#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM23	8745	genome.wustl.edu	37	2	207406802	207406802	+	Silent	SNP	A	A	G			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr2:207406802A>G	ENST00000264377.3	+	5	928	c.600A>G	c.(598-600)ggA>ggG	p.G200G	ADAM23_ENST00000374416.1_Silent_p.G200G|ADAM23_ENST00000374415.3_Silent_p.G200G	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	200					cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		ACTACCATGGAAGCATCAGAG	0.423																																					Melanoma(194;1127 2130 19620 24042 27855)	dbGAP											0													132.0	124.0	127.0					2																	207406802		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.600A>G	2.37:g.207406802A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU59	Silent	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.G200	ENST00000264377.3	37	c.600	CCDS2369.1	2																																																																																			ADAM23	-	pfam_Peptidase_M12B_N	ENSG00000114948		0.423	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM23	HGNC	protein_coding	OTTHUMT00000256431.2	53	0.00	0	A	NM_003812		207406802	207406802	+1	no_errors	ENST00000264377	ensembl	human	known	69_37n	silent	37	22.92	11	SNP	0.683	G
AKAP4	8852	genome.wustl.edu	37	X	49958245	49958245	+	Silent	SNP	C	C	T			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chrX:49958245C>T	ENST00000376056.2	-	5	1242	c.1092G>A	c.(1090-1092)agG>agA	p.R364R	AKAP4_ENST00000358526.2_Silent_p.R373R|AKAP4_ENST00000376064.3_Silent_p.R364R|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Intron					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					CCTTGGTGTGCCTTAGCAACA	0.473																																						dbGAP											0													65.0	55.0	59.0					X																	49958245		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.1092G>A	X.37:g.49958245C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.R373	ENST00000376056.2	37	c.1119	CCDS14330.1	X																																																																																			AKAP4	-	pfam_AKAP_110_C,smart_AKAP_110	ENSG00000147081		0.473	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	HGNC	protein_coding	OTTHUMT00000056552.1	44	0.00	0	C	NM_003886		49958245	49958245	-1	no_errors	ENST00000358526	ensembl	human	known	69_37n	silent	45	16.67	9	SNP	0.674	T
ARHGEF10L	55160	genome.wustl.edu	37	1	17949512	17949512	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr1:17949512G>A	ENST00000361221.3	+	12	1201	c.1042G>A	c.(1042-1044)Gag>Aag	p.E348K	ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.E348K|ARHGEF10L_ENST00000375420.3_Missense_Mutation_p.E106K|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000167825.4_Missense_Mutation_p.E126K|ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.E309K|ARHGEF10L_ENST00000375408.3_Missense_Mutation_p.E126K|ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.E309K	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	348	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CCCCCTGATGGAGATGGAGCC	0.667																																						dbGAP											0													55.0	51.0	52.0					1																	17949512		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.1042G>A	1.37:g.17949512G>A	ENSP00000355060:p.Glu348Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,smart_DH-domain,pfscan_DH-domain	p.E348K	ENST00000361221.3	37	c.1042	CCDS182.1	1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.355212	0.82243	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375420;ENST00000375408;ENST00000457829;ENST00000167825	T;T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08;-0.08	4.58	4.58	0.56647	Dbl homology (DH) domain (5);	0.199706	0.42053	D	0.000767	T	0.71962	0.3402	L	0.43923	1.385	0.58432	D	0.999998	D;P;D;P;P;D;D;D	0.76494	0.999;0.925;0.999;0.718;0.91;0.958;0.993;0.995	D;P;D;B;P;P;D;D	0.71656	0.974;0.85;0.961;0.366;0.728;0.793;0.932;0.959	T	0.74087	-0.3778	10	0.52906	T	0.07	-22.4224	15.9348	0.79694	0.0:0.0:1.0:0.0	.	126;106;348;126;114;309;309;348	Q5VXI4;B4DTE2;Q9HCE6-5;Q9HCE6-4;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;.;ARGAL_HUMAN	K	348;309;348;309;106;126;126;126	ENSP00000355060:E348K;ENSP00000399401:E309K;ENSP00000394621:E348K;ENSP00000364564:E309K;ENSP00000364569:E106K;ENSP00000364557:E126K;ENSP00000167825:E126K	ENSP00000167825:E126K	E	+	1	0	ARHGEF10L	17822099	1.000000	0.71417	1.000000	0.80357	0.508000	0.34012	9.207000	0.95064	2.085000	0.62840	0.491000	0.48974	GAG	ARHGEF10L	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000074964		0.667	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	ARHGEF10L	HGNC	protein_coding	OTTHUMT00000007147.1	18	0.00	0	G	NM_018125		17949512	17949512	+1	no_errors	ENST00000361221	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	A
ATAD5	79915	genome.wustl.edu	37	17	29214375	29214375	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr17:29214375C>G	ENST00000321990.4	+	19	4621	c.4243C>G	c.(4243-4245)Cca>Gca	p.P1415A		NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1415					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AGAAGAACGACCATTAACCCT	0.358																																						dbGAP											0													92.0	97.0	95.0					17																	29214375		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.4243C>G	17.37:g.29214375C>G	ENSP00000313171:p.Pro1415Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.P1415A	ENST00000321990.4	37	c.4243	CCDS11260.1	17	.	.	.	.	.	.	.	.	.	.	C	10.87	1.473579	0.26423	.	.	ENSG00000176208	ENST00000321990	T	0.17528	2.27	5.77	4.8	0.61643	.	0.391847	0.30556	N	0.009361	T	0.15782	0.0380	M	0.62723	1.935	0.32826	D	0.503424	P	0.36027	0.533	B	0.34873	0.191	T	0.06075	-1.0847	10	0.16896	T	0.51	.	8.2691	0.31833	0.1361:0.7353:0.0:0.1286	.	1415	Q96QE3	ATAD5_HUMAN	A	1415	ENSP00000313171:P1415A	ENSP00000313171:P1415A	P	+	1	0	ATAD5	26238501	0.002000	0.14202	1.000000	0.80357	0.675000	0.39556	0.092000	0.15066	2.744000	0.94065	0.454000	0.30748	CCA	ATAD5	-	NULL	ENSG00000176208		0.358	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD5	HGNC	protein_coding	OTTHUMT00000256206.2	66	0.00	0	C	NM_024857		29214375	29214375	+1	no_errors	ENST00000321990	ensembl	human	known	69_37n	missense	31	43.64	24	SNP	0.982	G
