#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB11	8647	genome.wustl.edu	37	2	169814622	169814622	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr2:169814622A>C	ENST00000263817.6	-	19	2319	c.2195T>G	c.(2194-2196)gTg>gGg	p.V732G		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	732					bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TTCTTCCTGCACAGGAATGTC	0.458																																						dbGAP											0													75.0	70.0	72.0					2																	169814622		1899	4117	6016	-	-	-	SO:0001583	missense	0			AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.2195T>G	2.37:g.169814622A>C	ENSP00000263817:p.Val732Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TL2|Q9UNB2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.V732G	ENST00000263817.6	37	c.2195	CCDS46444.1	2	.	.	.	.	.	.	.	.	.	.	A	5.469	0.271635	0.10349	.	.	ENSG00000073734	ENST00000263817	D	0.86627	-2.15	5.0	0.85	0.18980	.	1.748300	0.03740	N	0.254875	T	0.77765	0.4179	N	0.24115	0.695	0.43242	D	0.995156	B;B	0.19445	0.036;0.018	B;B	0.18263	0.013;0.021	T	0.62627	-0.6814	10	0.23891	T	0.37	.	4.9381	0.13950	0.6344:0.0:0.0819:0.2837	.	174;732	B4DZQ8;O95342	.;ABCBB_HUMAN	G	732	ENSP00000263817:V732G	ENSP00000263817:V732G	V	-	2	0	ABCB11	169522868	0.000000	0.05858	0.819000	0.32651	0.586000	0.36452	-0.357000	0.07651	0.299000	0.22661	0.383000	0.25322	GTG	ABCB11	-	NULL	ENSG00000073734		0.458	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB11	HGNC	protein_coding	OTTHUMT00000333616.2	80	0.00	0	A	NM_003742		169814622	169814622	-1	no_errors	ENST00000263817	ensembl	human	known	69_37n	missense	29	36.96	17	SNP	0.663	C
AK8	158067	genome.wustl.edu	37	9	135702351	135702351	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr9:135702351G>T	ENST00000298545.3	-	8	1168	c.647C>A	c.(646-648)gCt>gAt	p.A216D	AK8_ENST00000477396.1_5'UTR	NM_152572.2	NP_689785.1	Q96MA6	KAD8_HUMAN	adenylate kinase 8	216	Adenylate kinase 1.				nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			NS(1)|kidney(2)|large_intestine(4)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(2)	23						CAGTTTCTGAGCCGTCTCCAG	0.512																																						dbGAP											0													259.0	233.0	242.0					9																	135702351		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093446	CCDS6954.1	9q34.13	2013-04-29	2010-12-07	2010-12-07	ENSG00000165695	ENSG00000165695	2.7.4.3	"""Adenylate kinases"""	26526	protein-coding gene	gene with protein product		615365	"""chromosome 9 open reading frame 98"""	C9orf98		21080915	Standard	NM_152572		Approved	FLJ32704	uc004cbu.1	Q96MA6	OTTHUMG00000021009	ENST00000298545.3:c.647C>A	9.37:g.135702351G>T	ENSP00000298545:p.Ala216Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K821|Q8N9W9	Missense_Mutation	SNP	pfam_Adenylate_kin,superfamily_Adenylate_kinase_lid-dom,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,prints_Adenylate_kin	p.A216D	ENST00000298545.3	37	c.647	CCDS6954.1	9	.	.	.	.	.	.	.	.	.	.	G	11.77	1.736496	0.30774	.	.	ENSG00000165695	ENST00000298545	T	0.45276	0.9	5.34	4.44	0.53790	.	0.662303	0.15382	N	0.265268	T	0.46112	0.1376	M	0.69823	2.125	0.09310	N	1	P	0.34909	0.475	B	0.41988	0.372	T	0.35425	-0.9789	10	0.25751	T	0.34	-10.3512	8.8838	0.35392	0.0792:0.1492:0.7716:0.0	.	216	Q96MA6	KAD8_HUMAN	D	216	ENSP00000298545:A216D	ENSP00000298545:A216D	A	-	2	0	AK8	134692172	0.142000	0.22610	0.054000	0.19295	0.887000	0.51463	2.053000	0.41326	1.249000	0.43950	0.455000	0.32223	GCT	AK8	-	pfam_Adenylate_kin	ENSG00000165695		0.512	AK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK8	HGNC	protein_coding	OTTHUMT00000055413.1	266	0.00	0	G	NM_152572		135702351	135702351	-1	no_errors	ENST00000298545	ensembl	human	known	69_37n	missense	101	24.06	32	SNP	0.021	T
ANGPT4	51378	genome.wustl.edu	37	20	896760	896760	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr20:896760C>T	ENST00000381922.3	-	1	200	c.98G>A	c.(97-99)tGc>tAc	p.C33Y	ANGPT4_ENST00000546022.1_Missense_Mutation_p.C33Y	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	33					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						AAGTGTCTCGCAGCCCCTATC	0.617																																					Pancreas(181;481 2077 3259 31286 49856)	dbGAP											0													85.0	82.0	83.0					20																	896760		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.98G>A	20.37:g.896760C>T	ENSP00000371347:p.Cys33Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3J9|Q5TFF4|Q9H4Z4	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.C33Y	ENST00000381922.3	37	c.98	CCDS13009.1	20	.	.	.	.	.	.	.	.	.	.	C	2.502	-0.315062	0.05422	.	.	ENSG00000101280	ENST00000381922;ENST00000546022	T;T	0.48836	0.8;1.64	4.57	3.61	0.41365	.	0.906927	0.09203	N	0.834435	T	0.28962	0.0719	N	0.08118	0	0.09310	N	1	B;B	0.28900	0.227;0.227	B;B	0.23018	0.043;0.043	T	0.21586	-1.0241	10	0.87932	D	0	.	10.4218	0.44354	0.0:0.8021:0.1979:0.0	.	33;33	B4E3J9;Q9Y264	.;ANGP4_HUMAN	Y	33	ENSP00000371347:C33Y;ENSP00000439605:C33Y	ENSP00000371347:C33Y	C	-	2	0	ANGPT4	844760	0.007000	0.16637	0.002000	0.10522	0.018000	0.09664	0.791000	0.26915	1.125000	0.41998	0.305000	0.20034	TGC	ANGPT4	-	NULL	ENSG00000101280		0.617	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPT4	HGNC	protein_coding	OTTHUMT00000077493.1	171	0.00	0	C	NM_015985		896760	896760	-1	no_errors	ENST00000381922	ensembl	human	known	69_37n	missense	62	18.42	14	SNP	0.004	T
BCOR	54880	genome.wustl.edu	37	X	39937122	39937122	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chrX:39937122G>A	ENST00000378444.4	-	2	289	c.61C>T	c.(61-63)Cgc>Tgc	p.R21C	BCOR_ENST00000397354.3_Missense_Mutation_p.R21C|BCOR_ENST00000342274.4_Missense_Mutation_p.R21C|BCOR_ENST00000378455.4_Missense_Mutation_p.R21C	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	21					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						CCACACATGCGGACCCTCTCG	0.607			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																															dbGAP		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		0													105.0	82.0	90.0					X																	39937122		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.61C>T	X.37:g.39937122G>A	ENSP00000367705:p.Arg21Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R21C	ENST00000378444.4	37	c.61	CCDS48093.1	X	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323699	0.81580	.	.	ENSG00000183337	ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000406200;ENST00000412952	T;T;T;T	0.57436	0.41;0.4;0.43;0.4	5.51	5.51	0.81932	.	.	.	.	.	T	0.61350	0.2340	L	0.29908	0.895	0.58432	D	0.999991	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;P;D	0.67103	0.949;0.949;0.891;0.949	T	0.58819	-0.7569	8	.	.	.	-20.8834	18.4322	0.90630	0.0:0.0:1.0:0.0	.	21;21;21;21	Q6W2J9-3;Q6W2J9-4;Q6W2J9;Q6W2J9-2	.;.;BCOR_HUMAN;.	C	21	ENSP00000367716:R21C;ENSP00000380512:R21C;ENSP00000367705:R21C;ENSP00000345923:R21C	.	R	-	1	0	BCOR	39822066	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.159000	0.77483	2.292000	0.77174	0.513000	0.50165	CGC	BCOR	-	NULL	ENSG00000183337		0.607	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCOR	HGNC	protein_coding	OTTHUMT00000060666.2	153	0.00	0	G	NM_017745		39937122	39937122	-1	no_errors	ENST00000378444	ensembl	human	known	69_37n	missense	90	25.62	31	SNP	1.000	A
BMP3	651	genome.wustl.edu	37	4	81967479	81967479	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr4:81967479C>T	ENST00000282701.2	+	2	1224	c.904C>T	c.(904-906)Ctt>Ttt	p.L302F		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	302					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						GAACAACGAGCTTCCTGGGGC	0.507																																						dbGAP											0													52.0	59.0	57.0					4																	81967479		2203	4298	6501	-	-	-	SO:0001583	missense	0			M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.904C>T	4.37:g.81967479C>T	ENSP00000282701:p.Leu302Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAS5	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,pirsf_BMP3/GDF10	p.L302F	ENST00000282701.2	37	c.904	CCDS3588.1	4	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048032	0.75846	.	.	ENSG00000152785	ENST00000282701	T	0.78126	-1.15	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.89238	0.6658	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90501	0.4474	10	0.72032	D	0.01	.	18.603	0.91256	0.0:1.0:0.0:0.0	.	302	P12645	BMP3_HUMAN	F	302	ENSP00000282701:L302F	ENSP00000282701:L302F	L	+	1	0	BMP3	82186503	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	7.739000	0.84976	2.563000	0.86464	0.655000	0.94253	CTT	BMP3	-	pirsf_BMP3/GDF10	ENSG00000152785		0.507	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP3	HGNC	protein_coding	OTTHUMT00000252634.1	131	0.00	0	C			81967479	81967479	+1	no_errors	ENST00000282701	ensembl	human	known	69_37n	missense	19	61.22	30	SNP	1.000	T
BMP6	654	genome.wustl.edu	37	6	7845540	7845540	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr6:7845540C>G	ENST00000283147.6	+	2	991	c.832C>G	c.(832-834)Caa>Gaa	p.Q278E		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	278					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					CAGCATTTATCAAGTCTTACA	0.483																																						dbGAP											0													65.0	65.0	65.0					6																	7845540		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.832C>G	6.37:g.7845540C>G	ENSP00000283147:p.Gln278Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TCP3	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.Q278E	ENST00000283147.6	37	c.832	CCDS4503.1	6	.	.	.	.	.	.	.	.	.	.	C	17.86	3.493444	0.64186	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.64085	-0.08	5.12	5.12	0.69794	Transforming growth factor-beta, N-terminal (1);	0.055933	0.64402	D	0.000001	T	0.60650	0.2285	N	0.21194	0.64	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.58934	-0.7548	10	0.29301	T	0.29	.	18.9215	0.92528	0.0:1.0:0.0:0.0	.	278	P22004	BMP6_HUMAN	E	200;278;241	ENSP00000283147:Q278E	ENSP00000283147:Q278E	Q	+	1	0	BMP6	7790539	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.249000	0.78278	2.533000	0.85409	0.563000	0.77884	CAA	BMP6	-	pfam_TGF-b_N	ENSG00000153162		0.483	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP6	HGNC	protein_coding	OTTHUMT00000039794.1	171	0.00	0	C	NM_001718		7845540	7845540	+1	no_errors	ENST00000283147	ensembl	human	known	69_37n	missense	76	52.50	84	SNP	1.000	G
