#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABO	28	genome.wustl.edu	37	9	136131308	136131308	+	RNA	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr9:136131308G>A	ENST00000453660.2	-	0	820				RP11-430N14.4_ENST00000606717.1_RNA			P16442	BGAT_HUMAN	ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)						protein glycosylation (GO:0006486)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	fucosylgalactoside 3-alpha-galactosyltransferase activity (GO:0004381)|glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity (GO:0004380)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|prostate(1)|stomach(2)	11				OV - Ovarian serous cystadenocarcinoma(145;5.82e-06)|Epithelial(140;3.45e-05)		CCGACCCCCCGAAGAACCCCC	0.672																																						dbGAP											0													22.0	25.0	24.0					9																	136131308		1966	4139	6105	-	-	-			0			AF134415		9q34.2	2014-07-19			ENSG00000175164	ENSG00000175164	2.4.1.40, 2.4.1.37	"""Blood group antigens"", ""Glycosyltransferase family 6 domain containing"""	79	protein-coding gene	gene with protein product		110300				184030	Standard	NM_020469		Approved	A3GALNT, A3GALT1	uc004cda.1	P16442	OTTHUMG00000020872		9.37:g.136131308G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0JDB9|O14758|Q14490|Q53I57|Q6ISD4|Q6KFZ2|Q70V27|Q99484|Q99485|Q9NY01|Q9UQ68|Q9UQ69	RNA	SNP	-	NULL	ENST00000453660.2	37	NULL		9																																																																																			ABO	-	-	ENSG00000175164		0.672	ABO-001	KNOWN	basic	processed_transcript	ABO	HGNC	processed_transcript	OTTHUMT00000054907.4	48	0.00	0	G	NM_020469		136131308	136131308	-1	no_errors	ENST00000453660	ensembl	human	known	69_37n	rna	55	15.38	10	SNP	0.998	A
ACRBP	84519	genome.wustl.edu	37	12	6756501	6756501	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr12:6756501G>T	ENST00000229243.2	-	1	125	c.32C>A	c.(31-33)tCa>tAa	p.S11*	ACRBP_ENST00000414226.2_Nonsense_Mutation_p.S11*|ACRBP_ENST00000536350.1_Nonsense_Mutation_p.S11*	NM_032489.2	NP_115878.2			acrosin binding protein											NS(1)|breast(1)|central_nervous_system(1)|large_intestine(8)|lung(5)|ovary(1)	17						CTTCAGGAGTGAGGGAAGGAA	0.617																																						dbGAP											0													33.0	33.0	33.0					12																	6756501		2178	4277	6455	-	-	-	SO:0001587	stop_gained	0			AB051833	CCDS8554.1	12p13.31	2009-03-12			ENSG00000111644	ENSG00000111644			17195	protein-coding gene	gene with protein product	"""proacrosin binding protein sp32"", ""cancer/testis antigen 23"""	608352				11248070	Standard	NM_032489		Approved	SP32, OY-TES-1, CT23	uc001qpu.1	Q8NEB7	OTTHUMG00000168715	ENST00000229243.2:c.32C>A	12.37:g.6756501G>T	ENSP00000229243:p.Ser11*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Proacrosin-bd	p.S11*	ENST00000229243.2	37	c.32	CCDS8554.1	12	.	.	.	.	.	.	.	.	.	.	G	14.40	2.523785	0.44866	.	.	ENSG00000111644	ENST00000229243;ENST00000414226;ENST00000536350;ENST00000546114	.	.	.	4.05	3.14	0.36123	.	1.029310	0.07763	N	0.950485	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-2.0E-4	6.9031	0.24293	0.1301:0.0:0.8699:0.0	.	.	.	.	X	11	.	ENSP00000229243:S11X	S	-	2	0	ACRBP	6626762	0.506000	0.26139	0.021000	0.16686	0.078000	0.17371	1.767000	0.38501	1.011000	0.39340	0.549000	0.68633	TCA	ACRBP	-	pfam_Proacrosin-bd	ENSG00000111644		0.617	ACRBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACRBP	HGNC	protein_coding	OTTHUMT00000400703.1	46	0.00	0	G	NM_032489		6756501	6756501	-1	no_errors	ENST00000229243	ensembl	human	known	69_37n	nonsense	23	36.11	13	SNP	0.023	T
ADAMTSL3	57188	genome.wustl.edu	37	15	84651682	84651682	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr15:84651682G>A	ENST00000286744.5	+	21	3526	c.3302G>A	c.(3301-3303)aGa>aAa	p.R1101K	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.R1101K	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1101						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			GAGCTGATAAGAAACATGAGT	0.483																																						dbGAP											0													80.0	77.0	78.0					15																	84651682		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.3302G>A	15.37:g.84651682G>A	ENSP00000286744:p.Arg1101Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like,prints_Peptidase_M12B_ADAM-TS	p.R1101K	ENST00000286744.5	37	c.3302	CCDS10326.1	15	.	.	.	.	.	.	.	.	.	.	G	11.75	1.731817	0.30684	.	.	ENSG00000156218	ENST00000286744	T	0.64260	-0.09	5.43	2.08	0.27032	.	0.704877	0.11801	N	0.528149	T	0.50222	0.1603	L	0.43923	1.385	0.09310	N	1	B;B	0.12013	0.001;0.005	B;B	0.12156	0.005;0.007	T	0.34129	-0.9841	10	0.18710	T	0.47	.	9.5067	0.39051	0.375:0.0:0.625:0.0	.	1101;1101	P82987-2;P82987	.;ATL3_HUMAN	K	1101	ENSP00000286744:R1101K	ENSP00000286744:R1101K	R	+	2	0	ADAMTSL3	82442686	0.992000	0.36948	0.564000	0.28396	0.815000	0.46073	1.564000	0.36375	0.661000	0.30985	0.557000	0.71058	AGA	ADAMTSL3	-	NULL	ENSG00000156218		0.483	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	HGNC	protein_coding	OTTHUMT00000304007.2	23	0.00	0	G	NM_207517		84651682	84651682	+1	no_errors	ENST00000286744	ensembl	human	known	69_37n	missense	9	52.63	10	SNP	0.228	A
AGAP7P	653268	genome.wustl.edu	37	10	51465571	51465571	+	Silent	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr10:51465571G>A	ENST00000374095.5	-	7	1010	c.885C>T	c.(883-885)agC>agT	p.S295S		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		295	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						AATCACCTAAGCTTGAATAAT	0.423																																						dbGAP											0													38.0	40.0	39.0					10																	51465571		2178	4261	6439	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000374095.5:c.885C>T	10.37:g.51465571G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGH4	Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.S295	ENST00000374095.5	37	c.885	CCDS41524.1	10																																																																																			AGAP7	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000204169		0.423	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	AGAP7	HGNC	protein_coding	OTTHUMT00000048033.1	135	0.00	0	G			51465571	51465571	-1	no_errors	ENST00000374095	ensembl	human	known	69_37n	silent	116	18.31	26	SNP	1.000	A
ALMS1	7840	genome.wustl.edu	37	2	73679504	73679504	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr2:73679504C>G	ENST00000264448.6	+	8	5958	c.5847C>G	c.(5845-5847)atC>atG	p.I1949M	ALMS1_ENST00000377715.1_Missense_Mutation_p.I1949M|ALMS1_ENST00000409009.1_Missense_Mutation_p.I1907M	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1949	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CCAGTGTTATCTCTCAACAGG	0.443																																						dbGAP											0													68.0	66.0	67.0					2																	73679504		1868	4105	5973	-	-	-	SO:0001583	missense	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.5847C>G	2.37:g.73679504C>G	ENSP00000264448:p.Ile1949Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.I1949M	ENST00000264448.6	37	c.5847	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	C	7.931	0.740590	0.15642	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.15139	3.33;3.33;2.45	4.01	-7.54	0.01332	.	.	.	.	.	T	0.05686	0.0149	N	0.08118	0	0.09310	N	1	P;P;P	0.48230	0.907;0.907;0.792	B;B;B	0.41036	0.346;0.346;0.264	T	0.18366	-1.0339	9	0.36615	T	0.2	.	2.1797	0.03871	0.1263:0.1392:0.3779:0.3567	.	1949;1907;1949	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	M	1907;1949;1949	ENSP00000386627:I1907M;ENSP00000264448:I1949M;ENSP00000366944:I1949M	ENSP00000264448:I1949M	I	+	3	3	ALMS1	73533012	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.463000	0.02361	-1.520000	0.01773	0.555000	0.69702	ATC	ALMS1	-	NULL	ENSG00000116127		0.443	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	39	0.00	0	C	NM_015120		73679504	73679504	+1	no_errors	ENST00000264448	ensembl	human	known	69_37n	missense	15	58.33	21	SNP	0.000	G
AMPD3	272	genome.wustl.edu	37	11	10500163	10500163	+	Silent	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr11:10500163G>A	ENST00000396554.3	+	3	680	c.339G>A	c.(337-339)ccG>ccA	p.P113P	AMPD3_ENST00000444303.2_Intron	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	104					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		CAGCCAGTCCGGCCATGTCTC	0.597																																						dbGAP											0													100.0	112.0	108.0					11																	10500163		2201	4294	6495	-	-	-	SO:0001819	synonymous_variant	0			M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.339G>A	11.37:g.10500163G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUX0|B7Z2S2|B7Z763|B7Z877	Silent	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.P104	ENST00000396554.3	37	c.312	CCDS7802.1	11																																																																																			AMPD3	-	pirsf_AMP_deaminase	ENSG00000133805		0.597	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	AMPD3	HGNC	protein_coding	OTTHUMT00000385783.2	41	0.00	0	G	NM_000480		10500163	10500163	+1	no_errors	ENST00000396553	ensembl	human	known	69_37n	silent	28	26.32	10	SNP	0.000	A
ANKRD18DP	348840	genome.wustl.edu	37	3	197785890	197785890	+	RNA	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr3:197785890G>A	ENST00000435620.2	-	0	1408					NR_003291.1				ankyrin repeat domain 18D, pseudogene																		TATAGCAGCAGCCAGCCTAGA	0.373																																						dbGAP											0																																										-	-	-			0			BC042518		3q29	2011-11-23			ENSG00000226435	ENSG00000226435			28016	pseudogene	pseudogene							Standard	NR_003291		Approved		uc003fyx.3		OTTHUMG00000150228		3.37:g.197785890G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000435620.2	37	NULL		3																																																																																			ANKRD18DP	-	-	ENSG00000226435		0.373	ANKRD18DP-001	KNOWN	basic	processed_transcript	ANKRD18DP	HGNC	pseudogene	OTTHUMT00000316910.2	88	0.00	0	G	NR_003291		197785890	197785890	-1	no_errors	ENST00000335478	ensembl	human	known	69_37n	rna	46	31.34	21	SNP	0.149	A
ANKEF1	63926	genome.wustl.edu	37	20	10025082	10025082	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr20:10025082G>A	ENST00000378380.3	+	4	916	c.587G>A	c.(586-588)gGg>gAg	p.G196E	ANKEF1_ENST00000378392.1_Missense_Mutation_p.G196E|SNAP25-AS1_ENST00000603542.1_RNA|SNAP25-AS1_ENST00000421143.2_RNA|ANKEF1_ENST00000488991.1_3'UTR	NM_198798.1	NP_942093.1	Q9NU02	ANKE1_HUMAN	ankyrin repeat and EF-hand domain containing 1	196							calcium ion binding (GO:0005509)										TCAAGAGAAGGGGTAGTGGAA	0.448																																						dbGAP											0													199.0	182.0	188.0					20																	10025082		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025322	CCDS13108.1	20p12.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000132623	ENSG00000132623		"""EF-hand domain containing"", ""Ankyrin repeat domain containing"""	15803	protein-coding gene	gene with protein product			"""ankyrin repeat domain 5"""	ANKRD5		17142250	Standard	NM_022096		Approved	FLJ21669, dJ839B4.6	uc002wnp.3	Q9NU02	OTTHUMG00000031860	ENST00000378380.3:c.587G>A	20.37:g.10025082G>A	ENSP00000367631:p.Gly196Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUQ0|Q9H6Y9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EF_HAND_2,prints_Ankyrin_rpt	p.G196E	ENST00000378380.3	37	c.587	CCDS13108.1	20	.	.	.	.	.	.	.	.	.	.	G	24.1	4.492046	0.84962	.	.	ENSG00000132623	ENST00000378392;ENST00000378380	T;T	0.78707	-1.2;-1.2	5.24	5.24	0.73138	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.89392	0.6702	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90614	0.4554	10	0.87932	D	0	0.4991	19.1987	0.93701	0.0:0.0:1.0:0.0	.	196	Q9NU02	ANKR5_HUMAN	E	196	ENSP00000367644:G196E;ENSP00000367631:G196E	ENSP00000367631:G196E	G	+	2	0	ANKRD5	9973082	1.000000	0.71417	0.957000	0.39632	0.694000	0.40290	8.610000	0.90902	2.607000	0.88179	0.655000	0.94253	GGG	ANKRD5	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000132623		0.448	ANKEF1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ANKRD5	HGNC	protein_coding	OTTHUMT00000077968.2	34	0.00	0	G	NM_022096		10025082	10025082	+1	no_errors	ENST00000378380	ensembl	human	known	69_37n	missense	28	30.23	13	SNP	1.000	A
ARHGAP25	9938	genome.wustl.edu	37	2	69002532	69002532	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr2:69002532G>A	ENST00000295381.3	+	2	660	c.241G>A	c.(241-243)Gaa>Aaa	p.E81K	ARHGAP25_ENST00000409220.1_Missense_Mutation_p.E74K|ARHGAP25_ENST00000544262.1_Missense_Mutation_p.E55K|ARHGAP25_ENST00000467265.1_Missense_Mutation_p.E81K|ARHGAP25_ENST00000409030.3_Missense_Mutation_p.E74K|ARHGAP25_ENST00000409202.3_Missense_Mutation_p.E81K|ARHGAP25_ENST00000497079.1_Missense_Mutation_p.E74K|ARHGAP25_ENST00000456116.2_3'UTR	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25	81	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						CTACAAGGATGAAGAGGACAC	0.562																																						dbGAP											0													88.0	93.0	92.0					2																	69002532		2203	4300	6503	-	-	-	SO:0001583	missense	0			D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.241G>A	2.37:g.69002532G>A	ENSP00000295381:p.Glu81Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.E81K	ENST00000295381.3	37	c.241		2	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368482	0.82463	.	.	ENSG00000163219	ENST00000544262;ENST00000295381;ENST00000409202;ENST00000467265;ENST00000409030;ENST00000409220;ENST00000482106;ENST00000497079;ENST00000543533	T;T;T;T;T;T;T	0.13657	2.57;2.57;2.57;2.57;2.57;2.57;2.57	5.58	4.71	0.59529	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.353602	0.32015	N	0.006715	T	0.16385	0.0394	N	0.20766	0.605	0.42968	D	0.994424	D;B;P;P;P;P;B	0.61697	0.99;0.112;0.943;0.943;0.943;0.887;0.391	P;B;P;P;P;P;B	0.60173	0.87;0.282;0.758;0.758;0.758;0.758;0.352	T	0.09143	-1.0688	10	0.28530	T	0.3	.	8.7727	0.34742	0.0804:0.1512:0.7684:0.0	.	81;55;81;74;74;74;81	E9PFQ7;B7Z8K7;P42331-4;G5E9G2;P42331-3;P42331-2;P42331	.;.;.;.;.;.;RHG25_HUMAN	K	55;81;81;81;74;74;74;74;65	ENSP00000439917:E55K;ENSP00000295381:E81K;ENSP00000386911:E81K;ENSP00000420583:E81K;ENSP00000386863:E74K;ENSP00000386241:E74K;ENSP00000417139:E74K	ENSP00000295381:E81K	E	+	1	0	ARHGAP25	68856036	1.000000	0.71417	0.962000	0.40283	0.842000	0.47809	6.214000	0.72200	1.349000	0.45751	0.563000	0.77884	GAA	ARHGAP25	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000163219		0.562	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	ARHGAP25	HGNC	protein_coding		44	0.00	0	G	NM_014882		69002532	69002532	+1	no_errors	ENST00000409202	ensembl	human	known	69_37n	missense	42	16.00	8	SNP	0.996	A
BCOR	54880	genome.wustl.edu	37	X	39933225	39933225	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chrX:39933225C>G	ENST00000378444.4	-	4	1602	c.1374G>C	c.(1372-1374)atG>atC	p.M458I	BCOR_ENST00000342274.4_Missense_Mutation_p.M458I|BCOR_ENST00000397354.3_Missense_Mutation_p.M458I|BCOR_ENST00000378455.4_Missense_Mutation_p.M458I	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	458					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						CCATCTTTTTCATGTGGTCAG	0.493			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																															dbGAP		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		0													83.0	73.0	76.0					X																	39933225		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.1374G>C	X.37:g.39933225C>G	ENSP00000367705:p.Met458Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.M458I	ENST00000378444.4	37	c.1374	CCDS48093.1	X	.	.	.	.	.	.	.	.	.	.	C	2.578	-0.298108	0.05532	.	.	ENSG00000183337	ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000406200	T;T;T;T;T	0.09723	2.95;2.95;2.95;2.95;2.95	5.77	4.83	0.62350	.	.	.	.	.	T	0.05914	0.0154	N	0.08118	0	0.26994	N	0.96507	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.28808	-1.0032	9	0.25106	T	0.35	-12.6292	9.8073	0.40801	0.1992:0.7159:0.0:0.0849	.	458;458;458;458	Q6W2J9-3;Q6W2J9-4;Q6W2J9;Q6W2J9-2	.;.;BCOR_HUMAN;.	I	458	ENSP00000367716:M458I;ENSP00000380512:M458I;ENSP00000367705:M458I;ENSP00000345923:M458I;ENSP00000384485:M458I	ENSP00000345923:M458I	M	-	3	0	BCOR	39818169	0.746000	0.28272	1.000000	0.80357	0.997000	0.91878	0.035000	0.13797	2.426000	0.82243	0.600000	0.82982	ATG	BCOR	-	NULL	ENSG00000183337		0.493	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCOR	HGNC	protein_coding	OTTHUMT00000060666.2	46	0.00	0	C	NM_017745		39933225	39933225	-1	no_errors	ENST00000378444	ensembl	human	known	69_37n	missense	18	30.77	8	SNP	0.929	G