C5orf42	65250	genome.wustl.edu	37	5	37169187	37169187	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr5:37169187A>T	ENST00000508244.1	-	33	7032	c.6939T>A	c.(6937-6939)aaT>aaA	p.N2313K	C5orf42_ENST00000274258.7_Missense_Mutation_p.N1193K|C5orf42_ENST00000425232.2_Missense_Mutation_p.N2313K			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2313						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			AGTTCACATGATTAGGAATTT	0.368																																						dbGAP											0													144.0	148.0	147.0					5																	37169187		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.6939T>A	5.37:g.37169187A>T	ENSP00000421690:p.Asn2313Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	superfamily_Quino_amine_DH_bsu	p.N2313K	ENST00000508244.1	37	c.6939	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	a	3.365	-0.129724	0.06753	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.15017	2.46;2.46;2.52;2.5	5.43	-0.509	0.11977	.	0.517011	0.17077	N	0.187928	T	0.02533	0.0077	N	0.00237	-1.79	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42565	-0.9444	10	0.02654	T	1	.	5.6602	0.17664	0.1292:0.42:0.0:0.4508	.	2313;1193	E9PH94;Q9H799	.;CE042_HUMAN	K	2313;2313;1193;1361;1193	ENSP00000421690:N2313K;ENSP00000389014:N2313K;ENSP00000274258:N1193K;ENSP00000424223:N1361K	ENSP00000274258:N1193K	N	-	3	2	C5orf42	37204944	0.993000	0.37304	0.006000	0.13384	0.857000	0.48899	0.197000	0.17197	-0.126000	0.11682	-0.126000	0.14955	AAT	C5orf42	-	NULL	ENSG00000197603		0.368	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	159	0.00	0	A	NM_023073		37169187	37169187	-1	no_errors	ENST00000425232	ensembl	human	known	69_37n	missense	79	42.45	59	SNP	0.350	T
C5orf60	285679	genome.wustl.edu	37	5	179071958	179071958	+	Missense_Mutation	SNP	C	C	G	rs7731123	byFrequency	TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr5:179071958C>G	ENST00000448248.2	-	1	89	c.64G>C	c.(64-66)Gac>Cac	p.D22H	C5orf60_ENST00000506142.1_5'UTR	NM_001142306.1	NP_001135778.1	A6NFR6	CE060_HUMAN	chromosome 5 open reading frame 60	22						integral component of membrane (GO:0016021)				NS(1)|breast(1)|kidney(5)	7						ATAACACTGTCCAGAGGAAAG	0.522																																						dbGAP											0													66.0	64.0	65.0					5																	179071958		692	1591	2283	-	-	-	SO:0001583	missense	0			BC043435	CCDS47353.1	5q35.3	2010-08-19			ENSG00000204661	ENSG00000204661			27753	protein-coding gene	gene with protein product						12477932	Standard	NM_001142306		Approved		uc003mki.3	A6NFR6	OTTHUMG00000163221	ENST00000448248.2:c.64G>C	5.37:g.179071958C>G	ENSP00000404583:p.Asp22His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L488|B7ZM52|B7ZM53	Missense_Mutation	SNP	NULL	p.D22H	ENST00000448248.2	37	c.64	CCDS47353.1	5	.	.	.	.	.	.	.	.	.	.	c	3.367	-0.129222	0.06753	.	.	ENSG00000204661	ENST00000448248	T	0.25250	1.81	0.362	-0.723	0.11181	.	.	.	.	.	T	0.15912	0.0383	N	0.08118	0	0.80722	P	0.0	D;D	0.58268	0.982;0.982	P;P	0.50825	0.651;0.651	T	0.23404	-1.0189	7	0.46703	T	0.11	.	.	.	.	rs7731123;rs7731123	22;22	A6NFR6-2;A6NFR6-4	.;.	H	22	ENSP00000404583:D22H	ENSP00000404583:D22H	D	-	1	0	C5orf60	179004564	0.006000	0.16342	0.027000	0.17364	0.069000	0.16628	-0.549000	0.06041	-0.410000	0.07542	0.134000	0.15878	GAC	C5orf60	-	NULL	ENSG00000204661		0.522	C5orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf60	HGNC	protein_coding	OTTHUMT00000372148.2	17	0.00	0	C	NM_001142306		179071958	179071958	-1	no_errors	ENST00000448248	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	0.027	G
C9orf89	84270	genome.wustl.edu	37	9	95869982	95869982	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr9:95869982C>G	ENST00000375464.2	+	2	162	c.34C>G	c.(34-36)Cag>Gag	p.Q12E		NM_032310.3	NP_115686.3	Q96LW7	BINCA_HUMAN	chromosome 9 open reading frame 89	12	CARD.				negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	CARD domain binding (GO:0050700)			endometrium(1)|kidney(1)|lung(3)|ovary(1)|skin(1)	7						CCGCCTGGTGCAGGACACGCC	0.557																																						dbGAP											0													92.0	68.0	76.0					9																	95869982		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057716	CCDS6702.2	9q22.32	2012-03-16			ENSG00000165233	ENSG00000165233			28148	protein-coding gene	gene with protein product	"""Bcl10-interacting protein with CARD"""					12477932	Standard	XM_005252273		Approved	MGC11115, bA370F5.1, BinCARD	uc004atd.3	Q96LW7	OTTHUMG00000020243	ENST00000375464.2:c.34C>G	9.37:g.95869982C>G	ENSP00000364613:p.Gln12Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BJH8|Q9BSY2	Missense_Mutation	SNP	superfamily_DEATH-like	p.Q12E	ENST00000375464.2	37	c.34	CCDS6702.2	9	.	.	.	.	.	.	.	.	.	.	C	17.18	3.322703	0.60634	.	.	ENSG00000165233	ENST00000375464	.	.	.	5.16	5.16	0.70880	.	0.138464	0.49305	D	0.000148	T	0.63450	0.2512	.	.	.	0.31481	N	0.667209	D	0.54601	0.967	P	0.55391	0.775	T	0.67325	-0.5699	8	0.42905	T	0.14	.	16.516	0.84300	0.0:1.0:0.0:0.0	.	12	Q96LW7-2	.	E	12	.	ENSP00000364613:Q12E	Q	+	1	0	C9orf89	94909803	0.998000	0.40836	0.996000	0.52242	0.929000	0.56500	3.618000	0.54188	2.584000	0.87258	0.561000	0.74099	CAG	C9orf89	-	NULL	ENSG00000165233		0.557	C9orf89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf89	HGNC	protein_coding	OTTHUMT00000053128.1	28	0.00	0	C	NM_032310		95869982	95869982	+1	no_errors	ENST00000466409	ensembl	human	known	69_37n	missense	23	28.12	9	SNP	0.996	G
CDH1	999	genome.wustl.edu	37	16	68844245	68844245	+	Splice_Site	SNP	G	G	A			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr16:68844245G>A	ENST00000261769.5	+	6	1023		c.e6+1		CDH1_ENST00000422392.2_Splice_Site|CDH1_ENST00000562836.1_Splice_Site	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)						adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.G274_P277del(3)|p.?(3)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		GCTCTTCCAGGTATATCCACT	0.448			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	6	Unknown(3)|Deletion - In frame(3)	stomach(3)|breast(3)											87.0	88.0	88.0					16																	68844245		2198	4300	6498	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.832+1G>A	16.37:g.68844245G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Splice_Site	SNP	-	e6+1	ENST00000261769.5	37	c.832+1	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295896	0.81025	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5624	0.87910	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDH1	67401746	1.000000	0.71417	0.998000	0.56505	0.910000	0.53928	5.676000	0.68131	2.510000	0.84645	0.557000	0.71058	.	CDH1	-	-	ENSG00000039068		0.448	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	44	0.00	0	G	NM_004360	Intron	68844245	68844245	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	splice_site	11	54.17	13	SNP	1.000	A
