitution - Missense(30)|Deletion - In frame(14)|Deletion - Frameshift(9)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)	large_intestine(11)|breast(9)|ovary(6)|upper_aerodigestive_tract(5)|lung(5)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|prostate(4)|bone(4)|urinary_tract(3)|oesophagus(3)|adrenal_gland(2)|stomach(2)|biliary_tract(1)|skin(1)|liver(1)											45.0	46.0	45.0					17																	7578542		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.388C>G	17.37:g.7578542G>C	ENSP00000269305:p.Leu130Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.L130V	ENST00000269305.4	37	c.388	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640631	0.67244	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99867	-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.86953	2.85	0.58432	D	0.999992	D;D;D;P;D;D;D	0.76494	0.996;0.998;0.995;0.924;0.998;0.997;0.999	P;D;D;B;D;D;D	0.91635	0.899;0.999;0.98;0.388;0.999;0.999;0.989	D	0.96621	0.9459	10	0.87932	D	0	-29.0594	17.2272	0.86973	0.0:0.0:1.0:0.0	.	91;130;130;37;130;130;130	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	V	130;130;130;130;130;130;119;37;37;130	ENSP00000410739:L130V;ENSP00000352610:L130V;ENSP00000269305:L130V;ENSP00000398846:L130V;ENSP00000391127:L130V;ENSP00000391478:L130V;ENSP00000423862:L37V;ENSP00000424104:L130V	ENSP00000269305:L130V	L	-	1	0	TP53	7519267	1.000000	0.71417	0.930000	0.37139	0.764000	0.43329	5.638000	0.67861	2.733000	0.93635	0.655000	0.94253	CTC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	172	0.00	0	G	NM_000546		7578542	7578542	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	99	24.43	32	SNP	0.985	C
TP53	7157	genome.wustl.edu	37	17	7578542	7578542	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr17:7578542G>C	ENST00000269305.4	-	5	577	c.388C>G	c.(388-390)Ctc>Gtc	p.L130V	TP53_ENST00000420246.2_Missense_Mutation_p.L130V|TP53_ENST00000455263.2_Missense_Mutation_p.L130V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.L130V|TP53_ENST00000413465.2_Missense_Mutation_p.L130V|TP53_ENST00000359597.4_Missense_Mutation_p.L130V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	130	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> I (in a sporadic cancer; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L130F(16)|p.L130V(11)|p.0?(8)|p.Y126_K132delYSPALNK(6)|p.L37F(3)|p.Y126_N131delYSPALN(3)|p.L130fs*19(2)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.A129_L130insXX(1)|p.A129_N131delALN(1)|p.V73fs*9(1)|p.Y126fs*18(1)|p.L130fs*39(1)|p.L130fs*16(1)|p.A129_K132delALNK(1)|p.L130_M133delLNKM(1)|p.N131fs*27(1)|p.P13fs*18(1)|p.S127fs*36(1)|p.L130del(1)|p.L130fs*40(1)|p.L130fs*41(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATCTTGTTGAGGGCAGGGGAG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	65	Substitution - Missense(30)|Deletion - In frame(14)|Deletion - Frameshift(9)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)	large_intestine(11)|breast(9)|ovary(6)|upper_aerodigestive_tract(5)|lung(5)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|prostate(4)|bone(4)|urinary_tract(3)|oesophagus(3)|adrenal_gland(2)|stomach(2)|biliary_tract(1)|skin(1)|liver(1)											45.0	46.0	45.0					17																	7578542		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.388C>G	17.37:g.7578542G>C	ENSP00000269305:p.Leu130Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.L130V	ENST00000269305.4	37	c.388	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640631	0.67244	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99867	-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.86953	2.85	0.58432	D	0.999992	D;D;D;P;D;D;D	0.76494	0.996;0.998;0.995;0.924;0.998;0.997;0.999	P;D;D;B;D;D;D	0.91635	0.899;0.999;0.98;0.388;0.999;0.999;0.989	D	0.96621	0.9459	10	0.87932	D	0	-29.0594	17.2272	0.86973	0.0:0.0:1.0:0.0	.	