ARMCX4	100131755	genome.wustl.edu	37	X	100747194	100747194	+	Silent	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chrX:100747194G>A	ENST00000423738.3	+	2	3820	c.3618G>A	c.(3616-3618)aaG>aaA	p.K1206K		NM_001256155.1	NP_001243084.1	Q5H9R4	ARMX4_HUMAN	armadillo repeat containing, X-linked 4	0						integral component of membrane (GO:0016021)				lung(1)	1						CTGGGGACAAGGCCAGTGGAG	0.647																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK096955	CCDS59170.1	Xq22	2014-03-21	2009-11-26		ENSG00000196440	ENSG00000196440		"""Armadillo repeat containing"""	28615	protein-coding gene	gene with protein product			"""chromosome X open reading frame 35"", ""armadillo repeat containing, X-linked 4 pseudogene"""	CXorf35		16221301, 22569362	Standard	NR_028407		Approved	MGC40053, GASP4	uc031tkc.1	Q5H9R4	OTTHUMG00000022030	ENST00000423738.3:c.3618G>A	X.37:g.100747194G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K928|B3KXA4|Q5H9K8|Q8N8D6	Silent	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,pfscan_Armadillo	p.K1206	ENST00000423738.3	37	c.3618	CCDS59170.1	X																																																																																			ARMCX4	-	NULL	ENSG00000196440		0.647	ARMCX4-010	PUTATIVE	upstream_ATG|upstream_uORF|basic|appris_principal|CCDS	protein_coding	ARMCX4	HGNC	protein_coding	OTTHUMT00000370455.2	46	0.00	0	G	NM_001256155		100747194	100747194	+1	no_errors	ENST00000423738	ensembl	human	putative	69_37n	silent	28	26.32	10	SNP	0.653	A
MALRD1	340895	genome.wustl.edu	37	10	20019712	20019712	+	Splice_Site	SNP	T	T	G			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr10:20019712T>G	ENST00000454679.2	+	23	4341		c.e23+2		RP11-354E11.2_ENST00000423551.1_RNA|RP11-354E11.2_ENST00000431157.2_RNA|RP11-354E11.2_ENST00000451713.1_RNA|C10orf112_ENST00000455457.2_Splice_Site			Q5VYJ5	MALR1_HUMAN							cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						AAAACAGAGGTAAGTGGCAAG	0.453																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0																														ENST00000454679.2:c.4341+2T>G	10.37:g.20019712T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBP2	Splice_Site	SNP	-	e23+2	ENST00000454679.2	37	c.4341+2		10	.	.	.	.	.	.	.	.	.	.	T	16.18	3.049989	0.55218	.	.	ENSG00000204740	ENST00000377266;ENST00000454679;ENST00000377265;ENST00000455457	.	.	.	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0615	0.47950	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	C10orf112	20059718	1.000000	0.71417	0.993000	0.49108	0.853000	0.48598	3.603000	0.54074	2.185000	0.69588	0.528000	0.53228	.	C10orf112	-	-	ENSG00000204740		0.453	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		33	0.00	0	T		Intron	20019712	20019712	+1	no_errors	ENST00000454679	ensembl	human	known	69_37n	splice_site	28	28.21	11	SNP	0.999	G
C18orf54	162681	genome.wustl.edu	37	18	51889270	51889270	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr18:51889270G>T	ENST00000300091.5	+	4	1051	c.719G>T	c.(718-720)tGg>tTg	p.W240L	C18orf54_ENST00000382911.4_Missense_Mutation_p.W401L|C18orf54_ENST00000578138.1_Missense_Mutation_p.W19L	NM_173529.4	NP_775800.3	Q8IYD9	LAS2_HUMAN	chromosome 18 open reading frame 54	240						extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)		GACAGATCATGGGAAAATATT	0.343																																						dbGAP											0													79.0	79.0	79.0					18																	51889270		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK126503	CCDS11956.1, CCDS74223.1	18q21	2012-10-24			ENSG00000166845	ENSG00000166845			13796	protein-coding gene	gene with protein product	"""lung adenoma susceptibility protein 2"""	613258					Standard	XM_005258201		Approved	MGC33382, LAS2	uc031rij.1	Q8IYD9	OTTHUMG00000132703	ENST00000300091.5:c.719G>T	18.37:g.51889270G>T	ENSP00000300091:p.Trp240Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	I7HFJ6|Q6MZU3|Q6ZTL6	Missense_Mutation	SNP	NULL	p.W240L	ENST00000300091.5	37	c.719	CCDS11956.1	18	.	.	.	.	.	.	.	.	.	.	G	12.12	1.842319	0.32513	.	.	ENSG00000166845	ENST00000300091;ENST00000382911	T;T	0.13307	2.6;2.6	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.32376	0.0827	M	0.78049	2.395	0.37869	D	0.930001	D;D	0.56521	0.976;0.959	D;P	0.64042	0.921;0.74	T	0.33471	-0.9867	10	0.02654	T	1	0.2528	17.3156	0.87222	0.0:0.0:1.0:0.0	.	401;240	Q8IYD9-2;Q8IYD9	.;CR054_HUMAN	L	240;401	ENSP00000300091:W240L;ENSP00000372368:W401L	ENSP00000300091:W240L	W	+	2	0	C18orf54	50143268	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.531000	0.73820	2.386000	0.81285	0.491000	0.48974	TGG	C18orf54	-	NULL	ENSG00000166845		0.343	C18orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C18orf54	HGNC	protein_coding	OTTHUMT00000256001.1	40	0.00	0	G	NM_173529		51889270	51889270	+1	no_errors	ENST00000300091	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	1.000	T
C20orf166	128826	genome.wustl.edu	37	20	61167855	61167855	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr20:61167855C>G	ENST00000370527.3	+	4	1104	c.325C>G	c.(325-327)Ctc>Gtc	p.L109V	C20orf166_ENST00000370523.1_Missense_Mutation_p.L91V|C20orf166_ENST00000370524.2_Missense_Mutation_p.L91V	NM_178463.3	NP_848558.1			chromosome 20 open reading frame 166											endometrium(1)|kidney(1)|lung(2)	4	Breast(26;1.04e-08)		BRCA - Breast invasive adenocarcinoma(19;7.17e-06)			CTGGGAACGCCTCCTCTGCTA	0.592																																						dbGAP											0													31.0	33.0	33.0					20																	61167855		2048	4170	6218	-	-	-	SO:0001583	missense	0			AL449263	CCDS46627.1	20q13.33	2014-01-21			ENSG00000174407	ENSG00000174407			16159	protein-coding gene	gene with protein product	"""MIR133A2 host gene"""						Standard	NM_178463		Approved	dJ353C17.1, MIR1-1HG, MIR133A2HG	uc011aaj.2	Q9H1L0	OTTHUMG00000048000	ENST00000370527.3:c.325C>G	20.37:g.61167855C>G	ENSP00000359558:p.Leu109Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.L109V	ENST00000370527.3	37	c.325	CCDS46627.1	20	.	.	.	.	.	.	.	.	.	.	C	5.243	0.230275	0.09969	.	.	ENSG00000174407	ENST00000370527;ENST00000370524;ENST00000370523	T;T;T	0.39997	1.05;1.05;1.05	1.34	0.348	0.16026	.	.	.	.	.	T	0.15696	0.0378	N	0.08118	0	0.09310	N	1	P	0.45594	0.862	B	0.31751	0.135	T	0.14200	-1.0481	9	0.87932	D	0	.	3.443	0.07470	0.0:0.723:0.0:0.277	.	109	Q9H1L0	CT166_HUMAN	V	109;91;91	ENSP00000359558:L109V;ENSP00000359555:L91V;ENSP00000359554:L91V	ENSP00000359554:L91V	L	+	1	0	C20orf166	60578300	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.118000	0.10692	0.125000	0.18397	0.313000	0.20887	CTC	C20orf166	-	NULL	ENSG00000174407		0.592	C20orf166-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf166	HGNC	protein_coding	OTTHUMT00000109262.1	39	0.00	0	C	NM_178463		61167855	61167855	+1	no_errors	ENST00000370527	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	0.000	G
ACKR2	1238	genome.wustl.edu	37	3	42906330	42906330	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr3:42906330C>A	ENST00000422265.1	+	3	511	c.336C>A	c.(334-336)ttC>ttA	p.F112L	ACKR2_ENST00000273145.2_Missense_Mutation_p.F112L|KRBOX1_ENST00000426937.1_Intron|CYP8B1_ENST00000437102.1_Intron|ACKR2_ENST00000442925.1_Missense_Mutation_p.F112L|RP11-141M3.5_ENST00000471537.1_RNA	NM_001296.4	NP_001287.2	O00590	ACKR2_HUMAN	atypical chemokine receptor 2	112					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|multicellular organismal development (GO:0007275)|neutrophil activation (GO:0042119)|receptor-mediated endocytosis (GO:0006898)	actin filament (GO:0005884)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-X-C chemokine receptor activity (GO:0016494)|chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)										ATTGGGTCTTCGGGAGTTTCT	0.483																																						dbGAP											0													154.0	156.0	155.0					3																	42906330		2203	4300	6503	-	-	-	SO:0001583	missense	0			U94888	CCDS2706.1	3p21.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144648	ENSG00000144648		"""GPCR / Class A : Chemokine receptors : Atypical"""	1565	protein-coding gene	gene with protein product		602648	"""chemokine binding protein 2"""	CMKBR9, CCBP2		9364936, 9405404, 16148	Standard	NM_001296		Approved	CCR10, D6, CCR9	uc003cme.3	O00590	OTTHUMG00000133040	ENST00000422265.1:c.336C>A	3.37:g.42906330C>A	ENSP00000416996:p.Phe112Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8Y8|O00537|Q53YA1|Q86UN9|Q96A02	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_ATII_rcpt,prints_Chemokine_CXCR4	p.F112L	ENST00000422265.1	37	c.336	CCDS2706.1	3	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654859	0.67472	.	.	ENSG00000144648	ENST00000442925;ENST00000422265;ENST00000273145	T;T;T	0.38722	1.12;1.12;1.12	5.28	-5.35	0.02697	GPCR, rhodopsin-like superfamily (1);	0.285769	0.25214	N	0.032297	T	0.44829	0.1312	L	0.49513	1.565	0.80722	D	1	D;D	0.58268	0.982;0.982	P;P	0.57371	0.819;0.753	T	0.49854	-0.8895	9	.	.	.	.	12.8294	0.57738	0.0:0.4772:0.0:0.5228	.	112;112	O00590;Q7Z7I1	CCBP2_HUMAN;.	L	112	ENSP00000396150:F112L;ENSP00000416996:F112L;ENSP00000273145:F112L	.	F	+	3	2	CCBP2	42881334	0.002000	0.14202	0.384000	0.26145	0.871000	0.50021	-1.349000	0.02627	-1.398000	0.02066	-0.414000	0.06135	TTC	CCBP2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_ATII_rcpt,prints_Chemokine_CXCR4	ENSG00000144648		0.483	ACKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCBP2	HGNC	protein_coding	OTTHUMT00000256645.2	61	0.00	0	C	NM_001296		42906330	42906330	+1	no_errors	ENST00000273145	ensembl	human	known	69_37n	missense	29	31.82	14	SNP	0.821	A
CLIP2	7461	genome.wustl.edu	37	7	73753226	73753226	+	Silent	SNP	C	C	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr7:73753226C>T	ENST00000395060.1	+	2	570	c.570C>T	c.(568-570)agC>agT	p.S190S	CLIP2_ENST00000223398.6_Silent_p.S190S|CLIP2_ENST00000361545.5_Silent_p.S190S			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	190						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						TGCGGGAGAGCGTCCTCAACA	0.657																																						dbGAP											0													31.0	30.0	30.0					7																	73753226		2131	4207	6338	-	-	-	SO:0001819	synonymous_variant	0			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.570C>T	7.37:g.73753226C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O14527|O43611	Silent	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_t-SNARE,pfscan_CAP-Gly_domain	p.S190	ENST00000395060.1	37	c.570	CCDS5569.1	7																																																																																			CLIP2	-	superfamily_CAP-Gly_domain	ENSG00000106665		0.657	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP2	HGNC	protein_coding	OTTHUMT00000252556.1	46	0.00	0	C	NM_003388		73753226	73753226	+1	no_errors	ENST00000223398	ensembl	human	known	69_37n	silent	36	30.77	16	SNP	0.994	T
COG7	91949	genome.wustl.edu	37	16	23464305	23464305	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr16:23464305G>A	ENST00000307149.5	-	1	196	c.11C>T	c.(10-12)tCc>tTc	p.S4F	CTD-2270L9.4_ENST00000570080.1_lincRNA	NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	4					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		CAGGAACTTGGAGAAGTCCAT	0.642																																						dbGAP											0													57.0	55.0	56.0					16																	23464305		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.11C>T	16.37:g.23464305G>A	ENSP00000305442:p.Ser4Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWU7	Missense_Mutation	SNP	pfam_COG_su7	p.S4F	ENST00000307149.5	37	c.11	CCDS10610.1	16	.	.	.	.	.	.	.	.	.	.	G	29.1	4.979888	0.92982	.	.	ENSG00000168434	ENST00000307149	T	0.61040	0.14	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.74238	0.3690	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77736	-0.2476	10	0.72032	D	0.01	-25.0281	16.4402	0.83898	0.0:0.0:1.0:0.0	.	4	P83436	COG7_HUMAN	F	4	ENSP00000305442:S4F	ENSP00000305442:S4F	S	-	2	0	COG7	23371806	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	8.779000	0.91792	2.338000	0.79540	0.305000	0.20034	TCC	COG7	-	pfam_COG_su7	ENSG00000168434		0.642	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG7	HGNC	protein_coding	OTTHUMT00000211625.1	37	0.00	0	G			23464305	23464305	-1	no_errors	ENST00000307149	ensembl	human	known	69_37n	missense	17	37.04	10	SNP	1.000	A
CROCCP3	114819	genome.wustl.edu	37	1	16803524	16803524	+	RNA	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr1:16803524G>A	ENST00000263511.4	-	0	2232					NR_023386.1		Q8IVE0	CROL2_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 3						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CCAGCTCCTTGGCCAGGACTG	0.657																																						dbGAP											0																																										-	-	-			0			AB067509		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000080947	ENSG00000080947			29405	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 2"""	CROCCL2		11572484	Standard	NR_023386		Approved	KIAA1922	uc001ayt.2	Q8IVE0	OTTHUMG00000037885		1.37:g.16803524G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PW6	RNA	SNP	-	NULL	ENST00000263511.4	37	NULL		1																																																																																			CROCCP3	-	-	ENSG00000080947		0.657	CROCCP3-002	KNOWN	basic	processed_transcript	CROCCP3	HGNC	pseudogene	OTTHUMT00000458172.1	31	0.00	0	G	XM_057040		16803524	16803524	-1	no_errors	ENST00000263511	ensembl	human	known	69_37n	rna	28	30.00	12	SNP	0.686	A
CRTC1	23373	genome.wustl.edu	37	19	18888034	18888034	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr19:18888034G>A	ENST00000321949.8	+	14	1773	c.1747G>A	c.(1747-1749)Ggg>Agg	p.G583R	CRTC1_ENST00000594658.1_Missense_Mutation_p.G542R|CRTC1_ENST00000338797.6_Missense_Mutation_p.G599R|CRTC1_ENST00000601916.1_Missense_Mutation_p.G341R	NM_015321.2	NP_056136.2			CREB regulated transcription coactivator 1									p.G583W(1)|p.G599W(1)	CRTC1/MAML2(516)	NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	19						CTCTCTGGCCGGGGTCGGCGA	0.627																																						dbGAP											2	Substitution - Missense(2)	lung(2)											84.0	92.0	89.0					19																	18888034		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY040323	CCDS32963.1, CCDS42525.1	19p13	2012-07-31	2005-11-24	2005-11-24					16062	protein-coding gene	gene with protein product	"""transducer of regulated cAMP response element-binding protein"""	607536	"""mucoepidermoid carcinoma translocated 1"""	MECT1		12539049, 14536081, 14506290	Standard	NM_015321		Approved	KIAA0616, FLJ14027, TORC1	uc010ebv.3	Q6UUV9		ENST00000321949.8:c.1747G>A	19.37:g.18888034G>A	ENSP00000323332:p.Gly583Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G599R	ENST00000321949.8	37	c.1795	CCDS32963.1	19	.	.	.	.	.	.	.	.	.	.	G	17.38	3.376266	0.61735	.	.	ENSG00000105662	ENST00000338797;ENST00000321949	T;T	0.14640	2.49;2.53	3.95	3.95	0.45737	Transducer of regulated CREB activity, C-terminal (1);	0.063094	0.64402	N	0.000006	T	0.12732	0.0309	L	0.39245	1.2	0.58432	D	0.999999	B;P	0.39940	0.263;0.696	B;B	0.37989	0.057;0.262	T	0.12016	-1.0564	9	.	.	.	-8.7297	15.1523	0.72709	0.0:0.0:1.0:0.0	.	599;583	Q6UUV9-2;Q6UUV9	.;CRTC1_HUMAN	R	599;583	ENSP00000345001:G599R;ENSP00000323332:G583R	.	G	+	1	0	CRTC1	18749034	1.000000	0.71417	0.893000	0.35052	0.952000	0.60782	8.758000	0.91663	2.047000	0.60756	0.563000	0.77884	GGG	CRTC1	-	NULL	ENSG00000105662		0.627	CRTC1-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	CRTC1	HGNC	protein_coding	OTTHUMT00000465151.3	34	0.00	0	G	NM_025021		18888034	18888034	+1	no_errors	ENST00000338797	ensembl	human	known	69_37n	missense	47	11.11	6	SNP	1.000	A
CUBN	8029	genome.wustl.edu	37	10	16882890	16882890	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr10:16882890T>C	ENST00000377833.4	-	61	9885	c.9820A>G	c.(9820-9822)Atg>Gtg	p.M3274V		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3274	CUB 24. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCACTGTCCATGATGGTGTAT	0.338																																						dbGAP											0													111.0	99.0	103.0					10																	16882890		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9820A>G	10.37:g.16882890T>C	ENSP00000367064:p.Met3274Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.M3274V	ENST00000377833.4	37	c.9820	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.040898	0.00039	.	.	ENSG00000107611	ENST00000377833;ENST00000545090	T	0.44482	0.92	4.39	-6.83	0.01693	CUB (3);	1.811690	0.03303	N	0.189303	T	0.05823	0.0152	N	0.00033	-2.57	0.18873	N	0.999986	B	0.02656	0.0	B	0.01281	0.0	T	0.38351	-0.9665	10	0.02654	T	1	.	4.4038	0.11399	0.101:0.2989:0.0922:0.5078	.	3274	O60494	CUBN_HUMAN	V	3274;115	ENSP00000367064:M3274V	ENSP00000367064:M3274V	M	-	1	0	CUBN	16922896	0.000000	0.05858	0.001000	0.08648	0.045000	0.14185	-1.493000	0.02298	-1.014000	0.03379	-0.899000	0.02877	ATG	CUBN	-	superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000107611		0.338	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	113	0.00	0	T	NM_001081		16882890	16882890	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	missense	55	28.57	22	SNP	0.016	C
