#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANKRD18DP	348840	genome.wustl.edu	37	3	197785786	197785786	+	RNA	SNP	C	C	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr3:197785786C>G	ENST00000435620.2	-	0	1512					NR_003291.1				ankyrin repeat domain 18D, pseudogene																		AGTTGAGAAACAGTAGAACTT	0.308																																						dbGAP											0																																										-	-	-			0			BC042518		3q29	2011-11-23			ENSG00000226435	ENSG00000226435			28016	pseudogene	pseudogene							Standard	NR_003291		Approved		uc003fyx.3		OTTHUMG00000150228		3.37:g.197785786C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000435620.2	37	NULL		3																																																																																			ANKRD18DP	-	-	ENSG00000226435		0.308	ANKRD18DP-001	KNOWN	basic	processed_transcript	ANKRD18DP	HGNC	pseudogene	OTTHUMT00000316910.2	9	0.00	0	C	NR_003291		197785786	197785786	-1	no_errors	ENST00000335478	ensembl	human	known	69_37n	rna	9	43.75	7	SNP	0.000	G
ANO4	121601	genome.wustl.edu	37	12	101436158	101436159	+	Missense_Mutation	DNP	TG	TG	CA			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T|G	T|G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr12:101436158_101436159TG>CA	ENST00000392977.3	+	12	1276_1277	c.1066_1067TG>CA	c.(1066-1068)TGg>CAg	p.W356Q	ANO4_ENST00000392979.3_Missense_Mutation_p.W321Q|ANO4_ENST00000299222.9_5'UTR			Q32M45	ANO4_HUMAN	anoctamin 4	356					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						CTGGTTGGGCTGGTACACCGGC	0.485										HNSCC(74;0.22)																												dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		Exception_encountered	12.37:g.101436158_101436159delinsCA	ENSP00000376703:p.Trp356Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation|Nonsense_Mutation	SNP	pfam_Anoctamin	p.W356R|p.W356*	ENST00000392977.3	37	c.1066|c.1067		12																																																																																			ANO4	-	pfam_Anoctamin	ENSG00000151572		0.485	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	53|54	0.00	0	T|G	NM_178826		101436158|101436159	101436158|101436159	+1	no_errors	ENST00000392977	ensembl	human	known	69_37n	missense|nonsense	90|91	29.46|29.77	38|39	SNP	1.000	C|A
ARID1A	8289	genome.wustl.edu	37	1	27087442	27087442	+	Silent	SNP	G	G	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr1:27087442G>A	ENST00000324856.7	+	5	2387	c.2016G>A	c.(2014-2016)gaG>gaA	p.E672E	ARID1A_ENST00000374152.2_Silent_p.E289E|RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000457599.2_Silent_p.E672E	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	672					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCCAAGGAGAGCAGAGTAATC	0.572			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	dbGAP		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0													142.0	143.0	143.0					1																	27087442		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2016G>A	1.37:g.27087442G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Silent	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.E672	ENST00000324856.7	37	c.2016	CCDS285.1	1																																																																																			ARID1A	-	NULL	ENSG00000117713		0.572	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	44	0.00	0	G	NM_139135		27087442	27087442	+1	no_errors	ENST00000324856	ensembl	human	known	69_37n	silent	42	31.15	19	SNP	1.000	A
ASMT	438	genome.wustl.edu	37	X	1743208	1743208	+	Silent	SNP	C	C	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chrX:1743208C>G	ENST00000381229.4	+	3	327	c.291C>G	c.(289-291)gtC>gtG	p.V97V	ASMT_ENST00000381233.3_Silent_p.V97V|ASMT_ENST00000381241.3_Silent_p.V97V			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase	97					cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	TGACCACGGTCAGCCCGACGT	0.577																																						dbGAP											0													172.0	158.0	163.0					X																	1743208		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.291C>G	X.37:g.1743208C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC33|Q16598|Q5JQ72|Q5JQ73	Silent	SNP	pfam_O_MeTrfase_2,pirsf_O-MeTrfase_CAOMT-type	p.V97	ENST00000381229.4	37	c.291		X																																																																																			ASMT	-	pfam_O_MeTrfase_2,pirsf_O-MeTrfase_CAOMT-type	ENSG00000196433		0.577	ASMT-002	KNOWN	basic|appris_principal	protein_coding	ASMT	HGNC	protein_coding	OTTHUMT00000055612.1	44	0.00	0	C	NM_004043		1743208	1743208	+1	no_errors	ENST00000381241	ensembl	human	known	69_37n	silent	39	31.58	18	SNP	0.119	G
ASNA1	439	genome.wustl.edu	37	19	12858838	12858838	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr19:12858838C>A	ENST00000591090.1	+	8	1069	c.967C>A	c.(967-969)Cat>Aat	p.H323N	ASNA1_ENST00000357332.3_Missense_Mutation_p.H323N					arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)											endometrium(1)|lung(6)|ovary(3)	10						GCTGTTACCCCATGAGGTGCG	0.632																																						dbGAP											0													91.0	85.0	87.0					19																	12858838		2203	4300	6503	-	-	-	SO:0001583	missense	0			U60276	CCDS32920.1	19p13.13	2010-08-05	2001-12-04			ENSG00000198356			752	protein-coding gene	gene with protein product	"""golgi to ER traffic 3 homolog (S. cerevisiae)"", ""transmembrane domain recognition complex, 40kDa"""	601913	"""arsA (bacterial) arsenite transporter, ATP-binding, homolog 1"""			8884272, 17382883	Standard	NM_004317		Approved	ARSA-I, GET3, TRC40	uc002muv.3	O43681		ENST00000591090.1:c.967C>A	19.37:g.12858838C>A	ENSP00000466379:p.His323Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Anion-transp_ATPase-like_dom,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,tigrfam_ATPase_ArsA/Get3	p.H323N	ENST00000591090.1	37	c.967	CCDS32920.1	19	.	.	.	.	.	.	.	.	.	.	C	14.53	2.561920	0.45590	.	.	ENSG00000198356	ENST00000357332	T	0.40756	1.02	4.23	4.23	0.50019	.	0.000000	0.85682	D	0.000000	T	0.26666	0.0652	N	0.12182	0.205	0.58432	D	0.999997	B;B	0.20459	0.045;0.004	B;B	0.16722	0.016;0.01	T	0.05683	-1.0870	10	0.27785	T	0.31	-15.428	15.725	0.77747	0.0:1.0:0.0:0.0	.	305;323	E7EVN0;O43681	.;ASNA_HUMAN	N	323	ENSP00000349887:H323N	ENSP00000349887:H323N	H	+	1	0	ASNA1	12719838	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	6.879000	0.75572	2.066000	0.61787	0.555000	0.69702	CAT	ASNA1	-	pfam_Anion-transp_ATPase-like_dom,tigrfam_ATPase_ArsA/Get3	ENSG00000198356		0.632	ASNA1-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ASNA1	HGNC	protein_coding	OTTHUMT00000450921.1	19	0.00	0	C	NM_004317		12858838	12858838	+1	no_errors	ENST00000357332	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	1.000	A
ATAD3B	83858	genome.wustl.edu	37	1	1431165	1431165	+	Missense_Mutation	SNP	C	C	T	rs9792879		TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr1:1431165C>T	ENST00000308647.7	+	16	2031	c.1915C>T	c.(1915-1917)Ccg>Tcg	p.P639S		NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	639						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)	p.P639S(1)		endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TGGCGGTCGGCCGTTCTGCCC	0.647																																						dbGAP											1	Substitution - Missense(1)	skin(1)											33.0	33.0	33.0					1																	1431165		2202	4300	6502	-	-	-	SO:0001583	missense	0			AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.1915C>T	1.37:g.1431165C>T	ENSP00000311766:p.Pro639Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Missense_Mutation	SNP	pfam_DUF3523,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.P639S	ENST00000308647.7	37	c.1915	CCDS30.1	1	476	0.21794871794871795	147	0.29878048780487804	60	0.16574585635359115	170	0.2972027972027972	99	0.13060686015831136	c	11.49	1.652810	0.29336	.	.	ENSG00000160072	ENST00000378737;ENST00000308647	D	0.93811	-3.29	1.39	0.415	0.16411	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.58432	P	8.000000000008E-6	B;B	0.22604	0.072;0.024	B;B	0.12156	0.007;0.002	T	0.11324	-1.0592	8	0.87932	D	0	.	3.748	0.08555	0.0:0.7411:0.0:0.2589	rs9792879	593;639	Q5T9A4-3;Q5T9A4	.;ATD3B_HUMAN	S	473;639	ENSP00000311766:P639S	ENSP00000311766:P639S	P	+	1	0	ATAD3B	1421028	0.034000	0.19679	0.001000	0.08648	0.022000	0.10575	0.000000	0.12993	0.145000	0.18977	0.194000	0.17425	CCG	ATAD3B	-	NULL	ENSG00000160072		0.647	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD3B	HGNC	protein_coding	OTTHUMT00000001369.2	18	0.00	0	C	NM_031921		1431165	1431165	+1	no_errors	ENST00000308647	ensembl	human	known	69_37n	missense	13	53.57	15	SNP	0.003	T
BMI1	648	genome.wustl.edu	37	10	22618336	22618336	+	Silent	SNP	T	T	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr10:22618336T>G	ENST00000376663.3	+	10	1351	c.846T>G	c.(844-846)ccT>ccG	p.P282P	RP11-573G6.9_ENST00000606988.1_lincRNA|COMMD3-BMI1_ENST00000602390.1_Silent_p.P425P	NM_005180.8	NP_005171.4	P35226	BMI1_HUMAN	BMI1 proto-oncogene, polycomb ring finger	282	Pro/Ser-rich.				chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|regulation of gene expression (GO:0010468)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|ubiquitin ligase complex (GO:0000151)	RING-like zinc finger domain binding (GO:0071535)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|urinary_tract(1)	12						TGCAGTCTCCTCATCCACAGT	0.502																																						dbGAP											0													166.0	151.0	156.0					10																	22618336		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC011652	CCDS7138.1	10p13	2014-06-26	2014-06-26	2006-04-26	ENSG00000168283	ENSG00000168283		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	1066	protein-coding gene	gene with protein product		164831	"""polycomb group ring finger 4"", ""B lymphoma Mo-MLV insertion region 1 homolog (mouse)"""	PCGF4		8268912	Standard	NM_005180		Approved	RNF51		P35226	OTTHUMG00000017807	ENST00000376663.3:c.846T>G	10.37:g.22618336T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16030|Q5T8Z3|Q96F37	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P282	ENST00000376663.3	37	c.846	CCDS7138.1	10																																																																																			BMI1	-	NULL	ENSG00000168283		0.502	BMI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMI1	HGNC	protein_coding	OTTHUMT00000047176.1	70	0.00	0	T	NM_005180		22618336	22618336	+1	no_errors	ENST00000376663	ensembl	human	known	69_37n	silent	72	28.71	29	SNP	1.000	G
C10orf62	414157	genome.wustl.edu	37	10	99349999	99349999	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr10:99349999A>T	ENST00000370640.3	+	1	550	c.345A>T	c.(343-345)aaA>aaT	p.K115N	PI4K2A_ENST00000370649.3_Intron|PI4K2A_ENST00000555577.1_Intron|HOGA1_ENST00000370647.4_Intron|HOGA1_ENST00000370646.4_Intron	NM_001009997.2	NP_001009997.2	Q5T681	CJ062_HUMAN	chromosome 10 open reading frame 62	115										endometrium(2)|kidney(1)|lung(1)	4		Colorectal(252;0.162)		Epithelial(162;9.58e-11)|all cancers(201;8.62e-09)		AGTCTGGAAAAGCCCCATCCA	0.627																																						dbGAP											0													45.0	48.0	47.0					10																	99349999		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31261.1	10q24.2	2012-05-31			ENSG00000203942	ENSG00000203942			23294	protein-coding gene	gene with protein product							Standard	NM_001009997		Approved	bA548K23.1	uc001koa.3	Q5T681	OTTHUMG00000018858	ENST00000370640.3:c.345A>T	10.37:g.99349999A>T	ENSP00000359674:p.Lys115Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49A70|Q8N3Y6	Missense_Mutation	SNP	NULL	p.K115N	ENST00000370640.3	37	c.345	CCDS31261.1	10	.	.	.	.	.	.	.	.	.	.	A	13.31	2.200400	0.38905	.	.	ENSG00000203942	ENST00000370640	T	0.60672	0.17	5.13	-1.21	0.09524	.	0.318910	0.21912	U	0.067294	T	0.49762	0.1576	L	0.27053	0.805	0.09310	N	1	D	0.55385	0.971	P	0.52957	0.714	T	0.50800	-0.8785	10	0.87932	D	0	-3.2997	9.6285	0.39765	0.391:0.0:0.609:0.0	.	115	Q5T681	CJ062_HUMAN	N	115	ENSP00000359674:K115N	ENSP00000359674:K115N	K	+	3	2	C10orf62	99339989	0.000000	0.05858	0.002000	0.10522	0.229000	0.25112	-0.114000	0.10757	0.006000	0.14734	0.523000	0.50628	AAA	C10orf62	-	NULL	ENSG00000203942		0.627	C10orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf62	HGNC	protein_coding	OTTHUMT00000049723.1	11	0.00	0	A	NM_001009997		99349999	99349999	+1	no_errors	ENST00000370640	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	0.001	T
C11orf40	143501	genome.wustl.edu	37	11	4594648	4594648	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr11:4594648C>G	ENST00000307616.1	-	2	195	c.196G>C	c.(196-198)Gat>Cat	p.D66H		NM_144663.1	NP_653264.1	Q8WZ69	CK040_HUMAN	chromosome 11 open reading frame 40	66										large_intestine(3)|lung(1)|ovary(2)|stomach(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;4.28e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		ATGAACACATCCTTATCTAAG	0.433																																						dbGAP											0													164.0	146.0	152.0					11																	4594648		2201	4298	6499	-	-	-	SO:0001583	missense	0				CCDS31354.1	11p15.5	2005-10-03			ENSG00000171987	ENSG00000171987			23986	protein-coding gene	gene with protein product							Standard	NM_144663		Approved	NOV1	uc010qyg.2	Q8WZ69	OTTHUMG00000165345	ENST00000307616.1:c.196G>C	11.37:g.4594648C>G	ENSP00000302918:p.Asp66His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.D66H	ENST00000307616.1	37	c.196	CCDS31354.1	11	.	.	.	.	.	.	.	.	.	.	C	5.540	0.284501	0.10513	.	.	ENSG00000171987	ENST00000307616	T	0.57107	0.42	1.49	-1.98	0.07480	.	.	.	.	.	T	0.30634	0.0771	N	0.08118	0	0.09310	N	1	D	0.58268	0.982	P	0.47603	0.551	T	0.17592	-1.0364	9	0.87932	D	0	.	1.9732	0.03410	0.2617:0.3567:0.0:0.3816	.	66	Q8WZ69	CK040_HUMAN	H	66	ENSP00000302918:D66H	ENSP00000302918:D66H	D	-	1	0	C11orf40	4551224	0.000000	0.05858	0.000000	0.03702	0.098000	0.18820	-1.399000	0.02506	-0.671000	0.05274	0.563000	0.77884	GAT	C11orf40	-	NULL	ENSG00000171987		0.433	C11orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf40	HGNC	protein_coding	OTTHUMT00000383529.1	58	0.00	0	C	NM_144663		4594648	4594648	-1	no_errors	ENST00000307616	ensembl	human	known	69_37n	missense	42	35.38	23	SNP	0.000	G
C17orf80	55028	genome.wustl.edu	37	17	71232434	71232434	+	Silent	SNP	A	A	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr17:71232434A>G	ENST00000535032.2	+	2	926	c.813A>G	c.(811-813)ccA>ccG	p.P271P	C17orf80_ENST00000359042.2_Silent_p.P271P|C17orf80_ENST00000582793.1_Intron|C17orf80_ENST00000577615.1_Silent_p.P271P|C17orf80_ENST00000255557.4_Silent_p.P271P|C17orf80_ENST00000268942.8_Silent_p.P271P|C17orf80_ENST00000426147.2_Silent_p.P271P|FAM104A_ENST00000583178.1_Intron			Q9BSJ5	CQ080_HUMAN	chromosome 17 open reading frame 80	271						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(2)|skin(2)|stomach(2)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(166;0.197)			CTGAGACTCCAGAAAAGAACA	0.413																																						dbGAP											0													44.0	45.0	45.0					17																	71232434		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY163812	CCDS11694.1, CCDS42377.1, CCDS45767.1, CCDS74145.1	17q25.1	2012-02-24	2012-02-24	2012-02-24	ENSG00000141219	ENSG00000141219			29601	protein-coding gene	gene with protein product	"""sperm-expressed protein 1"", ""migration-inducing protein 3"""					12477932	Standard	NM_017941		Approved	HLC-8, MIG3, FLJ20721, SPEP1	uc002jjl.4	Q9BSJ5		ENST00000535032.2:c.813A>G	17.37:g.71232434A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9X3|Q5JB45|Q6YAU3|Q9H0L9|Q9H5E6|Q9NWN5	Silent	SNP	NULL	p.P271	ENST00000535032.2	37	c.813	CCDS11694.1	17																																																																																			C17orf80	-	NULL	ENSG00000141219		0.413	C17orf80-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf80	HGNC	protein_coding	OTTHUMT00000441893.1	12	0.00	0	A	NM_017941		71232434	71232434	+1	no_errors	ENST00000359042	ensembl	human	known	69_37n	silent	25	32.43	12	SNP	0.000	G
C4orf51	646603	genome.wustl.edu	37	4	146601496	146601496	+	Silent	SNP	A	A	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr4:146601496A>G	ENST00000438731.1	+	1	141	c.141A>G	c.(139-141)acA>acG	p.T47T		NM_001080531.1	NP_001074000.1	C9J302	CD051_HUMAN	chromosome 4 open reading frame 51	47										haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)	6						CCGTGACAACATACACAGGCA	0.453																																						dbGAP											0													133.0	127.0	129.0					4																	146601496		1962	4152	6114	-	-	-	SO:0001819	synonymous_variant	0				CCDS47140.1	4q31.21	2009-09-09			ENSG00000237136	ENSG00000237136			37264	protein-coding gene	gene with protein product							Standard	NM_001080531		Approved		uc003ikk.3	C9J302	OTTHUMG00000161367	ENST00000438731.1:c.141A>G	4.37:g.146601496A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.H7R	ENST00000438731.1	37	c.20	CCDS47140.1	4	.	.	.	.	.	.	.	.	.	.	A	8.854	0.945313	0.18356	.	.	ENSG00000237136	ENST00000511965	.	.	.	6.02	-8.47	0.00939	.	.	.	.	.	T	0.35711	0.0941	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	T	0.40440	-0.9563	4	.	.	.	.	3.5069	0.07693	0.2556:0.4416:0.1997:0.1031	.	.	.	.	R	7	.	.	H	+	2	0	C4orf51	146820946	0.461000	0.25783	0.007000	0.13788	0.169000	0.22640	-0.793000	0.04589	-1.741000	0.01344	-0.250000	0.11733	CAT	C4orf51	-	NULL	ENSG00000237136		0.453	C4orf51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf51	HGNC	protein_coding		49	0.00	0	A	NM_001080531		146601496	146601496	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000511965	ensembl	human	known	69_37n	missense	53	39.08	34	SNP	0.314	G
CADPS	8618	genome.wustl.edu	37	3	62503858	62503858	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr3:62503858G>A	ENST00000383710.4	-	14	2708	c.2359C>T	c.(2359-2361)Cga>Tga	p.R787*	CADPS_ENST00000357948.3_Nonsense_Mutation_p.R770*|CADPS_ENST00000283269.9_Nonsense_Mutation_p.R787*	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	787					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.R787*(2)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		AGCAGAACTCGGAGCCTCTCT	0.418																																						dbGAP											2	Substitution - Nonsense(2)	large_intestine(2)											111.0	109.0	110.0					3																	62503858		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2359C>T	3.37:g.62503858G>A	ENSP00000373215:p.Arg787*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Nonsense_Mutation	SNP	pfam_Ca-dep_secretion_activator,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R787*	ENST00000383710.4	37	c.2359	CCDS46858.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.312583|10.312583	0.99381|0.99381	.|.	.|.	ENSG00000163618|ENSG00000163618	ENST00000491424|ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269	.|.	.|.	.|.	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.48447|.	0.1500|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.37361|.	-0.9709|.	4|.	.|0.02654	.|T	.|1	.|.	20.1708|20.1708	0.98159|0.98159	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|X	93|787;787;770;787	.|.	.|ENSP00000283269:R787X	P|R	-|-	2|1	0|2	CADPS|CADPS	62478898|62478898	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.945000|0.945000	0.59286|0.59286	8.009000|8.009000	0.88606|0.88606	2.761000|2.761000	0.94854|0.94854	0.655000|0.655000	0.94253|0.94253	CCG|CGA	CADPS	-	NULL	ENSG00000163618		0.418	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	HGNC	protein_coding	OTTHUMT00000351951.5	44	0.00	0	G	NM_003716, NM_183393, NM_183394		62503858	62503858	-1	no_errors	ENST00000383710	ensembl	human	known	69_37n	nonsense	44	33.33	22	SNP	1.000	A