CLEC12A	160364	genome.wustl.edu	37	12	10134707	10134707	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr12:10134707A>C	ENST00000304361.4	+	5	802	c.620A>C	c.(619-621)aAt>aCt	p.N207T	CLEC12A_ENST00000355690.4_Missense_Mutation_p.N217T|CLEC12A_ENST00000350667.4_Missense_Mutation_p.N174T|CLEC12A_ENST00000434319.2_Missense_Mutation_p.N207T	NM_138337.5|NM_201623.3	NP_612210.4|NP_963917.2	Q5QGZ9	CL12A_HUMAN	C-type lectin domain family 12, member A	207	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	16						AGAGTGGATAATATAATCAAC	0.368																																					Melanoma(197;1487 2125 16611 22221 34855)	dbGAP											0													86.0	86.0	86.0					12																	10134707		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY498550	CCDS8608.1, CCDS8609.1, CCDS55803.1, CCDS73442.1	12p13.31	2010-08-17			ENSG00000172322	ENSG00000172322		"""C-type lectin domain containing"""	31713	protein-coding gene	gene with protein product		612088					Standard	NM_201623		Approved	CLL-1, MICL	uc001qwq.3	Q5QGZ9		ENST00000304361.4:c.620A>C	12.37:g.10134707A>C	ENSP00000302804:p.Asn207Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA16|Q6P4H1|Q6RH77|Q6RH78|Q8TDQ6	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.N217T	ENST00000304361.4	37	c.650	CCDS8608.1	12	.	.	.	.	.	.	.	.	.	.	A	3.561	-0.089698	0.07053	.	.	ENSG00000172322	ENST00000355690;ENST00000304361;ENST00000434319;ENST00000350667	T;T;T;T	0.19105	2.17;2.17;3.84;2.17	3.9	-1.12	0.09808	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.14614	0.0353	L	0.38175	1.15	0.09310	N	1	B;B;B	0.26708	0.095;0.116;0.157	B;B;B	0.30251	0.069;0.113;0.069	T	0.32134	-0.9918	9	0.54805	T	0.06	.	3.8145	0.08809	0.4677:0.2:0.3323:0.0	.	174;207;217	Q5QGZ9-4;Q5QGZ9;Q5QGZ9-1	.;CL12A_HUMAN;.	T	217;207;207;174	ENSP00000347916:N217T;ENSP00000302804:N207T;ENSP00000405244:N207T;ENSP00000345448:N174T	ENSP00000302804:N207T	N	+	2	0	CLEC12A	10025974	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.628000	0.24522	-0.200000	0.10300	0.533000	0.62120	AAT	CLEC12A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000172322		0.368	CLEC12A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CLEC12A	HGNC	protein_coding	OTTHUMT00000399545.1	85	0.00	0	A	NM_138337		10134707	10134707	+1	no_errors	ENST00000355690	ensembl	human	known	69_37n	missense	42	22.22	12	SNP	0.000	C
CNTRL	11064	genome.wustl.edu	37	9	123917201	123917201	+	Intron	SNP	C	C	G			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr9:123917201C>G	ENST00000373855.1	+	27	4625				CNTRL_ENST00000373847.1_Intron|CNTRL_ENST00000373844.1_5'Flank|CNTRL_ENST00000238341.5_Intron|CNTRL_ENST00000373850.1_Intron|CNTRL_ENST00000373845.2_Intron			Q7Z7A1	CNTRL_HUMAN	centriolin						cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						GGTTTGTCTTCTTGTGGTTTG	0.483																																						dbGAP											0													204.0	181.0	189.0					9																	123917201		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.4365+10C>G	9.37:g.123917201C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	superfamily_tRNA-bd_arm	p.L128V	ENST00000373855.1	37	c.382	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	c	5.152	0.213616	0.09757	.	.	ENSG00000119397	ENST00000373845	.	.	.	4.84	-0.0323	0.13905	.	.	.	.	.	T	0.31199	0.0789	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.28870	-1.0030	4	.	.	.	.	6.9895	0.24748	0.0:0.287:0.3296:0.3834	.	.	.	.	V	128	.	.	L	+	1	0	CNTRL	122957022	0.000000	0.05858	0.003000	0.11579	0.048000	0.14542	-1.406000	0.02490	0.180000	0.19960	-0.778000	0.03378	CTT	CNTRL	-	NULL	ENSG00000119397		0.483	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	126	0.00	0	C	NM_007018		123917201	123917201	+1	no_errors	ENST00000373845	ensembl	human	known	69_37n	missense	140	16.17	27	SNP	0.001	G
DNAH9	1770	genome.wustl.edu	37	17	11650986	11650986	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr17:11650986G>A	ENST00000262442.4	+	32	6581	c.6513G>A	c.(6511-6513)atG>atA	p.M2171I	DNAH9_ENST00000454412.2_Missense_Mutation_p.M2171I	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2171	AAA 2. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ATCAGATCATGAAACGGCGCC	0.542																																						dbGAP											0													92.0	85.0	87.0					17																	11650986		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.6513G>A	17.37:g.11650986G>A	ENSP00000262442:p.Met2171Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.M2171I	ENST00000262442.4	37	c.6513	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	G	14.11	2.438329	0.43326	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.26223	1.79;1.75	4.5	4.5	0.54988	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.151050	0.56097	N	0.000023	T	0.28200	0.0696	L	0.52905	1.665	0.80722	D	1	B	0.16603	0.018	B	0.24006	0.05	T	0.06409	-1.0828	10	0.25106	T	0.35	.	17.416	0.87500	0.0:0.0:1.0:0.0	.	2171	Q9NYC9	DYH9_HUMAN	I	2171;2171;753	ENSP00000262442:M2171I;ENSP00000414874:M2171I	ENSP00000262442:M2171I	M	+	3	0	DNAH9	11591711	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.394000	0.79862	2.346000	0.79739	0.557000	0.71058	ATG	DNAH9	-	pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	ENSG00000007174		0.542	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	62	0.00	0	G	NM_001372		11650986	11650986	+1	no_errors	ENST00000262442	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	1.000	A
