#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC6	368	genome.wustl.edu	37	16	16284084	16284084	+	Silent	SNP	G	G	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr16:16284084G>A	ENST00000205557.7	-	12	1601	c.1572C>T	c.(1570-1572)gcC>gcT	p.A524A	ABCC6_ENST00000574094.1_5'UTR	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	524	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	AGGTCCGCAAGGCGCCCAGCT	0.582																																						dbGAP											0													80.0	81.0	81.0					16																	16284084		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.1572C>T	16.37:g.16284084G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.A524	ENST00000205557.7	37	c.1572	CCDS10568.1	16																																																																																			ABCC6	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	ENSG00000091262		0.582	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC6	HGNC	protein_coding	OTTHUMT00000252232.2	28	0.00	0	G			16284084	16284084	-1	no_errors	ENST00000205557	ensembl	human	known	69_37n	silent	12	57.14	16	SNP	0.998	A
ABCF3	55324	genome.wustl.edu	37	3	183905745	183905745	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr3:183905745G>C	ENST00000429586.2	+	6	728	c.543G>C	c.(541-543)gaG>gaC	p.E181D	EIF2B5_ENST00000444495.1_Intron|ABCF3_ENST00000292808.5_Missense_Mutation_p.E175D	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	181	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGCGAATTGAGAACTTTGATG	0.473																																						dbGAP											0													163.0	167.0	165.0					3																	183905745		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.543G>C	3.37:g.183905745G>C	ENSP00000411471:p.Glu181Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E181D	ENST00000429586.2	37	c.543	CCDS3254.1	3	.	.	.	.	.	.	.	.	.	.	G	9.470	1.095309	0.20471	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	D;D	0.92495	-3.03;-3.05	4.67	4.67	0.58626	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.85635	0.5742	N	0.13299	0.325	0.80722	D	1	P;B	0.37038	0.579;0.026	P;B	0.44359	0.447;0.022	T	0.81833	-0.0751	10	0.15066	T	0.55	-18.1056	10.2548	0.43390	0.0911:0.0:0.9089:0.0	.	175;181	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	D	181;175	ENSP00000411471:E181D;ENSP00000292808:E175D	ENSP00000292808:E175D	E	+	3	2	ABCF3	185388439	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	4.737000	0.62066	2.127000	0.65507	0.462000	0.41574	GAG	ABCF3	-	pfscan_ABC_transporter-like	ENSG00000161204		0.473	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF3	HGNC	protein_coding	OTTHUMT00000346047.1	50	0.00	0	G	NM_018358		183905745	183905745	+1	no_errors	ENST00000429586	ensembl	human	known	69_37n	missense	50	20.00	13	SNP	1.000	C
ACVR1B	91	genome.wustl.edu	37	12	52387771	52387771	+	Silent	SNP	A	A	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr12:52387771A>T	ENST00000257963.4	+	9	1472	c.1395A>T	c.(1393-1395)gcA>gcT	p.A465A	ACVR1B_ENST00000542485.1_Silent_p.A413A|ACVR1B_ENST00000541224.1_Silent_p.A506A	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	465	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	CTGCACAGGCACTGCGGGTGA	0.622																																						dbGAP											0													103.0	93.0	96.0					12																	52387771		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.1395A>T	12.37:g.52387771A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A465	ENST00000257963.4	37	c.1395	CCDS8816.1	12																																																																																			ACVR1B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000135503		0.622	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1B	HGNC	protein_coding	OTTHUMT00000397000.1	29	0.00	0	A	NM_020328		52387771	52387771	+1	no_errors	ENST00000257963	ensembl	human	known	69_37n	silent	19	32.14	9	SNP	0.000	T
AHI1	54806	genome.wustl.edu	37	6	135787286	135787286	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr6:135787286G>A	ENST00000367800.4	-	5	631	c.415C>T	c.(415-417)Caa>Taa	p.Q139*	AHI1_ENST00000457866.2_Nonsense_Mutation_p.Q139*|AHI1_ENST00000327035.6_Nonsense_Mutation_p.Q139*	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	139					cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		TTCAGGTCTTGTGTAGTCAAC	0.423																																						dbGAP											0													223.0	201.0	208.0					6																	135787286		1940	4130	6070	-	-	-	SO:0001587	stop_gained	0			AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.415C>T	6.37:g.135787286G>A	ENSP00000356774:p.Gln139*	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_SH3_domain,pfam_SH3_2,superfamily_WD40_repeat_dom,superfamily_SH3_domain,smart_WD40_repeat,smart_SH3_domain,pfscan_SH3_domain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_SH3_domain	p.Q139*	ENST00000367800.4	37	c.415	CCDS47483.1	6	.	.	.	.	.	.	.	.	.	.	G	26.2	4.710101	0.89018	.	.	ENSG00000135541	ENST00000367800;ENST00000457866;ENST00000265602;ENST00000327035;ENST00000367801;ENST00000524469	.	.	.	5.22	3.3	0.37823	.	0.586375	0.16265	N	0.222043	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-6.332	3.284	0.06925	0.1134:0.1692:0.544:0.1734	.	.	.	.	X	139;139;139;139;139;121	.	ENSP00000265602:Q139X	Q	-	1	0	AHI1	135828979	0.000000	0.05858	0.073000	0.20177	0.055000	0.15305	0.212000	0.17497	1.300000	0.44818	0.585000	0.79938	CAA	AHI1	-	NULL	ENSG00000135541		0.423	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	AHI1	HGNC	protein_coding	OTTHUMT00000391948.1	119	0.00	0	G	NM_017651		135787286	135787286	-1	no_errors	ENST00000265602	ensembl	human	known	69_37n	nonsense	118	11.28	15	SNP	0.006	A
AKAP13	11214	genome.wustl.edu	37	15	86284649	86284649	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr15:86284649C>T	ENST00000394518.2	+	35	8076	c.7981C>T	c.(7981-7983)Ctt>Ttt	p.L2661F	AKAP13_ENST00000394510.2_Missense_Mutation_p.L906F|AKAP13_ENST00000560579.1_3'UTR|RP11-158M2.3_ENST00000558375.1_RNA|AKAP13_ENST00000361243.2_Missense_Mutation_p.L2665F	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2661	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CCAGAAACAGCTTGAGAGGGA	0.632																																					Melanoma(94;603 1453 3280 32295 32951)	dbGAP											0													43.0	40.0	41.0					15																	86284649		2202	4299	6501	-	-	-	SO:0001583	missense	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.7981C>T	15.37:g.86284649C>T	ENSP00000378026:p.Leu2661Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.L2665F	ENST00000394518.2	37	c.7993	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695685	0.68386	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.23147	1.92;1.92;1.92	5.47	5.47	0.80525	.	.	.	.	.	T	0.48502	0.1503	M	0.70595	2.14	0.45930	D	0.99876	D;D	0.89917	1.0;1.0	D;D	0.77004	0.975;0.989	T	0.48547	-0.9026	9	0.72032	D	0.01	.	11.7403	0.51788	0.0:0.9201:0.0:0.0799	.	2661;2665	Q12802;Q12802-2	AKP13_HUMAN;.	F	2665;2661;2664;2640;906	ENSP00000354718:L2665F;ENSP00000378026:L2661F;ENSP00000378018:L906F	ENSP00000354718:L2665F	L	+	1	0	AKAP13	84085653	0.967000	0.33354	0.984000	0.44739	0.785000	0.44390	0.244000	0.18124	2.554000	0.86153	0.655000	0.94253	CTT	AKAP13	-	NULL	ENSG00000170776		0.632	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	13	0.00	0	C	NM_007200		86284649	86284649	+1	no_errors	ENST00000361243	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	1.000	T
AKAP8	10270	genome.wustl.edu	37	19	15469801	15469801	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr19:15469801T>G	ENST00000269701.2	-	13	1660	c.1600A>C	c.(1600-1602)Aag>Cag	p.K534Q		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	534					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						TCCAGCATCTTCACTATATGT	0.443																																					GBM(190;1671 2163 3274 27186 30476)	dbGAP											0													158.0	141.0	147.0					19																	15469801		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.1600A>C	19.37:g.15469801T>G	ENSP00000269701:p.Lys534Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_AKAP95	p.K534Q	ENST00000269701.2	37	c.1600	CCDS12329.1	19	.	.	.	.	.	.	.	.	.	.	T	21.9	4.218935	0.79464	.	.	ENSG00000105127	ENST00000269701	T	0.45668	0.89	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000016	T	0.48314	0.1493	N	0.22421	0.69	0.80722	D	1	D	0.76494	0.999	D	0.65874	0.939	T	0.47262	-0.9131	10	0.44086	T	0.13	-46.1871	13.7399	0.62840	0.0:0.0:0.0:1.0	.	534	O43823	AKAP8_HUMAN	Q	534	ENSP00000269701:K534Q	ENSP00000269701:K534Q	K	-	1	0	AKAP8	15330801	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.538000	0.60650	2.234000	0.73211	0.460000	0.39030	AAG	AKAP8	-	pfam_AKAP95	ENSG00000105127		0.443	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP8	HGNC	protein_coding	OTTHUMT00000461293.3	57	0.00	0	T	NM_005858		15469801	15469801	-1	no_errors	ENST00000269701	ensembl	human	known	69_37n	missense	40	24.53	13	SNP	1.000	G
ANXA13	312	genome.wustl.edu	37	8	124724944	124724944	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr8:124724944T>G	ENST00000419625.1	-	2	137	c.65A>C	c.(64-66)aAg>aCg	p.K22T	ANXA13_ENST00000262219.6_Missense_Mutation_p.K63T	NM_004306.2	NP_004297.2	P27216	ANX13_HUMAN	annexin A13	22					cell differentiation (GO:0030154)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|exocytic vesicle (GO:0070382)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylglycerol binding (GO:1901611)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	25	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			TTTGTTCAGCTTTTTGGCATC	0.403																																						dbGAP											0													188.0	159.0	169.0					8																	124724944		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z11502	CCDS34939.1, CCDS47917.1	8q24.13	2005-11-09			ENSG00000104537	ENSG00000104537		"""Annexins"""	536	protein-coding gene	gene with protein product		602573		ANX13		9503022	Standard	NM_004306		Approved		uc003yqt.3	P27216	OTTHUMG00000164987	ENST00000419625.1:c.65A>C	8.37:g.124724944T>G	ENSP00000390809:p.Lys22Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQR5	Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinXIII	p.K63T	ENST00000419625.1	37	c.188	CCDS47917.1	8	.	.	.	.	.	.	.	.	.	.	T	15.57	2.872681	0.51695	.	.	ENSG00000104537	ENST00000262219;ENST00000419625	T;T	0.03301	3.98;3.98	5.76	0.275	0.15659	.	0.368613	0.33309	N	0.005059	T	0.05273	0.0140	N	0.25031	0.7	0.38850	D	0.95625	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.56709	-0.7934	10	0.26408	T	0.33	.	1.332	0.02137	0.1417:0.1707:0.1468:0.5408	.	22;63	P27216;P27216-2	ANX13_HUMAN;.	T	63;22	ENSP00000262219:K63T;ENSP00000390809:K22T	ENSP00000262219:K63T	K	-	2	0	ANXA13	124794125	0.995000	0.38212	0.967000	0.41034	0.994000	0.84299	0.023000	0.13533	0.067000	0.16545	0.379000	0.24179	AAG	ANXA13	-	pfam_Annexin_repeat,superfamily_Annexin	ENSG00000104537		0.403	ANXA13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA13	HGNC	protein_coding	OTTHUMT00000381308.1	65	0.00	0	T	NM_004306		124724944	124724944	-1	no_errors	ENST00000262219	ensembl	human	known	69_37n	missense	131	19.51	32	SNP	0.935	G
ATF7	11016	genome.wustl.edu	37	12	53946409	53946409	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr12:53946409C>G	ENST00000548446.2	-	3	173	c.61G>C	c.(61-63)Gag>Cag	p.E21Q	ATF7_ENST00000420353.2_Missense_Mutation_p.E21Q|RP11-793H13.10_ENST00000591834.1_Missense_Mutation_p.E21Q|ATF7_ENST00000548118.2_Missense_Mutation_p.E21Q|ATF7_ENST00000415113.1_Missense_Mutation_p.E21Q|ATF7_ENST00000328463.7_Missense_Mutation_p.E21Q|ATF7_ENST00000591397.1_Missense_Mutation_p.E21Q|ATF7_ENST00000456903.4_Missense_Mutation_p.E21Q			P17544	ATF7_HUMAN	activating transcription factor 7	21	Transactivation domain.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	AGGTGGTCCTCGTTTGTAAAT	0.418																																						dbGAP											0													113.0	107.0	109.0					12																	53946409		1885	4119	6004	-	-	-	SO:0001583	missense	0			X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.61G>C	12.37:g.53946409C>G	ENSP00000449938:p.Glu21Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,smart_Znf_C2H2-like,smart_bZIP,pirsf_TF_cAMP-dep,pfscan_Znf_C2H2,pfscan_bZIP	p.E21Q	ENST00000548446.2	37	c.61		12	.	.	.	.	.	.	.	.	.	.	C	21.1	4.099483	0.76983	.	.	ENSG00000170653	ENST00000548446;ENST00000328463;ENST00000306727;ENST00000415113;ENST00000420353;ENST00000456903	T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42	5.29	5.29	0.74685	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.58764	0.2145	M	0.79614	2.46	0.80722	D	1	D;D;D;D	0.89917	1.0;0.977;0.997;0.999	D;P;D;D	0.87578	0.998;0.888;0.983;0.991	T	0.61337	-0.7083	10	0.66056	D	0.02	-15.5269	17.8681	0.88801	0.0:1.0:0.0:0.0	.	21;21;21;21	P17544-2;A5D6Y4;B2RMP1;P17544	.;.;.;ATF7_HUMAN	Q	21	ENSP00000449938:E21Q;ENSP00000329212:E21Q;ENSP00000404880:E21Q;ENSP00000399465:E21Q;ENSP00000387406:E21Q	ENSP00000304187:E21Q	E	-	1	0	ATF7	52232676	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.577000	0.82486	2.756000	0.94617	0.561000	0.74099	GAG	ATF7	-	smart_Znf_C2H2-like,pirsf_TF_cAMP-dep,pfscan_Znf_C2H2	ENSG00000170653		0.418	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	ATF7	HGNC	protein_coding	OTTHUMT00000406302.2	61	0.00	0	C	NM_001130059		53946409	53946409	-1	no_errors	ENST00000328463	ensembl	human	known	69_37n	missense	13	65.79	25	SNP	1.000	G
BRPF1	7862	genome.wustl.edu	37	3	9781344	9781344	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr3:9781344A>G	ENST00000457855.1	+	2	1272	c.1261A>G	c.(1261-1263)Atg>Gtg	p.M421V	BRPF1_ENST00000383829.2_Missense_Mutation_p.M421V|BRPF1_ENST00000302054.3_Missense_Mutation_p.M421V|BRPF1_ENST00000424362.1_Missense_Mutation_p.M421V|BRPF1_ENST00000433861.2_Missense_Mutation_p.M421V			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	421					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					TGGCCTTTACATGAAGATGGA	0.587																																						dbGAP											0													45.0	45.0	45.0					3																	9781344		2203	4300	6503	-	-	-	SO:0001583	missense	0			M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.1261A>G	3.37:g.9781344A>G	ENSP00000410210:p.Met421Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP,prints_Bromodomain,pfscan_PWWP,pfscan_Znf_PHD-finger,pfscan_Znf_C2H2,pfscan_Bromodomain	p.M421V	ENST00000457855.1	37	c.1261	CCDS2575.1	3	.	.	.	.	.	.	.	.	.	.	A	15.11	2.734828	0.48939	.	.	ENSG00000156983	ENST00000433861;ENST00000424362;ENST00000383829;ENST00000302054;ENST00000457855	T;T;T;T;T	0.14391	2.51;2.51;2.51;2.51;2.51	6.04	6.04	0.98038	Zinc finger, PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.40040	0.1101	M	0.75085	2.285	0.80722	D	1	D;D;D;D	0.71674	0.998;0.997;0.993;0.998	D;D;D;D	0.91635	0.998;0.986;0.98;0.999	T	0.20672	-1.0268	10	0.87932	D	0	.	16.5763	0.84648	1.0:0.0:0.0:0.0	.	421;421;421;421	P55201-4;P55201-3;P55201-2;P55201	.;.;.;BRPF1_HUMAN	V	421	ENSP00000402485:M421V;ENSP00000398863:M421V;ENSP00000373340:M421V;ENSP00000306297:M421V;ENSP00000410210:M421V	ENSP00000306297:M421V	M	+	1	0	BRPF1	9756344	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	8.953000	0.93041	2.317000	0.78254	0.459000	0.35465	ATG	BRPF1	-	smart_Znf_PHD	ENSG00000156983		0.587	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BRPF1	HGNC	protein_coding	OTTHUMT00000338485.1	15	0.00	0	A	NM_001003694		9781344	9781344	+1	no_errors	ENST00000383829	ensembl	human	known	69_37n	missense	19	28.57	8	SNP	1.000	G