CECR2	27443	genome.wustl.edu	37	22	17983949	17983950	+	Frame_Shift_Del	DEL	CG	CG	-	rs377480686|rs373535489		TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	CG	CG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr22:17983949_17983950delCG	ENST00000400585.2	+	7	720_721	c.282_283delCG	c.(280-285)accgagfs	p.E95fs	CECR2_ENST00000342247.5_Frame_Shift_Del_p.E216fs|CECR2_ENST00000400573.5_Frame_Shift_Del_p.E236fs|CECR2_ENST00000262608.8_Frame_Shift_Del_p.E217fs			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	258					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		GACAGGTCACCGAGAGTTTTCG	0.545																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.282_283delCG	22.37:g.17983949_17983950delCG	ENSP00000383428:p.Glu95fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Frame_Shift_Del	DEL	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.S237fs	ENST00000400585.2	37	c.705_706		22																																																																																			CECR2	-	NULL	ENSG00000099954		0.545	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2	26	0.00	0	CG	NM_031413		17983949	17983950	+1	no_errors	ENST00000400573	ensembl	human	novel	69_37n	frame_shift_del	38	33.87	21	DEL	0.002:1.000	-
COL6A5	256076	genome.wustl.edu	37	3	130110116	130110116	+	Silent	SNP	T	T	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr3:130110116T>G	ENST00000432398.2	+	7	3005	c.2511T>G	c.(2509-2511)acT>acG	p.T837T	COL6A5_ENST00000265379.6_Silent_p.T837T	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	837	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TTAACCTAACTATCCATTTGG	0.378																																						dbGAP											0													117.0	92.0	100.0					3																	130110116		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.2511T>G	3.37:g.130110116T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.T837	ENST00000432398.2	37	c.2511		3																																																																																			COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000172752		0.378	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		41	0.00	0	T	NM_153264		130110116	130110116	+1	no_errors	ENST00000265379	ensembl	human	known	69_37n	silent	37	26.00	13	SNP	0.000	G
CRNKL1	51340	genome.wustl.edu	37	20	20033061	20033061	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr20:20033061C>G	ENST00000377340.2	-	2	440	c.409G>C	c.(409-411)Gtt>Ctt	p.V137L	CRNKL1_ENST00000377327.4_Missense_Mutation_p.V125L|C20orf26_ENST00000377309.2_5'Flank|CRNKL1_ENST00000536226.1_5'UTR|C20orf26_ENST00000389656.3_5'Flank|C20orf26_ENST00000245957.5_5'Flank|C20orf26_ENST00000377306.1_5'Flank	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	137					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						CTCACCGAAACCACAAAGCTT	0.607																																						dbGAP											0													70.0	70.0	70.0					20																	20033061		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.409G>C	20.37:g.20033061C>G	ENSP00000366557:p.Val137Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Missense_Mutation	SNP	pfam_HAT,pfam_Suf,smart_HAT,pfscan_TPR-contain_dom	p.V137L	ENST00000377340.2	37	c.409	CCDS33446.1	20	.	.	.	.	.	.	.	.	.	.	C	10.06	1.246880	0.22796	.	.	ENSG00000101343	ENST00000377327;ENST00000377340	T;T	0.29397	1.57;1.57	5.27	-0.233	0.13078	.	4.887320	0.00934	N	0.002753	T	0.16085	0.0387	N	0.08118	0	0.20196	N	0.999922	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.24404	-1.0161	10	0.72032	D	0.01	13.7193	1.516	0.02506	0.2919:0.4035:0.1418:0.1628	.	125;137	Q5JY65;Q9BZJ0	.;CRNL1_HUMAN	L	125;137	ENSP00000366544:V125L;ENSP00000366557:V137L	ENSP00000366544:V125L	V	-	1	0	CRNKL1	19981061	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	1.244000	0.32778	-0.144000	0.11314	-1.045000	0.02358	GTT	CRNKL1	-	NULL	ENSG00000101343		0.607	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	CRNKL1	HGNC	protein_coding	OTTHUMT00000127787.1	22	0.00	0	C			20033061	20033061	-1	no_errors	ENST00000377340	ensembl	human	known	69_37n	missense	43	20.37	11	SNP	0.000	G
DDX41	51428	genome.wustl.edu	37	5	176942194	176942194	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr5:176942194G>C	ENST00000507955.1	-	7	1160	c.637C>G	c.(637-639)Ccc>Gcc	p.P213A	DDX41_ENST00000506965.1_5'UTR	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	213	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			CACATGGTGGGGATGCCCTGG	0.532																																						dbGAP											0													255.0	217.0	230.0					5																	176942194		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.637C>G	5.37:g.176942194G>C	ENSP00000422753:p.Pro213Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_Znf_CCHC,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.P213A	ENST00000507955.1	37	c.637	CCDS4427.1	5	.	.	.	.	.	.	.	.	.	.	G	29.5	5.012312	0.93346	.	.	ENSG00000183258	ENST00000330503;ENST00000507955	T;T	0.53206	0.63;0.63	5.53	5.53	0.82687	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.76948	0.4059	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82176	-0.0587	10	0.87932	D	0	-28.2262	19.4714	0.94965	0.0:0.0:1.0:0.0	.	213	Q9UJV9	DDX41_HUMAN	A	231;213	ENSP00000330349:P231A;ENSP00000422753:P213A	ENSP00000330349:P231A	P	-	1	0	DDX41	176874800	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	9.497000	0.97970	2.596000	0.87737	0.563000	0.77884	CCC	DDX41	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000183258		0.532	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX41	HGNC	protein_coding	OTTHUMT00000253432.2	70	0.00	0	G	NM_016222		176942194	176942194	-1	no_errors	ENST00000507955	ensembl	human	known	69_37n	missense	60	45.45	50	SNP	1.000	C
DEFB127	140850	genome.wustl.edu	37	20	139457	139457	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr20:139457G>A	ENST00000382388.3	+	2	167	c.92G>A	c.(91-93)gGa>gAa	p.G31E		NM_139074.3	NP_620713.1	Q9H1M4	DB127_HUMAN	defensin, beta 127	31			G -> R (in dbSNP:rs12624954). {ECO:0000269|PubMed:11854508}.		defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)	9		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			TATGTACAAGGACATTGCAGG	0.403																																						dbGAP											0													92.0	82.0	86.0					20																	139457		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358796	CCDS12991.1	20p13	2008-02-01	2002-05-09	2002-05-10	ENSG00000088782	ENSG00000088782		"""Defensins, beta"""	16206	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 73"""	C20orf73		11854508	Standard	NM_139074		Approved	bA530N10.2, DEF-27	uc002wcy.2	Q9H1M4	OTTHUMG00000031617	ENST00000382388.3:c.92G>A	20.37:g.139457G>A	ENSP00000371825:p.Gly31Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14DW7	Missense_Mutation	SNP	NULL	p.G31E	ENST00000382388.3	37	c.92	CCDS12991.1	20	.	.	.	.	.	.	.	.	.	.	G	10.54	1.379128	0.24944	.	.	ENSG00000088782	ENST00000382388	T	0.63417	-0.04	3.26	3.26	0.37387	.	0.000000	0.33834	N	0.004506	T	0.74718	0.3753	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63620	-0.6596	9	0.72032	D	0.01	-21.6232	10.2787	0.43526	0.0:0.0:1.0:0.0	.	31	Q9H1M4	DB127_HUMAN	E	31	ENSP00000371825:G31E	ENSP00000371825:G31E	G	+	2	0	DEFB127	87457	0.959000	0.32827	0.148000	0.22405	0.026000	0.11368	3.236000	0.51336	2.130000	0.65690	0.460000	0.39030	GGA	DEFB127	-	NULL	ENSG00000088782		0.403	DEFB127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB127	HGNC	protein_coding	OTTHUMT00000077429.1	27	0.00	0	G	NM_139074		139457	139457	+1	no_errors	ENST00000382388	ensembl	human	known	69_37n	missense	23	34.29	12	SNP	0.169	A
DEGS2	123099	genome.wustl.edu	37	14	100615659	100615659	+	Silent	SNP	G	G	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr14:100615659G>C	ENST00000305631.5	-	2	1046	c.471C>G	c.(469-471)gcC>gcG	p.A157A	DEGS2_ENST00000557117.1_5'UTR|DEGS2_ENST00000553834.1_Intron	NM_206918.2	NP_996801.2			delta(4)-desaturase, sphingolipid 2											breast(1)|lung(6)|skin(1)	8		Melanoma(154;0.212)				GCAGCTTGCGGGCGGGTGTGC	0.662																																						dbGAP											0													30.0	31.0	31.0					14																	100615659		2202	4297	6499	-	-	-	SO:0001819	synonymous_variant	0				CCDS9956.1	14q32.2	2013-09-02	2011-12-09	2004-12-14	ENSG00000168350	ENSG00000168350		"""Fatty acid desaturases"""	20113	protein-coding gene	gene with protein product	"""sphingolipid delta(4)-desaturase 2"", ""dihydroceramide desaturase 2"""	610862	"""chromosome 14 open reading frame 66"", ""degenerative spermatocyte homolog 2, lipid desaturase (Drosophila)"""	C14orf66			Standard	NM_206918		Approved	DES2, FADS8	uc001ygx.2	Q6QHC5	OTTHUMG00000171537	ENST00000305631.5:c.471C>G	14.37:g.100615659G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Fatty_acid_desaturase-1,pfam_Sphingolipid_d4-desaturase_N,pirsf_Sphingolipid_d4-desaturase	p.A157	ENST00000305631.5	37	c.471	CCDS9956.1	14																																																																																			DEGS2	-	pfam_Fatty_acid_desaturase-1,pirsf_Sphingolipid_d4-desaturase	ENSG00000168350		0.662	DEGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEGS2	HGNC	protein_coding	OTTHUMT00000414003.1	12	0.00	0	G	NM_206918		100615659	100615659	-1	no_errors	ENST00000305631	ensembl	human	known	69_37n	silent	8	38.46	5	SNP	0.997	C
DNAH1	25981	genome.wustl.edu	37	3	52423503	52423503	+	Silent	SNP	C	C	T			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr3:52423503C>T	ENST00000420323.2	+	60	9783	c.9522C>T	c.(9520-9522)gaC>gaT	p.D3174D		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3239					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGCTCTACGACAGCTGGGTCA	0.617																																						dbGAP											0													34.0	39.0	37.0					3																	52423503		2109	4232	6341	-	-	-	SO:0001819	synonymous_variant	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.9522C>T	3.37:g.52423503C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.D3174	ENST00000420323.2	37	c.9522	CCDS46842.1	3																																																																																			DNAH1	-	NULL	ENSG00000114841		0.617	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	13	0.00	0	C	NM_015512		52423503	52423503	+1	no_errors	ENST00000420323	ensembl	human	known	69_37n	silent	29	27.50	11	SNP	0.000	T
DNM1	1759	genome.wustl.edu	37	9	131004517	131004517	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr9:131004517C>T	ENST00000372923.3	+	15	1656	c.1564C>T	c.(1564-1566)Cgc>Tgc	p.R522C	DNM1_ENST00000393594.3_Missense_Mutation_p.R522C|DNM1_ENST00000475805.1_Missense_Mutation_p.R522C|DNM1_ENST00000486160.1_Missense_Mutation_p.R522C|MIR3154_ENST00000577829.1_RNA|DNM1_ENST00000493925.1_3'UTR|DNM1_ENST00000341179.7_Missense_Mutation_p.R522C|MIR199B_ENST00000384849.1_RNA	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	522	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						CCAGGTCATCCGCAAGGGCTG	0.567																																					GBM(113;146 1575 2722 28670 29921)	dbGAP											0													61.0	52.0	55.0					9																	131004517		2202	4300	6502	-	-	-	SO:0001583	missense	0			L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1564C>T	9.37:g.131004517C>T	ENSP00000362014:p.Arg522Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin	p.R522C	ENST00000372923.3	37	c.1564	CCDS6895.1	9	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659201	0.67586	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393589;ENST00000393594;ENST00000486160;ENST00000543158	T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04	4.51	4.51	0.55191	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	D	0.000001	D	0.89266	0.6666	M	0.88377	2.95	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69654	0.965;0.94	D	0.91266	0.5040	10	0.66056	D	0.02	-6.6718	16.7262	0.85422	0.0:1.0:0.0:0.0	.	522;522	Q05193;Q05193-3	DYN1_HUMAN;.	C	522;522;522;517;522;522;67	ENSP00000419225:R522C;ENSP00000345680:R522C;ENSP00000362014:R522C;ENSP00000377219:R522C;ENSP00000420045:R522C	ENSP00000345680:R522C	R	+	1	0	DNM1	130044338	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	4.539000	0.60657	2.490000	0.84030	0.467000	0.42956	CGC	DNM1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000106976		0.567	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNM1	HGNC	protein_coding	OTTHUMT00000054367.1	31	0.00	0	C	NM_004408		131004517	131004517	+1	no_errors	ENST00000372923	ensembl	human	known	69_37n	missense	56	37.78	34	SNP	1.000	T
UPK3B	80761	genome.wustl.edu	37	7	76631515	76631515	+	Intron	SNP	G	G	A	rs61737189	byFrequency	TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr7:76631515G>A	ENST00000419923.2	+	6	1408				UPK3B_ENST00000443097.2_Intron|DTX2P1-UPK3BP1-PMS2P11_ENST00000584900.1_RNA			Q9BT76	UPK3B_HUMAN	uroplakin 3B						negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A7A(1)		breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				TGTCCGCAGCGTCTGGATACA	0.617																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)																																								-	-	-	SO:0001627	intron_variant	0			BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000419923.2:c.961-16626G>A	7.37:g.76631515G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	RNA	SNP	-	NULL	ENST00000419923.2	37	NULL	CCDS5588.1	7																																																																																			DTX2P1-UPK3BP1-PMS2P11	-	-	ENSG00000265479		0.617	UPK3B-201	KNOWN	basic|CCDS	protein_coding	DTX2P1-UPK3BP1-PMS2P11	HGNC	protein_coding		20	0.00	0	G	NM_030570		76631515	76631515	+1	no_errors	ENST00000579700	ensembl	human	known	69_37n	rna	23	30.30	10	SNP	0.111	A
EXOC3L1	283849	genome.wustl.edu	37	16	67222677	67222677	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr16:67222677G>A	ENST00000314586.6	-	4	614	c.374C>T	c.(373-375)gCc>gTc	p.A125V	EXOC3L1_ENST00000562887.1_Intron	NM_178516.3	NP_848611.2	Q86VI1	EX3L1_HUMAN	exocyst complex component 3-like 1	125	Mediates interaction with EXOC2, EXOC4 and EXOC5. {ECO:0000250}.				exocytosis (GO:0006887)|peptide hormone secretion (GO:0030072)	exocyst (GO:0000145)|secretory granule (GO:0030141)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	21						CTTGTGCTGGGCAACCCGCTC	0.667																																						dbGAP											0													44.0	46.0	45.0					16																	67222677		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK092858	CCDS10832.1	16q22.1	2011-01-31	2011-01-31	2011-01-31	ENSG00000179044	ENSG00000179044			27540	protein-coding gene	gene with protein product		614117	"""exocyst complex component 3-like"""	EXOC3L		12477932	Standard	NM_178516		Approved	FLJ35539, FLJ35587	uc002erx.1	Q86VI1	OTTHUMG00000137508	ENST00000314586.6:c.374C>T	16.37:g.67222677G>A	ENSP00000325674:p.Ala125Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7I9|Q8NAD2|Q8TEN2	Missense_Mutation	SNP	pfam_Sec6	p.A125V	ENST00000314586.6	37	c.374	CCDS10832.1	16	.	.	.	.	.	.	.	.	.	.	G	0.862	-0.734973	0.03111	.	.	ENSG00000179044	ENST00000314586	T	0.07216	3.21	5.71	-0.262	0.12958	.	0.629630	0.16482	N	0.212491	T	0.03178	0.0093	N	0.05124	-0.11	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42882	-0.9425	10	0.26408	T	0.33	0.0187	5.1079	0.14794	0.3666:0.0:0.4535:0.1799	.	125	Q86VI1	EX3L1_HUMAN	V	125	ENSP00000325674:A125V	ENSP00000325674:A125V	A	-	2	0	EXOC3L1	65780178	0.000000	0.05858	0.018000	0.16275	0.570000	0.35934	-0.172000	0.09868	0.049000	0.15920	0.655000	0.94253	GCC	EXOC3L1	-	NULL	ENSG00000179044		0.667	EXOC3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3L1	HGNC	protein_coding	OTTHUMT00000268827.2	14	0.00	0	G	NM_178516		67222677	67222677	-1	no_errors	ENST00000314586	ensembl	human	known	69_37n	missense	13	45.83	11	SNP	0.002	A
EYA2	2139	genome.wustl.edu	37	20	45702958	45702958	+	Silent	SNP	T	T	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr20:45702958T>C	ENST00000327619.5	+	7	1019	c.645T>C	c.(643-645)agT>agC	p.S215S	EYA2_ENST00000357410.3_Silent_p.S215S|EYA2_ENST00000317304.6_Silent_p.S215S	NM_005244.4	NP_005235.3	O00167	EYA2_HUMAN	EYA transcriptional coactivator and phosphatase 2	215					DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|histone dephosphorylation (GO:0016576)|mesodermal cell fate specification (GO:0007501)|mitochondrial outer membrane permeabilization (GO:0097345)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of transcription, DNA-templated (GO:0006355)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0241)				CCAACCAGAGTTCCGAGTCAC	0.602																																					Pancreas(120;56 1725 18501 25218 43520)	dbGAP											0													122.0	106.0	112.0					20																	45702958		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13403.1, CCDS54471.1	20q13.1	2014-06-19	2014-06-19		ENSG00000064655	ENSG00000064655		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3520	protein-coding gene	gene with protein product		601654	"""eyes absent (Drosophila) homolog 2"", ""eyes absent homolog 2 (Drosophila)"""			9020840	Standard	NM_005244		Approved	EAB1	uc002xsm.3	O00167	OTTHUMG00000033041	ENST00000327619.5:c.645T>C	20.37:g.45702958T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSW8|Q86U84|Q96CV6|Q96H97|Q99503|Q99812|Q9BWF6|Q9H4S3|Q9H4S9|Q9NPZ4|Q9UIX7	Missense_Mutation	SNP	NULL	p.V191A	ENST00000327619.5	37	c.572	CCDS13403.1	20																																																																																			EYA2	-	NULL	ENSG00000064655		0.602	EYA2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EYA2	HGNC	protein_coding	OTTHUMT00000080326.2	28	0.00	0	T	NM_005244		45702958	45702958	+1	no_errors	ENST00000497062	ensembl	human	known	69_37n	missense	52	20.00	13	SNP	1.000	C
