#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
CROCCP2	84809	genome.wustl.edu	37	1	16950889	16950889	+	lincRNA	SNP	G	G	A	rs12045375	byFrequency	TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr1:16950889G>A	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											TTGCCCCAGCGTCTCCACCTG	0.697													.|||	1177	0.235024	0.0174	0.2738	5008	,	,		56460	0.4712		0.2495	False		,,,				2504	0.2434					dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950889G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.697	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	15	0.00	0	G	NR_026752.1		16950889	16950889	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	17	32.00	8	SNP	0.470	A
CYHR1	50626	genome.wustl.edu	37	8	145675924	145675924	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr8:145675924G>C	ENST00000438911.2	-	5	1060	c.927C>G	c.(925-927)gaC>gaG	p.D309E	CYHR1_ENST00000530374.1_Missense_Mutation_p.D351E	NM_138496.1	NP_612505.1	Q6ZMK1	CYHR1_HUMAN	cysteine/histidine-rich 1	309						cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(3)|ovary(2)	7	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			TCCTCACGTCGTCGTAGGGGC	0.592																																						dbGAP											0													128.0	114.0	118.0					8																	145675924		692	1591	2283	-	-	-	SO:0001583	missense	0			AB007965	CCDS6426.1, CCDS47943.1	8q24	2004-12-07	2005-07-24		ENSG00000187954	ENSG00000187954			17806	protein-coding gene	gene with protein product			"""cysteine and histidine rich 1"""			10745073	Standard	NM_138496		Approved	CHRP, KIAA0496, MGC13010	uc003zcv.2	Q6ZMK1	OTTHUMG00000165171	ENST00000438911.2:c.927C>G	8.37:g.145675924G>C	ENSP00000387426:p.Asp309Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSX0|D3DWM3|Q9BSF6|Q9BSU6	Missense_Mutation	SNP	superfamily_TRAF-like,pfscan_Znf_TRAF	p.D309E	ENST00000438911.2	37	c.927	CCDS47943.1	8	.	.	.	.	.	.	.	.	.	.	G	6.355	0.433521	0.12045	.	.	ENSG00000187954	ENST00000438911;ENST00000530374	T;T	0.38240	1.15;1.15	5.21	-4.51	0.03483	.	0.431972	0.27991	N	0.017035	T	0.13970	0.0338	N	0.04508	-0.205	0.80722	D	1	B	0.13145	0.007	B	0.11329	0.006	T	0.12734	-1.0536	10	0.41790	T	0.15	-15.055	9.6154	0.39687	0.5456:0.0967:0.3577:0.0	.	309	Q6ZMK1	CYHR1_HUMAN	E	309;351	ENSP00000387426:D309E;ENSP00000433769:D351E	ENSP00000387426:D309E	D	-	3	2	CYHR1	145646732	0.959000	0.32827	0.011000	0.14972	0.426000	0.31534	0.081000	0.14823	-2.067000	0.00885	-1.478000	0.00992	GAC	CYHR1	-	NULL	ENSG00000187954		0.592	CYHR1-001	KNOWN	basic|CCDS	protein_coding	CYHR1	HGNC	protein_coding	OTTHUMT00000382438.1	44	0.00	0	G	NM_032687		145675924	145675924	-1	no_errors	ENST00000438911	ensembl	human	known	69_37n	missense	76	19.15	18	SNP	0.236	C
FREM3	166752	genome.wustl.edu	37	4	144614306	144614306	+	Silent	SNP	G	G	A			TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr4:144614306G>A	ENST00000329798.5	-	2	5234	c.5235C>T	c.(5233-5235)aaC>aaT	p.N1745N		NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	1745					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						CCTTTGATGCGTTGCTGCCCT	0.343																																						dbGAP											0													230.0	180.0	195.0					4																	144614306		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.5235C>T	4.37:g.144614306G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.N1745	ENST00000329798.5	37	c.5235	CCDS54808.1	4																																																																																			FREM3	-	NULL	ENSG00000183090		0.343	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	86	0.00	0	G	XM_094074		144614306	144614306	-1	no_errors	ENST00000329798	ensembl	human	putative	69_37n	silent	85	16.67	17	SNP	0.948	A