NRDE2	55051	genome.wustl.edu	37	14	90782992	90782992	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr14:90782992C>T	ENST00000354366.3	-	3	569	c.337G>A	c.(337-339)Gac>Aac	p.D113N	NRDE2_ENST00000557106.1_5'UTR|NRDE2_ENST00000357904.3_Intron	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	113																	GAATCGGTGTCTGTCTCAGAC	0.433																																						dbGAP											0													238.0	223.0	228.0					14																	90782992		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.337G>A	14.37:g.90782992C>T	ENSP00000346335:p.Asp113Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	pfam_NRDE-2	p.D113N	ENST00000354366.3	37	c.337	CCDS9890.1	14	.	.	.	.	.	.	.	.	.	.	C	18.11	3.551856	0.65311	.	.	ENSG00000119720	ENST00000354366	T	0.24908	1.83	5.3	3.45	0.39498	.	0.247407	0.40469	N	0.001099	T	0.29355	0.0731	M	0.65975	2.015	0.19775	N	0.999957	P	0.41673	0.759	B	0.42188	0.379	T	0.11842	-1.0571	10	0.20046	T	0.44	-14.3428	13.4942	0.61414	0.1894:0.8106:0.0:0.0	.	113	Q9H7Z3	CN102_HUMAN	N	113	ENSP00000346335:D113N	ENSP00000346335:D113N	D	-	1	0	C14orf102	89852745	0.015000	0.18098	0.007000	0.13788	0.085000	0.17905	1.297000	0.33400	0.705000	0.31890	0.655000	0.94253	GAC	C14orf102	-	NULL	ENSG00000119720		0.433	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf102	HGNC	protein_coding	OTTHUMT00000411264.1	77	0.00	0	C	NM_017970		90782992	90782992	-1	no_errors	ENST00000354366	ensembl	human	known	69_37n	missense	97	13.39	15	SNP	0.016	T
ERICH3	127254	genome.wustl.edu	37	1	75038741	75038741	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr1:75038741C>G	ENST00000326665.5	-	14	2871	c.2653G>C	c.(2653-2655)Gtg>Ctg	p.V885L	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		885	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						GTCTCAAGCACTGTGAGCATC	0.512																																						dbGAP											0													244.0	242.0	243.0					1																	75038741		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000326665.5:c.2653G>C	1.37:g.75038741C>G	ENSP00000322609:p.Val885Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.V885L	ENST00000326665.5	37	c.2653	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	C	18.40	3.616337	0.66672	.	.	ENSG00000178965	ENST00000326665	T	0.14391	2.51	5.37	4.45	0.53987	.	.	.	.	.	T	0.07908	0.0198	L	0.36672	1.1	0.58432	D	0.999992	P	0.47910	0.902	P	0.46659	0.523	T	0.21724	-1.0237	9	0.26408	T	0.33	-8.8708	15.2204	0.73306	0.0:0.8588:0.1411:0.0	.	885	Q5RHP9	CA173_HUMAN	L	885	ENSP00000322609:V885L	ENSP00000322609:V885L	V	-	1	0	C1orf173	74811329	0.003000	0.15002	0.001000	0.08648	0.001000	0.01503	1.786000	0.38694	1.241000	0.43820	0.563000	0.77884	GTG	C1orf173	-	NULL	ENSG00000178965		0.512	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	55	0.00	0	C			75038741	75038741	-1	no_errors	ENST00000326665	ensembl	human	known	69_37n	missense	94	22.95	28	SNP	0.018	G
CROCCP2	84809	genome.wustl.edu	37	1	16949355	16949355	+	lincRNA	SNP	G	G	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr1:16949355G>A	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											gcatggtggcgcgtgcctgta	0.542																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16949355G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.542	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	9	0.00	0	G	NR_026752.1		16949355	16949355	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	6	40.00	4	SNP	0.042	A
CLCA4	22802	genome.wustl.edu	37	1	87045132	87045132	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr1:87045132G>T	ENST00000370563.3	+	13	2260	c.2218G>T	c.(2218-2220)Gtg>Ttg	p.V740L	RP4-651E10.4_ENST00000456587.1_RNA	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	740					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		AGGTGCATTTGTGGTATCACA	0.478																																						dbGAP											0													116.0	110.0	112.0					1																	87045132		1956	4146	6102	-	-	-	SO:0001583	missense	0			AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.2218G>T	1.37:g.87045132G>T	ENSP00000359594:p.Val740Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	pfam_Cl_channel_Ca,pfam_DUF1973,pfam_VWF_A,superfamily_Fibronectin_type3,smart_VWF_A,pfscan_VWF_A,tigrfam_CaCC_prot	p.V740L	ENST00000370563.3	37	c.2218	CCDS41355.1	1	.	.	.	.	.	.	.	.	.	.	G	12.18	1.859202	0.32884	.	.	ENSG00000016602	ENST00000370563	T	0.02974	4.09	5.43	4.32	0.51571	.	0.424262	0.19952	N	0.102414	T	0.02418	0.0074	M	0.81802	2.56	0.80722	D	1	B;B	0.27951	0.195;0.195	B;B	0.34093	0.175;0.175	T	0.32052	-0.9921	10	0.22109	T	0.4	-13.3195	8.6054	0.33769	0.123:0.156:0.721:0.0	.	292;740	Q9NXP1;Q14CN2	.;CLCA4_HUMAN	L	740	ENSP00000359594:V740L	ENSP00000359594:V740L	V	+	1	0	CLCA4	86817720	0.676000	0.27567	1.000000	0.80357	0.597000	0.36814	0.396000	0.20867	2.530000	0.85305	0.655000	0.94253	GTG	CLCA4	-	tigrfam_CaCC_prot	ENSG00000016602		0.478	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCA4	HGNC	protein_coding	OTTHUMT00000028292.1	31	0.00	0	G	NM_012128		87045132	87045132	+1	no_errors	ENST00000370563	ensembl	human	known	69_37n	missense	22	37.14	13	SNP	0.914	T
CRYBG3	131544	genome.wustl.edu	37	3	97599998	97599998	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr3:97599998A>G	ENST00000182096.4	+	4	1307	c.1243A>G	c.(1243-1245)Att>Gtt	p.I415V		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2363							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						TCGTGACTGGATTCTTCAGAA	0.353																																						dbGAP											0													86.0	88.0	87.0					3																	97599998		1827	4077	5904	-	-	-	SO:0001583	missense	0					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.1243A>G	3.37:g.97599998A>G	ENSP00000182096:p.Ile415Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.I415V	ENST00000182096.4	37	c.1243		3	.	.	.	.	.	.	.	.	.	.	A	11.00	1.509363	0.27036	.	.	ENSG00000080200	ENST00000182096	T	0.75589	-0.95	4.89	-4.41	0.03590	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	1.107710	0.06775	N	0.784252	T	0.55401	0.1918	L	0.36672	1.1	0.80722	D	1	B	0.20671	0.047	B	0.22152	0.038	T	0.40869	-0.9540	10	0.15952	T	0.53	.	1.9017	0.03269	0.3354:0.2452:0.3057:0.1137	.	415	Q68DQ2	CRBG3_HUMAN	V	415	ENSP00000182096:I415V	ENSP00000182096:I415V	I	+	1	0	CRYBG3	99082688	0.994000	0.37717	0.896000	0.35187	0.993000	0.82548	0.218000	0.17622	-1.013000	0.03383	0.528000	0.53228	ATT	CRYBG3	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	ENSG00000080200		0.353	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	HGNC	protein_coding	OTTHUMT00000353751.1	48	0.00	0	A	NM_153605		97599998	97599998	+1	no_errors	ENST00000182096	ensembl	human	known	69_37n	missense	23	52.08	25	SNP	0.938	G
CSAD	51380	genome.wustl.edu	37	12	53565185	53565188	+	Frame_Shift_Del	DEL	GCGG	GCGG	-	rs200673743		TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	GCGG	GCGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr12:53565185_53565188delGCGG	ENST00000444623.1	-	8	756_759	c.489_492delCCGC	c.(487-492)gcccgcfs	p.AR163fs	CSAD_ENST00000491654.1_5'Flank|CSAD_ENST00000453446.2_Frame_Shift_Del_p.AR163fs|CSAD_ENST00000379843.3_Intron|CSAD_ENST00000379846.1_Intron|CSAD_ENST00000267085.4_Frame_Shift_Del_p.AR190fs|CSAD_ENST00000542115.1_3'UTR	NM_001244705.1	NP_001231634.1	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	163					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)		pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(4)	14					L-Cysteine(DB00151)	AGCGCTGATAGCGGGCCAGATTTA	0.618																																					Ovarian(109;252 1546 16882 28524 44645)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB044561	CCDS8848.2, CCDS58235.1	12q13.11-q14.3	2008-08-04			ENSG00000139631	ENSG00000139631			18966	protein-coding gene	gene with protein product	"""P-selectin cytoplasmic tail-associated protein"""					15489334	Standard	NM_015989		Approved	PCAP, CSD	uc001sbz.3	Q9Y600	OTTHUMG00000048076	ENST00000444623.1:c.489_492delCCGC	12.37:g.53565185_53565188delGCGG	ENSP00000415485:p.Ala163fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0U4|Q4QQH9|Q9UNJ5|Q9Y601	Frame_Shift_Del	DEL	pfam_PyrdxlP-dep_de-COase,pfam_Aminotrans_V/Cys_dSase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom	p.R191fs	ENST00000444623.1	37	c.573_570	CCDS58235.1	12																																																																																			CSAD	-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000139631		0.618	CSAD-017	KNOWN	basic|appris_principal|CCDS	protein_coding	CSAD	HGNC	protein_coding	OTTHUMT00000343697.1	20	0.00	0	GCGG	NM_015989		53565185	53565188	-1	no_errors	ENST00000267085	ensembl	human	known	69_37n	frame_shift_del	16	23.81	5	DEL	0.999:1.000:1.000:1.000	-
CYP2B6	1555	genome.wustl.edu	37	19	41515230	41515230	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr19:41515230A>T	ENST00000324071.4	+	5	759	c.752A>T	c.(751-753)aAg>aTg	p.K251M	CYP2B6_ENST00000593831.1_Intron|CYP2B6_ENST00000330446.5_Intron	NM_000767.4	NP_000758.1	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B, polypeptide 6	251					cellular ketone metabolic process (GO:0042180)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			NS(1)|breast(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(20;0.00322)		Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Antipyrine(DB01435)|Artemether(DB06697)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Brompheniramine(DB00835)|Bupropion(DB01156)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Citalopram(DB00215)|Clobazam(DB00349)|Clofibrate(DB00636)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Doxorubicin(DB00997)|Efavirenz(DB00625)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erythromycin(DB00199)|Estrone(DB00655)|Ethanol(DB00898)|Ethylmorphine(DB01466)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosphenytoin(DB01320)|Halothane(DB01159)|Ifosfamide(DB01181)|Imipramine(DB00458)|Irinotecan(DB00762)|Isoflurane(DB00753)|Itraconazole(DB01167)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lidocaine(DB00281)|Loperamide(DB00836)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Malathion(DB00772)|Memantine(DB01043)|Methadone(DB00333)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyltestosterone(DB06710)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitric Oxide(DB00435)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Paroxetine(DB00715)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Prasugrel(DB06209)|Primidone(DB00794)|Promethazine(DB01069)|Propofol(DB00818)|Quinidine(DB00908)|Raloxifene(DB00481)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Ropivacaine(DB00296)|Roxithromycin(DB00778)|Selegiline(DB01037)|Sertraline(DB01104)|Sevoflurane(DB01236)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Temazepam(DB00231)|Testosterone(DB00624)|Thiotepa(DB04572)|Ticlopidine(DB00208)|Tramadol(DB00193)|Tretinoin(DB00755)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)	AGTGTGGAGAAGCACCGTGAA	0.527																																						dbGAP											0													82.0	86.0	85.0					19																	41515230		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF182277	CCDS12570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000197408	ENSG00000197408		"""Cytochrome P450s"""	2615	protein-coding gene	gene with protein product		123930	"""cytochrome P450, subfamily IIB (phenobarbital-inducible), polypeptide 6"", ""cytochrome P450, family 2, subfamily B"", ""cytochrome P450, subfamily IIB (phenobarbital-inducible)"""	CYP2B		7668294, 15128046	Standard	NM_000767		Approved	CPB6, CYPIIB6	uc002opr.1	P20813	OTTHUMG00000182714	ENST00000324071.4:c.752A>T	19.37:g.41515230A>T	ENSP00000324648:p.Lys251Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWP3|Q2V565|Q9UK46	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2B-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I_CYP2A-like	p.K251M	ENST00000324071.4	37	c.752	CCDS12570.1	19	.	.	.	.	.	.	.	.	.	.	.	21.0	4.084172	0.76642	.	.	ENSG00000197408	ENST00000324071	T	0.69926	-0.44	4.32	4.32	0.51571	.	0.577661	0.17937	N	0.156961	T	0.80019	0.4547	M	0.85299	2.745	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.80178	-0.1490	10	0.54805	T	0.06	.	6.3838	0.21550	0.8905:0.0:0.1095:0.0	.	251	P20813	CP2B6_HUMAN	M	251	ENSP00000324648:K251M	ENSP00000324648:K251M	K	+	2	0	CYP2B6	46207070	0.001000	0.12720	0.932000	0.37286	0.505000	0.33919	0.829000	0.27449	1.812000	0.52913	0.260000	0.18958	AAG	CYP2B6	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000197408		0.527	CYP2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2B6	HGNC	protein_coding	OTTHUMT00000463260.1	28	0.00	0	A	NM_000767		41515230	41515230	+1	no_errors	ENST00000324071	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.999	T
DDX47	51202	genome.wustl.edu	37	12	12974614	12974614	+	Silent	SNP	A	A	C			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr12:12974614A>C	ENST00000358007.3	+	4	418	c.396A>C	c.(394-396)tcA>tcC	p.S132S	DDX47_ENST00000352940.4_Silent_p.S132S	NM_016355.3	NP_057439.2	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	132	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)		GAATTGATTCAATGTCTCAAT	0.358																																						dbGAP											0													128.0	129.0	129.0					12																	12974614		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK127712	CCDS8655.1, CCDS8656.1	12p13.2	2010-07-06			ENSG00000213782	ENSG00000213782		"""DEAD-boxes"""	18682	protein-coding gene	gene with protein product		615428					Standard	NM_016355		Approved	DKFZp564O176, FLJ30012, HQ0256, RRP3	uc001rax.3	Q9H0S4	OTTHUMG00000168709	ENST00000358007.3:c.396A>C	12.37:g.12974614A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXP4|G5E955|Q96GM0|Q96NV8|Q9UI98	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.S132	ENST00000358007.3	37	c.396	CCDS8655.1	12																																																																																			DDX47	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000213782		0.358	DDX47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX47	HGNC	protein_coding	OTTHUMT00000400674.1	64	0.00	0	A	NM_016355		12974614	12974614	+1	no_errors	ENST00000358007	ensembl	human	known	69_37n	silent	44	34.33	23	SNP	0.106	C
