#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC9	10060	genome.wustl.edu	37	12	21964989	21964989	+	Missense_Mutation	SNP	G	G	T	rs369587958		TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr12:21964989G>T	ENST00000261201.4	-	34	4204	c.4205C>A	c.(4204-4206)tCc>tAc	p.S1402Y	ABCC9_ENST00000345162.2_Missense_Mutation_p.S1366Y|ABCC9_ENST00000261200.4_Missense_Mutation_p.S1402Y	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1402	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CTACCTAATGGAACCACTGAA	0.373																																						dbGAP											0													200.0	171.0	181.0					12																	21964989		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.4205C>A	12.37:g.21964989G>T	ENSP00000261201:p.Ser1402Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.S1402Y	ENST00000261201.4	37	c.4205	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	G	21.8	4.209126	0.79240	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.92348	-3.02;-3.02;-3.02;-3.02	4.79	4.79	0.61399	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.97182	0.9079	H	0.94886	3.595	0.80722	D	1	D;D	0.71674	0.984;0.998	D;D	0.70487	0.934;0.969	D	0.98134	1.0432	10	0.87932	D	0	-15.8743	18.3916	0.90485	0.0:0.0:1.0:0.0	.	1402;1402	O60706;O60706-2	ABCC9_HUMAN;.	Y	1402;1029;1402;1366	ENSP00000261200:S1402Y;ENSP00000440521:S1029Y;ENSP00000261201:S1402Y;ENSP00000261202:S1366Y	ENSP00000261200:S1402Y	S	-	2	0	ABCC9	21856256	1.000000	0.71417	0.997000	0.53966	0.787000	0.44495	7.350000	0.79385	2.656000	0.90262	0.650000	0.86243	TCC	ABCC9	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000069431		0.373	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	32	0.00	0	G	NM_005691		21964989	21964989	-1	no_errors	ENST00000261200	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	T
ACOT7	11332	genome.wustl.edu	37	1	6378566	6378566	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:6378566C>T	ENST00000377855.2	-	6	874	c.728G>A	c.(727-729)gGc>gAc	p.G243D	ACOT7_ENST00000541130.1_Missense_Mutation_p.G213D|ACOT7_ENST00000608083.1_Missense_Mutation_p.G201D|ACOT7_ENST00000545482.1_Missense_Mutation_p.G128D|ACOT7_ENST00000377845.3_Missense_Mutation_p.G213D|ACOT7_ENST00000377842.3_Missense_Mutation_p.G192D|ACOT7_ENST00000361521.4_Missense_Mutation_p.G233D	NM_181864.2	NP_863654.1	O00154	BACH_HUMAN	acyl-CoA thioesterase 7	243	Acyl coenzyme A hydrolase 2.				coenzyme A biosynthetic process (GO:0015937)|fatty acid catabolic process (GO:0009062)|long-chain fatty-acyl-CoA catabolic process (GO:0036116)|medium-chain fatty acid biosynthetic process (GO:0051792)|medium-chain fatty-acyl-CoA catabolic process (GO:0036114)|palmitic acid biosynthetic process (GO:1900535)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)	carboxylic ester hydrolase activity (GO:0052689)|fatty-acyl-CoA binding (GO:0000062)|long-chain fatty acyl-CoA binding (GO:0036042)|palmitoyl-CoA hydrolase activity (GO:0016290)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	16	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		GTGCACAAAGCCGTGCAGGGT	0.557																																					GBM(74;673 1226 4974 11850 13190)	dbGAP											0													65.0	59.0	61.0					1																	6378566		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB074417	CCDS65.1, CCDS66.1, CCDS67.1, CCDS30573.1	1p36	2008-08-14			ENSG00000097021	ENSG00000097021		"""Acyl CoA thioesterases"""	24157	protein-coding gene	gene with protein product	"""brain acyl CoA hydrolase"""	602587				10578051, 16103133, 16940157	Standard	XM_005263427		Approved	BACH, ACH1, ACT, CTE-II, LACH1, MGC1126, hBACH	uc001amt.3	O00154	OTTHUMG00000001295	ENST00000377855.2:c.728G>A	1.37:g.6378566C>T	ENSP00000367086:p.Gly243Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0K7|A8K232|A8K6B8|A8K837|B3KQ12|O43703|Q53Y78|Q5JYL2|Q5JYL3|Q5JYL4|Q5JYL5|Q5JYL6|Q5TGR4|Q9UJM9|Q9Y539|Q9Y540	Missense_Mutation	SNP	pfam_Thioestr_supf	p.G243D	ENST00000377855.2	37	c.728	CCDS65.1	1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.043585	0.55003	.	.	ENSG00000097021	ENST00000377855;ENST00000377845;ENST00000377842;ENST00000361521;ENST00000545482;ENST00000541130	T;T;T;T;T;T	0.52057	0.69;0.69;0.69;0.69;0.69;0.68	5.51	5.51	0.81932	Thioesterase superfamily (1);	0.234700	0.44285	D	0.000463	T	0.54095	0.1837	L	0.61218	1.895	0.58432	D	0.999999	B;B;B;B	0.33807	0.248;0.426;0.028;0.089	B;B;B;B	0.40410	0.196;0.328;0.038;0.202	T	0.58222	-0.7674	10	0.87932	D	0	.	16.9145	0.86148	0.0:1.0:0.0:0.0	.	233;243;213;192	B3KQ12;O00154;O00154-5;O00154-6	.;BACH_HUMAN;.;.	D	243;213;192;233;128;213	ENSP00000367086:G243D;ENSP00000367076:G213D;ENSP00000367073:G192D;ENSP00000354615:G233D;ENSP00000439218:G128D;ENSP00000441872:G213D	ENSP00000354615:G233D	G	-	2	0	ACOT7	6301153	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	4.844000	0.62846	2.581000	0.87130	0.555000	0.69702	GGC	ACOT7	-	pfam_Thioestr_supf	ENSG00000097021		0.557	ACOT7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACOT7	HGNC	protein_coding	OTTHUMT00000003773.1	52	0.00	0	C	NM_007274		6378566	6378566	-1	no_errors	ENST00000377855	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	T
ADAM21	8747	genome.wustl.edu	37	14	70925057	70925057	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr14:70925057C>G	ENST00000603540.1	+	2	1099	c.841C>G	c.(841-843)Caa>Gaa	p.Q281E	ADAM21_ENST00000267499.3_Missense_Mutation_p.Q281E|RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	281	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CGATTTCTCTCAATGGAAACA	0.368																																						dbGAP											0													81.0	78.0	79.0					14																	70925057		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.841C>G	14.37:g.70925057C>G	ENSP00000474385:p.Gln281Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.Q281E	ENST00000603540.1	37	c.841	CCDS9804.1	14	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.193760	0.00302	.	.	ENSG00000139985	ENST00000267499	T	0.61742	0.08	4.36	2.44	0.29823	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	2.322460	0.02128	N	0.056216	T	0.33789	0.0875	N	0.05078	-0.115	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36696	-0.9737	10	0.02654	T	1	.	7.4129	0.27027	0.4199:0.4369:0.1432:0.0	.	281	Q9UKJ8	ADA21_HUMAN	E	281	ENSP00000267499:Q281E	ENSP00000267499:Q281E	Q	+	1	0	ADAM21	69994810	0.000000	0.05858	0.759000	0.31340	0.760000	0.43138	-1.216000	0.02982	0.530000	0.28619	0.557000	0.71058	CAA	ADAM21	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000139985		0.368	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM21	HGNC	protein_coding	OTTHUMT00000413008.3	58	0.00	0	C			70925057	70925057	+1	no_errors	ENST00000267499	ensembl	human	known	69_37n	missense	61	12.86	9	SNP	0.005	G
ADAM3A	1587	genome.wustl.edu	37	8	39362859	39362859	+	RNA	SNP	C	C	T	rs62510500	byFrequency	TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr8:39362859C>T	ENST00000490268.2	-	0	485					NR_073423.1				ADAM metallopeptidase domain 3A (pseudogene)																		AGAATACTCACGTCTGATTTG	0.313													C|||	2162	0.431709	0.7269	0.2378	5008	,	,		11203	0.5278		0.1998	False		,,,				2504	0.3098					dbGAP											0																																										-	-	-			0			X89657		8p11.22	2012-06-11	2012-06-11		ENSG00000197475	ENSG00000197475		"""ADAM metallopeptidase domain containing"""	209	pseudogene	pseudogene			"""cyritestin 1"", ""a disintegrin and metalloproteinase domain 3a (cyritestin 1)"", ""ADAM metallopeptidase domain 3A, pseudogene"", ""ADAM metallopeptidase domain 3A"""	CYRN1		9502432, 11439107	Standard	NR_024107		Approved	ADAM3, tMDCI	uc003xnf.4		OTTHUMG00000154991		8.37:g.39362859C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	NULL	ENST00000490268.2	37	c.NULL		8																																																																																			ADAM3A	-	-	ENSG00000197475		0.313	ADAM3A-005	KNOWN	basic	processed_transcript	ADAM3A	HGNC	pseudogene	OTTHUMT00000337953.1	15	0.00	0	C	NR_001569		39362859	39362859	-1	no_errors	ENST00000460383	ensembl	human	known	69_37n	splice_site	19	24.00	6	SNP	0.736	T
ANKRD52	283373	genome.wustl.edu	37	12	56648057	56648057	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr12:56648057C>T	ENST00000267116.7	-	8	821	c.700G>A	c.(700-702)Gaa>Aaa	p.E234K		NM_173595.3	NP_775866.2	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	234										endometrium(9)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(1)	29						GCATTGGGTTCATCGATCTGG	0.498																																						dbGAP											0													177.0	186.0	183.0					12																	56648057		2056	4212	6268	-	-	-	SO:0001583	missense	0			AK091555	CCDS44920.1	12q13.3	2013-01-10			ENSG00000139645	ENSG00000139645		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	26614	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit C"""						Standard	NM_173595		Approved	FLJ34236, PP6-ARS-C	uc001skm.4	Q8NB46	OTTHUMG00000170329	ENST00000267116.7:c.700G>A	12.37:g.56648057C>T	ENSP00000267116:p.Glu234Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NE79|B1Q2K2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E234K	ENST00000267116.7	37	c.700	CCDS44920.1	12	.	.	.	.	.	.	.	.	.	.	C	33	5.277934	0.95459	.	.	ENSG00000139645	ENST00000267116;ENST00000417002	T	0.15718	2.4	4.69	4.69	0.59074	Ankyrin repeat-containing domain (4);	0.056049	0.64402	D	0.000001	T	0.11153	0.0272	N	0.11427	0.14	0.80722	D	1	P	0.39326	0.668	B	0.43445	0.42	T	0.03493	-1.1031	10	0.02654	T	1	.	16.9167	0.86153	0.0:1.0:0.0:0.0	.	234	Q8NB46	ANR52_HUMAN	K	234	ENSP00000267116:E234K	ENSP00000267116:E234K	E	-	1	0	ANKRD52	54934324	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	7.651000	0.83577	2.595000	0.87683	0.655000	0.94253	GAA	ANKRD52	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000139645		0.498	ANKRD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD52	HGNC	protein_coding	OTTHUMT00000408539.1	50	0.00	0	C	NM_173595		56648057	56648057	-1	no_errors	ENST00000267116	ensembl	human	known	69_37n	missense	23	39.47	15	SNP	1.000	T
APBA2	321	genome.wustl.edu	37	15	29346222	29346222	+	Silent	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr15:29346222C>T	ENST00000558402.1	+	5	734	c.135C>T	c.(133-135)ggC>ggT	p.G45G	APBA2_ENST00000558330.1_Silent_p.G45G|APBA2_ENST00000561069.1_Silent_p.G45G|APBA2_ENST00000411764.1_Silent_p.G45G|APBA2_ENST00000558259.1_Silent_p.G45G			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	45					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		TGCCCGAGGGCCTGGAGCTGG	0.652																																						dbGAP											0													46.0	55.0	52.0					15																	29346222		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.135C>T	15.37:g.29346222C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PGI4|O60571|Q5XKC0	Silent	SNP	pfam_PTyr_interaction_dom,pfam_PDZ,superfamily_PDZ,smart_PTyr_interaction_dom,smart_PDZ,pfscan_PDZ,pfscan_PTyr_interaction_dom	p.G45	ENST00000558402.1	37	c.135	CCDS10022.1	15																																																																																			APBA2	-	NULL	ENSG00000034053		0.652	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA2	HGNC	protein_coding	OTTHUMT00000251362.3	51	0.00	0	C	NM_005503		29346222	29346222	+1	no_errors	ENST00000558259	ensembl	human	known	69_37n	silent	14	39.13	9	SNP	0.005	T
ATP8B5P	158381	genome.wustl.edu	37	9	35450083	35450083	+	RNA	SNP	G	G	C			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr9:35450083G>C	ENST00000430846.1	+	0	2933									ATPase, class I, type 8B, member 5, pseudogene																		TGAAACAGAAGATCTGCAGGC	0.418																																						dbGAP											0																																										-	-	-			0					9p13.3	2010-09-22			ENSG00000179766	ENSG00000179766		"""ATPases / P-type"""	27245	pseudogene	pseudogene	"""flippase expressed in testis splicing form A pseudogene"""					20210903, 19657017	Standard	NR_003582		Approved	FetA	uc010mkn.2		OTTHUMG00000019862		9.37:g.35450083G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000430846.1	37	NULL		9																																																																																			ATP8B5P	-	-	ENSG00000179766		0.418	ATP8B5P-002	KNOWN	basic	processed_transcript	ATP8B5P	HGNC	pseudogene	OTTHUMT00000052312.1	37	0.00	0	G	NR_003581.1		35450083	35450083	+1	no_errors	ENST00000430846	ensembl	human	known	69_37n	rna	18	45.45	15	SNP	0.470	C
AXIN1	8312	genome.wustl.edu	37	16	343662	343662	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr16:343662T>C	ENST00000262320.3	-	8	2383	c.2012A>G	c.(2011-2013)gAg>gGg	p.E671G	AXIN1_ENST00000354866.3_Missense_Mutation_p.E671G	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	671	Interaction with PPP2CA.|Interaction with RNF111.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)	p.E671G(1)		biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CCAGGGGTGCTCAAGGGACAA	0.637																																						dbGAP											1	Substitution - Missense(1)	thyroid(1)											93.0	109.0	104.0					16																	343662		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.2012A>G	16.37:g.343662T>C	ENSP00000262320:p.Glu671Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	pfam_DIX,pfam_Regulat_G_prot_signal,pfam_Axin_b-cat-bd,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_DIX,pfscan_DIX,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.E671G	ENST00000262320.3	37	c.2012	CCDS10405.1	16	.	.	.	.	.	.	.	.	.	.	T	14.10	2.434054	0.43224	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.63913	-0.07;0.02	4.17	4.17	0.49024	.	0.100857	0.64402	D	0.000003	T	0.76285	0.3966	M	0.69823	2.125	0.22684	N	0.998853	D;D	0.89917	1.0;1.0	D;D	0.87578	0.988;0.998	T	0.68002	-0.5524	10	0.62326	D	0.03	-29.7881	12.5465	0.56203	0.0:0.0:0.0:1.0	.	671;671	O15169-2;O15169	.;AXIN1_HUMAN	G	671	ENSP00000262320:E671G;ENSP00000346935:E671G	ENSP00000262320:E671G	E	-	2	0	AXIN1	283663	1.000000	0.71417	0.492000	0.27490	0.222000	0.24845	4.671000	0.61590	1.774000	0.52232	0.391000	0.25812	GAG	AXIN1	-	NULL	ENSG00000103126		0.637	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXIN1	HGNC	protein_coding	OTTHUMT00000139441.3	59	0.00	0	T			343662	343662	-1	no_errors	ENST00000262320	ensembl	human	known	69_37n	missense	40	36.51	23	SNP	0.999	C
B4GALNT3	283358	genome.wustl.edu	37	12	657408	657408	+	Silent	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr12:657408C>T	ENST00000266383.5	+	9	811	c.798C>T	c.(796-798)aaC>aaT	p.N266N	B4GALNT3_ENST00000544638.1_3'UTR	NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	266					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			GGCGACGGAACGACCCTGGAG	0.592																																						dbGAP											0													138.0	106.0	117.0					12																	657408		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.798C>T	12.37:g.657408C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZNC1|Q8N7T6	Silent	SNP	pfam_PA14,pfam_Chond_GalNAc,smart_PA14	p.N266	ENST00000266383.5	37	c.798	CCDS8504.1	12																																																																																			B4GALNT3	-	pfam_PA14,smart_PA14	ENSG00000139044		0.592	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT3	HGNC	protein_coding	OTTHUMT00000251406.2	72	0.00	0	C	NM_173593		657408	657408	+1	no_errors	ENST00000266383	ensembl	human	known	69_37n	silent	28	53.33	32	SNP	0.949	T
BACH2	60468	genome.wustl.edu	37	6	90717860	90717860	+	Intron	SNP	C	C	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr6:90717860C>A	ENST00000257749.4	-	6	951				BACH2_ENST00000343122.3_Intron|BACH2_ENST00000537989.1_Intron	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2							cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		TTCTTAGAATCTTACTGAATT	0.373																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.243+460G>T	6.37:g.90717860C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P518|Q59H70|Q5T793|Q9NTS5	RNA	SNP	-	NULL	ENST00000257749.4	37	NULL	CCDS5026.1	6																																																																																			BACH2	-	-	ENSG00000112182		0.373	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BACH2	HGNC	protein_coding	OTTHUMT00000041522.2	21	0.00	0	C	NM_021813		90717860	90717860	-1	no_errors	ENST00000481150	ensembl	human	known	69_37n	rna	7	46.15	6	SNP	0.588	A