HIST1H2AK	8330	genome.wustl.edu	37	6	27806084	27806084	+	Missense_Mutation	SNP	G	G	C	rs368921870		TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr6:27806084G>C	ENST00000330180.2	-	1	33	c.34C>G	c.(34-36)Cgc>Ggc	p.R12G	HIST1H2BN_ENST00000606613.1_5'Flank|HIST1H2BN_ENST00000396980.3_5'Flank	NM_003510.2	NP_003501.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ak	12						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			breast(2)|endometrium(2)|kidney(1)|lung(3)|upper_aerodigestive_tract(2)	10						GCCTTGGCGCGAGCTTTGCCG	0.567																																						dbGAP											0													48.0	48.0	48.0					6																	27806084		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z83739	CCDS4632.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000184348	ENSG00000275221		"""Histones / Replication-dependent"""	4726	protein-coding gene	gene with protein product		602788	"""H2A histone family, member D"", ""histone 1, H2ak"""	H2AFD		9439656, 12408966	Standard	NM_003510		Approved	H2A/d	uc003njs.3	P0C0S8	OTTHUMG00000016382	ENST00000330180.2:c.34C>G	6.37:g.27806084G>C	ENSP00000330307:p.Arg12Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.R12G	ENST00000330180.2	37	c.34	CCDS4632.1	6	.	.	.	.	.	.	.	.	.	.	.	5.698	0.313379	0.10789	.	.	ENSG00000184348	ENST00000330180	T	0.44881	0.91	4.53	4.53	0.55603	.	0.000000	0.31897	U	0.006898	T	0.34279	0.0892	.	.	.	0.27704	N	0.94567	.	.	.	.	.	.	T	0.11867	-1.0570	7	0.48119	T	0.1	.	13.8098	0.63256	0.0:0.0:0.8464:0.1536	.	.	.	.	G	12	ENSP00000330307:R12G	ENSP00000330307:R12G	R	-	1	0	HIST1H2AK	27914063	0.991000	0.36638	0.984000	0.44739	0.026000	0.11368	2.135000	0.42112	2.427000	0.82271	0.655000	0.94253	CGC	HIST1H2AK	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000184348		0.567	HIST1H2AK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AK	HGNC	protein_coding	OTTHUMT00000043814.1	30	0.00	0	G	NM_003510		27806084	27806084	-1	no_errors	ENST00000330180	ensembl	human	known	69_37n	missense	29	29.27	12	SNP	0.989	C
IGFN1	91156	genome.wustl.edu	37	1	201182360	201182360	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr1:201182360C>A	ENST00000335211.4	+	12	8469	c.8339C>A	c.(8338-8340)tCc>tAc	p.S2780Y	IGFN1_ENST00000451870.2_Intron|IGFN1_ENST00000295591.8_5'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GAGCAGGGGTCCCTGGAGGCT	0.627																																						dbGAP											0													44.0	51.0	49.0					1																	201182360		692	1591	2283	-	-	-	SO:0001583	missense	0			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.8339C>A	1.37:g.201182360C>A	ENSP00000334714:p.Ser2780Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S2780Y	ENST00000335211.4	37	c.8339	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	C	9.377	1.072081	0.20147	.	.	ENSG00000163395	ENST00000335211	T	0.55930	0.49	3.54	1.6	0.23607	.	.	.	.	.	T	0.30696	0.0773	N	0.08118	0	0.09310	N	0.999997	.	.	.	.	.	.	T	0.24584	-1.0156	7	0.72032	D	0.01	.	4.5949	0.12325	0.0:0.5343:0.0:0.4657	.	.	.	.	Y	2780	ENSP00000334714:S2780Y	ENSP00000334714:S2780Y	S	+	2	0	IGFN1	199448983	0.000000	0.05858	0.005000	0.12908	0.125000	0.20455	-0.564000	0.05936	0.466000	0.27193	0.491000	0.48974	TCC	IGFN1	-	NULL	ENSG00000163395		0.627	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		41	0.00	0	C	NM_178275		201182360	201182360	+1	no_errors	ENST00000335211	ensembl	human	known	69_37n	missense	49	10.91	6	SNP	0.003	A
