#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANKRD18A	253650	genome.wustl.edu	37	9	38595563	38595563	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr9:38595563T>C	ENST00000399703.5	-	9	2148	c.1774A>G	c.(1774-1776)Aga>Gga	p.R592G		NM_147195.2	NP_671728.2	Q8IVF6	AN18A_HUMAN	ankyrin repeat domain 18A	592										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	16						TCCTTATTTCTTTCTTCTAGA	0.308																																						dbGAP											0													25.0	19.0	21.0					9																	38595563		692	1587	2279	-	-	-	SO:0001583	missense	0			AB095935	CCDS55311.1	9p13.1	2013-01-10			ENSG00000180071	ENSG00000180071		"""Ankyrin repeat domain containing"""	23643	protein-coding gene	gene with protein product							Standard	NM_147195		Approved	KIAA2015, FLJ35740	uc004abg.4	Q8IVF6	OTTHUMG00000019950	ENST00000399703.5:c.1774A>G	9.37:g.38595563T>C	ENSP00000382610:p.Arg592Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD11|A8MVU5|Q5SY86|Q7Z468|Q8NA88	Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R592G	ENST00000399703.5	37	c.1774	CCDS55311.1	9	.	.	.	.	.	.	.	.	.	.	T	7.739	0.700887	0.15172	.	.	ENSG00000180071	ENST00000399703	T	0.18016	2.24	1.4	0.0782	0.14411	.	.	.	.	.	T	0.12561	0.0305	L	0.39514	1.22	0.29141	N	0.87902	B	0.12630	0.006	B	0.06405	0.002	T	0.20174	-1.0283	9	0.54805	T	0.06	.	5.4567	0.16594	0.0:0.0:0.2876:0.7124	.	592	Q8IVF6	AN18A_HUMAN	G	592	ENSP00000382610:R592G	ENSP00000382610:R592G	R	-	1	2	ANKRD18A	38585563	0.999000	0.42202	0.011000	0.14972	0.026000	0.11368	1.613000	0.36900	0.014000	0.14944	0.163000	0.16589	AGA	ANKRD18A	-	NULL	ENSG00000180071		0.308	ANKRD18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD18A	HGNC	protein_coding	OTTHUMT00000052506.3	37	0.00	0	T			38595563	38595563	-1	no_errors	ENST00000399703	ensembl	human	known	69_37n	missense	48	18.64	11	SNP	0.580	C
ABCB9	23457	genome.wustl.edu	37	12	123466575	123466575	+	5'Flank	SNP	C	C	G			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr12:123466575C>G	ENST00000542678.1	-	0	0				ARL6IP4_ENST00000543566.1_Missense_Mutation_p.Q285E|RP11-197N18.2_ENST00000540866.2_RNA|ARL6IP4_ENST00000426960.2_Missense_Mutation_p.Q162E|ARL6IP4_ENST00000357866.4_Intron|ARL6IP4_ENST00000439686.2_Missense_Mutation_p.Q173E|ARL6IP4_ENST00000315580.5_Missense_Mutation_p.Q304E|ARL6IP4_ENST00000392435.2_Missense_Mutation_p.Q285E|ARL6IP4_ENST00000412505.2_Intron|ARL6IP4_ENST00000453766.2_Missense_Mutation_p.Q296E|ARL6IP4_ENST00000454885.2_Missense_Mutation_p.Q170E			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9						peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		GGATGCCCGGCAGAGCATCAT	0.617																																					Ovarian(49;786 1333 9175 38236)	dbGAP											0													63.0	61.0	61.0					12																	123466575		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78			12.37:g.123466575C>G	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Missense_Mutation	SNP	pfam_Nucl_RNA-splicing_assoc_SR-25	p.Q304E	ENST00000542678.1	37	c.910	CCDS9241.1	12	.	.	.	.	.	.	.	.	.	.	C	20.1	3.940617	0.73557	.	.	ENSG00000182196	ENST00000543566;ENST00000315580;ENST00000542099;ENST00000392435;ENST00000413381;ENST00000426960;ENST00000453766;ENST00000454885;ENST00000439686;ENST00000456762	T;T;T;T;T;T;T;T;T;T	0.61158	0.13;0.13;0.13;0.13;0.13;0.13;0.13;0.13;0.13;0.13	5.31	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.66187	0.2764	M	0.83483	2.645	0.80722	D	1	B;P;P;P;P	0.41978	0.198;0.724;0.767;0.767;0.724	B;B;B;B;B	0.43331	0.114;0.292;0.416;0.416;0.292	T	0.72047	-0.4408	10	0.54805	T	0.06	.	16.1017	0.81175	0.0:0.8662:0.1338:0.0	.	170;285;285;304;296	B3V0L1;Q66PJ3-4;B3V0L0;Q66PJ3;Q66PJ3-2	.;.;.;AR6P4_HUMAN;.	E	285;304;293;285;173;162;296;170;173;163	ENSP00000442718:Q285E;ENSP00000313422:Q304E;ENSP00000442200:Q293E;ENSP00000376230:Q285E;ENSP00000441406:Q173E;ENSP00000406036:Q162E;ENSP00000414847:Q296E;ENSP00000396723:Q170E;ENSP00000396365:Q173E;ENSP00000391598:Q163E	ENSP00000313422:Q304E	Q	+	1	0	ARL6IP4	122032528	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	5.689000	0.68234	1.201000	0.43203	0.561000	0.74099	CAG	ARL6IP4	-	pfam_Nucl_RNA-splicing_assoc_SR-25	ENSG00000182196		0.617	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL6IP4	HGNC	protein_coding	OTTHUMT00000400956.1	15	0.00	0	C	NM_019624		123466575	123466575	+1	no_errors	ENST00000315580	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	1.000	G
C10orf91	170393	genome.wustl.edu	37	10	134261527	134261527	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr10:134261527G>A	ENST00000392630.3	+	3	461	c.400G>A	c.(400-402)Gtt>Att	p.V134I	C10orf91_ENST00000321248.2_Missense_Mutation_p.V134I	NM_173541.2	NP_775812.1	Q5T1B1	CJ091_HUMAN	chromosome 10 open reading frame 91	134										endometrium(1)|kidney(1)|lung(1)|ovary(2)	5		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;6.95e-05)|Epithelial(32;0.000142)|all cancers(32;0.000162)		ACAGGCGTCTGTTAGTCAGGG	0.662																																						dbGAP											0													62.0	77.0	72.0					10																	134261527		2193	4292	6485	-	-	-	SO:0001583	missense	0			BC030794	CCDS7668.1	10q26.3	2004-03-16			ENSG00000180066	ENSG00000180066			27275	protein-coding gene	gene with protein product						12477932	Standard	NM_173541		Approved	bA432J24.4	uc001llm.3	Q5T1B1	OTTHUMG00000019289	ENST00000392630.3:c.400G>A	10.37:g.134261527G>A	ENSP00000376407:p.Val134Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N0T7	Missense_Mutation	SNP	NULL	p.V134I	ENST00000392630.3	37	c.400	CCDS7668.1	10	.	