BDKRB1	623	genome.wustl.edu	37	14	96731044	96731044	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr14:96731044A>G	ENST00000216629.6	+	3	1631	c.1025A>G	c.(1024-1026)cAt>cGt	p.H342R	RP11-404P21.3_ENST00000553638.1_RNA|BDKRB1_ENST00000553356.1_Intron	NM_000710.3	NP_000701.2	P46663	BKRB1_HUMAN	bradykinin receptor B1	342					cell migration (GO:0016477)|inflammatory response (GO:0006954)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell growth (GO:0030308)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|peptide binding (GO:0042277)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(4)|skin(1)|urinary_tract(1)	16		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)		TCTTCATCCCATAGGAAAGAA	0.388																																						dbGAP											0													102.0	116.0	111.0					14																	96731044		2203	4300	6503	-	-	-	SO:0001583	missense	0			L42383	CCDS9943.1	14q32.1-q32.2	2012-08-08				ENSG00000100739		"""GPCR / Class A : Bradykinin receptors"""	1029	protein-coding gene	gene with protein product		600337				8808279	Standard	NM_000710		Approved	BKR1, B1BKR, bradyb1	uc001yfh.3	P46663		ENST00000216629.6:c.1025A>G	14.37:g.96731044A>G	ENSP00000216629:p.His342Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7F5|Q546S7|Q8N0Y8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_BK_rcpt_B1,prints_7TM_GPCR_Rhodpsn,prints_Brdyknn_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.H342R	ENST00000216629.6	37	c.1025	CCDS9943.1	14	.	.	.	.	.	.	.	.	.	.	A	1.005	-0.689720	0.03328	.	.	ENSG00000100739	ENST00000216629	T	0.35973	1.28	3.93	-7.86	0.01187	.	1.727520	0.03567	N	0.227975	T	0.14056	0.0340	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11179	-1.0598	10	0.20519	T	0.43	8.0E-4	3.4259	0.07410	0.2749:0.1349:0.4577:0.1325	.	342	P46663	BKRB1_HUMAN	R	342	ENSP00000216629:H342R	ENSP00000216629:H342R	H	+	2	0	BDKRB1	95800797	0.000000	0.05858	0.000000	0.03702	0.496000	0.33645	-2.018000	0.01444	-1.440000	0.01960	0.459000	0.35465	CAT	BDKRB1	-	NULL	ENSG00000100739		0.388	BDKRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BDKRB1	HGNC	protein_coding	OTTHUMT00000413300.1	50	0.00	0	A			96731044	96731044	+1	no_errors	ENST00000216629	ensembl	human	known	69_37n	missense	22	43.59	17	SNP	0.000	G
BID	637	genome.wustl.edu	37	22	18222887	18222887	+	Intron	DEL	G	G	-			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr22:18222887delG	ENST00000399774.3	-	4	393				BID_ENST00000551952.1_Intron|BID_ENST00000317361.7_Intron|BID_ENST00000342111.5_Frame_Shift_Del_p.S93fs|BID_ENST00000473439.1_Intron|BID_ENST00000399765.1_Intron|BID_ENST00000399767.1_Intron	NM_001196.3|NM_001244569.1	NP_001187.1|NP_001231498.1	P55957	BID_HUMAN	BH3 interacting domain death agonist						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|brain development (GO:0007420)|establishment of protein localization to membrane (GO:0090150)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|intrinsic apoptotic signaling pathway (GO:0097193)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of cell proliferation (GO:0042127)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|release of cytochrome c from mitochondria (GO:0001836)|response to estradiol (GO:0032355)|signal transduction in response to DNA damage (GO:0042770)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial membrane (GO:0032592)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	death receptor binding (GO:0005123)			large_intestine(2)|ovary(1)	3		all_epithelial(15;0.198)		Lung(27;0.0419)		CAACTGCCACGCTCCCTGCCG	0.597																																						dbGAP											0													27.0	29.0	29.0					22																	18222887		876	1990	2866	-	-	-	SO:0001627	intron_variant	0			AF042083	CCDS13747.1, CCDS13748.1, CCDS13749.1	22q11.2	2014-03-07			ENSG00000015475	ENSG00000015475		"""Endogenous ligands"""	1050	protein-coding gene	gene with protein product		601997				8918887, 9721221	Standard	NM_001244567		Approved		uc002znc.2	P55957	OTTHUMG00000150087	ENST00000399774.3:c.224-633C>-	22.37:g.18222887delG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q549M7|Q71T04|Q7Z4M9|Q8IY86	Frame_Shift_Del	DEL	pfam_BID	p.S93fs	ENST00000399774.3	37	c.279	CCDS13748.1	22																																																																																			BID	-	NULL	ENSG00000015475		0.597	BID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BID	HGNC	protein_coding	OTTHUMT00000316178.1	32	0.00	0	G	NM_197966		18222887	18222887	-1	no_errors	ENST00000342111	ensembl	human	known	69_37n	frame_shift_del	16	10.53	2	DEL	0.000	-
C18orf8	29919	genome.wustl.edu	37	18	21109597	21109597	+	Splice_Site	SNP	A	A	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr18:21109597A>G	ENST00000269221.3	+	16	1526		c.e16-1		C18orf8_ENST00000590868.1_Splice_Site|C18orf8_ENST00000591367.1_Splice_Site	NM_013326.3	NP_037458.3	Q96DM3	MIC1_HUMAN	chromosome 18 open reading frame 8							lysosomal membrane (GO:0005765)				endometrium(9)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	21	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TTTTCTCCCTAGGAGATGCCT	0.423																																						dbGAP											0													124.0	123.0	123.0					18																	21109597		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK057192	CCDS32803.1, CCDS74199.1	18q11.2	2013-12-13			ENSG00000141452	ENSG00000141452			24326	protein-coding gene	gene with protein product	"""colon cancer associated protein Mic1"", ""macrophage inhibitory cytokine 1"""					12477932	Standard	NM_013326		Approved	MIC1, MIC-1, HsT2591	uc021uie.2	Q96DM3		ENST00000269221.3:c.1417-1A>G	18.37:g.21109597A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BU17|Q9Y5M0	Splice_Site	SNP	-	e16-2	ENST00000269221.3	37	c.1417-2	CCDS32803.1	18	.	.	.	.	.	.	.	.	.	.	A	17.42	3.386245	0.61956	.	.	ENSG00000141452	ENST00000269221;ENST00000544799;ENST00000540942;ENST00000542734	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6766	0.77332	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C18orf8	19363595	1.000000	0.71417	0.970000	0.41538	0.533000	0.34776	8.536000	0.90627	2.099000	0.63709	0.533000	0.62120	.	C18orf8	-	-	ENSG00000141452		0.423	C18orf8-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C18orf8	HGNC	protein_coding	OTTHUMT00000445386.1	46	0	0	A	NM_013326	Intron	21109597	21109597	+1	no_errors	ENST00000269221	ensembl	human	known	69_37n	splice_site	28	15.15	5	SNP	1.000	G
SMCO1	255798	genome.wustl.edu	37	3	196234917	196234917	+	Silent	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr3:196234917G>A	ENST00000397537.2	-	3	642	c.486C>T	c.(484-486)atC>atT	p.I162I		NM_001077657.1	NP_001071125.1	Q147U7	SMCO1_HUMAN	single-pass membrane protein with coiled-coil domains 1	162						integral component of membrane (GO:0016021)											TGACATCCCTGATGTACATCT	0.463																																						dbGAP											0													173.0	162.0	165.0					3																	196234917		2044	4176	6220	-	-	-	SO:0001819	synonymous_variant	0			AK123917	CCDS43192.1	3q29	2013-03-08	2013-03-08	2013-03-08	ENSG00000214097	ENSG00000214097			27407	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 43"""	C3orf43			Standard	NM_001077657		Approved	FLJ41923, DKFZp313B0440		Q147U7	OTTHUMG00000155581	ENST00000397537.2:c.486C>T	3.37:g.196234917G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW20	Silent	SNP	NULL	p.I162	ENST00000397537.2	37	c.486	CCDS43192.1	3																																																																																			C3orf43	-	NULL	ENSG00000214097		0.463	SMCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf43	HGNC	protein_coding	OTTHUMT00000340776.1	74	0.00	0	G	NM_001006109		196234917	196234917	-1	no_errors	ENST00000397537	ensembl	human	known	69_37n	silent	37	35.09	20	SNP	0.028	A
CAPN9	10753	genome.wustl.edu	37	1	230895283	230895283	+	Silent	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:230895283C>T	ENST00000271971.2	+	3	422	c.309C>T	c.(307-309)atC>atT	p.I103I	RP11-99J16__A.2_ENST00000412344.1_RNA|CAPN9_ENST00000354537.1_Silent_p.I103I|CAPN9_ENST00000366666.2_Intron	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	103	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				TAGCCGCCATCGCCTCCCTTA	0.473																																						dbGAP											0													73.0	71.0	72.0					1																	230895283		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.309C>T	1.37:g.230895283C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1APS1|B1AQI0|Q9NS74	Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.I103	ENST00000271971.2	37	c.309	CCDS1586.1	1																																																																																			CAPN9	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	ENSG00000135773		0.473	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN9	HGNC	protein_coding	OTTHUMT00000092179.1	32	0.00	0	C	NM_006615		230895283	230895283	+1	no_errors	ENST00000271971	ensembl	human	known	69_37n	silent	31	27.91	12	SNP	0.667	T
CASC4	113201	genome.wustl.edu	37	15	44615196	44615196	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr15:44615196G>T	ENST00000345795.2	+	2	631	c.361G>T	c.(361-363)Gca>Tca	p.A121S	CASC4_ENST00000360824.3_Missense_Mutation_p.A121S|CASC4_ENST00000299957.6_Missense_Mutation_p.A121S	NM_177974.2	NP_816929.1	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4	121						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(2)	17		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		GTATCAGATGGCAGACATACA	0.269																																						dbGAP											0													94.0	96.0	95.0					15																	44615196		2198	4291	6489	-	-	-	SO:0001583	missense	0			AF103804	CCDS10108.1, CCDS10109.1	15q15.1	2010-11-24			ENSG00000166734	ENSG00000166734			24892	protein-coding gene	gene with protein product						10497265	Standard	NM_138423		Approved	H63, DKFZp459F1927	uc001ztp.3	Q6P4E1	OTTHUMG00000131133	ENST00000345795.2:c.361G>T	15.37:g.44615196G>T	ENSP00000335063:p.Ala121Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPZ6|G5E934|Q6UY45|Q96EM1	Missense_Mutation	SNP	NULL	p.A121S	ENST00000345795.2	37	c.361	CCDS10109.1	15	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281009	0.80692	.	.	ENSG00000166734	ENST00000299957;ENST00000345795;ENST00000360824;ENST00000416522	D;D	0.83591	-1.74;-1.74	6.08	6.08	0.98989	.	0.049179	0.85682	D	0.000000	D	0.87700	0.6243	L	0.46614	1.455	0.48185	D	0.9996	D;D;D	0.89917	1.0;0.996;1.0	D;D;D	0.91635	0.997;0.987;0.999	T	0.81344	-0.0975	10	0.09338	T	0.73	.	19.4436	0.94836	0.0:0.0:1.0:0.0	.	121;121;121	Q6P4E1-2;G5E934;Q6P4E1	.;.;CASC4_HUMAN	S	121;121;121;100	ENSP00000299957:A121S;ENSP00000335063:A121S	ENSP00000299957:A121S	A	+	1	0	CASC4	42402488	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.300000	0.72776	2.894000	0.99253	0.591000	0.81541	GCA	CASC4	-	NULL	ENSG00000166734		0.269	CASC4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CASC4	HGNC	protein_coding	OTTHUMT00000253816.1	28	0.00	0	G	NM_138423		44615196	44615196	+1	no_errors	ENST00000299957	ensembl	human	known	69_37n	missense	14	17.65	3	SNP	1.000	T
CCDC115	84317	genome.wustl.edu	37	2	131099321	131099321	+	Splice_Site	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr2:131099321C>T	ENST00000259229.2	-	3	440	c.217G>A	c.(217-219)Gag>Aag	p.E73K	CCDC115_ENST00000409127.1_Splice_Site_p.E68K|CCDC115_ENST00000437688.2_Splice_Site_p.E68K|IMP4_ENST00000409935.1_5'Flank|IMP4_ENST00000259239.3_5'Flank	NM_032357.2	NP_115733.2	Q96NT0	CC115_HUMAN	coiled-coil domain containing 115	73						endosome (GO:0005768)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	7	Colorectal(110;0.1)					TCCTGGGCCTCGCTGAAGGAC	0.667																																						dbGAP											0													23.0	23.0	23.0					2																	131099321		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK054693	CCDS2159.1	2q21.1	2010-12-24			ENSG00000136710	ENSG00000136710			28178	protein-coding gene	gene with protein product		613734				21118521	Standard	XM_005263825		Approved	MGC12981, FLJ30131, ccp1	uc002tqy.1	Q96NT0	OTTHUMG00000131631	ENST00000259229.2:c.216-1G>A	2.37:g.131099321C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJ47|Q9BR88	Missense_Mutation	SNP	NULL	p.E73K	ENST00000259229.2	37	c.217	CCDS2159.1	2	.	.	.	.	.	.	.	.	.	.	C	13.75	2.330086	0.41297	.	.	ENSG00000136710	ENST00000259229;ENST00000409127;ENST00000437688	D;D;D	0.95588	-3.75;-3.75;-3.75	3.77	3.77	0.43336	.	0.560211	0.19987	N	0.101655	D	0.95242	0.8457	M	0.76574	2.34	0.53688	D	0.999978	D;D;D;P	0.64830	0.994;0.994;0.964;0.938	P;P;P;B	0.53861	0.736;0.736;0.458;0.381	D	0.93035	0.6452	10	0.07813	T	0.8	-0.8127	11.398	0.49854	0.0:1.0:0.0:0.0	.	68;73;73;68	B4DJ47;F8WCZ3;Q96NT0;B8ZZ99	.;.;CC115_HUMAN;.	K	73;68;68	ENSP00000259229:E73K;ENSP00000387301:E68K;ENSP00000399756:E68K	ENSP00000259229:E73K	E	-	1	0	CCDC115	130815791	1.000000	0.71417	0.947000	0.38551	0.243000	0.25628	2.977000	0.49297	2.395000	0.81488	0.655000	0.94253	GAG	CCDC115	-	NULL	ENSG00000136710		0.667	CCDC115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC115	HGNC	protein_coding	OTTHUMT00000254524.2	26	0.00	0	C	NM_032357	Missense_Mutation	131099321	131099321	-1	no_errors	ENST00000442217	ensembl	human	known	69_37n	missense	6	53.85	7	SNP	0.960	T
CCDC88B	283234	genome.wustl.edu	37	11	64116864	64116864	+	Missense_Mutation	SNP	G	G	A	rs557823274		TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr11:64116864G>A	ENST00000356786.5	+	15	2722	c.2678G>A	c.(2677-2679)cGt>cAt	p.R893H	CCDC88B_ENST00000301897.4_5'UTR|CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000359902.2_Missense_Mutation_p.R45H	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	893						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CATTTGCAGCGTGAGCTGGAG	0.637																																						dbGAP											0													23.0	29.0	27.0					11																	64116864		2200	4297	6497	-	-	-	SO:0001583	missense	0			AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.2678G>A	11.37:g.64116864G>A	ENSP00000349238:p.Arg893His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	pfam_HOOK	p.R893H	ENST00000356786.5	37	c.2678	CCDS8072.2	11	.	.	.	.	.	.	.	.	.	.	g	8.915	0.959553	0.18507	.	.	ENSG00000168071	ENST00000377638;ENST00000356786;ENST00000359902	T;T	0.46451	1.93;0.87	3.68	-6.53	0.01866	.	.	.	.	.	T	0.12178	0.0296	N	0.01729	-0.75	0.09310	N	0.999998	P;D;B;P	0.59357	0.832;0.985;0.01;0.832	B;B;B;B	0.42851	0.107;0.4;0.002;0.107	T	0.16541	-1.0399	9	0.10111	T	0.7	.	5.4712	0.16670	0.4415:0.2534:0.305:0.0	.	893;29;542;893	B2RTU8;A6NC98-5;A6NC98-3;A6NC98	.;.;.;CC88B_HUMAN	H	893;893;45	ENSP00000349238:R893H;ENSP00000352974:R45H	ENSP00000349238:R893H	R	+	2	0	CCDC88B	63873440	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.647000	0.05397	-1.590000	0.01623	-0.288000	0.09946	CGT	CCDC88B	-	NULL	ENSG00000168071		0.637	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88B	HGNC	protein_coding	OTTHUMT00000104845.1	53	0.00	0	G	NM_032251		64116864	64116864	+1	no_errors	ENST00000356786	ensembl	human	known	69_37n	missense	15	40.00	10	SNP	0.000	A
CD109	135228	genome.wustl.edu	37	6	74407127	74407127	+	Missense_Mutation	SNP	C	C	T	rs202157387	byFrequency	TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr6:74407127C>T	ENST00000287097.5	+	2	191	c.79C>T	c.(79-81)Cgg>Tgg	p.R27W	CD109_ENST00000437994.2_Missense_Mutation_p.R27W|RP11-553A21.3_ENST00000428865.2_RNA|CD109_ENST00000422508.2_Missense_Mutation_p.R27W			Q6YHK3	CD109_HUMAN	CD109 molecule	27					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTTTAGGCCTCGGTTTCTGGT	0.502													C|||	2	0.000399361	0.0	0.0	5008	,	,		19616	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													100.0	97.0	98.0					6																	74407127		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.79C>T	6.37:g.74407127C>T	ENSP00000287097:p.Arg27Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.R27W	ENST00000287097.5	37	c.79	CCDS4982.1	6	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	13.47	2.247716	0.39697	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.24723	1.84;1.94;1.84	5.31	0.77	0.18497	.	0.671241	0.13479	N	0.384840	T	0.13200	0.0320	N	0.19112	0.55	0.09310	N	1	D;D;D;D	0.76494	0.987;0.999;0.993;0.997	P;P;P;P	0.53861	0.555;0.736;0.555;0.727	T	0.18085	-1.0348	10	0.49607	T	0.09	.	13.3182	0.60419	0.7597:0.2403:0.0:0.0	.	27;27;27;27	Q6YHK3-2;Q6YHK3-3;Q6YHK3-4;Q6YHK3	.;.;.;CD109_HUMAN	W	27	ENSP00000388062:R27W;ENSP00000404475:R27W;ENSP00000287097:R27W	ENSP00000287097:R27W	R	+	1	2	CD109	74463848	0.002000	0.14202	0.338000	0.25549	0.193000	0.23685	0.268000	0.18571	0.281000	0.22233	0.655000	0.94253	CGG	CD109	-	NULL	ENSG00000156535		0.502	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD109	HGNC	protein_coding	OTTHUMT00000041230.3	44	0.00	0	C	NM_133493		74407127	74407127	+1	no_errors	ENST00000287097	ensembl	human	known	69_37n	missense	27	32.50	13	SNP	0.114	T
CDH1	999	genome.wustl.edu	37	16	68847225	68847225	+	Nonsense_Mutation	SNP	C	C	T	rs587782798		TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr16:68847225C>T	ENST00000261769.5	+	9	1338	c.1147C>T	c.(1147-1149)Cag>Tag	p.Q383*	RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Intron	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	383	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.Y380_K440del(2)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		GTACAAGGGTCAGGTGCCTGA	0.483			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	3	Deletion - In frame(2)|Unknown(1)	breast(2)|stomach(1)											135.0	122.0	126.0					16																	68847225		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1147C>T	16.37:g.68847225C>T	ENSP00000261769:p.Gln383*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q383*	ENST00000261769.5	37	c.1147	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822314	0.90873	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794	.	.	.	5.53	-4.19	0.03835	.	1.277870	0.05589	N	0.574327	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	2.5341	0.04710	0.3607:0.1717:0.3357:0.1319	.	.	.	.	X	383	.	ENSP00000261769:Q383X	Q	+	1	0	CDH1	67404726	0.000000	0.05858	0.000000	0.03702	0.676000	0.39594	-0.926000	0.03988	-0.586000	0.05898	0.561000	0.74099	CAG	CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000039068		0.483	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	51	0.00	0	C	NM_004360		68847225	68847225	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	11	56.00	14	SNP	0.000	T