FAM200B	285550	genome.wustl.edu	37	4	15690255	15690255	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr4:15690255T>A	ENST00000422728.2	+	2	2493	c.1655T>A	c.(1654-1656)cTa>cAa	p.L552Q	FAM200B_ENST00000504137.1_3'UTR	NM_001145191.1	NP_001138663.1	P0CF97	F200B_HUMAN	family with sequence similarity 200, member B	552							nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						ataattgagctaaacttggtg	0.323																																						dbGAP											0													35.0	27.0	30.0					4																	15690255		692	1588	2280	-	-	-	SO:0001583	missense	0			BC048993	CCDS47028.1	4p15.32	2014-04-02			ENSG00000237765	ENSG00000237765			27740	protein-coding gene	gene with protein product	"""chromosome 4 open reading frame 53"""						Standard	NM_001145191		Approved	C4orf53	uc003gof.4	P0CF97	OTTHUMG00000160279	ENST00000422728.2:c.1655T>A	4.37:g.15690255T>A	ENSP00000393017:p.Leu552Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_RNaseH-like_dom,superfamily_PAH	p.L552Q	ENST00000422728.2	37	c.1655	CCDS47028.1	4	.	.	.	.	.	.	.	.	.	.	T	13.85	2.359934	0.41801	.	.	ENSG00000237765	ENST00000422728	T	0.23348	1.91	2.83	2.83	0.33086	.	.	.	.	.	T	0.22003	0.0530	L	0.29908	0.895	0.22656	N	0.998889	P	0.47350	0.894	P	0.49637	0.617	T	0.06041	-1.0849	9	0.13108	T	0.6	.	7.4713	0.27351	0.0:0.0:0.0:1.0	.	552	P0CF97	F200B_HUMAN	Q	552	ENSP00000393017:L552Q	ENSP00000393017:L552Q	L	+	2	0	FAM200B	15299353	1.000000	0.71417	0.989000	0.46669	0.983000	0.72400	2.433000	0.44793	1.543000	0.49345	0.454000	0.30748	CTA	FAM200B	-	NULL	ENSG00000237765		0.323	FAM200B-005	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM200B	HGNC	protein_coding	OTTHUMT00000360100.1	29	0.00	0	T	NM_001145191		15690255	15690255	+1	no_errors	ENST00000422728	ensembl	human	putative	69_37n	missense	26	35.00	14	SNP	0.994	A
GNL3L	54552	genome.wustl.edu	37	X	54578044	54578044	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chrX:54578044G>A	ENST00000336470.4	+	11	1046	c.907G>A	c.(907-909)Gat>Aat	p.D303N	GNL3L_ENST00000360845.2_Missense_Mutation_p.D303N	NM_019067.5	NP_061940.1	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)-like	303	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	30						CCGGCTCTTGGATGCTCCAGG	0.592																																						dbGAP											0													58.0	50.0	53.0					X																	54578044		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001475	CCDS14360.1	Xp11.22	2010-03-17			ENSG00000130119	ENSG00000130119			25553	protein-coding gene	gene with protein product		300873				12477932	Standard	NM_019067		Approved	FLJ10613	uc004dth.2	Q9NVN8	OTTHUMG00000021629	ENST00000336470.4:c.907G>A	X.37:g.54578044G>A	ENSP00000338573:p.Asp303Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,prints_GTP_binding_domain	p.D303N	ENST00000336470.4	37	c.907	CCDS14360.1	X	.	.	.	.	.	.	.	.	.	.	G	27.4	4.829816	0.91036	.	.	ENSG00000130119	ENST00000336470;ENST00000360845	T;T	0.69926	-0.44;-0.44	4.45	4.45	0.53987	GTP1/OBG (1);GTP-binding domain, HSR1-related (1);	0.000000	0.85682	D	0.000000	D	0.87920	0.6299	H	0.98133	4.155	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92017	0.5623	10	0.87932	D	0	-12.4025	13.7626	0.62975	0.0:0.0:1.0:0.0	.	303	Q9NVN8	GNL3L_HUMAN	N	303	ENSP00000338573:D303N;ENSP00000354091:D303N	ENSP00000338573:D303N	D	+	1	0	GNL3L	54594769	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	8.922000	0.92789	2.143000	0.66587	0.529000	0.55759	GAT	GNL3L	-	pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,prints_GTP_binding_domain	ENSG00000130119		0.592	GNL3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL3L	HGNC	protein_coding	OTTHUMT00000056805.1	23	0.00	0	G	NM_019067		54578044	54578044	+1	no_errors	ENST00000336470	ensembl	human	known	69_37n	missense	34	24.44	11	SNP	1.000	A
HAAO	23498	genome.wustl.edu	37	2	42994764	42994764	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr2:42994764A>C	ENST00000294973.6	-	9	808	c.753T>G	c.(751-753)gaT>gaG	p.D251E		NM_012205.2	NP_036337.2			3-hydroxyanthranilate 3,4-dioxygenase											breast(2)|cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(2)	11						GGAGGCTGTCATCAGGGGCCA	0.607																																						dbGAP											0													38.0	30.0	33.0					2																	42994764		2200	4290	6490	-	-	-	SO:0001583	missense	0			Z29481	CCDS33187.1	2p	2008-02-05			ENSG00000162882	ENSG00000162882	1.13.11.6		4796	protein-coding gene	gene with protein product		604521				7514594	Standard	NM_012205		Approved		uc002rst.4	P46952	OTTHUMG00000152348	ENST00000294973.6:c.753T>G	2.37:g.42994764A>C	ENSP00000294973:p.Asp251Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_3hydroanth_dOase,pfam_Cupin_2,superfamily_RmlC_Cupin,pirsf_3hydroanth_dOase_met,tigrfam_3hydroanth_dOase	p.D251E	ENST00000294973.6	37	c.753	CCDS33187.1	2	.	.	.	.	.	.	.	.	.	.	a	11.63	1.695642	0.30052	.	.	ENSG00000162882	ENST00000294973	T	0.30182	1.54	4.71	-3.34	0.04943	Cupin, RmlC-type (1);	0.065605	0.64402	D	0.000014	T	0.15349	0.0370	L	0.35723	1.085	0.25048	N	0.991157	B	0.02656	0.0	B	0.04013	0.001	T	0.07829	-1.0752	10	0.46703	T	0.11	.	1.0219	0.01520	0.3828:0.2923:0.1823:0.1426	.	251	P46952	3HAO_HUMAN	E	251	ENSP00000294973:D251E	ENSP00000294973:D251E	D	-	3	2	HAAO	42848268	0.010000	0.17322	0.934000	0.37439	0.427000	0.31564	-1.030000	0.03581	-0.082000	0.12640	-0.450000	0.05554	GAT	HAAO	-	superfamily_RmlC_Cupin,pirsf_3hydroanth_dOase_met	ENSG00000162882		0.607	HAAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAAO	HGNC	protein_coding	OTTHUMT00000325948.2	11	0.00	0	A			42994764	42994764	-1	no_errors	ENST00000294973	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.863	C
HAAO	23498	genome.wustl.edu	37	2	43010980	43010980	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr2:43010980C>G	ENST00000294973.6	-	3	242	c.187G>C	c.(187-189)Gtt>Ctt	p.V63L		NM_012205.2	NP_036337.2			3-hydroxyanthranilate 3,4-dioxygenase											breast(2)|cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(2)	11						ACTCGGAGAACCATGTCTCCC	0.612																																						dbGAP											0													65.0	53.0	57.0					2																	43010980		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z29481	CCDS33187.1	2p	2008-02-05			ENSG00000162882	ENSG00000162882	1.13.11.6		4796	protein-coding gene	gene with protein product		604521				7514594	Standard	NM_012205		Approved		uc002rst.4	P46952	OTTHUMG00000152348	ENST00000294973.6:c.187G>C	2.37:g.43010980C>G	ENSP00000294973:p.Val63Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_3hydroanth_dOase,pfam_Cupin_2,superfamily_RmlC_Cupin,pirsf_3hydroanth_dOase_met,tigrfam_3hydroanth_dOase	p.V63L	ENST00000294973.6	37	c.187	CCDS33187.1	2	.	.	.	.	.	.	.	.	.	.	C	10.04	1.242595	0.22796	.	.	ENSG00000162882	ENST00000294973;ENST00000431905	T;T	0.33438	1.41;1.41	4.68	1.85	0.25348	Cupin, RmlC-type (1);	0.299670	0.30085	N	0.010454	T	0.13415	0.0325	N	0.16790	0.44	0.35406	D	0.792044	B	0.12013	0.005	B	0.11329	0.006	T	0.22068	-1.0227	10	0.08837	T	0.75	.	4.9273	0.13900	0.0:0.6077:0.1903:0.2021	.	63	P46952	3HAO_HUMAN	L	63;29	ENSP00000294973:V63L;ENSP00000412601:V29L	ENSP00000294973:V63L	V	-	1	0	HAAO	42864484	1.000000	0.71417	0.994000	0.49952	0.982000	0.71751	1.568000	0.36418	0.202000	0.20498	0.455000	0.32223	GTT	HAAO	-	pfam_3hydroanth_dOase,pfam_Cupin_2,superfamily_RmlC_Cupin,pirsf_3hydroanth_dOase_met,tigrfam_3hydroanth_dOase	ENSG00000162882		0.612	HAAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAAO	HGNC	protein_coding	OTTHUMT00000325948.2	25	0.00	0	C			43010980	43010980	-1	no_errors	ENST00000294973	ensembl	human	known	69_37n	missense	51	30.14	22	SNP	0.998	G
HIVEP2	3097	genome.wustl.edu	37	6	143091059	143091059	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr6:143091059C>A	ENST00000367604.1	-	4	5456	c.4817G>T	c.(4816-4818)gGc>gTc	p.G1606V	HIVEP2_ENST00000012134.2_Missense_Mutation_p.G1606V|HIVEP2_ENST00000367603.2_Missense_Mutation_p.G1606V			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1606					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G1606D(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GACCAGCATGCCAACAGGCCG	0.577																																					Esophageal Squamous(107;843 1510 13293 16805 42198)	dbGAP											1	Substitution - Missense(1)	lung(1)											63.0	68.0	66.0					6																	143091059		2120	4241	6361	-	-	-	SO:0001583	missense	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.4817G>T	6.37:g.143091059C>A	ENSP00000356576:p.Gly1606Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G1606V	ENST00000367604.1	37	c.4817	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	C	13.56	2.275013	0.40194	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02345	4.33;4.33;4.33	5.95	5.95	0.96441	.	0.224693	0.53938	D	0.000049	T	0.01387	0.0045	L	0.34521	1.04	0.54753	D	0.999987	P	0.39216	0.664	B	0.33042	0.157	T	0.64071	-0.6493	10	0.40728	T	0.16	-9.4261	14.5145	0.67809	0.0:0.9303:0.0:0.0697	.	1606	P31629	ZEP2_HUMAN	V	1606	ENSP00000356576:G1606V;ENSP00000356575:G1606V;ENSP00000012134:G1606V	ENSP00000012134:G1606V	G	-	2	0	HIVEP2	143132752	1.000000	0.71417	0.951000	0.38953	0.969000	0.65631	2.764000	0.47613	2.811000	0.96726	0.655000	0.94253	GGC	HIVEP2	-	NULL	ENSG00000010818		0.577	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	30	0.00	0	C			143091059	143091059	-1	no_errors	ENST00000012134	ensembl	human	known	69_37n	missense	9	47.06	8	SNP	0.985	A
HRNR	388697	genome.wustl.edu	37	1	152186490	152186490	+	Missense_Mutation	SNP	C	C	T	rs201463788	byFrequency	TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr1:152186490C>T	ENST00000368801.2	-	3	7690	c.7615G>A	c.(7615-7617)Ggc>Agc	p.G2539S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2539				G -> S (in Ref. 1; BAC57496). {ECO:0000305}.	establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCACGCTGGCCGTGGCCTGGA	0.632													C|||	888	0.177316	0.1203	0.2147	5008	,	,		40970	0.2679		0.0934	False		,,,				2504	0.2209					dbGAP											0													1.0	1.0	1.0					1																	152186490		2	12	14	-	-	-	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.7615G>A	1.37:g.152186490C>T	ENSP00000357791:p.Gly2539Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.G2539S	ENST00000368801.2	37	c.7615	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	C	8.448	0.852355	0.17106	.	.	ENSG00000197915	ENST00000368801	T	0.05081	3.5	3.1	-1.4	0.08968	.	.	.	.	.	T	0.00967	0.0032	L	0.40543	1.245	0.80722	P	0.0	P	0.39181	0.663	B	0.20184	0.028	T	0.49818	-0.8899	8	0.11794	T	0.64	.	7.0816	0.25234	0.0:0.4912:0.0:0.5088	rs7514457;rs9661330	2539	Q86YZ3	HORN_HUMAN	S	2539	ENSP00000357791:G2539S	ENSP00000357791:G2539S	G	-	1	0	HRNR	150453114	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.984000	0.03755	-0.477000	0.06832	0.603000	0.83216	GGC	HRNR	-	NULL	ENSG00000197915		0.632	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	8	0.00	0	C	XM_373868		152186490	152186490	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	missense	3	50.00	3	SNP	0.000	T
IFT57	55081	genome.wustl.edu	37	3	107925495	107925495	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr3:107925495T>C	ENST00000264538.3	-	5	881	c.634A>G	c.(634-636)Aag>Gag	p.K212E		NM_018010.3	NP_060480.1	Q9NWB7	IFT57_HUMAN	intraflagellar transport 57	212					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cilium assembly (GO:0042384)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|Golgi apparatus (GO:0005794)|intraciliary transport particle B (GO:0030992)|photoreceptor connecting cilium (GO:0032391)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	14			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			GTCTGGGCCTTTAAAACGTTG	0.279																																						dbGAP											0													118.0	111.0	114.0					3																	107925495		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001009	CCDS2951.1	3q13.13	2014-07-03	2014-07-03	2005-11-02	ENSG00000114446	ENSG00000114446		"""Intraflagellar transport homologs"""	17367	protein-coding gene	gene with protein product		606621	"""estrogen-related receptor beta like 1"", ""intraflagellar transport 57 homolog (Chlamydomonas)"""	ESRRBL1			Standard	NM_018010		Approved	FLJ10147, HIPPI, MHS4R2	uc003dwx.4	Q9NWB7	OTTHUMG00000159223	ENST00000264538.3:c.634A>G	3.37:g.107925495T>C	ENSP00000264538:p.Lys212Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96DA9	Missense_Mutation	SNP	pfam_Intra-flagellar_transport_57,superfamily_t-SNARE	p.K212E	ENST00000264538.3	37	c.634	CCDS2951.1	3	.	.	.	.	.	.	.	.	.	.	T	13.54	2.266339	0.40095	.	.	ENSG00000114446	ENST00000264538	.	.	.	5.46	4.27	0.50696	.	0.442651	0.27060	N	0.021133	T	0.39358	0.1075	L	0.48642	1.525	0.41391	D	0.987615	P	0.39696	0.683	B	0.35655	0.207	T	0.15435	-1.0437	9	0.19147	T	0.46	.	7.7035	0.28636	0.1391:0.0:0.1456:0.7153	.	212	Q9NWB7	IFT57_HUMAN	E	212	.	ENSP00000264538:K212E	K	-	1	0	IFT57	109408185	1.000000	0.71417	0.997000	0.53966	0.939000	0.58152	3.321000	0.51999	0.979000	0.38497	0.454000	0.30748	AAG	IFT57	-	pfam_Intra-flagellar_transport_57	ENSG00000114446		0.279	IFT57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT57	HGNC	protein_coding	OTTHUMT00000353918.1	40	0.00	0	T	NM_018010		107925495	107925495	-1	no_errors	ENST00000264538	ensembl	human	known	69_37n	missense	54	12.90	8	SNP	1.000	C
IFT88	8100	genome.wustl.edu	37	13	21217606	21217606	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr13:21217606G>A	ENST00000319980.6	+	21	2049	c.1722G>A	c.(1720-1722)atG>atA	p.M574I	IFT88_ENST00000351808.5_Missense_Mutation_p.M565I|IFT88_ENST00000382778.4_Missense_Mutation_p.M574I|IFT88_ENST00000537103.1_Missense_Mutation_p.M546I	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	574					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		ATGAATTAATGGAAAATCCCA	0.318																																						dbGAP											0													103.0	101.0	101.0					13																	21217606		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.1722G>A	13.37:g.21217606G>A	ENSP00000323580:p.Met574Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat,smart_Sel1-like,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.M574I	ENST00000319980.6	37	c.1722	CCDS31944.1	13	.	.	.	.	.	.	.	.	.	.	G	15.39	2.820412	0.50633	.	.	ENSG00000032742	ENST00000382778;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83	5.83	5.83	0.93111	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.046192	0.85682	D	0.000000	T	0.66858	0.2832	L	0.54323	1.7	0.53005	D	0.999961	B;B	0.31209	0.313;0.139	B;B	0.25405	0.046;0.06	T	0.62464	-0.6849	10	0.20519	T	0.43	-23.2923	13.3379	0.60528	0.072:0.0:0.928:0.0	.	546;574	F5H6C2;Q13099	.;IFT88_HUMAN	I	574;565;574;546	ENSP00000372228:M574I;ENSP00000261632:M565I;ENSP00000323580:M574I;ENSP00000437719:M546I	ENSP00000323580:M574I	M	+	3	0	IFT88	20115606	1.000000	0.71417	1.000000	0.80357	0.620000	0.37586	4.762000	0.62250	2.755000	0.94549	0.557000	0.71058	ATG	IFT88	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000032742		0.318	IFT88-002	KNOWN	basic|CCDS	protein_coding	IFT88	HGNC	protein_coding	OTTHUMT00000044075.3	41	0.00	0	G	NM_006531		21217606	21217606	+1	no_errors	ENST00000319980	ensembl	human	known	69_37n	missense	47	30.88	21	SNP	1.000	A
IL1RL1	9173	genome.wustl.edu	37	2	102964405	102964405	+	Splice_Site	SNP	T	T	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr2:102964405T>A	ENST00000233954.1	+	9	1242	c.971T>A	c.(970-972)aTt>aAt	p.I324N		NM_016232.4	NP_057316.3	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1	324					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of macrophage activation (GO:0043032)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|interleukin-1 receptor activity (GO:0004908)|interleukin-33 receptor activity (GO:0002114)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(3)|urinary_tract(1)	16						TTTTGAATAGTTGATCATCAT	0.323																																						dbGAP											0													77.0	74.0	75.0					2																	102964405		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			D12764	CCDS2057.1, CCDS2058.1, CCDS74548.1	2q12	2013-01-29			ENSG00000115602	ENSG00000115602		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5998	protein-coding gene	gene with protein product	"""homolog of mouse growth stimulation-expressed"""	601203				1482686, 10191101, 16286016	Standard	NM_016232		Approved	ST2, FIT-1, ST2L, ST2V, DER4, T1, IL33R	uc002tbu.1	Q01638	OTTHUMG00000130782	ENST00000233954.1:c.971-1T>A	2.37:g.102964405T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6B3|B4E0I3|Q53TU7|Q8NEJ3|Q9ULV7|Q9UQ44	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Ig_I-set,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_IL1_rcpt_I/II	p.I324N	ENST00000233954.1	37	c.971	CCDS2057.1	2	.	.	.	.	.	.	.	.	.	.	T	7.686	0.689970	0.15039	.	.	ENSG00000115602	ENST00000233954	T	0.61859	0.07	5.53	1.83	0.25207	.	0.625775	0.15722	N	0.247843	T	0.35799	0.0944	N	0.25144	0.715	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.07558	-1.0766	9	.	.	.	.	4.9776	0.14148	0.0:0.2484:0.1502:0.6014	.	324	Q01638	ILRL1_HUMAN	N	324	ENSP00000233954:I324N	.	I	+	2	0	IL1RL1	102330837	0.038000	0.19896	0.968000	0.41197	0.433000	0.31745	-0.076000	0.11412	0.478000	0.27488	0.455000	0.32223	ATT	IL1RL1	-	NULL	ENSG00000115602		0.323	IL1RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RL1	HGNC	protein_coding	OTTHUMT00000253296.1	60	0.00	0	T	NM_016232	Missense_Mutation	102964405	102964405	+1	no_errors	ENST00000233954	ensembl	human	known	69_37n	missense	47	34.72	25	SNP	0.803	A
JSRP1	126306	genome.wustl.edu	37	19	2254465	2254465	+	Silent	SNP	G	G	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr19:2254465G>A	ENST00000300961.6	-	3	190	c.126C>T	c.(124-126)gcC>gcT	p.A42A	JSRP1_ENST00000586471.2_Silent_p.A42A	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	42	Mediates interaction with CACNA1S. {ECO:0000250}.				protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCCGGAGTCGGCCAGCCTGG	0.672																																						dbGAP											0													40.0	37.0	38.0					19																	2254465		2199	4298	6497	-	-	-	SO:0001819	synonymous_variant	0			AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.126C>T	19.37:g.2254465G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.A42	ENST00000300961.6	37	c.126	CCDS12086.1	19																																																																																			JSRP1	-	NULL	ENSG00000167476		0.672	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	JSRP1	HGNC	protein_coding	OTTHUMT00000451266.2	18	0.00	0	G	NM_144616		2254465	2254465	-1	no_errors	ENST00000300961	ensembl	human	known	69_37n	silent	19	29.63	8	SNP	0.004	A
KIF2B	84643	genome.wustl.edu	37	17	51902147	51902147	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr17:51902147C>G	ENST00000268919.4	+	1	1909	c.1753C>G	c.(1753-1755)Cct>Gct	p.P585A		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	585					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TATTAAAATACCTTATGTACA	0.423																																						dbGAP											0													93.0	97.0	96.0					17																	51902147		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1753C>G	17.37:g.51902147C>G	ENSP00000268919:p.Pro585Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MA2|Q9BXG6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P585A	ENST00000268919.4	37	c.1753	CCDS32685.1	17	.	.	.	.	.	.	.	.	.	.	C	0.391	-0.923387	0.02377	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.72725	-0.68	5.51	2.31	0.28768	.	0.414870	0.17517	N	0.171391	T	0.53834	0.1821	N	0.24115	0.695	0.09310	N	1	P	0.34546	0.456	B	0.41764	0.366	T	0.44205	-0.9343	10	0.08381	T	0.77	.	6.2403	0.20787	0.0:0.6311:0.1413:0.2275	.	585	Q8N4N8	KIF2B_HUMAN	A	585;473	ENSP00000268919:P585A	ENSP00000268919:P585A	P	+	1	0	KIF2B	49257146	0.000000	0.05858	0.002000	0.10522	0.068000	0.16541	-0.213000	0.09305	0.751000	0.32900	0.655000	0.94253	CCT	KIF2B	-	NULL	ENSG00000141200		0.423	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2B	HGNC	protein_coding	OTTHUMT00000438854.1	37	0.00	0	C	NM_032559		51902147	51902147	+1	no_errors	ENST00000268919	ensembl	human	known	69_37n	missense	46	23.33	14	SNP	0.000	G