DTX2	113878	genome.wustl.edu	37	7	76111950	76111950	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr7:76111950C>G	ENST00000324432.5	+	5	904	c.394C>G	c.(394-396)Ctg>Gtg	p.L132V	DTX2_ENST00000430490.2_Missense_Mutation_p.L132V|DTX2_ENST00000446600.1_Missense_Mutation_p.L41V|DTX2_ENST00000446820.2_Missense_Mutation_p.L132V|DTX2_ENST00000413936.2_Missense_Mutation_p.L132V|DTX2_ENST00000307569.8_Missense_Mutation_p.L132V	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	132	WWE 2. {ECO:0000255|PROSITE- ProRule:PRU00248}.				Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						CTGTGACTATCTGGAGCAGCA	0.622																																						dbGAP											0													57.0	51.0	53.0					7																	76111950		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.394C>G	7.37:g.76111950C>G	ENSP00000322885:p.Leu132Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Missense_Mutation	SNP	pfam_WWE-dom,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.L132V	ENST00000324432.5	37	c.394	CCDS5587.1	7	.	.	.	.	.	.	.	.	.	.	.	14.33	2.503938	0.44558	.	.	ENSG00000091073	ENST00000324432;ENST00000307569;ENST00000541989;ENST00000446600;ENST00000413936;ENST00000423646;ENST00000430490;ENST00000446820	T;T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66;0.66	5.41	4.52	0.55395	WWE domain (2);WWE domain, subgroup (1);	0.000000	0.64402	D	0.000001	T	0.43700	0.1259	L	0.55103	1.725	0.48185	D	0.999606	B;B;B	0.22800	0.041;0.075;0.011	B;B;B	0.29716	0.106;0.081;0.086	T	0.34850	-0.9812	10	0.39692	T	0.17	-7.2114	9.2476	0.37536	0.0:0.8365:0.0:0.1635	.	41;132;132	F5GX89;Q86UW9-2;Q86UW9	.;.;DTX2_HUMAN	V	132;132;41;41;132;132;132;132	ENSP00000322885:L132V;ENSP00000305242:L132V;ENSP00000397648:L41V;ENSP00000390218:L132V;ENSP00000415838:L132V;ENSP00000411986:L132V;ENSP00000392545:L132V	ENSP00000305242:L132V	L	+	1	2	AC005522.1	75949886	0.443000	0.25641	0.999000	0.59377	0.883000	0.51084	0.996000	0.29719	1.295000	0.44724	0.561000	0.74099	CTG	DTX2	-	pfam_WWE-dom,smart_WWE-dom_subgr,pfscan_WWE-dom	ENSG00000091073		0.622	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DTX2	Clone_based_vega_gene	protein_coding	OTTHUMT00000253104.2	30	0.00	0	C			76111950	76111950	+1	no_errors	ENST00000324432	ensembl	human	known	69_37n	missense	8	57.89	11	SNP	0.998	G
EIF2D	1939	genome.wustl.edu	37	1	206769083	206769083	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr1:206769083C>G	ENST00000271764.2	-	13	1701	c.1493G>C	c.(1492-1494)aGa>aCa	p.R498T	EIF2D_ENST00000367114.3_Missense_Mutation_p.R374T|EIF2D_ENST00000472709.2_5'UTR	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	498	SUI1. {ECO:0000255|PROSITE- ProRule:PRU00200}.				formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						ATTAGACGCTCTTTGTGCTAG	0.408																																						dbGAP											0													171.0	158.0	162.0					1																	206769083		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.1493G>C	1.37:g.206769083C>G	ENSP00000271764:p.Arg498Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Missense_Mutation	SNP	pfam_TIF_SUI1,superfamily_TIF_SUI1,superfamily_SWIB_MDM2_domain,superfamily_PUA-like_domain,smart_PUA,pfscan_PUA,pfscan_TIF_SUI1	p.R498T	ENST00000271764.2	37	c.1493	CCDS1465.1	1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.899946	0.72754	.	.	ENSG00000143486	ENST00000367114;ENST00000271764	T;T	0.50813	0.73;0.73	5.82	2.93	0.34026	Translation initiation factor SUI1 (3);	0.127760	0.64402	D	0.000001	T	0.68449	0.3002	M	0.87758	2.905	0.58432	D	0.999997	P;D	0.69078	0.585;0.997	B;D	0.70487	0.399;0.969	T	0.70022	-0.4986	10	0.87932	D	0	-20.823	9.8634	0.41129	0.0:0.7769:0.0:0.2231	.	374;498	P41214-2;P41214	.;EIF2D_HUMAN	T	374;498	ENSP00000356081:R374T;ENSP00000271764:R498T	ENSP00000271764:R498T	R	-	2	0	EIF2D	204835706	1.000000	0.71417	0.987000	0.45799	0.965000	0.64279	3.698000	0.54771	0.362000	0.24319	0.655000	0.94253	AGA	EIF2D	-	pfam_TIF_SUI1,superfamily_TIF_SUI1,pfscan_TIF_SUI1	ENSG00000143486		0.408	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2D	HGNC	protein_coding	OTTHUMT00000088475.1	96	0.00	0	C	NM_006893		206769083	206769083	-1	no_errors	ENST00000271764	ensembl	human	known	69_37n	missense	36	73.53	100	SNP	1.000	G
EIF4H	7458	genome.wustl.edu	37	7	73609623	73609623	+	Silent	SNP	A	A	G			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr7:73609623A>G	ENST00000265753.8	+	7	871	c.732A>G	c.(730-732)caA>caG	p.Q244Q	EIF4H_ENST00000353999.6_Silent_p.Q224Q	NM_022170.1	NP_071496.1	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H	244					cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|sexual reproduction (GO:0019953)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|lung(2)|prostate(1)	4						AAGTCGTTCAAAAGGAGCAAG	0.607																																						dbGAP											0													38.0	35.0	36.0					7																	73609623		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5564.1, CCDS5565.1	7q11.23	2013-02-12	2006-11-27	2006-11-27	ENSG00000106682	ENSG00000106682		"""RNA binding motif (RRM) containing"""	12741	protein-coding gene	gene with protein product		603431	"""Williams-Beuren syndrome chromosome region 1"""	WBSCR1		9516461, 15078951	Standard	NM_022170		Approved	WSCR1, KIAA0038	uc003uad.1	Q15056	OTTHUMG00000023025	ENST00000265753.8:c.732A>G	7.37:g.73609623A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3R1|D3DXF6|D3DXF8	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Q244	ENST00000265753.8	37	c.732	CCDS5564.1	7																																																																																			EIF4H	-	NULL	ENSG00000106682		0.607	EIF4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4H	HGNC	protein_coding	OTTHUMT00000252375.2	41	0.00	0	A	NM_022170		73609623	73609623	+1	no_errors	ENST00000265753	ensembl	human	known	69_37n	silent	21	44.74	17	SNP	0.003	G
FLI1	2313	genome.wustl.edu	37	11	128642719	128642719	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr11:128642719A>G	ENST00000527786.2	+	4	917	c.428A>G	c.(427-429)gAg>gGg	p.E143G	FLI1_ENST00000281428.8_Missense_Mutation_p.E77G|FLI1_ENST00000534087.2_Missense_Mutation_p.E110G|FLI1_ENST00000525560.1_Intron|FLI1_ENST00000344954.6_Missense_Mutation_p.E110G	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	143	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		CAATGGCTGGAGTGGGCCATA	0.512			T	EWSR1	Ewing sarcoma																																	dbGAP		Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	0													193.0	197.0	195.0					11																	128642719		2111	4241	6352	-	-	-	SO:0001583	missense	0			M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.428A>G	11.37:g.128642719A>G	ENSP00000433488:p.Glu143Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pfscan_Ets,prints_Ets	p.E143G	ENST00000527786.2	37	c.428	CCDS44768.1	11	.	.	.	.	.	.	.	.	.	.	A	20.7	4.029147	0.75504	.	.	ENSG00000151702	ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	T;T;T;T	0.33865	1.39;1.39;1.39;1.39	4.55	4.55	0.56014	Sterile alpha motif/pointed domain (2);Pointed domain (3);	0.154798	0.56097	D	0.000024	T	0.42517	0.1206	L	0.58428	1.81	0.58432	D	0.999998	B;B	0.25272	0.122;0.048	B;B	0.36464	0.18;0.225	T	0.45381	-0.9265	10	0.66056	D	0.02	.	13.9614	0.64182	1.0:0.0:0.0:0.0	.	143;77	Q01543;Q01543-2	FLI1_HUMAN;.	G	110;143;110;77	ENSP00000339627:E110G;ENSP00000399985:E143G;ENSP00000432950:E110G;ENSP00000281428:E77G	ENSP00000281428:E77G	E	+	2	0	FLI1	128147929	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.265000	0.95647	1.695000	0.51148	0.456000	0.33151	GAG	FLI1	-	pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom	ENSG00000151702		0.512	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLI1	HGNC	protein_coding	OTTHUMT00000386226.2	53	0.00	0	A	NM_002017		128642719	128642719	+1	no_errors	ENST00000429175	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	G