BTBD10	84280	genome.wustl.edu	37	11	13410404	13410404	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr11:13410404G>A	ENST00000278174.5	-	9	1647	c.1402C>T	c.(1402-1404)Cct>Tct	p.P468S	BTBD10_ENST00000530907.1_Missense_Mutation_p.P476S|BTBD10_ENST00000528120.1_Missense_Mutation_p.P420S	NM_032320.5	NP_115696.2	Q9BSF8	BTBDA_HUMAN	BTB (POZ) domain containing 10	468	Interaction with AKT family members. {ECO:0000250|UniProtKB:Q80X66}.					nucleus (GO:0005634)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|prostate(1)	20				Epithelial(150;0.0214)		TGTGCATCAGGATCGAGGTCA	0.498																																						dbGAP											0													152.0	118.0	129.0					11																	13410404		2200	4294	6494	-	-	-	SO:0001583	missense	0			AY221959	CCDS7811.1, CCDS73261.1	11p15.2	2013-01-24			ENSG00000148925	ENSG00000148925		"""BTB/POZ domain containing"""	21445	protein-coding gene	gene with protein product		615933				15556295	Standard	XM_005253164		Approved	GMRP1, GMRP-1, MGC13007	uc001mkz.3	Q9BSF8	OTTHUMG00000165787	ENST00000278174.5:c.1402C>T	11.37:g.13410404G>A	ENSP00000278174:p.Pro468Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z228|Q86WG1	Missense_Mutation	SNP	superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.P468S	ENST00000278174.5	37	c.1402	CCDS7811.1	11	.	.	.	.	.	.	.	.	.	.	G	13.62	2.290772	0.40494	.	.	ENSG00000148925	ENST00000278174;ENST00000530907;ENST00000528120	T;T;T	0.30448	1.56;1.53;1.58	4.89	3.93	0.45458	.	0.112447	0.64402	D	0.000008	T	0.21761	0.0524	N	0.22421	0.69	0.43750	D	0.996259	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.05068	-1.0908	10	0.49607	T	0.09	-13.5012	13.5653	0.61815	0.0:0.0:0.7499:0.2501	.	476;468;468	B7Z228;D3DQW7;Q9BSF8	.;.;BTBDA_HUMAN	S	468;476;420	ENSP00000278174:P468S;ENSP00000431186:P476S;ENSP00000435257:P420S	ENSP00000278174:P468S	P	-	1	0	BTBD10	13366980	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.960000	0.40422	2.526000	0.85167	0.555000	0.69702	CCT	BTBD10	-	NULL	ENSG00000148925		0.498	BTBD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD10	HGNC	protein_coding	OTTHUMT00000386200.1	113	0.00	0	G	NM_032320		13410404	13410404	-1	no_errors	ENST00000278174	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	1.000	A
SPX	80763	genome.wustl.edu	37	12	21679844	21679844	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr12:21679844A>G	ENST00000256969.2	+	2	197	c.31A>G	c.(31-33)Acc>Gcc	p.T11A		NM_030572.2	NP_085049.1	Q9BT56	SPXN_HUMAN		11					long-chain fatty acid import (GO:0044539)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of renal sodium excretion (GO:0035814)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of sensory perception of pain (GO:0051930)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)	neuropeptide hormone activity (GO:0005184)|type 2 galanin receptor binding (GO:0031765)|type 3 galanin receptor binding (GO:0031766)			endometrium(3)|large_intestine(1)|lung(2)|urinary_tract(1)	7						GGCAGCAACAACCTTGGCTCT	0.453																																						dbGAP											0													159.0	162.0	161.0					12																	21679844		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000256969.2:c.31A>G	12.37:g.21679844A>G	ENSP00000256969:p.Thr11Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KND6	Missense_Mutation	SNP	NULL	p.T11A	ENST00000256969.2	37	c.31	CCDS31757.1	12	.	.	.	.	.	.	.	.	.	.	A	12.61	1.988485	0.35036	.	.	ENSG00000134548	ENST00000256969	.	.	.	4.83	-2.68	0.06041	.	0.697700	0.14403	N	0.321765	T	0.25791	0.0628	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17471	-1.0368	9	0.33940	T	0.23	-17.8301	10.8512	0.46771	0.3818:0.0:0.6182:0.0	.	11	Q9BT56	SPXN_HUMAN	A	11	.	ENSP00000256969:T11A	T	+	1	0	C12orf39	21571111	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	0.210000	0.17455	-0.358000	0.08162	0.482000	0.46254	ACC	C12orf39	-	NULL	ENSG00000134548		0.453	C12orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf39	HGNC	protein_coding	OTTHUMT00000402389.1	382	0.26	1	A			21679844	21679844	+1	no_errors	ENST00000256969	ensembl	human	known	69_37n	missense	143	47.62	130	SNP	0.000	G
CASP2	835	genome.wustl.edu	37	7	142991361	142991361	+	Missense_Mutation	SNP	G	G	T	rs4647297	byFrequency	TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr7:142991361G>T	ENST00000310447.5	+	5	755	c.514G>T	c.(514-516)Gtc>Ttc	p.V172F	CASP2_ENST00000493642.1_3'UTR	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase	172			V -> L (in dbSNP:rs4647297). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.5, ECO:0000269|Ref.9}.		aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					AGATGGTCCTGTCTGCCTTCA	0.383																																						dbGAP											0													163.0	163.0	163.0					7																	142991361		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.514G>T	7.37:g.142991361G>T	ENSP00000312664:p.Val172Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	Missense_Mutation	SNP	pfam_Pept_C14_cat,pfam_CARD,superfamily_DEATH-like,smart_CARD,smart_Pept_C14_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14_p45_core	p.V172F	ENST00000310447.5	37	c.514	CCDS5879.1	7	.	.	.	.	.	.	.	.	.	.	G	14.06	2.422736	0.43020	.	.	ENSG00000106144	ENST00000310447;ENST00000392923	T	0.01947	4.54	5.78	4.9	0.64082	.	0.491806	0.25060	N	0.033444	T	0.01835	0.0058	N	0.19112	0.55	0.80722	D	1	B	0.23249	0.082	B	0.26416	0.069	T	0.52381	-0.8583	10	0.10111	T	0.7	.	10.3394	0.43868	0.0:0.7862:0.1406:0.0733	.	172	P42575	CASP2_HUMAN	F	172;141	ENSP00000312664:V172F	ENSP00000312664:V172F	V	+	1	0	CASP2	142701483	0.002000	0.14202	0.993000	0.49108	0.907000	0.53573	0.993000	0.29680	1.460000	0.47911	-0.321000	0.08615	GTC	CASP2	-	pirsf_Caspase_IL-1_beta	ENSG00000106144		0.383	CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP2	HGNC	protein_coding	OTTHUMT00000059962.3	347	0.00	0	G	NM_032982		142991361	142991361	+1	no_errors	ENST00000310447	ensembl	human	known	69_37n	missense	122	44.04	96	SNP	0.962	T
CCDC50	152137	genome.wustl.edu	37	3	191093245	191093245	+	Intron	SNP	A	A	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr3:191093245A>T	ENST00000392455.3	+	6	1046				CCDC50_ENST00000392456.3_Missense_Mutation_p.Q281H	NM_174908.3	NP_777568.1	Q8IVM0	CCD50_HUMAN	coiled-coil domain containing 50							cytoplasm (GO:0005737)	ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|stomach(1)	23	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)		AGTCCTCACAAAAAGCAGGGC	0.488																																						dbGAP											0													84.0	80.0	82.0					3																	191093245		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AJ416916	CCDS33912.1, CCDS33913.1	3q28	2010-12-24		2005-12-23	ENSG00000152492	ENSG00000152492			18111	protein-coding gene	gene with protein product		611051	"""deafness, autosomal dominant 44"""	C3orf6, DFNA44		16803894, 17503326	Standard	NM_178335		Approved	Ymer	uc003fsv.3	Q8IVM0	OTTHUMG00000156177	ENST00000392455.3:c.449-4703A>T	3.37:g.191093245A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VH7	Missense_Mutation	SNP	NULL	p.Q281H	ENST00000392455.3	37	c.843	CCDS33913.1	3	.	.	.	.	.	.	.	.	.	.	A	14.57	2.574029	0.45902	.	.	ENSG00000152492	ENST00000392456	T	0.32515	1.45	5.96	3.21	0.36854	.	0.773506	0.12073	N	0.502108	T	0.31231	0.0790	.	.	.	0.21256	N	0.999744	P	0.44195	0.828	P	0.45138	0.471	T	0.11470	-1.0586	9	0.59425	D	0.04	.	7.6274	0.28220	0.2664:0.0:0.7336:0.0	.	281	Q8IVM0-2	.	H	281	ENSP00000376250:Q281H	ENSP00000376250:Q281H	Q	+	3	2	CCDC50	192575939	0.225000	0.23685	0.659000	0.29680	0.839000	0.47603	1.434000	0.34958	0.412000	0.25729	-0.242000	0.12053	CAA	CCDC50	-	NULL	ENSG00000152492		0.488	CCDC50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC50	HGNC	protein_coding	OTTHUMT00000343315.1	202	0.00	0	A	NM_174908		191093245	191093245	+1	no_errors	ENST00000392456	ensembl	human	known	69_37n	missense	102	13.56	16	SNP	0.742	T
CD38	952	genome.wustl.edu	37	4	15818139	15818139	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr4:15818139T>C	ENST00000226279.3	+	2	376	c.239T>C	c.(238-240)gTa>gCa	p.V80A		NM_001775.2	NP_001766.2	P28907	CD38_HUMAN	CD38 molecule	80					apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|female pregnancy (GO:0007565)|long term synaptic depression (GO:0060292)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone resorption (GO:0045779)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell growth (GO:0030307)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hydroperoxide (GO:0033194)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|phosphorus-oxygen lyase activity (GO:0016849)|transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|stomach(1)	14						CTCAGACATGTAGACTGCCAA	0.303																																						dbGAP											0													64.0	60.0	62.0					4																	15818139		2203	4300	6503	-	-	-	SO:0001583	missense	0			D84276	CCDS3417.1	4p15.32	2010-05-04	2006-03-28		ENSG00000004468	ENSG00000004468	3.2.2.5	"""CD molecules"""	1667	protein-coding gene	gene with protein product	"""ADP-ribosyl cyclase 1"", ""NAD(+) nucleosidase"""	107270	"""CD38 antigen (p45)"""			9074508, 2319135	Standard	NM_001775		Approved		uc003gol.1	P28907	OTTHUMG00000048206	ENST00000226279.3:c.239T>C	4.37:g.15818139T>C	ENSP00000226279:p.Val80Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O00121|O00122|Q96HY4	Missense_Mutation	SNP	pfam_ADP-ribosyl_cyclase	p.V80A	ENST00000226279.3	37	c.239	CCDS3417.1	4	.	.	.	.	.	.	.	.	.	.	T	6.815	0.519495	0.13005	.	.	ENSG00000004468	ENST00000226279;ENST00000540195	T	0.13901	2.55	5.27	-6.63	0.01807	.	1.090020	0.06856	N	0.798141	T	0.09113	0.0225	L	0.42245	1.32	0.09310	N	1	B;B	0.25486	0.127;0.127	B;B	0.28991	0.097;0.097	T	0.43310	-0.9399	10	0.51188	T	0.08	-1.0534	0.3969	0.00419	0.2388:0.2238:0.1564:0.381	.	80;80	P28907;B2R880	CD38_HUMAN;.	A	80	ENSP00000226279:V80A	ENSP00000226279:V80A	V	+	2	0	CD38	15427237	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.087000	0.14958	-0.869000	0.04052	-0.371000	0.07208	GTA	CD38	-	pfam_ADP-ribosyl_cyclase	ENSG00000004468		0.303	CD38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD38	HGNC	protein_coding	OTTHUMT00000250322.2	178	0.00	0	T	NM_001775		15818139	15818139	+1	no_errors	ENST00000226279	ensembl	human	known	69_37n	missense	49	46.15	42	SNP	0.000	C