AREL1	9870	genome.wustl.edu	37	14	75136706	75136706	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr14:75136706C>A	ENST00000356357.4	-	14	2247	c.1732G>T	c.(1732-1734)Gct>Tct	p.A578S	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	578	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GTGAAGCGAGCTCGGACCAAC	0.532																																						dbGAP											0													85.0	85.0	85.0					14																	75136706		1945	4125	6070	-	-	-	SO:0001583	missense	0			AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.1732G>T	14.37:g.75136706C>A	ENSP00000348714:p.Ala578Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	pfam_HECT,pfam_Filamin/ABP280_repeat-like,superfamily_HECT,superfamily_Ig_E-set,smart_HECT,pfscan_Filamin/ABP280_repeat-like,pfscan_HECT	p.A578S	ENST00000356357.4	37	c.1732	CCDS41971.1	14	.	.	.	.	.	.	.	.	.	.	C	36	5.717292	0.96839	.	.	ENSG00000119682	ENST00000356357;ENST00000543377;ENST00000556202	T;T	0.56103	0.48;0.48	6.02	6.02	0.97574	HECT (4);	0.000000	0.85682	D	0.000000	T	0.76307	0.3969	M	0.81179	2.53	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.76102	-0.3082	10	0.56958	D	0.05	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	578	O15033	K0317_HUMAN	S	578;417;417	ENSP00000348714:A578S;ENSP00000452101:A417S	ENSP00000348714:A578S	A	-	1	0	KIAA0317	74206459	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.865000	0.98341	0.655000	0.94253	GCT	KIAA0317	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000119682		0.532	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0317	HGNC	protein_coding	OTTHUMT00000335517.2	46	0.00	0	C	NM_014821		75136706	75136706	-1	no_errors	ENST00000356357	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	A
MRPS31	10240	genome.wustl.edu	37	13	41333214	41333214	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr13:41333214C>G	ENST00000323563.6	-	3	505	c.469G>C	c.(469-471)Gca>Cca	p.A157P		NM_005830.3	NP_005821.2	Q92665	RT31_HUMAN	mitochondrial ribosomal protein S31	157						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	13		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.52e-08)|Epithelial(112;7.63e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000192)|GBM - Glioblastoma multiforme(144;0.00233)|BRCA - Breast invasive adenocarcinoma(63;0.0706)		GATGCAGCTGCCACCAACTCA	0.483																																						dbGAP											0													45.0	45.0	45.0					13																	41333214		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z68747	CCDS9372.1	13q14.11	2012-09-13			ENSG00000102738	ENSG00000102738		"""Mitochondrial ribosomal proteins / small subunits"""	16632	protein-coding gene	gene with protein product		611992				11279123, 8567980	Standard	NM_005830		Approved	IMOGN38	uc001uxm.4	Q92665	OTTHUMG00000016777	ENST00000323563.6:c.469G>C	13.37:g.41333214C>G	ENSP00000315397:p.Ala157Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCS3|Q5VYC8|Q8WTV8	Missense_Mutation	SNP	NULL	p.A157P	ENST00000323563.6	37	c.469	CCDS9372.1	13	.	.	.	.	.	.	.	.	.	.	C	17.85	3.489061	0.64074	.	.	ENSG00000102738	ENST00000323563	T	0.34072	1.38	4.88	4.0	0.46444	.	0.156720	0.56097	D	0.000031	T	0.59932	0.2230	M	0.83953	2.67	0.40587	D	0.981453	D	0.89917	1.0	D	0.81914	0.995	T	0.64980	-0.6279	10	0.66056	D	0.02	.	10.4316	0.44411	0.1955:0.8045:0.0:0.0	.	157	Q92665	RT31_HUMAN	P	157	ENSP00000315397:A157P	ENSP00000315397:A157P	A	-	1	0	MRPS31	40231214	1.000000	0.71417	0.899000	0.35326	0.621000	0.37620	1.508000	0.35769	1.087000	0.41251	0.557000	0.71058	GCA	MRPS31	-	NULL	ENSG00000102738		0.483	MRPS31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS31	HGNC	protein_coding	OTTHUMT00000044640.2	58	0.00	0	C			41333214	41333214	-1	no_errors	ENST00000323563	ensembl	human	known	69_37n	missense	63	10.00	7	SNP	0.999	G