KRT8P11	347265	genome.wustl.edu	37	9	102067616	102067616	+	IGR	SNP	G	G	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr9:102067616G>C								RN7SKP225 (20961 upstream) : NAMA (50075 downstream)																							TGGGGCCAGTGGCATGGGAGG	0.632																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															9.37:g.102067616G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.G75R		37	c.223		9	.	.	.	.	.	.	.	.	.	.	G	12.74	2.029175	0.35797	.	.	ENSG00000222039	ENST00000409686	T	0.81330	-1.48	0.522	-0.516	0.11950	.	.	.	.	.	T	0.78438	0.4283	.	.	.	0.39404	D	0.966649	.	.	.	.	.	.	T	0.72243	-0.4350	6	0.54805	T	0.06	.	4.6329	0.12511	0.2995:0.0:0.7005:0.0	.	.	.	.	R	75	ENSP00000404011:G75R	ENSP00000404011:G75R	G	+	1	0	KRT8P11	101107437	0.003000	0.15002	0.002000	0.10522	0.134000	0.20937	0.480000	0.22244	-0.319000	0.08652	0.313000	0.20887	GGC	KRT8P11	-	NULL	ENSG00000259197	0	0.632					KRT8P11	HGNC			9	0.00	0	G			102067616	102067616	+1	no_errors	ENST00000409686	ensembl	human	known	69_37n	missense	16	52.94	18	SNP	0.913	C
KRTAP5-1	387264	genome.wustl.edu	37	11	1606144	1606145	+	Frame_Shift_Ins	INS	-	-	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr11:1606144_1606145insG	ENST00000382171.2	-	1	368_369	c.335_336insC	c.(334-336)tgtfs	p.C112fs	KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	112	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGGATCCCCCACAAGAGCCACA	0.658																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.335_336insC	11.37:g.1606144_1606145insG	ENSP00000371606:p.Cys112fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	NULL	p.G113fs	ENST00000382171.2	37	c.336_335	CCDS31330.1	11																																																																																			KRTAP5-1	-	NULL	ENSG00000205869		0.658	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-1	HGNC	protein_coding	OTTHUMT00000127922.1	9	0.00	0	-	NM_001005922		1606144	1606145	-1	no_errors	ENST00000382171	ensembl	human	known	69_37n	frame_shift_ins	9	30.77	4	INS	0.482:0.485	G
LOXHD1	125336	genome.wustl.edu	37	18	44140364	44140364	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr18:44140364G>A	ENST00000398722.4	-	12	1908	c.1909C>T	c.(1909-1911)Cgg>Tgg	p.R637W	LOXHD1_ENST00000441551.2_Intron|LOXHD1_ENST00000536736.1_Missense_Mutation_p.R915W|LOXHD1_ENST00000582408.1_5'Flank|LOXHD1_ENST00000441893.2_5'Flank|LOXHD1_ENST00000300591.6_5'Flank			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	637	PLAT 5. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TTCTTCTTCCGGGCCTCCTCC	0.647																																						dbGAP											0													61.0	56.0	57.0					18																	44140364		692	1591	2283	-	-	-	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.1909C>T	18.37:g.44140364G>A	ENSP00000381707:p.Arg637Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	p.R915W	ENST00000398722.4	37	c.2743		18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.59|12.59	1.982532|1.982532	0.34942|0.34942	.|.	.|.	ENSG00000167210|ENSG00000167210	ENST00000441551|ENST00000398722;ENST00000536736;ENST00000335730	.|T;T	.|0.07327	.|3.28;3.2	4.98|4.98	2.96|2.96	0.34315|0.34315	.|.	.|0.266335	.|0.26620	.|N	.|0.023370	T|T	0.16471|0.16471	0.0396|0.0396	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.999;1.0	.|D;D	.|0.69654	.|0.916;0.965	T|T	0.00855|0.00855	-1.1539|-1.1539	5|10	.|0.72032	.|D	.|0.01	.|.	10.8825|10.8825	0.46946|0.46946	0.0:0.0:0.699:0.301|0.0:0.0:0.699:0.301	.|.	.|915;637	.|F5GZB4;Q8IVV2-2	.|.;.	L|W	895|637;915;637	.|ENSP00000381707:R637W;ENSP00000444586:R915W	.|ENSP00000338222:R637W	P|R	-|-	2|1	0|2	LOXHD1|LOXHD1	42394362|42394362	0.114000|0.114000	0.22134|0.22134	0.999000|0.999000	0.59377|0.59377	0.463000|0.463000	0.32649|0.32649	1.138000|1.138000	0.31491|0.31491	2.312000|2.312000	0.78011|0.78011	0.289000|0.289000	0.19496|0.19496	CCG|CGG	LOXHD1	-	superfamily_Lipase_LipOase,pfscan_LipOase_LH2	ENSG00000167210		0.647	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		32	0.00	0	G	NM_144612		44140364	44140364	-1	no_errors	ENST00000536736	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	0.987	A
MLLT4	4301	genome.wustl.edu	37	6	168312024	168312024	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr6:168312024A>C	ENST00000447894.2	+	15	1892	c.1892A>C	c.(1891-1893)aAg>aCg	p.K631T	MLLT4_ENST00000344191.4_Missense_Mutation_p.K631T|MLLT4_ENST00000392108.3_Missense_Mutation_p.K631T|MLLT4_ENST00000366806.2_Missense_Mutation_p.K631T|MLLT4_ENST00000392112.1_Missense_Mutation_p.K615T|MLLT4_ENST00000351017.4_Missense_Mutation_p.K631T|MLLT4_ENST00000400822.3_Missense_Mutation_p.K630T			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	631					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GTCCACTTTAAGTTGTCCCCT	0.363			T	MLL	AL																																	dbGAP		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0													102.0	104.0	103.0					6																	168312024		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.1892A>C	6.37:g.168312024A>C	ENSP00000404595:p.Lys631Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Dil_domain,pfam_PDZ,pfam_FHA_dom,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_FHA_dom,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.K631T	ENST00000447894.2	37	c.1892		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.2|25.2	4.611608|4.611608	0.87258|0.87258	.|.	.|.	ENSG00000130396|ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894|ENST00000423229	T;T;T;T;T;T;T|.	0.09445|.	3.25;2.98;3.26;3.26;3.07;3.16;3.15|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.72518|.	0.3470|.	M|M	0.83012|0.83012	2.62|2.62	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.996;0.999;0.996;0.996|.	T|.	0.76019|.	-0.3112|.	10|.	0.87932|.	D|.	0|.	-9.2087|-9.2087	15.524|15.524	0.75887|0.75887	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	329;630;631;615|.	Q96C95;P55196-5;P55196-6;P55196-2|.	.;.;.;.|.	T|Y	631;631;631;631;615;631;630;631|329	ENSP00000341118:K631T;ENSP00000252692:K631T;ENSP00000375956:K631T;ENSP00000355771:K631T;ENSP00000375960:K615T;ENSP00000383623:K630T;ENSP00000404595:K631T|.	ENSP00000345834:K631T|.	K|X	+|+	2|3	0|2	MLLT4|MLLT4	168054873|168054873	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.954000|0.954000	0.61252|0.61252	8.771000|8.771000	0.91751|0.91751	2.066000|2.066000	0.61787|0.61787	0.383000|0.383000	0.25322|0.25322	AAG|TAA	MLLT4	-	NULL	ENSG00000130396		0.363	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	HGNC	protein_coding	OTTHUMT00000372077.1	67	0.00	0	A	NM_005936		168312024	168312024	+1	no_errors	ENST00000366806	ensembl	human	known	69_37n	missense	27	37.21	16	SNP	1.000	C
MUC5B	727897	genome.wustl.edu	37	11	1268478	1268478	+	Silent	SNP	G	G	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr11:1268478G>A	ENST00000529681.1	+	31	10426	c.10368G>A	c.(10366-10368)ggG>ggA	p.G3456G	MUC5B_ENST00000447027.1_Silent_p.G3459G|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3456	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCACACACGGGCGGTCCCTGC	0.682																																						dbGAP											0													89.0	125.0	113.0					11																	1268478		2118	4236	6354	-	-	-	SO:0001819	synonymous_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.10368G>A	11.37:g.1268478G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.G3459	ENST00000529681.1	37	c.10377	CCDS44515.2	11																																																																																			MUC5B	-	NULL	ENSG00000117983		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	275	0.00	0	G	XM_001126093		1268478	1268478	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	silent	292	25.26	99	SNP	0.000	A
MUSK	4593	genome.wustl.edu	37	9	113547204	113547204	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr9:113547204C>G	ENST00000374448.4	+	12	1628	c.1494C>G	c.(1492-1494)atC>atG	p.I498M	MUSK_ENST00000189978.5_Missense_Mutation_p.I498M|MUSK_ENST00000416899.2_Missense_Mutation_p.I490M|MUSK_ENST00000374438.1_Intron	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	498					cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						CTGTAATAATCTCCATCATGT	0.408																																						dbGAP											0													201.0	195.0	197.0					9																	113547204		1930	4128	6058	-	-	-	SO:0001583	missense	0			AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.1494C>G	9.37:g.113547204C>G	ENSP00000363571:p.Ile498Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Frizzled_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Frizzled_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I504M	ENST00000374448.4	37	c.1512	CCDS48005.1	9	.	.	.	.	.	.	.	.	.	.	C	15.77	2.930285	0.52866	.	.	ENSG00000030304	ENST00000189978;ENST00000374448;ENST00000543335;ENST00000374447;ENST00000545907;ENST00000416899	T	0.76709	-1.04	5.72	2.49	0.30216	.	0.109721	0.64402	D	0.000007	T	0.79185	0.4403	L	0.51422	1.61	0.80722	D	1	D	0.56746	0.977	P	0.60682	0.878	T	0.77059	-0.2728	10	0.72032	D	0.01	.	5.2903	0.15723	0.1474:0.5636:0.0:0.289	.	498	O15146	MUSK_HUMAN	M	504;498;498;412;412;496	ENSP00000363571:I498M	ENSP00000189978:I504M	I	+	3	3	MUSK	112587025	0.994000	0.37717	0.999000	0.59377	0.998000	0.95712	0.230000	0.17852	0.674000	0.31244	0.650000	0.86243	ATC	MUSK	-	NULL	ENSG00000030304		0.408	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUSK	HGNC	protein_coding		77	0.00	0	C			113547204	113547204	+1	no_errors	ENST00000189978	ensembl	human	known	69_37n	missense	72	30.48	32	SNP	0.997	G
NBEAL2	23218	genome.wustl.edu	37	3	47037780	47037780	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr3:47037780T>C	ENST00000450053.3	+	16	2350	c.2171T>C	c.(2170-2172)aTc>aCc	p.I724T	NBEAL2_ENST00000292309.5_Missense_Mutation_p.I724T|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	724					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		TCCTGCTGTATCGGCTCCGCT	0.672																																						dbGAP											0													32.0	40.0	37.0					3																	47037780		1998	4149	6147	-	-	-	SO:0001583	missense	0			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.2171T>C	3.37:g.47037780T>C	ENSP00000415034:p.Ile724Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I724T	ENST00000450053.3	37	c.2171	CCDS46817.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.80|16.80	3.224363|3.224363	0.58668|0.58668	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000450053|ENST00000416683	T;T|.	0.67865|.	-0.29;-0.29|.	4.72|4.72	4.72|4.72	0.59763|0.59763	Concanavalin A-like lectin/glucanase (1);|.	0.058385|.	0.64402|.	D|.	0.000003|.	T|T	0.75133|0.75133	0.3808|0.3808	M|M	0.81497|0.81497	2.545|2.545	0.80722|0.80722	D|D	1|1	P|.	0.51147|.	0.942|.	P|.	0.53360|.	0.724|.	T|T	0.77437|0.77437	-0.2588|-0.2588	10|5	0.87932|.	D|.	0|.	.|.	13.1817|13.1817	0.59657|0.59657	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	724|.	Q6ZNJ1|.	NBEL2_HUMAN|.	T|P	724|196	ENSP00000292309:I724T;ENSP00000415034:I724T|.	ENSP00000292309:I724T|.	I|S	+|+	2|1	0|0	NBEAL2|NBEAL2	47012784|47012784	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.973000|0.973000	0.67179|0.67179	4.704000|4.704000	0.61831|0.61831	1.973000|1.973000	0.57446|0.57446	0.460000|0.460000	0.39030|0.39030	ATC|TCG	NBEAL2	-	superfamily_ConA-like_lec_gl	ENSG00000160796		0.672	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	31	0.00	0	T	XM_291064		47037780	47037780	+1	no_errors	ENST00000450053	ensembl	human	known	69_37n	missense	19	42.42	14	SNP	1.000	C
NMBR	4829	genome.wustl.edu	37	6	142409522	142409522	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr6:142409522G>C	ENST00000258042.1	-	1	414	c.274C>G	c.(274-276)Ctg>Gtg	p.L92V	RP11-137J7.2_ENST00000454401.1_RNA	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	92					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		GTGAGCAGCAGCAGCAAGTCC	0.587																																						dbGAP											0													68.0	63.0	65.0					6																	142409522		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.274C>G	6.37:g.142409522G>C	ENSP00000258042:p.Leu92Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E9KL38|Q5VUK8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_NeuroB_rcpt,prints_Bombsn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.L92V	ENST00000258042.1	37	c.274	CCDS5196.1	6	.	.	.	.	.	.	.	.	.	.	G	17.95	3.512710	0.64522	.	.	ENSG00000135577	ENST00000258042	T	0.19938	2.11	5.61	3.84	0.44239	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.09291	0.0229	N	0.25825	0.765	0.80722	D	1	P	0.45715	0.865	P	0.45577	0.486	T	0.09271	-1.0682	10	0.33141	T	0.24	-15.1955	12.457	0.55710	0.1361:0.0:0.8639:0.0	.	92	P28336	NMBR_HUMAN	V	92	ENSP00000258042:L92V	ENSP00000258042:L92V	L	-	1	2	NMBR	142451215	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.686000	0.74548	0.861000	0.35504	0.655000	0.94253	CTG	NMBR	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000135577		0.587	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMBR	HGNC	protein_coding	OTTHUMT00000042479.1	27	0.00	0	G			142409522	142409522	-1	no_errors	ENST00000258042	ensembl	human	known	69_37n	missense	26	36.59	15	SNP	1.000	C
NPNT	255743	genome.wustl.edu	37	4	106890054	106890054	+	Silent	SNP	C	C	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr4:106890054C>G	ENST00000379987.2	+	12	1821	c.1605C>G	c.(1603-1605)gtC>gtG	p.V535V	NPNT_ENST00000427316.2_Silent_p.V565V|NPNT_ENST00000506666.1_Silent_p.V536V|NPNT_ENST00000305572.8_Intron|NPNT_ENST00000514622.1_Silent_p.V506V|NPNT_ENST00000453617.2_Silent_p.V552V	NM_001033047.2	NP_001028219.1	Q6UXI9	NPNT_HUMAN	nephronectin	535	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to tumor necrosis factor (GO:0071356)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|pilomotor reflex (GO:0097195)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|ureteric bud development (GO:0001657)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integrin alpha8-beta1 complex (GO:0034678)|proteinaceous extracellular matrix (GO:0005578)|smooth muscle contractile fiber (GO:0030485)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			kidney(5)|large_intestine(2)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	21		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		CTCCCTAGGTCGTCTTCAAAG	0.463																																						dbGAP											0													133.0	118.0	123.0					4																	106890054		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34046.1, CCDS54784.1, CCDS54785.1, CCDS54786.1, CCDS54787.1	4q25	2005-10-07							27405	protein-coding gene	gene with protein product		610306				15754038	Standard	NM_001033047		Approved	EGFL6L, POEM	uc011cfd.2	Q6UXI9		ENST00000379987.2:c.1605C>G	4.37:g.106890054C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFT9|A8K1W4|B4DIT4|B4DYK3|B4E2H7|B4E3H2|D6RCA1|E9PCK8|E9PCQ1|E9PE64|E9PF04	Silent	SNP	pfam_MAM_dom,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_MAM_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.V535	ENST00000379987.2	37	c.1605	CCDS34046.1	4																																																																																			NPNT	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl,smart_MAM_dom,pfscan_MAM_dom	ENSG00000168743		0.463	NPNT-001	KNOWN	basic|CCDS	protein_coding	NPNT	HGNC	protein_coding	OTTHUMT00000364083.1	59	0.00	0	C	NM_198278		106890054	106890054	+1	no_errors	ENST00000379987	ensembl	human	known	69_37n	silent	93	14.68	16	SNP	1.000	G
NUMA1	4926	genome.wustl.edu	37	11	71726410	71726410	+	Silent	SNP	G	G	T			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr11:71726410G>T	ENST00000393695.3	-	15	2470	c.2139C>A	c.(2137-2139)gtC>gtA	p.V713V	NUMA1_ENST00000358965.6_Silent_p.V713V|RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000351960.6_Intron	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						TGCCCTTGGTGACCTTCAAGG	0.582			T	RARA	APL																																	dbGAP		Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	0													79.0	86.0	84.0					11																	71726410		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.2139C>A	11.37:g.71726410G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	superfamily_Prefoldin	p.V713	ENST00000393695.3	37	c.2139	CCDS31633.1	11																																																																																			NUMA1	-	NULL	ENSG00000137497		0.582	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMA1	HGNC	protein_coding	OTTHUMT00000395769.1	28	0.00	0	G			71726410	71726410	-1	no_errors	ENST00000393695	ensembl	human	known	69_37n	silent	37	38.33	23	SNP	0.046	T
OLFM4	10562	genome.wustl.edu	37	13	53624150	53624150	+	Silent	SNP	G	G	T			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr13:53624150G>T	ENST00000219022.2	+	5	855	c.777G>T	c.(775-777)gtG>gtT	p.V259V		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	259	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		AACCGTCTGTGGTTCAGCTCA	0.448																																						dbGAP											0													152.0	151.0	151.0					13																	53624150		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.777G>T	13.37:g.53624150G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O95362|Q5VWG0|Q86T22	Silent	SNP	pfam_Olfac-like,superfamily_Quinoprot_gluc/sorb_DH,smart_Olfac-like,pfscan_Olfac-like	p.V259	ENST00000219022.2	37	c.777	CCDS9440.1	13																																																																																			OLFM4	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000102837		0.448	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM4	HGNC	protein_coding	OTTHUMT00000045112.2	39	0.00	0	G	NM_006418		53624150	53624150	+1	no_errors	ENST00000219022	ensembl	human	known	69_37n	silent	55	12.70	8	SNP	0.024	T