CHAD	1101	genome.wustl.edu	37	17	48545782	48545782	+	Silent	SNP	G	G	A			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr17:48545782G>A	ENST00000508540.1	-	1	545	c.393C>T	c.(391-393)gaC>gaT	p.D131D	ACSF2_ENST00000506085.1_3'UTR|ACSF2_ENST00000504392.1_Intron|ACSF2_ENST00000300441.4_Intron|CHAD_ENST00000258969.4_Silent_p.D131D|ACSF2_ENST00000541920.1_Intron|ACSF2_ENST00000427954.2_Intron|ACSF2_ENST00000502667.1_Intron	NM_001267.2	NP_001258.2	O15335	CHAD_HUMAN	chondroadherin	131					bone development (GO:0060348)|cartilage condensation (GO:0001502)|negative regulation of bone trabecula formation (GO:1900155)	proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(2)|ovary(2)	15	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			CCTTGTTGTGGTCCAGGTAGA	0.577																																						dbGAP											0													62.0	53.0	56.0					17																	48545782		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U96767	CCDS11568.1	17q21.33	2008-02-05			ENSG00000136457	ENSG00000136457		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	1909	protein-coding gene	gene with protein product	"""chondroadherin proteoglycan"""	602178				9344663	Standard	NM_001267		Approved	SLRR4A	uc010dbr.3	O15335	OTTHUMG00000162129	ENST00000508540.1:c.393C>T	17.37:g.48545782G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K812|Q6GTU0|Q96RJ5	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.D131	ENST00000508540.1	37	c.393	CCDS11568.1	17																																																																																			CHAD	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000136457		0.577	CHAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAD	HGNC	protein_coding	OTTHUMT00000367447.3	94	0.00	0	G	NM_001267		48545782	48545782	-1	no_errors	ENST00000258969	ensembl	human	known	69_37n	silent	40	46.75	36	SNP	1.000	A
CTNNB1	1499	genome.wustl.edu	37	3	41268806	41268806	+	Silent	SNP	T	T	A			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr3:41268806T>A	ENST00000349496.5	+	7	1324	c.1044T>A	c.(1042-1044)tcT>tcA	p.S348S	CTNNB1_ENST00000453024.1_Silent_p.S341S|CTNNB1_ENST00000396185.3_Silent_p.S348S|CTNNB1_ENST00000396183.3_Silent_p.S348S|CTNNB1_ENST00000405570.1_Silent_p.S348S	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	348					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		AGGTGCTATCTGTCTGCTCTA	0.398		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)	dbGAP		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	0													113.0	109.0	110.0					3																	41268806		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1044T>A	3.37:g.41268806T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,prints_Beta-catenin,pfscan_Armadillo	p.S348	ENST00000349496.5	37	c.1044	CCDS2694.1	3																																																																																			CTNNB1	-	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	ENSG00000168036		0.398	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNB1	HGNC	protein_coding	OTTHUMT00000254182.2	220	0.00	0	T	NM_001098210		41268806	41268806	+1	no_errors	ENST00000349496	ensembl	human	known	69_37n	silent	82	45.70	69	SNP	0.987	A
CTRB2	440387	genome.wustl.edu	37	16	75239875	75239875	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr16:75239875G>T	ENST00000303037.8	-	3	215	c.172C>A	c.(172-174)Cac>Aac	p.H58N		NM_001025200.3	NP_001020371.3	Q6GPI1	CTRB2_HUMAN	chymotrypsinogen B2	58	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			endometrium(1)|large_intestine(1)|lung(2)	4						CCGCAGAAGTGGAAGCCGGTT	0.692																																						dbGAP											0													1.0	2.0	2.0					16																	75239875		968	2352	3320	-	-	-	SO:0001583	missense	0			M24400, AK131056	CCDS32489.1	16q22.3	2007-10-22			ENSG00000168928	ENSG00000168928			2522	protein-coding gene	gene with protein product						2917002, 8186414	Standard	NM_001025200		Approved		uc002fdr.3	Q6GPI1	OTTHUMG00000159271	ENST00000303037.8:c.172C>A	16.37:g.75239875G>T	ENSP00000303963:p.His58Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K707	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.H58N	ENST00000303037.8	37	c.172	CCDS32489.1	16	.	.	.	.	.	.	.	.	.	.	G	22.0	4.236202	0.79800	.	.	ENSG00000168928	ENST00000303037	D	0.93811	-3.29	4.36	4.36	0.52297	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	U	0.000000	D	0.95723	0.8609	L	0.60012	1.86	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	D	0.96426	0.9315	10	0.87932	D	0	.	17.2866	0.87143	0.0:0.0:1.0:0.0	.	58	Q6GPI1	CTRB2_HUMAN	N	58	ENSP00000303963:H58N	ENSP00000303963:H58N	H	-	1	0	CTRB2	73797376	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	6.313000	0.72844	2.167000	0.68274	0.436000	0.28706	CAC	CTRB2	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000168928		0.692	CTRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTRB2	HGNC	protein_coding	OTTHUMT00000354298.2	11	0.00	0	G	NM_001025200		75239875	75239875	-1	no_errors	ENST00000303037	ensembl	human	known	69_37n	missense	2	50.00	2	SNP	1.000	T
CYP2F1	1572	genome.wustl.edu	37	19	41627952	41627952	+	Missense_Mutation	SNP	G	G	T	rs370865507		TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr19:41627952G>T	ENST00000331105.2	+	6	808	c.736G>T	c.(736-738)Gcc>Tcc	p.A246S		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	246					naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.A246T(1)		central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						AGACCTCATCGCCCACAGCGT	0.602																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											46.0	45.0	45.0					19																	41627952		2202	4295	6497	-	-	-	SO:0001583	missense	0			J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.736G>T	19.37:g.41627952G>T	ENSP00000333534:p.Ala246Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_CYP2_fam,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.A246S	ENST00000331105.2	37	c.736	CCDS12572.1	19	.	.	.	.	.	.	.	.	.	.	N	3.329	-0.137098	0.06711	.	.	ENSG00000197446	ENST00000331105	T	0.68181	-0.31	3.21	2.12	0.27331	.	0.654924	0.14892	U	0.292363	T	0.37812	0.1017	N	0.02368	-0.58	0.09310	N	1	B;B;B	0.18166	0.026;0.002;0.001	B;B;B	0.27076	0.076;0.01;0.002	T	0.30851	-0.9964	10	0.18710	T	0.47	.	7.9492	0.30003	0.0:0.0:0.5603:0.4397	.	32;246;246	B4DL83;Q32MN5;P24903	.;.;CP2F1_HUMAN	S	246	ENSP00000333534:A246S	ENSP00000333534:A246S	A	+	1	0	CYP2F1	46319792	0.000000	0.05858	0.209000	0.23619	0.071000	0.16799	-0.331000	0.07914	0.526000	0.28541	0.398000	0.26397	GCC	CYP2F1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000197446		0.602	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2F1	HGNC	protein_coding	OTTHUMT00000394527.2	149	0.00	0	G			41627952	41627952	+1	no_errors	ENST00000331105	ensembl	human	known	69_37n	missense	53	54.70	64	SNP	0.224	T
DALRD3	55152	genome.wustl.edu	37	3	49053757	49053757	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr3:49053757G>C	ENST00000341949.4	-	9	1169	c.1163C>G	c.(1162-1164)gCt>gGt	p.A388G	DALRD3_ENST00000313778.5_Missense_Mutation_p.A221G|DALRD3_ENST00000395462.4_Missense_Mutation_p.A221G|DALRD3_ENST00000441576.2_Missense_Mutation_p.A388G|DALRD3_ENST00000440857.1_Missense_Mutation_p.A221G|DALRD3_ENST00000496568.1_5'Flank	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	388					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)			breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		ACTGCTGTCAGCCAGAGCCAG	0.547																																						dbGAP											0													56.0	55.0	55.0					3																	49053757		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.1163C>G	3.37:g.49053757G>C	ENSP00000344989:p.Ala388Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Missense_Mutation	SNP	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd	p.A388G	ENST00000341949.4	37	c.1163	CCDS33754.1	3	.	.	.	.	.	.	.	.	.	.	G	1.385	-0.582486	0.03827	.	.	ENSG00000178149	ENST00000441576;ENST00000341949;ENST00000395462;ENST00000440857;ENST00000313778	T;T;T;T;T	0.47177	0.86;0.87;0.87;0.85;0.87	5.69	1.16	0.20824	.	0.475212	0.23243	N	0.050321	T	0.39118	0.1066	L	0.57536	1.79	0.09310	N	1	B;P;B;B	0.39696	0.006;0.683;0.006;0.146	B;B;B;B	0.37480	0.005;0.251;0.005;0.057	T	0.20405	-1.0276	10	0.32370	T	0.25	-0.8082	9.2537	0.37571	0.0:0.1082:0.2608:0.631	.	388;221;388;388	B7Z727;C9JJG6;Q5D0E6-2;Q5D0E6	.;.;.;DALD3_HUMAN	G	388;388;221;221;221	ENSP00000410623:A388G;ENSP00000344989:A388G;ENSP00000378846:A221G;ENSP00000403770:A221G;ENSP00000323265:A221G	ENSP00000323265:A221G	A	-	2	0	DALRD3	49028761	0.050000	0.20438	0.001000	0.08648	0.009000	0.06853	0.513000	0.22770	0.578000	0.29487	0.561000	0.74099	GCT	DALRD3	-	NULL	ENSG00000178149		0.547	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DALRD3	HGNC	protein_coding	OTTHUMT00000345581.1	132	0.00	0	G	NM_018114		49053757	49053757	-1	no_errors	ENST00000341949	ensembl	human	known	69_37n	missense	72	16.28	14	SNP	0.000	C