.	.	.	.	.	.	.	.	.	G	4.264	0.048038	0.08243	.	.	ENSG00000180066	ENST00000392630;ENST00000321248	T;T	0.07216	3.21;3.21	0.62	-1.05	0.10036	.	.	.	.	.	T	0.02848	0.0085	N	0.08118	0	0.09310	N	1	P	0.36354	0.549	B	0.28139	0.086	T	0.43393	-0.9394	7	.	.	.	.	.	.	.	.	134	Q5T1B1	CJ091_HUMAN	I	134	ENSP00000376407:V134I;ENSP00000323241:V134I	.	V	+	1	0	C10orf91	134111517	0.000000	0.05858	0.002000	0.10522	0.053000	0.15095	-1.156000	0.03160	-0.436000	0.07254	0.205000	0.17691	GTT	C10orf91	-	NULL	ENSG00000180066		0.662	C10orf91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf91	HGNC	protein_coding	OTTHUMT00000051078.2	19	0.00	0	G	NM_173541		134261527	134261527	+1	no_errors	ENST00000321248	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	0.004	A
CNKSR2	22866	genome.wustl.edu	37	X	21666975	21666975	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chrX:21666975G>C	ENST00000379510.3	+	21	2755	c.2719G>C	c.(2719-2721)Gac>Cac	p.D907H	CNKSR2_ENST00000425654.2_Missense_Mutation_p.D877H	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	907					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						AAAGTTAGGAGACTCATTGCA	0.363																																						dbGAP											0													85.0	84.0	84.0					X																	21666975		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2719G>C	X.37:g.21666975G>C	ENSP00000368824:p.Asp907His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.D907H	ENST00000379510.3	37	c.2719	CCDS14198.1	X	.	.	.	.	.	.	.	.	.	.	G	18.57	3.651965	0.67472	.	.	ENSG00000149970	ENST00000425654;ENST00000379510	T;T	0.28454	1.61;1.69	5.76	3.99	0.46301	.	0.086796	0.85682	D	0.000000	T	0.51007	0.1649	M	0.67700	2.07	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.976	T	0.49428	-0.8941	10	0.62326	D	0.03	0.2084	11.6679	0.51385	0.147:0.0:0.853:0.0	.	877;907	B7ZLJ1;Q8WXI2	.;CNKR2_HUMAN	H	877;907	ENSP00000397906:D877H;ENSP00000368824:D907H	ENSP00000368824:D907H	D	+	1	0	CNKSR2	21576896	1.000000	0.71417	0.979000	0.43373	0.894000	0.52154	7.123000	0.77176	0.586000	0.29626	0.600000	0.82982	GAC	CNKSR2	-	NULL	ENSG00000149970		0.363	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR2	HGNC	protein_coding	OTTHUMT00000056019.1	24	0.00	0	G	NM_014927		21666975	21666975	+1	no_errors	ENST00000379510	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	1.000	C
DLGAP5	9787	genome.wustl.edu	37	14	55621420	55621420	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr14:55621420T>C	ENST00000247191.2	-	15	2194	c.1978A>G	c.(1978-1980)Act>Gct	p.T660A	DLGAP5_ENST00000395425.2_Missense_Mutation_p.T660A	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	660					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)			biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						GGTGATGTAGTTTGTTGTGGA	0.398																																						dbGAP											0													216.0	187.0	196.0					14																	55621420		2203	4300	6503	-	-	-	SO:0001583	missense	0			D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.1978A>G	14.37:g.55621420T>C	ENSP00000247191:p.Thr660Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTM6|B4DRM8|Q86T11|Q8NG58	Missense_Mutation	SNP	pfam_GKAP	p.T660A	ENST00000247191.2	37	c.1978	CCDS9723.1	14	.	.	.	.	.	.	.	.	.	.	T	8.810	0.935082	0.18206	.	.	ENSG00000126787	ENST00000395425;ENST00000247191	T;T	0.12569	2.67;2.67	4.0	0.438	0.16560	.	0.959049	0.08556	N	0.928259	T	0.09024	0.0223	L	0.29908	0.895	0.09310	N	1	B;B	0.12630	0.006;0.006	B;B	0.12156	0.007;0.007	T	0.39542	-0.9609	10	0.34782	T	0.22	.	3.4241	0.07403	0.0:0.2245:0.2288:0.5467	.	660;660	A8MTM6;Q15398	.;DLGP5_HUMAN	A	660	ENSP00000378815:T660A;ENSP00000247191:T660A	ENSP00000247191:T660A	T	-	1	0	DLGAP5	54691173	0.010000	0.17322	0.000000	0.03702	0.004000	0.04260	1.078000	0.30754	0.065000	0.16485	0.533000	0.62120	ACT	DLGAP5	-	NULL	ENSG00000126787		0.398	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP5	HGNC	protein_coding	OTTHUMT00000276908.2	126	0.79	1	T	NM_014750		55621420	55621420	-1	no_errors	ENST00000247191	ensembl	human	known	69_37n	missense	44	24.14	14	SNP	0.000	C
DNAI1	27019	genome.wustl.edu	37	9	34500839	34500839	+	Splice_Site	SNP	T	T	G			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr9:34500839T>G	ENST00000242317.4	+	11	1190		c.e11+2			NM_001281428.1|NM_012144.2	NP_001268357.1|NP_036276.1	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1						cell projection organization (GO:0030030)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	motor activity (GO:0003774)			autonomic_ganglia(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|prostate(1)|skin(2)|urinary_tract(1)	34	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		CCTCTGCTGGTAAGTATAGGC	0.547									Kartagener syndrome		OREG0019152	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													56.0	55.0	56.0					9																	34500839		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF091619	CCDS6557.1, CCDS75829.1	9p13.3	2013-02-19	2006-09-04		ENSG00000122735	ENSG00000122735		"""Axonemal dyneins"", ""WD repeat domain containing"""	2954	protein-coding gene	gene with protein product		604366	"""dynein, axonemal, intermediate polypeptide 1"""			10577904, 21953912	Standard	NM_012144		Approved	DIC1, PCD, CILD1	uc003zum.3	Q9UI46	OTTHUMG00000019825	ENST00000242317.4:c.1019+2T>G	9.37:g.34500839T>G		Somatic	848	WXS	Illumina GAIIx	Phase_IV	B7Z7U1|Q5T8G7|Q8NHQ7|Q9UEZ8	Splice_Site	SNP	-	e11+2	ENST00000242317.4	37	c.1019+2	CCDS6557.1	9	.	