DIDO1	11083	genome.wustl.edu	37	20	61542888	61542888	+	Missense_Mutation	SNP	G	G	A	rs35954422		TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr20:61542888G>A	ENST00000266070.4	-	3	402	c.77C>T	c.(76-78)aCa>aTa	p.T26I	DIDO1_ENST00000266071.5_Missense_Mutation_p.T26I|DIDO1_ENST00000395335.2_Missense_Mutation_p.T26I|DIDO1_ENST00000370371.4_Missense_Mutation_p.T26I|DIDO1_ENST00000370368.1_Missense_Mutation_p.T26I|DIDO1_ENST00000395343.1_Missense_Mutation_p.T26I|DIDO1_ENST00000370366.1_Missense_Mutation_p.T26I|DIDO1_ENST00000395340.1_Missense_Mutation_p.T26I|DIDO1_ENST00000354665.4_Missense_Mutation_p.T26I	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	26					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					AAAACCCCATGTTTTCCTGAA	0.597																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	dbGAP											0													84.0	82.0	83.0					20																	61542888		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.77C>T	20.37:g.61542888G>A	ENSP00000266070:p.Thr26Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.T26I	ENST00000266070.4	37	c.77	CCDS33506.1	20	.	.	.	.	.	.	.	.	.	.	G	32	5.150289	0.94645	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335;ENST00000370371;ENST00000370368;ENST00000354665;ENST00000370366;ENST00000266071	T;T;T;T;T;T;T;T;T	0.27720	2.53;2.53;2.19;2.19;1.65;1.65;1.65;1.67;1.67	5.82	5.82	0.92795	.	0.000000	0.42548	U	0.000684	T	0.58380	0.2118	M	0.70595	2.14	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;0.992;0.986	D;D;P;P	0.79108	0.992;0.992;0.9;0.843	T	0.58918	-0.7551	10	0.87932	D	0	-23.6175	20.0989	0.97860	0.0:0.0:1.0:0.0	.	26;26;26;26	Q9BTC0-2;Q9BTC0-3;Q9BTC0-1;Q9BTC0	.;.;.;DIDO1_HUMAN	I	26	ENSP00000266070:T26I;ENSP00000378752:T26I;ENSP00000378749:T26I;ENSP00000378744:T26I;ENSP00000359397:T26I;ENSP00000359394:T26I;ENSP00000346692:T26I;ENSP00000359391:T26I;ENSP00000266071:T26I	ENSP00000266070:T26I	T	-	2	0	DIDO1	61013333	1.000000	0.71417	0.822000	0.32727	0.909000	0.53808	7.430000	0.80321	2.764000	0.94973	0.650000	0.86243	ACA	DIDO1	-	NULL	ENSG00000101191		0.597	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	29	0.00	0	G	NM_080796		61542888	61542888	-1	no_errors	ENST00000266070	ensembl	human	known	69_37n	missense	22	38.89	14	SNP	1.000	A
DNAJB8	165721	genome.wustl.edu	37	3	128181838	128181838	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr3:128181838T>A	ENST00000469083.1	-	2	2808	c.251A>T	c.(250-252)cAc>cTc	p.H84L	DNAJB8-AS1_ENST00000471626.1_RNA|DNAJB8_ENST00000319153.3_Missense_Mutation_p.H84L			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8	84					chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)			kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		GAAGGGGCTGTGGTAGGGCGT	0.602																																						dbGAP											0													71.0	75.0	74.0					3																	128181838		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690	ENST00000469083.1:c.251A>T	3.37:g.128181838T>A	ENSP00000417418:p.His84Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWV7	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.H84L	ENST00000469083.1	37	c.251	CCDS3048.1	3	.	.	.	.	.	.	.	.	.	.	T	4.621	0.115468	0.08831	.	.	ENSG00000179407	ENST00000469083;ENST00000319153	T;T	0.73363	-0.74;-0.74	4.12	-3.36	0.04913	Heat shock protein DnaJ, N-terminal (1);	3.594190	0.00481	N	0.000139	T	0.58352	0.2116	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42682	-0.9437	10	0.31617	T	0.26	.	7.2497	0.26142	0.0:0.1615:0.1449:0.6936	.	84	Q8NHS0	DNJB8_HUMAN	L	84	ENSP00000417418:H84L;ENSP00000316053:H84L	ENSP00000316053:H84L	H	-	2	0	DNAJB8	129664528	0.042000	0.20092	0.004000	0.12327	0.001000	0.01503	-0.299000	0.08254	-0.653000	0.05401	-1.017000	0.02453	CAC	DNAJB8	-	NULL	ENSG00000179407		0.602	DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DNAJB8	HGNC	protein_coding	OTTHUMT00000356933.1	34	0.00	0	T	NM_153330		128181838	128181838	-1	no_errors	ENST00000319153	ensembl	human	known	69_37n	missense	14	57.14	20	SNP	0.036	A
E4F1	1877	genome.wustl.edu	37	16	2284337	2284337	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr16:2284337C>T	ENST00000301727.4	+	10	1589	c.1541C>T	c.(1540-1542)tCa>tTa	p.S514L	E4F1_ENST00000565090.1_Intron|DNASE1L2_ENST00000564065.1_5'Flank|DNASE1L2_ENST00000567494.1_5'Flank|RP11-304L19.12_ENST00000564055.1_lincRNA|E4F1_ENST00000564139.1_Missense_Mutation_p.S514L|DNASE1L2_ENST00000382437.4_5'Flank|DNASE1L2_ENST00000320700.5_5'Flank	NM_004424.3	NP_004415.2	Q66K89	E4F1_HUMAN	E4F transcription factor 1	514	Interaction with BMI1.|Mediates interaction with CDKN2A.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|mitotic cell cycle arrest (GO:0071850)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell cycle process (GO:0010564)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle, embryonic (GO:0009794)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			ovary(1)	1						CGCGTCCACTCAGACGAGCGG	0.657																																						dbGAP											0													59.0	62.0	61.0					16																	2284337		2197	4300	6497	-	-	-	SO:0001583	missense	0			U87269	CCDS32370.1, CCDS73809.1, CCDS73810.1	16p13.3	2013-01-08				ENSG00000167967		"""Zinc fingers, C2H2-type"""	3121	protein-coding gene	gene with protein product		603022				9763670, 8828041	Standard	XM_005255155		Approved	E4F	uc002cpm.3	Q66K89		ENST00000301727.4:c.1541C>T	16.37:g.2284337C>T	ENSP00000301727:p.Ser514Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2R4|O00146	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S514L	ENST00000301727.4	37	c.1541	CCDS32370.1	16	.	.	.	.	.	.	.	.	.	.	C	19.54	3.847596	0.71603	.	.	ENSG00000167967	ENST00000301727	T	0.18960	2.18	5.11	5.11	0.69529	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.38134	0.1029	L	0.37800	1.135	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.17992	-1.0351	10	0.87932	D	0	-10.9107	17.1139	0.86683	0.0:1.0:0.0:0.0	.	514	Q66K89	E4F1_HUMAN	L	514	ENSP00000301727:S514L	ENSP00000301727:S514L	S	+	2	0	E4F1	2224338	1.000000	0.71417	0.934000	0.37439	0.734000	0.41952	7.722000	0.84778	2.386000	0.81285	0.549000	0.68633	TCA	E4F1	-	pfscan_Znf_C2H2	ENSG00000167967		0.657	E4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E4F1	HGNC	protein_coding	OTTHUMT00000435225.1	18	0.00	0	C	NM_004424		2284337	2284337	+1	no_errors	ENST00000301727	ensembl	human	known	69_37n	missense	11	42.11	8	SNP	1.000	T
EMP1	2012	genome.wustl.edu	37	12	13366467	13366467	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr12:13366467A>G	ENST00000256951.5	+	3	332	c.133A>G	c.(133-135)Acc>Gcc	p.T45A	EMP1_ENST00000544053.1_5'UTR|EMP1_ENST00000431267.2_Intron|EMP1_ENST00000542289.1_Intron|EMP1_ENST00000396301.3_Missense_Mutation_p.T45A|EMP1_ENST00000537612.1_Missense_Mutation_p.T45A	NM_001423.2	NP_001414.1	P54849	EMP1_HUMAN	epithelial membrane protein 1	45					cell growth (GO:0016049)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)							Prostate(47;0.194)		BRCA - Breast invasive adenocarcinoma(232;0.153)		GAAAAACTGTACCAACATTAG	0.433																																						dbGAP											0													175.0	164.0	168.0					12																	13366467		2203	4300	6503	-	-	-	SO:0001583	missense	0			U43916	CCDS8660.1	12p12.3	2008-08-04				ENSG00000134531			3333	protein-coding gene	gene with protein product		602333				8996089, 9126480	Standard	NM_001423		Approved	TMP, CL-20	uc001rbr.3	P54849		ENST00000256951.5:c.133A>G	12.37:g.13366467A>G	ENSP00000256951:p.Thr45Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5N1|B4DRR1|O00681|Q13481|Q13834	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_PMP22_EMP_MP20,prints_EMP_1	p.T45A	ENST00000256951.5	37	c.133	CCDS8660.1	12	.	.	.	.	.	.	.	.	.	.	A	10.79	1.449209	0.26074	.	.	ENSG00000134531	ENST00000256951;ENST00000538364;ENST00000396301;ENST00000537612	D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5	5.78	-1.08	0.09936	.	1.637690	0.02588	N	0.099660	T	0.80539	0.4642	L	0.39245	1.2	0.09310	N	1	B;B	0.16166	0.016;0.016	B;B	0.15052	0.012;0.012	T	0.59532	-0.7437	10	0.15499	T	0.54	-28.0976	0.1089	0.00054	0.3084:0.1572:0.2302:0.3041	.	45;45	B4DRR1;P54849	.;EMP1_HUMAN	A	45	ENSP00000256951:T45A;ENSP00000441223:T45A;ENSP00000379595:T45A;ENSP00000445319:T45A	ENSP00000256951:T45A	T	+	1	0	EMP1	13257734	0.003000	0.15002	0.001000	0.08648	0.001000	0.01503	0.794000	0.26958	0.139000	0.18822	-1.248000	0.01517	ACC	EMP1	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000134531		0.433	EMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMP1	HGNC	protein_coding	OTTHUMT00000401019.1	101	0.00	0	A	NM_001423		13366467	13366467	+1	no_errors	ENST00000256951	ensembl	human	known	69_37n	missense	72	28.00	28	SNP	0.000	G
FNDC1	84624	genome.wustl.edu	37	6	159653643	159653643	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr6:159653643delC	ENST00000297267.9	+	11	2299	c.2099delC	c.(2098-2100)accfs	p.T700fs	FNDC1_ENST00000340366.6_Frame_Shift_Del_p.T637fs	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	700	Ser-rich.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GCCCGGAGGACCCCCCATTCA	0.692																																						dbGAP											0													13.0	16.0	15.0					6																	159653643		1906	4104	6010	-	-	-	SO:0001589	frameshift_variant	0			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.2099delC	6.37:g.159653643delC	ENSP00000297267:p.Thr700fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Frame_Shift_Del	DEL	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.H702fs	ENST00000297267.9	37	c.2099	CCDS47512.1	6																																																																																			FNDC1	-	NULL	ENSG00000164694		0.692	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC1	HGNC	protein_coding	OTTHUMT00000042897.3	8	0.00	0	C	NM_032532		159653643	159653643	+1	no_errors	ENST00000297267	ensembl	human	known	69_37n	frame_shift_del	9	30.77	4	DEL	0.000	-
FRG1B	284802	genome.wustl.edu	37	20	29624046	29624046	+	Missense_Mutation	SNP	C	C	T	rs10153995		TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr20:29624046C>T	ENST00000278882.3	+	4	450	c.70C>T	c.(70-72)Cct>Tct	p.P24S	FRG1B_ENST00000358464.4_Missense_Mutation_p.P24S|FRG1B_ENST00000439954.2_Missense_Mutation_p.P29S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	24										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGATGAGGGCCCTAGTCCTCC	0.279																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.70C>T	20.37:g.29624046C>T	ENSP00000278882:p.Pro24Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	C4AME5	Missense_Mutation	SNP	pfam_FRG1,superfamily_Actin_cross-linking	p.P24S	ENST00000278882.3	37	c.70		20	.	.	.	.	.	.	.	.	.	.	c	13.70	2.316522	0.40996	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.72394	-0.65	1.91	1.91	0.25777	.	0.000000	0.85682	D	0.000000	T	0.74861	0.3772	.	.	.	0.54753	D	0.999982	.	.	.	.	.	.	T	0.76260	-0.3024	7	0.56958	D	0.05	.	9.8627	0.41125	0.0:1.0:0.0:0.0	rs10153995	.	.	.	S	24;29;24	ENSP00000408863:P29S	ENSP00000278882:P24S	P	+	1	0	FRG1B	28237707	1.000000	0.71417	0.999000	0.59377	0.522000	0.34438	6.186000	0.72026	1.383000	0.46405	0.184000	0.17185	CCT	FRG1B	-	pfam_FRG1,superfamily_Actin_cross-linking	ENSG00000149531		0.279	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	40	0.00	0	C	NR_003579		29624046	29624046	+1	no_errors	ENST00000278882	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	1.000	T
GPC5	2262	genome.wustl.edu	37	13	92346012	92346012	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr13:92346012G>C	ENST00000377067.3	+	3	1269	c.897G>C	c.(895-897)ttG>ttC	p.L299F		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	299					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TCCGGTCGTTGGAAGAACTCT	0.498																																						dbGAP											0													140.0	128.0	132.0					13																	92346012		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.897G>C	13.37:g.92346012G>C	ENSP00000366267:p.Leu299Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	pfam_Glypican	p.L299F	ENST00000377067.3	37	c.897	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	G	16.22	3.062939	0.55432	.	.	ENSG00000179399	ENST00000377067	T	0.65549	-0.16	5.59	2.93	0.34026	.	0.000000	0.85682	D	0.000000	T	0.76758	0.4032	M	0.83953	2.67	0.52501	D	0.999956	D	0.89917	1.0	D	0.91635	0.999	T	0.76534	-0.2924	10	0.87932	D	0	-0.1883	7.6268	0.28216	0.3187:0.0:0.6813:0.0	.	299	P78333	GPC5_HUMAN	F	299	ENSP00000366267:L299F	ENSP00000366267:L299F	L	+	3	2	GPC5	91144013	1.000000	0.71417	0.960000	0.40013	0.625000	0.37756	3.527000	0.53517	0.727000	0.32360	0.650000	0.86243	TTG	GPC5	-	pfam_Glypican	ENSG00000179399		0.498	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	HGNC	protein_coding	OTTHUMT00000045454.1	21	0.00	0	G	NM_004466		92346012	92346012	+1	no_errors	ENST00000377067	ensembl	human	known	69_37n	missense	14	39.13	9	SNP	1.000	C
HLA-DRB1	3123	genome.wustl.edu	37	6	32552016	32552016	+	Silent	SNP	C	C	A	rs17880973		TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr6:32552016C>A	ENST00000360004.5	-	2	345	c.240G>T	c.(238-240)acG>acT	p.T80T		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	80	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GCCCCAGCTCCGTCACCGCCC	0.642										Multiple Myeloma(14;0.17)																												dbGAP											0													37.0	40.0	39.0					6																	32552016		2195	4294	6489	-	-	-	SO:0001819	synonymous_variant	0			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.240G>T	6.37:g.32552016C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P01914|Q9MYF5	Silent	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.T80	ENST00000360004.5	37	c.240	CCDS47409.1	6																																																																																			HLA-DRB1	-	pfam_MHC_II_b_N,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N	ENSG00000196126		0.642	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB1	HGNC	protein_coding	OTTHUMT00000076393.3	10	0.00	0	C	NM_002124		32552016	32552016	-1	no_errors	ENST00000360004	ensembl	human	known	69_37n	silent	16	40.74	11	SNP	0.834	A
HLA-DRB1	3123	genome.wustl.edu	37	6	32552039	32552039	+	Missense_Mutation	SNP	C	C	T	rs150747106		TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr6:32552039C>T	ENST00000360004.5	-	2	322	c.217G>A	c.(217-219)Gtg>Atg	p.V73M		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	73	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						AACTCCCCCACGTCGCTGTCG	0.632										Multiple Myeloma(14;0.17)																												dbGAP											0													37.0	38.0	37.0					6																	32552039		2197	4292	6489	-	-	-	SO:0001583	missense	0			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.217G>A	6.37:g.32552039C>T	ENSP00000353099:p.Val73Met	Somatic		WXS	Illumina GAIIx	Phase_IV	P01914|Q9MYF5	Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.V73M	ENST00000360004.5	37	c.217	CCDS47409.1	6	368	0.1684981684981685	37	0.07520325203252033	75	0.20718232044198895	112	0.1958041958041958	144	0.18997361477572558	.	12.23	1.876883	0.33162	.	.	ENSG00000196126	ENST00000360004	T	0.00402	7.56	3.52	0.0987	0.14499	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (2);MHC classes I/II-like antigen recognition protein (1);	0.657385	0.14883	N	0.292848	T	0.00695	0.0023	H	0.95679	3.705	0.32016	N	0.601387	D	0.89917	1.0	D	0.85130	0.997	T	0.33343	-0.9872	10	0.72032	D	0.01	.	6.8224	0.23864	0.3354:0.4996:0.1649:0.0	.	73	P01911	2B1F_HUMAN	M	73	ENSP00000353099:V73M	ENSP00000353099:V73M	V	-	1	0	HLA-DRB1	32660017	0.053000	0.20554	0.990000	0.47175	0.053000	0.15095	-0.110000	0.10824	0.237000	0.21200	0.453000	0.30009	GTG	HLA-DRB1	-	pfam_MHC_II_b_N,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N	ENSG00000196126		0.632	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB1	HGNC	protein_coding	OTTHUMT00000076393.3	10	0.00	0	C	NM_002124		32552039	32552039	-1	no_errors	ENST00000360004	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	0.943	T