FRG1B	284802	genome.wustl.edu	37	20	29612363	29612363	+	Intron	SNP	G	G	C	rs75773727	byFrequency	TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr20:29612363G>C	ENST00000278882.3	+	1	257				FRG1B_ENST00000439954.2_Intron|FRG1B_ENST00000468180.2_Intron|FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CCACGAGTTTGGGTCCCCTGA	0.562																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-124+250G>C	20.37:g.29612363G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	C4AME5	RNA	SNP	-	NULL	ENST00000278882.3	37	NULL		20																																																																																			FRG1B	-	-	ENSG00000149531		0.562	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	8	0.00	0	G	NR_003579		29612363	29612363	+1	no_errors	ENST00000482423	ensembl	human	known	69_37n	rna	4	50.00	4	SNP	0.000	C
GCC2	9648	genome.wustl.edu	37	2	109092242	109092242	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr2:109092242G>T	ENST00000309863.6	+	9	3710	c.2996G>T	c.(2995-2997)cGa>cTa	p.R999L		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	999					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						GAATCTCTTCGATCAGAAAAG	0.313																																						dbGAP											0													49.0	54.0	52.0					2																	109092242		2203	4297	6500	-	-	-	SO:0001583	missense	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.2996G>T	2.37:g.109092242G>T	ENSP00000307939:p.Arg999Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,smart_GRIP,pfscan_GRIP	p.R999L	ENST00000309863.6	37	c.2996	CCDS33268.1	2	.	.	.	.	.	.	.	.	.	.	G	10.53	1.376716	0.24857	.	.	ENSG00000135968	ENST00000309863	T	0.32988	1.43	5.69	-1.19	0.09585	.	0.663499	0.14309	N	0.327805	T	0.24236	0.0587	M	0.62723	1.935	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.22487	-1.0215	10	0.27082	T	0.32	.	5.5844	0.17267	0.3283:0.0:0.4622:0.2095	.	999	Q8IWJ2	GCC2_HUMAN	L	999	ENSP00000307939:R999L	ENSP00000307939:R999L	R	+	2	0	GCC2	108458674	0.001000	0.12720	0.000000	0.03702	0.577000	0.36160	-0.008000	0.12788	-0.072000	0.12864	-0.152000	0.13540	CGA	GCC2	-	NULL	ENSG00000135968		0.313	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	HGNC	protein_coding	OTTHUMT00000358516.3	20	0.00	0	G	NM_014635		109092242	109092242	+1	no_errors	ENST00000309863	ensembl	human	known	69_37n	missense	10	44.44	8	SNP	0.000	T
GNS	2799	genome.wustl.edu	37	12	65133264	65133264	+	Silent	SNP	G	G	A			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr12:65133264G>A	ENST00000258145.3	-	8	1061	c.891C>T	c.(889-891)ctC>ctT	p.L297L	GNS_ENST00000543646.1_Silent_p.L329L|GNS_ENST00000542058.1_Silent_p.L277L|GNS_ENST00000418919.2_Silent_p.L241L	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	297					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		CATCAACTGAGAGGAGAGTTT	0.443																																						dbGAP											0													133.0	117.0	123.0					12																	65133264		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.891C>T	12.37:g.65133264G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYH8|Q53F05	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.L117F	ENST00000258145.3	37	c.349	CCDS8970.1	12	.	.	.	.	.	.	.	.	.	.	G	8.291	0.817762	0.16607	.	.	ENSG00000135677	ENST00000540196	D	0.98717	-5.09	5.34	-0.839	0.10759	.	0.000000	0.85682	D	0.000000	D	0.97614	0.9218	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.94496	0.7705	6	.	.	.	-17.8766	9.5746	0.39450	0.0746:0.6465:0.1844:0.0945	.	.	.	.	F	117	ENSP00000437782:L117F	.	L	-	1	0	GNS	63419531	0.994000	0.37717	0.976000	0.42696	0.868000	0.49771	0.401000	0.20948	0.026000	0.15269	0.650000	0.86243	CTC	GNS	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000135677		0.443	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GNS	HGNC	protein_coding	OTTHUMT00000401195.2	85	0.00	0	G			65133264	65133264	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000540196	ensembl	human	novel	69_37n	missense	68	37.61	41	SNP	0.998	A
GRIK2	2898	genome.wustl.edu	37	6	102376327	102376327	+	Silent	SNP	A	A	C			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr6:102376327A>C	ENST00000421544.1	+	13	2395	c.1905A>C	c.(1903-1905)atA>atC	p.I635I	GRIK2_ENST00000318991.6_Silent_p.I635I|GRIK2_ENST00000413795.1_Silent_p.I635I|GRIK2_ENST00000369138.1_Silent_p.I635I|GRIK2_ENST00000369134.4_Silent_p.I586I|GRIK2_ENST00000369137.3_Silent_p.I559I	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	635					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CCACCAGGATAGTGGGAGGCA	0.443																																						dbGAP											0													149.0	129.0	136.0					6																	102376327		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.1905A>C	6.37:g.102376327A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.I635	ENST00000421544.1	37	c.1905	CCDS5048.1	6																																																																																			GRIK2	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	ENSG00000164418		0.443	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	HGNC	protein_coding	OTTHUMT00000043718.1	139	0.00	0	A			102376327	102376327	+1	no_errors	ENST00000421544	ensembl	human	known	69_37n	silent	74	26.00	26	SNP	1.000	C