.	.	.	.	.	.	.	.	.	T	18.34	3.602896	0.66445	.	.	ENSG00000122735	ENST00000242317	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9332	0.58299	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAI1	34490839	1.000000	0.71417	0.997000	0.53966	0.654000	0.38779	7.222000	0.78025	1.999000	0.58509	0.379000	0.24179	.	DNAI1	-	-	ENSG00000122735		0.547	DNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAI1	HGNC	protein_coding	OTTHUMT00000052192.1	26	0.00	0	T		Intron	34500839	34500839	+1	no_errors	ENST00000242317	ensembl	human	known	69_37n	splice_site	26	35.00	14	SNP	1.000	G
FAM208A	23272	genome.wustl.edu	37	3	56675495	56675495	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr3:56675495T>C	ENST00000493960.2	-	15	2511	c.2501A>G	c.(2500-2502)gAa>gGa	p.E834G	FAM208A_ENST00000431842.2_Missense_Mutation_p.E438G|FAM208A_ENST00000355628.5_Missense_Mutation_p.E834G	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	834							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						CTGTGCATTTTCAACTTTTGC	0.408																																						dbGAP											0													135.0	118.0	124.0					3																	56675495		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.2501A>G	3.37:g.56675495T>C	ENSP00000417509:p.Glu834Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	pfam_DUF3715	p.E834G	ENST00000493960.2	37	c.2501	CCDS46853.1	3	.	.	.	.	.	.	.	.	.	.	T	21.7	4.184479	0.78677	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.14516	2.5;2.66;2.65	5.99	5.99	0.97316	.	0.000000	0.64402	D	0.000001	T	0.31544	0.0800	L	0.50333	1.59	0.43574	D	0.995909	D;D;D	0.76494	0.996;0.993;0.999	P;P;D	0.69479	0.857;0.84;0.964	T	0.01059	-1.1465	10	0.62326	D	0.03	-19.4989	15.0653	0.71989	0.0:0.0:0.0:1.0	.	834;834;438	Q9UK61-3;Q9UK61-4;Q9UK61-2	.;.;.	G	438;834;834	ENSP00000399410:E438G;ENSP00000417509:E834G;ENSP00000347845:E834G	ENSP00000347845:E834G	E	-	2	0	C3orf63	56650535	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	5.027000	0.64109	2.291000	0.77112	0.533000	0.62120	GAA	FAM208A	-	NULL	ENSG00000163946		0.408	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM208A	HGNC	protein_coding	OTTHUMT00000352352.2	70	0.00	0	T	NM_015224		56675495	56675495	-1	no_errors	ENST00000355628	ensembl	human	known	69_37n	missense	22	31.25	10	SNP	1.000	C
HTR5A	3361	genome.wustl.edu	37	7	154863345	154863345	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr7:154863345G>T	ENST00000287907.2	+	1	1312	c.736G>T	c.(736-738)Gtg>Ttg	p.V246L	HTR5A-AS1_ENST00000493904.1_5'Flank|HTR5A-AS1_ENST00000395731.2_5'Flank|HTR5A-AS1_ENST00000543018.1_5'Flank	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	246					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	ATCCGAAGCTGTGGAGGTGGG	0.527																																						dbGAP											0													57.0	56.0	57.0					7																	154863345		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.736G>T	7.37:g.154863345G>T	ENSP00000287907:p.Val246Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M2D2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_5HT5A_rcpt,prints_5HT_rcpt	p.V246L	ENST00000287907.2	37	c.736	CCDS5936.1	7	.	.	.	.	.	.	.	.	.	.	G	4.344	0.063265	0.08388	.	.	ENSG00000157219	ENST00000287907	T	0.70164	-0.46	5.0	4.12	0.48240	GPCR, rhodopsin-like superfamily (1);	2.064530	0.01906	N	0.039484	T	0.48607	0.1509	N	0.05330	-0.07	0.30657	N	0.754815	B	0.02656	0.0	B	0.11329	0.006	T	0.45702	-0.9243	10	0.22109	T	0.4	.	6.9258	0.24414	0.1576:0.2168:0.6256:0.0	.	246	P47898	5HT5A_HUMAN	L	246	ENSP00000287907:V246L	ENSP00000287907:V246L	V	+	1	0	HTR5A	154494278	0.672000	0.27530	0.831000	0.32960	0.537000	0.34900	1.142000	0.31540	1.342000	0.45619	0.650000	0.86243	GTG	HTR5A	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_5HT5A_rcpt	ENSG00000157219		0.527	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR5A	HGNC	protein_coding	OTTHUMT00000322240.1	23	0.00	0	G	NM_024012		154863345	154863345	+1	no_errors	ENST00000287907	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.458	T
LRRC14B	389257	genome.wustl.edu	37	5	195276	195276	+	Silent	SNP	C	C	T			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr5:195276C>T	ENST00000328278.3	+	2	1381	c.1353C>T	c.(1351-1353)taC>taT	p.Y451Y	CTD-2083E4.7_ENST00000563761.1_RNA	NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	451										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						AGCAGAAATACGACGAGATCG	0.597																																						dbGAP											0													106.0	119.0	115.0					5																	195276		2162	4268	6430	-	-	-	SO:0001819	synonymous_variant	0				CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.1353C>T	5.37:g.195276C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.Y451	ENST00000328278.3	37	c.1353	CCDS47184.1	5																																																																																			LRRC14B	-	NULL	ENSG00000185028		0.597	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC14B	HGNC	protein_coding	OTTHUMT00000365393.2	22	0.00	0	C	NM_001080478		195276	195276	+1	no_errors	ENST00000328278	ensembl	human	novel	69_37n	silent	23	34.29	12	SNP	0.001	T