ICE2	79664	genome.wustl.edu	37	15	60720860	60720860	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr15:60720860G>C	ENST00000261520.4	-	15	2822	c.2588C>G	c.(2587-2589)tCt>tGt	p.S863C	NARG2_ENST00000439632.1_Missense_Mutation_p.S726C	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						TGCTGCATGAGATAACAAGTA	0.393																																						dbGAP											0													63.0	62.0	62.0					15																	60720860		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000261520.4:c.2588C>G	15.37:g.60720860G>C	ENSP00000261520:p.Ser863Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_NARG2_C	p.S863C	ENST00000261520.4	37	c.2588	CCDS10176.1	15	.	.	.	.	.	.	.	.	.	.	G	19.18	3.777316	0.70107	.	.	ENSG00000128915	ENST00000261520;ENST00000439632	.	.	.	5.96	5.03	0.67393	NMDA receptor-regulated gene protein 2 (1);	0.360025	0.31145	N	0.008179	T	0.62502	0.2433	L	0.47716	1.5	0.26507	N	0.974674	D	0.89917	1.0	D	0.77004	0.989	T	0.56685	-0.7938	9	0.72032	D	0.01	-17.603	16.3414	0.83083	0.0:0.1635:0.8365:0.0	.	863	Q659A1	NARG2_HUMAN	C	863;726	.	ENSP00000261520:S863C	S	-	2	0	NARG2	58508152	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.344000	0.44010	2.831000	0.97527	0.650000	0.86243	TCT	NARG2	-	pfam_NARG2_C	ENSG00000128915		0.393	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARG2	HGNC	protein_coding	OTTHUMT00000256136.1	33	0.00	0	G			60720860	60720860	-1	no_errors	ENST00000261520	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	1.000	C
OTOF	9381	genome.wustl.edu	37	2	26698897	26698897	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr2:26698897G>A	ENST00000272371.2	-	24	3002	c.2876C>T	c.(2875-2877)gCg>gTg	p.A959V	OTOF_ENST00000403946.3_Missense_Mutation_p.A959V|OTOF_ENST00000339598.3_Missense_Mutation_p.A212V|OTOF_ENST00000402415.3_Missense_Mutation_p.A269V|OTOF_ENST00000338581.6_Missense_Mutation_p.A212V	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	959	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGCTGGAACGCCTGCTTCTC	0.647																																					GBM(102;732 1451 20652 24062 31372)	dbGAP											0													41.0	38.0	39.0					2																	26698897		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.2876C>T	2.37:g.26698897G>A	ENSP00000272371:p.Ala959Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.A959V	ENST00000272371.2	37	c.2876	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	G	4.509	0.094395	0.08632	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19	5.41	0.261	0.15592	C2 calcium/lipid-binding domain, CaLB (1);	0.487572	0.23688	N	0.045554	T	0.33585	0.0868	N	0.05510	-0.035	0.24052	N	0.99604	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.0	T	0.20107	-1.0285	10	0.11182	T	0.66	-10.734	9.1636	0.37038	0.6256:0.0:0.3744:0.0	.	959;212;269;212	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	V	212;212;269;959;959	ENSP00000345137:A212V;ENSP00000344521:A212V;ENSP00000383906:A269V;ENSP00000272371:A959V;ENSP00000385255:A959V	ENSP00000272371:A959V	A	-	2	0	OTOF	26552401	0.367000	0.25023	0.592000	0.28758	0.542000	0.35054	1.592000	0.36676	-0.025000	0.13918	-1.020000	0.02445	GCG	OTOF	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000115155		0.647	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	41	0.00	0	G			26698897	26698897	-1	no_errors	ENST00000272371	ensembl	human	known	69_37n	missense	37	15.91	7	SNP	0.911	A