HLA-DRB1	3123	genome.wustl.edu	37	6	32552048	32552048	+	Missense_Mutation	SNP	C	C	T	rs56158521		TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr6:32552048C>T	ENST00000360004.5	-	2	313	c.208G>A	c.(208-210)Gac>Aac	p.D70N		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	70	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						ACGTCGCTGTCGAAGCGCACG	0.632										Multiple Myeloma(14;0.17)																												dbGAP											0													37.0	36.0	36.0					6																	32552048		2194	4292	6486	-	-	-	SO:0001583	missense	0			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.208G>A	6.37:g.32552048C>T	ENSP00000353099:p.Asp70Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	P01914|Q9MYF5	Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.D70N	ENST00000360004.5	37	c.208	CCDS47409.1	6	364	0.16666666666666666	38	0.07723577235772358	73	0.20165745856353592	112	0.1958041958041958	141	0.18601583113456466	.	11.18	1.563454	0.27915	.	.	ENSG00000196126	ENST00000360004	T	0.00358	7.88	3.52	2.61	0.31194	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (2);MHC classes I/II-like antigen recognition protein (1);	0.431350	0.28119	N	0.016536	T	0.00524	0.0017	M	0.93328	3.405	0.33541	D	0.594893	D	0.89917	1.0	D	0.91635	0.999	T	0.26292	-1.0107	10	0.66056	D	0.02	.	10.5792	0.45246	0.0:0.8015:0.1985:0.0	rs56158521	70	P01911	2B1F_HUMAN	N	70	ENSP00000353099:D70N	ENSP00000353099:D70N	D	-	1	0	HLA-DRB1	32660026	1.000000	0.71417	1.000000	0.80357	0.040000	0.13550	4.293000	0.59037	0.781000	0.33589	0.453000	0.30009	GAC	HLA-DRB1	-	pfam_MHC_II_b_N,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N	ENSG00000196126		0.632	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB1	HGNC	protein_coding	OTTHUMT00000076393.3	11	0.00	0	C	NM_002124		32552048	32552048	-1	no_errors	ENST00000360004	ensembl	human	known	69_37n	missense	15	40.00	10	SNP	1.000	T
HOXC10	3226	genome.wustl.edu	37	12	54379358	54379358	+	Silent	SNP	C	C	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr12:54379358C>G	ENST00000303460.4	+	1	389	c.315C>G	c.(313-315)gtC>gtG	p.V105V	HOXC-AS3_ENST00000514702.1_RNA|HOXC-AS3_ENST00000567780.1_RNA|HOXC-AS3_ENST00000513165.1_RNA|HOXC-AS3_ENST00000509870.1_RNA|RP11-834C11.12_ENST00000513209.1_5'Flank	NM_017409.3	NP_059105.2	Q9NYD6	HXC10_HUMAN	homeobox C10	105					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|neuromuscular process (GO:0050905)|positive regulation of cell proliferation (GO:0008284)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(3)|lung(14)|pancreas(1)	20						CACCTAGTGTCAAGGAGGAGA	0.627																																						dbGAP											0													49.0	50.0	50.0					12																	54379358		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8868.1	12q13.13	2011-06-20	2005-12-22		ENSG00000180818	ENSG00000180818		"""Homeoboxes / ANTP class : HOXL subclass"""	5122	protein-coding gene	gene with protein product		605560	"""homeo box C10"""	HOX3I		1358459	Standard	NM_017409		Approved		uc001sen.3	Q9NYD6	OTTHUMG00000160031	ENST00000303460.4:c.315C>G	12.37:g.54379358C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O15219|O15220|Q9BVD5	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.V105	ENST00000303460.4	37	c.315	CCDS8868.1	12																																																																																			HOXC10	-	NULL	ENSG00000180818		0.627	HOXC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC10	HGNC	protein_coding	OTTHUMT00000358952.2	12	0.00	0	C			54379358	54379358	+1	no_errors	ENST00000303460	ensembl	human	known	69_37n	silent	10	47.37	9	SNP	1.000	G
HSPA14	51182	genome.wustl.edu	37	10	14909121	14909121	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr10:14909121C>G	ENST00000378372.3	+	11	1272	c.1033C>G	c.(1033-1035)Cag>Gag	p.Q345E		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	345					'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)			breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						CCCAAAGCTACAGCAACTGAT	0.383																																						dbGAP											0													116.0	121.0	119.0					10																	14909121		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.1033C>G	10.37:g.14909121C>G	ENSP00000367623:p.Gln345Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.Q345E	ENST00000378372.3	37	c.1033	CCDS7103.1	10	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672462	0.88348	.	.	ENSG00000187522	ENST00000378372	T	0.01092	5.35	5.68	5.68	0.88126	Heat shock protein 70, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.11750	0.0286	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00581	-1.1660	10	0.87932	D	0	-8.4657	19.786	0.96437	0.0:1.0:0.0:0.0	.	345	Q0VDF9	HSP7E_HUMAN	E	345	ENSP00000367623:Q345E	ENSP00000367623:Q345E	Q	+	1	0	HSPA14	14949127	1.000000	0.71417	0.986000	0.45419	0.984000	0.73092	6.898000	0.75676	2.676000	0.91093	0.563000	0.77884	CAG	HSPA14	-	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	ENSG00000187522		0.383	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA14	HGNC	protein_coding	OTTHUMT00000046910.1	52	0.00	0	C	NM_016299		14909121	14909121	+1	no_errors	ENST00000378372	ensembl	human	known	69_37n	missense	45	34.78	24	SNP	1.000	G
HYDIN	54768	genome.wustl.edu	37	16	70926361	70926361	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr16:70926361C>A	ENST00000393567.2	-	56	9470	c.9320G>T	c.(9319-9321)gGt>gTt	p.G3107V		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3107					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.G3058V(1)|p.G3106V(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGTCAGTGAACCCTTTTTGGG	0.428																																						dbGAP											2	Substitution - Missense(2)	lung(2)											113.0	124.0	121.0					16																	70926361		1849	4089	5938	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.9320G>T	16.37:g.70926361C>A	ENSP00000377197:p.Gly3107Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.G3106V	ENST00000393567.2	37	c.9317	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	16.30	3.085619	0.55861	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01240	5.12	4.86	4.86	0.63082	.	0.000000	0.33553	U	0.004787	T	0.07728	0.0194	M	0.71206	2.165	0.80722	D	1	D	0.69078	0.997	D	0.71870	0.975	T	0.02220	-1.1193	10	0.87932	D	0	.	15.7874	0.78319	0.0:1.0:0.0:0.0	.	3106	F8WD23	.	V	3107;3106	ENSP00000377197:G3107V	ENSP00000313052:G3106V	G	-	2	0	HYDIN	69483862	1.000000	0.71417	0.439000	0.26833	0.287000	0.27160	6.411000	0.73298	2.248000	0.74166	0.436000	0.28706	GGT	HYDIN	-	NULL	ENSG00000157423		0.428	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	148	0.00	0	C			70926361	70926361	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	103	20.77	27	SNP	0.999	A
KCNA1	3736	genome.wustl.edu	37	12	5021319	5021319	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr12:5021319A>G	ENST00000382545.3	+	2	1882	c.775A>G	c.(775-777)Att>Gtt	p.I259V	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	259					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)			NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CTTCATAGACATTGTGGCCAT	0.532																																						dbGAP											0													85.0	82.0	83.0					12																	5021319		2203	4300	6503	-	-	-	SO:0001583	missense	0			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.775A>G	12.37:g.5021319A>G	ENSP00000371985:p.Ile259Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM83|Q3MIQ9	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1.3	p.I259V	ENST00000382545.3	37	c.775	CCDS8535.1	12	.	.	.	.	.	.	.	.	.	.	A	10.09	1.255634	0.22965	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.98313	-4.86	4.97	4.97	0.65823	Ion transport (1);	0.056476	0.64402	D	0.000001	D	0.94245	0.8152	N	0.12746	0.255	0.58432	D	0.999999	B	0.02656	0.0	B	0.09377	0.004	D	0.91443	0.5175	10	0.36615	T	0.2	.	14.2907	0.66275	1.0:0.0:0.0:0.0	.	259	Q09470	KCNA1_HUMAN	V	259	ENSP00000371985:I259V	ENSP00000228858:I259V	I	+	1	0	KCNA1	4891580	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	5.738000	0.68613	2.209000	0.71365	0.533000	0.62120	ATT	KCNA1	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000111262		0.532	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KCNA1	HGNC	protein_coding	OTTHUMT00000103343.2	17	0.00	0	A	NM_000217		5021319	5021319	+1	no_errors	ENST00000382545	ensembl	human	known	69_37n	missense	19	26.92	7	SNP	1.000	G
LPHN3	23284	genome.wustl.edu	37	4	62542579	62542579	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr4:62542579G>T	ENST00000514591.1	+	5	634	c.305G>T	c.(304-306)gGt>gTt	p.G102V	LPHN3_ENST00000511324.1_Missense_Mutation_p.G170V|LPHN3_ENST00000545650.1_Missense_Mutation_p.G102V|LPHN3_ENST00000507164.1_Missense_Mutation_p.G170V|LPHN3_ENST00000508693.1_Missense_Mutation_p.G170V|LPHN3_ENST00000512091.2_Missense_Mutation_p.G102V|LPHN3_ENST00000506700.1_Missense_Mutation_p.G102V|LPHN3_ENST00000507625.1_Missense_Mutation_p.G170V|LPHN3_ENST00000514157.1_Missense_Mutation_p.G102V|LPHN3_ENST00000508946.1_Missense_Mutation_p.G102V|LPHN3_ENST00000504896.1_Missense_Mutation_p.G102V|LPHN3_ENST00000506720.1_Missense_Mutation_p.G170V|LPHN3_ENST00000514996.1_Missense_Mutation_p.G102V|LPHN3_ENST00000509896.1_Missense_Mutation_p.G170V|LPHN3_ENST00000506746.1_Missense_Mutation_p.G170V			Q9HAR2	LPHN3_HUMAN	latrophilin 3	102	SUEL-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00260}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						GTGGTGGCAGGTCCTGATGTT	0.378																																						dbGAP											0													231.0	230.0	230.0					4																	62542579		1976	4191	6167	-	-	-	SO:0001583	missense	0			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.305G>T	4.37:g.62542579G>T	ENSP00000422533:p.Gly102Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like	p.G170V	ENST00000514591.1	37	c.509	CCDS54768.1	4	.	.	.	.	.	.	.	.	.	.	G	27.4	4.825164	0.90955	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.17213	2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.34774	0.0909	L	0.38953	1.18	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.04885	-1.0920	10	0.87932	D	0	.	18.2723	0.90072	0.0:0.0:1.0:0.0	.	102;170;102	E9PE04;E7EN28;Q9HAR2-2	.;.;.	V	102;102;170;170;102;102;102;102;102;170;170;170;102;102;102;170;170;102	ENSP00000423388:G102V;ENSP00000422533:G102V;ENSP00000423787:G170V;ENSP00000425033:G170V;ENSP00000424120:G102V;ENSP00000439831:G102V;ENSP00000421476:G170V;ENSP00000424030:G170V;ENSP00000421372:G170V;ENSP00000425201:G102V;ENSP00000423434:G102V;ENSP00000421627:G102V;ENSP00000420931:G170V;ENSP00000425884:G170V;ENSP00000424258:G102V	ENSP00000280009:G102V	G	+	2	0	LPHN3	62225174	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.441000	0.97557	2.569000	0.86673	0.484000	0.47621	GGT	LPHN3	-	pfam_Lectin_gal-bd_dom,pfscan_Lectin_gal-bd_dom	ENSG00000150471		0.378	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPHN3	HGNC	protein_coding	OTTHUMT00000361765.1	86	0.00	0	G			62542579	62542579	+1	no_errors	ENST00000507625	ensembl	human	known	69_37n	missense	49	35.53	27	SNP	1.000	T
MFSD6	54842	genome.wustl.edu	37	2	191362340	191362340	+	Silent	SNP	A	A	C			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr2:191362340A>C	ENST00000392328.1	+	7	2391	c.2067A>C	c.(2065-2067)ggA>ggC	p.G689G	MFSD6_ENST00000535751.1_Silent_p.G151G|MFSD6_ENST00000281416.7_Silent_p.G689G	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	689					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						CAGCCTGGGGAGTCAGCTCTT	0.478																																						dbGAP											0													163.0	141.0	149.0					2																	191362340		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.2067A>C	2.37:g.191362340A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3KSZ4|Q86TH2|Q9NXM3	Missense_Mutation	SNP	pfam_MFS,pfam_MFS_enterobactin_exp_EntS,superfamily_MFS_dom_general_subst_transpt	p.S225R	ENST00000392328.1	37	c.673	CCDS2306.1	2	.	.	.	.	.	.	.	.	.	.	A	10.35	1.326834	0.24080	.	.	ENSG00000151690	ENST00000434582	.	.	.	5.44	-3.08	0.05347	.	.	.	.	.	T	0.41465	0.1160	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33369	-0.9871	4	.	.	.	-20.5941	3.3345	0.07096	0.2601:0.3915:0.2529:0.0955	.	.	.	.	R	225	.	.	S	+	1	0	MFSD6	191070585	1.000000	0.71417	0.981000	0.43875	0.996000	0.88848	0.686000	0.25392	-0.518000	0.06452	-0.248000	0.11899	AGT	MFSD6	-	NULL	ENSG00000151690		0.478	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD6	HGNC	protein_coding	OTTHUMT00000255931.1	47	0.00	0	A			191362340	191362340	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000434582	ensembl	human	novel	69_37n	missense	32	30.43	14	SNP	0.971	C
MFSD7	84179	genome.wustl.edu	37	4	678308	678308	+	Silent	SNP	G	G	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr4:678308G>A	ENST00000404286.2	-	6	822	c.807C>T	c.(805-807)ctC>ctT	p.L269L	MFSD7_ENST00000513740.1_5'Flank|MFSD7_ENST00000515118.1_Silent_p.L172L|MFSD7_ENST00000503156.1_Silent_p.L204L|MFSD7_ENST00000322224.4_Silent_p.L268L|MFSD7_ENST00000347950.5_Silent_p.L150L	NM_032219.2	NP_115595.2	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing 7	269					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				cervix(1)|kidney(2)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	11						TCTGCTCCAGGAGGGCTGAGA	0.612											OREG0016025	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													88.0	90.0	89.0					4																	678308		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK025922	CCDS3338.1, CCDS75086.1	4p16.3	2013-05-22			ENSG00000169026	ENSG00000169026		"""Solute carriers"""	26177	protein-coding gene	gene with protein product						12975309	Standard	XM_005272295		Approved	FLJ22269, LP2561	uc003gax.3	Q6UXD7	OTTHUMG00000119001	ENST00000404286.2:c.807C>T	4.37:g.678308G>A		Somatic	590	WXS	Illumina GAIIx	Phase_IV	A8K7J5|Q6XYD4|Q8N6H1|Q9H6H6	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.L269	ENST00000404286.2	37	c.807		4																																																																																			MFSD7	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000169026		0.612	MFSD7-004	KNOWN	basic|appris_candidate_longest	protein_coding	MFSD7	HGNC	protein_coding	OTTHUMT00000358585.1	19	0.00	0	G	NM_032219		678308	678308	-1	no_errors	ENST00000404286	ensembl	human	known	69_37n	silent	12	47.83	11	SNP	0.998	A