OR10K1	391109	genome.wustl.edu	37	1	158435767	158435767	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr1:158435767G>T	ENST00000289451.2	+	1	496	c.416G>T	c.(415-417)gGg>gTg	p.G139V		NM_001004473.1	NP_001004473.1	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K, member 1	139						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	27	all_hematologic(112;0.0378)					ATGGGACATGGGGTGTGTATG	0.552																																						dbGAP											0													211.0	199.0	203.0					1																	158435767		2203	4300	6503	-	-	-	SO:0001583	missense	0			AP002532	CCDS30897.1	1q23.1	2012-08-09			ENSG00000173285	ENSG00000173285		"""GPCR / Class A : Olfactory receptors"""	14693	protein-coding gene	gene with protein product							Standard	NM_001004473		Approved		uc010pij.2	Q8NGX5	OTTHUMG00000017517	ENST00000289451.2:c.416G>T	1.37:g.158435767G>T	ENSP00000289451:p.Gly139Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFS2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G139V	ENST00000289451.2	37	c.416	CCDS30897.1	1	.	.	.	.	.	.	.	.	.	.	g	7.929	0.740251	0.15642	.	.	ENSG00000173285	ENST00000289451	T	0.37235	1.21	4.5	3.58	0.41010	GPCR, rhodopsin-like superfamily (1);	0.886807	0.09470	N	0.797752	T	0.28300	0.0699	L	0.38838	1.175	0.09310	N	1	D	0.58970	0.984	D	0.64042	0.921	T	0.11203	-1.0597	10	0.41790	T	0.15	.	6.7882	0.23685	0.094:0.3478:0.5582:0.0	.	139	Q8NGX5	O10K1_HUMAN	V	139	ENSP00000289451:G139V	ENSP00000289451:G139V	G	+	2	0	OR10K1	156702391	0.000000	0.05858	0.002000	0.10522	0.696000	0.40369	0.383000	0.20651	1.074000	0.40909	0.557000	0.71058	GGG	OR10K1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000173285		0.552	OR10K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10K1	HGNC	protein_coding	OTTHUMT00000046367.1	99	0.00	0	G			158435767	158435767	+1	no_errors	ENST00000289451	ensembl	human	known	69_37n	missense	160	23.08	48	SNP	0.001	T
OR7D2	162998	genome.wustl.edu	37	19	9296482	9296482	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr19:9296482T>A	ENST00000344248.2	+	1	204	c.25T>A	c.(25-27)Ttt>Att	p.F9I		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	9					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						CCAAACAGGATTTTTAGAGTT	0.488																																						dbGAP											0													54.0	56.0	55.0					19																	9296482		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.25T>A	19.37:g.9296482T>A	ENSP00000345563:p.Phe9Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFJ7|Q8N133	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F9I	ENST00000344248.2	37	c.25	CCDS32900.1	19	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.814617	0.00600	.	.	ENSG00000188000	ENST00000344248	T	0.00462	7.26	2.21	-4.43	0.03568	.	1.381260	0.05406	N	0.541507	T	0.00144	0.0004	N	0.00750	-1.22	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38200	-0.9672	10	0.02654	T	1	.	7.6344	0.28257	0.1955:0.0:0.6699:0.1346	.	9	Q96RA2	OR7D2_HUMAN	I	9	ENSP00000345563:F9I	ENSP00000345563:F9I	F	+	1	0	OR7D2	9157482	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.998000	0.03701	-1.759000	0.01313	-1.434000	0.01081	TTT	OR7D2	-	NULL	ENSG00000188000		0.488	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D2	HGNC	protein_coding	OTTHUMT00000449002.1	17	0.00	0	T			9296482	9296482	+1	no_errors	ENST00000344248	ensembl	human	known	69_37n	missense	56	25.33	19	SNP	0.000	A
PARP16	54956	genome.wustl.edu	37	15	65553280	65553280	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr15:65553280T>C	ENST00000444347.2	-	3	847	c.431A>G	c.(430-432)aAt>aGt	p.N144S	PARP16_ENST00000261888.6_Missense_Mutation_p.N259S			Q8N5Y8	PAR16_HUMAN	poly (ADP-ribose) polymerase family, member 16	259	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell death (GO:0060548)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum tubular network (GO:0071782)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	kinase binding (GO:0019900)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|protein serine/threonine kinase activator activity (GO:0043539)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	9						CAGCTGGTTATTGGTGACCAC	0.483																																					NSCLC(50;885 1163 13509 21242 41978)	dbGAP											0													201.0	175.0	184.0					15																	65553280		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK000516	CCDS10204.1	15q22.2	2010-02-16	2004-08-25	2004-08-25	ENSG00000138617	ENSG00000138617		"""Poly (ADP-ribose) polymerases"""	26040	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 30"""	C15orf30		15273990	Standard	NM_017851		Approved	FLJ20509, FLJ25281, pART15	uc002aoq.3	Q8N5Y8	OTTHUMG00000133138	ENST00000444347.2:c.431A>G	15.37:g.65553280T>C	ENSP00000396118:p.Asn144Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PK64|Q9NX03	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.N259S	ENST00000444347.2	37	c.776		15	.	.	.	.	.	.	.	.	.	.	T	28.9	4.958667	0.92726	.	.	ENSG00000138617	ENST00000261888;ENST00000444347	T;T	0.15603	2.41;2.41	5.21	5.21	0.72293	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.084182	0.85682	D	0.000000	T	0.38188	0.1031	M	0.74881	2.28	0.80722	D	1	D;P;D	0.56287	0.969;0.734;0.975	P;B;P	0.59056	0.768;0.302;0.851	T	0.26815	-1.0092	10	0.72032	D	0.01	-23.8529	14.2921	0.66286	0.0:0.0:0.0:1.0	.	259;144;259	Q8N5Y8-3;Q8N5Y8-2;Q8N5Y8	.;.;PAR16_HUMAN	S	259;144	ENSP00000261888:N259S;ENSP00000396118:N144S	ENSP00000261888:N259S	N	-	2	0	PARP16	63340333	1.000000	0.71417	0.962000	0.40283	0.998000	0.95712	7.885000	0.87282	1.963000	0.57068	0.533000	0.62120	AAT	PARP16	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000138617		0.483	PARP16-002	NOVEL	basic|exp_conf	protein_coding	PARP16	HGNC	protein_coding	OTTHUMT00000418174.1	47	0.00	0	T	NM_017851		65553280	65553280	-1	no_errors	ENST00000261888	ensembl	human	known	69_37n	missense	59	43.81	46	SNP	1.000	C
PCDH18	54510	genome.wustl.edu	37	4	138452231	138452231	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr4:138452231A>C	ENST00000344876.4	-	1	1398	c.1012T>G	c.(1012-1014)Tgc>Ggc	p.C338G	PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000507846.1_Missense_Mutation_p.C118G|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000412923.2_Missense_Mutation_p.C338G	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	338	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					ATAATTTTGCAATGGGCTGGG	0.338																																						dbGAP											0													27.0	30.0	29.0					4																	138452231		2186	4295	6481	-	-	-	SO:0001583	missense	0			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1012T>G	4.37:g.138452231A>C	ENSP00000355082:p.Cys338Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.C338G	ENST00000344876.4	37	c.1012	CCDS34064.1	4	.	.	.	.	.	.	.	.	.	.	A	18.12	3.553905	0.65425	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.48836	0.8;0.8;0.8	6.03	6.03	0.97812	Cadherin (4);Cadherin-like (1);	0.000000	0.47852	D	0.000216	T	0.74527	0.3728	M	0.88031	2.925	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.994;0.999	T	0.79818	-0.1643	10	0.87932	D	0	.	16.5724	0.84622	1.0:0.0:0.0:0.0	.	118;338;338	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	G	338;338;118	ENSP00000355082:C338G;ENSP00000390688:C338G;ENSP00000425903:C118G	ENSP00000355082:C338G	C	-	1	0	PCDH18	138671681	1.000000	0.71417	0.990000	0.47175	0.958000	0.62258	9.255000	0.95524	2.313000	0.78055	0.455000	0.32223	TGC	PCDH18	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000189184		0.338	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH18	HGNC	protein_coding	OTTHUMT00000364614.1	12	0.00	0	A	NM_019035		138452231	138452231	-1	no_errors	ENST00000344876	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	1.000	C
PLEKHH1	57475	genome.wustl.edu	37	14	68042170	68042170	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr14:68042170A>C	ENST00000329153.5	+	15	2282	c.2150A>C	c.(2149-2151)tAt>tCt	p.Y717S		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	717	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		TTCTACTACTATCGGAGCCAT	0.488																																						dbGAP											0													68.0	66.0	66.0					14																	68042170		1995	4167	6162	-	-	-	SO:0001583	missense	0			AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.2150A>C	14.37:g.68042170A>C	ENSP00000330278:p.Tyr717Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.Y717S	ENST00000329153.5	37	c.2150	CCDS45128.1	14	.	.	.	.	.	.	.	.	.	.	A	19.26	3.794211	0.70452	.	.	ENSG00000054690	ENST00000329153	T	0.45668	0.89	5.9	3.4	0.38934	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.57213	0.2038	L	0.56769	1.78	0.80722	D	1	D;P	0.89917	1.0;0.573	D;B	0.91635	0.999;0.306	T	0.59037	-0.7529	10	0.87932	D	0	-10.895	10.1926	0.43035	0.6214:0.0:0.0:0.3786	.	232;717	Q9ULM0-2;Q9ULM0	.;PKHH1_HUMAN	S	717	ENSP00000330278:Y717S	ENSP00000330278:Y717S	Y	+	2	0	PLEKHH1	67111923	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.286000	0.51724	1.038000	0.40049	0.460000	0.39030	TAT	PLEKHH1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000054690		0.488	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH1	HGNC	protein_coding	OTTHUMT00000412730.3	30	0.00	0	A	XM_031054		68042170	68042170	+1	no_errors	ENST00000329153	ensembl	human	known	69_37n	missense	26	43.48	20	SNP	1.000	C
PLIN3	10226	genome.wustl.edu	37	19	4852082	4852082	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr19:4852082C>G	ENST00000221957.4	-	5	756	c.580G>C	c.(580-582)Ggg>Cgg	p.G194R	PLIN3_ENST00000592528.1_Missense_Mutation_p.G182R|PLIN3_ENST00000585479.1_Missense_Mutation_p.G194R	NM_001164189.1|NM_001164194.1|NM_005817.4	NP_001157661.1|NP_001157666.1|NP_005808.3	O60664	PLIN3_HUMAN	perilipin 3	194					vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|membrane (GO:0016020)				cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9					Galsulfase(DB01279)|Idursulfase(DB01271)	TCCGACTTCCCCAGCACCGTG	0.667											OREG0025175	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													71.0	54.0	60.0					19																	4852082		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF051314	CCDS12137.1, CCDS59337.1, CCDS59338.1	19p13.3	2009-08-12	2009-08-12	2009-08-12		ENSG00000105355		"""Perilipins"""	16893	protein-coding gene	gene with protein product	"""cargo selection protein (mannose 6 phosphate receptor binding protein)"", ""placental protein 17"", ""MPR-BINDING PROTEIN, 47-KD"""	602702	"""mannose-6-phosphate receptor binding protein 1"""	M6PRBP1		9590177, 6856484, 19638644	Standard	NM_005817		Approved	TIP47, PP17	uc002mbj.2	O60664		ENST00000221957.4:c.580G>C	19.37:g.4852082C>G	ENSP00000221957:p.Gly194Arg	Somatic	622	WXS	Illumina GAIIx	Phase_IV	A8K4Y9|K7EQF4|Q53G77|Q9BS03|Q9UBD7|Q9UP92	Missense_Mutation	SNP	pfam_Perilipin,pirsf_Perilipin	p.G194R	ENST00000221957.4	37	c.580	CCDS12137.1	19	.	.	.	.	.	.	.	.	.	.	C	17.72	3.458575	0.63401	.	.	ENSG00000105355	ENST00000221957	T	0.05855	3.38	5.17	4.12	0.48240	.	0.204753	0.41823	U	0.000811	T	0.19765	0.0475	M	0.76574	2.34	0.33172	D	0.548379	D;D;D	0.69078	0.997;0.98;0.997	D;P;D	0.68192	0.926;0.837;0.956	T	0.18999	-1.0319	10	0.56958	D	0.05	-11.6314	7.6795	0.28505	0.1651:0.7508:0.0:0.0841	.	194;11;194	O60664-3;O60664-2;O60664	.;.;PLIN3_HUMAN	R	194	ENSP00000221957:G194R	ENSP00000221957:G194R	G	-	1	0	PLIN3	4803082	0.709000	0.27886	0.999000	0.59377	0.586000	0.36452	2.467000	0.45093	1.137000	0.42214	0.561000	0.74099	GGG	PLIN3	-	pfam_Perilipin,pirsf_Perilipin	ENSG00000105355		0.667	PLIN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLIN3	HGNC	protein_coding	OTTHUMT00000450436.1	22	0.00	0	C	NM_005817		4852082	4852082	-1	no_errors	ENST00000221957	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	1.000	G
POF1B	79983	genome.wustl.edu	37	X	84563184	84563184	+	Silent	SNP	C	C	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chrX:84563184C>A	ENST00000262753.4	-	10	1141	c.996G>T	c.(994-996)ctG>ctT	p.L332L	POF1B_ENST00000373145.3_Silent_p.L332L	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	332						tight junction (GO:0005923)				central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						TAAATGTGGACAGCACTAGTC	0.358																																						dbGAP											0													95.0	82.0	86.0					X																	84563184		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.996G>T	X.37:g.84563184C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Silent	SNP	NULL	p.L332	ENST00000262753.4	37	c.996	CCDS14452.1	X																																																																																			POF1B	-	NULL	ENSG00000124429		0.358	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POF1B	HGNC	protein_coding	OTTHUMT00000057391.2	44	0.00	0	C	NM_024921		84563184	84563184	-1	no_errors	ENST00000373145	ensembl	human	known	69_37n	silent	55	24.66	18	SNP	0.983	A
PRKAA1	5562	genome.wustl.edu	37	5	40771909	40771909	+	Silent	SNP	A	A	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr5:40771909A>G	ENST00000397128.2	-	4	428	c.420T>C	c.(418-420)taT>taC	p.Y140Y	PRKAA1_ENST00000296800.4_Silent_p.Y131Y|PRKAA1_ENST00000354209.3_Silent_p.Y155Y	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	140	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)			breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	GCCTGTGACAATAATCCACAC	0.393																																						dbGAP											0													117.0	111.0	113.0					5																	40771909		1913	4161	6074	-	-	-	SO:0001819	synonymous_variant	0				CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.420T>C	5.37:g.40771909A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y155	ENST00000397128.2	37	c.465	CCDS3932.2	5																																																																																			PRKAA1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000132356		0.393	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAA1	HGNC	protein_coding	OTTHUMT00000253833.2	22	0.00	0	A	NM_006251		40771909	40771909	-1	no_errors	ENST00000354209	ensembl	human	known	69_37n	silent	36	18.18	8	SNP	0.962	G
PRSS42	339906	genome.wustl.edu	37	3	46875230	46875230	+	Intron	SNP	C	C	T	rs112519542		TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr3:46875230C>T	ENST00000429665.1	-	2	214				PRSS42_ENST00000447340.1_Silent_p.A10A	NM_182702.1	NP_874361.1	Q7Z5A4	PRS42_HUMAN	protease, serine, 42						germ cell development (GO:0007281)|spermatogenesis (GO:0007283)	anchored component of plasma membrane (GO:0046658)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	8						CTCCCCCGGGCGCCCCGACGA	0.642																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS46816.1	3p21.31	2010-05-07			ENSG00000178055	ENSG00000178055		"""Serine peptidases / Serine peptidases"""	30716	protein-coding gene	gene with protein product	"""testis serine protease 2"""					12838346	Standard	NM_182702		Approved	TESSP2	uc011bap.2	Q7Z5A4	OTTHUMG00000156496	ENST00000429665.1:c.215-64G>A	3.37:g.46875230C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like	p.A10	ENST00000429665.1	37	c.30	CCDS46816.1	3																																																																																			PRSS42	-	NULL	ENSG00000178055		0.642	PRSS42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS42	HGNC	protein_coding	OTTHUMT00000344347.1	10	0.00	0	C	NM_182702		46875230	46875230	-1	no_errors	ENST00000447340	ensembl	human	putative	69_37n	silent	12	25.00	4	SNP	0.000	T
RELN	5649	genome.wustl.edu	37	7	103131244	103131244	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr7:103131244C>T	ENST00000428762.1	-	59	9635	c.9476G>A	c.(9475-9477)tGc>tAc	p.C3159Y	CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Missense_Mutation_p.C3159Y|RELN_ENST00000343529.5_Missense_Mutation_p.C3159Y	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3159					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GGAAGGAAGGCACTGGGTCTG	0.448																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											0													101.0	92.0	95.0					7																	103131244		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.9476G>A	7.37:g.103131244C>T	ENSP00000392423:p.Cys3159Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.C3159Y	ENST00000428762.1	37	c.9476	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822134	0.71028	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	T;T;T	0.57752	0.38;0.38;0.38	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.74306	0.3699	M	0.75615	2.305	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.994;0.997	T	0.76820	-0.2818	10	0.87932	D	0	.	19.3925	0.94590	0.0:1.0:0.0:0.0	.	3159;3159	P78509-2;P78509	.;RELN_HUMAN	Y	3159;3159;3159;676;3159	ENSP00000392423:C3159Y;ENSP00000345694:C3159Y;ENSP00000388446:C3159Y	ENSP00000345694:C3159Y	C	-	2	0	RELN	102918480	1.000000	0.71417	1.000000	0.80357	0.436000	0.31835	7.280000	0.78610	2.591000	0.87537	0.650000	0.86243	TGC	RELN	-	NULL	ENSG00000189056		0.448	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	38	0.00	0	C	NM_005045		103131244	103131244	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	61	26.51	22	SNP	1.000	T
PTPRN2	5799	genome.wustl.edu	37	7	157364169	157364169	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr7:157364169A>G	ENST00000389418.4	-	20	2809	c.2800T>C	c.(2800-2802)Tac>Cac	p.Y934H	PTPRN2_ENST00000409483.1_Missense_Mutation_p.Y896H|MIR153-2_ENST00000385225.1_RNA|PTPRN2_ENST00000389416.4_Missense_Mutation_p.Y917H|PTPRN2_ENST00000389413.3_Missense_Mutation_p.Y905H|PTPRN2_ENST00000404321.2_Missense_Mutation_p.Y957H	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	934	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CGGCCCCTGTAGCACTTGTTT	0.328																																						dbGAP											0													73.0	79.0	77.0					7																	157364169		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.2800T>C	7.37:g.157364169A>G	ENSP00000374069:p.Tyr934His	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.Y957H	ENST00000389418.4	37	c.2869	CCDS5947.1	7	.	.	.	.	.	.	.	.	.	.	A	21.1	4.092026	0.76756	.	.	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69	4.77	4.77	0.60923	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.071742	0.64402	D	0.000020	D	0.87826	0.6275	L	0.47016	1.485	0.58432	D	0.999998	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.78314	0.985;0.991;0.99;0.976;0.989	D	0.89134	0.3512	10	0.87932	D	0	.	14.3151	0.66443	1.0:0.0:0.0:0.0	.	957;896;905;917;934	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	H	896;905;917;934;957	ENSP00000387114:Y896H;ENSP00000374064:Y905H;ENSP00000374067:Y917H;ENSP00000374069:Y934H;ENSP00000385464:Y957H	ENSP00000374064:Y905H	Y	-	1	0	PTPRN2	157056930	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.511000	0.90535	1.763000	0.52060	0.460000	0.39030	TAC	PTPRN2	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000155093		0.328	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	HGNC	protein_coding	OTTHUMT00000353214.1	35	0.00	0	A			157364169	157364169	-1	no_errors	ENST00000404321	ensembl	human	known	69_37n	missense	37	15.91	7	SNP	1.000	G