CHPF	79586	genome.wustl.edu	37	2	220406340	220406340	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr2:220406340C>T	ENST00000243776.6	-	2	1134	c.886G>A	c.(886-888)Gag>Aag	p.E296K	CHPF_ENST00000373891.2_Missense_Mutation_p.E296K|CHPF_ENST00000535926.1_Missense_Mutation_p.E134K|TMEM198_ENST00000344458.2_5'Flank|TMEM198_ENST00000373883.3_5'Flank	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	296					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CATCCCACCTCGTGGTCACCA	0.577											OREG0015229	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													22.0	17.0	18.0					2																	220406340		2186	4265	6451	-	-	-	SO:0001583	missense	0			BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.886G>A	2.37:g.220406340C>T	ENSP00000243776:p.Glu296Lys	Somatic	2266	WXS	Illumina GAIIx	Phase_IV	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	pfam_Chond_GalNAc	p.E296K	ENST00000243776.6	37	c.886	CCDS2443.1	2	.	.	.	.	.	.	.	.	.	.	C	19.75	3.885676	0.72410	.	.	ENSG00000123989	ENST00000243776;ENST00000535926;ENST00000373891	T;T;T	0.16196	2.36;2.36;2.36	4.6	3.65	0.41850	.	0.195377	0.42964	D	0.000634	T	0.29914	0.0748	L	0.47190	1.495	0.58432	D	0.999997	B;D	0.58268	0.296;0.982	B;P	0.57720	0.049;0.826	T	0.05162	-1.0902	10	0.87932	D	0	-21.7913	15.494	0.75634	0.0:0.8612:0.1388:0.0	.	296;296	F8W6H2;Q8IZ52	.;CHSS2_HUMAN	K	296;134;296	ENSP00000243776:E296K;ENSP00000445571:E134K;ENSP00000362998:E296K	ENSP00000243776:E296K	E	-	1	0	CHPF	220114584	0.994000	0.37717	0.978000	0.43139	0.348000	0.29142	2.507000	0.45442	2.574000	0.86865	0.549000	0.68633	GAG	CHPF	-	pfam_Chond_GalNAc	ENSG00000123989		0.577	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHPF	HGNC	protein_coding	OTTHUMT00000130268.1	33	0.00	0	C	NM_024536		220406340	220406340	-1	no_errors	ENST00000243776	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	0.986	T
CPQ	10404	genome.wustl.edu	37	8	97847315	97847315	+	Missense_Mutation	SNP	C	C	T	rs577356141		TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr8:97847315C>T	ENST00000220763.5	+	3	758	c.548C>T	c.(547-549)aCg>aTg	p.T183M		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	183					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)	p.T183M(1)									TACTCAAGGACGGTGCAATAC	0.522																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											115.0	109.0	111.0					8																	97847315		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.548C>T	8.37:g.97847315C>T	ENSP00000220763:p.Thr183Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.T183M	ENST00000220763.5	37	c.548	CCDS6273.1	8	.	.	.	.	.	.	.	.	.	.	C	10.41	1.342702	0.24339	.	.	ENSG00000104324	ENST00000220763;ENST00000517742	T;T	0.56776	0.77;0.44	5.63	2.51	0.30379	.	0.242508	0.41605	D	0.000843	T	0.72819	0.3508	M	0.87547	2.89	0.09310	N	0.999999	D;D	0.89917	1.0;0.997	D;P	0.67725	0.953;0.849	T	0.67292	-0.5707	10	0.41790	T	0.15	-3.1769	15.1667	0.72833	0.0:0.6202:0.3798:0.0	.	183;183	B5MDX4;Q9Y646	.;PGCP_HUMAN	M	183	ENSP00000220763:T183M;ENSP00000429146:T183M	ENSP00000220763:T183M	T	+	2	0	AC010859.1	97916491	0.635000	0.27199	0.004000	0.12327	0.016000	0.09150	2.764000	0.47613	1.326000	0.45319	0.655000	0.94253	ACG	CPQ	-	NULL	ENSG00000104324		0.522	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPQ	HGNC	protein_coding	OTTHUMT00000379757.2	58	0.00	0	C	NM_016134		97847315	97847315	+1	no_errors	ENST00000220763	ensembl	human	known	69_37n	missense	37	26.00	13	SNP	0.070	T
CUBN	8029	genome.wustl.edu	37	10	17156097	17156097	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr10:17156097G>A	ENST00000377833.4	-	8	877	c.812C>T	c.(811-813)cCc>cTc	p.P271L		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	271	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GCAAGGCCCGGGCTGGAAGCT	0.582																																						dbGAP											0													67.0	52.0	57.0					10																	17156097		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.812C>T	10.37:g.17156097G>A	ENSP00000367064:p.Pro271Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.P271L	ENST00000377833.4	37	c.812	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	G	12.39	1.922495	0.33908	.	.	ENSG00000107611	ENST00000377833	D	0.92099	-2.97	5.64	1.44	0.22558	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.701890	0.12412	N	0.471232	T	0.81569	0.4850	N	0.11427	0.14	0.09310	N	1	P	0.35226	0.491	B	0.37015	0.239	T	0.70680	-0.4805	10	0.17369	T	0.5	.	8.2437	0.31675	0.0:0.2122:0.321:0.4667	.	271	O60494	CUBN_HUMAN	L	271	ENSP00000367064:P271L	ENSP00000367064:P271L	P	-	2	0	CUBN	17196103	0.005000	0.15991	0.001000	0.08648	0.017000	0.09413	0.813000	0.27225	0.826000	0.34661	0.563000	0.77884	CCC	CUBN	-	pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000107611		0.582	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	28	0.00	0	G	NM_001081		17156097	17156097	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	0.000	A
DACH2	117154	genome.wustl.edu	37	X	85403985	85403985	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chrX:85403985G>A	ENST00000373125.4	+	1	361	c.361G>A	c.(361-363)Gtg>Atg	p.V121M	DACH2_ENST00000373131.1_Missense_Mutation_p.V121M	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	121	DACHbox-N.				development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						TATATCCCCCGTGGTGTGTAC	0.557																																						dbGAP											0													83.0	76.0	78.0					X																	85403985		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.361G>A	X.37:g.85403985G>A	ENSP00000362217:p.Val121Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.V121M	ENST00000373125.4	37	c.361	CCDS14455.1	X	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698900	0.68501	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125	D;D	0.84223	-1.82;-1.82	4.5	4.5	0.54988	DNA binding domain, putative (1);Transforming protein Ski (2);	0.000000	0.45606	D	0.000349	D	0.90889	0.7137	M	0.67953	2.075	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72625	0.963;0.978	D	0.91073	0.4894	10	0.46703	T	0.11	.	16.1211	0.81357	0.0:0.0:1.0:0.0	.	121;121	Q96NX9-2;Q96NX9	.;DACH2_HUMAN	M	121	ENSP00000362223:V121M;ENSP00000362217:V121M	ENSP00000345134:V121M	V	+	1	0	DACH2	85290641	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	8.862000	0.92283	2.071000	0.62044	0.544000	0.68410	GTG	DACH2	-	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	ENSG00000126733		0.557	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACH2	HGNC	protein_coding	OTTHUMT00000359266.1	62	0.00	0	G	NM_053281		85403985	85403985	+1	no_errors	ENST00000373125	ensembl	human	known	69_37n	missense	42	20.75	11	SNP	1.000	A
DHX15	1665	genome.wustl.edu	37	4	24557984	24557984	+	Silent	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr4:24557984G>A	ENST00000336812.4	-	4	907	c.751C>T	c.(751-753)Ctg>Ttg	p.L251L		NM_001358.2	NP_001349.2	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 15	251	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	30		Breast(46;0.0503)				TAACGCTCCAGGAGGGGATCA	0.398																																						dbGAP											0													141.0	130.0	134.0					4																	24557984		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB001636	CCDS33966.1	4p15.3	2013-05-13	2013-05-13	2003-06-20	ENSG00000109606	ENSG00000109606		"""DEAH-boxes"""	2738	protein-coding gene	gene with protein product		603403	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 15"""	DDX15		9388478	Standard	NM_001358		Approved	HRH2, DBP1, PRP43, PrPp43p, PRPF43	uc003gqx.3	O43143	OTTHUMG00000160304	ENST00000336812.4:c.751C>T	4.37:g.24557984G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NQT7	Silent	SNP	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L251	ENST00000336812.4	37	c.751	CCDS33966.1	4																																																																																			DHX15	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000109606		0.398	DHX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX15	HGNC	protein_coding	OTTHUMT00000360143.1	50	0.00	0	G	NM_001358		24557984	24557984	-1	no_errors	ENST00000336812	ensembl	human	known	69_37n	silent	17	37.04	10	SNP	0.966	A
DNHD1	144132	genome.wustl.edu	37	11	6592334	6592334	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr11:6592334G>A	ENST00000527990.2	+	40	13592	c.13592G>A	c.(13591-13593)gGc>gAc	p.G4531D	DNHD1_ENST00000254579.6_Missense_Mutation_p.G4531D			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	4531					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CTCTGGACTGGCCGCCTACCC	0.692																																						dbGAP											0													22.0	26.0	24.0					11																	6592334		2059	4184	6243	-	-	-	SO:0001583	missense	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.13592G>A	11.37:g.6592334G>A	ENSP00000436180:p.Gly4531Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy,superfamily_t-SNARE	p.G4531D	ENST00000527990.2	37	c.13592	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076977	0.76415	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000530197	T;T	0.07567	3.18;3.18	4.25	4.25	0.50352	Dynein heavy chain (1);	0.154252	0.43747	D	0.000529	T	0.21590	0.0520	M	0.62723	1.935	0.32616	N	0.523996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.06588	-1.0818	10	0.15499	T	0.54	-16.2902	12.327	0.55018	0.0:0.0:1.0:0.0	.	3619;584;4531	B0I1S4;Q9NSW8;Q96M86	.;.;DNHD1_HUMAN	D	4531;4531;799	ENSP00000254579:G4531D;ENSP00000436180:G4531D	ENSP00000254579:G4531D	G	+	2	0	DNHD1	6548910	1.000000	0.71417	0.957000	0.39632	0.729000	0.41735	2.295000	0.43576	2.353000	0.79882	0.557000	0.71058	GGC	DNHD1	-	pfam_Dynein_heavy	ENSG00000179532		0.692	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	13	0.00	0	G	NM_144666		6592334	6592334	+1	no_errors	ENST00000254579	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	0.977	A
DSG3	1830	genome.wustl.edu	37	18	29055625	29055625	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr18:29055625C>T	ENST00000257189.4	+	16	2485	c.2402C>T	c.(2401-2403)gCg>gTg	p.A801V		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	801					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTTGCCTGTGCGGAGGAAGAC	0.428																																						dbGAP											0													103.0	101.0	101.0					18																	29055625		2203	4300	6503	-	-	-	SO:0001583	missense	0			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.2402C>T	18.37:g.29055625C>T	ENSP00000257189:p.Ala801Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2V2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmo_cadherin	p.A801V	ENST00000257189.4	37	c.2402	CCDS11898.1	18	.	.	.	.	.	.	.	.	.	.	C	25.9	4.683265	0.88542	.	.	ENSG00000134757	ENST00000257189	T	0.79554	-1.28	5.78	5.78	0.91487	Cadherin, cytoplasmic domain (1);	0.299113	0.23951	N	0.042954	D	0.85788	0.5778	M	0.80982	2.52	0.44247	D	0.997099	P	0.51057	0.941	P	0.46850	0.529	D	0.87030	0.2134	10	0.56958	D	0.05	.	20.0027	0.97425	0.0:1.0:0.0:0.0	.	801	P32926	DSG3_HUMAN	V	801	ENSP00000257189:A801V	ENSP00000257189:A801V	A	+	2	0	DSG3	27309623	1.000000	0.71417	0.991000	0.47740	0.883000	0.51084	5.677000	0.68142	2.733000	0.93635	0.655000	0.94253	GCG	DSG3	-	pfam_Cadherin_cytoplasmic-dom,prints_Desmoglein	ENSG00000134757		0.428	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG3	HGNC	protein_coding	OTTHUMT00000254949.1	51	0.00	0	C	NM_001944		29055625	29055625	+1	no_errors	ENST00000257189	ensembl	human	known	69_37n	missense	24	42.86	18	SNP	0.993	T
ECM1	1893	genome.wustl.edu	37	1	150483102	150483102	+	Intron	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:150483102G>A	ENST00000369047.4	+	6	510				ECM1_ENST00000369049.4_Intron|ECM1_ENST00000346569.6_Intron|ECM1_ENST00000470432.1_3'UTR	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1						angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CTGGGGAGAGGAGCAGGAAGC	0.532																																					Melanoma(156;1696 2560 11093 19685)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.386-250G>A	1.37:g.150483102G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	RNA	SNP	-	NULL	ENST00000369047.4	37	NULL	CCDS953.1	1																																																																																			ECM1	-	-	ENSG00000143369		0.532	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	ECM1	HGNC	protein_coding	OTTHUMT00000035832.2	22	0.00	0	G	NM_004425		150483102	150483102	+1	no_errors	ENST00000470432	ensembl	human	known	69_37n	rna	18	21.74	5	SNP	0.000	A
ERBB2IP	55914	genome.wustl.edu	37	5	65288560	65288560	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr5:65288560G>A	ENST00000284037.5	+	3	403	c.14G>A	c.(13-15)cGa>cAa	p.R5Q	ERBB2IP_ENST00000508515.1_Missense_Mutation_p.R5Q|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.R5Q|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.R5Q|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.R5Q|ERBB2IP_ENST00000380935.1_Missense_Mutation_p.R5Q|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.R5Q|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.R5Q|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.R5Q|ERBB2IP_ENST00000416865.2_Missense_Mutation_p.R5Q	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	5					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		ACTACAAAACGAAGTTTGTTT	0.363																																						dbGAP											0													131.0	130.0	130.0					5																	65288560		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.14G>A	5.37:g.65288560G>A	ENSP00000284037:p.Arg5Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.R5Q	ENST00000284037.5	37	c.14	CCDS58953.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.599092	0.96614	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000416865;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	T;T;T;T;T;T;T;T;T;T	0.56103	0.69;0.69;1.31;0.71;0.9;0.48;0.83;0.67;0.74;0.48	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.63438	0.2511	N	0.25647	0.755	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D;D	0.91635	0.992;0.998;0.996;0.996;0.99;0.992;0.999;0.993	T	0.67803	-0.5576	10	0.87932	D	0	.	19.0642	0.93103	0.0:0.0:1.0:0.0	.	5;5;5;5;5;5;5;5	B4DIP2;Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-7;Q96RT1-2	.;.;.;.;.;LAP2_HUMAN;.;.	Q	5	ENSP00000284037:R5Q;ENSP00000370330:R5Q;ENSP00000397833:R5Q;ENSP00000370326:R5Q;ENSP00000370323:R5Q;ENSP00000370322:R5Q;ENSP00000370325:R5Q;ENSP00000422766:R5Q;ENSP00000426632:R5Q;ENSP00000422015:R5Q	ENSP00000284037:R5Q	R	+	2	0	ERBB2IP	65324316	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.494000	0.84150	0.655000	0.94253	CGA	ERBB2IP	-	NULL	ENSG00000112851		0.363	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	ERBB2IP	HGNC	protein_coding	OTTHUMT00000215070.1	52	0.00	0	G	NM_018695		65288560	65288560	+1	no_errors	ENST00000284037	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	1.000	A
ESPNP	284729	genome.wustl.edu	37	1	17017675	17017675	+	RNA	SNP	C	C	A	rs2743471	byFrequency	TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:17017675C>A	ENST00000492551.1	-	0	2015					NR_026567.1				espin pseudogene																		CAGTCAAGACCCGCTGCCAGG	0.657																																						dbGAP											0																																										-	-	-			0			AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17017675C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			RP1-163M9.6	-	-	ENSG00000239644		0.657	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	Clone_based_vega_gene	pseudogene	OTTHUMT00000326311.1	102	0.97	1	C			17017675	17017675	-1	no_errors	ENST00000414828	ensembl	human	putative	69_37n	rna	52	10.34	6	SNP	0.003	A
ETAA1	54465	genome.wustl.edu	37	2	67631369	67631369	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr2:67631369G>A	ENST00000272342.5	+	5	1685	c.1555G>A	c.(1555-1557)Gaa>Aaa	p.E519K	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	519						cytoplasm (GO:0005737)		p.E519Q(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						TGAAGCTTCTGAAAGGAAGTC	0.294																																						dbGAP											1	Substitution - Missense(1)	lung(1)											31.0	34.0	33.0					2																	67631369		2197	4297	6494	-	-	-	SO:0001583	missense	0			AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.1555G>A	2.37:g.67631369G>A	ENSP00000272342:p.Glu519Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05BT7|Q53SC4	Missense_Mutation	SNP	NULL	p.E519K	ENST00000272342.5	37	c.1555	CCDS1882.1	2	.	.	.	.	.	.	.	.	.	.	G	0.624	-0.819995	0.02755	.	.	ENSG00000143971	ENST00000272342	T	0.18338	2.22	5.51	4.62	0.57501	.	0.913543	0.09540	N	0.788368	T	0.16128	0.0388	L	0.57536	1.79	0.35219	D	0.775828	B	0.11235	0.004	B	0.12837	0.008	T	0.20974	-1.0259	10	0.07813	T	0.8	-29.7296	6.9824	0.24709	0.1502:0.1534:0.6964:0.0	.	519	Q9NY74	ETAA1_HUMAN	K	519	ENSP00000272342:E519K	ENSP00000272342:E519K	E	+	1	0	ETAA1	67484873	0.987000	0.35691	0.988000	0.46212	0.095000	0.18619	2.922000	0.48860	1.291000	0.44653	0.655000	0.94253	GAA	ETAA1	-	NULL	ENSG00000143971		0.294	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETAA1	HGNC	protein_coding	OTTHUMT00000251735.1	30	0.00	0	G	NM_019002		67631369	67631369	+1	no_errors	ENST00000272342	ensembl	human	known	69_37n	missense	10	56.52	13	SNP	0.889	A