EEF1A1	1915	genome.wustl.edu	37	6	74227973	74227973	+	Missense_Mutation	SNP	G	G	T	rs190893068		TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr6:74227973G>T	ENST00000316292.9	-	6	2035	c.1044C>A	c.(1042-1044)aaC>aaA	p.N348K	EEF1A1_ENST00000309268.6_Missense_Mutation_p.N348K|EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000331523.2_Missense_Mutation_p.N348K	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	348					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						GGCCTGGATGGTTCAGGATAA	0.423																																						dbGAP											0													45.0	49.0	47.0					6																	74227973		2199	4298	6497	-	-	-	SO:0001583	missense	0			BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1044C>A	6.37:g.74227973G>T	ENSP00000339063:p.Asn348Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_ProtSyn_GTP-bd,tigrfam_Transl_elong_EF1A_euk/arc	p.N348K	ENST00000316292.9	37	c.1044	CCDS4980.1	6	.	.	.	.	.	.	.	.	.	.	G	13.71	2.319688	0.41096	.	.	ENSG00000156508	ENST00000316292;ENST00000358190;ENST00000309268;ENST00000331523;ENST00000391977	T;T;T	0.43688	0.94;0.94;0.94	4.71	3.84	0.44239	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (2);Translation elongation factor EFTu/EF1A, C-terminal (2);	0.000000	0.85682	U	0.000000	T	0.52354	0.1729	H	0.98866	4.355	0.80722	D	1	B;B;B	0.26483	0.027;0.027;0.15	B;B;B	0.30316	0.074;0.074;0.114	T	0.65533	-0.6145	10	0.87932	D	0	.	13.2814	0.60216	0.0779:0.0:0.9221:0.0	.	348;348;348	P68104;Q6IPS9;Q5VTE0	EF1A1_HUMAN;.;EF1A3_HUMAN	K	348;346;348;348;327	ENSP00000339063:N348K;ENSP00000339053:N348K;ENSP00000330054:N348K	ENSP00000339053:N348K	N	-	3	2	EEF1A1	74284694	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.738000	0.55067	1.107000	0.41642	0.556000	0.70494	AAC	EEF1A1	-	pfam_Transl_elong_EFTu/EF1A_C,superfamily_Transl_elong_EF1A/Init_IF2_C,tigrfam_Transl_elong_EF1A_euk/arc	ENSG00000156508		0.423	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1A1	HGNC	protein_coding	OTTHUMT00000041210.2	65	0.00	0	G	NM_001402		74227973	74227973	-1	no_errors	ENST00000309268	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	T
EXOC4	60412	genome.wustl.edu	37	7	133059629	133059629	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr7:133059629T>A	ENST00000253861.4	+	7	1084	c.1055T>A	c.(1054-1056)gTa>gAa	p.V352E	EXOC4_ENST00000393161.2_Missense_Mutation_p.V352E|EXOC4_ENST00000539845.1_Missense_Mutation_p.V251E	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	352					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				TTTAATGCTGTAGCCGCTGCA	0.423																																						dbGAP											0													136.0	126.0	129.0					7																	133059629		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.1055T>A	7.37:g.133059629T>A	ENSP00000253861:p.Val352Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	pfam_Sec8_exocyst	p.V352E	ENST00000253861.4	37	c.1055	CCDS5829.1	7	.	.	.	.	.	.	.	.	.	.	T	31	5.096075	0.94197	.	.	ENSG00000131558	ENST00000253861;ENST00000393161;ENST00000539845	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.78071	0.4226	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.981;0.997	T	0.80264	-0.1455	9	0.87932	D	0	.	15.9698	0.80004	0.0:0.0:0.0:1.0	.	352;352	Q96A65;Q8TAR2	EXOC4_HUMAN;.	E	352;352;251	.	ENSP00000253861:V352E	V	+	2	0	EXOC4	132710169	1.000000	0.71417	0.985000	0.45067	0.996000	0.88848	7.460000	0.80816	2.250000	0.74265	0.455000	0.32223	GTA	EXOC4	-	NULL	ENSG00000131558		0.423	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC4	HGNC	protein_coding	OTTHUMT00000339182.1	29	0.00	0	T	NM_021807		133059629	133059629	+1	no_errors	ENST00000253861	ensembl	human	known	69_37n	missense	17	46.88	15	SNP	1.000	A
FAT3	120114	genome.wustl.edu	37	11	92532481	92532481	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr11:92532481C>A	ENST00000298047.6	+	9	6319	c.6302C>A	c.(6301-6303)aCt>aAt	p.T2101N	FAT3_ENST00000525166.1_Missense_Mutation_p.T1951N|FAT3_ENST00000409404.2_Missense_Mutation_p.T2101N			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2101	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GAACCCGGGACTCTGATTTAT	0.458										TCGA Ovarian(4;0.039)																												dbGAP											0													52.0	53.0	53.0					11																	92532481		1916	4126	6042	-	-	-	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.6302C>A	11.37:g.92532481C>A	ENSP00000298047:p.Thr2101Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.T2101N	ENST00000298047.6	37	c.6302		11	.	.	.	.	.	.	.	.	.	.	C	7.860	0.725787	0.15439	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.57907	0.37;0.37;0.37	5.9	5.9	0.94986	.	.	.	.	.	T	0.67021	0.2849	M	0.91818	3.245	0.80722	D	1	P	0.40834	0.73	B	0.42771	0.397	T	0.67894	-0.5552	9	0.18276	T	0.48	.	20.2822	0.98520	0.0:1.0:0.0:0.0	.	2101	Q8TDW7-3	.	N	2101;2101;1951	ENSP00000298047:T2101N;ENSP00000387040:T2101N;ENSP00000432586:T1951N	ENSP00000298047:T2101N	T	+	2	0	FAT3	92172129	0.979000	0.34478	1.000000	0.80357	0.460000	0.32559	4.823000	0.62694	2.806000	0.96561	0.655000	0.94253	ACT	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000165323		0.458	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		44	0.00	0	C	NM_001008781		92532481	92532481	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	missense	26	25.71	9	SNP	1.000	A
FAT3	120114	genome.wustl.edu	37	11	92532610	92532610	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr11:92532610C>T	ENST00000298047.6	+	9	6448	c.6431C>T	c.(6430-6432)gCa>gTa	p.A2144V	FAT3_ENST00000525166.1_Missense_Mutation_p.A1994V|FAT3_ENST00000409404.2_Missense_Mutation_p.A2144V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2144	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTAAAGGAAGCATTCAACTCT	0.423										TCGA Ovarian(4;0.039)																												dbGAP											0													42.0	42.0	42.0					11																	92532610		1913	4129	6042	-	-	-	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.6431C>T	11.37:g.92532610C>T	ENSP00000298047:p.Ala2144Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.A2144V	ENST00000298047.6	37	c.6431		11	.	.	.	.	.	.	.	.	.	.	C	17.41	3.382585	0.61845	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.02656	4.21;4.21;4.21	6.02	5.11	0.69529	.	.	.	.	.	T	0.07638	0.0192	L	0.47716	1.5	0.80722	D	1	D	0.56968	0.978	P	0.54590	0.756	T	0.43343	-0.9397	9	0.30854	T	0.27	.	15.1629	0.72798	0.0:0.9326:0.0:0.0674	.	2144	Q8TDW7-3	.	V	2144;2144;1994	ENSP00000298047:A2144V;ENSP00000387040:A2144V;ENSP00000432586:A1994V	ENSP00000298047:A2144V	A	+	2	0	FAT3	92172258	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	4.831000	0.62752	1.551000	0.49450	0.655000	0.94253	GCA	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.423	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		39	0.00	0	C	NM_001008781		92532610	92532610	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	1.000	T
FAT4	79633	genome.wustl.edu	37	4	126237642	126237642	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr4:126237642C>T	ENST00000394329.3	+	1	89	c.76C>T	c.(76-78)Cga>Tga	p.R26*		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	26					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TCAGCTCCTTCGAGTGTTTTG	0.607											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													84.0	93.0	90.0					4																	126237642		1923	4117	6040	-	-	-	SO:0001587	stop_gained	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.76C>T	4.37:g.126237642C>T	ENSP00000377862:p.Arg26*	Somatic	1548	WXS	Illumina GAIIx	Phase_IV	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.R26*	ENST00000394329.3	37	c.76	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063704	0.76187	.	.	ENSG00000196159	ENST00000394329	.	.	.	4.55	3.67	0.42095	.	.	.	.	.	.	.	.	.	.	.	0.18873	N	0.999986	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.7394	0.40409	0.3915:0.6085:0.0:0.0	.	.	.	.	X	26	.	ENSP00000377862:R26X	R	+	1	2	FAT4	126457092	0.006000	0.16342	0.014000	0.15608	0.193000	0.23685	0.659000	0.24994	1.206000	0.43276	0.650000	0.86243	CGA	FAT4	-	NULL	ENSG00000196159		0.607	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	43	0.00	0	C	NM_024582		126237642	126237642	+1	no_errors	ENST00000394329	ensembl	human	known	69_37n	nonsense	49	18.33	11	SNP	0.007	T
FBXL3	26224	genome.wustl.edu	37	13	77581590	77581590	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr13:77581590C>T	ENST00000355619.5	-	5	1301	c.977G>A	c.(976-978)cGt>cAt	p.R326H	FBXL3_ENST00000477982.1_Intron	NM_012158.2	NP_036290.1	Q9UKT7	FBXL3_HUMAN	F-box and leucine-rich repeat protein 3	326					entrainment of circadian clock by photoperiod (GO:0043153)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|urinary_tract(1)	16		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.218)		GBM - Glioblastoma multiforme(99;0.0521)		CATTCCCACACGGCCAAGCAC	0.423																																						dbGAP											0													103.0	87.0	93.0					13																	77581590		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF129532	CCDS9457.1	13q22	2011-06-09	2004-07-20	2004-07-21	ENSG00000005812	ENSG00000005812		"""F-boxes / Leucine-rich repeats"""	13599	protein-coding gene	gene with protein product		605653	"""F-box and leucine-rich repeat protein 3A"""	FBXL3A		10531035, 10828603	Standard	NM_012158		Approved	FBL3, FBL3A	uc001vkd.3	Q9UKT7	OTTHUMG00000017099	ENST00000355619.5:c.977G>A	13.37:g.77581590C>T	ENSP00000347834:p.Arg326His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB04|Q9P122	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like	p.R326H	ENST00000355619.5	37	c.977	CCDS9457.1	13	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860180	0.91433	.	.	ENSG00000005812	ENST00000355619	T	0.23754	1.89	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.51109	0.1655	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.25537	-1.0129	10	0.14252	T	0.57	-18.8857	20.5407	0.99260	0.0:1.0:0.0:0.0	.	326	Q9UKT7	FBXL3_HUMAN	H	326	ENSP00000347834:R326H	ENSP00000347834:R326H	R	-	2	0	FBXL3	76479591	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.865000	0.98341	0.655000	0.94253	CGT	FBXL3	-	NULL	ENSG00000005812		0.423	FBXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL3	HGNC	protein_coding	OTTHUMT00000045312.3	30	0.00	0	C			77581590	77581590	-1	no_errors	ENST00000355619	ensembl	human	known	69_37n	missense	12	53.85	14	SNP	1.000	T
FAM86B3P	286042	genome.wustl.edu	37	8	8092025	8092025	+	IGR	SNP	G	G	A	rs2980436	byFrequency	TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr8:8092025G>A								FAM85B (7889 upstream) : ALG1L13P (3170 downstream)																							TCCACACGGAGCCTTTGGATG	0.547													.|||	2407	0.480631	0.177	0.6153	5008	,	,		19446	0.8155		0.4414	False		,,,				2504	0.4908					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															8.37:g.8092025G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		8																																																																																			RP11-556O5.3	-	-	ENSG00000173295	0	0.547					FLJ10661	Clone_based_vega_gene			92	0.00	0	G			8092025	8092025	+1	no_errors	ENST00000522601	ensembl	human	known	69_37n	rna	40	14.89	7	SNP	0.998	A
MROH5	389690	genome.wustl.edu	37	8	142458028	142458028	+	RNA	SNP	G	G	C			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr8:142458028G>C	ENST00000430863.1	-	0	2878				SNORD5_ENST00000458800.1_RNA	NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		GGGCACGGCCGCCTCCTGGGC	0.642																																						dbGAP											0													21.0	24.0	23.0					8																	142458028		1969	4147	6116	-	-	-			0					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142458028G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A933G	ENST00000430863.1	37	c.2798		8																																																																																			AC100803.1	-	NULL	ENSG00000226807		0.642	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	FLJ43860	Clone_based_vega_gene	polymorphic_pseudogene	OTTHUMT00000342412.4	52	0.00	0	G	NM_207414		142458028	142458028	-1	pseudogene	ENST00000430863	ensembl	human	known	69_37n	missense	79	17.71	17	SNP	0.000	C
FSHR	2492	genome.wustl.edu	37	2	49191057	49191057	+	Silent	SNP	A	A	C			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr2:49191057A>C	ENST00000406846.2	-	10	1022	c.903T>G	c.(901-903)gtT>gtG	p.V301V	FSHR_ENST00000346173.3_Silent_p.V239V|FSHR_ENST00000304421.4_Silent_p.V275V|FSHR_ENST00000541117.1_Silent_p.V37V	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	301					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	TCATATAATCAACTTCTTGCC	0.393									Gonadal Dysgenesis, 46 XX																													dbGAP											0													150.0	143.0	145.0					2																	49191057		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.903T>G	2.37:g.49191057A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_GnHR_TM,pfam_LRR-contain_N,pfam_Leu-rich_rpt,smart_LRR-contain_N,pfscan_GPCR_Rhodpsn_supfam,prints_FSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_TSH_rcpt	p.V301	ENST00000406846.2	37	c.903	CCDS1843.1	2																																																																																			FSHR	-	pfam_GnHR_TM	ENSG00000170820		0.393	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	HGNC	protein_coding	OTTHUMT00000251367.2	39	0.00	0	A			49191057	49191057	-1	no_errors	ENST00000406846	ensembl	human	known	69_37n	silent	17	45.16	14	SNP	0.226	C
GFPT2	9945	genome.wustl.edu	37	5	179731847	179731847	+	Silent	SNP	G	G	T	rs375659031		TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr5:179731847G>T	ENST00000253778.8	-	17	1936	c.1767C>A	c.(1765-1767)ccC>ccA	p.P589P		NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	589	SIS 2. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)	p.P589P(1)		breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	CCATGATGACGGGCATCTGCT	0.557																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											138.0	148.0	145.0					5																	179731847		2033	4184	6217	-	-	-	SO:0001819	synonymous_variant	0			AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.1767C>A	5.37:g.179731847G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XM2|Q9BWS4	Silent	SNP	pfam_SIS,pfam_GATase_dom,tigrfam_GlmS_trans	p.P589	ENST00000253778.8	37	c.1767	CCDS43411.1	5																																																																																			GFPT2	-	pfam_SIS,tigrfam_GlmS_trans	ENSG00000131459		0.557	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFPT2	HGNC	protein_coding	OTTHUMT00000373444.4	39	0.00	0	G	NM_005110		179731847	179731847	-1	no_errors	ENST00000253778	ensembl	human	known	69_37n	silent	23	42.50	17	SNP	0.000	T
GON4L	54856	genome.wustl.edu	37	1	155791266	155791266	+	Splice_Site	SNP	A	A	C			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr1:155791266A>C	ENST00000368331.1	-	5	1010	c.962T>G	c.(961-963)tTt>tGt	p.F321C	GON4L_ENST00000437809.1_Splice_Site_p.F321C|GON4L_ENST00000271883.5_Splice_Site_p.F321C|GON4L_ENST00000361040.5_Splice_Site_p.F321C|GON4L_ENST00000471341.1_5'UTR	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	321					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					ACTACTCACAAACATTGGCAT	0.388																																						dbGAP											0													211.0	165.0	181.0					1																	155791266		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.963+1T>G	1.37:g.155791266A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.F321C	ENST00000368331.1	37	c.962		1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.534437	0.85812	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000539959;ENST00000361040	T;T;T;T	0.15372	2.6;2.61;2.6;2.43	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.30262	0.0759	M	0.66939	2.045	0.45150	D	0.998162	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.997;0.999;0.997;0.999	T	0.04268	-1.0964	10	0.66056	D	0.02	.	13.3643	0.60674	1.0:0.0:0.0:0.0	.	15;321;321;321;321	Q9H5U2;A4PB68;Q3T8J9-2;Q3T8J9;Q3T8J9-3	.;.;.;GON4L_HUMAN;.	C	321	ENSP00000396117:F321C;ENSP00000357315:F321C;ENSP00000271883:F321C;ENSP00000354322:F321C	ENSP00000271883:F321C	F	-	2	0	GON4L	154057890	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.746000	0.91604	2.175000	0.68902	0.533000	0.62120	TTT	GON4L	-	NULL	ENSG00000116580		0.388	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		48	0.00	0	A	NM_032292	Missense_Mutation	155791266	155791266	-1	no_errors	ENST00000368331	ensembl	human	known	69_37n	missense	27	35.71	15	SNP	1.000	C