PINK1	65018	genome.wustl.edu	37	1	20977053	20977053	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr1:20977053T>G	ENST00000321556.4	+	8	1709	c.1615T>G	c.(1615-1617)Ttg>Gtg	p.L539V	PINK1_ENST00000492302.1_3'UTR|PINK1-AS_ENST00000451424.1_RNA	NM_032409.2	NP_115785.1	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1	539					activation of protein kinase B activity (GO:0032148)|cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|intracellular signal transduction (GO:0035556)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron intrinsic apoptotic signaling pathway (GO:1903384)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|peptidyl-serine autophosphorylation (GO:0036289)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of peptidase activity (GO:0010952)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein complex assembly (GO:0043254)|regulation of protein ubiquitination (GO:0031396)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|TORC2 signaling (GO:0038203)|ubiquitin-dependent protein catabolic process (GO:0006511)	astrocyte projection (GO:0097449)|axon (GO:0030424)|cell body (GO:0044297)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|Lewy body (GO:0097413)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|C3HC4-type RING finger domain binding (GO:0055131)|calcium-dependent protein kinase activity (GO:0010857)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)|protein kinase B binding (GO:0043422)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)	14		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGCCGCCACTTTGTTGGCCAA	0.498																																					Esophageal Squamous(145;853 1803 8146 34412 35011)	dbGAP											0													70.0	65.0	67.0					1																	20977053		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB053323	CCDS211.1	1p36.12	2011-07-21			ENSG00000158828	ENSG00000158828		"""Parkinson disease"""	14581	protein-coding gene	gene with protein product		608309	"""Parkinson disease (autosomal recessive) 6"""	PARK6		11494141, 15349860	Standard	NM_032409		Approved		uc001bdm.3	Q9BXM7	OTTHUMG00000002841	ENST00000321556.4:c.1615T>G	1.37:g.20977053T>G	ENSP00000364204:p.Leu539Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N6T9|Q8NBU3|Q96DE4	Splice_Site	SNP	-	NULL	ENST00000321556.4	37	c.NULL	CCDS211.1	1	.	.	.	.	.	.	.	.	.	.	T	17.85	3.491075	0.64074	.	.	ENSG00000158828	ENST00000321556	T	0.75938	-0.98	5.83	-8.14	0.01069	.	0.136017	0.49916	D	0.000123	T	0.68613	0.3020	M	0.63843	1.955	0.23487	N	0.997574	P;D	0.58970	0.921;0.984	P;P	0.51615	0.654;0.675	T	0.66388	-0.5936	10	0.72032	D	0.01	-1.4036	6.6087	0.22739	0.213:0.2235:0.0:0.5634	.	232;539	Q9BXM7-2;Q9BXM7	.;PINK1_HUMAN	V	539	ENSP00000364204:L539V	ENSP00000364204:L539V	L	+	1	2	PINK1	20849640	0.000000	0.05858	0.000000	0.03702	0.880000	0.50808	-1.448000	0.02394	-1.526000	0.01760	0.402000	0.26972	TTG	AL391357.1	-	-	ENSG00000257033		0.498	PINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000257033	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000007954.1	152	0.00	0	T	NM_032409		20977053	20977053	-1	no_coding_region:pseudogene	ENST00000535128	ensembl	human	known	69_37n	splice_site	44	35.29	24	SNP	0.001	G
F2	2147	genome.wustl.edu	37	11	46744957	46744957	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr11:46744957G>T	ENST00000311907.5	+	6	504	c.448G>T	c.(448-450)Gcc>Tcc	p.A150S	F2_ENST00000530231.1_Missense_Mutation_p.A150S	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	150	Kringle 1. {ECO:0000255|PROSITE- ProRule:PRU00121}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)			endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	CCATCCTGGGGCCGACCTACA	0.587																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)	dbGAP											0													60.0	61.0	61.0					11																	46744957		2201	4299	6500	-	-	-	SO:0001583	missense	0			M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.448G>T	11.37:g.46744957G>T	ENSP00000308541:p.Ala150Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Kringle,pfam_Thrombin_light_chain,pfam_GLA_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,superfamily_GLA_domain,smart_GLA_domain,smart_Kringle,smart_Peptidase_S1_S6,pirsf_Peptidase_S1A_prothrombin,pfscan_GLA_domain,pfscan_Kringle,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A_prothrombin,prints_Peptidase_S1A,prints_GLA_domain	p.A150S	ENST00000311907.5	37	c.448	CCDS31476.1	11	.	.	.	.	.	.	.	.	.	.	G	6.122	0.390703	0.11581	.	.	ENSG00000180210	ENST00000311907;ENST00000530231;ENST00000442468	T;T;T	0.67523	-0.27;-0.27;-0.27	4.87	3.97	0.46021	Kringle (5);Kringle-like fold (1);	0.304376	0.37437	N	0.002089	T	0.50803	0.1637	N	0.20807	0.61	0.09310	N	1	B	0.24576	0.106	B	0.25405	0.06	T	0.51631	-0.8681	10	0.87932	D	0	.	10.6774	0.45794	0.0903:0.0:0.9097:0.0	.	150	P00734	THRB_HUMAN	S	150;150;140	ENSP00000308541:A150S;ENSP00000433907:A150S;ENSP00000387413:A140S	ENSP00000308541:A150S	A	+	1	0	F2	46701533	0.799000	0.28903	0.087000	0.20705	0.218000	0.24690	2.974000	0.49272	1.287000	0.44583	-0.254000	0.11334	GCC	F2	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pirsf_Peptidase_S1A_prothrombin,pfscan_Kringle	ENSG00000180210		0.587	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2	HGNC	protein_coding	OTTHUMT00000317706.1	87	0.00	0	G			46744957	46744957	+1	no_errors	ENST00000311907	ensembl	human	known	69_37n	missense	44	40.54	30	SNP	0.171	T
FAT2	2196	genome.wustl.edu	37	5	150905430	150905430	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr5:150905430C>A	ENST00000261800.5	-	17	10417	c.10405G>T	c.(10405-10407)Ggg>Tgg	p.G3469W		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3469	Cadherin 31. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCGTTGTTCCCCTTGGTGATT	0.572																																						dbGAP											0													72.0	66.0	68.0					5																	150905430		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.10405G>T	5.37:g.150905430C>A	ENSP00000261800:p.Gly3469Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.G3469W	ENST00000261800.5	37	c.10405	CCDS4317.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.83|17.83	3.485631|3.485631	0.63962|0.63962	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000520200|ENST00000261800	.|T	.|0.64260	.|-0.09	5.09|5.09	4.16|4.16	0.48862|0.48862	.|Cadherin (4);Cadherin-like (1);	0.089641|0.089641	0.48767|0.48767	D|D	0.000167|0.000167	D|D	0.86719|0.86719	0.6000|0.6000	H|H	0.98559|0.98559	4.265|4.265	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	D|D	0.91448|0.91448	0.5179|0.5179	6|10	.|0.66056	.|D	.|0.02	.|.	15.3154|15.3154	0.74074|0.74074	0.0:0.8598:0.1402:0.0|0.0:0.8598:0.1402:0.0	.|.	.|3469;660	.|Q9NYQ8;E9PDJ8	.|FAT2_HUMAN;.	V|W	327|3469	.|ENSP00000261800:G3469W	.|ENSP00000261800:G3469W	G|G	-|-	2|1	0|0	FAT2|FAT2	150885623|150885623	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.443000|0.443000	0.32047|0.32047	4.548000|4.548000	0.60718|0.60718	2.529000|2.529000	0.85273|0.85273	0.544000|0.544000	0.68410|0.68410	GGG|GGG	FAT2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.572	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	108	0.00	0	C	NM_001447		150905430	150905430	-1	no_errors	ENST00000261800	ensembl	human	known	69_37n	missense	81	31.36	37	SNP	0.998	A
FAT2	2196	genome.wustl.edu	37	5	150924172	150924172	+	Silent	SNP	C	C	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr5:150924172C>T	ENST00000261800.5	-	9	6528	c.6516G>A	c.(6514-6516)caG>caA	p.Q2172Q		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2172	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AATAAGGACTCTGAAACAGTG	0.493																																						dbGAP											0													123.0	130.0	128.0					5																	150924172		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.6516G>A	5.37:g.150924172C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75091|Q9NSR7	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.Q2172	ENST00000261800.5	37	c.6516	CCDS4317.1	5																																																																																			FAT2	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000086570		0.493	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	84	0.00	0	C	NM_001447		150924172	150924172	-1	no_errors	ENST00000261800	ensembl	human	known	69_37n	silent	22	54.17	26	SNP	1.000	T
FHOD1	29109	genome.wustl.edu	37	16	67265611	67265611	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr16:67265611C>A	ENST00000258201.4	-	15	2561	c.2314G>T	c.(2314-2316)Gcc>Tcc	p.A772S		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	772	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.|Interaction with ROCK1.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		CCAATGGAGGCAAGAGTCATC	0.597																																						dbGAP											0													71.0	72.0	71.0					16																	67265611		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.2314G>T	16.37:g.67265611C>A	ENSP00000258201:p.Ala772Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.A772S	ENST00000258201.4	37	c.2314	CCDS10834.1	16	.	.	.	.	.	.	.	.	.	.	C	2.535	-0.307712	0.05458	.	.	ENSG00000135723	ENST00000258201	T	0.15256	2.44	5.53	3.51	0.40186	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.156968	0.56097	D	0.000028	T	0.07324	0.0185	N	0.02751	-0.505	0.46631	D	0.999137	B	0.23591	0.088	B	0.37989	0.262	T	0.26573	-1.0099	10	0.02654	T	1	.	7.6959	0.28594	0.3207:0.5999:0.0:0.0794	.	772	Q9Y613	FHOD1_HUMAN	S	772	ENSP00000258201:A772S	ENSP00000258201:A772S	A	-	1	0	FHOD1	65823112	0.992000	0.36948	0.993000	0.49108	0.906000	0.53458	2.785000	0.47782	1.337000	0.45525	0.655000	0.94253	GCC	FHOD1	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000135723		0.597	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHOD1	HGNC	protein_coding	OTTHUMT00000268844.2	266	0.00	0	C			67265611	67265611	-1	no_errors	ENST00000258201	ensembl	human	known	69_37n	missense	58	38.95	37	SNP	0.971	A