LRRFIP1	9208	genome.wustl.edu	37	2	238643948	238643948	+	Intron	SNP	G	G	A			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr2:238643948G>A	ENST00000392000.4	+	5	366				LRRFIP1_ENST00000244815.5_Intron|LRRFIP1_ENST00000308482.9_Missense_Mutation_p.R176Q|LRRFIP1_ENST00000289175.6_Intron	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1						innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		GGTGGGACCCGACGGGGCAGC	0.627																																						dbGAP											0													46.0	46.0	46.0					2																	238643948		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.250-13059G>A	2.37:g.238643948G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	pfam_Leu-rich_rep_flightless-int_pr,superfamily_Prefoldin	p.R176Q	ENST00000392000.4	37	c.527	CCDS46552.1	2	.	.	.	.	.	.	.	.	.	.	G	10.31	1.313812	0.23908	.	.	ENSG00000124831	ENST00000308482;ENST00000391999	T	0.48836	0.8	4.98	3.18	0.36537	.	.	.	.	.	T	0.27098	0.0664	N	0.24115	0.695	0.21861	N	0.999504	P	0.35011	0.48	B	0.17979	0.02	T	0.07046	-1.0793	9	0.36615	T	0.2	.	7.8809	0.29621	0.1918:0.0:0.8082:0.0	.	176	E9PGZ2	.	Q	176;166	ENSP00000310109:R176Q	ENSP00000310109:R176Q	R	+	2	0	LRRFIP1	238308687	0.998000	0.40836	0.051000	0.19133	0.007000	0.05969	2.584000	0.46102	0.620000	0.30215	-0.150000	0.13652	CGA	LRRFIP1	-	NULL	ENSG00000124831		0.627	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	LRRFIP1	HGNC	protein_coding	OTTHUMT00000317198.1	24	0.00	0	G	NM_004735		238643948	238643948	+1	no_errors	ENST00000308482	ensembl	human	putative	69_37n	missense	25	26.47	9	SNP	0.189	A
METTL10	399818	genome.wustl.edu	37	10	126453973	126453973	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr10:126453973C>G	ENST00000368836.2	-	5	640	c.604G>C	c.(604-606)Gaa>Caa	p.E202Q	RP11-12J10.3_ENST00000494792.1_Missense_Mutation_p.M166I|Y_RNA_ENST00000362596.1_RNA	NM_212554.2	NP_997719.2	Q5JPI9	MET10_HUMAN	methyltransferase like 10	202							methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_lung(145;0.0186)|Lung NSC(174;0.0295)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.101)|COAD - Colon adenocarcinoma(40;0.111)		TCACTGAATTCATTTAGCAAC	0.363																																						dbGAP											0													157.0	153.0	154.0					10																	126453973		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31307.1	10q26.13	2010-01-15			ENSG00000203791	ENSG00000203791			33787	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 138"""	C10orf138			Standard	NM_212554		Approved	Em:AC068896.3	uc001lhy.1	Q5JPI9	OTTHUMG00000019217	ENST00000368836.2:c.604G>C	10.37:g.126453973C>G	ENSP00000357829:p.Glu202Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPY7	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_tRNA_(Gua-N-7)_MeTrfase	p.E202Q	ENST00000368836.2	37	c.604	CCDS31307.1	10	.	.	.	.	.	.	.	.	.	.	C	11.79	1.742723	0.30865	.	.	ENSG00000203791	ENST00000368836	T	0.63096	-0.02	5.85	5.85	0.93711	.	0.284309	0.34777	N	0.003695	T	0.53786	0.1818	L	0.36672	1.1	0.25443	N	0.988074	B;B	0.28208	0.04;0.203	B;B	0.29663	0.105;0.085	T	0.57888	-0.7733	9	0.29301	T	0.29	-15.2653	15.6262	0.76859	0.0:0.8633:0.1367:0.0	.	203;202	B5MDU2;Q5JPI9	.;MTL10_HUMAN	Q	202	ENSP00000357829:E202Q	ENSP00000357829:E202Q	E	-	1	0	METTL10	126443963	0.962000	0.33011	0.994000	0.49952	0.987000	0.75469	2.120000	0.41968	2.773000	0.95371	0.585000	0.79938	GAA	METTL10	-	NULL	ENSG00000203791		0.363	METTL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL10	HGNC	protein_coding	OTTHUMT00000050884.1	58	0.00	0	C	NM_212554		126453973	126453973	-1	no_errors	ENST00000368836	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	0.963	G
MGAT5B	146664	genome.wustl.edu	37	17	74902194	74902194	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr17:74902194G>A	ENST00000569840.2	+	8	1524	c.950G>A	c.(949-951)tGg>tAg	p.W317*	MGAT5B_ENST00000374998.3_3'UTR|MGAT5B_ENST00000428789.2_Nonsense_Mutation_p.W328*|MGAT5B_ENST00000301618.4_Nonsense_Mutation_p.W317*	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	317					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ATGGTGCAGTGGGCGGACATT	0.642																																						dbGAP											0													72.0	69.0	70.0					17																	74902194		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.950G>A	17.37:g.74902194G>A	ENSP00000456037:p.Trp317*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Nonsense_Mutation	SNP	superfamily_PyrdxlP-dep_Trfase_major_dom	p.W328*	ENST00000569840.2	37	c.983	CCDS59299.1	17	.	.	.	.	.	.	.	.	.	.	G	38	6.862304	0.97893	.	.	ENSG00000167889	ENST00000374998;ENST00000301618;ENST00000428789	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.4886	17.8862	0.88855	0.0:0.0:1.0:0.0	.	.	.	.	X	317;317;328	.	ENSP00000301618:W317X	W	+	2	0	MGAT5B	72413789	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	9.643000	0.98464	2.464000	0.83262	0.455000	0.32223	TGG	MGAT5B	-	NULL	ENSG00000167889		0.642	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGAT5B	HGNC	protein_coding	OTTHUMT00000460624.2	26	0.00	0	G	NM_144677		74902194	74902194	+1	no_errors	ENST00000428789	ensembl	human	known	69_37n	nonsense	21	34.38	11	SNP	1.000	A