RPAP1	26015	genome.wustl.edu	37	15	41820178	41820178	+	Silent	SNP	G	G	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr15:41820178G>A	ENST00000304330.4	-	11	1424	c.1308C>T	c.(1306-1308)agC>agT	p.S436S	RPAP1_ENST00000561603.1_Silent_p.S436S|RPAP1_ENST00000568413.1_5'Flank	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	436						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CCAAAAGGAGGCTTAAGACAC	0.557																																						dbGAP											0													51.0	43.0	46.0					15																	41820178		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.1308C>T	15.37:g.41820178G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Silent	SNP	pfam_RNA_pol_II_AP1_C,pfam_RNA_pol_II_AP1_N,superfamily_ARM-type_fold	p.S436	ENST00000304330.4	37	c.1308	CCDS10079.1	15																																																																																			RPAP1	-	superfamily_ARM-type_fold	ENSG00000103932		0.557	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP1	HGNC	protein_coding	OTTHUMT00000252694.2	24	0.00	0	G	NM_015540		41820178	41820178	-1	no_errors	ENST00000304330	ensembl	human	known	69_37n	silent	13	43.48	10	SNP	0.851	A
SCN4A	6329	genome.wustl.edu	37	17	62034778	62034778	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr17:62034778A>G	ENST00000435607.1	-	13	2196	c.2120T>C	c.(2119-2121)cTg>cCg	p.L707P	SCN4A_ENST00000578147.1_Missense_Mutation_p.L707P	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	707					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GATGATAGCCAGCACCAGCGT	0.567																																						dbGAP											0													112.0	123.0	119.0					17																	62034778		2199	4299	6498	-	-	-	SO:0001583	missense	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.2120T>C	17.37:g.62034778A>G	ENSP00000396320:p.Leu707Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.L707P	ENST00000435607.1	37	c.2120	CCDS45761.1	17	.	.	.	.	.	.	.	.	.	.	A	20.1	3.931543	0.73442	.	.	ENSG00000007314	ENST00000435607	D	0.98876	-5.2	3.66	3.66	0.41972	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.99486	0.9817	H	0.99238	4.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97862	1.0281	10	0.87932	D	0	.	11.9578	0.52991	1.0:0.0:0.0:0.0	.	707	P35499	SCN4A_HUMAN	P	707	ENSP00000396320:L707P	ENSP00000396320:L707P	L	-	2	0	SCN4A	59388510	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.087000	0.94110	1.678000	0.50952	0.459000	0.35465	CTG	SCN4A	-	pfam_Ion_trans_dom	ENSG00000007314		0.567	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		61	0.00	0	A	NM_000334		62034778	62034778	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	missense	147	10.91	18	SNP	1.000	G
SFI1	9814	genome.wustl.edu	37	22	31998278	31998278	+	Splice_Site	SNP	T	T	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr22:31998278T>C	ENST00000400288.2	+	16	1730	c.1625T>C	c.(1624-1626)aTg>aCg	p.M542T	SFI1_ENST00000540643.1_Splice_Site_p.M487T|SFI1_ENST00000432498.1_Splice_Site_p.M511T|SFI1_ENST00000400289.1_Splice_Site_p.M460T|SFI1_ENST00000443011.1_Splice_Site_p.M389T|SFI1_ENST00000414585.1_Splice_Site_p.M389T|SFI1_ENST00000443326.1_Splice_Site_p.M460T	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	542					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GCAGAGAGAATGGTAAATGGC	0.502																																						dbGAP											0													93.0	92.0	93.0					22																	31998278		1954	4135	6089	-	-	-	SO:0001630	splice_region_variant	0			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.1626+1T>C	22.37:g.31998278T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	superfamily_Cyclin-like	p.M542T	ENST00000400288.2	37	c.1625	CCDS43004.1	22	.	.	.	.	.	.	.	.	.	.	T	11.05	1.526108	0.27299	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000421060;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288;ENST00000417682	T;T;T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6	5.49	5.49	0.81192	.	0.267081	0.42420	D	0.000710	T	0.31451	0.0797	N	0.08118	0	0.35620	D	0.809384	P;P;D;P;P;D	0.58970	0.935;0.804;0.984;0.835;0.804;0.984	P;B;D;B;B;P	0.66716	0.493;0.311;0.946;0.39;0.288;0.888	T	0.43196	-0.9406	10	0.28530	T	0.3	.	11.9829	0.53129	0.0:0.0:0.0:1.0	.	487;460;460;511;542;518	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3;A8K8P3-5	.;.;.;.;SFI1_HUMAN;.	T	511;487;460;518;389;389;460;542;157	ENSP00000402679:M511T;ENSP00000443025:M487T;ENSP00000416469:M460T;ENSP00000397148:M389T;ENSP00000401199:M389T;ENSP00000383146:M460T;ENSP00000383145:M542T;ENSP00000398871:M157T	ENSP00000383145:M542T	M	+	2	0	SFI1	30328278	1.000000	0.71417	0.999000	0.59377	0.266000	0.26442	1.562000	0.36353	2.091000	0.63221	0.459000	0.35465	ATG	SFI1	-	NULL	ENSG00000198089		0.502	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFI1	HGNC	protein_coding	OTTHUMT00000337180.3	60	0.00	0	T	NM_014775	Missense_Mutation	31998278	31998278	+1	no_errors	ENST00000400288	ensembl	human	known	69_37n	missense	40	28.57	16	SNP	1.000	C
SFRP4	6424	genome.wustl.edu	37	7	37947171	37947171	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr7:37947171C>G	ENST00000436072.2	-	6	1328	c.951G>C	c.(949-951)aaG>aaC	p.K317N	EPDR1_ENST00000476620.1_Intron	NM_003014.3	NP_003005.2	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related protein 4	317					brain development (GO:0007420)|cell differentiation (GO:0030154)|decidualization (GO:0046697)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|menstrual cycle phase (GO:0022601)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of sodium-dependent phosphate transport (GO:2000119)|phosphate ion homeostasis (GO:0055062)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of receptor internalization (GO:0002092)|response to hormone (GO:0009725)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						GAGGCTTTCCCTTTGGTTTGG	0.512																																						dbGAP											0													144.0	142.0	143.0					7																	37947171		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF026692	CCDS5453.1	7p14.1	2008-07-18			ENSG00000106483	ENSG00000106483		"""Secreted frizzled-related proteins"""	10778	protein-coding gene	gene with protein product		606570				10211996	Standard	NM_003014		Approved	frpHE, FRP-4, FRPHE	uc003tfo.4	Q6FHJ7	OTTHUMG00000023026	ENST00000436072.2:c.951G>C	7.37:g.37947171C>G	ENSP00000410715:p.Lys317Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYC1|O14877|Q05BG7|Q1ZYW2|Q4G124|Q6FHM0|Q6PD64	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.K317N	ENST00000436072.2	37	c.951	CCDS5453.1	7	.	.	.	.	.	.	.	.	.	.	C	12.67	2.008432	0.35415	.	.	ENSG00000106483	ENST00000436072;ENST00000446575	T	0.64991	-0.13	5.83	2.97	0.34412	.	0.171292	0.41396	D	0.000885	T	0.39064	0.1064	N	0.19112	0.55	0.28380	N	0.919569	B	0.10296	0.003	B	0.04013	0.001	T	0.22695	-1.0209	10	0.49607	T	0.09	.	1.5929	0.02658	0.1456:0.4798:0.1413:0.2333	.	317	Q6FHJ7	SFRP4_HUMAN	N	317;314	ENSP00000410715:K317N	ENSP00000410715:K317N	K	-	3	2	SFRP4	37913696	0.998000	0.40836	0.999000	0.59377	0.905000	0.53344	0.393000	0.20817	0.747000	0.32809	-0.312000	0.09012	AAG	SFRP4	-	NULL	ENSG00000106483		0.512	SFRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP4	HGNC	protein_coding	OTTHUMT00000220017.2	63	0.00	0	C	NM_003014		37947171	37947171	-1	no_errors	ENST00000436072	ensembl	human	known	69_37n	missense	81	13.83	13	SNP	0.994	G
SLC13A4	26266	genome.wustl.edu	37	7	135377130	135377130	+	Silent	SNP	G	G	T	rs191462278	byFrequency	TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr7:135377130G>T	ENST00000354042.4	-	11	1850	c.1161C>A	c.(1159-1161)acC>acA	p.T387T	C7orf73_ENST00000422968.1_3'UTR	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	387					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						ACCACAGTACGGTCATCAGGA	0.433																																						dbGAP											0													66.0	75.0	72.0					7																	135377130		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.1161C>A	7.37:g.135377130G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Q4|Q8N631	Silent	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom,pfam_DctM	p.T387	ENST00000354042.4	37	c.1161	CCDS5840.1	7																																																																																			SLC13A4	-	pfam_Na/sul_symport	ENSG00000164707		0.433	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A4	HGNC	protein_coding	OTTHUMT00000340558.1	32	0.00	0	G	NM_012450		135377130	135377130	-1	no_errors	ENST00000354042	ensembl	human	known	69_37n	silent	17	19.05	4	SNP	0.000	T
SLC2A9	56606	genome.wustl.edu	37	4	9922065	9922065	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr4:9922065G>C	ENST00000264784.3	-	7	999	c.946C>G	c.(946-948)Cag>Gag	p.Q316E	RP13-560N11.1_ENST00000504249.1_RNA|SLC2A9_ENST00000506583.1_Missense_Mutation_p.Q287E|SLC2A9_ENST00000309065.3_Missense_Mutation_p.Q287E	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	316					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	GTGACCACCTGCCAGCGGACG	0.632																																						dbGAP											0													51.0	46.0	47.0					4																	9922065		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.946C>G	4.37:g.9922065G>C	ENSP00000264784:p.Gln316Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,tigrfam_Sugar/inositol_transpt	p.Q316E	ENST00000264784.3	37	c.946	CCDS3407.1	4	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873192	0.91664	.	.	ENSG00000109667	ENST00000506583;ENST00000264784;ENST00000309065	T;T;T	0.80653	-0.8;-1.4;-0.8	5.2	5.2	0.72013	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.91327	0.7265	M	0.89353	3.025	0.46678	D	0.999151	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.999	D	0.92518	0.6022	9	.	.	.	.	17.728	0.88370	0.0:0.0:1.0:0.0	.	287;316	Q9NRM0-2;Q9NRM0	.;GTR9_HUMAN	E	287;316;287	ENSP00000422209:Q287E;ENSP00000264784:Q316E;ENSP00000311383:Q287E	.	Q	-	1	0	SLC2A9	9531163	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.129000	0.94430	2.427000	0.82271	0.650000	0.86243	CAG	SLC2A9	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000109667		0.632	SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC2A9	HGNC	protein_coding	OTTHUMT00000207055.1	13	0.00	0	G			9922065	9922065	-1	no_errors	ENST00000264784	ensembl	human	known	69_37n	missense	18	37.93	11	SNP	1.000	C
SNX15	29907	genome.wustl.edu	37	11	64803030	64803030	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr11:64803030G>C	ENST00000377244.3	+	6	689	c.559G>C	c.(559-561)Gat>Cat	p.D187H	RP11-399J13.3_ENST00000301886.3_3'UTR|SNX15_ENST00000352068.5_Missense_Mutation_p.D187H	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15	187					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						GGAGGCCCTGGATCTCCTCTT	0.567																																					Esophageal Squamous(56;269 1304 3324 8253)	dbGAP											0													109.0	120.0	116.0					11																	64803030		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387	ENST00000377244.3:c.559G>C	11.37:g.64803030G>C	ENSP00000366452:p.Asp187His	Somatic		WXS	Illumina GAIIx	Phase_IV	E5KQS6|Q9NRS5	Missense_Mutation	SNP	pfam_MIT,pfam_Phox,superfamily_Phox,smart_Phox,smart_MIT,pfscan_Phox	p.D187H	ENST00000377244.3	37	c.559	CCDS8089.1	11	.	.	.	.	.	.	.	.	.	.	G	22.7	4.320412	0.81469	.	.	ENSG00000110025	ENST00000377244;ENST00000534637;ENST00000524831;ENST00000352068	T;T;T;T	0.52754	0.75;0.65;0.76;1.48	4.96	4.96	0.65561	.	0.497398	0.20233	N	0.096445	T	0.58119	0.2100	L	0.29908	0.895	0.58432	D	0.99999	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.936;0.998	T	0.61426	-0.7065	10	0.66056	D	0.02	-20.1452	15.7292	0.77788	0.0:0.0:1.0:0.0	.	187;187;187	E5KQS5;E5KQS6;Q9NRS6	.;.;SNX15_HUMAN	H	187;183;175;187	ENSP00000366452:D187H;ENSP00000437277:D183H;ENSP00000431690:D175H;ENSP00000316410:D187H	ENSP00000316410:D187H	D	+	1	0	SNX15	64559606	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	6.677000	0.74503	2.308000	0.77769	0.563000	0.77884	GAT	SNX15	-	NULL	ENSG00000110025		0.567	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX15	HGNC	protein_coding	OTTHUMT00000091004.3	39	0.00	0	G			64803030	64803030	+1	no_errors	ENST00000377244	ensembl	human	known	69_37n	missense	63	27.59	24	SNP	1.000	C
SNX32	254122	genome.wustl.edu	37	11	65620794	65620794	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr11:65620794G>C	ENST00000308342.6	+	13	1625	c.1200G>C	c.(1198-1200)aaG>aaC	p.K400N		NM_152760.2	NP_689973.2	Q86XE0	SNX32_HUMAN	sorting nexin 32	400					intracellular protein transport (GO:0006886)	endosome (GO:0005768)	phosphatidylinositol binding (GO:0035091)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				READ - Rectum adenocarcinoma(159;0.171)		TTGCCCTAAAGGGGGAGCCTT	0.577																																						dbGAP											0													105.0	107.0	106.0					11																	65620794		2201	4297	6498	-	-	-	SO:0001583	missense	0			AK055496	CCDS8113.2	11q13.1	2008-03-11	2008-03-11	2008-03-11	ENSG00000172803	ENSG00000172803		"""Sorting nexins"""	26423	protein-coding gene	gene with protein product			"""sorting nexin 6B"""	SNX6B		16782399	Standard	XM_005273871		Approved	FLJ30934	uc001ofr.3	Q86XE0	OTTHUMG00000128491	ENST00000308342.6:c.1200G>C	11.37:g.65620794G>C	ENSP00000310620:p.Lys400Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW53|Q96NG4	Missense_Mutation	SNP	pfam_Vps5_C,pfam_Phox,superfamily_Phox,pirsf_Snx5_Snx6,pfscan_Phox	p.K400N	ENST00000308342.6	37	c.1200	CCDS8113.2	11	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980040	0.53827	.	.	ENSG00000172803	ENST00000308342	T	0.22336	1.96	4.26	0.0927	0.14474	.	0.453515	0.18351	N	0.143878	T	0.32496	0.0831	L	0.59436	1.845	0.33214	D	0.553773	D	0.71674	0.998	D	0.75484	0.986	T	0.39210	-0.9625	10	0.45353	T	0.12	-16.5593	3.5176	0.07730	0.2945:0.0:0.5272:0.1783	.	400	Q86XE0	SNX32_HUMAN	N	400	ENSP00000310620:K400N	ENSP00000310620:K400N	K	+	3	2	SNX32	65377370	0.997000	0.39634	0.919000	0.36401	0.995000	0.86356	0.354000	0.20146	-0.155000	0.11098	0.561000	0.74099	AAG	SNX32	-	pirsf_Snx5_Snx6	ENSG00000172803		0.577	SNX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX32	HGNC	protein_coding	OTTHUMT00000250295.3	15	0.00	0	G	NM_152760		65620794	65620794	+1	no_errors	ENST00000308342	ensembl	human	known	69_37n	missense	28	51.72	30	SNP	0.992	C
SPINT1	6692	genome.wustl.edu	37	15	41145408	41145408	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr15:41145408G>T	ENST00000344051.4	+	3	796	c.562G>T	c.(562-564)Gat>Tat	p.D188Y	SPINT1_ENST00000431806.1_Missense_Mutation_p.D188Y|SPINT1_ENST00000562057.1_Missense_Mutation_p.D188Y			O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	188					branching involved in labyrinthine layer morphogenesis (GO:0060670)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|placenta blood vessel development (GO:0060674)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	16		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GGAAAACACAGATTGGCGCCT	0.617																																						dbGAP											0													137.0	131.0	133.0					15																	41145408		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10067.1, CCDS45231.1	15q13.3	2008-02-05	2005-08-17		ENSG00000166145	ENSG00000166145			11246	protein-coding gene	gene with protein product		605123	"""serine protease inhibitor, Kunitz type 1"""				Standard	XM_006720657		Approved	HAI, MANSC2	uc001zna.3	O43278	OTTHUMG00000130068	ENST00000344051.4:c.562G>T	15.37:g.41145408G>T	ENSP00000342098:p.Asp188Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z7D2	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,pfam_MANSC_N,pfam_LDrepeatLR_classA_rpt,superfamily_Prot_inh_Kunz-m,superfamily_LDrepeatLR_classA_rpt,superfamily_PKD_dom,smart_MANSC_N,smart_Prot_inh_Kunz-m,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_MANSC,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.D188Y	ENST00000344051.4	37	c.562	CCDS10067.1	15	.	.	.	.	.	.	.	.	.	.	G	10.93	1.490469	0.26686	.	.	ENSG00000166145	ENST00000344051;ENST00000536281;ENST00000431806	D;D	0.96427	-3.99;-4.01	5.33	3.46	0.39613	.	0.238905	0.47852	D	0.000205	D	0.97841	0.9291	M	0.88512	2.96	0.18873	N	0.999983	D;D;D	0.89917	0.999;1.0;0.999	P;D;D	0.71414	0.879;0.973;0.915	D	0.93376	0.6739	10	0.87932	D	0	-8.1639	9.0831	0.36565	0.1725:0.0:0.8275:0.0	.	188;188;188	B2RBU9;O43278-2;O43278	.;.;SPIT1_HUMAN	Y	188;155;188	ENSP00000342098:D188Y;ENSP00000409935:D188Y	ENSP00000342098:D188Y	D	+	1	0	SPINT1	38932700	0.987000	0.35691	0.005000	0.12908	0.001000	0.01503	2.011000	0.40922	0.631000	0.30412	-0.258000	0.10820	GAT	SPINT1	-	NULL	ENSG00000166145		0.617	SPINT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPINT1	HGNC	protein_coding	OTTHUMT00000252359.2	39	0.00	0	G	NM_003710		41145408	41145408	+1	no_errors	ENST00000344051	ensembl	human	known	69_37n	missense	35	33.96	18	SNP	0.204	T
ST3GAL2	6483	genome.wustl.edu	37	16	70428926	70428926	+	Silent	SNP	A	A	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr16:70428926A>G	ENST00000393640.4	-	2	2599	c.492T>C	c.(490-492)tcT>tcC	p.S164S	RP11-529K1.4_ENST00000566960.1_RNA|ST3GAL2_ENST00000342907.2_Silent_p.S164S			Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 2	164					amino sugar metabolic process (GO:0006040)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	11		Ovarian(137;0.0694)				GCCCATAGCCAGAGCCCCGCA	0.672																																						dbGAP											0													95.0	101.0	99.0					16																	70428926		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			U63090	CCDS10890.1	16q22.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000157350	ENSG00000157350	2.4.99.4	"""Sialyltransferases"""	10863	protein-coding gene	gene with protein product		607188	"""sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4B		9266697, 8920913	Standard	NM_006927		Approved	ST3GALII, ST3GalA.2	uc002eyx.2	Q16842	OTTHUMG00000137580	ENST00000393640.4:c.492T>C	16.37:g.70428926A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O00654	Silent	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.S164	ENST00000393640.4	37	c.492	CCDS10890.1	16																																																																																			ST3GAL2	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000157350		0.672	ST3GAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL2	HGNC	protein_coding	OTTHUMT00000268968.1	20	0.00	0	A	NM_006927		70428926	70428926	-1	no_errors	ENST00000342907	ensembl	human	known	69_37n	silent	18	47.06	16	SNP	0.941	G