91;130;130;37;130;130;130	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	V	130;130;130;130;130;130;119;37;37;130	ENSP00000410739:L130V;ENSP00000352610:L130V;ENSP00000269305:L130V;ENSP00000398846:L130V;ENSP00000391127:L130V;ENSP00000391478:L130V;ENSP00000423862:L37V;ENSP00000424104:L130V	ENSP00000269305:L130V	L	-	1	0	TP53	7519267	1.000000	0.71417	0.930000	0.37139	0.764000	0.43329	5.638000	0.67861	2.733000	0.93635	0.655000	0.94253	CTC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	154	0.64	1	G	NM_000546		7578542	7578542	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	99	24.43	32	SNP	0.985	C
TRPM7	54822	genome.wustl.edu	37	15	50905926	50905926	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr15:50905926G>C	ENST00000313478.7	-	15	2029	c.1748C>G	c.(1747-1749)aCa>aGa	p.T583R	TRPM7_ENST00000560955.1_Missense_Mutation_p.T583R	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	583					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		GGGCTGTGCTGTCTTAATGAA	0.323																																						dbGAP											0													106.0	90.0	95.0					15																	50905926		1828	4077	5905	-	-	-	SO:0001583	missense	0			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.1748C>G	15.37:g.50905926G>C	ENSP00000320239:p.Thr583Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.T583R	ENST00000313478.7	37	c.1748	CCDS42035.1	15	.	.	.	.	.	.	.	.	.	.	G	25.2	4.614542	0.87359	.	.	ENSG00000092439	ENST00000313478	T	0.73897	-0.79	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.83954	0.5366	L	0.49126	1.545	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.85027	0.0915	10	0.72032	D	0.01	-17.6717	19.2151	0.93774	0.0:0.0:1.0:0.0	.	583	Q96QT4	TRPM7_HUMAN	R	583	ENSP00000320239:T583R	ENSP00000320239:T583R	T	-	2	0	TRPM7	48693218	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.624000	0.98398	2.542000	0.85734	0.563000	0.77884	ACA	TRPM7	-	NULL	ENSG00000092439		0.323	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM7	HGNC	protein_coding	OTTHUMT00000418604.1	369	0.00	0	G	NM_017672		50905926	50905926	-1	no_errors	ENST00000313478	ensembl	human	known	69_37n	missense	172	18.10	38	SNP	1.000	C
TRPM7	54822	genome.wustl.edu	37	15	50905926	50905926	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr15:50905926G>C	ENST00000313478.7	-	15	2029	c.1748C>G	c.(1747-1749)aCa>aGa	p.T583R	TRPM7_ENST00000560955.1_Missense_Mutation_p.T583R	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	583					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		GGGCTGTGCTGTCTTAATGAA	0.323																																						dbGAP											0													106.0	90.0	95.0					15																	50905926		1828	4077	5905	-	-	-	SO:0001583	missense	0			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.1748C>G	15.37:g.50905926G>C	ENSP00000320239:p.Thr583Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.T583R	ENST00000313478.7	37	c.1748	CCDS42035.1	15	.	.	.	.	.	.	.	.	.	.	G	25.2	4.614542	0.87359	.	.	ENSG00000092439	ENST00000313478	T	0.73897	-0.79	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.83954	0.5366	L	0.49126	1.545	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.85027	0.0915	10	0.72032	D	0.01	-17.6717	19.2151	0.93774	0.0:0.0:1.0:0.0	.	583	Q96QT4	TRPM7_HUMAN	R	583	ENSP00000320239:T583R	ENSP00000320239:T583R	T	-	2	0	TRPM7	48693218	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.624000	0.98398	2.542000	0.85734	0.563000	0.77884	ACA	TRPM7	-	NULL	ENSG00000092439		0.323	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM7	HGNC	protein_coding	OTTHUMT00000418604.1	421	0.24	1	G	NM_017672		50905926	50905926	-1	no_errors	ENST00000313478	ensembl	human	known	69_37n	missense	172	18.10	38	SNP	1.000	C