GHITM	27069	genome.wustl.edu	37	10	85901316	85901316	+	Silent	SNP	T	T	G			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr10:85901316T>G	ENST00000372134.3	+	2	253	c.60T>G	c.(58-60)gcT>gcG	p.A20A	RP11-338I21.1_ENST00000606511.1_RNA	NM_014394.2	NP_055209.2	Q9H3K2	GHITM_HUMAN	growth hormone inducible transmembrane protein	20					apoptotic process (GO:0006915)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(2)	10						TCCACCCAGCTTTCACCAAGG	0.478																																						dbGAP											0													108.0	104.0	105.0					10																	85901316		1891	4120	6011	-	-	-	SO:0001819	synonymous_variant	0			AB009685	CCDS41542.1	10q23.1	2008-02-01			ENSG00000165678	ENSG00000165678			17281	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 5"""					8619474, 9110174	Standard	NM_014394		Approved	HSPC282, PTD010, DERP2, My021, TMBIM5	uc001kcs.1	Q9H3K2	OTTHUMG00000018637	ENST00000372134.3:c.60T>G	10.37:g.85901316T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Z9|D3DWE0|O95894|Q5VT95|Q9H0P2	Silent	SNP	pfam_Bax_inhibitor_1-related	p.A20	ENST00000372134.3	37	c.60	CCDS41542.1	10																																																																																			GHITM	-	NULL	ENSG00000165678		0.478	GHITM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHITM	HGNC	protein_coding	OTTHUMT00000049125.1	232	0.00	0	T	NM_014394		85901316	85901316	+1	no_errors	ENST00000372134	ensembl	human	known	69_37n	silent	147	16.48	29	SNP	0.000	G
GPR98	84059	genome.wustl.edu	37	5	89939720	89939720	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr5:89939720A>T	ENST00000405460.2	+	14	2750	c.2654A>T	c.(2653-2655)gAt>gTt	p.D885V		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	885	Calx-beta 7. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AAAAATGATGATCCTCATGGC	0.393																																						dbGAP											0													109.0	106.0	107.0					5																	89939720		1900	4113	6013	-	-	-	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.2654A>T	5.37:g.89939720A>T	ENSP00000384582:p.Asp885Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.D885V	ENST00000405460.2	37	c.2654	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.2|22.2	4.255397|4.255397	0.80135|0.80135	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043|ENST00000504142	T|.	0.31510|.	1.49|.	5.05|5.05	5.05|5.05	0.67936|0.67936	Na-Ca exchanger/integrin-beta4 (1);|.	0.046353|.	0.85682|.	D|.	0.000000|.	D|.	0.83298|.	0.5224|.	M|M	0.90542|0.90542	3.125|3.125	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.73708|.	0.981|.	D|.	0.86888|.	0.2046|.	10|.	0.87932|.	D|.	0|.	.|.	14.7852|14.7852	0.69796|0.69796	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	885|.	Q8WXG9|.	GPR98_HUMAN|.	V|C	885|473	ENSP00000384582:D885V|.	ENSP00000296619:D885V|.	D|X	+|+	2|3	0|0	GPR98|GPR98	89975476|89975476	1.000000|1.000000	0.71417|0.71417	0.880000|0.880000	0.34516|0.34516	0.805000|0.805000	0.45488|0.45488	8.393000|8.393000	0.90182|0.90182	1.899000|1.899000	0.54978|0.54978	0.533000|0.533000	0.62120|0.62120	GAT|TGA	GPR98	-	smart_Calx_beta	ENSG00000164199		0.393	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	324	0.00	0	A	NM_032119		89939720	89939720	+1	no_errors	ENST00000405460	ensembl	human	known	69_37n	missense	98	51.24	103	SNP	1.000	T
HMCN1	83872	genome.wustl.edu	37	1	185984569	185984569	+	Splice_Site	SNP	G	G	C			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr1:185984569G>C	ENST00000271588.4	+	31	5138	c.4909G>C	c.(4909-4911)Gtt>Ctt	p.V1637L	HMCN1_ENST00000367492.2_Splice_Site_p.V1637L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1637					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GGATGTCTATGGTGAGGAACA	0.378																																						dbGAP											0													101.0	102.0	102.0					1																	185984569		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.4909+1G>C	1.37:g.185984569G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.V1637L	ENST00000271588.4	37	c.4909	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252959	0.80135	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.72615	-0.67;-0.67	5.5	5.5	0.81552	Immunoglobulin-like fold (1);	0.121170	0.53938	D	0.000055	D	0.85388	0.5685	M	0.84585	2.705	0.51767	D	0.99993	D	0.56035	0.974	D	0.66716	0.946	T	0.83227	-0.0065	10	0.30078	T	0.28	.	19.7622	0.96325	0.0:0.0:1.0:0.0	.	1637	Q96RW7	HMCN1_HUMAN	L	1637	ENSP00000271588:V1637L;ENSP00000356462:V1637L	ENSP00000271588:V1637L	V	+	1	0	HMCN1	184251192	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.567000	0.60850	2.732000	0.93576	0.650000	0.86243	GTT	HMCN1	-	NULL	ENSG00000143341		0.378	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	234	0.00	0	G	NM_031935	Missense_Mutation	185984569	185984569	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	58	35.56	32	SNP	1.000	C
IGSF1	3547	genome.wustl.edu	37	X	130409100	130409100	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chrX:130409100G>T	ENST00000361420.3	-	17	3424	c.3345C>A	c.(3343-3345)taC>taA	p.Y1115*	IGSF1_ENST00000370903.3_Nonsense_Mutation_p.Y1120*|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Nonsense_Mutation_p.Y1106*|IGSF1_ENST00000370904.1_Nonsense_Mutation_p.Y1106*			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1115	Ig-like C2-type 11.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						AGTCAGCCCTGTACCCACTTG	0.488																																						dbGAP											0													198.0	195.0	196.0					X																	130409100		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3345C>A	X.37:g.130409100G>T	ENSP00000355010:p.Tyr1115*	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEG2|H9KV64|O15070|Q9NTC8	Nonsense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Y1120*	ENST00000361420.3	37	c.3360	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	G	40	8.028027	0.98619	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	.	.	.	4.83	4.83	0.62350	.	1.114690	0.06817	N	0.791387	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.231	0.54488	0.0:0.0:1.0:0.0	.	.	.	.	X	1106;1115;1106;1120	.	ENSP00000355010:Y1115X	Y	-	3	2	IGSF1	130236781	0.998000	0.40836	0.999000	0.59377	0.814000	0.46013	1.944000	0.40263	2.376000	0.81061	0.594000	0.82650	TAC	IGSF1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000147255		0.488	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	215	0.00	0	G			130409100	130409100	-1	no_errors	ENST00000370903	ensembl	human	known	69_37n	nonsense	72	58.38	101	SNP	0.997	T
KRTAP5-10	387273	genome.wustl.edu	37	11	71276905	71276905	+	Missense_Mutation	SNP	A	A	C	rs201034939	byFrequency	TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr11:71276905A>C	ENST00000398531.1	+	1	297	c.272A>C	c.(271-273)aAg>aCg	p.K91T	KRTAP5-10_ENST00000376536.4_Intron	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	91	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						GGGGGCTCCAAGGGGGGCTGT	0.682																																						dbGAP											0													36.0	54.0	48.0					11																	71276905		2053	4175	6228	-	-	-	SO:0001583	missense	0			AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.272A>C	11.37:g.71276905A>C	ENSP00000381542:p.Lys91Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EHA4	Missense_Mutation	SNP	NULL	p.K91T	ENST00000398531.1	37	c.272	CCDS41684.1	11	.	.	.	.	.	.	.	.	.	.	a	1.871	-0.460257	0.04508	.	.	ENSG00000204572	ENST00000398531	T	0.01228	5.14	1.97	0.458	0.16670	.	.	.	.	.	T	0.01835	0.0058	M	0.80508	2.5	0.09310	N	0.999995	B	0.32893	0.389	B	0.21708	0.036	T	0.45352	-0.9267	9	0.16420	T	0.52	.	4.6381	0.12534	0.7192:0.0:0.2808:0.0	.	91	Q6L8G5	KR510_HUMAN	T	91	ENSP00000381542:K91T	ENSP00000381542:K91T	K	+	2	0	KRTAP5-10	70954553	0.715000	0.27946	0.027000	0.17364	0.088000	0.18126	0.562000	0.23531	0.110000	0.17919	0.333000	0.21579	AAG	KRTAP5-10	-	NULL	ENSG00000204572		0.682	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRTAP5-10	HGNC	protein_coding	OTTHUMT00000127968.2	107	0.00	0	A			71276905	71276905	+1	no_errors	ENST00000398531	ensembl	human	known	69_37n	missense	63	34.38	33	SNP	0.636	C
LMBR1L	55716	genome.wustl.edu	37	12	49499717	49499717	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr12:49499717T>C	ENST00000267102.8	-	3	523	c.181A>G	c.(181-183)Aac>Gac	p.N61D	LMBR1L_ENST00000553204.1_5'UTR|LMBR1L_ENST00000547382.1_Missense_Mutation_p.N61D|LMBR1L_ENST00000395141.4_Missense_Mutation_p.N56D	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like	61	LCN1-binding.				endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GCAATCTTGTTGACGGTGGCA	0.547																																						dbGAP											0													163.0	127.0	139.0					12																	49499717		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.181A>G	12.37:g.49499717T>C	ENSP00000267102:p.Asn61Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	Missense_Mutation	SNP	pfam_LMBR1-like_membr_prot,prints_Lipcalin_1_rcpt	p.N61D	ENST00000267102.8	37	c.181	CCDS8780.2	12	.	.	.	.	.	.	.	.	.	.	T	29.4	5.006056	0.93287	.	.	ENSG00000139636	ENST00000267102;ENST00000547382;ENST00000395141;ENST00000547675;ENST00000551854;ENST00000551782	T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47	5.94	5.94	0.96194	LMBR1-like membrane protein (1);	0.182364	0.56097	D	0.000036	T	0.50854	0.1640	L	0.59436	1.845	0.53688	D	0.999975	P;D;D	0.71674	0.884;0.961;0.998	P;P;D	0.80764	0.503;0.721;0.994	T	0.39583	-0.9607	10	0.28530	T	0.3	.	15.3773	0.74621	0.0:0.0:0.0:1.0	.	61;61;56	Q6UX01-3;Q6UX01;Q6UX01-4	.;LMBRL_HUMAN;.	D	61;61;56;61;66;61	ENSP00000267102:N61D;ENSP00000447329:N61D;ENSP00000378573:N56D;ENSP00000447240:N61D;ENSP00000446641:N66D;ENSP00000449633:N61D	ENSP00000267102:N61D	N	-	1	0	LMBR1L	47785984	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.061000	0.64319	2.272000	0.75746	0.459000	0.35465	AAC	LMBR1L	-	pfam_LMBR1-like_membr_prot	ENSG00000139636		0.547	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBR1L	HGNC	protein_coding	OTTHUMT00000318696.1	264	0.00	0	T	NM_018113		49499717	49499717	-1	no_errors	ENST00000267102	ensembl	human	known	69_37n	missense	236	16.31	46	SNP	1.000	C
LTF	4057	genome.wustl.edu	37	3	46501161	46501161	+	Silent	SNP	A	A	G			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr3:46501161A>G	ENST00000231751.4	-	2	487	c.192T>C	c.(190-192)tgT>tgC	p.C64C	LTF_ENST00000426532.2_Silent_p.C20C|LTF_ENST00000417439.1_Silent_p.C64C	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	64	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		TGGCCTGGATACACTGGATGG	0.512																																						dbGAP											0													106.0	101.0	103.0					3																	46501161		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.192T>C	3.37:g.46501161A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Silent	SNP	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	p.C64	ENST00000231751.4	37	c.192	CCDS33747.1	3																																																																																			LTF	-	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	ENSG00000012223		0.512	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LTF	HGNC	protein_coding	OTTHUMT00000343951.2	274	0.00	0	A	NM_002343		46501161	46501161	-1	no_errors	ENST00000231751	ensembl	human	known	69_37n	silent	115	42.50	85	SNP	0.531	G