EXD2	55218	genome.wustl.edu	37	14	69695782	69695782	+	Silent	SNP	C	C	A	rs142445480	byFrequency	TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr14:69695782C>A	ENST00000409018.3	+	3	711	c.583C>A	c.(583-585)Cgg>Agg	p.R195R	EXD2_ENST00000312994.5_Silent_p.R195R|EXD2_ENST00000409675.1_Silent_p.R70R|EXD2_ENST00000492815.1_3'UTR|EXD2_ENST00000409949.1_Silent_p.R70R|EXD2_ENST00000409242.1_Silent_p.R70R|EXD2_ENST00000409014.1_Silent_p.R70R|EXD2_ENST00000449989.1_Silent_p.R70R	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	195	3'-5' exonuclease.						3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						CCTAGCCATGCGGCAGAGGTG	0.493																																						dbGAP											0													99.0	99.0	99.0					14																	69695782		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.583C>A	14.37:g.69695782C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIH6|G5E947|Q6AWB6|Q8N3D3	Silent	SNP	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.R195	ENST00000409018.3	37	c.583	CCDS53902.1	14																																																																																			EXD2	-	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	ENSG00000081177		0.493	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	EXD2	HGNC	protein_coding	OTTHUMT00000335504.1	56	0.00	0	C			69695782	69695782	+1	no_errors	ENST00000312994	ensembl	human	known	69_37n	silent	35	12.50	5	SNP	1.000	A
EXOC2	55770	genome.wustl.edu	37	6	629855	629856	+	Frame_Shift_Ins	INS	-	-	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr6:629855_629856insG	ENST00000230449.4	-	4	536_537	c.401_402insC	c.(400-402)ccgfs	p.P134fs	EXOC2_ENST00000448181.3_Intron	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	134					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		CAATGCCAAGCGGGTTAGCAGG	0.401																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.402dupC	6.37:g.629858_629858dupG	ENSP00000230449:p.Pro134fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Frame_Shift_Ins	INS	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,superfamily_Cullin_repeat-like_dom	p.L135fs	ENST00000230449.4	37	c.402_401	CCDS34327.1	6																																																																																			EXOC2	-	NULL	ENSG00000112685		0.401	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC2	HGNC	protein_coding	OTTHUMT00000039627.1	58	0.00	0	-	NM_018303		629855	629856	-1	no_errors	ENST00000230449	ensembl	human	known	69_37n	frame_shift_ins	35	16.67	7	INS	0.001:1.000	G
FGF16	8823	genome.wustl.edu	37	X	76711932	76711932	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chrX:76711932G>A	ENST00000439435.1	+	2	269	c.269G>A	c.(268-270)aGa>aAa	p.R90K				O43320	FGF16_HUMAN	fibroblast growth factor 16	0					cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of brown fat cell proliferation (GO:0070349)|response to temperature stimulus (GO:0009266)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)			NS(1)|breast(1)|lung(2)	4						AACGACACCAGAAATTCACTC	0.488																																						dbGAP											0													102.0	100.0	101.0					X																	76711932		1909	4114	6023	-	-	-	SO:0001583	missense	0			AB009391	CCDS75996.1	Xq21.1	2014-01-31			ENSG00000196468	ENSG00000196468			3672	protein-coding gene	gene with protein product		300827	"""metacarpal 4-5 fusion"""	MF4		9473496, 11474196, 23709756	Standard	NM_003868		Approved		uc011mqp.2	O43320	OTTHUMG00000013133	ENST00000439435.1:c.269G>A	X.37:g.76711932G>A	ENSP00000399324:p.Arg90Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF,prints_GF_heparin-bd	p.R90K	ENST00000439435.1	37	c.269		X	.	.	.	.	.	.	.	.	.	.	G	4.217	0.039138	0.08148	.	.	ENSG00000196468	ENST00000439435	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	T	0.73976	0.3656	.	.	.	0.30974	N	0.7227589999999999	.	.	.	.	.	.	T	0.73681	-0.3906	3	.	.	.	.	17.774	0.88502	0.0:0.0:1.0:0.0	.	.	.	.	K	90	.	.	R	+	2	0	FGF16	76598588	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.642000	0.61383	2.128000	0.65567	0.600000	0.82982	AGA	FGF16	-	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF	ENSG00000196468		0.488	FGF16-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	FGF16	HGNC	protein_coding	OTTHUMT00000036814.1	35	0.00	0	G	NM_003868		76711932	76711932	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000439435	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	1.000	A
FILIP1	27145	genome.wustl.edu	37	6	76072536	76072536	+	Missense_Mutation	SNP	C	C	A	rs373336897		TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr6:76072536C>A	ENST00000237172.7	-	3	704	c.374G>T	c.(373-375)cGg>cTg	p.R125L	FILIP1_ENST00000393004.2_Missense_Mutation_p.R125L|RP11-415D17.3_ENST00000588761.1_RNA|RP11-415D17.3_ENST00000440220.1_RNA|RP11-415D17.3_ENST00000419709.1_RNA|RP11-415D17.3_ENST00000415457.2_RNA|RP11-415D17.3_ENST00000609544.1_RNA|FILIP1_ENST00000370020.1_Missense_Mutation_p.R26L|RP11-415D17.3_ENST00000591821.2_RNA	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	125										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						GTGCAGGACCCGCAGCACTTT	0.498																																						dbGAP											0													121.0	121.0	121.0					6																	76072536		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.374G>T	6.37:g.76072536C>A	ENSP00000237172:p.Arg125Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,prints_Tropomyosin	p.R125L	ENST00000237172.7	37	c.374	CCDS4984.1	6	.	.	.	.	.	.	.	.	.	.	C	15.85	2.954121	0.53293	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.41065	1.01;1.01;1.01	5.99	5.99	0.97316	Cortactin-binding protein-2, N-terminal (1);	0.063366	0.64402	D	0.000003	T	0.14313	0.0346	N	0.11064	0.09	0.24359	N	0.994881	P;P;B	0.40794	0.579;0.729;0.429	B;B;B	0.41374	0.219;0.355;0.242	T	0.09228	-1.0684	10	0.27082	T	0.32	-15.9523	14.6024	0.68450	0.0:0.931:0.0:0.069	.	125;125;125	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	L	125;125;26	ENSP00000376728:R125L;ENSP00000237172:R125L;ENSP00000359037:R26L	ENSP00000237172:R125L	R	-	2	0	FILIP1	76129256	1.000000	0.71417	0.146000	0.22360	0.789000	0.44602	3.848000	0.55903	2.840000	0.97914	0.655000	0.94253	CGG	FILIP1	-	pfam_Cortactin-binding_p2_N	ENSG00000118407		0.498	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FILIP1	HGNC	protein_coding	OTTHUMT00000041263.1	63	0.00	0	C	XM_029179		76072536	76072536	-1	no_errors	ENST00000237172	ensembl	human	known	69_37n	missense	50	12.28	7	SNP	0.272	A
FOXA1	3169	genome.wustl.edu	37	14	38061240	38061240	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr14:38061240G>A	ENST00000250448.2	-	2	810	c.749C>T	c.(748-750)tCc>tTc	p.S250F	FOXA1_ENST00000540786.1_Missense_Mutation_p.S217F|FOXA1_ENST00000545425.2_5'UTR	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	250					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		CATGTTGCCGGAGTCCGGGTG	0.677																																						dbGAP											0													29.0	28.0	29.0					14																	38061240		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.749C>T	14.37:g.38061240G>A	ENSP00000250448:p.Ser250Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S250F	ENST00000250448.2	37	c.749	CCDS9665.1	14	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480686	0.84747	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	D;D	0.95788	-3.81;-3.81	3.88	3.88	0.44766	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	D	0.000000	D	0.96269	0.8783	L	0.42632	1.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96852	0.9626	10	0.87932	D	0	.	14.7467	0.69494	0.0:0.0:1.0:0.0	.	250	P55317	FOXA1_HUMAN	F	250;217	ENSP00000250448:S250F;ENSP00000440178:S217F	ENSP00000250448:S250F	S	-	2	0	FOXA1	37130991	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.596000	0.82721	1.996000	0.58369	0.400000	0.26472	TCC	FOXA1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000129514		0.677	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	39	0.00	0	G			38061240	38061240	-1	no_errors	ENST00000250448	ensembl	human	known	69_37n	missense	28	35.56	16	SNP	1.000	A
FRG1B	284802	genome.wustl.edu	37	20	29614296	29614297	+	5'UTR	INS	-	-	AGA	rs376619640		TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr20:29614296_29614297insAGA	ENST00000278882.3	+	0	289_290				FRG1B_ENST00000358464.4_5'UTR|FRG1B_ENST00000439954.2_5'UTR			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						aagagaaaaagagaagatgaag	0.292																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-91->AGA	20.37:g.29614300_29614302dupAGA		Somatic		WXS	Illumina GAIIx	Phase_IV	C4AME5	RNA	INS	-	NULL	ENST00000278882.3	37	NULL		20																																																																																			FRG1B	-	-	ENSG00000149531		0.292	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	33	0.00	0	-	NR_003579		29614296	29614297	+1	no_errors	ENST00000482423	ensembl	human	known	69_37n	rna	27	20.59	7	INS	0.998:0.997	AGA
FRYL	285527	genome.wustl.edu	37	4	48512870	48512870	+	Silent	SNP	G	G	C			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr4:48512870G>C	ENST00000503238.1	-	55	8276	c.8277C>G	c.(8275-8277)gtC>gtG	p.V2759V	FRYL_ENST00000507873.2_Silent_p.V155V|FRYL_ENST00000264319.7_Silent_p.V155V|FRYL_ENST00000358350.4_Silent_p.V2759V|FRYL_ENST00000537810.1_Silent_p.V2759V			O94915	FRYL_HUMAN	FRY-like	2759					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						CATCCACAAAGACTGTTGGGC	0.373																																						dbGAP											0													121.0	112.0	115.0					4																	48512870		1873	4098	5971	-	-	-	SO:0001819	synonymous_variant	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.8277C>G	4.37:g.48512870G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O95640|Q8WTZ5|Q9NT40	Silent	SNP	superfamily_ARM-type_fold	p.V2759	ENST00000503238.1	37	c.8277	CCDS43227.1	4																																																																																			FRYL	-	NULL	ENSG00000075539		0.373	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	57	0.00	0	G			48512870	48512870	-1	no_errors	ENST00000358350	ensembl	human	known	69_37n	silent	25	21.88	7	SNP	1.000	C
GABPA	2551	genome.wustl.edu	37	21	27107738	27107738	+	5'UTR	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr21:27107738G>A	ENST00000400075.3	+	0	44				ATP5J_ENST00000400099.1_5'Flank|ATP5J_ENST00000400094.1_5'Flank|GABPA_ENST00000487266.1_3'UTR|GABPA_ENST00000354828.3_Intron|ATP5J_ENST00000457143.2_5'Flank|ATP5J_ENST00000400090.3_Intron|ATP5J_ENST00000284971.3_5'Flank|ATP5J_ENST00000400087.3_5'UTR|ATP5J_ENST00000400093.3_5'UTR	NM_002040.3	NP_002031.2	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha subunit 60kDa						cell differentiation (GO:0030154)|in utero embryonic development (GO:0001701)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	24						TCTCAGCGCCGATTCCGCGGG	0.682																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS13575.1	21q21-q22.1	2008-07-31	2002-08-29		ENSG00000154727	ENSG00000154727			4071	protein-coding gene	gene with protein product	"""human nuclear respiratory factor-2 subunit alpha"", ""nuclear respiratory factor 2 alpha subunit"""	600609	"""GA-binding protein transcription factor, alpha subunit (60kD)"""			8441384	Standard	NM_002040		Approved	E4TF1A, NFT2, NRF2, E4TF1-60, NRF2A	uc002yly.4	Q06546	OTTHUMG00000078443	ENST00000400075.3:c.-178G>A	21.37:g.27107738G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q12939	RNA	SNP	-	NULL	ENST00000400075.3	37	NULL	CCDS13575.1	21																																																																																			GABPA	-	-	ENSG00000154727		0.682	GABPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABPA	HGNC	protein_coding	OTTHUMT00000171364.1	49	0.00	0	G	NM_002040		27107738	27107738	+1	no_errors	ENST00000487266	ensembl	human	putative	69_37n	rna	37	19.57	9	SNP	1.000	A
GOLGA2	2801	genome.wustl.edu	37	9	131020796	131020798	+	In_Frame_Del	DEL	CCT	CCT	-	rs201018639|rs556715333|rs112603354	byFrequency	TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	CCT	CCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr9:131020796_131020798delCCT	ENST00000421699.2	-	21	2156_2158	c.2144_2146delAGG	c.(2143-2148)gaggcg>gcg	p.E715del	GOLGA2_ENST00000609374.1_In_Frame_Del_p.E703del|AL590708.1_ENST00000408370.1_RNA	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	715	Poly-Glu.				mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						ACTGCCACCGcctcctcctcctc	0.635														1316	0.26278	0.4508	0.1844	5008	,	,		10190	0.2887		0.1034	False		,,,				2504	0.2014					dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.2144_2146delAGG	9.37:g.131020805_131020807delCCT	ENSP00000416097:p.Glu715del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GRM9|Q9BRB0|Q9NYF9	In_Frame_Del	DEL	superfamily_CofA_tubulin-bd	p.E715in_frame_del	ENST00000421699.2	37	c.2146_2144	CCDS6896.2	9																																																																																			GOLGA2	-	NULL	ENSG00000167110		0.635	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA2	HGNC	protein_coding	OTTHUMT00000054358.2	19	0.00	0	CCT	NM_004486		131020796	131020798	-1	no_errors	ENST00000421699	ensembl	human	known	69_37n	in_frame_del	20	20.00	5	DEL	0.000:0.000:0.004	-
GRHL2	79977	genome.wustl.edu	37	8	102555524	102555524	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr8:102555524C>T	ENST00000251808.3	+	2	414	c.76C>T	c.(76-78)Cga>Tga	p.R26*	GRHL2_ENST00000395927.1_Nonsense_Mutation_p.R10*	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	26	Transcription activation.				brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R26R(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			ATTCAATACCCGAAGAGCCTA	0.468																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											135.0	130.0	132.0					8																	102555524		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.76C>T	8.37:g.102555524C>T	ENSP00000251808:p.Arg26*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L303|Q6NT03|Q9H8B8	Nonsense_Mutation	SNP	pfam_CP2	p.R26*	ENST00000251808.3	37	c.76	CCDS34931.1	8	.	.	.	.	.	.	.	.	.	.	C	39	7.365655	0.98238	.	.	ENSG00000083307	ENST00000251808;ENST00000395927;ENST00000395928	.	.	.	5.96	5.08	0.68730	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.8001	14.4062	0.67083	0.3213:0.6787:0.0:0.0	.	.	.	.	X	26;10;26	.	ENSP00000251808:R26X	R	+	1	2	GRHL2	102624700	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.996000	0.40776	1.499000	0.48617	0.655000	0.94253	CGA	GRHL2	-	NULL	ENSG00000083307		0.468	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHL2	HGNC	protein_coding	OTTHUMT00000313882.1	37	0.00	0	C	NM_024915		102555524	102555524	+1	no_errors	ENST00000251808	ensembl	human	known	69_37n	nonsense	38	28.30	15	SNP	1.000	T
HADHA	3030	genome.wustl.edu	37	2	26424084	26424084	+	Missense_Mutation	SNP	G	G	C	rs11552520		TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr2:26424084G>C	ENST00000380649.3	-	13	1455	c.1326C>G	c.(1324-1326)gaC>gaG	p.D442E		NM_000182.4	NP_000173.2	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit	442					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			autonomic_ganglia(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(4)|skin(1)	30	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAATCACCATGTCGGCCTTTT	0.433																																						dbGAP											0													92.0	82.0	86.0					2																	26424084		2203	4300	6503	-	-	-	SO:0001583	missense	0			D16480	CCDS1721.1	2p23	2014-09-17	2010-04-30		ENSG00000084754	ENSG00000084754	1.1.1.211, 4.2.1.17		4801	protein-coding gene	gene with protein product	"""gastrin-binding protein"", ""long-chain-3-hydroxyacyl-CoA dehydrogenase"", ""long-chain 2-enoyl-CoA hydratase"", ""mitochondrial trifunctional protein, alpha subunit"""	600890	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit"""			9605857, 7918661	Standard	NM_000182		Approved	GBP, LCEH, LCHAD, MTPA	uc002rgy.3	P40939	OTTHUMG00000096979	ENST00000380649.3:c.1326C>G	2.37:g.26424084G>C	ENSP00000370023:p.Asp442Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	pfam_Crotonase_core,pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like,tigrfam_Fa_ox_alpha_mit	p.D442E	ENST00000380649.3	37	c.1326	CCDS1721.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.156760	0.94686	.	.	ENSG00000084754	ENST00000380649	D	0.81908	-1.55	5.43	5.43	0.79202	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.91707	0.7378	M	0.84948	2.725	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.67382	0.951;0.951	D	0.92831	0.6280	10	0.87932	D	0	-10.8293	17.8231	0.88656	0.0:0.0:1.0:0.0	.	442;442	E9KL44;P40939	.;ECHA_HUMAN	E	442	ENSP00000370023:D442E	ENSP00000370023:D442E	D	-	3	2	HADHA	26277588	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.882000	0.87258	2.557000	0.86248	0.655000	0.94253	GAC	HADHA	-	pfam_3-OHacyl-CoA_DH_NAD-bd,tigrfam_Fa_ox_alpha_mit	ENSG00000084754		0.433	HADHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HADHA	HGNC	protein_coding	OTTHUMT00000214051.1	38	0.00	0	G	NM_000182		26424084	26424084	-1	no_errors	ENST00000380649	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	C