TTBK1	84630	genome.wustl.edu	37	6	43225687	43225687	+	Silent	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr6:43225687G>A	ENST00000259750.4	+	10	1082	c.999G>A	c.(997-999)caG>caA	p.Q333Q	TTBK1_ENST00000304139.5_Silent_p.Q282Q	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	333					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			ACACCCGGCAGACGGCAGCCA	0.637																																						dbGAP											0													44.0	43.0	44.0					6																	43225687		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.999G>A	6.37:g.43225687G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q333	ENST00000259750.4	37	c.999	CCDS34455.1	6																																																																																			TTBK1	-	NULL	ENSG00000146216		0.637	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK1	HGNC	protein_coding	OTTHUMT00000040584.3	76	0.00	0	G			43225687	43225687	+1	no_errors	ENST00000259750	ensembl	human	known	69_37n	silent	113	11.63	15	SNP	1.000	A
TTBK1	84630	genome.wustl.edu	37	6	43225687	43225687	+	Silent	SNP	G	G	A			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr6:43225687G>A	ENST00000259750.4	+	10	1082	c.999G>A	c.(997-999)caG>caA	p.Q333Q	TTBK1_ENST00000304139.5_Silent_p.Q282Q	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	333					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			ACACCCGGCAGACGGCAGCCA	0.637																																						dbGAP											0													44.0	43.0	44.0					6																	43225687		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.999G>A	6.37:g.43225687G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q333	ENST00000259750.4	37	c.999	CCDS34455.1	6																																																																																			TTBK1	-	NULL	ENSG00000146216		0.637	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK1	HGNC	protein_coding	OTTHUMT00000040584.3	66	0.00	0	G			43225687	43225687	+1	no_errors	ENST00000259750	ensembl	human	known	69_37n	silent	113	11.63	15	SNP	1.000	A
WDR13	64743	genome.wustl.edu	37	X	48458901	48458901	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chrX:48458901A>G	ENST00000218056.5	+	5	1223	c.718A>G	c.(718-720)Acc>Gcc	p.T240A	WDR13_ENST00000376729.5_Missense_Mutation_p.T240A	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	240						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						ACTGGATGCCACCATGCGCAT	0.612																																						dbGAP											0													104.0	64.0	78.0					X																	48458901		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.718A>G	X.37:g.48458901A>G	ENSP00000218056:p.Thr240Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T240A	ENST00000218056.5	37	c.718	CCDS14302.1	X	.	.	.	.	.	.	.	.	.	.	A	21.6	4.175137	0.78564	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.69435	-0.4;-0.4	4.93	4.93	0.64822	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.048076	0.85682	D	0.000000	T	0.76499	0.3996	M	0.64676	1.99	0.46654	D	0.999147	D;D	0.59357	0.984;0.985	P;D	0.63113	0.755;0.911	T	0.78959	-0.1998	10	0.87932	D	0	-22.1829	11.6068	0.51037	1.0:0.0:0.0:0.0	.	118;240	B4DVQ7;Q9H1Z4	.;WDR13_HUMAN	A	240	ENSP00000365919:T240A;ENSP00000218056:T240A	ENSP00000218056:T240A	T	+	1	0	WDR13	48343845	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	6.501000	0.73691	1.641000	0.50575	0.356000	0.21956	ACC	WDR13	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000101940		0.612	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	HGNC	protein_coding	OTTHUMT00000060743.2	62	0.00	0	A			48458901	48458901	+1	no_errors	ENST00000218056	ensembl	human	known	69_37n	missense	112	25.64	40	SNP	1.000	G