MBOAT1	154141	genome.wustl.edu	37	6	20144468	20144468	+	Silent	SNP	G	G	A			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr6:20144468G>A	ENST00000324607.7	-	4	566	c.402C>T	c.(400-402)ctC>ctT	p.L134L	MBOAT1_ENST00000536798.1_Silent_p.L134L|MBOAT1_ENST00000541730.1_Missense_Mutation_p.S4L	NM_001080480.1	NP_001073949.1	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain containing 1	134					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(5)	20	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			AATCCGTAGTGAGAATTCCAT	0.388																																						dbGAP											0													127.0	130.0	129.0					6																	20144468		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK093994	CCDS34346.1	6p22.3	2013-10-11	2006-06-29	2006-06-29	ENSG00000172197	ENSG00000172197			21579	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 1"""	611732	"""O-acyltransferase (membrane bound) domain containing 1"""	OACT1		18287005	Standard	NM_001080480		Approved	MGC44669, dJ434O11.1, LPEAT1	uc003ncx.2	Q6ZNC8	OTTHUMG00000014334	ENST00000324607.7:c.402C>T	6.37:g.20144468G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A9EDQ5|B4DL59|B4E3J4|Q86XC2|Q8N9R5	Missense_Mutation	SNP	pfam_MBOAT_fam	p.S4L	ENST00000324607.7	37	c.11	CCDS34346.1	6	.	.	.	.	.	.	.	.	.	.	G	14.58	2.579275	0.46006	.	.	ENSG00000172197	ENST00000541730	T	0.18016	2.24	5.28	3.37	0.38596	.	.	.	.	.	T	0.03564	0.0102	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26744	-1.0094	7	.	.	.	-14.9253	6.8657	0.24093	0.1642:0.1469:0.6889:0.0	.	4	Q6ZNC8-2	.	L	4	ENSP00000441568:S4L	.	S	-	2	0	MBOAT1	20252447	0.999000	0.42202	1.000000	0.80357	0.987000	0.75469	0.387000	0.20718	1.210000	0.43336	0.514000	0.50259	TCA	MBOAT1	-	NULL	ENSG00000172197		0.388	MBOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT1	HGNC	protein_coding	OTTHUMT00000039980.1	276	0.00	0	G			20144468	20144468	-1	no_errors	ENST00000541730	ensembl	human	known	69_37n	missense	242	11.68	32	SNP	0.999	A
NFYB	4801	genome.wustl.edu	37	12	104519903	104519903	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr12:104519903G>A	ENST00000240055.3	-	4	447	c.220C>T	c.(220-222)Caa>Taa	p.Q74*	RNA5SP370_ENST00000362545.1_RNA|NFYB_ENST00000551727.1_Nonsense_Mutation_p.Q74*	NM_006166.3	NP_006157.1	P25208	NFYB_HUMAN	nuclear transcription factor Y, beta	74	B domain.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	6						TTTCCCGTTTGAGGTATGGCA	0.363																																						dbGAP											0													191.0	173.0	179.0					12																	104519903		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS9098.1	12q22-q23	2008-11-11				ENSG00000120837			7805	protein-coding gene	gene with protein product		189904				1774067, 9612081	Standard	NM_006166		Approved	CBF-A, HAP3, NF-YB	uc001tkl.1	P25208	OTTHUMG00000170176	ENST00000240055.3:c.220C>T	12.37:g.104519903G>A	ENSP00000240055:p.Gln74*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7B9|Q96IY8	Nonsense_Mutation	SNP	pfam_CBFA_NFYB_domain,pfam_Histone_core_D,superfamily_Histone-fold,prints_Transcrpt_fac_CBFA/NFYB_topo	p.Q74*	ENST00000240055.3	37	c.220	CCDS9098.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.475224	0.97598	.	.	ENSG00000120837	ENST00000240055;ENST00000551727;ENST00000551446	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-2.4991	19.7096	0.96089	0.0:0.0:1.0:0.0	.	.	.	.	X	74;74;75	.	ENSP00000240055:Q74X	Q	-	1	0	NFYB	103044033	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.062000	0.89475	2.652000	0.90054	0.655000	0.94253	CAA	NFYB	-	pfam_CBFA_NFYB_domain,pfam_Histone_core_D,superfamily_Histone-fold	ENSG00000120837		0.363	NFYB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFYB	HGNC	protein_coding	OTTHUMT00000407786.1	714	0.00	0	G			104519903	104519903	-1	no_errors	ENST00000240055	ensembl	human	known	69_37n	nonsense	360	15.85	68	SNP	1.000	A
NLRP12	91662	genome.wustl.edu	37	19	54312951	54312951	+	Silent	SNP	C	C	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr19:54312951C>T	ENST00000324134.6	-	3	2130	c.1962G>A	c.(1960-1962)ctG>ctA	p.L654L	NLRP12_ENST00000391773.1_Silent_p.L654L|NLRP12_ENST00000391772.1_Silent_p.L654L|NLRP12_ENST00000391775.3_Silent_p.L654L|NLRP12_ENST00000535162.1_Silent_p.L654L|NLRP12_ENST00000345770.5_Silent_p.L654L|NLRP12_ENST00000354278.3_Silent_p.L654L|NLRP12_ENST00000351894.4_Silent_p.L654L	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	654					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TGCAGCGCTTCAGACAGAACG	0.622																																						dbGAP											0													61.0	56.0	57.0					19																	54312951		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1962G>A	19.37:g.54312951C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L654	ENST00000324134.6	37	c.1962	CCDS12864.1	19																																																																																			NLRP12	-	NULL	ENSG00000142405		0.622	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	HGNC	protein_coding	OTTHUMT00000134340.1	97	0.00	0	C	NM_144687		54312951	54312951	-1	no_errors	ENST00000391773	ensembl	human	known	69_37n	silent	35	20.45	9	SNP	0.001	T
PGK2	5232	genome.wustl.edu	37	6	49753845	49753845	+	Silent	SNP	G	G	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr6:49753845G>T	ENST00000304801.3	-	1	1208	c.1056C>A	c.(1054-1056)acC>acA	p.T352T		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	352					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					TGAGGGCTTTGGTTCCCTTAG	0.473																																						dbGAP											0													145.0	145.0	145.0					6																	49753845		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.1056C>A	6.37:g.49753845G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Y8|Q9H107	Silent	SNP	pfam_Phosphoglycerate_kinase,superfamily_Phosphoglycerate_kinase,prints_Phosphoglycerate_kinase	p.T352	ENST00000304801.3	37	c.1056	CCDS4930.1	6																																																																																			PGK2	-	pfam_Phosphoglycerate_kinase,superfamily_Phosphoglycerate_kinase,prints_Phosphoglycerate_kinase	ENSG00000170950		0.473	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGK2	HGNC	protein_coding	OTTHUMT00000040872.1	325	0.00	0	G			49753845	49753845	-1	no_errors	ENST00000304801	ensembl	human	known	69_37n	silent	149	19.02	35	SNP	0.998	T
PIP4K2C	79837	genome.wustl.edu	37	12	57987825	57987825	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr12:57987825G>T	ENST00000354947.5	+	2	208	c.192G>T	c.(190-192)caG>caT	p.Q64H	PIP4K2C_ENST00000540759.2_Missense_Mutation_p.Q64H|PIP4K2C_ENST00000422156.3_Missense_Mutation_p.Q64H|PIP4K2C_ENST00000550465.1_Missense_Mutation_p.Q64H			Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, gamma	64	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(13)|pancreas(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Melanoma(17;0.122)					AGCTCAGCCAGGTGCCTCCCC	0.512																																						dbGAP											0													117.0	97.0	104.0					12																	57987825		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK125526	CCDS8946.1, CCDS53808.1, CCDS55839.1	12q13.3	2014-09-04	2007-08-14	2007-08-14	ENSG00000166908	ENSG00000166908			23786	protein-coding gene	gene with protein product			"""phosphatidylinositol-4-phosphate 5-kinase, type II, gamma"""	PIP5K2C		9367159	Standard	NM_024779		Approved	FLJ22055	uc001sot.3	Q8TBX8	OTTHUMG00000170144	ENST00000354947.5:c.192G>T	12.37:g.57987825G>T	ENSP00000347032:p.Gln64His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDL3|B4DM11|B4DY44|Q9H6N2	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.Q64H	ENST00000354947.5	37	c.192	CCDS8946.1	12	.	.	.	.	.	.	.	.	.	.	G	0.343	-0.949588	0.02304	.	.	ENSG00000166908	ENST00000422156;ENST00000540759;ENST00000436866;ENST00000551772;ENST00000550465;ENST00000354947	T;T;T;T;T	0.31247	1.5;1.5;1.56;1.5;1.5	3.53	3.53	0.40419	Phosphatidylinositol-4-phosphate 5-kinase, core (1);	0.000000	0.85682	D	0.000000	T	0.10508	0.0257	N	0.03930	-0.32	0.50039	D	0.99984	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.18999	-1.0319	10	0.02654	T	1	-17.3698	8.8815	0.35378	0.1086:0.0:0.8914:0.0	.	64;64;64	B4DM11;B4DY44;Q8TBX8	.;.;PI42C_HUMAN	H	64;64;64;43;64;64	ENSP00000412035:Q64H;ENSP00000439878:Q64H;ENSP00000450197:Q43H;ENSP00000447390:Q64H;ENSP00000347032:Q64H	ENSP00000347032:Q64H	Q	+	3	2	PIP4K2C	56274092	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	0.722000	0.25925	2.265000	0.75225	0.563000	0.77884	CAG	PIP4K2C	-	NULL	ENSG00000166908		0.512	PIP4K2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP4K2C	HGNC	protein_coding	OTTHUMT00000407644.1	242	0.00	0	G	NM_024779		57987825	57987825	+1	no_errors	ENST00000354947	ensembl	human	known	69_37n	missense	107	55.23	132	SNP	1.000	T