MMRN2	79812	genome.wustl.edu	37	10	88704043	88704043	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr10:88704043T>A	ENST00000372027.5	-	5	952	c.631A>T	c.(631-633)Atg>Ttg	p.M211L	MMRN2_ENST00000488950.1_Intron	NM_024756.2	NP_079032.2	Q9H8L6	MMRN2_HUMAN	multimerin 2	211					angiogenesis (GO:0001525)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|stomach(1)	19						TTTGCTTCCATCACTGCAGCT	0.607																																						dbGAP											0													156.0	145.0	149.0					10																	88704043		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023527	CCDS7379.1	10q23.31	2004-03-10	2004-03-02	2004-03-02	ENSG00000173269	ENSG00000173269		"""EMI domain containing"""	19888	protein-coding gene	gene with protein product		608925	"""elastin microfibril interfacer 3"""	EMILIN3		11559704	Standard	NM_024756		Approved	EndoGlyx-1, FLJ13465	uc001kea.3	Q9H8L6	OTTHUMG00000018663	ENST00000372027.5:c.631A>T	10.37:g.88704043T>A	ENSP00000361097:p.Met211Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q504V7|Q6P2N2	Missense_Mutation	SNP	pfam_C1q,pfam_EMI_domain,superfamily_Tumour_necrosis_fac-like,superfamily_tRNA-bd_arm,smart_C1q,prints_C1q,pfscan_C1q,pfscan_EMI_domain	p.M211L	ENST00000372027.5	37	c.631	CCDS7379.1	10	.	.	.	.	.	.	.	.	.	.	T	4.452	0.083766	0.08533	.	.	ENSG00000173269	ENST00000372027	T	0.12465	2.68	5.4	-0.866	0.10659	.	1.350910	0.04740	N	0.422602	T	0.10337	0.0253	L	0.34521	1.04	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.36286	-0.9754	10	0.26408	T	0.33	-0.9889	5.5848	0.17269	0.0:0.4284:0.1702:0.4014	.	150;211	B4E3H8;Q9H8L6	.;MMRN2_HUMAN	L	211	ENSP00000361097:M211L	ENSP00000361097:M211L	M	-	1	0	MMRN2	88694023	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.587000	0.05780	-0.165000	0.10908	0.459000	0.35465	ATG	MMRN2	-	NULL	ENSG00000173269		0.607	MMRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN2	HGNC	protein_coding	OTTHUMT00000049179.2	33	0.00	0	T	NM_024756		88704043	88704043	-1	no_errors	ENST00000372027	ensembl	human	known	69_37n	missense	13	53.57	15	SNP	0.000	A
PLOD2	5352	genome.wustl.edu	37	3	145809641	145809641	+	Silent	SNP	C	C	T			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr3:145809641C>T	ENST00000360060.3	-	8	1002	c.825G>A	c.(823-825)caG>caA	p.Q275Q	PLOD2_ENST00000494950.1_Silent_p.Q220Q|PLOD2_ENST00000282903.5_Silent_p.Q275Q|RP11-274H2.2_ENST00000480247.1_RNA	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	275					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	AGCCATTATCCTGTGTCCATG	0.373																																						dbGAP											0													104.0	94.0	97.0					3																	145809641		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.825G>A	3.37:g.145809641C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWS3|Q59ED2|Q8N170	Silent	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.Q275	ENST00000360060.3	37	c.825	CCDS3131.1	3																																																																																			PLOD2	-	NULL	ENSG00000152952		0.373	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD2	HGNC	protein_coding	OTTHUMT00000355185.1	40	0.00	0	C	NM_000935		145809641	145809641	-1	no_errors	ENST00000282903	ensembl	human	known	69_37n	silent	45	13.46	7	SNP	1.000	T
RYR1	6261	genome.wustl.edu	37	19	38959725	38959725	+	Silent	SNP	C	C	A			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr19:38959725C>A	ENST00000359596.3	+	26	3501	c.3501C>A	c.(3499-3501)gtC>gtA	p.V1167V	RYR1_ENST00000360985.3_Silent_p.V1167V|RYR1_ENST00000355481.4_Silent_p.V1167V			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1167	6 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ATGGCGAGGTCCTCATGTCTG	0.562																																						dbGAP											0													119.0	101.0	107.0					19																	38959725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3501C>A	19.37:g.38959725C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.V1167	ENST00000359596.3	37	c.3501	CCDS33011.1	19																																																																																			RYR1	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000196218		0.562	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	34	0.00	0	C			38959725	38959725	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	silent	31	16.22	6	SNP	1.000	A
LINC00969	440993	genome.wustl.edu	37	3	195399506	195399506	+	lincRNA	SNP	G	G	A			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr3:195399506G>A	ENST00000445430.1	+	0	1240									long intergenic non-protein coding RNA 969																		CCTCCCCACCGTGCATTATAA	0.602																																						dbGAP											0																																										-	-	-			0			AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195399506G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000445430.1	37	NULL		3																																																																																			SDHAP2	-	-	ENSG00000215837		0.602	LINC00969-038	KNOWN	basic	lincRNA	SDHAP2	HGNC	lincRNA	OTTHUMT00000341951.1	12	0.00	0	G			195399506	195399506	+1	no_errors	ENST00000429897	ensembl	human	known	69_37n	rna	17	29.17	7	SNP	0.994	A