IGDCC4	57722	genome.wustl.edu	37	15	65674097	65674097	+	3'UTR	SNP	A	A	G			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr15:65674097A>G	ENST00000352385.2	-	0	6212				IGDCC4_ENST00000558048.1_5'UTR	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						AAAGGCCAATAGATTCTTTTC	0.358																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.*2250T>C	15.37:g.65674097A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HCE4	RNA	SNP	-	NULL	ENST00000352385.2	37	NULL	CCDS10206.1	15																																																																																			IGDCC4	-	-	ENSG00000103742		0.358	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	HGNC	protein_coding	OTTHUMT00000256825.2	14	0.00	0	A	NM_020962		65674097	65674097	-1	no_errors	ENST00000558048	ensembl	human	known	69_37n	rna	12	29.41	5	SNP	0.887	G
ITGB3	3690	genome.wustl.edu	37	17	45387552	45387553	+	Frame_Shift_Ins	INS	-	-	ACGT			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr17:45387552_45387553insACGT	ENST00000559488.1	+	15	2365_2366	c.2349_2350insACGT	c.(2350-2352)acgfs	p.-785fs	ITGB3_ENST00000435993.2_Intron|ITGB3_ENST00000560629.1_Intron|RP11-290H9.4_ENST00000575039.1_RNA	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)						activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	TCACCAATATCACGTACCGGGG	0.47																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.2350_2353dupACGT	17.37:g.45387553_45387556dupACGT	ENSP00000452786:p.Tyr785fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Frame_Shift_Ins	INS	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.R785fs	ENST00000559488.1	37	c.2349_2350	CCDS11511.1	17																																																																																			ITGB3	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_cyt	ENSG00000259207		0.470	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB3	HGNC	protein_coding	OTTHUMT00000416111.3	46	0.00	0	-	NM_000212		45387552	45387553	+1	no_errors	ENST00000262017	ensembl	human	known	69_37n	frame_shift_ins	28	22.22	8	INS	1.000:1.000	ACGT
ITGB6	3694	genome.wustl.edu	37	2	161030528	161030528	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr2:161030528G>T	ENST00000283249.2	-	5	953	c.716C>A	c.(715-717)cCc>cAc	p.P239H	ITGB6_ENST00000409967.2_Missense_Mutation_p.P239H|ITGB6_ENST00000428609.2_Missense_Mutation_p.P197H|ITGB6_ENST00000485635.1_5'UTR|ITGB6_ENST00000409872.1_Missense_Mutation_p.P239H	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	239	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						TCCACCTTCGGGTGTGTCAAT	0.358																																						dbGAP											0													105.0	103.0	104.0					2																	161030528		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.716C>A	2.37:g.161030528G>T	ENSP00000283249:p.Pro239His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.P239H	ENST00000283249.2	37	c.716	CCDS2212.1	2	.	.	.	.	.	.	.	.	.	.	G	21.3	4.132955	0.77662	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	D;D;D;D	0.98192	-4.78;-4.78;-4.78;-4.78	5.3	5.3	0.74995	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.054776	0.85682	D	0.000000	D	0.99290	0.9752	H	0.94847	3.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.984;0.988	D	0.98948	1.0793	10	0.87932	D	0	.	19.3005	0.94143	0.0:0.0:1.0:0.0	.	197;239	E9PEE8;P18564	.;ITB6_HUMAN	H	239;197;239;239	ENSP00000283249:P239H;ENSP00000408024:P197H;ENSP00000386828:P239H;ENSP00000386367:P239H	ENSP00000283249:P239H	P	-	2	0	ITGB6	160738774	1.000000	0.71417	0.956000	0.39512	0.947000	0.59692	7.215000	0.77966	2.646000	0.89796	0.491000	0.48974	CCC	ITGB6	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N,prints_Integrin_bsu	ENSG00000115221		0.358	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB6	HGNC	protein_coding	OTTHUMT00000255036.1	48	0.00	0	G	NM_000888		161030528	161030528	-1	no_errors	ENST00000283249	ensembl	human	known	69_37n	missense	45	29.69	19	SNP	0.998	T
KCNA5	3741	genome.wustl.edu	37	12	5154013	5154013	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr12:5154013C>T	ENST00000252321.3	+	1	929	c.700C>T	c.(700-702)Cgc>Tgc	p.R234C		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	234					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	CGAGTTCCAGCGCCAGGTGTG	0.597																																						dbGAP											0													78.0	88.0	85.0					12																	5154013		2203	4300	6503	-	-	-	SO:0001583	missense	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.700C>T	12.37:g.5154013C>T	ENSP00000252321:p.Arg234Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.R234C	ENST00000252321.3	37	c.700	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	C	15.98	2.991341	0.54041	.	.	ENSG00000130037	ENST00000252321	T	0.65549	-0.16	4.77	2.78	0.32641	.	0.079005	0.45867	U	0.000340	T	0.80059	0.4554	M	0.91406	3.205	0.51012	D	0.999902	D	0.89917	1.0	D	0.71414	0.973	T	0.82667	-0.0344	10	0.87932	D	0	.	9.6947	0.40150	0.15:0.7668:0.0:0.0833	.	234	P22460	KCNA5_HUMAN	C	234	ENSP00000252321:R234C	ENSP00000252321:R234C	R	+	1	0	KCNA5	5024274	0.022000	0.18835	0.991000	0.47740	0.989000	0.77384	0.397000	0.20883	1.234000	0.43709	0.561000	0.74099	CGC	KCNA5	-	NULL	ENSG00000130037		0.597	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	76	0.00	0	C	NM_002234		5154013	5154013	+1	no_errors	ENST00000252321	ensembl	human	known	69_37n	missense	54	27.03	20	SNP	0.910	T
KPNA1	3836	genome.wustl.edu	37	3	122146502	122146503	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr3:122146502_122146503insTA	ENST00000344337.6	-	13	1487_1488	c.1311_1312insTA	c.(1309-1314)tctaagfs	p.K438fs	KPNA1_ENST00000466923.1_5'UTR|RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA|RP11-299J3.8_ENST00000608015.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA	NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)	438					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		TGTACAATCTTAGAGTCCATGA	0.416																																					Melanoma(12;340 801 11196 19797)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.1311_1312insTA	3.37:g.122146502_122146503insTA	ENSP00000343701:p.Lys438fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN93|Q6IBQ9|Q9BQ56	Frame_Shift_Ins	INS	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.K437fs	ENST00000344337.6	37	c.1312_1311	CCDS3013.1	3																																																																																			KPNA1	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000114030		0.416	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA1	HGNC	protein_coding	OTTHUMT00000355740.1	30	0.00	0	-	NM_002264		122146502	122146503	-1	no_errors	ENST00000344337	ensembl	human	known	69_37n	frame_shift_ins	24	27.27	9	INS	1.000:1.000	TA
KRTAP9-7	100505724	genome.wustl.edu	37	17	39432040	39432040	+	Missense_Mutation	SNP	C	C	T	rs57771667	byFrequency	TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr17:39432040C>T	ENST00000391354.1	+	1	130	c.91C>T	c.(91-93)Ccc>Tcc	p.P31S		NM_001277332.1	NP_001264261.1	A8MTY7	KRA97_HUMAN	keratin associated protein 9-7	31	17 X 5 AA repeats of C-C-[VGSREQH]- [SQTPN]-[STPAI].					keratin filament (GO:0045095)				ovary(1)	1						CAGCAGCACACCCTGCTGCCA	0.632													.|||	119	0.023762	0.0855	0.0086	5008	,	,		11620	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AC006070	CCDS59287.1	17q21.2	2013-06-25			ENSG00000180386	ENSG00000180386		"""Keratin associated proteins"""	18915	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 1"""	KRTAP9L1			Standard	NM_001277332		Approved	KAP9.7	uc031rah.1	A8MTY7	OTTHUMG00000133605	ENST00000391354.1:c.91C>T	17.37:g.39432040C>T	ENSP00000375149:p.Pro31Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.P31S	ENST00000391354.1	37	c.91	CCDS59287.1	17	75	0.034340659340659344	51	0.10365853658536585	12	0.03314917127071823	8	0.013986013986013986	4	0.005277044854881266	.	9.593	1.126681	0.20959	.	.	ENSG00000180386	ENST00000391354	T	0.01084	5.36	3.52	-6.74	0.01743	.	.	.	.	.	T	0.00012	0.0000	N	0.00859	-1.14	0.09310	N	1	.	.	.	.	.	.	T	0.44498	-0.9324	7	0.05436	T	0.98	.	9.0608	0.36433	0.5896:0.2952:0.1152:0.0	rs57771667	.	.	.	S	31	ENSP00000375149:P31S	ENSP00000375149:P31S	P	+	1	0	KRTAP9-7	36685566	0.000000	0.05858	0.000000	0.03702	0.394000	0.30568	-0.352000	0.07701	-0.901000	0.03891	0.430000	0.28490	CCC	KRTAP9-7	-	NULL	ENSG00000180386		0.632	KRTAP9-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP9-7	HGNC	protein_coding	OTTHUMT00000257713.1	20	0.00	0	C	XM_003118738		39432040	39432040	+1	no_errors	ENST00000391354	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	0.000	T
LAD1	3898	genome.wustl.edu	37	1	201352318	201352318	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr1:201352318G>A	ENST00000391967.2	-	7	1571	c.1270C>T	c.(1270-1272)Cgg>Tgg	p.R424W	LAD1_ENST00000367313.3_Missense_Mutation_p.R438W|LAD1_ENST00000488842.1_5'UTR	NM_005558.3	NP_005549.2	O00515	LAD1_HUMAN	ladinin 1	424						basement membrane (GO:0005604)	structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|prostate(2)|skin(2)	19						GGCAGACCCCGAGACTTGACA	0.587																																						dbGAP											0													98.0	102.0	101.0					1																	201352318		2203	4300	6503	-	-	-	SO:0001583	missense	0			U42408	CCDS1410.1	1q25.1-q32.3	2008-02-05			ENSG00000159166	ENSG00000159166			6472	protein-coding gene	gene with protein product		602314				8618013, 9119369	Standard	NM_005558		Approved		uc001gwm.3	O00515	OTTHUMG00000035737	ENST00000391967.2:c.1270C>T	1.37:g.201352318G>A	ENSP00000375829:p.Arg424Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O95614|Q96GD8	Missense_Mutation	SNP	pirsf_Ladinin_1	p.R438W	ENST00000391967.2	37	c.1312	CCDS1410.1	1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.654959	0.47467	.	.	ENSG00000159166	ENST00000503578;ENST00000391967;ENST00000367313	T;T;T	0.45668	0.89;2.72;2.71	5.1	2.13	0.27403	.	0.382697	0.24388	N	0.038949	T	0.32526	0.0832	N	0.22421	0.69	0.09310	N	1	D	0.57571	0.98	P	0.49953	0.627	T	0.13575	-1.0504	10	0.66056	D	0.02	-2.1239	5.5356	0.17009	0.1815:0.1625:0.6561:0.0	.	424	O00515	LAD1_HUMAN	W	75;424;438	ENSP00000422687:R75W;ENSP00000375829:R424W;ENSP00000356282:R438W	ENSP00000356282:R438W	R	-	1	2	LAD1	199618941	0.004000	0.15560	0.000000	0.03702	0.002000	0.02628	1.248000	0.32827	0.169000	0.19679	0.561000	0.74099	CGG	LAD1	-	pirsf_Ladinin_1	ENSG00000159166		0.587	LAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAD1	HGNC	protein_coding	OTTHUMT00000086946.1	21	0.00	0	G	NM_005558		201352318	201352318	-1	no_errors	ENST00000367313	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	0.004	A
LCN8	138307	genome.wustl.edu	37	9	139650606	139650606	+	5'UTR	SNP	A	A	G			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr9:139650606A>G	ENST00000482893.1	-	0	939				LCN8_ENST00000371688.3_Intron			Q6JVE9	LCN8_HUMAN	lipocalin 8						response to hormone (GO:0009725)|transport (GO:0006810)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)	10	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;5.56e-06)|Epithelial(140;8.32e-05)		ggaacagcgcagggaacagca	0.597																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AK124003	CCDS35183.1	9q34.3	2011-10-24	2005-01-11		ENSG00000204001	ENSG00000204001		"""Lipocalins"""	27038	protein-coding gene	gene with protein product		612902	"""chromosome 9 open reading frame 137"", ""lipocalin 5"""	LCN5			Standard	XM_005266058		Approved		uc004cjb.1	Q6JVE9	OTTHUMG00000020942	ENST00000482893.1:c.-1686T>C	9.37:g.139650606A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4A8|A6NMN9|Q5T5R4	RNA	SNP	-	NULL	ENST00000482893.1	37	NULL		9																																																																																			LCN8	-	-	ENSG00000204001		0.597	LCN8-003	KNOWN	basic	processed_transcript	LCN8	HGNC	protein_coding	OTTHUMT00000055111.1	22	0.00	0	A	NM_178469		139650606	139650606	-1	no_errors	ENST00000482893	ensembl	human	known	69_37n	rna	33	23.26	10	SNP	0.034	G
LCT	3938	genome.wustl.edu	37	2	136594164	136594164	+	Silent	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr2:136594164G>A	ENST00000264162.2	-	1	586	c.576C>T	c.(574-576)ctC>ctT	p.L192L		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	192	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TGAGGGTCTGGAGTTGTGACG	0.517																																						dbGAP											0													145.0	109.0	121.0					2																	136594164		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.576C>T	2.37:g.136594164G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG58	Silent	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.L192	ENST00000264162.2	37	c.576	CCDS2178.1	2																																																																																			LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000115850		0.517	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	76	0.00	0	G	NM_002299		136594164	136594164	-1	no_errors	ENST00000264162	ensembl	human	known	69_37n	silent	77	12.50	11	SNP	0.069	A
LRRFIP1	9208	genome.wustl.edu	37	2	238643965	238643965	+	Intron	SNP	G	G	C			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr2:238643965G>C	ENST00000392000.4	+	5	366				LRRFIP1_ENST00000244815.5_Intron|LRRFIP1_ENST00000308482.9_Missense_Mutation_p.G182R|LRRFIP1_ENST00000289175.6_Intron	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1						innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		CAGCACCTCCGGCTCCCGTGC	0.647																																						dbGAP											0													43.0	43.0	43.0					2																	238643965		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.250-13042G>C	2.37:g.238643965G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	pfam_Leu-rich_rep_flightless-int_pr,superfamily_Prefoldin	p.G182R	ENST00000392000.4	37	c.544	CCDS46552.1	2	.	.	.	.	.	.	.	.	.	.	G	11.55	1.673501	0.29693	.	.	ENSG00000124831	ENST00000308482;ENST00000391999	T	0.47177	0.85	4.98	0.563	0.17296	.	.	.	.	.	T	0.27967	0.0689	N	0.14661	0.345	0.09310	N	0.999993	B	0.17268	0.021	B	0.15052	0.012	T	0.23440	-1.0188	9	0.72032	D	0.01	.	6.3729	0.21491	0.473:0.0:0.527:0.0	.	182	E9PGZ2	.	R	182;172	ENSP00000310109:G182R	ENSP00000310109:G182R	G	+	1	0	LRRFIP1	238308704	0.026000	0.19158	0.005000	0.12908	0.029000	0.11900	0.562000	0.23531	0.240000	0.21263	0.655000	0.94253	GGC	LRRFIP1	-	NULL	ENSG00000124831		0.647	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	LRRFIP1	HGNC	protein_coding	OTTHUMT00000317198.1	30	0.00	0	G	NM_004735		238643965	238643965	+1	no_errors	ENST00000308482	ensembl	human	putative	69_37n	missense	22	26.67	8	SNP	0.002	C
MAPK8IP3	23162	genome.wustl.edu	37	16	1816295	1816295	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr16:1816295G>T	ENST00000250894.4	+	22	2858	c.2701G>T	c.(2701-2703)Gtg>Ttg	p.V901L	MAPK8IP3_ENST00000356010.5_Missense_Mutation_p.V895L	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	901					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						GGCCACGGAGGTGCCAGACCC	0.672																																						dbGAP											0													30.0	42.0	38.0					16																	1816295		2111	4229	6340	-	-	-	SO:0001583	missense	0			AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.2701G>T	16.37:g.1816295G>T	ENSP00000250894:p.Val901Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Missense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.V901L	ENST00000250894.4	37	c.2701	CCDS10442.2	16	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244847	0.59103	.	.	ENSG00000138834	ENST00000250894;ENST00000356010	T;T	0.31769	1.48;1.48	5.09	5.09	0.68999	.	0.139116	0.49916	D	0.000140	T	0.37999	0.1024	M	0.62723	1.935	0.80722	D	1	B;B;B	0.25563	0.015;0.017;0.129	B;B;B	0.34038	0.044;0.066;0.174	T	0.16188	-1.0411	10	0.28530	T	0.3	-22.3866	18.0927	0.89479	0.0:0.0:1.0:0.0	.	902;895;901	B7ZMF3;E9PFH7;Q9UPT6	.;.;JIP3_HUMAN	L	901;895	ENSP00000250894:V901L;ENSP00000348290:V895L	ENSP00000250894:V901L	V	+	1	0	MAPK8IP3	1756296	1.000000	0.71417	0.971000	0.41717	0.760000	0.43138	7.687000	0.84139	2.387000	0.81309	0.561000	0.74099	GTG	MAPK8IP3	-	NULL	ENSG00000138834		0.672	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP3	HGNC	protein_coding	OTTHUMT00000250508.2	16	0.00	0	G	NM_001040439		1816295	1816295	+1	no_errors	ENST00000250894	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	1.000	T