MORC1	27136	genome.wustl.edu	37	3	108723692	108723692	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr3:108723692G>T	ENST00000483760.1	-	19	2037	c.1994C>A	c.(1993-1995)cCa>cAa	p.P665Q	MORC1_ENST00000232603.5_Missense_Mutation_p.P686Q					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						CCCTTCAGTTGGTTGAGCTCT	0.353																																						dbGAP											0													172.0	192.0	185.0					3																	108723692		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.1994C>A	3.37:g.108723692G>T	ENSP00000417282:p.Pro665Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_CW,superfamily_ATPase-like_ATP-bd,pfscan_Znf_CW	p.P686Q	ENST00000483760.1	37	c.2057		3	.	.	.	.	.	.	.	.	.	.	G	0.136	-1.108168	0.01813	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.06449	3.3;3.47	3.28	0.423	0.16463	.	.	.	.	.	T	0.04182	0.0116	N	0.14661	0.345	0.09310	N	1	P;P	0.45348	0.856;0.856	P;P	0.46144	0.505;0.505	T	0.38067	-0.9678	9	0.20046	T	0.44	0.564	3.5708	0.07917	0.2468:0.2112:0.542:0.0	.	665;686	E7ERX1;Q86VD1	.;MORC1_HUMAN	Q	686;665	ENSP00000232603:P686Q;ENSP00000417282:P665Q	ENSP00000232603:P686Q	P	-	2	0	MORC1	110206382	0.001000	0.12720	0.001000	0.08648	0.005000	0.04900	0.399000	0.20916	0.069000	0.16605	-0.459000	0.05422	CCA	MORC1	-	NULL	ENSG00000114487		0.353	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	MORC1	HGNC	protein_coding	OTTHUMT00000353844.1	37	0.00	0	G			108723692	108723692	-1	no_errors	ENST00000232603	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	0.001	T
MUC7	4589	genome.wustl.edu	37	4	71347316	71347316	+	Silent	SNP	C	C	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr4:71347316C>A	ENST00000304887.5	+	3	1045	c.855C>A	c.(853-855)ccC>ccA	p.P285P	MUC7_ENST00000456088.1_Silent_p.P285P|MUC7_ENST00000413702.1_Silent_p.P285P	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	285	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			CTGCCCCACCCACACCTTCTG	0.577																																						dbGAP											0													398.0	360.0	373.0					4																	71347316		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.855C>A	4.37:g.71347316C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UCD7|Q9UCD8	Silent	SNP	NULL	p.P285	ENST00000304887.5	37	c.855	CCDS3541.1	4																																																																																			MUC7	-	NULL	ENSG00000171195		0.577	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC7	HGNC	protein_coding	OTTHUMT00000252168.2	256	0.00	0	C	NM_152291		71347316	71347316	+1	no_errors	ENST00000304887	ensembl	human	known	69_37n	silent	123	12.06	17	SNP	0.015	A
MYH11	4629	genome.wustl.edu	37	16	15878554	15878554	+	Intron	SNP	C	C	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr16:15878554C>T	ENST00000300036.5	-	5	743				MYH11_ENST00000452625.2_Splice_Site|MYH11_ENST00000576790.2_Intron|MYH11_ENST00000396324.3_Splice_Site	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle						axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CAGTTACTCACGTAGGCAAAA	0.483			T	CBFB	AML																																	dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													105.0	107.0	106.0					16																	15878554		2056	4199	6255	-	-	-	SO:0001627	intron_variant	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.633+1932G>A	16.37:g.15878554C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Splice_Site	SNP	-	e5+1	ENST00000300036.5	37	c.654+1	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581335	0.86748	.	.	ENSG00000133392	ENST00000396324;ENST00000452625	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8769	0.86054	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYH11	15786055	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.779000	0.68948	2.561000	0.86390	0.655000	0.94253	.	MYH11	-	-	ENSG00000133392		0.483	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	61	0.00	0	C	NM_001040113		15878554	15878554	-1	no_errors	ENST00000396324	ensembl	human	known	69_37n	splice_site	12	61.29	19	SNP	1.000	T
MYT1L	23040	genome.wustl.edu	37	2	1805469	1805469	+	Splice_Site	SNP	T	T	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr2:1805469T>A	ENST00000399161.2	-	23	4022	c.3275A>T	c.(3274-3276)cAg>cTg	p.Q1092L	MYT1L_ENST00000407844.1_Missense_Mutation_p.Q88L|MYT1L_ENST00000428368.2_Splice_Site_p.Q1090L	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1092					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		AACTGTTACCTGAGTTCTGAG	0.383																																						dbGAP											0													219.0	214.0	215.0					2																	1805469		1834	4103	5937	-	-	-	SO:0001630	splice_region_variant	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3276+1A>T	2.37:g.1805469T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.Q1092L	ENST00000399161.2	37	c.3275		2	.	.	.	.	.	.	.	.	.	.	T	28.6	4.937232	0.92458	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000407844;ENST00000399157;ENST00000428368	T;T;T	0.53423	0.62;2.18;0.62	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.68220	0.2977	M	0.73962	2.25	0.80722	D	1	D;D;D	0.67145	0.996;0.993;0.996	D;D;D	0.77557	0.99;0.977;0.99	T	0.72978	-0.4127	10	0.87932	D	0	-37.5346	14.9299	0.70906	0.0:0.0:0.0:1.0	.	88;1092;1090	Q9UL68-3;Q9UL68;Q9UL68-4	.;MYT1L_HUMAN;.	L	1092;1038;88;146;1090	ENSP00000382114:Q1092L;ENSP00000382111:Q146L;ENSP00000396103:Q1090L	ENSP00000295067:Q1038L	Q	-	2	0	MYT1L	1784476	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.793000	0.85851	2.087000	0.62958	0.533000	0.62120	CAG	MYT1L	-	NULL	ENSG00000186487		0.383	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	94	0.00	0	T	NM_015025	Missense_Mutation	1805469	1805469	-1	no_errors	ENST00000399161	ensembl	human	known	69_37n	missense	56	44.00	44	SNP	1.000	A
NCKAP1	10787	genome.wustl.edu	37	2	183800077	183800077	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr2:183800077T>C	ENST00000361354.4	-	25	3094	c.2722A>G	c.(2722-2724)Aca>Gca	p.T908A	NCKAP1_ENST00000360982.2_Missense_Mutation_p.T914A|NCKAP1_ENST00000478449.1_5'UTR	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	908					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			CCAATTATTGTCATCCTCTTC	0.343																																						dbGAP											0													110.0	105.0	107.0					2																	183800077		2203	4298	6501	-	-	-	SO:0001583	missense	0			AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.2722A>G	2.37:g.183800077T>C	ENSP00000355348:p.Thr908Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	pfam_Nck-associated_protein-1	p.T914A	ENST00000361354.4	37	c.2740	CCDS2287.1	2	.	.	.	.	.	.	.	.	.	.	T	30	5.050555	0.93740	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.32753	1.44;1.44	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.55353	0.1915	M	0.84511	2.7	0.80722	D	1	D;P	0.63880	0.993;0.955	P;P	0.60286	0.872;0.74	T	0.58549	-0.7617	10	0.33141	T	0.24	-14.0108	15.5156	0.75822	0.0:0.0:0.0:1.0	.	908;914	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	A	908;914	ENSP00000355348:T908A;ENSP00000354251:T914A	ENSP00000354251:T914A	T	-	1	0	NCKAP1	183508322	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.131000	0.65755	0.477000	0.44152	ACA	NCKAP1	-	pfam_Nck-associated_protein-1	ENSG00000061676		0.343	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1	HGNC	protein_coding	OTTHUMT00000255867.2	64	0.00	0	T	NM_205842		183800077	183800077	-1	no_errors	ENST00000360982	ensembl	human	known	69_37n	missense	52	31.58	24	SNP	1.000	C
OVCH1	341350	genome.wustl.edu	37	12	29629199	29629199	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr12:29629199G>A	ENST00000318184.5	-	13	1410	c.1411C>T	c.(1411-1413)Cca>Tca	p.P471S	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	471	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					ATACAGTTTGGACTAAATTTG	0.373																																						dbGAP											0													175.0	166.0	168.0					12																	29629199		1864	4110	5974	-	-	-	SO:0001583	missense	0			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1411C>T	12.37:g.29629199G>A	ENSP00000326708:p.Pro471Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,smart_Peptidase_S1_S6,smart_CUB,prints_Peptidase_S1A,pfscan_CUB,pfscan_Peptidase_S1_S6	p.P471S	ENST00000318184.5	37	c.1411		12	.	.	.	.	.	.	.	.	.	.	G	0.051	-1.251153	0.01469	.	.	ENSG00000187950	ENST00000318184	T	0.16597	2.33	2.83	0.914	0.19360	CUB (5);	.	.	.	.	T	0.07999	0.0200	N	0.11927	0.2	0.09310	N	1	B	0.17465	0.022	B	0.19391	0.025	T	0.43180	-0.9407	9	0.09084	T	0.74	.	7.8689	0.29554	0.0:0.5375:0.2974:0.1651	.	471	Q7RTY7	OVCH1_HUMAN	S	471	ENSP00000326708:P471S	ENSP00000326708:P471S	P	-	1	0	OVCH1	29520466	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.198000	0.09505	0.232000	0.21100	0.650000	0.86243	CCA	OVCH1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000187950		0.373	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	OVCH1	HGNC	protein_coding	OTTHUMT00000395997.2	39	0.00	0	G	NM_183378		29629199	29629199	-1	no_errors	ENST00000318184	ensembl	human	known	69_37n	missense	31	49.18	30	SNP	0.000	A
PAPPA	5069	genome.wustl.edu	37	9	118974155	118974155	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr9:118974155C>T	ENST00000328252.3	+	4	2231	c.1862C>T	c.(1861-1863)aCc>aTc	p.T621I	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	621					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GGAAATGACACCTGTGGCTTT	0.517																																						dbGAP											0													252.0	248.0	249.0					9																	118974155		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1862C>T	9.37:g.118974155C>T	ENSP00000330658:p.Thr621Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.T621I	ENST00000328252.3	37	c.1862	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	C	21.2	4.116920	0.77323	.	.	ENSG00000182752	ENST00000328252	T	0.02323	4.34	5.63	5.63	0.86233	Peptidase M43, pregnancy-associated plasma-A (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.20981	0.0505	M	0.93462	3.42	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	T	0.00849	-1.1541	10	0.54805	T	0.06	-24.1343	14.2516	0.66023	0.0:0.9286:0.0:0.0714	.	621	Q13219	PAPP1_HUMAN	I	621	ENSP00000330658:T621I	ENSP00000330658:T621I	T	+	2	0	PAPPA	118013976	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.909000	0.63314	2.821000	0.97095	0.555000	0.69702	ACC	PAPPA	-	pfam_Peptidase_M43	ENSG00000182752		0.517	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	16	0.00	0	C	NM_002581		118974155	118974155	+1	no_errors	ENST00000328252	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.998	T
PAPPA	5069	genome.wustl.edu	37	9	118997528	118997528	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr9:118997528T>C	ENST00000328252.3	+	7	2713	c.2344T>C	c.(2344-2346)Tac>Cac	p.Y782H	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	782					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TCAAGGCTGCTACCTCGAGCT	0.562																																						dbGAP											0													119.0	96.0	104.0					9																	118997528		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.2344T>C	9.37:g.118997528T>C	ENSP00000330658:p.Tyr782His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.Y782H	ENST00000328252.3	37	c.2344	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	T	11.39	1.623901	0.28889	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.01871	4.59	6.04	4.91	0.64330	.	0.252766	0.44688	N	0.000426	T	0.01730	0.0055	N	0.14661	0.345	0.80722	D	1	B;B	0.12013	0.005;0.002	B;B	0.15484	0.013;0.004	T	0.58177	-0.7682	10	0.25106	T	0.35	-24.2657	9.2761	0.37700	0.0:0.1373:0.0:0.8627	.	226;782	E7EMD3;Q13219	.;PAPP1_HUMAN	H	782;226	ENSP00000330658:Y782H	ENSP00000330658:Y782H	Y	+	1	0	PAPPA	118037349	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.488000	0.45276	1.113000	0.41760	0.460000	0.39030	TAC	PAPPA	-	superfamily_Fibronectin_type3	ENSG00000182752		0.562	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	20	0.00	0	T	NM_002581		118997528	118997528	+1	no_errors	ENST00000328252	ensembl	human	known	69_37n	missense	3	78.57	11	SNP	1.000	C
PCDHB7	56129	genome.wustl.edu	37	5	140553041	140553041	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr5:140553041A>G	ENST00000231137.3	+	1	799	c.625A>G	c.(625-627)Agt>Ggt	p.S209G		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	209	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACCAGAGTTCAGTTTAACCCT	0.502																																						dbGAP											0													72.0	70.0	71.0					5																	140553041		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.625A>G	5.37:g.140553041A>G	ENSP00000231137:p.Ser209Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3Y8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S209G	ENST00000231137.3	37	c.625	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	A	0.397	-0.920404	0.02396	.	.	ENSG00000113212	ENST00000231137	T	0.03004	4.08	4.61	4.61	0.57282	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.08403	0.0209	M	0.80332	2.49	0.09310	N	1	B	0.29341	0.242	B	0.36766	0.232	T	0.18304	-1.0341	9	0.46703	T	0.11	.	6.2559	0.20874	0.8458:0.0:0.1542:0.0	.	209	Q9Y5E2	PCDB7_HUMAN	G	209	ENSP00000231137:S209G	ENSP00000231137:S209G	S	+	1	0	PCDHB7	140533225	0.000000	0.05858	0.984000	0.44739	0.025000	0.11179	0.273000	0.18662	1.823000	0.53134	0.533000	0.62120	AGT	PCDHB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113212		0.502	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	18	0.00	0	A	NM_018940		140553041	140553041	+1	no_errors	ENST00000231137	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	0.108	G
PCDHB7	56129	genome.wustl.edu	37	5	140554394	140554394	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr5:140554394G>A	ENST00000231137.3	+	1	2152	c.1978G>A	c.(1978-1980)Gtg>Atg	p.V660M	PCDHB8_ENST00000239444.2_5'Flank	NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	660	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V660L(2)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACGCTGCACGTGCTCCTGGT	0.711																																						dbGAP											2	Substitution - Missense(2)	lung(2)											35.0	56.0	49.0					5																	140554394		2168	4268	6436	-	-	-	SO:0001583	missense	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1978G>A	5.37:g.140554394G>A	ENSP00000231137:p.Val660Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3Y8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V660M	ENST00000231137.3	37	c.1978	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299321	0.40694	.	.	ENSG00000113212	ENST00000231137	T	0.75938	-0.98	3.98	3.98	0.46160	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.87904	0.6295	H	0.94385	3.53	0.24426	N	0.994592	D	0.76494	0.999	D	0.74674	0.984	T	0.78695	-0.2104	9	0.72032	D	0.01	.	7.0702	0.25173	0.0969:0.1765:0.7266:0.0	.	660	Q9Y5E2	PCDB7_HUMAN	M	660	ENSP00000231137:V660M	ENSP00000231137:V660M	V	+	1	0	PCDHB7	140534578	0.001000	0.12720	1.000000	0.80357	0.889000	0.51656	0.196000	0.17176	1.922000	0.55676	0.449000	0.29647	GTG	PCDHB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113212		0.711	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	26	0.00	0	G	NM_018940		140554394	140554394	+1	no_errors	ENST00000231137	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	0.649	A