SENP6	26054	genome.wustl.edu	37	6	76425115	76425115	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr6:76425115delT	ENST00000447266.2	+	24	3622	c.3144delT	c.(3142-3144)agtfs	p.S1048fs	SENP6_ENST00000541192.1_3'UTR|SENP6_ENST00000370010.2_Frame_Shift_Del_p.S1041fs|SENP6_ENST00000370014.3_Frame_Shift_Del_p.S1048fs	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	1048	Protease.				protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				CAATTCTCAGTTTTGAACTAC	0.313																																						dbGAP											0													100.0	96.0	97.0					6																	76425115		1806	4074	5880	-	-	-	SO:0001589	frameshift_variant	0				CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.3144delT	6.37:g.76425115delT	ENSP00000402527:p.Ser1048fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Frame_Shift_Del	DEL	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.F1049fs	ENST00000447266.2	37	c.3144	CCDS47454.1	6																																																																																			SENP6	-	pfam_Peptidase_C48	ENSG00000112701		0.313	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP6	HGNC	protein_coding	OTTHUMT00000041272.2	46	0.00	0	T	NM_015571		76425115	76425115	+1	no_errors	ENST00000370014	ensembl	human	known	69_37n	frame_shift_del	8	61.90	13	DEL	1.000	-
SKIDA1	387640	genome.wustl.edu	37	10	21805480	21805480	+	Silent	SNP	T	T	C	rs201836118		TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr10:21805480T>C	ENST00000449193.2	-	4	3524	c.1272A>G	c.(1270-1272)gaA>gaG	p.E424E	SKIDA1_ENST00000444772.3_Silent_p.E345E|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	343						nucleus (GO:0005634)											cctcctcctcttcctcctcct	0.632																																						dbGAP											0													5.0	6.0	6.0					10																	21805480		2001	4121	6122	-	-	-	SO:0001819	synonymous_variant	0			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1272A>G	10.37:g.21805480T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.E424	ENST00000449193.2	37	c.1272	CCDS44363.1	10																																																																																			SKIDA1	-	NULL	ENSG00000180592		0.632	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	HGNC	protein_coding	OTTHUMT00000286950.2	8	0.00	0	T	NM_207371		21805480	21805480	-1	no_errors	ENST00000449193	ensembl	human	known	69_37n	silent	7	41.67	5	SNP	0.381	C
SNX17	9784	genome.wustl.edu	37	2	27598788	27598788	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr2:27598788T>A	ENST00000233575.2	+	11	1276	c.1054T>A	c.(1054-1056)Tac>Aac	p.Y352N	SNX17_ENST00000537606.1_Missense_Mutation_p.Y327N|SNX17_ENST00000543024.1_Missense_Mutation_p.Y138N|SNX17_ENST00000542478.1_Missense_Mutation_p.Y138N|ZNF513_ENST00000491924.1_5'Flank	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	352	FERM-like.|PTB-like F3 module.				cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCTTTTGAATACCTCATGAG	0.592																																						dbGAP											0													63.0	66.0	65.0					2																	27598788		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.1054T>A	2.37:g.27598788T>A	ENSP00000233575:p.Tyr352Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQM7|Q53HN7|Q6IAS3	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,superfamily_FERM_central,smart_Phox,pfscan_Phox,pfscan_Ras-assoc	p.Y352N	ENST00000233575.2	37	c.1054	CCDS1750.1	2	.	.	.	.	.	.	.	.	.	.	T	23.1	4.372586	0.82573	.	.	ENSG00000115234	ENST00000233575;ENST00000543024;ENST00000537606;ENST00000542478	T;T;T;T	0.72615	-0.2;-0.67;-0.58;-0.67	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.85600	0.5734	M	0.85197	2.74	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.997;0.997;0.999	D	0.87859	0.2663	10	0.87932	D	0	-8.5912	15.1436	0.72630	0.0:0.0:0.0:1.0	.	327;340;332;352	B4DQM7;B4DTB8;B4DQ37;Q15036	.;.;.;SNX17_HUMAN	N	352;138;327;138	ENSP00000233575:Y352N;ENSP00000441779:Y138N;ENSP00000439208:Y327N;ENSP00000442567:Y138N	ENSP00000233575:Y352N	Y	+	1	0	SNX17	27452292	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.733000	0.84916	2.248000	0.74166	0.459000	0.35465	TAC	SNX17	-	NULL	ENSG00000115234		0.592	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX17	HGNC	protein_coding	OTTHUMT00000215024.1	37	0.00	0	T	NM_014748		27598788	27598788	+1	no_errors	ENST00000233575	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	1.000	A