PPT1	5538	genome.wustl.edu	37	1	40544493	40544493	+	Intron	DEL	T	T	-	rs372364973|rs548291240		TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr1:40544493delT	ENST00000433473.3	-	7	1092				PPT1_ENST00000449045.2_Intron|PPT1_ENST00000372775.2_5'UTR|PPT1_ENST00000530076.1_Intron	NM_000310.3	NP_000301.1	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1						adult locomotory behavior (GO:0008344)|associative learning (GO:0008306)|brain development (GO:0007420)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cofactor metabolic process (GO:0051186)|cofactor transport (GO:0051181)|grooming behavior (GO:0007625)|lipid catabolic process (GO:0016042)|lysosomal lumen acidification (GO:0007042)|membrane raft organization (GO:0031579)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neuron development (GO:0048666)|neurotransmitter secretion (GO:0007269)|pinocytosis (GO:0006907)|positive regulation of pinocytosis (GO:0048549)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein catabolic process (GO:0030163)|protein depalmitoylation (GO:0002084)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|regulation of phospholipase A2 activity (GO:0032429)|regulation of synapse structure and activity (GO:0050803)|sphingolipid catabolic process (GO:0030149)|visual perception (GO:0007601)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	palmitoyl-(protein) hydrolase activity (GO:0008474)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(5)|large_intestine(1)|lung(3)|ovary(1)|stomach(1)	11	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CCTGTACAGCTTTTTTttttc	0.398																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U44772	CCDS447.1, CCDS44119.1	1p32	2014-09-17	2008-07-31		ENSG00000131238	ENSG00000131238	3.1.2.22		9325	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 1, infantile"""	600722		PPT		7637805, 8325646	Standard	NM_000310		Approved	CLN1, INCL	uc001cfb.2	P50897	OTTHUMG00000004495	ENST00000433473.3:c.628-163A>-	1.37:g.40544493delT		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DY24|Q6FGQ4	RNA	DEL	-	NULL	ENST00000433473.3	37	NULL	CCDS447.1	1																																																																																			PPT1	-	-	ENSG00000131238		0.398	PPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPT1	HGNC	protein_coding	OTTHUMT00000013126.2	15	0.00	0	T	NM_000310		40544493	40544493	-1	no_errors	ENST00000372775	ensembl	human	known	69_37n	rna	4	42.86	3	DEL	0.001	-
PTCD1	26024	genome.wustl.edu	37	7	99021452	99021452	+	Silent	SNP	T	T	C			TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr7:99021452T>C	ENST00000292478.4	-	7	2116	c.1866A>G	c.(1864-1866)gaA>gaG	p.E622E	ATP5J2-PTCD1_ENST00000413834.1_Silent_p.E671E|PTCD1_ENST00000555673.1_Silent_p.E671E	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	622					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GGATGACCACTTCGTTCACCG	0.547																																						dbGAP											0													225.0	182.0	197.0					7																	99021452		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1866A>G	7.37:g.99021452T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	pfam_Pentatricopeptide_repeat,pfam_F1F0-ATPsyn_F_prd,tigrfam_Pentatricopeptide_repeat	p.E671	ENST00000292478.4	37	c.2013	CCDS34691.1	7																																																																																			PTCD1	-	NULL	ENSG00000106246		0.547	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCD1	HGNC	protein_coding	OTTHUMT00000336391.1	63	0.00	0	T	NM_015545		99021452	99021452	-1	no_errors	ENST00000555673	ensembl	human	known	69_37n	silent	70	21.35	19	SNP	0.991	C