MAST3	23031	genome.wustl.edu	37	19	18257727	18257727	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr19:18257727G>A	ENST00000262811.6	+	25	3112	c.3112G>A	c.(3112-3114)Gag>Aag	p.E1038K	AC007192.6_ENST00000600364.2_RNA	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	1038	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.						ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						CACAGCCCTGGAGAACACCTC	0.662																																						dbGAP											0													26.0	28.0	27.0					19																	18257727		1982	4099	6081	-	-	-	SO:0001583	missense	0			AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.3112G>A	19.37:g.18257727G>A	ENSP00000262811:p.Glu1038Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.E1038K	ENST00000262811.6	37	c.3112	CCDS46014.1	19	.	.	.	.	.	.	.	.	.	.	g	22.1	4.241746	0.79912	.	.	ENSG00000099308	ENST00000262811	T	0.42131	0.98	4.38	4.38	0.52667	PDZ/DHR/GLGF (3);	0.000000	0.85682	D	0.000000	T	0.51924	0.1703	L	0.38175	1.15	0.58432	D	0.999995	D	0.64830	0.994	P	0.61658	0.892	T	0.57573	-0.7788	10	0.87932	D	0	-20.9904	15.9367	0.79717	0.0:0.0:1.0:0.0	.	1038	O60307	MAST3_HUMAN	K	1038	ENSP00000262811:E1038K	ENSP00000262811:E1038K	E	+	1	0	MAST3	18118727	1.000000	0.71417	1.000000	0.80357	0.334000	0.28698	9.726000	0.98782	1.985000	0.57927	0.486000	0.48141	GAG	MAST3	-	superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000099308		0.662	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST3	HGNC	protein_coding	OTTHUMT00000466526.2	32	0.00	0	G	XM_038150		18257727	18257727	+1	no_errors	ENST00000262811	ensembl	human	known	69_37n	missense	23	47.73	21	SNP	1.000	A
MB	4151	genome.wustl.edu	37	22	36007099	36007099	+	Silent	SNP	C	C	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr22:36007099C>T	ENST00000397326.2	-	2	348	c.150G>A	c.(148-150)ctG>ctA	p.L50L	MB_ENST00000401702.1_5'UTR|MB_ENST00000359787.1_Silent_p.L50L|MB_ENST00000406324.1_Silent_p.L50L|MB_ENST00000397328.1_Silent_p.L50L	NM_005368.2	NP_005359.1	P02144	MYG_HUMAN	myoglobin	50					brown fat cell differentiation (GO:0050873)|enucleate erythrocyte differentiation (GO:0043353)|heart development (GO:0007507)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|slow-twitch skeletal muscle fiber contraction (GO:0031444)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			lung(1)	1						CCTCTGACTTCAGGTGCTTGA	0.562																																					GBM(49;694 1113 16998 18419)|Esophageal Squamous(101;120 1973 10459 37086)	dbGAP											0													127.0	103.0	111.0					22																	36007099		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13917.1	22q13.1	2012-10-02			ENSG00000198125	ENSG00000198125			6915	protein-coding gene	gene with protein product		160000				10591208, 2989088	Standard	NM_005368		Approved	PVALB	uc003anz.3	P02144	OTTHUMG00000150606	ENST00000397326.2:c.150G>A	22.37:g.36007099C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q52H51|Q5THY7	Silent	SNP	pfam_Globin,superfamily_Globin-like,prints_Myoglobin,pfscan_Globin	p.L50	ENST00000397326.2	37	c.150	CCDS13917.1	22																																																																																			MB	-	pfam_Globin,superfamily_Globin-like,pfscan_Globin	ENSG00000198125		0.562	MB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MB	HGNC	protein_coding	OTTHUMT00000319057.2	57	0.00	0	C	NM_203377		36007099	36007099	-1	no_errors	ENST00000359787	ensembl	human	known	69_37n	silent	25	30.56	11	SNP	1.000	T
MEOX2	4223	genome.wustl.edu	37	7	15725586	15725586	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr7:15725586C>T	ENST00000262041.5	-	1	851	c.442G>A	c.(442-444)Gac>Aac	p.D148N	AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	148					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		CGGCCGTAGTCCCCCGGCGCG	0.706																																					Esophageal Squamous(140;197 1769 16409 18257 29929)	dbGAP											0													34.0	41.0	38.0					7																	15725586		2190	4274	6464	-	-	-	SO:0001583	missense	0				CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.442G>A	7.37:g.15725586C>T	ENSP00000262041:p.Asp148Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8I7|O75263|Q9UPL6	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.D148N	ENST00000262041.5	37	c.442	CCDS34605.1	7	.	.	.	.	.	.	.	.	.	.	C	33	5.217245	0.95104	.	.	ENSG00000106511	ENST00000262041	D	0.90385	-2.66	5.43	5.43	0.79202	.	0.103674	0.64402	D	0.000006	D	0.89104	0.6620	L	0.54323	1.7	0.58432	D	0.999997	P	0.51057	0.941	B	0.41374	0.355	D	0.89203	0.3559	10	0.42905	T	0.14	-22.3139	19.2402	0.93879	0.0:1.0:0.0:0.0	.	148	P50222	MEOX2_HUMAN	N	148	ENSP00000262041:D148N	ENSP00000262041:D148N	D	-	1	0	MEOX2	15692111	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.901000	0.75693	2.533000	0.85409	0.655000	0.94253	GAC	MEOX2	-	NULL	ENSG00000106511		0.706	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEOX2	HGNC	protein_coding	OTTHUMT00000326058.2	37	0.00	0	C	NM_005924		15725586	15725586	-1	no_errors	ENST00000262041	ensembl	human	known	69_37n	missense	55	17.91	12	SNP	1.000	T
MNT	4335	genome.wustl.edu	37	17	2290427	2290427	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr17:2290427G>A	ENST00000174618.4	-	6	1922	c.1517C>T	c.(1516-1518)tCc>tTc	p.S506F	RP1-59D14.1_ENST00000571775.1_RNA|MNT_ENST00000575374.1_5'Flank	NM_020310.2	NP_064706.1	Q99583	MNT_HUMAN	MAX network transcriptional repressor	506					cell aging (GO:0007569)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cell cycle (GO:0051726)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			endometrium(4)|large_intestine(5)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	12				Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)		GGGCAGCTGGGAGCCCAGGTG	0.706																																						dbGAP											0													28.0	28.0	28.0					17																	2290427		2199	4293	6492	-	-	-	SO:0001583	missense	0			Y13444	CCDS11018.1	17p13.3	2013-11-15	2013-11-15		ENSG00000070444	ENSG00000070444		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7188	protein-coding gene	gene with protein product	"""myc antagonist"", ""Max-interacting protein"""	603039	"""MAX binding protein"", ""MNT, MAX dimerization protein"""			9598315	Standard	NM_020310		Approved	ROX, MXD6, MAD6, bHLHd3	uc002fur.3	Q99583	OTTHUMG00000090603	ENST00000174618.4:c.1517C>T	17.37:g.2290427G>A	ENSP00000174618:p.Ser506Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6D1|D3DTI7|Q1ED38	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.S506F	ENST00000174618.4	37	c.1517	CCDS11018.1	17	.	.	.	.	.	.	.	.	.	.	G	16.06	3.016528	0.54468	.	.	ENSG00000070444	ENST00000174618;ENST00000404961	D	0.83075	-1.68	4.91	3.93	0.45458	.	0.480125	0.17965	N	0.156060	T	0.68247	0.2980	N	0.08118	0	0.28077	N	0.932358	P	0.36438	0.553	B	0.38712	0.28	T	0.64228	-0.6457	10	0.59425	D	0.04	-19.1034	9.0712	0.36493	0.0:0.14:0.5787:0.2813	.	506	Q99583	MNT_HUMAN	F	506	ENSP00000174618:S506F	ENSP00000174618:S506F	S	-	2	0	MNT	2237177	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.464000	0.45067	1.047000	0.40274	0.591000	0.81541	TCC	MNT	-	NULL	ENSG00000070444		0.706	MNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNT	HGNC	protein_coding	OTTHUMT00000207158.1	96	0.00	0	G	NM_020310		2290427	2290427	-1	no_errors	ENST00000174618	ensembl	human	known	69_37n	missense	47	44.71	38	SNP	0.995	A
MUC19	283463	genome.wustl.edu	37	12	40857956	40857956	+	Silent	SNP	C	C	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr12:40857956C>T	ENST00000454784.4	+	40	4279	c.3546C>T	c.(3544-3546)gtC>gtT	p.V1182V				Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	1182	Approximate repeats of G-V-T-G-T-T-G-P-S- A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CCCCTGCAGTCGGAGGTGGCA	0.463																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.3546C>T	12.37:g.40857956C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NA85	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_VWC_out,smart_Unchr_dom_Cys-rich	p.V1411	ENST00000454784.4	37	c.4233		12																																																																																			MUC19	-	NULL	ENSG00000205592		0.463	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	30	0.00	0	C	XM_003403524		40857956	40857956	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000425730	ensembl	human	novel	69_37n	silent	19	24.00	6	SNP	0.000	T
NDN	4692	genome.wustl.edu	37	15	23931600	23931600	+	Silent	SNP	C	C	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr15:23931600C>T	ENST00000331837.4	-	1	850	c.765G>A	c.(763-765)ccG>ccA	p.P255P		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	255	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		CGTATTCGGGCGGCTCCACGT	0.562									Prader-Willi syndrome																													dbGAP											0													36.0	35.0	35.0					15																	23931600		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Prader-Labhart-Willi syndrome	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.765G>A	15.37:g.23931600C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Z5	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.P255	ENST00000331837.4	37	c.765	CCDS10014.1	15																																																																																			NDN	-	pfam_MAGE,pfscan_MAGE	ENSG00000182636		0.562	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDN	HGNC	protein_coding	OTTHUMT00000251226.2	60	0.00	0	C	NM_002487		23931600	23931600	-1	no_errors	ENST00000331837	ensembl	human	known	69_37n	silent	53	18.46	12	SNP	0.018	T
NOS3	4846	genome.wustl.edu	37	7	150706014	150706014	+	Intron	SNP	G	G	T	rs148909379	byFrequency	TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr7:150706014G>T	ENST00000297494.3	+	18	2469				NOS3_ENST00000461406.1_Intron	NM_000603.4	NP_000594.2	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)						germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGCCTGTCCCGCAGGCCGCCT	0.692											OREG0018442	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													12.0	17.0	16.0					7																	150706014		2197	4291	6488	-	-	-	SO:0001627	intron_variant	0				CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000297494.3:c.2113-4G>T	7.37:g.150706014G>T		Somatic	1734	WXS	Illumina GAIIx	Phase_IV	Q495E5	RNA	SNP	-	NULL	ENST00000297494.3	37	NULL	CCDS5912.1	7																																																																																			NOS3	-	-	ENSG00000164867		0.692	NOS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS3	HGNC	protein_coding	OTTHUMT00000350750.2	40	0.00	0	G	NM_000603		150706014	150706014	+1	no_errors	ENST00000473057	ensembl	human	known	69_37n	rna	30	21.05	8	SNP	0.640	T
NPY1R	4886	genome.wustl.edu	37	4	164246691	164246691	+	Missense_Mutation	SNP	G	G	T	rs374797315		TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr4:164246691G>T	ENST00000296533.2	-	3	1450	c.919C>A	c.(919-921)Ctc>Atc	p.L307I	NPY1R_ENST00000509586.1_Missense_Mutation_p.L64I	NM_000909.5	NP_000900.1	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	307					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose metabolic process (GO:0006006)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|regulation of blood pressure (GO:0008217)|regulation of multicellular organism growth (GO:0040014)|sensory perception of pain (GO:0019233)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			breast(1)|cervix(1)|large_intestine(4)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)	30	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				ATTGCTGTGAGGTGGCAGAGC	0.418																																						dbGAP											0													90.0	97.0	95.0					4																	164246691		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34089.1	4q31.3-q32	2012-08-08				ENSG00000164128		"""GPCR / Class A : Neuropeptide receptors : Y"""	7956	protein-coding gene	gene with protein product		162641		NPYR		8095935	Standard	NM_000909		Approved		uc003iqm.2	P25929		ENST00000296533.2:c.919C>A	4.37:g.164246691G>T	ENSP00000354652:p.Leu307Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6H5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_Glucose_rcpt_Git3_N,pfscan_GPCR_Rhodpsn_supfam,prints_NPY1_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.L307I	ENST00000296533.2	37	c.919	CCDS34089.1	4	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499734	0.85176	.	.	ENSG00000164128	ENST00000296533;ENST00000509586;ENST00000504391	T;T;T	0.58210	0.56;0.56;0.35	5.74	5.74	0.90152	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.74253	0.3692	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.73636	-0.3920	10	0.49607	T	0.09	.	19.9311	0.97118	0.0:0.0:1.0:0.0	.	307	P25929	NPY1R_HUMAN	I	307;64;64	ENSP00000354652:L307I;ENSP00000427284:L64I;ENSP00000422963:L64I	ENSP00000354652:L307I	L	-	1	0	NPY1R	164466141	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.935000	0.87658	2.714000	0.92807	0.655000	0.94253	CTC	NPY1R	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	ENSG00000164128		0.418	NPY1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY1R	HGNC	protein_coding	OTTHUMT00000364685.1	25	0.00	0	G			164246691	164246691	-1	no_errors	ENST00000296533	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	1.000	T
OBSCN	84033	genome.wustl.edu	37	1	228511202	228511202	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr1:228511202C>T	ENST00000422127.1	+	56	15591	c.15547C>T	c.(15547-15549)Cag>Tag	p.Q5183*	OBSCN_ENST00000366707.4_Nonsense_Mutation_p.Q2817*|OBSCN_ENST00000570156.2_Nonsense_Mutation_p.Q6140*|OBSCN_ENST00000366709.4_Nonsense_Mutation_p.Q2302*|OBSCN_ENST00000284548.11_Nonsense_Mutation_p.Q5183*	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5183	Ig-like 49.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGGTGGCCATCAGCTCATCAT	0.572																																						dbGAP											0													99.0	101.0	100.0					1																	228511202		2174	4275	6449	-	-	-	SO:0001587	stop_gained	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15547C>T	1.37:g.228511202C>T	ENSP00000409493:p.Gln5183*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.Q5183*	ENST00000422127.1	37	c.15547	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	64	79.649806	0.99993	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	.	.	.	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	18.6451	0.91408	0.0:1.0:0.0:0.0	.	.	.	.	X	5183;5183;2817;2302	.	ENSP00000284548:Q5183X	Q	+	1	0	OBSCN	226577825	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.597000	0.82733	2.629000	0.89072	0.655000	0.94253	CAG	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000154358		0.572	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		43	0.00	0	C	NM_052843		228511202	228511202	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	nonsense	27	18.18	6	SNP	1.000	T
ORMDL1	94101	genome.wustl.edu	37	2	190636411	190636411	+	3'UTR	SNP	C	C	G	rs6942	byFrequency	TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr2:190636411C>G	ENST00000325795.3	-	0	1330				ORMDL1_ENST00000392350.3_3'UTR|ORMDL1_ENST00000392349.4_3'UTR|ORMDL1_ENST00000496543.1_5'UTR			Q9P0S3	ORML1_HUMAN	ORMDL sphingolipid biosynthesis regulator 1						ceramide metabolic process (GO:0006672)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(1)|urinary_tract(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00177)|Epithelial(96;0.0317)|all cancers(119;0.0889)			CACATTATCACAGAAACAGTG	0.338													C|||	2924	0.583866	0.1732	0.6988	5008	,	,		18071	0.7312		0.7286	False		,,,				2504	0.7566					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS2301.1	2q32	2014-06-16	2014-06-16		ENSG00000128699	ENSG00000128699			16036	protein-coding gene	gene with protein product		610073	"""ORM1 (S. cerevisiae)-like 1"", ""ORM1-like 1 (S. cerevisiae)"""			12093374, 23066021	Standard	NM_016467		Approved		uc002ure.4	Q9P0S3	OTTHUMG00000132661	ENST00000325795.3:c.*82G>C	2.37:g.190636411C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8W3|D3DPH9	RNA	SNP	-	NULL	ENST00000325795.3	37	NULL	CCDS2301.1	2																																																																																			ORMDL1	-	-	ENSG00000128699		0.338	ORMDL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ORMDL1	HGNC	protein_coding	OTTHUMT00000335275.1	28	0.00	0	C	NM_016467		190636411	190636411	-1	no_errors	ENST00000496543	ensembl	human	putative	69_37n	rna	27	12.90	4	SNP	0.539	G