SVEP1	79987	genome.wustl.edu	37	9	113233652	113233652	+	Missense_Mutation	SNP	C	C	A	rs61732547	byFrequency	TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr9:113233652C>A	ENST00000401783.2	-	16	3326	c.2990G>T	c.(2989-2991)cGt>cTt	p.R997L	SVEP1_ENST00000302728.8_Missense_Mutation_p.R997L|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.R974L	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	997					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						ACCACACATACGCCCTCTCAG	0.423																																						dbGAP											0													63.0	61.0	62.0					9																	113233652		1930	4150	6080	-	-	-	SO:0001583	missense	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.2990G>T	9.37:g.113233652C>A	ENSP00000384917:p.Arg997Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Growth_fac_rcpt,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.R997L	ENST00000401783.2	37	c.2990	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	C	29.6	5.018619	0.93404	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728	T;T;T	0.62364	0.03;0.03;0.03	5.49	5.49	0.81192	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	T	0.71281	0.3321	L	0.39633	1.23	0.48511	D	0.99966	D;D	0.89917	0.997;1.0	D;D	0.91635	0.987;0.999	T	0.63377	-0.6651	10	0.11794	T	0.64	.	19.3773	0.94517	0.0:1.0:0.0:0.0	.	997;997	E9PBN8;Q4LDE5	.;SVEP1_HUMAN	L	997;974;997	ENSP00000384917:R997L;ENSP00000363593:R974L;ENSP00000304118:R997L	ENSP00000304118:R997L	R	-	2	0	SVEP1	112273473	1.000000	0.71417	0.879000	0.34478	0.921000	0.55340	7.275000	0.78548	2.583000	0.87209	0.650000	0.86243	CGT	SVEP1	-	superfamily_Growth_fac_rcpt	ENSG00000165124		0.423	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding		49	0.00	0	C			113233652	113233652	-1	no_errors	ENST00000401783	ensembl	human	known	69_37n	missense	64	16.88	13	SNP	0.997	A
TGFB1	7040	genome.wustl.edu	37	19	41838160	41838160	+	Missense_Mutation	SNP	C	C	G	rs200164212		TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr19:41838160C>G	ENST00000221930.5	-	6	1753	c.887G>C	c.(886-888)cGg>cCg	p.R296P		NM_000660.4	NP_000651.3	P01137	TGFB1_HUMAN	transforming growth factor, beta 1	296					active induction of host immune response by virus (GO:0046732)|adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains (GO:0002460)|aging (GO:0007568)|ATP biosynthetic process (GO:0006754)|blood coagulation (GO:0007596)|branch elongation involved in mammary gland duct branching (GO:0060751)|cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cell-cell junction organization (GO:0045216)|cellular calcium ion homeostasis (GO:0006874)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to organic cyclic compound (GO:0071407)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation (GO:0002062)|common-partner SMAD protein phosphorylation (GO:0007182)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|defense response to fungus, incompatible interaction (GO:0009817)|digestive tract development (GO:0048565)|embryo development (GO:0009790)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|evasion or tolerance of host defenses by virus (GO:0019049)|extracellular matrix assembly (GO:0085029)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|face morphogenesis (GO:0060325)|female pregnancy (GO:0007565)|frontal suture morphogenesis (GO:0060364)|germ cell migration (GO:0008354)|hematopoietic progenitor cell differentiation (GO:0002244)|hyaluronan catabolic process (GO:0030214)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|lens fiber cell differentiation (GO:0070306)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lymph node development (GO:0048535)|macrophage derived foam cell differentiation (GO:0010742)|mammary gland branching involved in thelarche (GO:0060744)|MAPK cascade (GO:0000165)|mitotic cell cycle checkpoint (GO:0007093)|modulation by virus of host morphology or physiology (GO:0019048)|mononuclear cell proliferation (GO:0032943)|myelination (GO:0042552)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA replication (GO:0008156)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of extracellular matrix disassembly (GO:0010716)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of ossification (GO:0030279)|negative regulation of phagocytosis (GO:0050765)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|ossification involved in bone remodeling (GO:0043932)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|phosphate-containing compound metabolic process (GO:0006796)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of bone mineralization (GO:0030501)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of isotype switching to IgA isotypes (GO:0048298)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NAD+ ADP-ribosyltransferase activity (GO:1901666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of odontogenesis (GO:0042482)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein secretion (GO:0050714)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein export from nucleus (GO:0006611)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|receptor catabolic process (GO:0032801)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of binding (GO:0051098)|regulation of blood vessel remodeling (GO:0060312)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of cartilage development (GO:0061035)|regulation of cell migration (GO:0030334)|regulation of DNA binding (GO:0051101)|regulation of miRNA metabolic process (GO:2000628)|regulation of protein import into nucleus (GO:0042306)|regulation of sodium ion transport (GO:0002028)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulatory T cell differentiation (GO:0045066)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to laminar fluid shear stress (GO:0034616)|response to progesterone (GO:0032570)|response to radiation (GO:0009314)|response to vitamin D (GO:0033280)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|T cell homeostasis (GO:0043029)|tolerance induction to self antigen (GO:0002513)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|viral life cycle (GO:0019058)	axon (GO:0030424)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	antigen binding (GO:0003823)|cytokine activity (GO:0005125)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(1)|large_intestine(2)|lung(4)|skin(1)	8					Hyaluronidase(DB00070)	GTACAGCTGCCGCACGCAGCA	0.632																																						dbGAP											0													56.0	44.0	48.0					19																	41838160		2203	4300	6503	-	-	-	SO:0001583	missense	0			X02812	CCDS33031.1	19q13.1	2014-01-30	2007-02-16			ENSG00000105329		"""Endogenous ligands"""	11766	protein-coding gene	gene with protein product	"""Camurati-Engelmann disease"", ""prepro-transforming growth factor beta-1"""	190180		TGFB, DPD1		10631145, 10843814	Standard	NM_000660		Approved	CED, TGFbeta	uc002oqh.2	P01137		ENST00000221930.5:c.887G>C	19.37:g.41838160C>G	ENSP00000221930:p.Arg296Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K792|Q9UCG4	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,pirsf_TGF-beta,prints_TGFb1,prints_TGF-beta	p.R296P	ENST00000221930.5	37	c.887	CCDS33031.1	19	.	.	.	.	.	.	.	.	.	.	C	22.0	4.224123	0.79576	.	.	ENSG00000105329	ENST00000221930	D	0.85013	-1.93	4.72	4.72	0.59763	Transforming growth factor-beta, C-terminal (3);	0.123966	0.50627	D	0.000117	D	0.93151	0.7819	M	0.92970	3.365	0.52501	D	0.999955	D	0.89917	1.0	D	0.91635	0.999	D	0.93784	0.7086	10	0.87932	D	0	-28.6115	10.2384	0.43297	0.0:0.9078:0.0:0.0922	.	296	P01137	TGFB1_HUMAN	P	296	ENSP00000221930:R296P	ENSP00000221930:R296P	R	-	2	0	TGFB1	46530000	0.993000	0.37304	1.000000	0.80357	0.855000	0.48748	3.656000	0.54467	2.466000	0.83321	0.462000	0.41574	CGG	TGFB1	-	pfam_TGF-b_C,smart_TGF-b_C,pirsf_TGF-beta	ENSG00000105329		0.632	TGFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFB1	HGNC	protein_coding	OTTHUMT00000463500.2	27	0.00	0	C			41838160	41838160	-1	no_errors	ENST00000221930	ensembl	human	known	69_37n	missense	19	44.12	15	SNP	1.000	G
THOC2	57187	genome.wustl.edu	37	X	122754799	122754799	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chrX:122754799T>A	ENST00000245838.8	-	32	4265	c.4234A>T	c.(4234-4236)Att>Ttt	p.I1412F	THOC2_ENST00000491737.1_Missense_Mutation_p.I1297F|THOC2_ENST00000355725.4_Missense_Mutation_p.I1412F|THOC2_ENST00000497887.1_5'Flank	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	1412	Lys-rich.				mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						TGAGTATCAATTTTGCGGCGT	0.388																																						dbGAP											0													217.0	207.0	210.0					X																	122754799		2008	4164	6172	-	-	-	SO:0001583	missense	0			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.4234A>T	X.37:g.122754799T>A	ENSP00000245838:p.Ile1412Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	pfam_THO_THOC2_C,pfam_THO_THOC2_N	p.I1412F	ENST00000245838.8	37	c.4234	CCDS43988.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.64|10.64	1.407436|1.407436	0.25378|0.25378	.|.	.|.	ENSG00000125676|ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000416618;ENST00000491737|ENST00000448128;ENST00000441692	.|.	.|.	.|.	5.47|5.47	4.36|4.36	0.52297|0.52297	.|.	0.380204|.	0.24762|.	N|.	0.035806|.	T|T	0.40645|0.40645	0.1125|0.1125	N|N	0.19112|0.19112	0.55|0.55	0.49798|0.49798	D|D	0.99982|0.99982	B|.	0.24258|.	0.1|.	B|.	0.24006|.	0.05|.	T|T	0.39603|0.39603	-0.9606|-0.9606	9|6	0.48119|0.59425	T|D	0.1|0.04	-3.2136|-3.2136	4.8262|4.8262	0.13417|0.13417	0.0:0.148:0.2575:0.5944|0.0:0.148:0.2575:0.5944	.|.	1412|.	Q8NI27|.	THOC2_HUMAN|.	F|N	1412;1412;1;1297|7;179	.|.	ENSP00000245838:I1412F|ENSP00000415947:K147N	I|K	-|-	1|3	0|2	THOC2|THOC2	122582480|122582480	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.490000|3.490000	0.53245|0.53245	1.837000|1.837000	0.53436|0.53436	0.486000|0.486000	0.48141|0.48141	ATT|AAA	THOC2	-	NULL	ENSG00000125676		0.388	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC2	HGNC	protein_coding	OTTHUMT00000058153.3	47	0.00	0	T			122754799	122754799	-1	no_errors	ENST00000245838	ensembl	human	known	69_37n	missense	53	23.19	16	SNP	1.000	A
TMEM171	134285	genome.wustl.edu	37	5	72419255	72419255	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr5:72419255A>T	ENST00000454765.2	+	2	528	c.55A>T	c.(55-57)Agc>Tgc	p.S19C	TMEM171_ENST00000287773.5_Missense_Mutation_p.S19C			Q8WVE6	TM171_HUMAN	transmembrane protein 171	19						integral component of membrane (GO:0016021)				endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)	15		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.87e-54)|Lung(70;0.115)		CAGACACGTCAGCAAACTCAT	0.567																																					NSCLC(112;638 2280 27369 30736)	dbGAP											0													118.0	113.0	115.0					5																	72419255		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC018083	CCDS4017.1, CCDS54869.1	5q13.2	2008-02-05			ENSG00000157111	ENSG00000157111			27031	protein-coding gene	gene with protein product						12477932	Standard	NM_173490		Approved	PRP2	uc003kcm.2	Q8WVE6	OTTHUMG00000131269	ENST00000454765.2:c.55A>T	5.37:g.72419255A>T	ENSP00000415030:p.Ser19Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N0S1|Q8TDT7	Missense_Mutation	SNP	NULL	p.S19C	ENST00000454765.2	37	c.55	CCDS4017.1	5	.	.	.	.	.	.	.	.	.	.	A	16.37	3.105346	0.56291	.	.	ENSG00000157111	ENST00000454765;ENST00000287773	T;T	0.27256	1.68;1.68	5.09	5.09	0.68999	.	0.124872	0.56097	D	0.000036	T	0.43077	0.1231	M	0.74881	2.28	0.35995	D	0.836948	D;D	0.58268	0.982;0.982	P;P	0.55999	0.789;0.789	T	0.58278	-0.7664	10	0.66056	D	0.02	-15.7773	10.9073	0.47088	0.9238:0.0:0.0762:0.0	.	19;19	Q8WVE6-2;Q8WVE6	.;TM171_HUMAN	C	19	ENSP00000415030:S19C;ENSP00000287773:S19C	ENSP00000287773:S19C	S	+	1	0	TMEM171	72455011	0.995000	0.38212	0.994000	0.49952	0.541000	0.35023	2.222000	0.42926	1.922000	0.55676	0.379000	0.24179	AGC	TMEM171	-	NULL	ENSG00000157111		0.567	TMEM171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM171	HGNC	protein_coding	OTTHUMT00000254037.2	66	0.00	0	A	NM_173490		72419255	72419255	+1	no_errors	ENST00000454765	ensembl	human	known	69_37n	missense	64	35.35	35	SNP	0.991	T
TMEM74	157753	genome.wustl.edu	37	8	109797275	109797275	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr8:109797275G>A	ENST00000297459.3	-	2	231	c.53C>T	c.(52-54)gCc>gTc	p.A18V	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	18					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			CCAGTCCCTGGCATCACAGAG	0.552																																						dbGAP											0													46.0	46.0	46.0					8																	109797275		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.53C>T	8.37:g.109797275G>A	ENSP00000297459:p.Ala18Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A18V	ENST00000297459.3	37	c.53	CCDS6310.1	8	.	.	.	.	.	.	.	.	.	.	G	1.642	-0.516159	0.04200	.	.	ENSG00000164841	ENST00000297459	.	.	.	5.9	1.62	0.23740	.	0.681105	0.13793	N	0.362397	T	0.24470	0.0593	L	0.27053	0.805	0.09310	N	1	B	0.19583	0.037	B	0.18561	0.022	T	0.15752	-1.0426	9	0.21540	T	0.41	-2.9575	5.1679	0.15096	0.0682:0.2749:0.4349:0.222	.	18	Q96NL1	TMM74_HUMAN	V	18	.	ENSP00000297459:A18V	A	-	2	0	TMEM74	109866451	0.000000	0.05858	0.003000	0.11579	0.002000	0.02628	-0.075000	0.11431	0.863000	0.35553	-0.122000	0.15005	GCC	TMEM74	-	NULL	ENSG00000164841		0.552	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM74	HGNC	protein_coding	OTTHUMT00000380755.1	20	0.00	0	G	NM_153015		109797275	109797275	-1	no_errors	ENST00000297459	ensembl	human	known	69_37n	missense	24	33.33	12	SNP	0.000	A
TMX3	54495	genome.wustl.edu	37	18	66354909	66354909	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr18:66354909T>A	ENST00000299608.2	-	10	1047	c.731A>T	c.(730-732)gAc>gTc	p.D244V	TMX3_ENST00000566887.1_5'Flank	NM_019022.3	NP_061895.3	Q96JJ7	TMX3_HUMAN	thioredoxin-related transmembrane protein 3	244					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	17						GTTACCTGTGTCTCCAAGTTC	0.328																																						dbGAP											0													161.0	144.0	149.0					18																	66354909		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647846	CCDS32840.1	18q22	2011-10-19	2009-02-23	2009-02-23		ENSG00000166479		"""Protein disulfide isomerases"""	24718	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 13"""		"""thioredoxin domain containing 10"""	TXNDC10		15623505	Standard	NM_019022		Approved	FLJ20793, KIAA1830, PDIA13	uc002lkf.3	Q96JJ7		ENST00000299608.2:c.731A>T	18.37:g.66354909T>A	ENSP00000299608:p.Asp244Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV75|Q52LT7|Q8N5J0|Q9NWJ9	Missense_Mutation	SNP	pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Thioredoxin	p.D244V	ENST00000299608.2	37	c.731	CCDS32840.1	18	.	.	.	.	.	.	.	.	.	.	T	24.1	4.497385	0.85069	.	.	ENSG00000166479	ENST00000299608;ENST00000544714	T	0.30182	1.54	5.57	5.57	0.84162	.	0.046058	0.85682	D	0.000000	T	0.48484	0.1502	L	0.57536	1.79	0.80722	D	1	D	0.62365	0.991	P	0.61658	0.892	T	0.39210	-0.9625	10	0.40728	T	0.16	.	15.1775	0.72924	0.0:0.0:0.0:1.0	.	244	Q96JJ7	TMX3_HUMAN	V	244	ENSP00000299608:D244V	ENSP00000299608:D244V	D	-	2	0	TMX3	64505889	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	6.950000	0.75977	2.242000	0.73789	0.477000	0.44152	GAC	TMX3	-	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold	ENSG00000166479		0.328	TMX3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TMX3	HGNC	protein_coding	OTTHUMT00000420155.1	39	0.00	0	T	NM_019022		66354909	66354909	-1	no_errors	ENST00000299608	ensembl	human	known	69_37n	missense	32	30.43	14	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179604705	179604705	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr2:179604705delG	ENST00000591111.1	-	46	12528	c.12304delC	c.(12304-12306)ctafs	p.L4102fs	TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Frame_Shift_Del_p.L4419fs|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Frame_Shift_Del_p.L4248fs|TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Frame_Shift_Del_p.L4181fs|TTN_ENST00000460472.2_Frame_Shift_Del_p.L4056fs			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATATTTCTTAGCCACTCAGAG	0.478																																						dbGAP											0													91.0	92.0	92.0					2																	179604705		1949	4131	6080	-	-	-	SO:0001589	frameshift_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12304delC	2.37:g.179604705delG	ENSP00000465570:p.Leu4102fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L4248fs	ENST00000591111.1	37	c.12742		2																																																																																			TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.478	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	34	0.00	0	G	NM_133378		179604705	179604705	-1	no_errors	ENST00000342175	ensembl	human	known	69_37n	frame_shift_del	30	21.05	8	DEL	1.000	-
UBE4A	9354	genome.wustl.edu	37	11	118257271	118257271	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr11:118257271G>C	ENST00000431736.2	+	16	2624	c.2552G>C	c.(2551-2553)cGt>cCt	p.R851P	UBE4A_ENST00000545354.1_Missense_Mutation_p.R316P|UBE4A_ENST00000252108.3_Missense_Mutation_p.R844P					ubiquitination factor E4A											autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		CAGCTGGCACGTTTCCATAAC	0.478																																						dbGAP											0													168.0	172.0	170.0					11																	118257271		2200	4296	6496	-	-	-	SO:0001583	missense	0			D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.2552G>C	11.37:g.118257271G>C	ENSP00000387362:p.Arg851Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ub_conjug_fac_E4_core,pfam_Ubox_domain,smart_Ubox_domain	p.R851P	ENST00000431736.2	37	c.2552	CCDS8396.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.224738	0.95173	.	.	ENSG00000110344	ENST00000252108;ENST00000431736;ENST00000545354	T;T;T	0.52295	0.67;0.67;0.67	5.67	5.67	0.87782	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.71533	0.3351	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.986	T	0.73294	-0.4028	10	0.62326	D	0.03	-7.9501	19.7714	0.96367	0.0:0.0:1.0:0.0	.	844;851	Q14139;Q14139-2	UBE4A_HUMAN;.	P	844;851;316	ENSP00000252108:R844P;ENSP00000387362:R851P;ENSP00000438918:R316P	ENSP00000252108:R844P	R	+	2	0	UBE4A	117762481	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.823000	0.99369	2.666000	0.90696	0.655000	0.94253	CGT	UBE4A	-	pfam_Ub_conjug_fac_E4_core	ENSG00000110344		0.478	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBE4A	HGNC	protein_coding	OTTHUMT00000398143.1	22	0.00	0	G	NM_004788		118257271	118257271	+1	no_errors	ENST00000431736	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	C
USP19	10869	genome.wustl.edu	37	3	49152539	49152539	+	Silent	SNP	C	C	T			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr3:49152539C>T	ENST00000398888.2	-	13	2043	c.1725G>A	c.(1723-1725)gcG>gcA	p.A575A	USP19_ENST00000398892.3_Silent_p.A615A|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000434032.2_Silent_p.A676A|USP19_ENST00000398898.2_Silent_p.A615A|USP19_ENST00000398896.1_Silent_p.A383A|USP19_ENST00000453664.1_Silent_p.A666A|USP19_ENST00000417901.1_Silent_p.A678A	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	575	USP.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)	p.A663A(1)		NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGGCCTTACTCGCCACAATGG	0.602																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											61.0	65.0	64.0					3																	49152539		2133	4232	6365	-	-	-	SO:0001819	synonymous_variant	0			AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.1725G>A	3.37:g.49152539C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Silent	SNP	pfam_DUF1872,pfam_Peptidase_C19,pfam_Znf_MYND,pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain,pfscan_Znf_MYND,pfscan_Peptidase_C19	p.A575	ENST00000398888.2	37	c.1725	CCDS43090.1	3																																																																																			USP19	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000172046		0.602	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USP19	HGNC	protein_coding	OTTHUMT00000257721.1	33	0.00	0	C	NM_006677		49152539	49152539	-1	no_errors	ENST00000398888	ensembl	human	known	69_37n	silent	50	25.37	17	SNP	0.447	T