POU2F2	5452	genome.wustl.edu	37	19	42596350	42596350	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr19:42596350C>T	ENST00000526816.2	-	13	1286	c.1271G>A	c.(1270-1272)gGg>gAg	p.G424E	POU2F2_ENST00000389341.5_Missense_Mutation_p.G408E|POU2F2_ENST00000560398.1_Missense_Mutation_p.G430E|POU2F2_ENST00000560558.1_Missense_Mutation_p.G369E|POU2F2_ENST00000533720.1_Missense_Mutation_p.G408E|POU2F2_ENST00000529952.1_Missense_Mutation_p.G424E|POU2F2_ENST00000342301.4_Missense_Mutation_p.G424E|POU2F2_ENST00000529067.1_Intron			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	424	Gly-rich.				cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	gggcgcagccccgcccccgcc	0.662																																						dbGAP											0													5.0	7.0	7.0					19																	42596350		2072	4048	6120	-	-	-	SO:0001583	missense	0				CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.1271G>A	19.37:g.42596350C>T	ENSP00000431603:p.Gly424Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16648|Q7M4M8|Q9BRS4	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU,prints_TF_octamer	p.G424E	ENST00000526816.2	37	c.1271	CCDS56095.1	19	.	.	.	.	.	.	.	.	.	.	C	15.27	2.782824	0.49891	.	.	ENSG00000028277	ENST00000389341;ENST00000342301;ENST00000292077;ENST00000533720;ENST00000526816;ENST00000529952	D;D;D;D;D	0.82526	-1.5;-1.62;-1.6;-1.52;-1.52	3.0	1.92	0.25849	.	7739.210000	0.00166	N	0.000000	D	0.84156	0.5410	N	0.14661	0.345	0.27129	N	0.961938	D;D	0.64830	0.994;0.983	D;B	0.75484	0.986;0.383	T	0.71925	-0.4445	10	0.66056	D	0.02	.	7.3085	0.26461	0.2622:0.7378:0.0:0.0	.	424;408	P09086;P09086-3	PO2F2_HUMAN;.	E	408;424;424;408;423;424	ENSP00000373992:G408E;ENSP00000339369:G424E;ENSP00000437221:G408E;ENSP00000431603:G423E;ENSP00000436988:G424E	ENSP00000292077:G424E	G	-	2	0	POU2F2	47288190	0.995000	0.38212	0.998000	0.56505	0.962000	0.63368	0.618000	0.24373	0.590000	0.29694	0.462000	0.41574	GGG	POU2F2	-	NULL	ENSG00000028277		0.662	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POU2F2	HGNC	protein_coding	OTTHUMT00000387329.3	8	0.00	0	C			42596350	42596350	-1	no_errors	ENST00000342301	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	1.000	T
PTGER3	5733	genome.wustl.edu	37	1	71318542	71318542	+	3'UTR	SNP	C	C	G			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr1:71318542C>G	ENST00000370931.3	-	0	1407				PTGER3_ENST00000460330.1_Splice_Site_p.E369Q|PTGER3_ENST00000351052.5_3'UTR|PTGER3_ENST00000370932.2_Splice_Site_p.E360Q	NM_198714.1	NP_942007.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)						cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	CAAAATTCCTCCTGGAAAACA	0.308																																						dbGAP											0													130.0	145.0	140.0					1																	71318542		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000370931.3:c.*24G>C	1.37:g.71318542C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srbc,pfscan_GPCR_Rhodpsn_supfam,prints_Prostglndn_EP3_rcpt,prints_Prostanoid_rcpt,prints_EP3_rcpt_2,prints_Prostglndn_DP_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Thbox_rcpt	p.E369Q	ENST00000370931.3	37	c.1105	CCDS656.1	1	.	.	.	.	.	.	.	.	.	.	C	0.922	-0.715434	0.03206	.	.	ENSG00000050628	ENST00000370932;ENST00000460330	T;T	0.17370	2.43;2.28	2.92	1.95	0.26073	.	.	.	.	.	T	0.05364	0.0142	L	0.41124	1.26	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.11084	-1.0602	9	0.41790	T	0.15	.	7.6006	0.28073	0.0:0.7342:0.2658:0.0	.	360;369	P43115-3;P43115-4	.;.	Q	360;369	ENSP00000359970:E360Q;ENSP00000418073:E369Q	ENSP00000359970:E360Q	E	-	1	0	PTGER3	71091130	0.991000	0.36638	0.980000	0.43619	0.274000	0.26718	0.983000	0.29552	0.736000	0.32559	0.460000	0.39030	GAG	PTGER3	-	NULL	ENSG00000050628		0.308	PTGER3-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	PTGER3	HGNC	protein_coding	OTTHUMT00000026077.1	198	0.00	0	C	NM_000957		71318542	71318542	-1	no_errors	ENST00000460330	ensembl	human	known	69_37n	missense	72	44.62	58	SNP	0.987	G
SCN2A	6326	genome.wustl.edu	37	2	166179821	166179822	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr2:166179821_166179822delCT	ENST00000375437.2	+	12	2117_2118	c.1827_1828delCT	c.(1825-1830)gactctfs	p.S610fs	SCN2A_ENST00000283256.6_Frame_Shift_Del_p.S610fs|SCN2A_ENST00000357398.3_Frame_Shift_Del_p.S610fs|SCN2A_ENST00000375427.2_Frame_Shift_Del_p.S610fs	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	610					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCCGAAGAGACTCTCTGTTCGT	0.559																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1827_1828delCT	2.37:g.166179825_166179826delCT	ENSP00000364586:p.Ser610fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Frame_Shift_Del	DEL	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.L611fs	ENST00000375437.2	37	c.1827_1828	CCDS33314.1	2																																																																																			SCN2A	-	pfam_DUF3451	ENSG00000136531		0.559	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	169	0.00	0	CT	NM_021007		166179821	166179822	+1	no_errors	ENST00000283256	ensembl	human	known	69_37n	frame_shift_del	47	29.85	20	DEL	1.000:1.000	-
SHROOM4	57477	genome.wustl.edu	37	X	50350476	50350476	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chrX:50350476G>C	ENST00000289292.7	-	6	3949	c.3666C>G	c.(3664-3666)caC>caG	p.H1222Q	SHROOM4_ENST00000460112.3_Missense_Mutation_p.H1106Q|SHROOM4_ENST00000376020.2_Missense_Mutation_p.H1222Q			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1222	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					GAGATCCCAAGTGACCCCTTA	0.547																																						dbGAP											0													85.0	74.0	77.0					X																	50350476		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3666C>G	X.37:g.50350476G>C	ENSP00000289292:p.His1222Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	pfam_ASD2,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.H1222Q	ENST00000289292.7	37	c.3666	CCDS35277.1	X	.	.	.	.	.	.	.	.	.	.	G	4.400	0.073849	0.08485	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.28666	1.6;1.6;1.6	4.39	-0.378	0.12497	Apx/shroom, ASD2 (2);	0.910304	0.09467	N	0.798223	T	0.15478	0.0373	N	0.22421	0.69	0.09310	N	1	B	0.18166	0.026	B	0.16289	0.015	T	0.28650	-1.0037	10	0.30078	T	0.28	.	0.7354	0.00964	0.3043:0.1615:0.3658:0.1684	.	1222	Q9ULL8	SHRM4_HUMAN	Q	1222;1222;1106	ENSP00000289292:H1222Q;ENSP00000365188:H1222Q;ENSP00000421450:H1106Q	ENSP00000289292:H1222Q	H	-	3	2	SHROOM4	50367216	0.000000	0.05858	0.000000	0.03702	0.797000	0.45037	0.132000	0.15891	-0.243000	0.09653	-0.305000	0.09177	CAC	SHROOM4	-	pfam_ASD2	ENSG00000158352		0.547	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	HGNC	protein_coding	OTTHUMT00000056564.4	202	0.00	0	G	NM_020717		50350476	50350476	-1	no_errors	ENST00000289292	ensembl	human	known	69_37n	missense	74	38.84	47	SNP	0.000	C
SMC1B	27127	genome.wustl.edu	37	22	45804622	45804622	+	Silent	SNP	G	G	A	rs552854282		TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr22:45804622G>A	ENST00000357450.4	-	2	266	c.267C>T	c.(265-267)ggC>ggT	p.G89G	SMC1B_ENST00000404354.3_Silent_p.G89G	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	89					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TTTTCTCTTCGCCACTTTCCT	0.294													G|||	1	0.000199681	0.0	0.0	5008	,	,		16067	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													79.0	74.0	76.0					22																	45804622		1803	4070	5873	-	-	-	SO:0001819	synonymous_variant	0			AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.267C>T	22.37:g.45804622G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Silent	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_t-SNARE,smart_SMC_hinge	p.G89	ENST00000357450.4	37	c.267	CCDS43027.1	22																																																																																			SMC1B	-	pfam_RecF/RecN/SMC	ENSG00000077935		0.294	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1B	HGNC	protein_coding	OTTHUMT00000322256.2	180	0.00	0	G	NM_148674		45804622	45804622	-1	no_errors	ENST00000357450	ensembl	human	known	69_37n	silent	46	37.84	28	SNP	0.803	A
THEM5	284486	genome.wustl.edu	37	1	151823599	151823599	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr1:151823599A>G	ENST00000368817.5	-	3	525	c.394T>C	c.(394-396)Ttt>Ctt	p.F132L	AL450992.2_ENST00000434182.1_RNA	NM_182578.3	NP_872384	Q8N1Q8	ACO15_HUMAN	thioesterase superfamily member 5	132					cardiolipin acyl-chain remodeling (GO:0035965)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)	mitochondrial matrix (GO:0005759)	palmitoyl-CoA hydrolase activity (GO:0016290)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			GGCTGGAAAAAGATGACATAC	0.552																																						dbGAP											0													129.0	116.0	121.0					1																	151823599		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095283	CCDS1005.1	1q21.3	2008-02-05			ENSG00000196407	ENSG00000196407			26755	protein-coding gene	gene with protein product		615653					Standard	NM_182578		Approved	FLJ37964	uc021oyw.1	Q8N1Q8	OTTHUMG00000013070	ENST00000368817.5:c.394T>C	1.37:g.151823599A>G	ENSP00000357807:p.Phe132Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1C3	Missense_Mutation	SNP	pfam_Thioestr_supf	p.F132L	ENST00000368817.5	37	c.394	CCDS1005.1	1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.869250	0.91587	.	.	ENSG00000196407	ENST00000368817	T	0.22539	1.95	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.41282	0.1152	M	0.84683	2.71	0.42929	D	0.994316	D	0.69078	0.997	D	0.75020	0.985	T	0.47262	-0.9131	10	0.59425	D	0.04	-1.8516	13.0206	0.58784	1.0:0.0:0.0:0.0	.	132	Q8N1Q8	THEM5_HUMAN	L	132	ENSP00000357807:F132L	ENSP00000357807:F132L	F	-	1	0	THEM5	150090223	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.625000	0.61262	2.326000	0.78906	0.533000	0.62120	TTT	THEM5	-	NULL	ENSG00000196407		0.552	THEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THEM5	HGNC	protein_coding	OTTHUMT00000036678.2	257	0.39	1	A	NM_182578		151823599	151823599	-1	no_errors	ENST00000368817	ensembl	human	known	69_37n	missense	145	37.87	89	SNP	1.000	G