PRB2	653247	genome.wustl.edu	37	12	11546260	11546260	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr12:11546260T>G	ENST00000389362.4	-	3	787	c.752A>C	c.(751-753)aAc>aCc	p.N251T	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	251	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TTGGGGCTGGTTGCCTCCTTG	0.602																																						dbGAP											0													107.0	141.0	129.0					12																	11546260		2171	4272	6443	-	-	-	SO:0001583	missense	0			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.752A>C	12.37:g.11546260T>G	ENSP00000374013:p.Asn251Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00599|P02811|P04281	Missense_Mutation	SNP	NULL	p.N251T	ENST00000389362.4	37	c.752	CCDS41757.2	12	.	.	.	.	.	.	.	.	.	.	.	5.805	0.332788	0.11013	.	.	ENSG00000121335	ENST00000389362	T	0.04758	3.56	1.63	0.14	0.14804	.	.	.	.	.	T	0.04407	0.0121	L	0.59436	1.845	0.09310	N	1	P	0.46020	0.871	B	0.34722	0.188	T	0.37731	-0.9693	9	0.38643	T	0.18	.	5.0072	0.14293	0.2665:0.0:0.0:0.7335	.	251	P02812	PRB2_HUMAN	T	251	ENSP00000374013:N251T	ENSP00000374013:N251T	N	-	2	0	PRB2	11437527	0.012000	0.17670	0.000000	0.03702	0.004000	0.04260	0.893000	0.28336	-0.154000	0.11118	0.342000	0.21767	AAC	PRB2	-	NULL	ENSG00000121335		0.602	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	HGNC	protein_coding	OTTHUMT00000346925.2	110	0.00	0	T	NM_006248		11546260	11546260	-1	no_errors	ENST00000389362	ensembl	human	known	69_37n	missense	65	31.63	31	SNP	0.001	G
PTPRB	5787	genome.wustl.edu	37	12	71002944	71002944	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr12:71002944G>C	ENST00000261266.5	-	2	259	c.230C>G	c.(229-231)aCa>aGa	p.T77R	PTPRB_ENST00000551525.1_Missense_Mutation_p.T294R|PTPRB_ENST00000334414.6_Missense_Mutation_p.T295R|PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000550358.1_Missense_Mutation_p.T295R|PTPRB_ENST00000550857.1_Missense_Mutation_p.T77R|PTPRB_ENST00000538708.1_Missense_Mutation_p.T77R|PTPRB_ENST00000451516.2_Missense_Mutation_p.T77R	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	77	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ACATCCGTATGTGGTGTTGTC	0.458																																						dbGAP											0													138.0	142.0	141.0					12																	71002944		1918	4115	6033	-	-	-	SO:0001583	missense	0			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.230C>G	12.37:g.71002944G>C	ENSP00000261266:p.Thr77Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.T295R	ENST00000261266.5	37	c.884	CCDS44944.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.10|17.10	3.303344|3.303344	0.60195|0.60195	.|.	.|.	ENSG00000127329|ENSG00000127329	ENST00000547715|ENST00000334414;ENST00000451516;ENST00000550358;ENST00000544694;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	.|T;T;T;T;T;T;T;T	.|0.59906	.|0.23;0.23;0.23;0.23;0.23;0.23;0.23;0.23	4.75|4.75	4.75|4.75	0.60458|0.60458	.|Fibronectin, type III (3);	.|0.317409	.|0.29876	.|N	.|0.010973	T|T	0.66607|0.66607	0.2806|0.2806	L|L	0.45137|0.45137	1.4|1.4	0.30660|0.30660	N|N	0.75447|0.75447	.|D;D;D;D;D;D;D;D	.|0.76494	.|0.995;0.991;0.993;0.999;0.964;0.991;0.958;0.997	.|D;D;D;D;P;P;P;D	.|0.77557	.|0.923;0.923;0.962;0.99;0.828;0.876;0.875;0.964	T|T	0.62695|0.62695	-0.6800|-0.6800	5|10	.|0.21540	.|T	.|0.41	.|.	14.7808|14.7808	0.69766|0.69766	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|77;77;174;295;294;295;77;295	.|P23467-2;F5H3G6;Q6ZR19;Q6ZTX7;F8VSD5;P23467-3;P23467;F8VU56	.|.;.;.;.;.;.;PTPRB_HUMAN;.	Q|R	68|295;77;295;295;77;77;77;294;174	.|ENSP00000334928:T295R;ENSP00000393028:T77R;ENSP00000448058:T295R;ENSP00000438927:T77R;ENSP00000447302:T77R;ENSP00000261266:T77R;ENSP00000448349:T294R;ENSP00000446982:T174R	.|ENSP00000261266:T77R	H|T	-|-	3|2	2|0	PTPRB|PTPRB	69289211|69289211	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.942000|0.942000	0.58702|0.58702	5.076000|5.076000	0.64413|0.64413	2.452000|2.452000	0.82932|0.82932	0.591000|0.591000	0.81541|0.81541	CAC|ACA	PTPRB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000127329		0.458	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404439.1	36	0.00	0	G			71002944	71002944	-1	no_errors	ENST00000334414	ensembl	human	known	69_37n	missense	30	36.17	17	SNP	0.998	C
RPL13A	23521	genome.wustl.edu	37	19	49993772	49993772	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr19:49993772C>A	ENST00000391857.4	+	4	271	c.195C>A	c.(193-195)aaC>aaA	p.N65K	SNORD34_ENST00000365633.1_RNA|RPL13A_ENST00000477613.2_3'UTR|CTD-3148I10.15_ENST00000595815.1_RNA|SNORD33_ENST00000362761.1_RNA|SNORD32A_ENST00000364805.1_RNA|SNORD35A_ENST00000363389.1_RNA	NM_001270491.1|NM_012423.3	NP_001257420.1|NP_036555.1	P40429	RL13A_HUMAN	ribosomal protein L13a	65					cellular protein metabolic process (GO:0044267)|cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of formation of translation preinitiation complex (GO:1901194)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|GAIT complex (GO:0097452)|large ribosomal subunit (GO:0015934)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)	2		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		TGAACACCAACCCTTCCCGAG	0.647																																						dbGAP											0													31.0	37.0	35.0					19																	49993772		2203	4300	6503	-	-	-	SO:0001583	missense	0			X56932	CCDS12768.1, CCDS74421.1	19q13.3	2011-04-06			ENSG00000142541	ENSG00000142541		"""L ribosomal proteins"""	10304	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 1"""	TSTA1			Standard	NM_012423		Approved	L13A	uc031rlt.1	P40429	OTTHUMG00000134289	ENST00000391857.4:c.195C>A	19.37:g.49993772C>A	ENSP00000375730:p.Asn65Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K505	Missense_Mutation	SNP	pfam_Ribosomal_L13,superfamily_Ribosomal_L13_dom,tigrfam_Ribosomal_L13_euk/arc	p.N65K	ENST00000391857.4	37	c.195	CCDS12768.1	19	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064765	0.55432	.	.	ENSG00000142541	ENST00000391857;ENST00000396949	.	.	.	5.34	4.27	0.50696	Ribosomal protein L13 domain (2);	0.000000	0.85682	U	0.000000	T	0.57946	0.2088	L	0.48218	1.51	0.80722	D	1	B;B	0.27594	0.182;0.107	B;B	0.34489	0.184;0.104	T	0.56257	-0.8009	9	0.40728	T	0.16	.	12.7995	0.57578	0.1651:0.8349:0.0:0.0	.	65;65	Q5QTS3;P40429	.;RL13A_HUMAN	K	65	.	ENSP00000375730:N65K	N	+	3	2	RPL13A	54685584	1.000000	0.71417	0.996000	0.52242	0.918000	0.54935	1.748000	0.38308	1.187000	0.43000	0.655000	0.94253	AAC	RPL13A	-	pfam_Ribosomal_L13,superfamily_Ribosomal_L13_dom,tigrfam_Ribosomal_L13_euk/arc	ENSG00000142541		0.647	RPL13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL13A	HGNC	protein_coding	OTTHUMT00000258989.1	22	0.00	0	C			49993772	49993772	+1	no_errors	ENST00000391857	ensembl	human	known	69_37n	missense	6	50.00	6	SNP	1.000	A
RRN3	54700	genome.wustl.edu	37	16	15165061	15165061	+	Missense_Mutation	SNP	G	G	T	rs370313375		TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr16:15165061G>T	ENST00000198767.6	-	13	1259	c.1176C>A	c.(1174-1176)gaC>gaA	p.D392E	PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000540462.1_Missense_Mutation_p.D210E|RRN3_ENST00000563559.1_Missense_Mutation_p.D392E|RRN3_ENST00000327307.7_Missense_Mutation_p.D359E|RRN3_ENST00000429751.2_Missense_Mutation_p.D362E	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	392					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						GATTACTTGGGTCCTGCAATT	0.393																																						dbGAP											0													85.0	94.0	91.0					16																	15165061		2196	4300	6496	-	-	-	SO:0001583	missense	0			AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.1176C>A	16.37:g.15165061G>T	ENSP00000198767:p.Asp392Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	pfam_RNA_pol_I_trans_ini_fac_RRN3,superfamily_ARM-type_fold	p.D392E	ENST00000198767.6	37	c.1176	CCDS10559.1	16	.	.	.	.	.	.	.	.	.	.	.	13.59	2.283276	0.40394	.	.	ENSG00000085721	ENST00000198767;ENST00000429751;ENST00000327307;ENST00000540462	T;T;T;T	0.48836	0.8;0.8;0.8;2.47	5.62	2.19	0.27852	.	0.200966	0.39909	N	0.001231	T	0.36717	0.0977	L	0.55481	1.735	0.41896	D	0.990391	P;B;B	0.40834	0.73;0.259;0.39	B;B;B	0.35182	0.167;0.186;0.197	T	0.12426	-1.0548	10	0.35671	T	0.21	.	8.9855	0.35992	0.7846:0.0:0.2154:0.0	.	362;293;392	F5H148;B4DZL9;Q9NYV6	.;.;RRN3_HUMAN	E	392;362;359;210	ENSP00000198767:D392E;ENSP00000402027:D362E;ENSP00000318484:D359E;ENSP00000437963:D210E	ENSP00000198767:D392E	D	-	3	2	RRN3	15072562	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	2.975000	0.49281	0.467000	0.27218	-0.507000	0.04495	GAC	RRN3	-	pfam_RNA_pol_I_trans_ini_fac_RRN3,superfamily_ARM-type_fold	ENSG00000085721		0.393	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRN3	HGNC	protein_coding	OTTHUMT00000252087.2	32	0.00	0	G	NM_018427		15165061	15165061	-1	no_errors	ENST00000198767	ensembl	human	known	69_37n	missense	10	54.55	12	SNP	1.000	T
RSPH10B	222967	genome.wustl.edu	37	7	6005323	6005323	+	Missense_Mutation	SNP	C	C	T	rs200962894	byFrequency	TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr7:6005323C>T	ENST00000405415.1	-	3	661	c.275G>A	c.(274-276)cGt>cAt	p.R92H	RSPH10B_ENST00000337579.3_Missense_Mutation_p.R92H|RSPH10B_ENST00000404406.1_Missense_Mutation_p.R92H|RSPH10B_ENST00000441023.2_Missense_Mutation_p.R92H|RSPH10B_ENST00000535104.1_5'Flank			P0C881	R10B1_HUMAN	radial spoke head 10 homolog B (Chlamydomonas)	92										breast(1)|kidney(1)|lung(4)|ovary(1)|skin(4)	11		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)		ATACAGCCCACGAACCTTTTC	0.438													C|||	294	0.0587061	0.0166	0.121	5008	,	,		13170	0.0149		0.1362	False		,,,				2504	0.0368					dbGAP											0													4.0	4.0	4.0					7																	6005323		1653	3655	5308	-	-	-	SO:0001583	missense	0				CCDS34598.1	7p22.2	2008-07-04			ENSG00000155026	ENSG00000155026			27362	protein-coding gene	gene with protein product						16507594	Standard	NM_173565		Approved		uc003sph.1	P0C881	OTTHUMG00000152378	ENST00000405415.1:c.275G>A	7.37:g.6005323C>T	ENSP00000385443:p.Arg92His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMW7|Q86ST9|Q8NE68	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.R92H	ENST00000405415.1	37	c.275	CCDS34598.1	7	104	0.047619047619047616	9	0.018292682926829267	29	0.08011049723756906	2	0.0034965034965034965	64	0.08443271767810026	C	4.777	0.144454	0.09134	.	.	ENSG00000155026	ENST00000405415;ENST00000404406;ENST00000337579;ENST00000441023	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	4.73	0.597	0.17504	.	0.588391	0.17861	N	0.159518	T	0.01156	0.0038	N	0.21508	0.67	0.09310	N	1	B	0.26876	0.162	B	0.24394	0.053	T	0.05903	-1.0857	10	0.42905	T	0.14	.	5.1232	0.14871	0.0:0.4291:0.1466:0.4243	.	92	P0C881	R10B1_HUMAN	H	92	ENSP00000385443:R92H;ENSP00000384097:R92H;ENSP00000338556:R92H;ENSP00000400988:R92H	ENSP00000338556:R92H	R	-	2	0	RSPH10B	5971849	0.011000	0.17503	0.159000	0.22649	0.202000	0.24057	0.078000	0.14761	0.040000	0.15660	0.561000	0.74099	CGT	RSPH10B	-	pfam_MORN	ENSG00000155026		0.438	RSPH10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH10B	HGNC	protein_coding	OTTHUMT00000325465.2	10	0.00	0	C	NM_173565		6005323	6005323	-1	no_errors	ENST00000337579	ensembl	human	known	69_37n	missense	4	76.47	13	SNP	0.005	T
RUSC2	9853	genome.wustl.edu	37	9	35558483	35558483	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr9:35558483G>T	ENST00000455600.1	+	8	3829	c.3260G>T	c.(3259-3261)gGc>gTc	p.G1087V		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1087	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			GTCCTGCATGGCCTCTACAAC	0.567																																						dbGAP											0													245.0	206.0	219.0					9																	35558483		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.3260G>T	9.37:g.35558483G>T	ENSP00000393922:p.Gly1087Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	pfam_Run,pfam_SH3_2,superfamily_SH3_domain,smart_Run,smart_SH3_domain,pfscan_Run,pfscan_SH3_domain	p.G1087V	ENST00000455600.1	37	c.3260	CCDS35008.1	9	.	.	.	.	.	.	.	.	.	.	G	33	5.217806	0.95104	.	.	ENSG00000198853	ENST00000361226;ENST00000455600	T;T	0.11604	2.76;2.76	5.72	5.72	0.89469	RUN (2);	0.099119	0.64402	D	0.000001	T	0.13543	0.0328	N	0.22421	0.69	0.80722	D	1	P	0.48589	0.912	P	0.47603	0.551	T	0.01480	-1.1344	10	0.48119	T	0.1	-19.7711	18.8498	0.92224	0.0:0.0:1.0:0.0	.	1087	Q8N2Y8	RUSC2_HUMAN	V	1087	ENSP00000355177:G1087V;ENSP00000393922:G1087V	ENSP00000355177:G1087V	G	+	2	0	RUSC2	35548483	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.440000	0.66563	2.705000	0.92388	0.655000	0.94253	GGC	RUSC2	-	pfam_Run,pfscan_Run	ENSG00000198853		0.567	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RUSC2	HGNC	protein_coding	OTTHUMT00000052309.1	38	0.00	0	G	XM_048462		35558483	35558483	+1	no_errors	ENST00000361226	ensembl	human	known	69_37n	missense	25	45.83	22	SNP	1.000	T
RXRG	6258	genome.wustl.edu	37	1	165398021	165398021	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr1:165398021C>G	ENST00000359842.5	-	2	534	c.232G>C	c.(232-234)Ggc>Cgc	p.G78R		NM_001256570.1|NM_006917.4	NP_001243499.1|NP_008848.1	P48443	RXRG_HUMAN	retinoid X receptor, gamma	78	Modulating. {ECO:0000250}.				gene expression (GO:0010467)|heart development (GO:0007507)|neuron differentiation (GO:0030182)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|skeletal muscle tissue development (GO:0007519)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	9-cis retinoic acid receptor activity (GO:0004886)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(6)|lung(22)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	38	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tretinoin(DB00755)	GAGGGTGGGCCCATGGCAGAG	0.597																																						dbGAP											0													55.0	60.0	59.0					1																	165398021		2203	4300	6503	-	-	-	SO:0001583	missense	0			U38480	CCDS1248.1, CCDS72970.1	1q22-q23	2013-01-16			ENSG00000143171	ENSG00000143171		"""Nuclear hormone receptors"""	10479	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 3"""	180247				8034312	Standard	NR_033824		Approved	NR2B3	uc001gda.3	P48443	OTTHUMG00000034626	ENST00000359842.5:c.232G>C	1.37:g.165398021C>G	ENSP00000352900:p.Gly78Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIP1|Q6IBU7	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_DUF3345,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoid-X_rcpt/HNF4,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF	p.G78R	ENST00000359842.5	37	c.232	CCDS1248.1	1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048936	0.75846	.	.	ENSG00000143171	ENST00000359842	D	0.92595	-3.07	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.95056	0.8399	M	0.78456	2.415	0.53688	D	0.999970	D	0.63880	0.993	D	0.68039	0.955	D	0.95247	0.8356	9	0.62326	D	0.03	.	16.4144	0.83729	0.0:1.0:0.0:0.0	.	78	P48443	RXRG_HUMAN	R	78	ENSP00000352900:G78R	ENSP00000352900:G78R	G	-	1	0	RXRG	163664645	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	4.442000	0.59988	2.436000	0.82500	0.561000	0.74099	GGC	RXRG	-	pfam_DUF3345	ENSG00000143171		0.597	RXRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RXRG	HGNC	protein_coding	OTTHUMT00000083794.2	20	0.00	0	C	NM_006917		165398021	165398021	-1	no_errors	ENST00000359842	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	1.000	G