IFNA10	3446	genome.wustl.edu	37	9	21206973	21206973	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr9:21206973C>T	ENST00000357374.2	-	1	169	c.124G>A	c.(124-126)Gga>Aga	p.G42R		NM_002171.1	NP_002162.1	P01566	IFN10_HUMAN	interferon, alpha 10	42			G -> A (in dbSNP:rs2230853).		adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			endometrium(1)|large_intestine(3)|liver(1)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	16				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		CCCATTTGTCCCAGGAGTATC	0.522																																						dbGAP											0													92.0	99.0	96.0					9																	21206973		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6499.1	9p22	2010-08-24			ENSG00000186803	ENSG00000186803		"""Interferons"""	5418	protein-coding gene	gene with protein product		147577				1385305	Standard	NM_002171		Approved	IFN-alphaC	uc003zoq.1	P01566	OTTHUMG00000019658	ENST00000357374.2:c.124G>A	9.37:g.21206973C>T	ENSP00000369566:p.Gly42Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VV13	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.G42R	ENST00000357374.2	37	c.124	CCDS6499.1	9	.	.	.	.	.	.	.	.	.	.	-	6.169	0.399306	0.11696	.	.	ENSG00000186803	ENST00000357374	T	0.05717	3.4	3.65	-0.708	0.11241	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.761996	0.12212	N	0.489217	T	0.03695	0.0105	N	0.25031	0.7	0.09310	N	1	B	0.06786	0.001	B	0.15870	0.014	T	0.43393	-0.9394	10	0.29301	T	0.29	.	3.5112	0.07709	0.1806:0.4752:0.0:0.3442	.	42	P01566	IFN10_HUMAN	R	42	ENSP00000369566:G42R	ENSP00000369566:G42R	G	-	1	0	IFNA10	21196973	0.000000	0.05858	0.001000	0.08648	0.037000	0.13140	-3.276000	0.00530	-0.110000	0.12022	0.499000	0.49734	GGA	IFNA10	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core	ENSG00000186803		0.522	IFNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA10	HGNC	protein_coding	OTTHUMT00000051887.1	102	0.97	1	C	NM_002171		21206973	21206973	-1	no_errors	ENST00000357374	ensembl	human	known	69_37n	missense	67	11.84	9	SNP	0.008	T
IGHG3	3502	genome.wustl.edu	37	14	106236232	106236232	+	RNA	SNP	G	G	A	rs587607987		TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr14:106236232G>A	ENST00000390551.2	-	0	571							P01860	IGHG3_HUMAN	immunoglobulin heavy constant gamma 3 (G3m marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)										CCACCACCACGCACGTGACCT	0.597													.|||	1	0.000199681	0.0	0.0014	5008	,	,		14461	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0			M12958		14q32.33	2012-10-02			ENSG00000211897	ENSG00000211897		"""Immunoglobulins / IGH locus"""	5527	other	immunoglobulin gene		147120				6808505	Standard	NG_001019		Approved			P01860	OTTHUMG00000152539		14.37:g.106236232G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2NU35	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.A191V	ENST00000390551.2	37	c.572		14																																																																																			IGHG3	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000211897		0.597	IGHG3-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHG3	HGNC	IG_C_gene	OTTHUMT00000326654.1	70	0.00	0	G	NG_001019		106236232	106236232	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390551	ensembl	human	known	69_37n	missense	38	29.63	16	SNP	0.633	A
ITGA8	8516	genome.wustl.edu	37	10	15697406	15697406	+	Splice_Site	SNP	C	C	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr10:15697406C>G	ENST00000378076.3	-	11	1302		c.e11-1			NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8						brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						AAGATGCCATCTGCAAAGGAA	0.333																																						dbGAP											0													133.0	126.0	129.0					10																	15697406		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.949-1G>C	10.37:g.15697406C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ31|Q5VX94	Splice_Site	SNP	-	e11-1	ENST00000378076.3	37	c.949-1	CCDS31155.1	10	.	.	.	.	.	.	.	.	.	.	C	23.7	4.447094	0.84101	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3789	0.98926	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ITGA8	15737412	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	7.625000	0.83145	2.826000	0.97356	0.563000	0.77884	.	ITGA8	-	-	ENSG00000077943		0.333	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	HGNC	protein_coding	OTTHUMT00000046987.1	21	0.00	0	C	NM_003638	Intron	15697406	15697406	-1	no_errors	ENST00000378076	ensembl	human	known	69_37n	splice_site	14	36.36	8	SNP	1.000	G
KALRN	8997	genome.wustl.edu	37	3	124181439	124181439	+	Silent	SNP	C	C	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr3:124181439C>A	ENST00000240874.3	+	25	4141	c.3984C>A	c.(3982-3984)atC>atA	p.I1328I	KALRN_ENST00000360013.3_Silent_p.I1328I|KALRN_ENST00000460856.1_Silent_p.I1319I	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1328	DH 1. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						AAGAGCATATCATCTTTGGCA	0.473																																						dbGAP											0													92.0	84.0	86.0					3																	124181439		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.3984C>A	3.37:g.124181439C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.S1297*	ENST00000240874.3	37	c.3890	CCDS3027.1	3	.	.	.	.	.	.	.	.	.	.	C	10.19	1.281667	0.23392	.	.	ENSG00000160145	ENST00000354186	.	.	.	5.19	5.19	0.71726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6155	0.68544	0.1461:0.8539:0.0:0.0	.	.	.	.	X	1297	.	.	S	+	2	0	KALRN	125664129	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.005000	0.40864	2.709000	0.92574	0.655000	0.94253	TCA	KALRN	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000160145		0.473	KALRN-005	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000258843.4	21	0.00	0	C	NM_003947		124181439	124181439	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000354186	ensembl	human	novel	69_37n	nonsense	15	28.57	6	SNP	1.000	A
KIF26B	55083	genome.wustl.edu	37	1	245530510	245530510	+	Silent	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:245530510G>A	ENST00000407071.2	+	3	1280	c.840G>A	c.(838-840)aaG>aaA	p.K280K	KIF26B_ENST00000479506.1_3'UTR	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	280					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CGGAAAAGAAGAGCGGGTCCC	0.612																																						dbGAP											0													32.0	44.0	40.0					1																	245530510		2019	4173	6192	-	-	-	SO:0001819	synonymous_variant	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.840G>A	1.37:g.245530510G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.K280	ENST00000407071.2	37	c.840	CCDS44342.1	1																																																																																			KIF26B	-	NULL	ENSG00000162849		0.612	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	64	0.00	0	G	XM_371354		245530510	245530510	+1	no_errors	ENST00000407071	ensembl	human	known	69_37n	silent	33	23.26	10	SNP	1.000	A
KSR2	283455	genome.wustl.edu	37	12	118199253	118199253	+	Silent	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr12:118199253G>A	ENST00000339824.5	-	4	1276	c.549C>T	c.(547-549)tgC>tgT	p.C183C	KSR2_ENST00000425217.1_Silent_p.C154C			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	183	Pro-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCTCCGGGGGGCACACGGGAT	0.622																																						dbGAP											0													52.0	54.0	54.0					12																	118199253		1941	4132	6073	-	-	-	SO:0001819	synonymous_variant	0			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.549C>T	12.37:g.118199253G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJT2|Q3B828|Q8N775	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.C183	ENST00000339824.5	37	c.549		12																																																																																			KSR2	-	NULL	ENSG00000171435		0.622	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	HGNC	protein_coding	OTTHUMT00000401987.2	28	0.00	0	G	NM_173598		118199253	118199253	-1	no_errors	ENST00000339824	ensembl	human	known	69_37n	silent	28	26.32	10	SNP	1.000	A
LACTBL1	646262	genome.wustl.edu	37	1	23285349	23285349	+	Missense_Mutation	SNP	C	C	T	rs552142459	byFrequency	TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:23285349C>T	ENST00000426928.2	-	4	381	c.382G>A	c.(382-384)Gtg>Atg	p.V128M				A8MY62	BLML_HUMAN	lactamase, beta-like 1	99																	AGGGAGGCCACGATGCCCTCC	0.562													C|||	2	0.000399361	0.0015	0.0	5008	,	,		21486	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0					1p36.12	2010-07-20			ENSG00000215906	ENSG00000215906			35445	protein-coding gene	gene with protein product							Standard	XM_003846622		Approved			A8MY62	OTTHUMG00000003228	ENST00000426928.2:c.382G>A	1.37:g.23285349C>T	ENSP00000402297:p.Val128Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Beta-lactam-related,superfamily_Beta-lactam/transpept-like	p.S116	ENST00000426928.2	37	c.348		1																																																																																			LACTBL1	-	pfam_Beta-lactam-related,superfamily_Beta-lactam/transpept-like	ENSG00000215906		0.562	LACTBL1-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LACTBL1	HGNC	protein_coding	OTTHUMT00000008903.4	28	0.00	0	C	XM_002342035.1		23285349	23285349	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426928	ensembl	human	putative	69_37n	silent	7	46.15	6	SNP	0.981	T
LCE5A	254910	genome.wustl.edu	37	1	152484086	152484086	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:152484086C>A	ENST00000334269.2	+	2	252	c.76C>A	c.(76-78)Cct>Act	p.P26T	CRCT1_ENST00000368790.3_5'Flank	NM_178438.4	NP_848525.1	Q5TCM9	LCE5A_HUMAN	late cornified envelope 5A	26	Cys-rich.				keratinization (GO:0031424)					lung(3)|ovary(1)|prostate(3)	7	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			caagtgtactcctaagtgtcc	0.572																																						dbGAP											0													94.0	87.0	90.0					1																	152484086		2203	4300	6503	-	-	-	SO:0001583	missense	0			BI670518	CCDS1011.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000186207	ENSG00000186207		"""Late cornified envelopes"""	16614	protein-coding gene	gene with protein product		612619	"""small proline rich-like (epidermal differentiation complex) 5A"""	SPRL5A		11698679	Standard	NM_178438		Approved	LEP18	uc001ezy.3	Q5TCM9	OTTHUMG00000014401	ENST00000334269.2:c.76C>A	1.37:g.152484086C>A	ENSP00000333952:p.Pro26Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.P26T	ENST00000334269.2	37	c.76	CCDS1011.1	1	.	.	.	.	.	.	.	.	.	.	C	0.413	-0.912349	0.02415	.	.	ENSG00000186207	ENST00000334269	T	0.05025	3.51	3.99	1.32	0.21799	.	.	.	.	.	T	0.05777	0.0151	M	0.87547	2.89	0.09310	N	1	P	0.46512	0.879	P	0.45538	0.484	T	0.15896	-1.0421	9	0.87932	D	0	.	5.8789	0.18844	0.0:0.674:0.0:0.326	.	26	Q5TCM9	LCE5A_HUMAN	T	26	ENSP00000333952:P26T	ENSP00000333952:P26T	P	+	1	0	LCE5A	150750710	0.000000	0.05858	0.000000	0.03702	0.119000	0.20118	-0.013000	0.12678	0.187000	0.20147	0.603000	0.83216	CCT	LCE5A	-	NULL	ENSG00000186207		0.572	LCE5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE5A	HGNC	protein_coding	OTTHUMT00000040059.1	66	0.00	0	C	NM_178438		152484086	152484086	+1	no_errors	ENST00000334269	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	0.000	A
KMT2C	58508	genome.wustl.edu	37	7	151945576	151945577	+	Frame_Shift_Ins	INS	-	-	AAAA			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr7:151945576_151945577insAAAA	ENST00000262189.6	-	14	2160_2161	c.1942_1943insTTTT	c.(1942-1944)gaafs	p.E648fs	KMT2C_ENST00000355193.2_Frame_Shift_Ins_p.E648fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	648					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTCTGTCACTTCCATTTTATCT	0.376																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1942_1943insTTTT	7.37:g.151945576_151945577insAAAA	ENSP00000262189:p.Glu648fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Ins	INS	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E648fs	ENST00000262189.6	37	c.1943_1942	CCDS5931.1	7																																																																																			MLL3	-	NULL	ENSG00000055609		0.376	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	41	0.00	0	-			151945576	151945577	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	frame_shift_ins	21	27.59	8	INS	1.000:1.000	AAAA
MLLT10	8028	genome.wustl.edu	37	10	21903799	21903799	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr10:21903799T>G	ENST00000307729.7	+	7	727	c.549T>G	c.(547-549)aaT>aaG	p.N183K	MLLT10_ENST00000446906.2_Missense_Mutation_p.N183K|MLLT10_ENST00000377072.3_Missense_Mutation_p.N183K|MLLT10_ENST00000377059.3_Missense_Mutation_p.N183K			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	183	Interaction with FSTL3.|Self-association.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						AAGAAGGTAATGGTGCCGATA	0.328			T	"""MLL, PICALM, CDK6"""	AL																																	dbGAP		Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	0													152.0	151.0	151.0					10																	21903799		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.549T>G	10.37:g.21903799T>G	ENSP00000307411:p.Asn183Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANA8|Q5JT37|Q5VX90|Q66K63	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.N183K	ENST00000307729.7	37	c.549	CCDS55708.1	10	.	.	.	.	.	.	.	.	.	.	T	15.79	2.936729	0.52972	.	.	ENSG00000078403	ENST00000377072;ENST00000446906;ENST00000307729;ENST00000396529;ENST00000377059	T;T;T;T	0.13420	2.59;2.59;2.59;2.59	5.3	5.3	0.74995	Zinc finger, PHD-finger (1);Zinc finger, PHD-type (1);	0.386513	0.29707	N	0.011416	T	0.28699	0.0711	M	0.70903	2.155	0.44995	D	0.998012	D;D;D	0.69078	0.961;0.997;0.961	P;P;P	0.62740	0.841;0.906;0.841	T	0.17715	-1.0360	10	0.06099	T	0.92	.	13.81	0.63256	0.0:0.0:0.0:1.0	.	183;183;183	E9PBP4;Q5VX90;P55197	.;.;AF10_HUMAN	K	183;183;183;29;183	ENSP00000366272:N183K;ENSP00000401406:N183K;ENSP00000307411:N183K;ENSP00000366258:N183K	ENSP00000307411:N183K	N	+	3	2	MLLT10	21943805	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.235000	0.32671	2.006000	0.58801	0.460000	0.39030	AAT	MLLT10	-	smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000078403		0.328	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT10	HGNC	protein_coding	OTTHUMT00000047136.1	57	0.00	0	T			21903799	21903799	+1	no_errors	ENST00000307729	ensembl	human	known	69_37n	missense	34	43.33	26	SNP	1.000	G
TRIM46	80128	genome.wustl.edu	37	1	155159223	155159223	+	IGR	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:155159223C>T	ENST00000334634.4	+	0	3061				MUC1_ENST00000368392.3_Intron|MUC1_ENST00000343256.5_Intron|MUC1_ENST00000337604.5_Intron|MUC1_ENST00000438413.1_Intron|MUC1_ENST00000457295.2_3'UTR|MUC1_ENST00000462215.1_Intron|MUC1_ENST00000368395.1_Intron|MUC1_ENST00000338684.5_Intron|MUC1_ENST00000368398.3_Intron|MUC1_ENST00000368393.3_Intron|MUC1_ENST00000368396.4_Intron|MUC1_ENST00000368389.2_Intron|RP11-201K10.3_ENST00000473363.2_Intron|MUC1_ENST00000342482.4_Intron|MUC1_ENST00000368390.3_Intron	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46							intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCTGACACTTCTTCTTCTACC	0.567																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0				CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680		1.37:g.155159223C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	RNA	SNP	-	NULL	ENST00000334634.4	37	NULL	CCDS1097.1	1																																																																																			MUC1	-	-	ENSG00000185499		0.567	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC1	HGNC	protein_coding	OTTHUMT00000086728.1	53	0.00	0	C	NM_025058		155159223	155159223	-1	no_errors	ENST00000462317	ensembl	human	known	69_37n	rna	44	21.43	12	SNP	0.035	T
MUC17	140453	genome.wustl.edu	37	7	100684931	100684931	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr7:100684931G>T	ENST00000306151.4	+	3	10298	c.10234G>T	c.(10234-10236)Gtc>Ttc	p.V3412F		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3412	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CACGCCGGTGGTCAGTTCTGA	0.493																																						dbGAP											0													263.0	269.0	267.0					7																	100684931		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.10234G>T	7.37:g.100684931G>T	ENSP00000302716:p.Val3412Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.V3412F	ENST00000306151.4	37	c.10234	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	G	3.054	-0.194715	0.06259	.	.	ENSG00000169876	ENST00000306151	T	0.02787	4.16	1.05	-2.1	0.07210	.	.	.	.	.	T	0.03390	0.0098	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.36625	-0.9740	9	0.42905	T	0.14	.	1.7167	0.02903	0.3058:0.0:0.3159:0.3783	.	3412	Q685J3	MUC17_HUMAN	F	3412	ENSP00000302716:V3412F	ENSP00000302716:V3412F	V	+	1	0	MUC17	100471651	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.644000	0.00107	-0.880000	0.03997	-1.292000	0.01352	GTC	MUC17	-	NULL	ENSG00000169876		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	61	0.00	0	G	NM_001040105		100684931	100684931	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	25	46.81	22	SNP	0.000	T