IGHA1	3493	genome.wustl.edu	37	14	106173790	106173790	+	RNA	SNP	A	A	G	rs17349690	byFrequency	TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr14:106173790A>G	ENST00000390547.2	-	0	776				AL928768.3_ENST00000497872.2_lincRNA			P01876	IGHA1_HUMAN	immunoglobulin heavy constant alpha 1						antibacterial humoral response (GO:0019731)|glomerular filtration (GO:0003094)|immune response (GO:0006955)|positive regulation of respiratory burst (GO:0060267)|protein-chromophore linkage (GO:0018298)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|monomeric IgA immunoglobulin complex (GO:0071748)|secretory dimeric IgA immunoglobulin complex (GO:0071752)|secretory IgA immunoglobulin complex (GO:0071751)	antigen binding (GO:0003823)										GAACCAGCACATCCTTGGGGC	0.697																																						dbGAP											0													34.0	48.0	44.0					14																	106173790		2137	4250	6387	-	-	-			0			J00220		14q32.33	2012-10-02			ENSG00000211895	ENSG00000211895		"""Immunoglobulins / IGH locus"""	5478	other	immunoglobulin gene		146900					Standard	NG_001019		Approved			P01876	OTTHUMG00000152494		14.37:g.106173790A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.D259	ENST00000390547.2	37	c.777		14																																																																																			IGHA1	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000211895		0.697	IGHA1-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHA1	HGNC	IG_C_gene	OTTHUMT00000326459.1	10	0.00	0	A	NG_001019		106173790	106173790	-1	no_start_codon	ENST00000390547	ensembl	human	known	69_37n	silent	27	43.75	21	SNP	0.000	G
LMNA	4000	genome.wustl.edu	37	1	156104249	156104249	+	Missense_Mutation	SNP	G	G	A	rs267607571		TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr1:156104249G>A	ENST00000368300.4	+	3	781	c.569G>A	c.(568-570)cGg>cAg	p.R190Q	LMNA_ENST00000347559.2_Missense_Mutation_p.R190Q|LMNA_ENST00000448611.2_Missense_Mutation_p.R78Q|LMNA_ENST00000392353.3_Missense_Mutation_p.R109Q|LMNA_ENST00000368297.1_Missense_Mutation_p.R109Q|LMNA_ENST00000368301.2_Missense_Mutation_p.R190Q|LMNA_ENST00000361308.4_Missense_Mutation_p.R190Q|LMNA_ENST00000368299.3_Missense_Mutation_p.R190Q|LMNA_ENST00000473598.2_Missense_Mutation_p.R91Q	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	190	Coil 1B.|Rod.		R -> Q (in EDMD2 and CMD1A; aberrant localization with decreased nuclear rim staining and increased formation of intranuclear foci). {ECO:0000269|PubMed:15744034, ECO:0000269|PubMed:20160190}.|R -> RR (in EDMD2). {ECO:0000269|PubMed:20848652}.|R -> W (in CMD1A; dbSNP:rs59026483). {ECO:0000269|PubMed:11897440, ECO:0000269|PubMed:15219508, ECO:0000269|PubMed:16061563}.		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					ATGCTGCGGCGGGTGGATGCT	0.557									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																													dbGAP											0			GRCh37	CM050658	LMNA	M							69.0	65.0	67.0					1																	156104249		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.569G>A	1.37:g.156104249G>A	ENSP00000357283:p.Arg190Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Missense_Mutation	SNP	pfam_F,pfam_Lamin_tail_dom,superfamily_Prefoldin	p.R190Q	ENST00000368300.4	37	c.569	CCDS1129.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.764865	0.96906	.	.	ENSG00000160789	ENST00000368301;ENST00000347559;ENST00000361308;ENST00000368300;ENST00000368299;ENST00000292302;ENST00000392355;ENST00000448611;ENST00000368297;ENST00000504687;ENST00000473598;ENST00000392353	D;D;D;D;D;D;D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83;-2.83;-2.83;-2.83;-2.83;-2.83;-2.83	5.44	5.44	0.79542	Filament (1);	0.000000	0.51477	D	0.000090	D	0.95313	0.8479	M	0.85542	2.76	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.992;0.998;0.995;0.995;0.998;0.992;0.997	D	0.95759	0.8799	10	0.87932	D	0	.	16.7575	0.85503	0.0:0.0:1.0:0.0	.	78;190;91;109;190;190;190	E7EUI9;Q6UYC3;D6RAQ3;Q5TCI8;P02545;P02545-3;P02545-2	.;.;.;.;LMNA_HUMAN;.;.	Q	190;190;190;190;190;190;190;78;109;107;91;109	ENSP00000357284:R190Q;ENSP00000292304:R190Q;ENSP00000355292:R190Q;ENSP00000357283:R190Q;ENSP00000357282:R190Q;ENSP00000395597:R78Q;ENSP00000357280:R109Q;ENSP00000426535:R107Q;ENSP00000421821:R91Q;ENSP00000376164:R109Q	ENSP00000292302:R190Q	R	+	2	0	LMNA	154370873	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.783000	0.99037	2.546000	0.85860	0.462000	0.41574	CGG	LMNA	-	pfam_F	ENSG00000160789		0.557	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMNA	HGNC	protein_coding	OTTHUMT00000039200.2	60	0.00	0	G	NM_170707		156104249	156104249	+1	no_errors	ENST00000368300	ensembl	human	known	69_37n	missense	65	19.51	16	SNP	1.000	A
LAMC1	3915	genome.wustl.edu	37	1	183093773	183093773	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr1:183093773A>C	ENST00000258341.4	+	14	2666	c.2409A>C	c.(2407-2409)agA>agC	p.R803S		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	803	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						CAGGTAAGAGATGTGAGCTCT	0.478																																						dbGAP											0													127.0	124.0	125.0					1																	183093773		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2409A>C	1.37:g.183093773A>C	ENSP00000258341:p.Arg803Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYE7	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.R803S	ENST00000258341.4	37	c.2409	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.959007	0.74016	.	.	ENSG00000135862	ENST00000258341	T	0.62105	0.05	5.51	-4.89	0.03103	EGF-like, laminin (4);	0.000000	0.85682	D	0.000000	T	0.68888	0.3050	M	0.63169	1.94	0.80722	D	1	D	0.76494	0.999	D	0.69307	0.963	T	0.70019	-0.4987	10	0.72032	D	0.01	.	11.327	0.49454	0.2123:0.2236:0.5641:0.0	.	803	P11047	LAMC1_HUMAN	S	803	ENSP00000258341:R803S	ENSP00000258341:R803S	R	+	3	2	LAMC1	181360396	0.978000	0.34361	0.809000	0.32408	0.975000	0.68041	0.216000	0.17585	-1.315000	0.02297	-0.256000	0.11100	AGA	LAMC1	-	pfam_EGF_laminin,smart_EGF-like,smart_EGF_laminin	ENSG00000135862		0.478	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	HGNC	protein_coding	OTTHUMT00000085954.2	81	0.00	0	A	NM_002293		183093773	183093773	+1	no_errors	ENST00000258341	ensembl	human	known	69_37n	missense	89	15.24	16	SNP	0.823	C
LAMB3	3914	genome.wustl.edu	37	1	209803184	209803184	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr1:209803184C>T	ENST00000356082.4	-	10	1164	c.1030G>A	c.(1030-1032)Gac>Aac	p.D344N	LAMB3_ENST00000367030.3_Missense_Mutation_p.D344N|LAMB3_ENST00000391911.1_Missense_Mutation_p.D344N	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	344	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		CGGCAATTGTCACACACACCT	0.582																																						dbGAP											0													102.0	100.0	101.0					1																	209803184		2203	4300	6503	-	-	-	SO:0001583	missense	0			D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.1030G>A	1.37:g.209803184C>T	ENSP00000348384:p.Asp344Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_EGF_laminin,pfscan_Laminin_N	p.D344N	ENST00000356082.4	37	c.1030	CCDS1487.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.660589	0.96734	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.61980	0.06;0.06;0.06	5.65	5.65	0.86999	EGF-like, laminin (4);	0.093849	0.64402	D	0.000001	T	0.78483	0.4290	M	0.68952	2.095	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.76610	-0.2896	10	0.42905	T	0.14	.	19.3748	0.94503	0.0:1.0:0.0:0.0	.	344	Q13751	LAMB3_HUMAN	N	344	ENSP00000375778:D344N;ENSP00000348384:D344N;ENSP00000355997:D344N	ENSP00000348384:D344N	D	-	1	0	LAMB3	207869807	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.113000	0.77095	2.682000	0.91365	0.644000	0.83932	GAC	LAMB3	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000196878		0.582	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB3	HGNC	protein_coding	OTTHUMT00000088525.2	52	0.00	0	C	NM_000228		209803184	209803184	-1	no_errors	ENST00000356082	ensembl	human	known	69_37n	missense	62	25.30	21	SNP	1.000	T