SPHKAP	80309	genome.wustl.edu	37	2	228883047	228883047	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr2:228883047C>G	ENST00000392056.3	-	7	2569	c.2523G>C	c.(2521-2523)gaG>gaC	p.E841D	SPHKAP_ENST00000344657.5_Missense_Mutation_p.E841D	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	841						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTTTTGTATCCTCTCCTGCTA	0.493																																						dbGAP											0													754.0	716.0	729.0					2																	228883047		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2523G>C	2.37:g.228883047C>G	ENSP00000375909:p.Glu841Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.E841D	ENST00000392056.3	37	c.2523	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	C	0.524	-0.860715	0.02610	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.11604	2.76;2.76	5.45	-2.18	0.07037	.	0.778438	0.12681	N	0.448000	T	0.07007	0.0178	L	0.48877	1.53	0.09310	N	1	B;B	0.11235	0.001;0.004	B;B	0.09377	0.003;0.004	T	0.37842	-0.9688	10	0.35671	T	0.21	.	0.0584	0.00014	0.2933:0.1952:0.2366:0.2748	.	841;841	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	D	841	ENSP00000375909:E841D;ENSP00000339886:E841D	ENSP00000339886:E841D	E	-	3	2	SPHKAP	228591291	0.000000	0.05858	0.000000	0.03702	0.329000	0.28539	-1.695000	0.01913	-0.210000	0.10140	0.655000	0.94253	GAG	SPHKAP	-	NULL	ENSG00000153820		0.493	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	56	0.00	0	C	NM_030623		228883047	228883047	-1	no_errors	ENST00000392056	ensembl	human	known	69_37n	missense	31	22.50	9	SNP	0.000	G
SPTB	6710	genome.wustl.edu	37	14	65239994	65239994	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr14:65239994C>G	ENST00000389721.5	-	24	5154	c.5122G>C	c.(5122-5124)Gaa>Caa	p.E1708Q	SPTB_ENST00000542895.1_Missense_Mutation_p.E1708Q|SPTB_ENST00000389722.3_Missense_Mutation_p.E1708Q|SPTB_ENST00000389720.3_Missense_Mutation_p.E1708Q|SPTB_ENST00000556626.1_Missense_Mutation_p.E1708Q	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1708					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		AGCTCCTTTTCTGAAATCCAC	0.547																																						dbGAP											0													103.0	91.0	95.0					14																	65239994		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.5122G>C	14.37:g.65239994C>G	ENSP00000374371:p.Glu1708Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15510|Q15519	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.E1708Q	ENST00000389721.5	37	c.5122	CCDS32100.1	14	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397378	0.83120	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.57436	0.48;0.48;0.48;0.48;0.48;0.4	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.69531	0.3121	M	0.68728	2.09	0.80722	D	1	D;D;D	0.71674	0.98;0.998;0.988	P;D;P	0.63113	0.829;0.911;0.73	T	0.73190	-0.4061	10	0.87932	D	0	.	17.6535	0.88171	0.0:1.0:0.0:0.0	.	492;1708;1712	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	Q	1712;1708;492;373;1708;1708;1708;1708	ENSP00000374372:E1708Q;ENSP00000451324:E373Q;ENSP00000451752:E1708Q;ENSP00000374371:E1708Q;ENSP00000443882:E1708Q;ENSP00000374370:E1708Q	ENSP00000334218:E492Q	E	-	1	0	SPTB	64309747	1.000000	0.71417	0.296000	0.24974	0.878000	0.50629	7.703000	0.84585	2.537000	0.85549	0.561000	0.74099	GAA	SPTB	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000070182		0.547	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	HGNC	protein_coding	OTTHUMT00000414080.1	36	0.00	0	C			65239994	65239994	-1	no_errors	ENST00000389722	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	1.000	G
SUN5	140732	genome.wustl.edu	37	20	31572971	31572971	+	Silent	SNP	C	C	T			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr20:31572971C>T	ENST00000356173.3	-	12	1010	c.918G>A	c.(916-918)aaG>aaA	p.K306K	SUN5_ENST00000375523.3_Silent_p.K281K	NM_080675.3	NP_542406.2	Q8TC36	SUN5_HUMAN	Sad1 and UNC84 domain containing 5	306	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	25						ACACCTCCTCCTTGGGGGAGC	0.577																																						dbGAP											0													88.0	86.0	87.0					20																	31572971		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL121756	CCDS13209.1	20q11.21	2010-01-27	2010-01-27	2010-01-27	ENSG00000167098	ENSG00000167098			16252	protein-coding gene	gene with protein product	"""testis and spermatogenesis related gene 4"""	613942	"""sperm associated antigen 4-like"""	SPAG4L		9691178, 10373309	Standard	NM_080675		Approved	dJ726C3.1, TSARG4	uc002wyi.3	Q8TC36	OTTHUMG00000032239	ENST00000356173.3:c.918G>A	20.37:g.31572971C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ82|Q5T9R0	Silent	SNP	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.K306	ENST00000356173.3	37	c.918	CCDS13209.1	20																																																																																			SUN5	-	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	ENSG00000167098		0.577	SUN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUN5	HGNC	protein_coding	OTTHUMT00000078659.1	28	0.00	0	C	NM_080675		31572971	31572971	-1	no_errors	ENST00000356173	ensembl	human	known	69_37n	silent	35	18.60	8	SNP	0.031	T