MUC4	4585	genome.wustl.edu	37	3	195506542	195506542	+	Missense_Mutation	SNP	G	G	T	rs200412534	byFrequency	TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr3:195506542G>T	ENST00000463781.3	-	2	12368	c.11909C>A	c.(11908-11910)cCt>cAt	p.P3970H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3970H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGGTGACAGGAAGAGAGGT	0.592													.|||	604	0.120607	0.1104	0.1037	5008	,	,		7981	0.0526		0.1948	False		,,,				2504	0.1401					dbGAP											0													14.0	9.0	10.0					3																	195506542		635	1414	2049	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11909C>A	3.37:g.195506542G>T	ENSP00000417498:p.Pro3970His	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.P3970H	ENST00000463781.3	37	c.11909	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	3.984	-0.005753	0.07773	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34667	1.35;1.45	.	.	.	.	.	.	.	.	T	0.37812	0.1017	N	0.19112	0.55	0.09310	N	1	D	0.76494	0.999	D	0.77557	0.99	T	0.18999	-1.0319	7	.	.	.	.	6.5141	0.22239	2.0E-4:0.0:0.9998:0.0	.	3842	E7ESK3	.	H	3970	ENSP00000417498:P3970H;ENSP00000420243:P3970H	.	P	-	2	0	MUC4	196991321	0.000000	0.05858	0.006000	0.13384	0.016000	0.09150	0.063000	0.14410	0.419000	0.25927	0.064000	0.15345	CCT	MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	9	0.00	0	G	NM_018406		195506542	195506542	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	14	36.36	8	SNP	0.000	T
MYH7	4625	genome.wustl.edu	37	14	23887512	23887512	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr14:23887512C>T	ENST00000355349.3	-	30	4238	c.4076G>A	c.(4075-4077)cGc>cAc	p.R1359H	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1359				RV -> GD (in Ref. 14; CAA27381). {ECO:0000305}.	adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.R1359H(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GGAAAGGACGCGCTGCAGCTC	0.647																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											72.0	66.0	68.0					14																	23887512		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4076G>A	14.37:g.23887512C>T	ENSP00000347507:p.Arg1359His	Somatic		WXS	Illumina GAIIx	Phase_IV	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1359H	ENST00000355349.3	37	c.4076	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	C	24.9	4.579211	0.86645	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.81579	-1.51	4.83	4.83	0.62350	Myosin tail (1);	.	.	.	.	D	0.92234	0.7537	M	0.93978	3.48	0.80722	D	1	D	0.65815	0.995	D	0.70935	0.971	D	0.94200	0.7449	9	0.87932	D	0	.	18.1069	0.89523	0.0:1.0:0.0:0.0	.	1359	P12883	MYH7_HUMAN	H	1359;1364	ENSP00000347507:R1359H	ENSP00000347507:R1359H	R	-	2	0	MYH7	22957352	1.000000	0.71417	0.972000	0.41901	0.447000	0.32167	7.375000	0.79646	2.520000	0.84964	0.655000	0.94253	CGC	MYH7	-	pfam_Myosin_tail	ENSG00000092054		0.647	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	46	0.00	0	C	NM_000257		23887512	23887512	-1	no_errors	ENST00000355349	ensembl	human	known	69_37n	missense	20	51.22	21	SNP	1.000	T
MYH8	4626	genome.wustl.edu	37	17	10312803	10312803	+	Missense_Mutation	SNP	C	C	T	rs201603486		TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr17:10312803C>T	ENST00000403437.2	-	16	1784	c.1690G>A	c.(1690-1692)Gcc>Acc	p.A564T	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	564	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TGGAAGTTGGCAGACTTGCCC	0.532									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling				C|||	1	0.000199681	0.0	0.0	5008	,	,		18626	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													121.0	119.0	120.0					17																	10312803		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.1690G>A	17.37:g.10312803C>T	ENSP00000384330:p.Ala564Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14910	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A564T	ENST00000403437.2	37	c.1690	CCDS11153.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	12.64	1.998468	0.35226	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.87571	-2.27	5.23	-0.259	0.12971	Myosin head, motor domain (2);	0.911314	0.08982	U	0.865711	T	0.78188	0.4244	L	0.33792	1.035	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.58418	-0.7640	10	0.15066	T	0.55	.	9.9563	0.41668	0.0:0.2924:0.0:0.7076	.	564	P13535	MYH8_HUMAN	T	564	ENSP00000384330:A564T	ENSP00000252173:A564T	A	-	1	0	MYH8	10253528	0.000000	0.05858	0.310000	0.25168	0.996000	0.88848	0.233000	0.17911	0.076000	0.16826	0.655000	0.94253	GCC	MYH8	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000133020		0.532	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	57	0.00	0	C	NM_002472		10312803	10312803	-1	no_errors	ENST00000403437	ensembl	human	known	69_37n	missense	29	11.76	4	SNP	0.006	T
NFATC1	4772	genome.wustl.edu	37	18	77211060	77211060	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr18:77211060G>A	ENST00000427363.2	+	5	1696	c.1696G>A	c.(1696-1698)Gtt>Att	p.V566I	NFATC1_ENST00000253506.5_Missense_Mutation_p.V566I|NFATC1_ENST00000545796.1_Missense_Mutation_p.V94I|NFATC1_ENST00000592223.1_Missense_Mutation_p.V553I|NFATC1_ENST00000542384.1_Missense_Mutation_p.V566I|NFATC1_ENST00000587635.1_Intron|NFATC1_ENST00000591814.1_Missense_Mutation_p.V566I|NFATC1_ENST00000397790.2_Missense_Mutation_p.V94I|NFATC1_ENST00000329101.4_Missense_Mutation_p.V553I|NFATC1_ENST00000586434.1_Missense_Mutation_p.V553I|NFATC1_ENST00000318065.5_Missense_Mutation_p.V553I			O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1	566	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				calcium ion transport (GO:0006816)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	FK506 binding (GO:0005528)|mitogen-activated protein kinase p38 binding (GO:0048273)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(1)|soft_tissue(1)	40		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Pseudoephedrine(DB00852)	GGTGTTCCGCGTTCACGTCCC	0.607																																					GBM(151;1210 2593 28719 45011)	dbGAP											0													98.0	95.0	96.0					18																	77211060		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08015	CCDS12015.1, CCDS12016.1, CCDS32850.1, CCDS59326.1, CCDS59327.1, CCDS62467.1, CCDS62468.1, CCDS62469.1, CCDS62470.1, CCDS62471.1	18q23	2009-11-24			ENSG00000131196	ENSG00000131196		"""Nuclear factor of activated T-cells"""	7775	protein-coding gene	gene with protein product		600489				8202141	Standard	NM_001278669		Approved	NF-ATC, NFATc, NFAT2	uc002lnf.3	O95644	OTTHUMG00000132897	ENST00000427363.2:c.1696G>A	18.37:g.77211060G>A	ENSP00000389377:p.Val566Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B5B2M4|B5B2M5|B5B2M6|B5B2M7|B5B2M8|B5B2M9|B5B2N1|Q12865|Q15793|Q2M1S3	Missense_Mutation	SNP	pfam_RHD,pfam_IPT_TIG_rcpt,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,prints_NFAT,pfscan_RHD	p.V566I	ENST00000427363.2	37	c.1696		18	.	.	.	.	.	.	.	.	.	.	G	14.59	2.579974	0.46006	.	.	ENSG00000131196	ENST00000318065;ENST00000253506;ENST00000397790;ENST00000542384;ENST00000329101;ENST00000545796;ENST00000427363;ENST00000397794	T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64	4.65	2.84	0.33178	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.134215	0.49916	D	0.000135	T	0.67221	0.2870	M	0.85197	2.74	0.51233	D	0.999918	P;P;P;D;D;P	0.76494	0.907;0.907;0.927;0.999;0.999;0.927	B;B;B;D;D;B	0.68192	0.357;0.357;0.357;0.916;0.956;0.357	T	0.71020	-0.4713	10	0.87932	D	0	-35.5538	10.0079	0.41968	0.165:0.0:0.835:0.0	.	553;553;566;566;553;566	B5B2M7;B5B2N1;B5B2M6;O95644;B5B2M5;Q2M1S3	.;.;.;NFAC1_HUMAN;.;.	I	566;566;94;566;553;94;553;530	ENSP00000253506:V566I;ENSP00000380892:V94I;ENSP00000442435:V566I;ENSP00000327850:V553I;ENSP00000439992:V94I	ENSP00000253506:V566I	V	+	1	0	NFATC1	75312048	1.000000	0.71417	0.133000	0.22050	0.019000	0.09904	7.567000	0.82357	0.954000	0.37851	0.563000	0.77884	GTT	NFATC1	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD	ENSG00000131196		0.607	NFATC1-007	KNOWN	basic	protein_coding	NFATC1	HGNC	protein_coding	OTTHUMT00000450507.1	41	0.00	0	G	NM_172390		77211060	77211060	+1	no_errors	ENST00000427363	ensembl	human	known	69_37n	missense	15	40.00	10	SNP	0.976	A
NNMT	4837	genome.wustl.edu	37	11	114183079	114183079	+	Silent	SNP	G	G	C			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr11:114183079G>C	ENST00000535401.1	+	5	939	c.675G>C	c.(673-675)gtG>gtC	p.V225V	NNMT_ENST00000299964.3_Silent_p.V225V|NNMT_ENST00000541754.1_Silent_p.V30V|NNMT_ENST00000542647.1_Silent_p.V30V|RP11-64D24.2_ENST00000544925.1_RNA|NNMT_ENST00000545255.1_Silent_p.V30V			P40261	NNMT_HUMAN	nicotinamide N-methyltransferase	225					methylation (GO:0032259)|organ regeneration (GO:0031100)|response to drug (GO:0042493)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	nicotinamide N-methyltransferase activity (GO:0008112)			kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;4.83e-16)|all_epithelial(67;7.28e-09)|all_hematologic(158;0.000135)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.79e-06)|Epithelial(105;1.32e-05)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.128)	Niacin(DB00627)	AGGCTGCTGTGAAAGAGGCTG	0.537																																						dbGAP											0													61.0	64.0	63.0					11																	114183079		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			U08021	CCDS8368.1	11q23.1	2007-08-15					2.1.1.1		7861	protein-coding gene	gene with protein product		600008				8575745	Standard	NM_006169		Approved		uc001pos.1	P40261		ENST00000535401.1:c.675G>C	11.37:g.114183079G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	p.V225	ENST00000535401.1	37	c.675	CCDS8368.1	11																																																																																			NNMT	-	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	ENSG00000166741		0.537	NNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NNMT	HGNC	protein_coding	OTTHUMT00000398951.1	50	0.00	0	G	NM_006169		114183079	114183079	+1	no_errors	ENST00000299964	ensembl	human	known	69_37n	silent	14	48.15	13	SNP	0.002	C
NRG1	3084	genome.wustl.edu	37	8	32505492	32505492	+	Intron	SNP	G	G	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr8:32505492G>T	ENST00000405005.3	+	5	502				NRG1_ENST00000338921.4_Intron|NRG1_ENST00000341377.5_Intron|NRG1_ENST00000287845.5_Intron|NRG1_ENST00000356819.4_Intron|NRG1_ENST00000520502.2_Missense_Mutation_p.V86F|NRG1_ENST00000521670.1_Intron|NRG1_ENST00000520407.1_Intron|NRG1_ENST00000519301.1_Intron|NRG1_ENST00000287842.3_Intron|NRG1_ENST00000523079.1_Intron			Q02297	NRG1_HUMAN	neuregulin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GGCTTGCCTGGTCAGCCTCTG	0.577																																						dbGAP											0													108.0	109.0	108.0					8																	32505492		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.502+31089G>T	8.37:g.32505492G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	smart_EGF-like,pfscan_EG-like_dom	p.V86F	ENST00000405005.3	37	c.256	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	G	14.25	2.479309	0.44044	.	.	ENSG00000157168	ENST00000520502;ENST00000523041	.	.	.	5.98	4.17	0.49024	.	.	.	.	.	T	0.38878	0.1057	L	0.27053	0.805	0.80722	D	1	B;B	0.33212	0.402;0.402	B;B	0.36766	0.232;0.106	T	0.31475	-0.9942	8	0.87932	D	0	.	5.8204	0.18524	0.2106:0.2915:0.498:0.0	.	86;86	Q53F54;Q02297-10	.;.	F	86;46	.	ENSP00000433289:V86F	V	+	1	0	NRG1	32625034	0.240000	0.23847	0.738000	0.30950	0.998000	0.95712	0.686000	0.25392	0.841000	0.35020	0.655000	0.94253	GTC	NRG1	-	NULL	ENSG00000157168		0.577	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	38	0.00	0	G			32505492	32505492	+1	no_errors	ENST00000520502	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	0.590	T
NSD1	64324	genome.wustl.edu	37	5	176707706	176707706	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr5:176707706C>G	ENST00000439151.2	+	18	5808	c.5763C>G	c.(5761-5763)caC>caG	p.H1921Q	NSD1_ENST00000347982.4_Missense_Mutation_p.H1652Q|NSD1_ENST00000354179.4_Missense_Mutation_p.H1652Q|NSD1_ENST00000361032.4_Missense_Mutation_p.H1818Q	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1921	AWS. {ECO:0000255|PROSITE- ProRule:PRU00562}.				gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		ATGAGTGCCACCCCACAGTGT	0.512			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																												dbGAP		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													79.0	71.0	73.0					5																	176707706		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.5763C>G	5.37:g.176707706C>G	ENSP00000395929:p.His1921Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PD8|Q96RN7	Missense_Mutation	SNP	pfam_PWWP,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.H1921Q	ENST00000439151.2	37	c.5763	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	C	19.42	3.823413	0.71143	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48	5.92	2.76	0.32466	AWS (2);	0.000000	0.64402	D	0.000003	D	0.93572	0.7948	M	0.83852	2.665	0.42647	D	0.993437	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.91635	0.997;0.999;0.953	D	0.93118	0.6522	10	0.72032	D	0.01	.	9.9696	0.41745	0.0:0.6872:0.0:0.3128	.	1652;1818;1921	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	Q	1652;1921;1652;1818	ENSP00000346111:H1652Q;ENSP00000395929:H1921Q;ENSP00000343209:H1652Q;ENSP00000354310:H1818Q	ENSP00000343209:H1652Q	H	+	3	2	NSD1	176640312	0.997000	0.39634	1.000000	0.80357	0.967000	0.64934	0.525000	0.22956	0.779000	0.33543	0.650000	0.86243	CAC	NSD1	-	smart_AWS,pfscan_AWS	ENSG00000165671		0.512	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	50	0.00	0	C	NM_172349		176707706	176707706	+1	no_errors	ENST00000439151	ensembl	human	known	69_37n	missense	37	27.45	14	SNP	1.000	G
OR2T34	127068	genome.wustl.edu	37	1	248737167	248737167	+	Missense_Mutation	SNP	G	G	A	rs148590921	byFrequency	TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:248737167G>A	ENST00000328782.2	-	1	913	c.892C>T	c.(892-894)Cgc>Tgc	p.R298C		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCTTTGTTGCGGAGACTGTAA	0.483																																						dbGAP											0													13.0	13.0	13.0					1																	248737167		1841	3755	5596	-	-	-	SO:0001583	missense	0			BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.892C>T	1.37:g.248737167G>A	ENSP00000330904:p.Arg298Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R298C	ENST00000328782.2	37	c.892	CCDS31120.1	1	418	0.19139194139194138	111	0.22560975609756098	65	0.17955801104972377	145	0.2534965034965035	97	0.1279683377308707	.	8.250	0.808823	0.16467	.	.	ENSG00000183310	ENST00000328782	T	0.40476	1.03	2.37	-4.74	0.03249	.	.	.	.	.	T	0.00012	0.0000	M	0.77820	2.39	0.80722	P	0.0	D	0.89917	1.0	D	0.74348	0.983	T	0.06588	-1.0818	8	0.72032	D	0.01	.	5.5241	0.16949	0.1475:0.0:0.2286:0.624	.	298	Q8NGX1	O2T34_HUMAN	C	298	ENSP00000330904:R298C	ENSP00000330904:R298C	R	-	1	0	OR2T34	246803790	0.000000	0.05858	0.003000	0.11579	0.341000	0.28922	-0.784000	0.04633	-1.176000	0.02747	0.123000	0.15791	CGC	OR2T34	-	pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000183310		0.483	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T34	HGNC	protein_coding	OTTHUMT00000097138.1	16	0.00	0	G	NM_001001821		248737167	248737167	-1	no_errors	ENST00000328782	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	0.000	A
OR52B6	340980	genome.wustl.edu	37	11	5602887	5602887	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr11:5602887G>A	ENST00000345043.2	+	1	781	c.781G>A	c.(781-783)Gga>Aga	p.G261R	HBG2_ENST00000380259.2_Intron|AC015691.13_ENST00000394793.2_RNA	NM_001005162.2	NP_001005162.2	Q8NGF0	O52B6_HUMAN	olfactory receptor, family 52, subfamily B, member 6	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;3.56e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGTACCTGTGGATCCCATAT	0.493																																						dbGAP											0													243.0	256.0	252.0					11																	5602887		1993	4168	6161	-	-	-	SO:0001583	missense	0			AB065858	CCDS41611.1	11p15.4	2012-08-09			ENSG00000187747	ENSG00000187747		"""GPCR / Class A : Olfactory receptors"""	15211	protein-coding gene	gene with protein product							Standard	NM_001005162		Approved		uc010qzi.2	Q8NGF0	OTTHUMG00000066906	ENST00000345043.2:c.781G>A	11.37:g.5602887G>A	ENSP00000341581:p.Gly261Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFI7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G261R	ENST00000345043.2	37	c.781	CCDS41611.1	11	.	.	.	.	.	.	.	.	.	.	G	17.93	3.507962	0.64410	.	.	ENSG00000187747	ENST00000345043	T	0.37584	1.19	5.0	4.1	0.47936	GPCR, rhodopsin-like superfamily (1);	0.630259	0.13055	U	0.417324	T	0.66436	0.2789	H	0.94847	3.59	0.28116	N	0.930815	D	0.76494	0.999	D	0.76575	0.988	T	0.61367	-0.7077	10	0.87932	D	0	.	6.316	0.21190	0.0923:0.0:0.7263:0.1814	.	261	Q8NGF0	O52B6_HUMAN	R	261	ENSP00000341581:G261R	ENSP00000341581:G261R	G	+	1	0	OR52B6	5559463	0.067000	0.21026	0.997000	0.53966	0.993000	0.82548	2.431000	0.44775	1.347000	0.45714	0.655000	0.94253	GGA	OR52B6	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000187747		0.493	OR52B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52B6	HGNC	protein_coding	OTTHUMT00000143397.1	79	0.00	0	G	NM_001005162		5602887	5602887	+1	no_errors	ENST00000345043	ensembl	human	known	69_37n	missense	53	13.11	8	SNP	1.000	A