MUC12	10071	genome.wustl.edu	37	7	100636820	100636820	+	Silent	SNP	T	T	C	rs145616035	byFrequency	TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr7:100636820T>C	ENST00000379442.3	+	5	3405	c.3405T>C	c.(3403-3405)acT>acC	p.T1135T	MUC12_ENST00000536621.1_Silent_p.T992T			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1135	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GAGAATCTACTGCCTTCCAGA	0.582													N|||	138	0.0275559	0.025	0.0115	5008	,	,		8948	0.0268		0.0199	False		,,,				2504	0.0511					dbGAP											0													79.0	85.0	83.0					7																	100636820		537	1177	1714	-	-	-	SO:0001819	synonymous_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.3405T>C	7.37:g.100636820T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Silent	SNP	pfam_SEA	p.T1135	ENST00000379442.3	37	c.3405		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.582	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	73	0.00	0	T	XM_379904		100636820	100636820	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	silent	13	13.33	2	SNP	0.001	C
NUP210L	91181	genome.wustl.edu	37	1	153974380	153974380	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr1:153974380T>C	ENST00000368559.3	-	36	5083	c.5012A>G	c.(5011-5013)tAt>tGt	p.Y1671C	NUP210L_ENST00000271854.3_Intron|NUP210L_ENST00000368553.1_Intron	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1671					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			AGCCCACCCATAGACTGAGGT	0.468																																						dbGAP											0													83.0	85.0	84.0					1																	153974380		2016	4187	6203	-	-	-	SO:0001583	missense	0			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.5012A>G	1.37:g.153974380T>C	ENSP00000357547:p.Tyr1671Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.Y1671C	ENST00000368559.3	37	c.5012	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	T	18.03	3.531527	0.64972	.	.	ENSG00000143552	ENST00000368559	T	0.04862	3.54	4.77	4.77	0.60923	.	0.351382	0.24597	N	0.037175	T	0.09423	0.0232	M	0.63428	1.95	0.80722	D	1	D	0.71674	0.998	P	0.57324	0.818	T	0.04991	-1.0913	10	0.41790	T	0.15	-26.5324	11.7657	0.51928	0.0:0.0:0.0:1.0	.	1671	Q5VU65	P210L_HUMAN	C	1671	ENSP00000357547:Y1671C	ENSP00000357547:Y1671C	Y	-	2	0	NUP210L	152241004	0.423000	0.25482	0.902000	0.35471	0.994000	0.84299	1.906000	0.39887	1.989000	0.58080	0.454000	0.30748	TAT	NUP210L	-	NULL	ENSG00000143552		0.468	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3	69	0.00	0	T	NM_207308		153974380	153974380	-1	no_errors	ENST00000368559	ensembl	human	known	69_37n	missense	30	62.03	49	SNP	0.993	C
OR1B1	347169	genome.wustl.edu	37	9	125391118	125391118	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr9:125391118G>A	ENST00000304833.3	-	1	734	c.697C>T	c.(697-699)Cgt>Tgt	p.R233C	RP11-64P14.7_ENST00000419604.1_RNA|RP11-64P14.7_ENST00000431442.1_RNA	NM_001004450.1	NP_001004450.1	Q8NGR6	OR1B1_HUMAN	olfactory receptor, family 1, subfamily B, member 1	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)	16						GAAGGCAAACGTAGAATAGCG	0.532																																						dbGAP											0													73.0	71.0	71.0					9																	125391118		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC006313	CCDS35126.1	9q33.2	2012-08-09			ENSG00000171484	ENSG00000171484		"""GPCR / Class A : Olfactory receptors"""	8181	protein-coding gene	gene with protein product							Standard	NM_001004450		Approved	OR9-B	uc011lyz.2	Q8NGR6	OTTHUMG00000020616	ENST00000304833.3:c.697C>T	9.37:g.125391118G>A	ENSP00000303151:p.Arg233Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFN3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R233C	ENST00000304833.3	37	c.697	CCDS35126.1	9	.	.	.	.	.	.	.	.	.	.	g	14.00	2.404205	0.42613	.	.	ENSG00000171484	ENST00000304833	T	0.00267	8.38	4.72	3.81	0.43845	GPCR, rhodopsin-like superfamily (1);	0.331472	0.21813	N	0.068722	T	0.00524	0.0017	M	0.83603	2.65	0.09310	N	1	D	0.76494	0.999	D	0.71414	0.973	T	0.35475	-0.9787	10	0.87932	D	0	-2.5569	9.4091	0.38480	0.0:0.1573:0.68:0.1628	.	233	Q8NGR6	OR1B1_HUMAN	C	233	ENSP00000303151:R233C	ENSP00000303151:R233C	R	-	1	0	OR1B1	124430939	0.005000	0.15991	0.143000	0.22291	0.739000	0.42172	0.926000	0.28804	1.315000	0.45114	0.645000	0.84053	CGT	OR1B1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000171484		0.532	OR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1B1	HGNC	protein_coding	OTTHUMT00000053947.2	36	0.00	0	G	NM_001004450		125391118	125391118	-1	no_errors	ENST00000304833	ensembl	human	novel	69_37n	missense	18	21.74	5	SNP	0.001	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	54	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	13	70.45	31	SNP	1.000	G
PTPDC1	138639	genome.wustl.edu	37	9	96847676	96847676	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr9:96847676C>A	ENST00000375360.3	+	3	566	c.226C>A	c.(226-228)Caa>Aaa	p.Q76K	PTPDC1_ENST00000288976.3_Missense_Mutation_p.Q128K	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	76					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						TGAGCAGGAGCAAGCCATTAA	0.537																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.226C>A	9.37:g.96847676C>A	ENSP00000364509:p.Gln76Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase	p.Q76K	ENST00000375360.3	37	c.226	CCDS6707.1	9	.	.	.	.	.	.	.	.	.	.	.	22.5	4.302259	0.81136	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	T;T	0.69561	-0.41;-0.41	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.69975	0.3171	M	0.68952	2.095	0.58432	D	0.999995	P;P;P;P	0.41524	0.528;0.475;0.656;0.753	B;B;B;P	0.44561	0.243;0.348;0.235;0.453	T	0.67975	-0.5531	10	0.31617	T	0.26	-18.9773	16.933	0.86196	0.0:1.0:0.0:0.0	.	130;128;130;76	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	K	76;128	ENSP00000364509:Q76K;ENSP00000288976:Q128K	ENSP00000288976:Q128K	Q	+	1	0	PTPDC1	95887497	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	7.331000	0.79192	2.759000	0.94783	0.591000	0.81541	CAA	PTPDC1	-	NULL	ENSG00000158079		0.537	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPDC1	HGNC	protein_coding	OTTHUMT00000215007.1	36	0.00	0	C	NM_177995, NM_152422		96847676	96847676	+1	no_errors	ENST00000375360	ensembl	human	known	69_37n	missense	20	35.48	11	SNP	1.000	A