PCDH18	54510	genome.wustl.edu	37	4	138451312	138451312	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr4:138451312A>T	ENST00000344876.4	-	1	2317	c.1931T>A	c.(1930-1932)aTg>aAg	p.M644K	PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000412923.2_Missense_Mutation_p.M644K|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000507846.1_Missense_Mutation_p.M424K	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	644	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					AACAGAATCCATGCTAACGTT	0.438																																						dbGAP											0													210.0	185.0	194.0					4																	138451312		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1931T>A	4.37:g.138451312A>T	ENSP00000355082:p.Met644Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.M644K	ENST00000344876.4	37	c.1931	CCDS34064.1	4	.	.	.	.	.	.	.	.	.	.	A	12.84	2.057717	0.36277	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.51817	0.69;0.69;0.69	5.93	5.93	0.95920	Cadherin (4);Cadherin-like (1);	0.296299	0.24608	N	0.037073	T	0.43277	0.1240	L	0.35854	1.095	0.80722	D	1	B;B;B	0.23937	0.028;0.026;0.094	B;B;B	0.25405	0.06;0.06;0.06	T	0.34453	-0.9828	10	0.87932	D	0	.	16.3817	0.83467	1.0:0.0:0.0:0.0	.	424;644;644	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	K	644;644;424	ENSP00000355082:M644K;ENSP00000390688:M644K;ENSP00000425903:M424K	ENSP00000355082:M644K	M	-	2	0	PCDH18	138670762	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	7.516000	0.81772	2.261000	0.74972	0.460000	0.39030	ATG	PCDH18	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000189184		0.438	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH18	HGNC	protein_coding	OTTHUMT00000364614.1	43	0.00	0	A	NM_019035		138451312	138451312	-1	no_errors	ENST00000344876	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	1.000	T
PCDHB7	56129	genome.wustl.edu	37	5	140553979	140553979	+	Silent	SNP	C	C	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr5:140553979C>T	ENST00000231137.3	+	1	1737	c.1563C>T	c.(1561-1563)taC>taT	p.Y521Y		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	521	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTGGACTACGAGGCCCTGC	0.711																																						dbGAP											0													73.0	78.0	76.0					5																	140553979		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1563C>T	5.37:g.140553979C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3Y8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y521	ENST00000231137.3	37	c.1563	CCDS4249.1	5																																																																																			PCDHB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000113212		0.711	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	107	0.00	0	C	NM_018940		140553979	140553979	+1	no_errors	ENST00000231137	ensembl	human	known	69_37n	silent	93	26.19	33	SNP	0.988	T
PCDHB13	56123	genome.wustl.edu	37	5	140594884	140594884	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr5:140594884G>A	ENST00000341948.4	+	1	1376	c.1189G>A	c.(1189-1191)Gcg>Acg	p.A397T		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	397	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTGAAATCCGCGGAAAACTT	0.448																																						dbGAP											0													88.0	88.0	88.0					5																	140594884		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1189G>A	5.37:g.140594884G>A	ENSP00000345491:p.Ala397Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9V6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A397T	ENST00000341948.4	37	c.1189	CCDS4255.1	5	.	.	.	.	.	.	.	.	.	.	N	7.975	0.749884	0.15778	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.01821	4.62	3.5	-7.0	0.01599	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.00724	0.0024	N	0.00991	-1.07	0.09310	N	1	B	0.09022	0.002	B	0.24269	0.052	T	0.52320	-0.8591	9	0.49607	T	0.09	.	7.6502	0.28344	0.1823:0.0:0.1404:0.6772	.	397	Q9Y5F0	PCDBD_HUMAN	T	397	ENSP00000345491:A397T	ENSP00000345491:A397T	A	+	1	0	PCDHB13	140575068	0.000000	0.05858	0.000000	0.03702	0.411000	0.31082	-1.840000	0.01684	-1.255000	0.02481	0.298000	0.19748	GCG	PCDHB13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000187372		0.448	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB13	HGNC	protein_coding	OTTHUMT00000251810.1	53	0.00	0	G	NM_018933		140594884	140594884	+1	no_errors	ENST00000341948	ensembl	human	known	69_37n	missense	32	25.58	11	SNP	0.000	A
PDZRN3	23024	genome.wustl.edu	37	3	73523654	73523654	+	Intron	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr3:73523654G>A	ENST00000263666.4	-	4	1033				PDZRN3_ENST00000466780.1_Intron|PDZRN3_ENST00000462146.2_5'UTR|PDZRN3_ENST00000535920.1_Silent_p.F12F|PDZRN3_ENST00000308537.4_Intron	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3						neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TAAATTTACTGAACAATAAGA	0.363																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.919-70108C>T	3.37:g.73523654G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.F12	ENST00000263666.4	37	c.36	CCDS33789.1	3																																																																																			PDZRN3	-	NULL	ENSG00000121440		0.363	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN3	HGNC	protein_coding	OTTHUMT00000352460.1	22	0.00	0	G	XM_041363		73523654	73523654	-1	no_errors	ENST00000535920	ensembl	human	known	69_37n	silent	8	42.86	6	SNP	0.015	A
PPFIA4	8497	genome.wustl.edu	37	1	203025561	203025563	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr1:203025561_203025563delCTC	ENST00000447715.2	+	23	2540_2542	c.2099_2101delCTC	c.(2098-2103)tctcct>tct	p.P702del	PPFIA4_ENST00000295706.4_In_Frame_Del_p.P218del|PPFIA4_ENST00000599966.1_In_Frame_Del_p.P218del|PPFIA4_ENST00000414050.2_In_Frame_Del_p.P431del|PPFIA4_ENST00000367240.2_In_Frame_Del_p.P703del|PPFIA4_ENST00000272198.6_In_Frame_Del_p.P218del			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	702					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						TGTGAGACTTCTCCTCCTTCCTC	0.567																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.2099_2101delCTC	1.37:g.203025564_203025566delCTC	ENSP00000402576:p.Pro702del	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	In_Frame_Del	DEL	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_Prefoldin,smart_SAM,pfscan_SAM	p.P703in_frame_del	ENST00000447715.2	37	c.2102_2104		1																																																																																			PPFIA4	-	NULL	ENSG00000143847		0.567	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	PPFIA4	HGNC	protein_coding	OTTHUMT00000462949.1	43	0.00	0	CTC	NM_015053		203025561	203025563	+1	no_errors	ENST00000367240	ensembl	human	known	69_37n	in_frame_del	33	15.38	6	DEL	1.000:0.996:1.000	-
PPM1D	8493	genome.wustl.edu	37	17	58740764	58740764	+	Silent	SNP	C	C	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr17:58740764C>A	ENST00000305921.3	+	6	1901	c.1669C>A	c.(1669-1671)Cga>Aga	p.R557R	RNU6-623P_ENST00000363143.1_RNA	NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	557					G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			TGGCTTAAGTCGAAGTAGTGG	0.463											OREG0031485	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																										dbGAP											0													85.0	79.0	81.0					17																	58740764		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.1669C>A	17.37:g.58740764C>A		Somatic	1033	WXS	Illumina GAIIx	Phase_IV	Q53XP4|Q6P991|Q8IVR6	Silent	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.R557	ENST00000305921.3	37	c.1669	CCDS11625.1	17																																																																																			PPM1D	-	NULL	ENSG00000170836		0.463	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1D	HGNC	protein_coding	OTTHUMT00000449474.1	21	0.00	0	C	NM_003620		58740764	58740764	+1	no_errors	ENST00000305921	ensembl	human	known	69_37n	silent	13	31.58	6	SNP	0.816	A
PSD	5662	genome.wustl.edu	37	10	104174725	104174725	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr10:104174725C>A	ENST00000020673.5	-	4	1545	c.1019G>T	c.(1018-1020)gGc>gTc	p.G340V	PSD_ENST00000492902.2_5'Flank|PSD_ENST00000406432.1_Missense_Mutation_p.G340V	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	340					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		GGGATGAGGGCCAGGGAGTGG	0.662																																						dbGAP											0													73.0	63.0	66.0					10																	104174725		2203	4300	6503	-	-	-	SO:0001583	missense	0			X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.1019G>T	10.37:g.104174725C>A	ENSP00000020673:p.Gly340Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7,prints_PH_dom-spectrin-type	p.G340V	ENST00000020673.5	37	c.1019	CCDS31272.1	10	.	.	.	.	.	.	.	.	.	.	C	6.594	0.478047	0.12521	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.16324	2.35;2.35	5.31	1.11	0.20524	.	0.638085	0.15801	N	0.243960	T	0.08403	0.0209	N	0.14661	0.345	0.09310	N	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.25950	-1.0117	10	0.49607	T	0.09	.	4.4124	0.11439	0.1108:0.5668:0.1085:0.2139	.	340	A5PKW4	PSD1_HUMAN	V	340;243;340	ENSP00000020673:G340V;ENSP00000384830:G340V	ENSP00000020673:G340V	G	-	2	0	PSD	104164715	.	.	0.563000	0.28383	0.042000	0.13812	.	.	0.238000	0.21222	-1.134000	0.01955	GGC	PSD	-	NULL	ENSG00000059915		0.662	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD	HGNC	protein_coding	OTTHUMT00000050041.2	55	0.00	0	C			104174725	104174725	-1	no_errors	ENST00000020673	ensembl	human	known	69_37n	missense	37	35.09	20	SNP	0.012	A
PTPRQ	374462	genome.wustl.edu	37	12	80936644	80936644	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr12:80936644A>G	ENST00000266688.5	+	28	3845	c.3845A>G	c.(3844-3846)gAc>gGc	p.D1282G				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1328	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						CATGAAACTGACACTATATAT	0.294																																						dbGAP											0													40.0	34.0	35.0					12																	80936644		692	1589	2281	-	-	-	SO:0001583	missense	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.3845A>G	12.37:g.80936644A>G	ENSP00000266688:p.Asp1282Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.D1282G	ENST00000266688.5	37	c.3845		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.55|14.55	2.569730|2.569730	0.45798|0.45798	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000266688|ENST00000532722	T|.	0.52983|.	0.64|.	5.88|5.88	5.88|5.88	0.94601|0.94601	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|T	0.73289|0.73289	0.3568|0.3568	.|.	.|.	.|.	0.42886|0.42886	D|D	0.994187|0.994187	P|.	0.48998|.	0.918|.	P|.	0.52386|.	0.697|.	T|T	0.72880|0.72880	-0.4158|-0.4158	8|4	0.42905|.	T|.	0.14|.	.|.	16.2874|16.2874	0.82727|0.82727	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1328|.	Q9UMZ3|.	PTPRQ_HUMAN|.	G|A	1282|983	ENSP00000266688:D1282G|.	ENSP00000266688:D1282G|.	D|T	+|+	2|1	0|0	PTPRQ|PTPRQ	79460775|79460775	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.817000|0.817000	0.46193|0.46193	4.901000|4.901000	0.63259|0.63259	2.248000|2.248000	0.74166|0.74166	0.528000|0.528000	0.53228|0.53228	GAC|ACA	PTPRQ	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000139304		0.294	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		45	0.00	0	A	NM_001145026		80936644	80936644	+1	no_errors	ENST00000266688	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	1.000	G
RABGAP1L	9910	genome.wustl.edu	37	1	174927026	174927026	+	Splice_Site	SNP	A	A	C			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr1:174927026A>C	ENST00000251507.4	+	21	2607		c.e21-1		RABGAP1L_ENST00000325589.5_Intron|RABGAP1L_ENST00000367687.1_Intron|RABGAP1L_ENST00000347255.2_Intron|RABGAP1L_ENST00000489615.1_Intron|RABGAP1L_ENST00000367686.3_Splice_Site|RABGAP1L_ENST00000478442.1_Splice_Site|RABGAP1L_ENST00000486220.1_Splice_Site|RABGAP1L_ENST00000392064.2_Intron	NM_014857.4	NP_055672.3	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like											NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						CTTTTCTTTCAGTTTGTATAT	0.373																																						dbGAP											0													115.0	110.0	112.0					1																	174927026		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000251507.4:c.2434-1A>C	1.37:g.174927026A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZAA4	Splice_Site	SNP	-	e20-2	ENST00000251507.4	37	c.2434-2	CCDS1314.1	1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.091576	0.76756	.	.	ENSG00000152061	ENST00000251507;ENST00000478442;ENST00000486220	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9194	0.70826	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RABGAP1L	173193649	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.731000	0.68554	2.254000	0.74563	0.533000	0.62120	.	RABGAP1L	-	-	ENSG00000152061		0.373	RABGAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGAP1L	HGNC	protein_coding	OTTHUMT00000084497.1	68	0	0	A	NM_001243765	Intron	174927026	174927026	+1	no_errors	ENST00000251507	ensembl	human	known	69_37n	splice_site	60	21.05	16	SNP	1.000	C
SCN11A	11280	genome.wustl.edu	37	3	38889033	38889033	+	Missense_Mutation	SNP	T	T	C	rs191164627		TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr3:38889033T>C	ENST00000302328.3	-	26	4726	c.4528A>G	c.(4528-4530)Atc>Gtc	p.I1510V	SCN11A_ENST00000456224.3_Missense_Mutation_p.I1472V|SCN11A_ENST00000450244.1_Missense_Mutation_p.I1510V	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1510					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATGGCATAGATAAACATAATC	0.443													T|||	1	0.000199681	0.0008	0.0	5008	,	,		22053	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													79.0	79.0	79.0					3																	38889033		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.4528A>G	3.37:g.38889033T>C	ENSP00000307599:p.Ile1510Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.I1510V	ENST00000302328.3	37	c.4528	CCDS33737.1	3	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	T	22.4	4.283763	0.80803	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224	D;D;D	0.98889	-5.21;-5.21;-5.21	5.81	5.81	0.92471	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98871	0.9618	M	0.64170	1.965	0.54753	D	0.999987	D	0.76494	0.999	D	0.85130	0.997	D	0.99901	1.1161	10	0.87932	D	0	.	16.1668	0.81768	0.0:0.0:0.0:1.0	.	1510	Q9UI33	SCNBA_HUMAN	V	1510;1510;1472	ENSP00000307599:I1510V;ENSP00000400945:I1510V;ENSP00000416757:I1472V	ENSP00000307599:I1510V	I	-	1	0	SCN11A	38864037	1.000000	0.71417	0.939000	0.37840	0.900000	0.52787	8.032000	0.88838	2.220000	0.72140	0.519000	0.50382	ATC	SCN11A	-	pfam_Ion_trans_dom	ENSG00000168356		0.443	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	32	0.00	0	T	NM_014139		38889033	38889033	-1	no_errors	ENST00000302328	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	1.000	C
SEC14L5	9717	genome.wustl.edu	37	16	5061184	5061184	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr16:5061184G>C	ENST00000251170.7	+	15	2069	c.1889G>C	c.(1888-1890)gGt>gCt	p.G630A	RP11-165E7.1_ENST00000588778.1_RNA	NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	630	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						AGCCTCCCGGGTGTGGACGAT	0.642																																						dbGAP											0													24.0	29.0	27.0					16																	5061184		2010	4168	6178	-	-	-	SO:0001583	missense	0			AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.1889G>C	16.37:g.5061184G>C	ENSP00000251170:p.Gly630Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PRELI/MSF1,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,superfamily_GOLD,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,pfscan_PRELI/MSF1,prints_CRAL-bd_toc_tran	p.G630A	ENST00000251170.7	37	c.1889	CCDS45403.1	16	.	.	.	.	.	.	.	.	.	.	G	3.789	-0.044009	0.07452	.	.	ENSG00000103184	ENST00000251170	T	0.68765	-0.35	4.17	4.17	0.49024	GOLD (2);	0.078761	0.50627	D	0.000102	T	0.57961	0.2089	L	0.51422	1.61	0.49582	D	0.9998	B	0.20887	0.049	B	0.19946	0.027	T	0.55742	-0.8093	10	0.06236	T	0.91	-15.5438	17.0152	0.86416	0.0:0.0:1.0:0.0	.	630	O43304	S14L5_HUMAN	A	630	ENSP00000251170:G630A	ENSP00000251170:G630A	G	+	2	0	SEC14L5	5001185	1.000000	0.71417	0.677000	0.29947	0.268000	0.26511	8.842000	0.92136	2.309000	0.77851	0.561000	0.74099	GGT	SEC14L5	-	superfamily_GOLD,pfscan_GOLD	ENSG00000103184		0.642	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L5	HGNC	protein_coding	OTTHUMT00000434379.1	77	0.00	0	G			5061184	5061184	+1	no_errors	ENST00000251170	ensembl	human	known	69_37n	missense	55	25.68	19	SNP	0.995	C