OTOG	340990	genome.wustl.edu	37	11	17632615	17632615	+	Missense_Mutation	SNP	T	T	C	rs61732913	byFrequency	TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr11:17632615T>C	ENST00000399391.2	+	35	5804	c.5804T>C	c.(5803-5805)aTg>aCg	p.M1935T	OTOG_ENST00000342528.2_Missense_Mutation_p.M941T|OTOG_ENST00000399397.1_Missense_Mutation_p.M1862T	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	1935					adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						CCCACTTCCATGTATGGTTCT	0.622													T|||	45	0.00898562	0.0318	0.0043	5008	,	,		21385	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.5804T>C	11.37:g.17632615T>C	ENSP00000382323:p.Met1935Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTX6|A8MUJ0|B7WPC4	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.M1935T	ENST00000399391.2	37	c.5804	CCDS59225.1	11	21	0.009615384615384616	19	0.03861788617886179	2	0.0055248618784530384	0	0.0	0	0.0	T	5.216	0.225441	0.09916	.	.	ENSG00000188162	ENST00000399391;ENST00000399397;ENST00000342528	T;T;T	0.14766	2.48;2.59;2.94	5.15	-2.06	0.07298	.	1.497260	0.04059	N	0.306139	T	0.01222	0.0040	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33929	-0.9849	10	0.12103	T	0.63	.	4.7399	0.13007	0.1521:0.3993:0.0:0.4486	rs61732913	941	Q6ZRI0-2	.	T	1935;1862;941	ENSP00000382323:M1935T;ENSP00000382329:M1862T;ENSP00000341666:M941T	ENSP00000341666:M941T	M	+	2	0	OTOG	17589191	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.456000	0.06754	-0.157000	0.11059	0.460000	0.39030	ATG	OTOG	-	NULL	ENSG00000188162		0.622	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		11	0.00	0	T			17632615	17632615	+1	no_errors	ENST00000399391	ensembl	human	known	69_37n	missense	4	60.00	6	SNP	0.000	C
OR4A15	81328	genome.wustl.edu	37	11	55136330	55136330	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr11:55136330G>A	ENST00000314706.3	+	1	971	c.971G>A	c.(970-972)aGt>aAt	p.S324N		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	324						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S324I(1)		NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						GAAATGAAAAGTGCCATGAGG	0.378																																						dbGAP											1	Substitution - Missense(1)	lung(1)											114.0	117.0	116.0					11																	55136330		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.971G>A	11.37:g.55136330G>A	ENSP00000325065:p.Ser324Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFL4|Q96R65	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S324N	ENST00000314706.3	37	c.971	CCDS31500.1	11	.	.	.	.	.	.	.	.	.	.	-	0.003	-2.406418	0.00193	.	.	ENSG00000181958	ENST00000314706	T	0.36340	1.26	3.65	-2.12	0.07165	.	0.238358	0.29300	N	0.012560	T	0.08758	0.0217	N	0.01771	-0.73	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.30090	-0.9990	10	0.02654	T	1	.	5.1978	0.15246	0.3954:0.1762:0.4284:0.0	.	324	Q8NGL6	O4A15_HUMAN	N	324	ENSP00000325065:S324N	ENSP00000325065:S324N	S	+	2	0	OR4A15	54892906	0.000000	0.05858	0.212000	0.23672	0.249000	0.25844	-1.027000	0.03592	-0.667000	0.05303	-1.398000	0.01145	AGT	OR4A15	-	NULL	ENSG00000181958		0.378	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A15	HGNC	protein_coding	OTTHUMT00000391161.1	55	0.00	0	G	NM_001005275		55136330	55136330	+1	no_errors	ENST00000314706	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	0.157	A
OTUD6A	139562	genome.wustl.edu	37	X	69282969	69282969	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chrX:69282969G>A	ENST00000338352.2	+	1	629	c.595G>A	c.(595-597)Ggc>Agc	p.G199S		NM_207320.1	NP_997203.1	Q7L8S5	OTU6A_HUMAN	OTU deubiquitinase 6A	199	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)		ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(3)|urinary_tract(1)	23						CGACTCCTTCGGCTACGACGA	0.622																																						dbGAP											0													67.0	60.0	62.0					X																	69282969		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098697	CCDS14395.1	Xq13.1	2014-02-24	2014-02-24			ENSG00000189401		"""OTU domain containing"""	32312	protein-coding gene	gene with protein product		300714	"""OTU domain containing 6A"""			23827681	Standard	NM_207320		Approved	FLJ25831, HSHIN6, DUBA2	uc004dxu.1	Q7L8S5		ENST00000338352.2:c.595G>A	X.37:g.69282969G>A	ENSP00000339389:p.Gly199Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPB7	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.G199S	ENST00000338352.2	37	c.595	CCDS14395.1	X	.	.	.	.	.	.	.	.	.	.	G	10.04	1.242019	0.22796	.	.	ENSG00000189401	ENST00000338352	T	0.42131	0.98	4.27	-2.6	0.06190	Ovarian tumour, otubain (2);	0.628666	0.15414	N	0.263614	T	0.08980	0.0222	N	0.00408	-1.53	0.09310	N	1	B	0.14012	0.009	B	0.12837	0.008	T	0.36480	-0.9746	10	0.09843	T	0.71	.	6.1485	0.20298	0.3082:0.0:0.5263:0.1656	.	199	Q7L8S5	OTU6A_HUMAN	S	199	ENSP00000339389:G199S	ENSP00000339389:G199S	G	+	1	0	OTUD6A	69199694	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.357000	0.20199	-0.651000	0.05415	-0.912000	0.02778	GGC	OTUD6A	-	pfam_OTU,pfscan_OTU	ENSG00000189401		0.622	OTUD6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD6A	HGNC	protein_coding	OTTHUMT00000358763.1	32	0.00	0	G	NM_207320		69282969	69282969	+1	no_errors	ENST00000338352	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	0.000	A
PAPPA2	60676	genome.wustl.edu	37	1	176668567	176668567	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:176668567T>G	ENST00000367662.3	+	8	4242	c.3078T>G	c.(3076-3078)gaT>gaG	p.D1026E		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1026					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						ACACCTTTGATGAGAGGATAG	0.562																																						dbGAP											0													129.0	135.0	133.0					1																	176668567		2094	4228	6322	-	-	-	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.3078T>G	1.37:g.176668567T>G	ENSP00000356634:p.Asp1026Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.D1026E	ENST00000367662.3	37	c.3078	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	T	15.66	2.899417	0.52227	.	.	ENSG00000116183	ENST00000367662	T	0.41065	1.01	5.38	4.23	0.50019	Fibronectin, type III (2);	0.000000	0.85682	D	0.000000	T	0.36771	0.0979	L	0.48362	1.52	0.80722	D	1	P	0.42010	0.768	B	0.41088	0.347	T	0.15122	-1.0448	10	0.51188	T	0.08	-20.553	9.4521	0.38731	0.0:0.1481:0.0:0.8519	.	1026	Q9BXP8	PAPP2_HUMAN	E	1026	ENSP00000356634:D1026E	ENSP00000356634:D1026E	D	+	3	2	PAPPA2	174935190	0.984000	0.35163	1.000000	0.80357	0.908000	0.53690	0.082000	0.14847	1.023000	0.39654	0.533000	0.62120	GAT	PAPPA2	-	superfamily_Fibronectin_type3	ENSG00000116183		0.562	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	76	0.00	0	T			176668567	176668567	+1	no_errors	ENST00000367662	ensembl	human	known	69_37n	missense	48	48.94	46	SNP	1.000	G
PCDHA6	56142	genome.wustl.edu	37	5	140209181	140209181	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr5:140209181G>A	ENST00000529310.1	+	1	1619	c.1505G>A	c.(1504-1506)cGc>cAc	p.R502H	PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Missense_Mutation_p.R502H|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	502	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGGCGAGCGCGCGTTGTCG	0.677																																						dbGAP											0													47.0	52.0	50.0					5																	140209181		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1505G>A	5.37:g.140209181G>A	ENSP00000433378:p.Arg502His	Somatic		WXS	Illumina GAIIx	Phase_IV	O75283|Q9NRT8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R502H	ENST00000529310.1	37	c.1505	CCDS47281.1	5	.	.	.	.	.	.	.	.	.	.	G	10.08	1.251434	0.22880	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.60920	0.15;0.15	3.72	3.72	0.42706	Cadherin (4);Cadherin-like (1);	0.000000	0.36854	U	0.002376	T	0.49830	0.1580	L	0.43923	1.385	0.09310	N	1	P;P;P	0.43287	0.761;0.682;0.802	P;B;B	0.44921	0.464;0.421;0.151	T	0.40534	-0.9558	10	0.35671	T	0.21	.	8.279	0.31889	0.0:0.1679:0.6598:0.1723	.	502;502;502	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	H	502	ENSP00000433378:R502H;ENSP00000434113:R502H	ENSP00000434113:R502H	R	+	2	0	PCDHA6	140189365	0.000000	0.05858	0.884000	0.34674	0.393000	0.30537	0.517000	0.22832	2.061000	0.61500	0.313000	0.20887	CGC	PCDHA6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000081842		0.677	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA6	HGNC	protein_coding	OTTHUMT00000372829.3	124	0.00	0	G	NM_018909		140209181	140209181	+1	no_errors	ENST00000529310	ensembl	human	known	69_37n	missense	48	38.46	30	SNP	0.001	A
PCDHGA12	26025	genome.wustl.edu	37	5	140810542	140810542	+	Silent	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr5:140810542G>A	ENST00000252085.3	+	1	358	c.216G>A	c.(214-216)acG>acA	p.T72T	PCDHGA11_ENST00000398587.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB8P_ENST00000502926.1_RNA|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	72	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGTAGGACGCAGCTTTTCG	0.637																																						dbGAP											0													59.0	72.0	68.0					5																	140810542		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.216G>A	5.37:g.140810542G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O15100|Q6UW70|Q9Y5D7	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T72	ENST00000252085.3	37	c.216	CCDS4260.1	5																																																																																			PCDHGA12	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin	ENSG00000253159		0.637	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA12	HGNC	protein_coding	OTTHUMT00000251806.2	28	0.00	0	G	NM_003735		140810542	140810542	+1	no_errors	ENST00000252085	ensembl	human	known	69_37n	silent	8	55.56	10	SNP	0.000	A
PGAM4	441531	genome.wustl.edu	37	X	77224968	77224968	+	Silent	SNP	G	G	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chrX:77224968G>T	ENST00000458128.1	-	1	167	c.168C>A	c.(166-168)ctC>ctA	p.L56L	ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000341514.6_Intron|ATP7A_ENST00000343533.5_Intron	NM_001029891.2	NP_001025062.1	Q8N0Y7	PGAM4_HUMAN	phosphoglycerate mutase family member 4	56					glycolytic process (GO:0006096)|positive regulation of sperm motility (GO:1902093)	extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|phosphoglycerate mutase activity (GO:0004619)			endometrium(2)|lung(4)	6						GCACTGAGGTGAGGCAGATGT	0.617																																						dbGAP											0													103.0	98.0	100.0					X																	77224968		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			AF465731	CCDS35338.1	Xq21.1	2011-02-09	2006-02-09		ENSG00000226784	ENSG00000226784			21731	protein-coding gene	gene with protein product		300567	"""phosphoglycerate mutase family 4"""			11961099, 9370262	Standard	NM_001029891		Approved	dJ1000K24.1, PGAM3, PGAM-B, PGAM1	uc004ecy.1	Q8N0Y7	OTTHUMG00000057865	ENST00000458128.1:c.168C>A	X.37:g.77224968G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JPN2|Q8NI24|Q8NI25|Q8NI26	Silent	SNP	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,tigrfam_Phosphogly_mut1	p.L56	ENST00000458128.1	37	c.168	CCDS35338.1	X																																																																																			PGAM4	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,tigrfam_Phosphogly_mut1	ENSG00000226784		0.617	PGAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAM4	HGNC	protein_coding	OTTHUMT00000128371.2	77	0.00	0	G	NM_001029891		77224968	77224968	-1	no_errors	ENST00000458128	ensembl	human	known	69_37n	silent	37	28.85	15	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178921553	178921553	+	Missense_Mutation	SNP	T	T	A	rs121913284		TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr3:178921553T>A	ENST00000263967.3	+	5	1192	c.1035T>A	c.(1033-1035)aaT>aaA	p.N345K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	345	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.N345K(44)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CCTACGTGAATGTAAATATTC	0.308		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	44	Substitution - Missense(44)	breast(27)|endometrium(6)|large_intestine(6)|central_nervous_system(5)											67.0	66.0	66.0					3																	178921553		1807	4074	5881	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1035T>A	3.37:g.178921553T>A	ENSP00000263967:p.Asn345Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.N345K	ENST00000263967.3	37	c.1035	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	T	16.01	3.002090	0.54254	.	.	ENSG00000121879	ENST00000263967	T	0.70164	-0.46	5.41	3.03	0.35002	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.77745	0.4176	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75465	-0.3308	10	0.49607	T	0.09	-21.0442	9.7159	0.40274	0.0:0.1415:0.0:0.8585	.	345	P42336	PK3CA_HUMAN	K	345	ENSP00000263967:N345K	ENSP00000263967:N345K	N	+	3	2	PIK3CA	180404247	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.030000	0.41108	0.441000	0.26529	0.402000	0.26972	AAT	PIK3CA	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom	ENSG00000121879		0.308	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	36	0.00	0	T			178921553	178921553	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	20	48.72	19	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178947865	178947865	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr3:178947865G>C	ENST00000263967.3	+	19	2897	c.2740G>C	c.(2740-2742)Gga>Cga	p.G914R		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	914	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		G -> R (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TTTGGGAATTGGAGATCGTCA	0.358		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	0													191.0	178.0	182.0					3																	178947865		1904	4128	6032	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2740G>C	3.37:g.178947865G>C	ENSP00000263967:p.Gly914Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.G914R	ENST00000263967.3	37	c.2740	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.078849	0.94050	.	.	ENSG00000121879	ENST00000263967	D	0.83755	-1.76	5.61	5.61	0.85477	Protein kinase-like domain (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.87763	0.6259	L	0.56280	1.765	0.80722	D	1	D	0.54397	0.966	P	0.55999	0.789	D	0.88362	0.2988	10	0.72032	D	0.01	-16.7487	19.6363	0.95735	0.0:0.0:1.0:0.0	.	914	P42336	PK3CA_HUMAN	R	914	ENSP00000263967:G914R	ENSP00000263967:G914R	G	+	1	0	PIK3CA	180430559	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.367000	0.97148	2.648000	0.89879	0.585000	0.79938	GGA	PIK3CA	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.358	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	66	0.00	0	G			178947865	178947865	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	30	50.82	31	SNP	1.000	C
PLEKHA2	59339	genome.wustl.edu	37	8	38803697	38803697	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr8:38803697G>A	ENST00000521746.1	+	5	537	c.303G>A	c.(301-303)atG>atA	p.M101I	PLEKHA2_ENST00000420274.1_Missense_Mutation_p.M101I|PLEKHA2_ENST00000388745.4_3'UTR			Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2	101	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			AGAAAGATATGAAGGACTGGG	0.438																																						dbGAP											0													93.0	89.0	90.0					8																	38803697		1896	4120	6016	-	-	-	SO:0001583	missense	0			AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000521746.1:c.303G>A	8.37:g.38803697G>A	ENSP00000430938:p.Met101Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.M101I	ENST00000521746.1	37	c.303		8	.	.	.	.	.	.	.	.	.	.	G	14.39	2.520572	0.44866	.	.	ENSG00000169499	ENST00000521746;ENST00000420274;ENST00000535929;ENST00000519640	T;T;T	0.76316	-1.01;-1.01;-1.01	5.38	2.5	0.30297	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.136815	0.49916	D	0.000136	T	0.62332	0.2419	L	0.34521	1.04	0.32546	N	0.532963	B;B	0.12013	0.005;0.005	B;B	0.08055	0.003;0.003	T	0.60762	-0.7199	10	0.49607	T	0.09	.	4.7116	0.12875	0.2398:0.0:0.6027:0.1575	.	101;101	Q9HB19;A8K727	PKHA2_HUMAN;.	I	101;101;51;101	ENSP00000430938:M101I;ENSP00000393860:M101I;ENSP00000429956:M101I	ENSP00000393860:M101I	M	+	3	0	PLEKHA2	38922854	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	0.928000	0.28831	0.710000	0.31997	0.655000	0.94253	ATG	PLEKHA2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000169499		0.438	PLEKHA2-002	PUTATIVE	basic	protein_coding	PLEKHA2	HGNC	protein_coding	OTTHUMT00000377068.1	38	0.00	0	G	NM_021623		38803697	38803697	+1	no_errors	ENST00000420274	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	1.000	A
PLEKHG1	57480	genome.wustl.edu	37	6	151055058	151055058	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr6:151055058G>A	ENST00000358517.2	+	2	452	c.241G>A	c.(241-243)Gag>Aag	p.E81K	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.E81K			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	81							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GAACGCGGATGAGGGCAGCGA	0.627																																						dbGAP											0													40.0	45.0	44.0					6																	151055058		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.241G>A	6.37:g.151055058G>A	ENSP00000351318:p.Glu81Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1F2	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E81K	ENST00000358517.2	37	c.241	CCDS34552.1	6	.	.	.	.	.	.	.	.	.	.	G	14.83	2.651865	0.47362	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	T;T	0.58797	0.31;0.31	5.51	-2.37	0.06643	.	0.659677	0.16512	N	0.211181	T	0.17704	0.0425	N	0.22421	0.69	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.06405	0.001;0.002	T	0.30851	-0.9964	9	.	.	.	.	12.8695	0.57957	0.1161:0.5661:0.3178:0.0	.	81;81	Q5JYA6;Q9ULL1	.;PKHG1_HUMAN	K	81	ENSP00000356297:E81K;ENSP00000351318:E81K	.	E	+	1	0	PLEKHG1	151096751	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.398000	0.20899	-0.736000	0.04831	-0.175000	0.13238	GAG	PLEKHG1	-	NULL	ENSG00000120278		0.627	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG1	HGNC	protein_coding	OTTHUMT00000042691.1	23	0.00	0	G			151055058	151055058	+1	no_errors	ENST00000358517	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	0.000	A