SYNE1	23345	genome.wustl.edu	37	6	152749432	152749432	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr6:152749432C>G	ENST00000367255.5	-	37	5485	c.4884G>C	c.(4882-4884)gaG>gaC	p.E1628D	SYNE1_ENST00000367253.4_Missense_Mutation_p.E1628D|SYNE1_ENST00000448038.1_Missense_Mutation_p.E1635D|SYNE1_ENST00000341594.5_Missense_Mutation_p.E1698D|SYNE1_ENST00000423061.1_Missense_Mutation_p.E1635D|SYNE1_ENST00000265368.4_Missense_Mutation_p.E1628D	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1628					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAGCCGCAGCCTCCTGAACAC	0.587										HNSCC(10;0.0054)																												dbGAP											0													136.0	135.0	135.0					6																	152749432		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.4884G>C	6.37:g.152749432C>G	ENSP00000356224:p.Glu1628Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E1628D	ENST00000367255.5	37	c.4884	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	4.257	0.046684	0.08243	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253	T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68	5.68	-2.46	0.06461	.	0.000000	0.64402	D	0.000018	T	0.14960	0.0361	L	0.56769	1.78	0.35859	D	0.827367	B;B;B;B;B	0.06786	0.001;0.0;0.001;0.0;0.001	B;B;B;B;B	0.09377	0.002;0.002;0.002;0.002;0.004	T	0.07177	-1.0786	10	0.20519	T	0.43	.	2.7507	0.05280	0.0946:0.3504:0.1865:0.3685	.	1611;1628;1628;1628;1635	B3W695;Q8NF91;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	D	1628;1635;1628;1635;1698;1628	ENSP00000356224:E1628D;ENSP00000396024:E1635D;ENSP00000265368:E1628D;ENSP00000390975:E1635D;ENSP00000341887:E1698D;ENSP00000356222:E1628D	ENSP00000265368:E1628D	E	-	3	2	SYNE1	152791125	0.584000	0.26766	0.216000	0.23742	0.065000	0.16274	-0.255000	0.08769	-0.395000	0.07715	-0.768000	0.03414	GAG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.587	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	49	0.00	0	C	NM_182961		152749432	152749432	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.012	G
TRPC6	7225	genome.wustl.edu	37	11	101454133	101454133	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr11:101454133C>G	ENST00000344327.3	-	1	526	c.102G>C	c.(100-102)atG>atC	p.M34I	TRPC6_ENST00000526713.1_Intron|TRPC6_ENST00000360497.4_Missense_Mutation_p.M34I|TRPC6_ENST00000532133.1_Missense_Mutation_p.M34I|TRPC6_ENST00000348423.4_Missense_Mutation_p.M34I|RP11-748H22.1_ENST00000527374.1_RNA	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	34					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		GCTCCGAGTCCATGAGCAGAT	0.721																																					Colon(166;1315 1927 11094 12848 34731)	dbGAP											0													16.0	17.0	17.0					11																	101454133		2194	4284	6478	-	-	-	SO:0001583	missense	0			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.102G>C	11.37:g.101454133C>G	ENSP00000340913:p.Met34Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC6_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.M34I	ENST00000344327.3	37	c.102	CCDS8311.1	11	.	.	.	.	.	.	.	.	.	.	C	16.06	3.016428	0.54468	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.78246	-0.99;-1.07;-0.91;-1.16	5.02	4.08	0.47627	.	1.134880	0.06432	N	0.724303	T	0.66954	0.2842	N	0.22421	0.69	0.33180	D	0.549408	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.60031	-0.7342	10	0.34782	T	0.22	-5.7991	9.9974	0.41907	0.0:0.7291:0.2709:0.0	.	34;34;34	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	I	34	ENSP00000340913:M34I;ENSP00000435574:M34I;ENSP00000343672:M34I;ENSP00000353687:M34I	ENSP00000340913:M34I	M	-	3	0	TRPC6	100959343	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.005000	0.40864	2.319000	0.78375	0.561000	0.74099	ATG	TRPC6	-	NULL	ENSG00000137672		0.721	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC6	HGNC	protein_coding	OTTHUMT00000394770.1	14	0.00	0	C	NM_004621		101454133	101454133	-1	no_errors	ENST00000344327	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	1.000	G
TRPM1	4308	genome.wustl.edu	37	15	31294084	31294084	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1LL-01A-11D-A142-09	TCGA-E2-A1LL-11A-21D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47312f61-5ef4-4f25-9320-8fbb4758790e	ed257922-f940-4fb3-9a92-fde82d130aef	g.chr15:31294084T>C	ENST00000256552.6	-	28	4966	c.4819A>G	c.(4819-4821)Atg>Gtg	p.M1607V	TRPM1_ENST00000397795.2_Missense_Mutation_p.M1585V|TRPM1_ENST00000542188.1_Missense_Mutation_p.M1624V|RP11-348B17.1_ENST00000561299.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TCTGCTGTCATTCCAGACACA	0.358																																						dbGAP											0													103.0	93.0	96.0					15																	31294084		1847	4094	5941	-	-	-	SO:0001583	missense	0			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.4819A>G	15.37:g.31294084T>C	ENSP00000256552:p.Met1607Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ion_trans_dom	p.M1624V	ENST00000256552.6	37	c.4870	CCDS58346.1	15	.	.	.	.	.	.	.	.	.	.	T	0.017	-1.511163	0.00984	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.47869	0.85;0.83;0.85	4.87	1.07	0.20283	.	1.373680	0.04917	N	0.454213	T	0.21962	0.0529	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20874	-1.0262	10	0.05436	T	0.98	-0.1843	3.361	0.07186	0.1662:0.2359:0.0:0.5979	.	1579;1585	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	V	1585;1624;1607;1585	ENSP00000380897:M1585V;ENSP00000437849:M1624V;ENSP00000256552:M1607V	ENSP00000256552:M1607V	M	-	1	0	TRPM1	29081376	0.001000	0.12720	0.001000	0.08648	0.033000	0.12548	0.624000	0.24462	0.252000	0.21531	0.460000	0.39030	ATG	TRPM1	-	NULL	ENSG00000134160		0.358	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	TRPM1	HGNC	protein_coding	OTTHUMT00000417166.2	53	0.00	0	T	NM_002420		31294084	31294084	-1	no_errors	ENST00000542188	ensembl	human	known	69_37n	missense	71	25.26	24	SNP	0.001	C