RBL1	5933	genome.wustl.edu	37	20	35661256	35661256	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr20:35661256T>G	ENST00000373664.3	-	16	2260	c.2194A>C	c.(2194-2196)Atc>Ctc	p.I732L	RBL1_ENST00000344359.3_Missense_Mutation_p.I732L	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	732	Pocket; binds T and E1A.|Spacer.				chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				ATCAGTGTGATCTCTCCAGCA	0.348																																						dbGAP											0													136.0	124.0	128.0					20																	35661256		2203	4300	6503	-	-	-	SO:0001583	missense	0			L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.2194A>C	20.37:g.35661256T>G	ENSP00000362768:p.Ile732Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Missense_Mutation	SNP	pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,pfam_Rb_C,superfamily_Cyclin-like,smart_Cyclin-like	p.I732L	ENST00000373664.3	37	c.2194	CCDS13289.1	20	.	.	.	.	.	.	.	.	.	.	T	18.51	3.638717	0.67130	.	.	ENSG00000080839	ENST00000373664;ENST00000344359	D;D	0.94417	-3.19;-3.42	5.3	5.3	0.74995	.	0.129591	0.51477	D	0.000084	D	0.91446	0.7300	L	0.34521	1.04	0.41197	D	0.986348	P;B	0.34615	0.459;0.076	B;B	0.37144	0.242;0.081	D	0.91559	0.5263	10	0.52906	T	0.07	-15.4331	15.4174	0.74980	0.0:0.0:0.0:1.0	.	732;732	P28749-2;P28749	.;RBL1_HUMAN	L	732	ENSP00000362768:I732L;ENSP00000343646:I732L	ENSP00000343646:I732L	I	-	1	0	RBL1	35094670	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	5.577000	0.67444	2.240000	0.73641	0.528000	0.53228	ATC	RBL1	-	NULL	ENSG00000080839		0.348	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBL1	HGNC	protein_coding	OTTHUMT00000079067.2	48	0.00	0	T	NM_002895		35661256	35661256	-1	no_errors	ENST00000373664	ensembl	human	known	69_37n	missense	41	14.58	7	SNP	1.000	G
SMARCA2	6595	genome.wustl.edu	37	9	2054717	2054717	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr9:2054717G>T	ENST00000382203.1	+	6	1376	c.1167G>T	c.(1165-1167)caG>caT	p.Q389H	SMARCA2_ENST00000349721.2_Missense_Mutation_p.Q389H|SMARCA2_ENST00000382194.1_Missense_Mutation_p.Q389H|SMARCA2_ENST00000357248.2_Missense_Mutation_p.Q389H			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	389					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		TCAATTTCCAGCGTCAGGTAA	0.383																																						dbGAP											0													92.0	94.0	93.0					9																	2054717		2203	4300	6503	-	-	-	SO:0001583	missense	0			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.1167G>T	9.37:g.2054717G>T	ENSP00000371638:p.Gln389His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_HSA,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.Q389H	ENST00000382203.1	37	c.1167	CCDS34977.1	9	.	.	.	.	.	.	.	.	.	.	G	17.71	3.457839	0.63401	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000450198;ENST00000382203;ENST00000382194	T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72	5.93	-9.77	0.00500	.	0.068480	0.64402	N	0.000012	T	0.44265	0.1285	M	0.82056	2.57	0.80722	D	1	B;B	0.12630	0.004;0.006	B;B	0.11329	0.006;0.004	T	0.29701	-1.0003	10	0.72032	D	0.01	-26.4942	16.9194	0.86160	0.1591:0.0:0.7651:0.0758	.	389;389	P51531-2;P51531	.;SMCA2_HUMAN	H	389	ENSP00000265773:Q389H;ENSP00000349788:Q389H;ENSP00000392081:Q389H;ENSP00000371638:Q389H;ENSP00000371629:Q389H	ENSP00000265773:Q389H	Q	+	3	2	SMARCA2	2044717	0.924000	0.31332	0.624000	0.29186	0.963000	0.63663	-0.015000	0.12634	-1.880000	0.01125	-0.293000	0.09583	CAG	SMARCA2	-	NULL	ENSG00000080503		0.383	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	HGNC	protein_coding	OTTHUMT00000051505.1	80	0.00	0	G	NM_003070		2054717	2054717	+1	no_errors	ENST00000349721	ensembl	human	known	69_37n	missense	41	46.05	35	SNP	0.888	T
TUBBP5	643224	genome.wustl.edu	37	9	141069844	141069844	+	RNA	SNP	T	T	C	rs62581042		TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr9:141069844T>C	ENST00000503395.1	+	0	1053									tubulin, beta pseudogene 5									p.A29A(1)									ATGAACATGCTATCGACTCCG	0.667																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)																																								-	-	-			0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141069844T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			TUBBP5	-	-	ENSG00000159247		0.667	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	HGNC	pseudogene	OTTHUMT00000373087.1	11	0.00	0	T	NR_027156		141069844	141069844	+1	no_errors	ENST00000290377	ensembl	human	known	69_37n	rna	12	29.41	5	SNP	0.991	C
ZIC2	7546	genome.wustl.edu	37	13	100635003	100635006	+	Frame_Shift_Del	DEL	GCGG	GCGG	-			TCGA-E2-A1L8-01A-11D-A13L-09	TCGA-E2-A1L8-10A-01D-A13O-09	GCGG	GCGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	04a7762f-2cbb-498b-ab4e-921406c1aec0	7931bb8b-3c42-4cee-b39b-86371aa369f6	g.chr13:100635003_100635006delGCGG	ENST00000376335.3	+	1	978_981	c.685_688delGCGG	c.(685-690)gcggccfs	p.AA229fs		NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	229	Necessary for interaction with MDFIC and transcriptional activation or repression. {ECO:0000250}.|Poly-Ala.				brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GGCAGCAGCCGCGGCccaccacca	0.623																																					Pancreas(97;119 1522 31925 44771 48764)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.685_688delGCGG	13.37:g.100635003_100635006delGCGG	ENSP00000365514:p.Ala229fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYA9|Q9H309	Frame_Shift_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A229fs	ENST00000376335.3	37	c.685_688	CCDS9495.1	13																																																																																			ZIC2	-	NULL	ENSG00000043355		0.623	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC2	HGNC	protein_coding	OTTHUMT00000045618.2	16	0.00	0	GCGG	NM_007129		100635003	100635006	+1	no_errors	ENST00000376335	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	1.000:1.000:1.000:1.000	-