WDR13	64743	genome.wustl.edu	37	X	48458901	48458901	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chrX:48458901A>G	ENST00000218056.5	+	5	1223	c.718A>G	c.(718-720)Acc>Gcc	p.T240A	WDR13_ENST00000376729.5_Missense_Mutation_p.T240A	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	240						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						ACTGGATGCCACCATGCGCAT	0.612																																						dbGAP											0													104.0	64.0	78.0					X																	48458901		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.718A>G	X.37:g.48458901A>G	ENSP00000218056:p.Thr240Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T240A	ENST00000218056.5	37	c.718	CCDS14302.1	X	.	.	.	.	.	.	.	.	.	.	A	21.6	4.175137	0.78564	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.69435	-0.4;-0.4	4.93	4.93	0.64822	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.048076	0.85682	D	0.000000	T	0.76499	0.3996	M	0.64676	1.99	0.46654	D	0.999147	D;D	0.59357	0.984;0.985	P;D	0.63113	0.755;0.911	T	0.78959	-0.1998	10	0.87932	D	0	-22.1829	11.6068	0.51037	1.0:0.0:0.0:0.0	.	118;240	B4DVQ7;Q9H1Z4	.;WDR13_HUMAN	A	240	ENSP00000365919:T240A;ENSP00000218056:T240A	ENSP00000218056:T240A	T	+	1	0	WDR13	48343845	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	6.501000	0.73691	1.641000	0.50575	0.356000	0.21956	ACC	WDR13	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000101940		0.612	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	HGNC	protein_coding	OTTHUMT00000060743.2	46	0.00	0	A			48458901	48458901	+1	no_errors	ENST00000218056	ensembl	human	known	69_37n	missense	112	25.64	40	SNP	1.000	G
ZNF540	163255	genome.wustl.edu	37	19	38102566	38102566	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr19:38102566G>C	ENST00000592533.1	+	5	717	c.385G>C	c.(385-387)Gag>Cag	p.E129Q	ZNF540_ENST00000316433.4_Missense_Mutation_p.E129Q|ZNF540_ENST00000589117.1_Missense_Mutation_p.E97Q|ZNF540_ENST00000586792.1_3'UTR|ZNF540_ENST00000343599.5_Missense_Mutation_p.E129Q	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	129					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAGTGAGTTTGAGGGTCAACA	0.333																																						dbGAP											0													125.0	140.0	135.0					19																	38102566		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.385G>C	19.37:g.38102566G>C	ENSP00000466274:p.Glu129Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E129Q	ENST00000592533.1	37	c.385	CCDS12506.1	19	.	.	.	.	.	.	.	.	.	.	G	9.211	1.030826	0.19590	.	.	ENSG00000171817	ENST00000316433;ENST00000343599	T	0.09163	3.01	1.46	-1.1	0.09872	.	.	.	.	.	T	0.06600	0.0169	L	0.31371	0.925	0.09310	N	1	B;B	0.17268	0.021;0.012	B;B	0.13407	0.009;0.004	T	0.38045	-0.9679	9	0.42905	T	0.14	.	2.6317	0.04946	0.2215:0.3139:0.4646:0.0	.	97;129	Q8NDQ6-2;Q8NDQ6	.;ZN540_HUMAN	Q	129;97	ENSP00000324598:E129Q	ENSP00000324598:E129Q	E	+	1	0	ZNF540	42794406	0.000000	0.05858	0.000000	0.03702	0.581000	0.36288	0.172000	0.16704	-0.232000	0.09811	0.313000	0.20887	GAG	ZNF540	-	NULL	ENSG00000171817		0.333	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF540	HGNC	protein_coding	OTTHUMT00000459481.1	255	0.00	0	G	NM_152606		38102566	38102566	+1	no_errors	ENST00000316433	ensembl	human	known	69_37n	missense	87	21.62	24	SNP	0.000	C