RPL6	6128	genome.wustl.edu	37	12	112846113	112846113	+	Silent	SNP	G	G	C	rs17851814		TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr12:112846113G>C	ENST00000424576.2	-	3	452	c.267C>G	c.(265-267)ctC>ctG	p.L89L	RPL6_ENST00000202773.9_Silent_p.L89L	NM_001024662.1	NP_001019833.1	Q02878	RL6_HUMAN	ribosomal protein L6	89					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|large_intestine(6)|lung(3)	10						TAACAGTTGCGAGAACCTTCT	0.428																																						dbGAP											0													105.0	107.0	106.0					12																	112846113		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X69391	CCDS9162.1	12q24.13	2014-06-05				ENSG00000089009		"""L ribosomal proteins"""	10362	protein-coding gene	gene with protein product		603703		TXREB1		8479925, 8457378	Standard	XM_005253920		Approved	TAXREB107, L6	uc001ttv.3	Q02878		ENST00000424576.2:c.267C>G	12.37:g.112846113G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3Q3|Q8WW97	Silent	SNP	pfam_Ribosomal_L6E,pfam_Ribosomal_L6_N,superfamily_Translation_prot_SH3-like	p.L89	ENST00000424576.2	37	c.267	CCDS9162.1	12																																																																																			RPL6	-	pfam_Ribosomal_L6_N	ENSG00000089009		0.428	RPL6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPL6	HGNC	protein_coding	OTTHUMT00000405422.1	73	0.00	0	G			112846113	112846113	-1	no_errors	ENST00000202773	ensembl	human	known	69_37n	silent	66	23.60	21	SNP	0.291	C
SYNPR	132204	genome.wustl.edu	37	3	63466619	63466619	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr3:63466619G>C	ENST00000295894.5	+	2	505	c.136G>C	c.(136-138)Gcc>Ccc	p.A46P	SYNPR-AS1_ENST00000488201.1_RNA|SYNPR_ENST00000479198.1_Missense_Mutation_p.A46P|SYNPR_ENST00000478744.1_3'UTR|SYNPR_ENST00000465156.1_Missense_Mutation_p.A46P|SYNPR_ENST00000478300.1_Missense_Mutation_p.A66P|SYNPR_ENST00000460711.1_Missense_Mutation_p.A57P	NM_144642.4	NP_653243.1	Q8TBG9	SYNPR_HUMAN	synaptoporin	46	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.					cell junction (GO:0030054)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)	transporter activity (GO:0005215)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)		CATAGCGTTTGCCTACCCATT	0.483																																					NSCLC(29;1052 1116 20025 32519)	dbGAP											0													152.0	155.0	154.0					3																	63466619		1999	4163	6162	-	-	-	SO:0001583	missense	0			AF411860	CCDS46859.1, CCDS46860.1	3p14.3	2011-07-28			ENSG00000163630	ENSG00000163630			16507	protein-coding gene	gene with protein product						8034131, 12974474	Standard	NM_144642		Approved	MGC26651, SPO	uc003dlp.3	Q8TBG9	OTTHUMG00000158699	ENST00000295894.5:c.136G>C	3.37:g.63466619G>C	ENSP00000295894:p.Ala46Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R675|G5E9W4	Missense_Mutation	SNP	pfam_MARVEL-like_dom,prints_Synaptophysin/porin	p.A66P	ENST00000295894.5	37	c.196	CCDS46860.1	3	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593008	0.66219	.	.	ENSG00000163630	ENST00000478300;ENST00000295894;ENST00000479198;ENST00000460711;ENST00000465156	T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39	5.04	5.04	0.67666	Marvel (1);MARVEL-like domain (1);	0.000000	0.85682	D	0.000000	T	0.78929	0.4361	M	0.75264	2.295	0.80722	D	1	D;D;D	0.63880	0.991;0.977;0.993	P;P;P	0.59288	0.855;0.8;0.827	T	0.79463	-0.1793	10	0.41790	T	0.15	-21.964	17.382	0.87407	0.0:0.0:1.0:0.0	.	57;46;66	B3KVD8;Q8TBG9;G5E9W4	.;SYNPR_HUMAN;.	P	66;46;46;57;46	ENSP00000418994:A66P;ENSP00000295894:A46P;ENSP00000418929:A46P;ENSP00000418701:A57P;ENSP00000418123:A46P	ENSP00000295894:A46P	A	+	1	0	SYNPR	63441659	1.000000	0.71417	0.961000	0.40146	0.960000	0.62799	7.628000	0.83189	2.343000	0.79666	0.557000	0.71058	GCC	SYNPR	-	pfam_MARVEL-like_dom,prints_Synaptophysin/porin	ENSG00000163630		0.483	SYNPR-004	KNOWN	basic|CCDS	protein_coding	SYNPR	HGNC	protein_coding	OTTHUMT00000351787.1	62	0.00	0	G			63466619	63466619	+1	no_errors	ENST00000478300	ensembl	human	known	69_37n	missense	50	25.37	17	SNP	1.000	C