TMEM91	641649	genome.wustl.edu	37	19	41889743	41889743	+	Silent	SNP	C	C	T			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr19:41889743C>T	ENST00000392002.2	+	4	1144	c.484C>T	c.(484-486)Ctg>Ttg	p.L162L	TMEM91_ENST00000604123.1_Intron|BCKDHA_ENST00000595085.1_Intron|TMEM91_ENST00000542945.1_3'UTR|TMEM91_ENST00000539627.1_3'UTR|CTC-435M10.3_ENST00000540732.1_Intron|TMEM91_ENST00000356385.4_3'UTR|TMEM91_ENST00000544232.1_Intron|CTC-435M10.3_ENST00000604424.1_Intron|TMEM91_ENST00000436170.2_Intron|TMEM91_ENST00000447302.2_Intron|TMEM91_ENST00000413014.2_Intron	NM_001098821.1	NP_001092291.1	Q6ZNR0	TMM91_HUMAN	transmembrane protein 91	162					hematopoietic progenitor cell differentiation (GO:0002244)|response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)				lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	5						CCTGGTGACCCTGGCTGCCTA	0.697																																						dbGAP											0													25.0	32.0	30.0					19																	41889743		2040	4186	6226	-	-	-	SO:0001819	synonymous_variant	0			AK130820, BC063705	CCDS42571.1, CCDS42572.1, CCDS46082.1, CCDS46083.1, CCDS46084.1	19q13.2	2009-10-16							32393	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 6"""					12477932	Standard	NM_001098824		Approved	FLJ27310, IFITMD6		Q6ZNR0		ENST00000392002.2:c.484C>T	19.37:g.41889743C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J9D1|C9JZ62|C9K046|Q6P434	Silent	SNP	pfam_Interferon-induced_TM_protein	p.L162	ENST00000392002.2	37	c.484	CCDS42571.1	19																																																																																			TMEM91	-	NULL	ENSG00000142046		0.697	TMEM91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM91	HGNC	protein_coding	OTTHUMT00000398302.2	71	0.00	0	C			41889743	41889743	+1	no_errors	ENST00000392002	ensembl	human	known	69_37n	silent	63	17.11	13	SNP	1.000	T
TPCN2	219931	genome.wustl.edu	37	11	68825062	68825062	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr11:68825062G>C	ENST00000294309.3	+	5	547	c.446G>C	c.(445-447)tGg>tCg	p.W149S	TPCN2_ENST00000442692.2_3'UTR|TPCN2_ENST00000542467.1_Missense_Mutation_p.W149S	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	149					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CTGTTCGGGTGGGCCCATTTC	0.612																																						dbGAP											0													185.0	139.0	155.0					11																	68825062		2200	4294	6494	-	-	-	SO:0001583	missense	0			AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.446G>C	11.37:g.68825062G>C	ENSP00000294309:p.Trp149Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NT82	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.W149S	ENST00000294309.3	37	c.446	CCDS8189.1	11	.	.	.	.	.	.	.	.	.	.	G	12.30	1.898086	0.33535	.	.	ENSG00000162341	ENST00000356782;ENST00000294309;ENST00000535009;ENST00000542467	D;D	0.98329	-4.87;-4.87	4.46	3.53	0.40419	Ion transport (1);	0.217871	0.42548	D	0.000697	D	0.98535	0.9511	M	0.81497	2.545	0.80722	D	1	P;P;D	0.71674	0.934;0.833;0.998	P;B;D	0.66716	0.659;0.438;0.946	D	0.98383	1.0559	10	0.56958	D	0.05	-3.3664	10.4474	0.44503	0.1006:0.0:0.8994:0.0	.	149;149;64	E7ETX0;Q8NHX9;F5H1G5	.;TPC2_HUMAN;.	S	79;149;64;149	ENSP00000294309:W149S;ENSP00000445551:W149S	ENSP00000294309:W149S	W	+	2	0	TPCN2	68581638	1.000000	0.71417	0.814000	0.32528	0.741000	0.42261	4.123000	0.57917	0.843000	0.35070	0.462000	0.41574	TGG	TPCN2	-	pfam_Ion_trans_dom	ENSG00000162341		0.612	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPCN2	HGNC	protein_coding	OTTHUMT00000396878.2	384	0.00	0	G	NM_139075		68825062	68825062	+1	no_errors	ENST00000294309	ensembl	human	known	69_37n	missense	195	37.38	117	SNP	0.992	C
TRAF5	7188	genome.wustl.edu	37	1	211545718	211545718	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr1:211545718delG	ENST00000261464.5	+	11	1402	c.1348delG	c.(1348-1350)gggfs	p.G450fs	TRAF5_ENST00000336184.2_Frame_Shift_Del_p.G450fs|TRAF5_ENST00000427925.2_Frame_Shift_Del_p.G344fs|TRAF5_ENST00000367004.3_Frame_Shift_Del_p.G450fs	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	450	Interaction with EIF2AK2/PKR.|MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		ATACCTGAATGGGGATGGGTC	0.572																																						dbGAP											0													90.0	90.0	90.0					1																	211545718		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.1348delG	1.37:g.211545718delG	ENSP00000261464:p.Gly450fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIS9|B4E0A2|Q6FHY1	Frame_Shift_Del	DEL	pfam_MATH,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.D451fs	ENST00000261464.5	37	c.1348	CCDS1497.1	1																																																																																			TRAF5	-	pfam_MATH,superfamily_TRAF-like,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH	ENSG00000082512		0.572	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF5	HGNC	protein_coding	OTTHUMT00000089825.1	93	0.00	0	G	NM_004619		211545718	211545718	+1	no_errors	ENST00000261464	ensembl	human	known	69_37n	frame_shift_del	56	21.13	15	DEL	1.000	-
UCK2	7371	genome.wustl.edu	37	1	165859581	165859581	+	Silent	SNP	G	G	A			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr1:165859581G>A	ENST00000367879.4	+	2	543	c.240G>A	c.(238-240)caG>caA	p.Q80Q	UCK2_ENST00000372212.4_Silent_p.Q80Q	NM_012474.4	NP_036606.2	Q9BZX2	UCK2_HUMAN	uridine-cytidine kinase 2	80					cellular response to oxygen levels (GO:0071453)|CTP salvage (GO:0044211)|feeding behavior (GO:0007631)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|response to axon injury (GO:0048678)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					TGAAGGGCCAGTTCAACTTTG	0.522																																						dbGAP											0													74.0	66.0	69.0					1																	165859581		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF236637	CCDS1252.1	1p32	2012-10-02	2004-07-13	2004-07-14	ENSG00000143179	ENSG00000143179	2.7.1.48		12562	protein-coding gene	gene with protein product		609329	"""uridine monophosphate kinase"""	UMPK			Standard	NM_012474		Approved		uc001gdp.3	Q9BZX2	OTTHUMG00000040117	ENST00000367879.4:c.240G>A	1.37:g.165859581G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VV91|Q7KZV3|Q92528|Q96KG5|Q9BU42	Silent	SNP	pfam_PRK/URK,pfam_Depp_CoAkinase,prints_Uridine_kinase,prints_PRK,tigrfam_Uridine_kinase	p.Q80	ENST00000367879.4	37	c.240	CCDS1252.1	1																																																																																			UCK2	-	pfam_PRK/URK,pfam_Depp_CoAkinase,tigrfam_Uridine_kinase	ENSG00000143179		0.522	UCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCK2	HGNC	protein_coding	OTTHUMT00000096753.1	251	0.00	0	G	NM_012474		165859581	165859581	+1	no_errors	ENST00000367879	ensembl	human	known	69_37n	silent	149	15.34	27	SNP	1.000	A
USPL1	10208	genome.wustl.edu	37	13	31232168	31232168	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr13:31232168A>G	ENST00000255304.4	+	9	2296	c.1954A>G	c.(1954-1956)Ata>Gta	p.I652V		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	652					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		ATTTGTGGACATAAGTTTTCC	0.338																																					Ovarian(60;318 1180 1554 28110 31601)	dbGAP											0													76.0	74.0	75.0					13																	31232168		2203	4300	6503	-	-	-	SO:0001583	missense	0			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.1954A>G	13.37:g.31232168A>G	ENSP00000255304:p.Ile652Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	pfscan_Peptidase_C19	p.I652V	ENST00000255304.4	37	c.1954	CCDS9336.1	13	.	.	.	.	.	.	.	.	.	.	A	0.024	-1.392917	0.01185	.	.	ENSG00000132952	ENST00000255304	T	0.13196	2.61	4.99	-3.17	0.05202	.	1.921840	0.02052	N	0.050115	T	0.07369	0.0186	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.25187	-1.0139	10	0.19590	T	0.45	1.086	0.223	0.00170	0.3733:0.1712:0.2139:0.2415	.	652	Q5W0Q7	USPL1_HUMAN	V	652	ENSP00000255304:I652V	ENSP00000255304:I652V	I	+	1	0	USPL1	30130168	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.023000	0.13533	-0.215000	0.10063	-1.137000	0.01932	ATA	USPL1	-	NULL	ENSG00000132952		0.338	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USPL1	HGNC	protein_coding	OTTHUMT00000044369.1	166	0.00	0	A	NM_005800		31232168	31232168	+1	no_errors	ENST00000255304	ensembl	human	known	69_37n	missense	11	77.55	38	SNP	0.000	G
ZWILCH	55055	genome.wustl.edu	37	15	66829513	66829513	+	Missense_Mutation	SNP	A	A	C	rs549811304		TCGA-E2-A15S-01A-11D-A10Y-09	TCGA-E2-A15S-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	01f78efa-ba0b-4263-81fd-d3d8ea1bc5fd	9c963e55-136d-498c-b440-09d4fc3f74de	g.chr15:66829513A>C	ENST00000307897.5	+	16	1866	c.1486A>C	c.(1486-1488)Ata>Cta	p.I496L	ZWILCH_ENST00000446801.2_Missense_Mutation_p.I382L|ZWILCH_ENST00000565627.1_Missense_Mutation_p.I382L|ZWILCH_ENST00000535141.2_Missense_Mutation_p.I382L	NM_017975.3	NP_060445.3	Q9H900	ZWILC_HUMAN	zwilch kinetochore protein	496					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(1)|lung(6)|ovary(1)	18						CAGGATCTGCATAAAGTATTA	0.343																																						dbGAP											0													77.0	74.0	75.0					15																	66829513		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK023175	CCDS10219.1, CCDS73746.1	15q22.31	2013-01-17	2012-12-13		ENSG00000174442	ENSG00000174442			25468	protein-coding gene	gene with protein product		609984	"""Zwilch, kinetochore associated, homolog (Drosophila)"""			12686595	Standard	NM_017975		Approved	FLJ10036, KNTC1AP	uc002aqb.3	Q9H900	OTTHUMG00000133194	ENST00000307897.5:c.1486A>C	15.37:g.66829513A>C	ENSP00000311429:p.Ile496Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVB8|Q6N049|Q8N404|Q96SY7|Q9NWG7	Missense_Mutation	SNP	pfam_RZZ-complex_zwilch	p.I496L	ENST00000307897.5	37	c.1486	CCDS10219.1	15	.	.	.	.	.	.	.	.	.	.	A	8.237	0.806033	0.16467	.	.	ENSG00000174442	ENST00000307897;ENST00000446801;ENST00000535141	T;T;T	0.42900	0.96;0.96;0.96	5.89	4.77	0.60923	.	0.101813	0.64402	D	0.000002	T	0.26666	0.0652	L	0.41356	1.27	0.29731	N	0.837912	B	0.11235	0.004	B	0.25614	0.062	T	0.36480	-0.9746	10	0.02654	T	1	-19.7904	4.0433	0.09761	0.6732:0.1319:0.0684:0.1265	.	496	Q9H900	ZWILC_HUMAN	L	496;382;382	ENSP00000311429:I496L;ENSP00000402217:I382L;ENSP00000437749:I382L	ENSP00000311429:I496L	I	+	1	0	ZWILCH	64616567	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.807000	0.38902	1.064000	0.40671	0.459000	0.35465	ATA	ZWILCH	-	pfam_RZZ-complex_zwilch	ENSG00000174442		0.343	ZWILCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZWILCH	HGNC	protein_coding	OTTHUMT00000256904.4	286	0.35	1	A	NM_017975		66829513	66829513	+1	no_errors	ENST00000307897	ensembl	human	known	69_37n	missense	146	14.62	25	SNP	1.000	C