RYR1	6261	genome.wustl.edu	37	19	38939431	38939431	+	Missense_Mutation	SNP	G	G	A	rs113332073		TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr19:38939431G>A	ENST00000359596.3	+	11	1100	c.1100G>A	c.(1099-1101)cGg>cAg	p.R367Q	RYR1_ENST00000355481.4_Missense_Mutation_p.R367Q|RYR1_ENST00000360985.3_Missense_Mutation_p.R367Q			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	367	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.		R -> L (in MHS1). {ECO:0000269|PubMed:19191329}.		calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AAGGCCCTGCGGCTCGGCGTG	0.607																																						dbGAP											0			GRCh37	CM063114|CM064220	RYR1	M	rs113332073						51.0	45.0	47.0					19																	38939431		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.1100G>A	19.37:g.38939431G>A	ENSP00000352608:p.Arg367Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.R367Q	ENST00000359596.3	37	c.1100	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	G	17.37	3.371290	0.61624	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.91351	-2.83;-2.83;-2.83	4.59	4.59	0.56863	MIR motif (1);MIR (2);	0.000000	0.64402	U	0.000003	D	0.93746	0.8001	L	0.58428	1.81	0.44454	D	0.99738	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.92535	0.6037	10	0.32370	T	0.25	.	16.3211	0.82951	0.0:0.0:1.0:0.0	.	367;367	P21817-2;P21817	.;RYR1_HUMAN	Q	367	ENSP00000352608:R367Q;ENSP00000347667:R367Q;ENSP00000354254:R367Q	ENSP00000347667:R367Q	R	+	2	0	RYR1	43631271	1.000000	0.71417	0.752000	0.31206	0.636000	0.38137	9.228000	0.95250	2.375000	0.81037	0.561000	0.74099	CGG	RYR1	-	pfam_MIR,superfamily_MIR	ENSG00000196218		0.607	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	23	0.00	0	G			38939431	38939431	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	1.000	A
SCYL3	57147	genome.wustl.edu	37	1	169857904	169857904	+	Silent	SNP	A	A	C			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr1:169857904A>C	ENST00000367770.1	-	1	125	c.78T>G	c.(76-78)gtT>gtG	p.V26V	SCYL3_ENST00000470238.1_5'UTR|SCYL3_ENST00000367771.6_Silent_p.V26V|SCYL3_ENST00000367772.4_Silent_p.V26V			Q8IZE3	PACE1_HUMAN	SCY1-like 3 (S. cerevisiae)	26	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CAGCGGGATAAACAGCAAGTC	0.418																																						dbGAP											0													201.0	184.0	190.0					1																	169857904		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC014662	CCDS1286.1, CCDS1287.1	1q24.2	2008-02-05			ENSG00000000457	ENSG00000000457			19285	protein-coding gene	gene with protein product	"""ezrin-binding partner PACE-1"""	608192				12651155	Standard	NM_020423		Approved	PACE-1, PACE1	uc001ggs.3	Q8IZE3	OTTHUMG00000035941	ENST00000367770.1:c.78T>G	1.37:g.169857904A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Z2|Q5THA6|Q5THA8|Q8IZN9|Q96C56|Q9UBK6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_HEAT_type_2,pfscan_Prot_kinase_cat_dom	p.V26	ENST00000367770.1	37	c.78	CCDS1287.1	1																																																																																			SCYL3	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000000457		0.418	SCYL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL3	HGNC	protein_coding	OTTHUMT00000087550.4	52	0.00	0	A	NM_181093		169857904	169857904	-1	no_errors	ENST00000367770	ensembl	human	known	69_37n	silent	98	27.74	38	SNP	0.576	C
SEMA4D	10507	genome.wustl.edu	37	9	91978680	91978680	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr9:91978680C>T	ENST00000420987.1	-	18	2514	c.2068G>A	c.(2068-2070)Gtg>Atg	p.V690M	SEMA4D_ENST00000420101.2_Missense_Mutation_p.V75M|SEMA4D_ENST00000469653.1_5'UTR|SEMA4D_ENST00000343780.4_Missense_Mutation_p.V690M|SEMA4D_ENST00000339861.4_Missense_Mutation_p.V690M|SEMA4D_ENST00000455551.2_Missense_Mutation_p.V690M	NM_001142287.1	NP_001135759.1	Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	0					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						GCAACCTGCACCTTCGAAGTC	0.502																																						dbGAP											0													103.0	87.0	92.0					9																	91978680		2203	4300	6503	-	-	-	SO:0001583	missense	0			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000420987.1:c.2068G>A	9.37:g.91978680C>T	ENSP00000391733:p.Val690Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPM6|Q7Z5S4|Q8N8B0	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.V690M	ENST00000420987.1	37	c.2068	CCDS47991.1	9	.	.	.	.	.	.	.	.	.	.	C	17.99	3.524285	0.64747	.	.	ENSG00000187764	ENST00000339861;ENST00000420987;ENST00000420101;ENST00000455551;ENST00000343780	T;T;T;T	0.15952	2.38;2.38;2.38;2.38	5.05	5.05	0.67936	.	0.385111	0.22009	N	0.065892	T	0.32133	0.0819	.	.	.	0.41873	D	0.990286	P	0.47191	0.891	P	0.53593	0.73	T	0.01743	-1.1283	9	0.59425	D	0.04	.	14.3556	0.66735	0.1485:0.8515:0.0:0.0	.	690	Q92854-2	.	M	690;690;75;690;690	ENSP00000344923:V690M;ENSP00000391733:V690M;ENSP00000411981:V690M;ENSP00000343418:V690M	ENSP00000344923:V690M	V	-	1	0	SEMA4D	91168500	0.268000	0.24133	0.018000	0.16275	0.789000	0.44602	3.444000	0.52914	2.635000	0.89317	0.462000	0.41574	GTG	SEMA4D	-	pfscan_Ig-like	ENSG00000187764		0.502	SEMA4D-203	KNOWN	basic|CCDS	protein_coding	SEMA4D	HGNC	protein_coding	OTTHUMT00000402418.2	29	0.00	0	C	NM_006378		91978680	91978680	-1	no_errors	ENST00000343780	ensembl	human	known	69_37n	missense	19	38.71	12	SNP	0.013	T
SGK1	6446	genome.wustl.edu	37	6	134494418	134494418	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr6:134494418C>G	ENST00000237305.7	-	5	499	c.411G>C	c.(409-411)aaG>aaC	p.K137N	SGK1_ENST00000367858.5_Missense_Mutation_p.K232N|SGK1_ENST00000475719.2_Missense_Mutation_p.K137N|SGK1_ENST00000413996.3_Missense_Mutation_p.K151N|SGK1_ENST00000367857.5_Missense_Mutation_p.K127N|SGK1_ENST00000528577.1_Missense_Mutation_p.K165N|SGK1_ENST00000489458.2_5'UTR	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	137	Glu/Lys-rich.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		ATACCTCTTTCTTTTTCAGGA	0.393																																						dbGAP											0													111.0	111.0	111.0					6																	134494418		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.411G>C	6.37:g.134494418C>G	ENSP00000237305:p.Lys137Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_Phox,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.K232N	ENST00000237305.7	37	c.696	CCDS5170.1	6	.	.	.	.	.	.	.	.	.	.	C	16.57	3.161258	0.57368	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719	T;T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2;1.94	6.17	4.4	0.53042	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.41442	0.1159	N	0.21240	0.645	0.80722	D	1	B;B;B;B;B;B	0.32800	0.203;0.102;0.385;0.02;0.339;0.241	B;B;B;B;B;B	0.41764	0.041;0.057;0.366;0.024;0.074;0.069	T	0.50709	-0.8796	10	0.66056	D	0.02	.	12.9426	0.58354	0.0:0.8699:0.0:0.1301	.	165;151;137;127;232;137	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	N	232;151;137;127;165;137	ENSP00000356832:K232N;ENSP00000396242:K151N;ENSP00000237305:K137N;ENSP00000356831:K127N;ENSP00000434450:K165N;ENSP00000434302:K137N	ENSP00000237305:K137N	K	-	3	2	SGK1	134536111	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.053000	0.57427	0.940000	0.37473	0.655000	0.94253	AAG	SGK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000118515		0.393	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK1	HGNC	protein_coding	OTTHUMT00000042312.2	70	0.00	0	C			134494418	134494418	-1	no_errors	ENST00000367858	ensembl	human	known	69_37n	missense	62	31.11	28	SNP	1.000	G
SLC4A1	6521	genome.wustl.edu	37	17	42335404	42335404	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr17:42335404A>G	ENST00000262418.6	-	11	1387	c.1232T>C	c.(1231-1233)tTc>tCc	p.F411S	SLC4A1_ENST00000471005.1_5'Flank|AC003043.1_ENST00000597382.1_Intron	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	411	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		AAAGTAGATGAAGATGACGGC	0.597																																						dbGAP											0													76.0	72.0	74.0					17																	42335404		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.1232T>C	17.37:g.42335404A>G	ENSP00000262418:p.Phe411Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_1,tigrfam_HCO3_transpt_euk	p.F411S	ENST00000262418.6	37	c.1232	CCDS11481.1	17	.	.	.	.	.	.	.	.	.	.	a	29.0	4.966214	0.92855	.	.	ENSG00000004939	ENST00000262418	D	0.85013	-1.93	4.96	4.96	0.65561	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94748	0.8305	H	0.96691	3.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.96057	0.9036	10	0.66056	D	0.02	.	13.7488	0.62894	1.0:0.0:0.0:0.0	.	411;411	E2RVJ0;P02730	.;B3AT_HUMAN	S	411	ENSP00000262418:F411S	ENSP00000262418:F411S	F	-	2	0	SLC4A1	39690930	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.097000	0.94193	2.084000	0.62774	0.459000	0.35465	TTC	SLC4A1	-	pfam_HCO3_transpt_C,prints_Anion_exchange,tigrfam_HCO3_transpt_euk	ENSG00000004939		0.597	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1	HGNC	protein_coding	OTTHUMT00000346194.1	33	0.00	0	A	NM_000342		42335404	42335404	-1	no_errors	ENST00000262418	ensembl	human	known	69_37n	missense	7	70.83	17	SNP	1.000	G
SPOCD1	90853	genome.wustl.edu	37	1	32279574	32279574	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr1:32279574C>A	ENST00000360482.2	-	2	1490	c.1361G>T	c.(1360-1362)aGc>aTc	p.S454I	SPOCD1_ENST00000373648.2_Missense_Mutation_p.S454I|SPOCD1_ENST00000533231.1_Missense_Mutation_p.S454I|SPOCD1_ENST00000257100.3_Intron	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	454					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		GCCTCCTGGGCTGGGTTCCTC	0.557																																						dbGAP											0													75.0	79.0	78.0					1																	32279574		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.1361G>T	1.37:g.32279574C>A	ENSP00000353670:p.Ser454Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,superfamily_TFIIS_cen_dom,smart_TFS2M	p.S454I	ENST00000360482.2	37	c.1361	CCDS347.1	1	.	.	.	.	.	.	.	.	.	.	C	13.74	2.327459	0.41197	.	.	ENSG00000134668	ENST00000360482;ENST00000373648;ENST00000533231	T;T;T	0.41400	1.73;1.0;1.73	3.62	3.62	0.41486	.	.	.	.	.	T	0.44829	0.1312	N	0.19112	0.55	0.09310	N	1	D;D	0.76494	0.999;0.998	D;P	0.65443	0.935;0.863	T	0.21759	-1.0236	9	0.33940	T	0.23	-10.4353	11.0508	0.47889	0.0:1.0:0.0:0.0	.	454;454	Q6ZMY3-2;Q6ZMY3	.;SPOC1_HUMAN	I	454	ENSP00000353670:S454I;ENSP00000362752:S454I;ENSP00000435851:S454I	ENSP00000353670:S454I	S	-	2	0	SPOCD1	32052161	0.000000	0.05858	0.045000	0.18777	0.473000	0.32948	0.012000	0.13287	2.288000	0.76882	0.455000	0.32223	AGC	SPOCD1	-	NULL	ENSG00000134668		0.557	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCD1	HGNC	protein_coding	OTTHUMT00000381912.1	33	0.00	0	C	NM_144569		32279574	32279574	-1	no_errors	ENST00000360482	ensembl	human	known	69_37n	missense	20	47.37	18	SNP	0.053	A
TANC1	85461	genome.wustl.edu	37	2	160019974	160019974	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr2:160019974C>T	ENST00000263635.6	+	8	1100	c.863C>T	c.(862-864)gCa>gTa	p.A288V	TANC1_ENST00000454300.1_Missense_Mutation_p.A182V	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	288					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						CTGCCCAAAGCAGAATCCTCA	0.572																																						dbGAP											0													61.0	69.0	66.0					2																	160019974		2024	4180	6204	-	-	-	SO:0001583	missense	0			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.863C>T	2.37:g.160019974C>T	ENSP00000263635:p.Ala288Val	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JD88|Q49AI8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.A288V	ENST00000263635.6	37	c.863	CCDS42766.1	2	.	.	.	.	.	.	.	.	.	.	C	6.468	0.454453	0.12283	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.69306	-0.39;-0.39	5.93	5.05	0.67936	.	0.427371	0.27429	N	0.019409	T	0.52240	0.1722	L	0.36672	1.1	0.24774	N	0.992851	B;B	0.15719	0.009;0.014	B;B	0.14023	0.009;0.01	T	0.39583	-0.9607	10	0.51188	T	0.08	.	5.7967	0.18392	0.0:0.6776:0.1671:0.1553	.	287;288	B9EK39;Q9C0D5	.;TANC1_HUMAN	V	182;288	ENSP00000396339:A182V;ENSP00000263635:A288V	ENSP00000263635:A288V	A	+	2	0	TANC1	159728220	0.097000	0.21791	0.991000	0.47740	0.887000	0.51463	0.381000	0.20619	2.814000	0.96858	0.563000	0.77884	GCA	TANC1	-	NULL	ENSG00000115183		0.572	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANC1	HGNC	protein_coding	OTTHUMT00000333135.1	22	0.00	0	C			160019974	160019974	+1	no_errors	ENST00000263635	ensembl	human	known	69_37n	missense	16	44.83	13	SNP	0.889	T
TLR7	51284	genome.wustl.edu	37	X	12903898	12903898	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chrX:12903898C>A	ENST00000380659.3	+	3	410	c.271C>A	c.(271-273)Ctg>Atg	p.L91M		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	91					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	ACTGGACCATCTGGTAGAGAT	0.473																																						dbGAP											0													141.0	131.0	134.0					X																	12903898		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.271C>A	X.37:g.12903898C>A	ENSP00000370034:p.Leu91Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D1CS69|Q9NR98	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_TIR_dom,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L91M	ENST00000380659.3	37	c.271	CCDS14151.1	X	.	.	.	.	.	.	.	.	.	.	C	11.28	1.592492	0.28357	.	.	ENSG00000196664	ENST00000380659	T	0.20200	2.09	5.79	4.94	0.65067	.	0.091871	0.45126	D	0.000384	T	0.54464	0.1860	M	0.90977	3.165	0.37002	D	0.895322	D	0.89917	1.0	D	0.76575	0.988	T	0.70684	-0.4804	10	0.87932	D	0	.	13.9646	0.64200	0.0:0.9254:0.0:0.0746	.	91	Q9NYK1	TLR7_HUMAN	M	91	ENSP00000370034:L91M	ENSP00000370034:L91M	L	+	1	2	TLR7	12813819	0.994000	0.37717	0.016000	0.15963	0.137000	0.21094	2.657000	0.46724	1.210000	0.43336	0.500000	0.49745	CTG	TLR7	-	NULL	ENSG00000196664		0.473	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR7	HGNC	protein_coding	OTTHUMT00000055769.1	37	0.00	0	C	NM_016562		12903898	12903898	+1	no_errors	ENST00000380659	ensembl	human	known	69_37n	missense	22	50.00	22	SNP	0.690	A