SHC4	399694	genome.wustl.edu	37	15	49255010	49255010	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr15:49255010G>A	ENST00000332408.4	-	1	631	c.203C>T	c.(202-204)cCg>cTg	p.P68L		NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	68	CH2.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		ATCTTCAGTCGGCAGGTGAGG	0.657																																						dbGAP											0													35.0	38.0	37.0					15																	49255010		2197	4292	6489	-	-	-	SO:0001583	missense	0			AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.203C>T	15.37:g.49255010G>A	ENSP00000329668:p.Pro68Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_SH2,smart_PTyr_interaction_dom,smart_SH2,prints_PID_domain,prints_SH2,pfscan_PTyr_interaction_dom,pfscan_SH2	p.P68L	ENST00000332408.4	37	c.203	CCDS10130.1	15	.	.	.	.	.	.	.	.	.	.	G	11.65	1.700768	0.30142	.	.	ENSG00000185634	ENST00000332408	T	0.46063	0.88	4.68	3.77	0.43336	.	0.451712	0.20972	N	0.082375	T	0.37625	0.1010	L	0.58101	1.795	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.18304	-1.0341	10	0.34782	T	0.22	-10.3147	10.2623	0.43434	0.1653:0.0:0.8347:0.0	.	68	Q6S5L8	SHC4_HUMAN	L	68	ENSP00000329668:P68L	ENSP00000329668:P68L	P	-	2	0	SHC4	47042302	1.000000	0.71417	0.827000	0.32855	0.911000	0.54048	4.180000	0.58296	1.192000	0.43071	0.655000	0.94253	CCG	SHC4	-	NULL	ENSG00000185634		0.657	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHC4	HGNC	protein_coding	OTTHUMT00000254371.1	33	0.00	0	G	NM_203349		49255010	49255010	-1	no_errors	ENST00000332408	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	0.971	A
SLC25A30	253512	genome.wustl.edu	37	13	45971461	45971461	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr13:45971461C>T	ENST00000539591.1	-	8	776	c.613G>A	c.(613-615)Gaa>Aaa	p.E205K				Q5SVS4	KMCP1_HUMAN	solute carrier family 25, member 30	256					mitochondrial transport (GO:0006839)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	9		Lung NSC(96;0.00227)|Prostate(109;0.00578)|Breast(56;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.95e-05)		AAAAACCCTTCATTCTTCCAT	0.373																																						dbGAP											0													62.0	63.0	63.0					13																	45971461		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074457	CCDS31967.1, CCDS66539.1	13q14	2013-05-22			ENSG00000174032	ENSG00000174032		"""Solute carriers"""	27371	protein-coding gene	gene with protein product		610793					Standard	XM_005266321		Approved		uc001vag.3	Q5SVS4	OTTHUMG00000016853	ENST00000539591.1:c.613G>A	13.37:g.45971461C>T	ENSP00000443542:p.Glu205Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN96|B4DZK3|F5H8H8	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling,prints_Mit_carrier	p.E256K	ENST00000539591.1	37	c.766		13	.	.	.	.	.	.	.	.	.	.	.	34	5.310538	0.95629	.	.	ENSG00000174032	ENST00000519676;ENST00000536510;ENST00000539591	D;D	0.83591	-1.74;-1.74	5.62	5.62	0.85841	Mitochondrial carrier domain (2);	0.101684	0.64402	D	0.000003	D	0.93249	0.7849	H	0.97465	4.01	0.80722	D	1	D	0.53462	0.96	P	0.54924	0.764	D	0.95084	0.8216	10	0.72032	D	0.01	0.0388	18.5744	0.91149	0.0:1.0:0.0:0.0	.	256	Q5SVS4	KMCP1_HUMAN	K	256;181;205	ENSP00000429168:E256K;ENSP00000443542:E205K	ENSP00000429168:E256K	E	-	1	0	SLC25A30	44869461	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.095000	0.76952	2.795000	0.96236	0.655000	0.94253	GAA	SLC25A30	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000174032		0.373	SLC25A30-201	KNOWN	basic	protein_coding	SLC25A30	HGNC	protein_coding		33	0.00	0	C	XM_170736		45971461	45971461	-1	no_errors	ENST00000519676	ensembl	human	known	69_37n	missense	12	45.45	10	SNP	1.000	T
SLC38A9	153129	genome.wustl.edu	37	5	55008321	55008321	+	5'UTR	SNP	G	G	C	rs6450345	byFrequency	TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr5:55008321G>C	ENST00000396865.2	-	0	233				SLC38A9_ENST00000504880.1_5'UTR	NM_173514.3	NP_775785.2	Q8NBW4	S38A9_HUMAN	solute carrier family 38, member 9						amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)				AGGAGGCTGGGCAGCCGGCGC	0.677													G|||	2484	0.496006	0.289	0.5562	5008	,	,		13845	0.4246		0.6451	False		,,,				2504	0.6534					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS3968.1, CCDS58947.1, CCDS58948.1, CCDS75243.1	5q11.2	2013-05-22			ENSG00000177058	ENSG00000177058		"""Solute carriers"""	26907	protein-coding gene	gene with protein product							Standard	NM_173514		Approved	FLJ90709	uc003jqf.3	Q8NBW4	OTTHUMG00000131189	ENST00000396865.2:c.-359C>G	5.37:g.55008321G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXV1|B7Z7D0|Q0P5S0|Q6MZJ8	RNA	SNP	-	NULL	ENST00000396865.2	37	NULL	CCDS3968.1	5																																																																																			SLC38A9	-	-	ENSG00000177058		0.677	SLC38A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC38A9	HGNC	protein_coding	OTTHUMT00000253912.2	26	0.00	0	G	NM_173514		55008321	55008321	-1	no_errors	ENST00000504880	ensembl	human	known	69_37n	rna	19	20.00	5	SNP	0.000	C
GNB2L1	10399	genome.wustl.edu	37	5	180668879	180668881	+	Intron	TNP	TCA	TCA	CAT			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	T|C|A	T|C|A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr5:180668879_180668881TCA>CAT	ENST00000512805.1	-	3	690				GNB2L1_ENST00000505461.1_Intron|GNB2L1_ENST00000511566.1_Intron|SNORD96A_ENST00000606577.1_RNA|SNORD95_ENST00000579879.1_RNA|GNB2L1_ENST00000376817.4_Intron|GNB2L1_ENST00000511900.1_Intron|GNB2L1_ENST00000504726.1_Intron|GNB2L1_ENST00000456394.2_Intron	NM_006098.4	NP_006089.1	P63244	GBLP_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cell cycle (GO:0007049)|gastrulation (GO:0007369)|negative regulation of cell growth (GO:0030308)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron death (GO:1903208)|negative regulation of phagocytosis (GO:0050765)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of translation (GO:0017148)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of cell migration (GO:0030335)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of gastrulation (GO:2000543)|positive regulation of GTPase activity (GO:0043547)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein phosphorylation (GO:0001934)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein localization (GO:0032880)|rhythmic process (GO:0048511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|phagocytic cup (GO:0001891)|small ribosomal subunit (GO:0015935)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|ion channel inhibitor activity (GO:0008200)|poly(A) RNA binding (GO:0044822)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase inhibitor activity (GO:0030292)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)			lung(3)|skin(2)	5	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.101)|all cancers(165;0.11)		ATGCCATCTGTCATCACCAGGAC	0.463																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M24194	CCDS34324.1	5q35.3	2013-01-10				ENSG00000204628		"""WD repeat domain containing"""	4399	protein-coding gene	gene with protein product	"""Receptor for Activated C Kinase 1"""	176981				8302854, 2499885	Standard	NM_006098		Approved	Gnb2-rs1, RACK1, H12.3	uc003mni.1	P63244		ENST00000512805.1:c.282-240TGA>ATG	5.37:g.180668879TCA>CAT		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTJ0|D3DWS0|P25388|P99049|Q53HU2|Q5J8M6|Q5VLR4|Q6FH47	RNA	SNP	-	NULL	ENST00000512805.1	37	NULL	CCDS34324.1	5																																																																																			SNORD96A	-	-	ENSG00000208342		0.463	GNB2L1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SNORD96A	HGNC	protein_coding	OTTHUMT00000372943.2	58|60|59	0.00	0	T|C|A	NM_006098		180668879|180668880|180668881	180668879|180668880|180668881	-1	no_errors	ENST00000385607	ensembl	human	known	69_37n	rna	60|65|66	16.67|15.38|15.38	12	SNP	0.982|1.000|1.000	C|A|T
SUSD4	55061	genome.wustl.edu	37	1	223441874	223441874	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr1:223441874C>A	ENST00000343846.3	-	3	1138	c.505G>T	c.(505-507)Gga>Tga	p.G169*	SUSD4_ENST00000484758.2_Nonsense_Mutation_p.G98*|SUSD4_ENST00000454695.2_Nonsense_Mutation_p.G9*|SUSD4_ENST00000344029.6_Nonsense_Mutation_p.G169*|SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000494793.2_Nonsense_Mutation_p.G169*|SUSD4_ENST00000366878.4_Nonsense_Mutation_p.G169*			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	169	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		TTCCACGTTCCATCATCGCGA	0.438																																						dbGAP											0													197.0	172.0	181.0					1																	223441874		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.505G>T	1.37:g.223441874C>A	ENSP00000344219:p.Gly169*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Nonsense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.G169*	ENST00000343846.3	37	c.505	CCDS41471.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.072824	0.97256	.	.	ENSG00000143502	ENST00000343846;ENST00000366878;ENST00000542750;ENST00000454695;ENST00000271787;ENST00000344029	.	.	.	5.38	5.38	0.77491	.	0.000000	0.47852	D	0.000218	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-18.557	18.3046	0.90176	0.0:1.0:0.0:0.0	.	.	.	.	X	169;169;98;9;169;169	.	ENSP00000271787:G169X	G	-	1	0	SUSD4	221508497	1.000000	0.71417	0.585000	0.28666	0.814000	0.46013	5.848000	0.69458	2.802000	0.96397	0.650000	0.86243	GGA	SUSD4	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP	ENSG00000143502		0.438	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD4	HGNC	protein_coding	OTTHUMT00000092592.2	35	0.00	0	C	NM_017982		223441874	223441874	-1	no_errors	ENST00000343846	ensembl	human	known	69_37n	nonsense	18	30.77	8	SNP	1.000	A
SYNJ2	8871	genome.wustl.edu	37	6	158480367	158480367	+	Silent	SNP	G	G	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr6:158480367G>T	ENST00000355585.4	+	7	1011	c.936G>T	c.(934-936)gtG>gtT	p.V312V	SYNJ2_ENST00000449859.2_Silent_p.V261V|SYNJ2_ENST00000367121.3_Silent_p.V312V|SYNJ2_ENST00000367122.2_Silent_p.V312V	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	312	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		GAGAGGAGGTGCTCAACAGAG	0.642																																						dbGAP											0													73.0	45.0	55.0					6																	158480367		2072	3988	6060	-	-	-	SO:0001819	synonymous_variant	0			AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.936G>T	6.37:g.158480367G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Missense_Mutation	SNP	pfam_Syja_N,pfscan_Syja_N	p.C139F	ENST00000355585.4	37	c.416	CCDS5254.1	6																																																																																			SYNJ2	-	pfam_Syja_N,pfscan_Syja_N	ENSG00000078269		0.642	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNJ2	HGNC	protein_coding	OTTHUMT00000042858.2	23	0.00	0	G			158480367	158480367	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000485863	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	1.000	T
SYT4	6860	genome.wustl.edu	37	18	40854127	40854127	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr18:40854127C>A	ENST00000255224.3	-	2	635	c.267G>T	c.(265-267)aaG>aaT	p.K89N	SYT4_ENST00000586678.1_Intron|SYT4_ENST00000590752.1_Missense_Mutation_p.K71N	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	89					exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.K89N(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						GCAATGAATTCTTTGGCACAG	0.393																																					NSCLC(85;81 1419 2855 22820 35912)	dbGAP											2	Substitution - Missense(2)	large_intestine(2)											143.0	139.0	141.0					18																	40854127		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.267G>T	18.37:g.40854127C>A	ENSP00000255224:p.Lys89Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEU3|Q9P2K4	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin	p.K89N	ENST00000255224.3	37	c.267	CCDS11922.1	18	.	.	.	.	.	.	.	.	.	.	C	12.52	1.962031	0.34659	.	.	ENSG00000132872	ENST00000255224	T	0.38077	1.16	5.86	3.07	0.35406	.	0.088246	0.85682	N	0.000000	T	0.22044	0.0531	N	0.22421	0.69	0.36453	D	0.866228	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.11518	-1.0584	10	0.25751	T	0.34	.	9.1087	0.36714	0.0:0.7402:0.1261:0.1336	.	71;89	B4DEU3;Q9H2B2	.;SYT4_HUMAN	N	89	ENSP00000255224:K89N	ENSP00000255224:K89N	K	-	3	2	SYT4	39108125	0.999000	0.42202	0.998000	0.56505	0.965000	0.64279	0.585000	0.23879	0.456000	0.26937	0.650000	0.86243	AAG	SYT4	-	NULL	ENSG00000132872		0.393	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT4	HGNC	protein_coding	OTTHUMT00000255851.2	74	0.00	0	C	NM_020783		40854127	40854127	-1	no_errors	ENST00000255224	ensembl	human	known	69_37n	missense	37	28.85	15	SNP	1.000	A
TCEA2	6919	genome.wustl.edu	37	20	62703271	62703271	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr20:62703271A>T	ENST00000343484.5	+	9	1037	c.868A>T	c.(868-870)Aac>Tac	p.N290Y	TCEA2_ENST00000361317.2_Missense_Mutation_p.N263Y|TCEA2_ENST00000465111.1_3'UTR|TCEA2_ENST00000395053.3_3'UTR|RGS19_ENST00000493165.1_5'Flank	NM_003195.4	NP_003186.1	Q15560	TCEA2_HUMAN	transcription elongation factor A (SII), 2	290					DNA-templated transcription, elongation (GO:0006354)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)	centrosome (GO:0005813)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)	12	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					TGTTGTCTGCAACGAGTGTGG	0.617																																						dbGAP											0													84.0	71.0	75.0					20																	62703271		2203	4300	6503	-	-	-	SO:0001583	missense	0			U86749	CCDS13553.1, CCDS13554.1	20q13.33	2011-01-25			ENSG00000171703	ENSG00000171703			11614	protein-coding gene	gene with protein product		604784				9441762, 8566795	Standard	NM_003195		Approved	TFIIS	uc021wgq.1	Q15560	OTTHUMG00000033026	ENST00000343484.5:c.868A>T	20.37:g.62703271A>T	ENSP00000343515:p.Asn290Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNM1|Q8TD37|Q8TD38	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_TFIIS_N,pfam_Znf_TFIIS,superfamily_TFIIS_cen_dom,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_TFS2M,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	p.N290Y	ENST00000343484.5	37	c.868	CCDS13553.1	20	.	.	.	.	.	.	.	.	.	.	A	21.7	4.180717	0.78677	.	.	ENSG00000171703	ENST00000361317;ENST00000343484;ENST00000458442	.	.	.	3.99	3.99	0.46301	Zinc finger, TFIIS-type (4);	0.060237	0.64402	D	0.000006	T	0.74129	0.3676	M	0.63843	1.955	0.80722	D	1	P;P;D	0.76494	0.949;0.949;0.999	P;P;D	0.75484	0.826;0.826;0.986	T	0.73560	-0.3944	9	0.36615	T	0.2	.	13.1695	0.59589	1.0:0.0:0.0:0.0	.	290;290;263	Q15560;Q6IB64;B3KNM1	TCEA2_HUMAN;.;.	Y	263;290;263	.	ENSP00000343515:N290Y	N	+	1	0	TCEA2	62173715	1.000000	0.71417	0.989000	0.46669	0.963000	0.63663	9.040000	0.93783	1.589000	0.49982	0.260000	0.18958	AAC	TCEA2	-	pfam_Znf_TFIIS,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	ENSG00000171703		0.617	TCEA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEA2	HGNC	protein_coding	OTTHUMT00000080277.2	65	0.00	0	A	NM_198723		62703271	62703271	+1	no_errors	ENST00000343484	ensembl	human	known	69_37n	missense	32	34.69	17	SNP	1.000	T