ZNF540	163255	genome.wustl.edu	37	19	38102566	38102566	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	e71af20f-596d-4bad-8af3-4ded35614825	g.chr19:38102566G>C	ENST00000592533.1	+	5	717	c.385G>C	c.(385-387)Gag>Cag	p.E129Q	ZNF540_ENST00000316433.4_Missense_Mutation_p.E129Q|ZNF540_ENST00000589117.1_Missense_Mutation_p.E97Q|ZNF540_ENST00000586792.1_3'UTR|ZNF540_ENST00000343599.5_Missense_Mutation_p.E129Q	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	129					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAGTGAGTTTGAGGGTCAACA	0.333																																						dbGAP											0													125.0	140.0	135.0					19																	38102566		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.385G>C	19.37:g.38102566G>C	ENSP00000466274:p.Glu129Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E129Q	ENST00000592533.1	37	c.385	CCDS12506.1	19	.	.	.	.	.	.	.	.	.	.	G	9.211	1.030826	0.19590	.	.	ENSG00000171817	ENST00000316433;ENST00000343599	T	0.09163	3.01	1.46	-1.1	0.09872	.	.	.	.	.	T	0.06600	0.0169	L	0.31371	0.925	0.09310	N	1	B;B	0.17268	0.021;0.012	B;B	0.13407	0.009;0.004	T	0.38045	-0.9679	9	0.42905	T	0.14	.	2.6317	0.04946	0.2215:0.3139:0.4646:0.0	.	97;129	Q8NDQ6-2;Q8NDQ6	.;ZN540_HUMAN	Q	129;97	ENSP00000324598:E129Q	ENSP00000324598:E129Q	E	+	1	0	ZNF540	42794406	0.000000	0.05858	0.000000	0.03702	0.581000	0.36288	0.172000	0.16704	-0.232000	0.09811	0.313000	0.20887	GAG	ZNF540	-	NULL	ENSG00000171817		0.333	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF540	HGNC	protein_coding	OTTHUMT00000459481.1	341	0.29	1	G	NM_152606		38102566	38102566	+1	no_errors	ENST00000316433	ensembl	human	known	69_37n	missense	87	21.62	24	SNP	0.000	C
ZNF652	22834	genome.wustl.edu	37	17	47376040	47376040	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15M-01A-11D-A12B-09	TCGA-E2-A15M-11A-22D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	06b28922-49b5-4633-a07b-c0bd51b2aee5	635d491b-44f7-4467-adb0-941c2bd5d1f9	g.chr17:47376040A>G	ENST00000362063.2	-	6	1874	c.1556T>C	c.(1555-1557)gTg>gCg	p.V519A	ZNF652_ENST00000430262.2_Missense_Mutation_p.V519A	NM_014897.2	NP_055712.1	Q9Y2D9	ZN652_HUMAN	zinc finger protein 652	519	Mediates interaction with CBFA2T3.|Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(4;6.81e-14)|Breast(4;4.97e-29)|all_epithelial(4;1.53e-17)		BRCA - Breast invasive adenocarcinoma(1;3.1e-14)|Epithelial(5;2.92e-06)|all cancers(6;3.15e-05)			TGTGTTCACCACAGAAGGAAC	0.577																																						dbGAP											0													60.0	56.0	58.0					17																	47376040		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023141	CCDS32677.1	17q21.32	2013-01-08				ENSG00000198740		"""Zinc fingers, C2H2-type"""	29147	protein-coding gene	gene with protein product		613907				10231032	Standard	NM_014897		Approved	KIAA0924	uc002iow.3	Q9Y2D9		ENST00000362063.2:c.1556T>C	17.37:g.47376040A>G	ENSP00000354686:p.Val519Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPD9|Q5H9Q0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V519A	ENST00000362063.2	37	c.1556	CCDS32677.1	17	.	.	.	.	.	.	.	.	.	.	A	11.80	1.745371	0.30955	.	.	ENSG00000198740	ENST00000362063;ENST00000430262	T;T	0.07327	3.2;3.2	4.54	1.05	0.20165	.	0.790897	0.12014	N	0.507581	T	0.06096	0.0158	L	0.34521	1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41520	-0.9504	10	0.27785	T	0.31	-7.8027	5.7985	0.18399	0.7048:0.1414:0.1538:0.0	.	519	Q9Y2D9	ZN652_HUMAN	A	519	ENSP00000354686:V519A;ENSP00000416305:V519A	ENSP00000354686:V519A	V	-	2	0	ZNF652	44731039	0.868000	0.29978	0.530000	0.27963	0.985000	0.73830	1.787000	0.38704	0.051000	0.15978	0.482000	0.46254	GTG	ZNF652	-	NULL	ENSG00000198740		0.577	ZNF652-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF652	HGNC	protein_coding	OTTHUMT00000364524.1	297	0.00	0	A	NM_014897		47376040	47376040	-1	no_errors	ENST00000362063	ensembl	human	known	69_37n	missense	307	24.38	99	SNP	0.050	G