TFDP3	51270	genome.wustl.edu	37	X	132351078	132351079	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chrX:132351078_132351079CC>AA	ENST00000310125.4	-	1	1297_1298	c.1209_1210GG>TT	c.(1207-1212)gaGGat>gaTTat	p.403_404ED>DY		NM_016521.2	NP_057605.3	Q5H9I0	TFDP3_HUMAN	transcription factor Dp family, member 3	403					cellular response to DNA damage stimulus (GO:0006974)|G1/S transition of mitotic cell cycle (GO:0000082)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(1)|lung(8)|ovary(1)|prostate(2)	19	Acute lymphoblastic leukemia(192;0.000127)					CGTCAGTCATCCTCGTCATTCT	0.455																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF219119	CCDS14636.2	Xq26.2	2009-03-25			ENSG00000183434	ENSG00000183434			24603	protein-coding gene	gene with protein product	"""E2F-like protein"", ""cancer/testis antigen 30"""	300772				12097419	Standard	NM_016521		Approved	HCA661, E2F-like, CT30	uc004exb.1	Q5H9I0	OTTHUMG00000022433	ENST00000310125.4:c.1209_1210delinsAA	X.37:g.132351078_132351079delinsAA	ENSP00000385461:p.E403_D404delinsDY	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6DK49|Q9NZ54	Missense_Mutation	SNP	pfam_Transc_factor_DP_C,pfam_E2F_TDP,pirsf_Transcription_factor_DP_subgr	p.D404Y|p.E403D	ENST00000310125.4	37	c.1210|c.1209	CCDS14636.2	X																																																																																			TFDP3	-	NULL|pirsf_Transcription_factor_DP_subgr	ENSG00000183434		0.455	TFDP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFDP3	HGNC	protein_coding	OTTHUMT00000058337.1	13	0.00	0	C	NM_016521		132351078|132351079	132351078|132351079	-1	no_errors	ENST00000310125	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577518	7577518	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr17:7577518T>A	ENST00000269305.4	-	7	952	c.763A>T	c.(763-765)Atc>Ttc	p.I255F	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.I255F|TP53_ENST00000455263.2_Missense_Mutation_p.I255F|TP53_ENST00000359597.4_Missense_Mutation_p.I255F|TP53_ENST00000420246.2_Missense_Mutation_p.I255F|TP53_ENST00000413465.2_Missense_Mutation_p.I255F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	255	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> M (in sporadic cancers; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I255F(20)|p.0?(8)|p.I255del(7)|p.I255fs*9(3)|p.I255V(3)|p.T253_I255del(2)|p.I255fs*8(1)|p.?(1)|p.I254fs*7(1)|p.I254_T256del(1)|p.R249_T256delRPILTIIT(1)|p.I255fs*90(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCAGTGTGATGATGGTGAGG	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	49	Substitution - Missense(23)|Deletion - In frame(11)|Whole gene deletion(8)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Unknown(1)	oesophagus(10)|large_intestine(5)|haematopoietic_and_lymphoid_tissue(5)|ovary(5)|breast(4)|lung(4)|bone(4)|central_nervous_system(3)|upper_aerodigestive_tract(2)|pancreas(2)|stomach(1)|soft_tissue(1)|liver(1)|urinary_tract(1)|skin(1)											146.0	105.0	119.0					17																	7577518		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.763A>T	17.37:g.7577518T>A	ENSP00000269305:p.Ile255Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.I255F	ENST00000269305.4	37	c.763	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	10.72	1.428650	0.25726	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99737	-6.59;-6.59;-6.59;-6.59;-6.59;-6.59;-6.59	4.62	3.53	0.40419	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.058771	0.64402	D	0.000004	D	0.98921	0.9634	N	0.12746	0.255	0.58432	D	0.999992	D;B;D;D;D	0.89917	0.999;0.056;0.997;0.999;1.0	D;B;D;D;D	0.81914	0.989;0.068;0.988;0.995;0.994	D	0.98395	1.0565	10	0.87932	D	0	-21.9257	8.6786	0.34194	0.0:0.0922:0.0:0.9078	.	255;255;255;255;255	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	F	255;255;255;255;255;255;244;123	ENSP00000410739:I255F;ENSP00000352610:I255F;ENSP00000269305:I255F;ENSP00000398846:I255F;ENSP00000391127:I255F;ENSP00000391478:I255F;ENSP00000425104:I123F	ENSP00000269305:I255F	I	-	1	0	TP53	7518243	0.995000	0.38212	0.999000	0.59377	0.384000	0.30261	0.399000	0.20916	0.900000	0.36469	0.379000	0.24179	ATC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	15	0.00	0	T	NM_000546		7577518	7577518	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	13	45.83	11	SNP	1.000	A
TRMT112	51504	genome.wustl.edu	37	11	64084394	64084394	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr11:64084394A>C	ENST00000544844.1	-	4	874	c.317T>G	c.(316-318)aTg>aGg	p.M106R	PRDX5_ENST00000265462.4_5'Flank|TRMT112_ENST00000539854.1_3'UTR|PRDX5_ENST00000347941.4_5'Flank|PRDX5_ENST00000352435.4_5'Flank|TRMT112_ENST00000308774.2_Missense_Mutation_p.M101R|TRMT112_ENST00000535126.1_3'UTR|TRMT112_ENST00000535750.1_Missense_Mutation_p.M62R			Q9UI30	TR112_HUMAN	tRNA methyltransferase 11-2 homolog (S. cerevisiae)	106	TRM112.				peptidyl-glutamine methylation (GO:0018364)	extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	protein methyltransferase activity (GO:0008276)			large_intestine(1)|upper_aerodigestive_tract(1)	2						GATGGGGAACATACGTCCAGA	0.577																																						dbGAP											0													71.0	78.0	75.0					11																	64084394		2201	4295	6496	-	-	-	SO:0001583	missense	0			AF110774	CCDS8068.1, CCDS66113.1, CCDS73312.1	11q13.1	2013-07-23			ENSG00000173113	ENSG00000173113			26940	protein-coding gene	gene with protein product						11042152	Standard	NM_001286082		Approved	HSPC152, HSPC170, TRM112, TRMT11-2	uc001nzt.3	Q9UI30	OTTHUMG00000167848	ENST00000544844.1:c.317T>G	11.37:g.64084394A>C	ENSP00000438349:p.Met106Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R539|J3KNG5|Q3MHC7|Q8N2Z4	Missense_Mutation	SNP	pfam_UPF0434/Trm112	p.M106R	ENST00000544844.1	37	c.317	CCDS8068.1	11	.	.	.	.	.	.	.	.	.	.	A	8.206	0.799199	0.16397	.	.	ENSG00000173113	ENST00000535750;ENST00000544844;ENST00000308774	.	.	.	5.0	3.87	0.44632	.	0.568451	0.16151	N	0.227271	T	0.19046	0.0457	N	0.02751	-0.505	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.05886	-1.0858	9	0.16420	T	0.52	.	4.5634	0.12172	0.7401:0.0:0.0906:0.1693	.	106	Q9UI30	TR112_HUMAN	R	62;106;101	.	ENSP00000309433:M101R	M	-	2	0	TRMT112	63840970	1.000000	0.71417	0.432000	0.26747	0.657000	0.38888	5.395000	0.66291	1.044000	0.40200	-0.256000	0.11100	ATG	TRMT112	-	pfam_UPF0434/Trm112	ENSG00000173113		0.577	TRMT112-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRMT112	HGNC	protein_coding	OTTHUMT00000396598.2	20	0.00	0	A	NM_016404		64084394	64084394	-1	no_errors	ENST00000544844	ensembl	human	known	69_37n	missense	24	38.46	15	SNP	0.935	C
WHAMM	123720	genome.wustl.edu	37	15	83502073	83502073	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr15:83502073A>G	ENST00000286760.4	+	10	2314	c.2215A>G	c.(2215-2217)Atc>Gtc	p.I739V		NM_001080435.1	NP_001073904.1	Q8TF30	WHAMM_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules	739	Mediates actin nucleation. {ECO:0000269|PubMed:18614018}.|WH2 2. {ECO:0000255|PROSITE- ProRule:PRU00406}.				actin filament organization (GO:0007015)|actin filament reorganization (GO:0090527)|ER to Golgi vesicle-mediated transport (GO:0006888)|focal adhesion assembly (GO:0048041)|lamellipodium assembly (GO:0030032)|membrane tubulation (GO:0097320)|positive regulation of actin nucleation (GO:0051127)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|Golgi membrane (GO:0000139)	Arp2/3 complex binding (GO:0071933)|GTP-Rho binding (GO:0017049)|microtubule binding (GO:0008017)			endometrium(6)|large_intestine(5)|lung(1)|prostate(1)	13						CCACGCCTCAATCAATGAGCA	0.547																																						dbGAP											0													57.0	58.0	58.0					15																	83502073		2005	4168	6173	-	-	-	SO:0001583	missense	0			AK126887	CCDS45333.1	15q25.2	2009-02-18	2009-02-18	2009-02-18	ENSG00000156232	ENSG00000156232			30493	protein-coding gene	gene with protein product		612393	"""WAS protein homology region 2 domain containing 1"""	WHDC1		11853319, 18226259, 18614018, 18812086	Standard	XM_005272422		Approved	KIAA1971	uc002bje.3	Q8TF30		ENST00000286760.4:c.2215A>G	15.37:g.83502073A>G	ENSP00000286760:p.Ile739Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1J9	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_WH2_dom	p.I739V	ENST00000286760.4	37	c.2215	CCDS45333.1	15	.	.	.	.	.	.	.	.	.	.	A	3.883	-0.025559	0.07589	.	.	ENSG00000156232	ENST00000286760	T	0.27402	1.67	5.57	-0.906	0.10524	Actin-binding WH2 (1);	0.540214	0.19865	N	0.104340	T	0.04137	0.0115	N	0.00092	-2.175	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40887	-0.9539	10	0.02654	T	1	.	6.9537	0.24560	0.2754:0.0:0.611:0.1136	.	739	Q8TF30	WHAMM_HUMAN	V	739	ENSP00000286760:I739V	ENSP00000286760:I739V	I	+	1	0	WHAMM	81299127	0.004000	0.15560	0.000000	0.03702	0.466000	0.32739	-0.090000	0.11163	-0.442000	0.07190	-1.074000	0.02243	ATC	WHAMM	-	pfscan_WH2_dom	ENSG00000156232		0.547	WHAMM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WHAMM	HGNC	protein_coding	OTTHUMT00000418463.1	34	0.00	0	A			83502073	83502073	+1	no_errors	ENST00000286760	ensembl	human	known	69_37n	missense	17	54.05	20	SNP	0.039	G
ZAR1L	646799	genome.wustl.edu	37	13	32885924	32885924	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr13:32885924G>C	ENST00000533490.2	-	3	557	c.139C>G	c.(139-141)Cca>Gca	p.P47A	ZAR1L_ENST00000345108.6_Missense_Mutation_p.P47A			A6NP61	ZAR1L_HUMAN	zygote arrest 1-like	47						cytoplasm (GO:0005737)				NS(1)|kidney(1)	2						AGCAGCCCTGGCCTGGCCAGA	0.602																																						dbGAP											0													27.0	28.0	28.0					13																	32885924		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45023.1	13q13.1	2014-02-20			ENSG00000189167	ENSG00000189167			37116	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 7"""					18442940	Standard	NM_001136571		Approved	Z3CXXC7	uc010abc.1	A6NP61	OTTHUMG00000016694	ENST00000533490.2:c.139C>G	13.37:g.32885924G>C	ENSP00000437289:p.Pro47Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RV03|B7ZBU2	Missense_Mutation	SNP	NULL	p.P47A	ENST00000533490.2	37	c.139	CCDS45023.1	13	.	.	.	.	.	.	.	.	.	.	g	7.734	0.699940	0.15106	.	.	ENSG00000189167	ENST00000345108	.	.	.	4.72	1.84	0.25277	.	0.871161	0.09023	U	0.859914	T	0.33731	0.0873	L	0.46157	1.445	0.09310	N	1	P	0.39282	0.666	B	0.33339	0.162	T	0.09465	-1.0673	9	0.16420	T	0.52	-2.3224	13.5202	0.61563	0.0:0.0:0.4623:0.5377	.	47	A6NP61	ZAR1L_HUMAN	A	47	.	ENSP00000344616:P47A	P	-	1	0	ZAR1L	31783924	0.009000	0.17119	0.184000	0.23157	0.335000	0.28730	0.623000	0.24447	0.155000	0.19261	0.651000	0.88453	CCA	ZAR1L	-	NULL	ENSG00000189167		0.602	ZAR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAR1L	HGNC	protein_coding	OTTHUMT00000044403.5	9	0.00	0	G			32885924	32885924	-1	no_errors	ENST00000345108	ensembl	human	known	69_37n	missense	7	61.11	11	SNP	0.074	C
ZCCHC18	644353	genome.wustl.edu	37	X	103360019	103360019	+	3'UTR	SNP	C	C	A			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chrX:103360019C>A	ENST00000537356.3	+	0	2631				SLC25A53_ENST00000357421.4_Intron|ZCCHC18_ENST00000422784.1_3'UTR			P0CG32	ZCC18_HUMAN	zinc finger, CCHC domain containing 18								nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)										CAGTAAGGATCTAGTCCAGCC	0.473																																						dbGAP											0													44.0	36.0	39.0					X																	103360019		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF086548	CCDS65304.1	Xq22.2	2013-01-31	2009-02-03		ENSG00000166707	ENSG00000166707		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	32459	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7B"""		"""zinc finger, CCHC domain containing 12 pseudogene 1"""				Standard	NM_001143978		Approved	SIZN2, PNMA7B	uc011msh.2	P0CG32	OTTHUMG00000022123	ENST00000537356.3:c.*5C>A	X.37:g.103360019C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000537356.3	37	NULL		X																																																																																			ZCCHC18	-	-	ENSG00000166707		0.473	ZCCHC18-006	PUTATIVE	basic|appris_principal	protein_coding	ZCCHC18	HGNC	protein_coding	OTTHUMT00000471686.1	23	0.00	0	C	NM_001143978		103360019	103360019	+1	no_errors	ENST00000422784	ensembl	human	known	69_37n	rna	25	26.47	9	SNP	0.001	A
ZNF461	92283	genome.wustl.edu	37	19	37129736	37129736	+	Missense_Mutation	SNP	T	T	G	rs562716096		TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr19:37129736T>G	ENST00000588268.1	-	6	1738	c.1511A>C	c.(1510-1512)aAg>aCg	p.K504T	ZNF461_ENST00000360357.4_Missense_Mutation_p.K481T|ZNF461_ENST00000540605.2_5'UTR	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	504					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GCTAAAGGCCTTCCCACATTC	0.383																																						dbGAP											0													100.0	107.0	105.0					19																	37129736		2200	4299	6499	-	-	-	SO:0001583	missense	0			BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.1511A>C	19.37:g.37129736T>G	ENSP00000467931:p.Lys504Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9W9|Q6VSF7|Q9ULZ8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K504T	ENST00000588268.1	37	c.1511	CCDS54257.1	19	.	.	.	.	.	.	.	.	.	.	T	19.39	3.818605	0.71028	.	.	ENSG00000197808	ENST00000396893;ENST00000396896;ENST00000360357;ENST00000540605;ENST00000396892	T	0.27890	1.64	3.48	3.48	0.39840	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.61035	0.2315	M	0.91090	3.175	0.35756	D	0.819787	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.75605	-0.3260	9	0.87932	D	0	.	11.3453	0.49556	0.0:0.0:0.0:1.0	.	481;426;504	B4DRP8;Q59G30;Q8TAF7	.;.;ZN461_HUMAN	T	504;235;481;377;198	ENSP00000353515:K481T	ENSP00000353515:K481T	K	-	2	0	ZNF461	41821576	1.000000	0.71417	0.951000	0.38953	0.990000	0.78478	4.254000	0.58798	1.579000	0.49836	0.402000	0.26972	AAG	ZNF461	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197808		0.383	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF461	HGNC	protein_coding	OTTHUMT00000453202.1	53	0.00	0	T	NM_153257		37129736	37129736	-1	no_errors	ENST00000588268	ensembl	human	known	69_37n	missense	27	44.90	22	SNP	0.994	G
ZNF671	79891	genome.wustl.edu	37	19	58232994	58232994	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1L7-01A-11D-A142-09	TCGA-E2-A1L7-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	33a09072-6554-4d46-b738-0852624940af	f5286adc-5c10-4b09-a433-daeca4c1f377	g.chr19:58232994C>T	ENST00000317398.6	-	4	555	c.460G>A	c.(460-462)Gtc>Atc	p.V154I	ZNF671_ENST00000335820.3_Missense_Mutation_p.V56I|ZNF671_ENST00000594803.1_5'Flank|AC003006.7_ENST00000594684.1_Intron|AC003006.7_ENST00000599221.1_Intron	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	154					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AGAGTCCTGACCTCTGACACT	0.463																																						dbGAP											0													119.0	115.0	116.0					19																	58232994		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.460G>A	19.37:g.58232994C>T	ENSP00000321848:p.Val154Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF07|Q9H5E9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V154I	ENST00000317398.6	37	c.460	CCDS12961.1	19	.	.	.	.	.	.	.	.	.	.	C	7.281	0.609160	0.14066	.	.	ENSG00000083814	ENST00000317398;ENST00000335820	T;T	0.07021	3.38;3.23	1.66	0.47	0.16747	.	.	.	.	.	T	0.04363	0.0120	N	0.17082	0.46	0.09310	N	1	B	0.32409	0.37	B	0.32393	0.145	T	0.45145	-0.9281	9	0.21014	T	0.42	.	4.8546	0.13554	0.3603:0.6397:0.0:0.0	.	154	Q8TAW3	ZN671_HUMAN	I	154;56	ENSP00000321848:V154I;ENSP00000338670:V56I	ENSP00000321848:V154I	V	-	1	0	ZNF671	62924806	0.000000	0.05858	0.001000	0.08648	0.214000	0.24535	-1.002000	0.03686	0.207000	0.20607	0.313000	0.20887	GTC	ZNF671	-	NULL	ENSG00000083814		0.463	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF671	HGNC	protein_coding	OTTHUMT00000466817.1	35	0.00	0	C	NM_024833		58232994	58232994	-1	no_errors	ENST00000317398	ensembl	human	known	69_37n	missense	27	40.00	18	SNP	0.001	T