TFAP2B	7021	genome.wustl.edu	37	6	50805705	50805705	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr6:50805705G>A	ENST00000393655.3	+	5	1008	c.839G>A	c.(838-840)gGg>gAg	p.G280E	TFAP2B_ENST00000263046.4_Missense_Mutation_p.G289E	NM_003221.3	NP_003212.2	Q92481	AP2B_HUMAN	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	280					aorta morphogenesis (GO:0035909)|calcium ion homeostasis (GO:0055074)|cellular ammonia homeostasis (GO:0097275)|cellular creatinine homeostasis (GO:0097276)|cellular urea homeostasis (GO:0097277)|collecting duct development (GO:0072044)|distal tubule development (GO:0072017)|ductus arteriosus closure (GO:0097070)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hindlimb morphogenesis (GO:0035137)|kidney development (GO:0001822)|magnesium ion homeostasis (GO:0010960)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphate ion homeostasis (GO:0055062)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|potassium ion homeostasis (GO:0055075)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell differentiation (GO:0045595)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|renal water homeostasis (GO:0003091)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|retina layer formation (GO:0010842)|skin development (GO:0043588)|sodium ion homeostasis (GO:0055078)|sympathetic nervous system development (GO:0048485)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)	40	Lung NSC(77;0.156)					TCGAAAAATGGGGGGAGATCT	0.433																																					Pancreas(116;1373 2332 5475 10752)	dbGAP											0													86.0	95.0	92.0					6																	50805705		2203	4300	6503	-	-	-	SO:0001583	missense	0			X95694	CCDS4934.2	6p12	2008-02-05	2001-11-28		ENSG00000008196	ENSG00000008196			11743	protein-coding gene	gene with protein product		601601	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)"""			7555706, 8661133	Standard	NM_003221		Approved	AP2-B	uc003pag.3	Q92481	OTTHUMG00000014836	ENST00000393655.3:c.839G>A	6.37:g.50805705G>A	ENSP00000377265:p.Gly280Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYX6|Q9NQ63|Q9NU99|Q9UJI7|Q9Y214|Q9Y3K3	Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_beta,prints_TF_AP2_C	p.G289E	ENST00000393655.3	37	c.866	CCDS4934.2	6	.	.	.	.	.	.	.	.	.	.	G	27.1	4.797880	0.90538	.	.	ENSG00000008196	ENST00000393655;ENST00000263046	D;D	0.98105	-4.72;-4.72	5.63	5.63	0.86233	Transcription factor AP-2, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.99130	0.9700	M	0.93106	3.38	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99414	1.0931	10	0.87932	D	0	-13.0705	20.0471	0.97613	0.0:0.0:1.0:0.0	.	280	Q92481	AP2B_HUMAN	E	280;289	ENSP00000377265:G280E;ENSP00000263046:G289E	ENSP00000263046:G289E	G	+	2	0	TFAP2B	50913664	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.815000	0.96918	0.561000	0.74099	GGG	TFAP2B	-	pfam_TF_AP2_C,prints_TF_AP2_C	ENSG00000008196		0.433	TFAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2B	HGNC	protein_coding	OTTHUMT00000040886.3	28	0.00	0	G	NM_003221		50805705	50805705	+1	no_errors	ENST00000263046	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578440	7578440	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr17:7578440T>C	ENST00000269305.4	-	5	679	c.490A>G	c.(490-492)Aag>Gag	p.K164E	TP53_ENST00000420246.2_Missense_Mutation_p.K164E|TP53_ENST00000455263.2_Missense_Mutation_p.K164E|TP53_ENST00000413465.2_Missense_Mutation_p.K164E|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.K164E|TP53_ENST00000445888.2_Missense_Mutation_p.K164E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	164	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in sporadic cancers; somatic mutation).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation).|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K164E(15)|p.K164*(11)|p.0?(8)|p.K164Q(2)|p.K164fs*6(2)|p.K164fs*3(2)|p.V157_C176del20(1)|p.Y163fs*1(1)|p.Y163_Q165delYKQ(1)|p.P151_V173del23(1)|p.K164fs*5(1)|p.K71E(1)|p.K164fs*17(1)|p.Y163fs*14(1)|p.S149fs*72(1)|p.A159_Q167delAMAIYKQSQ(1)|p.K32E(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGTGACTGCTTGTAGATGGCC	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	51	Substitution - Missense(19)|Substitution - Nonsense(11)|Deletion - Frameshift(8)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(1)	lung(12)|central_nervous_system(6)|bone(5)|urinary_tract(4)|breast(4)|oesophagus(4)|upper_aerodigestive_tract(3)|large_intestine(3)|ovary(3)|liver(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)											54.0	54.0	54.0					17																	7578440		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.490A>G	17.37:g.7578440T>C	ENSP00000269305:p.Lys164Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.K164E	ENST00000269305.4	37	c.490	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	16.70	3.195088	0.58017	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99784	-6.74;-6.74;-6.74;-6.74;-6.74;-6.74;-6.74;-6.74;-6.74	5.59	4.5	0.54988	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99585	0.9850	M	0.62088	1.915	0.58432	D	0.999992	D;D;D;D;D;P;D	0.89917	0.986;0.996;0.965;0.998;0.997;0.95;1.0	D;D;P;D;D;P;D	0.85130	0.934;0.952;0.76;0.98;0.972;0.9;0.997	D	0.98302	1.0519	10	0.87932	D	0	-15.5455	10.4804	0.44689	0.1456:0.0:0.0:0.8544	.	125;164;164;71;164;164;164	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	E	164;164;164;164;164;164;153;71;32;71;32;164	ENSP00000410739:K164E;ENSP00000352610:K164E;ENSP00000269305:K164E;ENSP00000398846:K164E;ENSP00000391127:K164E;ENSP00000391478:K164E;ENSP00000425104:K32E;ENSP00000423862:K71E;ENSP00000424104:K164E	ENSP00000269305:K164E	K	-	1	0	TP53	7519165	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	7.996000	0.88334	1.039000	0.40074	-0.336000	0.08194	AAG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	25	0.00	0	T	NM_000546		7578440	7578440	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	12	27.78	5	SNP	1.000	C
TRIM46	80128	genome.wustl.edu	37	1	155154369	155154369	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr1:155154369G>C	ENST00000334634.4	+	9	1630	c.1630G>C	c.(1630-1632)Gag>Cag	p.E544Q	TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000392451.2_3'UTR|TRIM46_ENST00000368382.1_Missense_Mutation_p.E521Q|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000368383.3_Missense_Mutation_p.E544Q|TRIM46_ENST00000545012.1_Missense_Mutation_p.E418Q|TRIM46_ENST00000543729.1_3'UTR	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	544	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CGCAAGCCGAGAGCGGCTGGC	0.627																																						dbGAP											0													45.0	48.0	47.0					1																	155154369		2178	4254	6432	-	-	-	SO:0001583	missense	0				CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.1630G>C	1.37:g.155154369G>C	ENSP00000334657:p.Glu544Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Fibronectin_type3,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.E544Q	ENST00000334634.4	37	c.1630	CCDS1097.1	1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.720095	0.68844	.	.	ENSG00000163462	ENST00000430513;ENST00000545012;ENST00000368383;ENST00000368382;ENST00000334634	T;T;T;T	0.66638	-0.22;2.57;0.24;0.29	4.06	4.06	0.47325	B30.2/SPRY domain (1);	0.123467	0.53938	D	0.000058	T	0.66645	0.2810	L	0.43923	1.385	0.42950	D	0.994371	D;D	0.63046	0.992;0.986	D;P	0.63703	0.917;0.856	T	0.68258	-0.5456	10	0.48119	T	0.1	.	14.1186	0.65172	0.0:0.0:1.0:0.0	.	544;544	Q5VT61;Q7Z4K8	.;TRI46_HUMAN	Q	502;418;544;521;544	ENSP00000440254:E418Q;ENSP00000357367:E544Q;ENSP00000357366:E521Q;ENSP00000334657:E544Q	ENSP00000334657:E544Q	E	+	1	0	TRIM46	153420993	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	8.883000	0.92426	2.285000	0.76669	0.561000	0.74099	GAG	TRIM46	-	pfscan_B30.2/SPRY	ENSG00000163462		0.627	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM46	HGNC	protein_coding	OTTHUMT00000086728.1	122	0.00	0	G	NM_025058		155154369	155154369	+1	no_errors	ENST00000334634	ensembl	human	known	69_37n	missense	110	29.03	45	SNP	1.000	C
TRPC4	7223	genome.wustl.edu	37	13	38320328	38320328	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr13:38320328C>G	ENST00000379705.3	-	3	1500	c.643G>C	c.(643-645)Gat>Cat	p.D215H	TRPC4_ENST00000358477.2_Missense_Mutation_p.D215H|TRPC4_ENST00000447043.1_Missense_Mutation_p.D215H|TRPC4_ENST00000379681.3_Missense_Mutation_p.D215H|TRPC4_ENST00000338947.5_Intron|TRPC4_ENST00000355779.2_Missense_Mutation_p.D215H|TRPC4_ENST00000426868.2_Missense_Mutation_p.D215H|TRPC4_ENST00000379673.2_Missense_Mutation_p.D215H|TRPC4_ENST00000379679.1_Intron			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	215					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		AGAAAAGGATCTTCGCTTGAC	0.502																																						dbGAP											0													113.0	97.0	103.0					13																	38320328		2203	4300	6503	-	-	-	SO:0001583	missense	0			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.643G>C	13.37:g.38320328C>G	ENSP00000369027:p.Asp215His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC4_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.D215H	ENST00000379705.3	37	c.643	CCDS9365.1	13	.	.	.	.	.	.	.	.	.	.	C	26.9	4.784276	0.90282	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	D;D;D;D;D;D;D	0.90069	-2.61;-2.61;-2.61;-2.61;-2.61;-2.61;-2.61	5.98	5.98	0.97165	Transient receptor potential II (1);	0.000000	0.85682	D	0.000000	D	0.95749	0.8617	M	0.88640	2.97	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.997;0.998;0.998;0.997;0.999	D	0.95628	0.8687	10	0.87932	D	0	-32.9181	20.452	0.99131	0.0:1.0:0.0:0.0	.	215;215;215;215;215	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-2;Q9UBN4	.;.;.;.;TRPC4_HUMAN	H	215	ENSP00000369027:D215H;ENSP00000369003:D215H;ENSP00000410133:D215H;ENSP00000348025:D215H;ENSP00000351264:D215H;ENSP00000368995:D215H;ENSP00000414316:D215H	ENSP00000348025:D215H	D	-	1	0	TRPC4	37218328	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.838000	0.97847	0.591000	0.81541	GAT	TRPC4	-	pfam_TRP_dom,tigrfam_TRP_channel	ENSG00000133107		0.502	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4	HGNC	protein_coding	OTTHUMT00000044574.2	57	0.00	0	C	NM_003306		38320328	38320328	-1	no_errors	ENST00000379681	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	1.000	G
UGT1A10	54575	genome.wustl.edu	37	2	234545372	234545372	+	Silent	SNP	A	A	G			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr2:234545372A>G	ENST00000344644.5	+	1	273	c.204A>G	c.(202-204)agA>agG	p.R68R	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000373445.1_Silent_p.R68R	NM_019075.2	NP_061948.1	Q9HAW8	UD110_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A10	68					cellular glucuronidation (GO:0052695)|flavone metabolic process (GO:0051552)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(2)|skin(3)	32		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)	Acetaminophen(DB00316)|Etodolac(DB00749)|Losartan(DB00678)|Mycophenolate mofetil(DB00688)|Valproic Acid(DB00313)	AACTGGAAAGATCACTGAATT	0.502																																						dbGAP											0													121.0	102.0	109.0					2																	234545372		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U39550	CCDS33403.1	2q37	2010-03-05	2005-07-20		ENSG00000242515	ENSG00000242515		"""UDP glucuronosyltransferases"""	12531	other	complex locus constituent		606435	"""UDP glycosyltransferase 1 family, polypeptide A10"""			9295054, 9325166	Standard	NM_019075		Approved	UGT1J		Q9HAW8	OTTHUMG00000059121	ENST00000344644.5:c.204A>G	2.37:g.234545372A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O00474|Q6NT91|Q7Z6H8	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.R68	ENST00000344644.5	37	c.204	CCDS33403.1	2																																																																																			UGT1A10	-	pfam_UDP_glucos_trans	ENSG00000242515		0.502	UGT1A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT1A10	HGNC	protein_coding	OTTHUMT00000130986.1	89	0.00	0	A	NM_019075		234545372	234545372	+1	no_errors	ENST00000344644	ensembl	human	known	69_37n	silent	58	20.55	15	SNP	0.006	G
UNC13C	440279	genome.wustl.edu	37	15	54306089	54306089	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr15:54306089G>T	ENST00000260323.11	+	1	989	c.989G>T	c.(988-990)aGa>aTa	p.R330I	UNC13C_ENST00000537900.1_Missense_Mutation_p.R330I|UNC13C_ENST00000545554.1_Missense_Mutation_p.R330I	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	330					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		ACTGAAGAAAGATTTGAATAT	0.358																																						dbGAP											0													88.0	88.0	88.0					15																	54306089		1844	4087	5931	-	-	-	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.989G>T	15.37:g.54306089G>T	ENSP00000260323:p.Arg330Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.R330I	ENST00000260323.11	37	c.989	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965561	0.53507	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.79940	-1.32;-1.32;-1.32	5.08	4.1	0.47936	.	.	.	.	.	T	0.64594	0.2612	N	0.14661	0.345	0.52099	D	0.999944	P	0.49961	0.93	B	0.41571	0.36	T	0.68424	-0.5412	9	0.72032	D	0.01	.	7.8758	0.29592	0.0852:0.164:0.7508:0.0	.	330	Q8NB66	UN13C_HUMAN	I	330	ENSP00000260323:R330I;ENSP00000438156:R330I;ENSP00000442569:R330I	ENSP00000260323:R330I	R	+	2	0	UNC13C	52093381	1.000000	0.71417	0.999000	0.59377	0.937000	0.57800	2.264000	0.43302	2.343000	0.79666	0.655000	0.94253	AGA	UNC13C	-	NULL	ENSG00000137766		0.358	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	91	0.00	0	G	NM_173166		54306089	54306089	+1	no_errors	ENST00000260323	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	0.990	T
WASH6P	653440	genome.wustl.edu	37	X	155251319	155251319	+	RNA	SNP	C	C	T			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chrX:155251319C>T	ENST00000461007.1	+	0	327				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GGGAGCAGCCCAGCCTCTGTG	0.632																																						dbGAP											0																																										-	-	-			0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155251319C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGF1|Q8N305	RNA	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			WASH6P	-	-	ENSG00000182484		0.632	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	27	0.00	0	C	NG_008380		155251319	155251319	+1	no_errors	ENST00000461007	ensembl	human	known	69_37n	rna	21	19.23	5	SNP	0.975	T
ZFAT	57623	genome.wustl.edu	37	8	135612755	135612755	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr8:135612755C>A	ENST00000377838.3	-	7	2573	c.2399G>T	c.(2398-2400)tGt>tTt	p.C800F	ZFAT_ENST00000520727.1_Missense_Mutation_p.C788F|ZFAT_ENST00000429442.2_Missense_Mutation_p.C788F|ZFAT_ENST00000520356.1_Missense_Mutation_p.C788F|ZFAT_ENST00000520214.1_Missense_Mutation_p.C788F|ZFAT_ENST00000523399.1_Missense_Mutation_p.C738F|ZFAT-AS1_ENST00000505776.1_RNA	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	800					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			ATCGGTGGGACACTTCAGCAA	0.433																																						dbGAP											0													182.0	179.0	180.0					8																	135612755		1972	4153	6125	-	-	-	SO:0001583	missense	0			BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.2399G>T	8.37:g.135612755C>A	ENSP00000367069:p.Cys800Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C800F	ENST00000377838.3	37	c.2399	CCDS47924.1	8	.	.	.	.	.	.	.	.	.	.	C	25.5	4.640775	0.87859	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399;ENST00000398946	T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27	5.61	5.61	0.85477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.67468	0.2896	M	0.87758	2.905	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.91635	0.999;0.998;0.999;0.994	T	0.72178	-0.4369	10	0.87932	D	0	-12.6844	18.9874	0.92777	0.0:1.0:0.0:0.0	.	738;788;788;800	E9PER3;E9PBN4;Q9P243-3;Q9P243	.;.;.;ZFAT_HUMAN	F	788;788;788;800;788;687;738;788	ENSP00000427879:C788F;ENSP00000427831:C788F;ENSP00000394501:C788F;ENSP00000367069:C800F;ENSP00000428483:C788F;ENSP00000429091:C738F	ENSP00000326997:C687F	C	-	2	0	ZFAT	135681937	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.765000	0.85310	2.813000	0.96785	0.655000	0.94253	TGT	ZFAT	-	smart_Znf_C2H2-like	ENSG00000066827		0.433	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAT	HGNC	protein_coding	OTTHUMT00000378272.1	35	0.00	0	C	NM_001029939		135612755	135612755	-1	no_errors	ENST00000377838	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	1.000	A
ZNF677	342926	genome.wustl.edu	37	19	53741153	53741153	+	Missense_Mutation	SNP	G	G	A	rs370992225		TCGA-E2-A1LE-01A-12D-A19Y-09	TCGA-E2-A1LE-11A-23D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	eac99b55-b6ca-40be-8bd5-8ac8bf066651	85a70007-4c24-4ac8-9f64-7d7502788851	g.chr19:53741153G>A	ENST00000598513.1	-	5	977	c.827C>T	c.(826-828)tCg>tTg	p.S276L	ZNF677_ENST00000333952.4_Missense_Mutation_p.S276L|CTD-2245F17.6_ENST00000596041.1_RNA	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		AGTGAGGTTCGAACTTTTGCT	0.383													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19365	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													83.0	76.0	78.0					19																	53741153		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.827C>T	19.37:g.53741153G>A	ENSP00000469391:p.Ser276Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S276L	ENST00000598513.1	37	c.827	CCDS12861.1	19	.	.	.	.	.	.	.	.	.	.	G	13.14	2.146878	0.37923	.	.	ENSG00000197928	ENST00000333952	T	0.01705	4.68	2.1	-0.12	0.13539	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.28140	N	0.016456	T	0.01695	0.0054	L	0.43923	1.385	0.09310	N	1	B	0.18610	0.029	B	0.06405	0.002	T	0.42849	-0.9427	10	0.54805	T	0.06	.	4.9931	0.14224	0.1408:0.2181:0.641:0.0	.	276	Q86XU0	ZN677_HUMAN	L	276	ENSP00000334394:S276L	ENSP00000334394:S276L	S	-	2	0	ZNF677	58432965	0.000000	0.05858	0.477000	0.27303	0.956000	0.61745	-0.076000	0.11412	0.044000	0.15775	-0.156000	0.13503	TCG	ZNF677	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197928		0.383	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF677	HGNC	protein_coding	OTTHUMT00000464189.1	52	0.00	0	G	NM_182609		53741153	53741153	-1	no_errors	ENST00000333952	ensembl	human	known	69_37n	missense	34	27.66	13	SNP	0.004	A