VASH2	79805	genome.wustl.edu	37	1	213139626	213139626	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr1:213139626delG	ENST00000517399.1	+	4	436	c.436delG	c.(436-438)gcafs	p.A146fs	VASH2_ENST00000366966.2_Frame_Shift_Del_p.A81fs|VASH2_ENST00000366964.3_Frame_Shift_Del_p.A4fs|VASH2_ENST00000366965.2_Intron|VASH2_ENST00000366968.4_Frame_Shift_Del_p.A81fs|VASH2_ENST00000366967.2_Frame_Shift_Del_p.A42fs|VASH2_ENST00000271776.4_3'UTR			Q86V25	VASH2_HUMAN	vasohibin 2	146					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)	cytoplasm (GO:0005737)				endometrium(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(81;0.00479)|all cancers(67;0.00844)|GBM - Glioblastoma multiforme(131;0.0496)|Epithelial(68;0.0986)		AATGGAAACAGCAAAAGAAAT	0.433																																						dbGAP											0													248.0	215.0	225.0					1																	213139626		692	1591	2283	-	-	-	SO:0001589	frameshift_variant	0			AK022567	CCDS1511.1, CCDS44315.1, CCDS44316.1, CCDS73026.1	1q23	2008-02-05			ENSG00000143494	ENSG00000143494			25723	protein-coding gene	gene with protein product		610471				16528006	Standard	XR_247041		Approved	FLJ12505	uc001hjw.3	Q86V25	OTTHUMG00000036925	ENST00000517399.1:c.436delG	1.37:g.213139626delG	ENSP00000428324:p.Ala146fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYZ5|Q2VT46|Q5VTE7|Q5VTE9|Q7Z6E3|Q8IZ24|Q9H9W5	Frame_Shift_Del	DEL	NULL	p.A146fs	ENST00000517399.1	37	c.436	CCDS1511.1	1																																																																																			VASH2	-	NULL	ENSG00000143494		0.433	VASH2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	VASH2	HGNC	protein_coding	OTTHUMT00000381686.1	58	0.00	0	G	NM_024749		213139626	213139626	+1	no_errors	ENST00000517399	ensembl	human	known	69_37n	frame_shift_del	132	18.90	31	DEL	1.000	-
WBP2NL	164684	genome.wustl.edu	37	22	42422812	42422812	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr22:42422812C>G	ENST00000328823.9	+	6	588	c.557C>G	c.(556-558)cCt>cGt	p.P186R	WBP2NL_ENST00000543212.1_Missense_Mutation_p.P112R	NM_152613.2	NP_689826.2	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like	186	10 X 7 AA tandem repeat of Y-G-X-P-P-X-G.|Gly-rich.				egg activation (GO:0007343)|male pronucleus assembly (GO:0035039)|meiotic nuclear division (GO:0007126)	perinuclear theca (GO:0033011)	WW domain binding (GO:0050699)			breast(2)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)	14						GGAGCCCCACCTCCCGGATAC	0.512																																						dbGAP											0													89.0	104.0	99.0					22																	42422812		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022546	CCDS14029.1	22q13.2	2007-07-18			ENSG00000183066	ENSG00000183066			28389	protein-coding gene	gene with protein product	"""postacrosomal sheath WW domain-binding protein"""	610981				17289678	Standard	NM_152613		Approved	FLJ26145, MGC26816, PAWP	uc003bbt.3	Q6ICG8	OTTHUMG00000151270	ENST00000328823.9:c.557C>G	22.37:g.42422812C>G	ENSP00000332983:p.Pro186Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFF7|A8MSG5|B3KXX4|Q8TBF0|Q8TBF3	Missense_Mutation	SNP	pfam_WW-domain-binding,pfam_GRAM	p.P186R	ENST00000328823.9	37	c.557	CCDS14029.1	22	.	.	.	.	.	.	.	.	.	.	C	15.30	2.791233	0.50102	.	.	ENSG00000183066	ENST00000328823;ENST00000543212	T;T	0.40476	1.03;1.03	4.11	1.94	0.25998	WW-domain-binding protein (1);	.	.	.	.	T	0.53270	0.1786	L	0.61036	1.89	0.31617	N	0.650799	D	0.64830	0.994	D	0.63283	0.913	T	0.56980	-0.7889	9	0.56958	D	0.05	.	6.7453	0.23458	0.1757:0.7266:0.0:0.0977	.	186	Q6ICG8	WBP2L_HUMAN	R	186;112	ENSP00000332983:P186R;ENSP00000442447:P112R	ENSP00000332983:P186R	P	+	2	0	WBP2NL	40752758	0.000000	0.05858	0.005000	0.12908	0.021000	0.10359	0.897000	0.28390	0.481000	0.27557	0.650000	0.86243	CCT	WBP2NL	-	pfam_WW-domain-binding	ENSG00000183066		0.512	WBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP2NL	HGNC	protein_coding	OTTHUMT00000322037.1	33	0.00	0	C	NM_152613		42422812	42422812	+1	no_errors	ENST00000328823	ensembl	human	known	69_37n	missense	27	30.77	12	SNP	0.184	G
WDR72	256764	genome.wustl.edu	37	15	54015063	54015063	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr15:54015063T>A	ENST00000396328.1	-	3	435	c.196A>T	c.(196-198)Aca>Tca	p.T66S	WDR72_ENST00000559418.1_Missense_Mutation_p.T66S|WDR72_ENST00000557913.1_Missense_Mutation_p.T66S|WDR72_ENST00000360509.5_Missense_Mutation_p.T66S	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	66										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		GCCAAACATGTTACCGAAGCT	0.373																																						dbGAP											0													137.0	127.0	130.0					15																	54015063		2194	4293	6487	-	-	-	SO:0001583	missense	0			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.196A>T	15.37:g.54015063T>A	ENSP00000379619:p.Thr66Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T66S	ENST00000396328.1	37	c.196	CCDS10151.1	15	.	.	.	.	.	.	.	.	.	.	T	19.55	3.849357	0.71603	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.61510	0.1;0.1	5.68	5.68	0.88126	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.142496	0.49305	D	0.000155	T	0.67942	0.2947	M	0.67397	2.05	0.33615	D	0.604106	P	0.48640	0.913	P	0.53313	0.723	T	0.77981	-0.2383	10	0.46703	T	0.11	.	15.0975	0.72247	0.0:0.0:0.0:1.0	.	66	Q3MJ13	WDR72_HUMAN	S	66	ENSP00000379619:T66S;ENSP00000353699:T66S	ENSP00000353699:T66S	T	-	1	0	WDR72	51802355	1.000000	0.71417	0.186000	0.23195	0.904000	0.53231	5.829000	0.69316	2.165000	0.68154	0.460000	0.39030	ACA	WDR72	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000166415		0.373	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	HGNC	protein_coding	OTTHUMT00000254893.2	37	0.00	0	T	NM_182758		54015063	54015063	-1	no_errors	ENST00000360509	ensembl	human	known	69_37n	missense	29	35.56	16	SNP	0.982	A
YTHDC1	91746	genome.wustl.edu	37	4	69179981	69179981	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr4:69179981G>A	ENST00000344157.4	-	17	2355	c.2020C>T	c.(2020-2022)Cgg>Tgg	p.R674W	YTHDC1_ENST00000579690.1_Missense_Mutation_p.R682W|YTHDC1_ENST00000355665.3_Missense_Mutation_p.R656W	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	674	Arg-rich.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						CTACTTCTCCGGCCACTGACA	0.483																																						dbGAP											0													79.0	71.0	73.0					4																	69179981		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.2020C>T	4.37:g.69179981G>A	ENSP00000339245:p.Arg674Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	pfam_YTH_domain,pfscan_YTH_domain	p.R674W	ENST00000344157.4	37	c.2020	CCDS33992.1	4	.	.	.	.	.	.	.	.	.	.	G	16.99	3.274058	0.59649	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.28069	1.66;1.63	5.57	5.57	0.84162	.	0.055302	0.64402	D	0.000001	T	0.32285	0.0824	L	0.27053	0.805	0.58432	D	0.999999	D;D	0.71674	0.998;0.997	P;B	0.50754	0.649;0.446	T	0.06162	-1.0842	10	0.87932	D	0	.	14.4002	0.67037	0.0:0.0:0.8524:0.1476	.	656;674	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	W	674;656	ENSP00000339245:R674W;ENSP00000347888:R656W	ENSP00000339245:R674W	R	-	1	2	YTHDC1	68862576	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	4.570000	0.60872	2.628000	0.89032	0.591000	0.81541	CGG	YTHDC1	-	NULL	ENSG00000083896		0.483	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YTHDC1	HGNC	protein_coding	OTTHUMT00000251437.1	50	0.00	0	G	NM_133370		69179981	69179981	-1	no_errors	ENST00000344157	ensembl	human	known	69_37n	missense	61	17.57	13	SNP	0.999	A
ZBED2	79413	genome.wustl.edu	37	3	111312772	111312772	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr3:111312772C>A	ENST00000317012.4	-	2	1285	c.277G>T	c.(277-279)Gtg>Ttg	p.V93L	CD96_ENST00000438817.2_Intron|CD96_ENST00000283285.5_Intron|CD96_ENST00000352690.4_Intron	NM_024508.4	NP_078784.2	Q9BTP6	ZBED2_HUMAN	zinc finger, BED-type containing 2	93							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(1)|skin(2)	6						GTGGTGCCCACGTTGACCCCA	0.617																																						dbGAP											0													63.0	62.0	62.0					3																	111312772		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC003536	CCDS2960.2	3p13-q13.2	2013-05-03			ENSG00000177494	ENSG00000177494		"""Zinc fingers, BED-type"""	20710	protein-coding gene	gene with protein product		615246				23533661	Standard	NM_024508		Approved	MGC10796	uc003dxy.3	Q9BTP6	OTTHUMG00000074061	ENST00000317012.4:c.277G>T	3.37:g.111312772C>A	ENSP00000321370:p.Val93Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN62	Missense_Mutation	SNP	pfam_Znf_BED_prd,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.V93L	ENST00000317012.4	37	c.277	CCDS2960.2	3	.	.	.	.	.	.	.	.	.	.	C	18.44	3.625474	0.66901	.	.	ENSG00000177494	ENST00000317012	.	.	.	4.34	3.44	0.39384	Zinc finger, BED-type predicted (3);	0.000000	0.38111	U	0.001811	T	0.24699	0.0599	N	0.14661	0.345	0.09310	N	0.999999	P	0.44090	0.826	P	0.45913	0.497	T	0.04900	-1.0919	9	0.49607	T	0.09	-17.8256	7.4951	0.27483	0.0:0.8781:0.0:0.1219	.	93	Q9BTP6	ZBED2_HUMAN	L	93	.	ENSP00000321370:V93L	V	-	1	0	ZBED2	112795462	0.317000	0.24589	0.549000	0.28204	0.907000	0.53573	0.428000	0.21395	1.141000	0.42275	0.467000	0.42956	GTG	ZBED2	-	pfam_Znf_BED_prd,smart_Znf_BED_prd,pfscan_Znf_BED_prd	ENSG00000177494		0.617	ZBED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED2	HGNC	protein_coding	OTTHUMT00000157228.2	42	0.00	0	C	NM_024508		111312772	111312772	-1	no_errors	ENST00000317012	ensembl	human	known	69_37n	missense	34	35.85	19	SNP	0.368	A
ZCCHC11	23318	genome.wustl.edu	37	1	52901105	52901105	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr1:52901105G>C	ENST00000371544.3	-	27	4454	c.4192C>G	c.(4192-4194)Caa>Gaa	p.Q1398E	ZCCHC11_ENST00000257177.4_Missense_Mutation_p.Q1399E	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	1398	Gln-rich.				cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)	p.Q1399*(1)		NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						GCCACCTGTTGAGCATTTACA	0.433																																						dbGAP											1	Substitution - Nonsense(1)	lung(1)											114.0	98.0	103.0					1																	52901105		2203	4300	6503	-	-	-	SO:0001583	missense	0			D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.4192C>G	1.37:g.52901105G>C	ENSP00000360599:p.Gln1398Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Nonsense_Mutation	SNP	pfam_PAP_assoc,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.S243*	ENST00000371544.3	37	c.728	CCDS30716.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.8|22.8	4.334674|4.334674	0.81801|0.81801	.|.	.|.	ENSG00000134744|ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000531722|ENST00000474453	T;T|.	0.55413|.	0.57;0.52|.	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	0.220017|.	0.38837|.	N|.	0.001559|.	T|.	0.54615|.	0.1869|.	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	D|.	0.59767|.	0.986|.	D|.	0.69654|.	0.965|.	T|.	0.50750|.	-0.8791|.	10|.	0.66056|.	D|.	0.02|.	.|.	16.3003|16.3003	0.82806|0.82806	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1398|.	Q5TAX3|.	TUT4_HUMAN|.	E|X	1399;1398;236|243	ENSP00000257177:Q1399E;ENSP00000360599:Q1398E|.	ENSP00000257177:Q1399E|.	Q|S	-|-	1|2	0|0	ZCCHC11|ZCCHC11	52673693|52673693	1.000000|1.000000	0.71417|0.71417	0.981000|0.981000	0.43875|0.43875	0.993000|0.993000	0.82548|0.82548	7.587000|7.587000	0.82613|0.82613	2.390000|2.390000	0.81377|0.81377	0.467000|0.467000	0.42956|0.42956	CAA|TCA	ZCCHC11	-	NULL	ENSG00000134744		0.433	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZCCHC11	HGNC	protein_coding	OTTHUMT00000022462.1	38	0.00	0	G	XM_038288		52901105	52901105	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000474453	ensembl	human	novel	69_37n	nonsense	49	26.87	18	SNP	1.000	C
ZDHHC11B	653082	genome.wustl.edu	37	5	741736	741736	+	Missense_Mutation	SNP	G	G	T	rs61128505	byFrequency	TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr5:741736G>T	ENST00000382776.4	-	7	907	c.908C>A	c.(907-909)gCt>gAt	p.A303D	ZDHHC11_ENST00000424784.2_Intron|ZDHHC11B_ENST00000508859.2_Missense_Mutation_p.A314D			P0C7U3	ZH11B_HUMAN	zinc finger, DHHC-type containing 11B	303						integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			lung(3)|stomach(1)	4						CAGGGCGCCAGCTCCTTGCTG	0.438													.|||	4531	0.904752	0.972	0.9063	5008	,	,		21891	0.9702		0.8429	False		,,,				2504	0.8088					dbGAP											0																																										-	-	-	SO:0001583	missense	0					5p15.33	2007-01-29				ENSG00000206077		"""Zinc fingers, DHHC-type"""	32962	protein-coding gene	gene with protein product							Standard	XM_003118532		Approved			P0C7U3		ENST00000382776.4:c.908C>A	5.37:g.741736G>T	ENSP00000445280:p.Ala303Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHR3	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.A303D	ENST00000382776.4	37	c.908		5	.	.	.	.	.	.	.	.	.	.	t	0.021	-1.422845	0.01126	.	.	ENSG00000206077	ENST00000508859;ENST00000382776	T;T	0.28895	1.59;1.6	2.29	-3.8	0.04307	.	.	.	.	.	T	0.15132	0.0365	.	.	.	0.58432	P	1.999999999946489E-6	.	.	.	.	.	.	T	0.22312	-1.0220	5	0.29301	T	0.29	.	0.2495	0.00203	0.3527:0.2495:0.1642:0.2335	rs61128505	.	.	.	D	314;303	ENSP00000442373:A314D;ENSP00000445280:A303D	ENSP00000445280:A303D	A	-	2	0	ZDHHC11B	794736	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.473000	0.00988	-1.527000	0.01758	-1.667000	0.00748	GCT	ZDHHC11B	-	NULL	ENSG00000206077		0.438	ZDHHC11B-201	KNOWN	basic|appris_candidate	protein_coding	ZDHHC11B	HGNC	protein_coding		11	0.00	0	G	XM_926053		741736	741736	-1	no_errors	ENST00000382776	ensembl	human	known	69_37n	missense	29	38.30	18	SNP	0.000	T
ZNF407	55628	genome.wustl.edu	37	18	72345907	72345907	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr18:72345907G>T	ENST00000299687.5	+	1	2932	c.2932G>T	c.(2932-2934)Gat>Tat	p.D978Y	ZNF407_ENST00000577538.1_Missense_Mutation_p.D978Y|ZNF407_ENST00000309902.6_Missense_Mutation_p.D978Y|ZNF407_ENST00000582337.1_Missense_Mutation_p.D978Y	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	978					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		TCATTCTCTAGATGGAGAAGT	0.448																																						dbGAP											0													45.0	46.0	46.0					18																	72345907		1883	4122	6005	-	-	-	SO:0001583	missense	0			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.2932G>T	18.37:g.72345907G>T	ENSP00000299687:p.Asp978Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.D978Y	ENST00000299687.5	37	c.2932	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	G	12.14	1.848795	0.32699	.	.	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.12879	2.64;3.06	5.81	4.92	0.64577	.	0.413516	0.23365	N	0.048964	T	0.19167	0.0460	L	0.27053	0.805	0.33518	D	0.59203	P;D;P	0.53312	0.928;0.959;0.933	P;P;P	0.58210	0.772;0.835;0.564	T	0.19745	-1.0296	10	0.54805	T	0.06	.	10.1199	0.42614	0.0708:0.1382:0.7911:0.0	.	978;978;978	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	Y	978	ENSP00000299687:D978Y;ENSP00000310359:D978Y	ENSP00000299687:D978Y	D	+	1	0	ZNF407	70474895	1.000000	0.71417	0.884000	0.34674	0.021000	0.10359	4.739000	0.62080	1.034000	0.39945	0.455000	0.32223	GAT	ZNF407	-	NULL	ENSG00000215421		0.448	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1	10	0.00	0	G	NM_017757		72345907	72345907	+1	no_errors	ENST00000299687	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.854	T
ZNF831	128611	genome.wustl.edu	37	20	57768111	57768111	+	Silent	SNP	T	T	A			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr20:57768111T>A	ENST00000371030.2	+	1	2037	c.2037T>A	c.(2035-2037)ccT>ccA	p.P679P		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	679							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GGAGGACCCCTGTCCATGAGG	0.617																																						dbGAP											0													35.0	43.0	40.0					20																	57768111		2064	4197	6261	-	-	-	SO:0001819	synonymous_variant	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2037T>A	20.37:g.57768111T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDR4|Q8TCP0	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P679	ENST00000371030.2	37	c.2037	CCDS42894.1	20																																																																																			ZNF831	-	NULL	ENSG00000124203		0.617	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	14	0.00	0	T	NM_178457		57768111	57768111	+1	no_errors	ENST00000371030	ensembl	human	novel	69_37n	silent	27	28.95	11	SNP	0.000	A
ZNF835	90485	genome.wustl.edu	37	19	57176314	57176314	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LA-01A-11D-A142-09	TCGA-E2-A1LA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bdcd4800-3258-446f-b6e5-3c8e2f46c656	d3d4282c-2865-42e6-b9b3-0d69ffd11ccb	g.chr19:57176314C>T	ENST00000537055.2	-	2	484	c.253G>A	c.(253-255)Gcg>Acg	p.A85T		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	85					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						TCCCCAGGCGCGCTGCACCTC	0.647																																						dbGAP											0													53.0	58.0	57.0					19																	57176314		2083	4229	6312	-	-	-	SO:0001583	missense	0			AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.253G>A	19.37:g.57176314C>T	ENSP00000444747:p.Ala85Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5Y0|G3V1S0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A85T	ENST00000537055.2	37	c.253	CCDS56105.1	19	.	.	.	.	.	.	.	.	.	.	C	10.74	1.435861	0.25813	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.06608	3.28	2.58	-0.903	0.10534	.	.	.	.	.	T	0.03178	0.0093	N	0.14661	0.345	0.09310	N	1	B	0.22146	0.065	B	0.12837	0.008	T	0.43130	-0.9410	9	0.41790	T	0.15	.	2.7824	0.05364	0.0:0.4335:0.2526:0.3139	.	107	Q9Y2P0	ZN835_HUMAN	T	107;85	ENSP00000444747:A85T	ENSP00000341756:A107T	A	-	1	0	ZNF835	61868126	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.972000	0.03802	0.024000	0.15214	0.561000	0.74099	GCG	ZNF835	-	NULL	ENSG00000127903		0.647	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF835	HGNC	protein_coding	OTTHUMT00000459800.1	62	0.00	0	C	NM_001005850		57176314	57176314	-1	no_errors	ENST00000537055	ensembl	human	known	69_37n	missense	57	26.58	21	SNP	0.000	T