TAF1B	9014	genome.wustl.edu	37	2	9989571	9989571	+	Frame_Shift_Del	DEL	A	A	-	rs528368939		TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr2:9989571delA	ENST00000263663.5	+	3	375	c.187delA	c.(187-189)aaafs	p.K65fs	TAF1B_ENST00000396242.3_5'UTR|TAF1B_ENST00000402170.1_3'UTR	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	65	B-reader.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CCGGGGGCTTAAAAAAAAAAA	0.333																																						dbGAP											0										139,495,3606		1,2,135,2,489,1491	20.0	22.0	21.0			1.7	0.9	2		23	207,946,7081		0,0,207,0,946,2964	no	codingComplex	TAF1B	NM_005680.2		1,2,342,2,1435,4455	A1A1,A1A2,A1R,A2A2,A2R,RR		14.0029,14.9528,14.3258			9989571	346,1441,10687	2194	4292	6486	-	-	-	SO:0001589	frameshift_variant	0			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.187delA	2.37:g.9989571delA	ENSP00000263663:p.Lys65fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI42|F8WD72|Q15574|Q8WVC3	Frame_Shift_Del	DEL	pfam_TF_Rrn7	p.N66fs	ENST00000263663.5	37	c.187	CCDS33143.1	2																																																																																			TAF1B	-	NULL	ENSG00000115750		0.333	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	HGNC	protein_coding	OTTHUMT00000323426.2	28	0.00	0	A	NM_005680		9989571	9989571	+1	no_errors	ENST00000263663	ensembl	human	known	69_37n	frame_shift_del	26	13.33	4	DEL	0.991	-
USH2A	7399	genome.wustl.edu	37	1	215932045	215932045	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A1LI-01A-12D-A159-09	TCGA-E2-A1LI-11A-23D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c812374c-8bc9-4ccf-9157-fbd9d162ee1e	21e814d9-cef6-4f92-8ace-592086fc309f	g.chr1:215932045C>T	ENST00000307340.3	-	58	11667	c.11281G>A	c.(11281-11283)Gat>Aat	p.D3761N	USH2A_ENST00000366943.2_Missense_Mutation_p.D3761N	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3761	Fibronectin type-III 22. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATGTAATCATCACTAGCACTG	0.358										HNSCC(13;0.011)																												dbGAP											0													166.0	163.0	164.0					1																	215932045		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11281G>A	1.37:g.215932045C>T	ENSP00000305941:p.Asp3761Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.D3761N	ENST00000307340.3	37	c.11281	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	9.814	1.184003	0.21870	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.54675	0.56;0.56	5.8	0.263	0.15602	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.152891	0.29699	U	0.011435	T	0.44435	0.1293	M	0.75264	2.295	0.27073	N	0.963277	B	0.09022	0.002	B	0.06405	0.002	T	0.34304	-0.9834	10	0.17832	T	0.49	.	6.9357	0.24464	0.0:0.6152:0.1137:0.2711	.	3761	O75445	USH2A_HUMAN	N	3761	ENSP00000305941:D3761N;ENSP00000355910:D3761N	ENSP00000305941:D3761N	D	-	1	0	USH2A	213998668	1.000000	0.71417	0.008000	0.14137	0.025000	0.11179	1.322000	0.33689	0.066000	0.16515	-0.236000	0.12185	GAT	USH2A	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.358	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	95	0.00	0	C	NM_007123		215932045	215932045	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	132	32.99	65	SNP	0.978	T