PLEKHG1	57480	genome.wustl.edu	37	6	151055078	151055078	+	Silent	SNP	C	C	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr6:151055078C>A	ENST00000358517.2	+	2	472	c.261C>A	c.(259-261)ccC>ccA	p.P87P	PLEKHG1_ENST00000367328.1_Silent_p.P87P			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	87							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		AAAGGCCACCCAGAGCGCAGT	0.612																																						dbGAP											0													43.0	48.0	46.0					6																	151055078		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.261C>A	6.37:g.151055078C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1F2	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.P87	ENST00000358517.2	37	c.261	CCDS34552.1	6																																																																																			PLEKHG1	-	NULL	ENSG00000120278		0.612	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG1	HGNC	protein_coding	OTTHUMT00000042691.1	19	0.00	0	C			151055078	151055078	+1	no_errors	ENST00000358517	ensembl	human	known	69_37n	silent	14	41.67	10	SNP	0.557	A
PLG	5340	genome.wustl.edu	37	6	161128834	161128834	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr6:161128834G>T	ENST00000308192.9	+	3	351	c.288G>T	c.(286-288)aaG>aaT	p.K96N	PLG_ENST00000462918.1_3'UTR|PLG_ENST00000366924.2_Missense_Mutation_p.K96N	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	96	PAN. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	TATTTGAAAAGAAAGGTGAGT	0.388																																						dbGAP											0													216.0	203.0	208.0					6																	161128834		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.288G>T	6.37:g.161128834G>T	ENSP00000308938:p.Lys96Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	pirsf_Pept_S1A_plasmin,pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.K96N	ENST00000308192.9	37	c.288	CCDS5279.1	6	.	.	.	.	.	.	.	.	.	.	.	14.28	2.489338	0.44249	.	.	ENSG00000122194	ENST00000366924;ENST00000308192;ENST00000418964	T;T;T	0.65916	-0.18;-0.18;-0.18	4.32	3.45	0.39498	PAN-1 domain (1);Apple-like (2);Kringle-like fold (1);	0.000000	0.41097	U	0.000942	T	0.69415	0.3108	M	0.86953	2.85	0.58432	D	0.999996	D	0.57571	0.98	P	0.62740	0.906	T	0.73563	-0.3943	10	0.72032	D	0.01	.	6.9132	0.24346	0.2075:0.0:0.7925:0.0	.	96	P00747	PLMN_HUMAN	N	96;96;113	ENSP00000355891:K96N;ENSP00000308938:K96N;ENSP00000389424:K113N	ENSP00000308938:K96N	K	+	3	2	PLG	161048824	1.000000	0.71417	0.815000	0.32552	0.465000	0.32709	2.057000	0.41365	1.151000	0.42436	0.655000	0.94253	AAG	PLG	-	pirsf_Pept_S1A_plasmin,pfam_PAN-1_domain,superfamily_Kringle-like,smart_Pan_app,pfscan_Pan_app	ENSG00000122194		0.388	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2	105	0.00	0	G	NM_000301		161128834	161128834	+1	no_errors	ENST00000308192	ensembl	human	known	69_37n	missense	105	11.02	13	SNP	0.996	T
SARS	6301	genome.wustl.edu	37	1	109756668	109756668	+	Silent	SNP	C	C	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:109756668C>G	ENST00000234677.2	+	1	129	c.54C>G	c.(52-54)ctC>ctG	p.L18L	SARS_ENST00000369923.4_Silent_p.L18L	NM_006513.3	NP_006504.2	P49591	SYSC_HUMAN	seryl-tRNA synthetase	18					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|RNA binding (GO:0003723)|serine-tRNA ligase activity (GO:0004828)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	17		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	ACCCAGCCCTCATCCGAGAGA	0.612																																						dbGAP											0													97.0	84.0	89.0					1																	109756668		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC009390	CCDS795.1	1p13.3	2011-07-01			ENSG00000031698	ENSG00000031698	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	10537	protein-coding gene	gene with protein product	"""serine tRNA ligase 1, cytoplasmic"""	607529				9431993	Standard	NM_006513		Approved	SERS	uc001dwu.2	P49591	OTTHUMG00000011726	ENST00000234677.2:c.54C>G	1.37:g.109756668C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Y9|Q5T5C8|Q9NSE3	Silent	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Ser-tRNA-synth_IIa_N,superfamily_tRNA-bd_arm,pirsf_Ser-tRNA-synth_IIa,pfscan_aa-tRNA-synth_II,prints_Ser-tRNA-synth_IIa,tigrfam_Ser-tRNA-synth_IIa	p.L18	ENST00000234677.2	37	c.54	CCDS795.1	1																																																																																			SARS	-	pfam_Ser-tRNA-synth_IIa_N,superfamily_tRNA-bd_arm,pirsf_Ser-tRNA-synth_IIa,tigrfam_Ser-tRNA-synth_IIa	ENSG00000031698		0.612	SARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARS	HGNC	protein_coding	OTTHUMT00000032394.2	56	0.00	0	C	NM_006513		109756668	109756668	+1	no_errors	ENST00000369923	ensembl	human	known	69_37n	silent	24	17.24	5	SNP	0.889	G
SEL1L3	23231	genome.wustl.edu	37	4	25821433	25821433	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr4:25821433C>T	ENST00000399878.3	-	8	1542	c.1420G>A	c.(1420-1422)Gca>Aca	p.A474T	SEL1L3_ENST00000264868.5_Missense_Mutation_p.A439T|SEL1L3_ENST00000502949.1_Missense_Mutation_p.A321T	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	474						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						CACTTACATGCTTCTTGTCTC	0.388																																						dbGAP											0													61.0	58.0	59.0					4																	25821433		1963	4150	6113	-	-	-	SO:0001583	missense	0			BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.1420G>A	4.37:g.25821433C>T	ENSP00000382767:p.Ala474Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Missense_Mutation	SNP	pfam_Sel1-like,superfamily_ConA-like_lec_gl,smart_Sel1-like	p.A474T	ENST00000399878.3	37	c.1420	CCDS47037.1	4	.	.	.	.	.	.	.	.	.	.	C	7.991	0.753317	0.15778	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949	T;T;T	0.14266	2.74;2.73;2.52	6.17	3.08	0.35506	.	0.752409	0.13637	N	0.373270	T	0.06600	0.0169	N	0.21448	0.665	0.23070	N	0.99834	B	0.06786	0.001	B	0.04013	0.001	T	0.42616	-0.9441	10	0.07030	T	0.85	.	2.9393	0.05825	0.2167:0.5369:0.0:0.2464	.	474	Q68CR1	SE1L3_HUMAN	T	474;439;321	ENSP00000382767:A474T;ENSP00000264868:A439T;ENSP00000425438:A321T	ENSP00000264868:A439T	A	-	1	0	SEL1L3	25430531	0.025000	0.19082	0.639000	0.29394	0.350000	0.29205	0.011000	0.13264	0.889000	0.36185	0.655000	0.94253	GCA	SEL1L3	-	NULL	ENSG00000091490		0.388	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEL1L3	HGNC	protein_coding	OTTHUMT00000360261.1	66	0.00	0	C	NM_015187		25821433	25821433	-1	no_errors	ENST00000399878	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	0.472	T
SLC5A4	6527	genome.wustl.edu	37	22	32626965	32626965	+	Silent	SNP	C	C	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr22:32626965C>G	ENST00000266086.4	-	10	1130	c.1119G>C	c.(1117-1119)ctG>ctC	p.L373L	RP1-90G24.10_ENST00000434942.1_RNA	NM_014227.2	NP_055042.1	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (glucose activated ion channel), member 4	373					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|pancreas(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CTTGGGGCATCAGTTCCAGCA	0.537																																						dbGAP											0													97.0	74.0	82.0					22																	32626965		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U41897	CCDS13903.1	22q12.3	2013-07-19	2013-07-19		ENSG00000100191	ENSG00000100191		"""Solute carriers"""	11039	protein-coding gene	gene with protein product			"""solute carrier family 5 (low affinity glucose cotransporter), member 4"""			9501190, 12354616	Standard	NM_014227		Approved	SAAT1, SGLT3, DJ90G24.4	uc003ami.3	Q9NY91	OTTHUMG00000150007	ENST00000266086.4:c.1119G>C	22.37:g.32626965C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O15279	Silent	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.L373	ENST00000266086.4	37	c.1119	CCDS13903.1	22																																																																																			SLC5A4	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000100191		0.537	SLC5A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A4	HGNC	protein_coding	OTTHUMT00000315724.1	37	0.00	0	C	NM_014227		32626965	32626965	-1	no_errors	ENST00000266086	ensembl	human	known	69_37n	silent	9	64.00	16	SNP	1.000	G
SNAPC3	6619	genome.wustl.edu	37	9	15423978	15423978	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr9:15423978C>G	ENST00000380821.3	+	2	562	c.386C>G	c.(385-387)aCt>aGt	p.T129S	SNAPC3_ENST00000461041.1_3'UTR	NM_001039697.1	NP_001034786.1	Q92966	SNPC3_HUMAN	small nuclear RNA activating complex, polypeptide 3, 50kDa	129					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription (GO:0009301)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|large_intestine(6)|lung(2)	12				GBM - Glioblastoma multiforme(50;2.15e-06)		GACCTGGTGACTTTGGGGTAT	0.358																																						dbGAP											0													211.0	189.0	196.0					9																	15423978		2203	4300	6503	-	-	-	SO:0001583	missense	0			U71300	CCDS6478.1	9p22.3	2008-07-21	2002-08-29		ENSG00000164975	ENSG00000164975			11136	protein-coding gene	gene with protein product		602348	"""small nuclear RNA activating complex, polypeptide 3, 50kD"""			9003788	Standard	XR_428427		Approved	SNAP50, PTFbeta, MGC33124, MGC132011	uc003zlt.3	Q92966	OTTHUMG00000019583	ENST00000380821.3:c.386C>G	9.37:g.15423978C>G	ENSP00000370200:p.Thr129Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRI8|Q2VPI6|Q5T285	Missense_Mutation	SNP	pfam_snRNA-activating_su3	p.T129S	ENST00000380821.3	37	c.386	CCDS6478.1	9	.	.	.	.	.	.	.	.	.	.	C	23.1	4.373438	0.82573	.	.	ENSG00000164975	ENST00000380821;ENST00000380807;ENST00000447670;ENST00000421710	T	0.62498	0.02	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.78342	0.4268	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.85130	0.987;0.997	T	0.79657	-0.1712	10	0.72032	D	0.01	-31.5588	15.5372	0.76013	0.0:1.0:0.0:0.0	.	100;129	B4DDR9;Q92966	.;SNPC3_HUMAN	S	129;129;100;129	ENSP00000370200:T129S	ENSP00000370185:T129S	T	+	2	0	SNAPC3	15413978	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.913000	0.56394	2.734000	0.93682	0.655000	0.94253	ACT	SNAPC3	-	NULL	ENSG00000164975		0.358	SNAPC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPC3	HGNC	protein_coding	OTTHUMT00000051763.2	51	0.00	0	C	NM_001039697		15423978	15423978	+1	no_errors	ENST00000380821	ensembl	human	known	69_37n	missense	41	24.07	13	SNP	1.000	G
SORCS3	22986	genome.wustl.edu	37	10	107005371	107005371	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr10:107005371G>C	ENST00000369701.3	+	21	3167	c.2940G>C	c.(2938-2940)caG>caC	p.Q980H	SORCS3_ENST00000369699.4_3'UTR	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	980					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.Q980H(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TCACAGTCCAGGTGGCTGCTG	0.468																																					NSCLC(116;1497 1690 7108 13108 14106)	dbGAP											1	Substitution - Missense(1)	endometrium(1)											207.0	158.0	175.0					10																	107005371		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2940G>C	10.37:g.107005371G>C	ENSP00000358715:p.Gln980His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.Q980H	ENST00000369701.3	37	c.2940	CCDS7558.1	10	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449522	0.63178	.	.	ENSG00000156395	ENST00000369701	T	0.42513	0.97	5.96	3.03	0.35002	PKD domain (1);	0.127385	0.56097	D	0.000028	T	0.63307	0.2500	M	0.84683	2.71	0.49483	D	0.99979	D	0.89917	1.0	D	0.77557	0.99	T	0.62397	-0.6863	9	.	.	.	.	8.413	0.32655	0.3798:0.0:0.6202:0.0	.	980	Q9UPU3	SORC3_HUMAN	H	980	ENSP00000358715:Q980H	.	Q	+	3	2	SORCS3	106995361	0.984000	0.35163	1.000000	0.80357	0.988000	0.76386	0.246000	0.18160	0.368000	0.24481	-0.145000	0.13849	CAG	SORCS3	-	superfamily_PKD_dom	ENSG00000156395		0.468	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS3	HGNC	protein_coding	OTTHUMT00000050221.1	63	0.00	0	G	NM_014978		107005371	107005371	+1	no_errors	ENST00000369701	ensembl	human	known	69_37n	missense	48	21.31	13	SNP	1.000	C
SP140	11262	genome.wustl.edu	37	2	231090581	231090581	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr2:231090581G>C	ENST00000392045.3	+	1	136	c.22G>C	c.(22-24)Ggg>Cgg	p.G8R	SP140_ENST00000420434.3_Missense_Mutation_p.G8R|SP140_ENST00000486687.2_Missense_Mutation_p.G8R|SP140_ENST00000417495.3_Missense_Mutation_p.G8R|SP140_ENST00000373645.3_Missense_Mutation_p.G8R|SP110_ENST00000540870.1_5'Flank|SP140_ENST00000343805.6_Missense_Mutation_p.G8R|SP140_ENST00000350136.5_5'UTR	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	8					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GGGCCAGCAGGGGCAGATGGC	0.552																																						dbGAP											0													159.0	129.0	139.0					2																	231090581		2203	4300	6503	-	-	-	SO:0001583	missense	0			U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.22G>C	2.37:g.231090581G>C	ENSP00000375899:p.Gly8Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom,pfscan_Bromodomain	p.G8R	ENST00000392045.3	37	c.22	CCDS42831.1	2	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330802	0.41297	.	.	ENSG00000079263	ENST00000537563;ENST00000486687;ENST00000392044;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434;ENST00000373645	T;T;T;T;T	0.61627	0.3;0.37;0.09;0.34;0.45	2.87	-5.74	0.02391	.	.	.	.	.	T	0.27313	0.0670	N	0.08118	0	0.20307	N	0.999918	B;B;B;B;B;B	0.18741	0.005;0.005;0.009;0.005;0.03;0.002	B;B;B;B;B;B	0.12837	0.002;0.002;0.006;0.002;0.008;0.002	T	0.13953	-1.0490	9	0.87932	D	0	.	0.4371	0.00480	0.3171:0.1487:0.3133:0.2208	.	8;8;8;8;8;8	E7EUR5;E7ESH9;E9PFJ6;Q13342;E7EX75;Q6NSG4	.;.;.;LY10_HUMAN;.;.	R	8	ENSP00000440107:G8R;ENSP00000375899:G8R;ENSP00000342096:G8R;ENSP00000398210:G8R;ENSP00000362749:G8R	ENSP00000342096:G8R	G	+	1	0	SP140	230798825	0.000000	0.05858	0.000000	0.03702	0.590000	0.36582	-1.827000	0.01704	-1.673000	0.01462	0.585000	0.79938	GGG	SP140	-	NULL	ENSG00000079263		0.552	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SP140	HGNC	protein_coding	OTTHUMT00000332015.1	98	0.00	0	G	NM_007237		231090581	231090581	+1	no_errors	ENST00000392045	ensembl	human	known	69_37n	missense	33	32.65	16	SNP	0.000	C
SPTBN2	6712	genome.wustl.edu	37	11	66453379	66453379	+	Missense_Mutation	SNP	C	C	T	rs555843012		TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr11:66453379C>T	ENST00000533211.1	-	38	7467	c.7136G>A	c.(7135-7137)cGa>cAa	p.R2379Q	SPTBN2_ENST00000309996.2_Missense_Mutation_p.R2379Q|SPTBN2_ENST00000529997.1_3'UTR			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	2379					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GCGTTTTTCTCGCTCTCGTTC	0.607													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17804	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													73.0	70.0	71.0					11																	66453379		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.7136G>A	11.37:g.66453379C>T	ENSP00000432568:p.Arg2379Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O14872|O14873	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology,prints_PH_dom-spectrin-type	p.R2379Q	ENST00000533211.1	37	c.7136	CCDS8150.1	11	.	.	.	.	.	.	.	.	.	.	C	28.9	4.964076	0.92791	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000443262	T;T	0.72394	-0.65;-0.65	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000002	T	0.68650	0.3024	L	0.39898	1.24	0.80722	D	1	D	0.57899	0.981	P	0.45310	0.476	T	0.72187	-0.4366	10	0.62326	D	0.03	.	18.837	0.92167	0.0:1.0:0.0:0.0	.	2379	O15020	SPTN2_HUMAN	Q	2379;2379;923	ENSP00000432568:R2379Q;ENSP00000311489:R2379Q	ENSP00000311489:R2379Q	R	-	2	0	SPTBN2	66209955	0.928000	0.31464	1.000000	0.80357	0.967000	0.64934	1.998000	0.40796	2.826000	0.97356	0.561000	0.74099	CGA	SPTBN2	-	pirsf_Spectrin_bsu	ENSG00000173898		0.607	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN2	HGNC	protein_coding	OTTHUMT00000393892.2	50	0.00	0	C	NM_006946		66453379	66453379	-1	no_errors	ENST00000309996	ensembl	human	known	69_37n	missense	20	33.33	10	SNP	1.000	T
SYF2	25949	genome.wustl.edu	37	1	25558585	25558585	+	Intron	SNP	G	G	A	rs139754260	byFrequency	TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:25558585G>A	ENST00000236273.4	-	2	158				SYF2_ENST00000476231.1_5'UTR|SYF2_ENST00000354361.3_Intron	NM_015484.4	NP_056299.1	O95926	SYF2_HUMAN	SYF2 pre-mRNA-splicing factor						embryonic organ development (GO:0048568)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|mitotic G2 DNA damage checkpoint (GO:0007095)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(4)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-26)|Colorectal(126;2.54e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000455)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00145)|GBM - Glioblastoma multiforme(114;0.00443)|READ - Rectum adenocarcinoma(331;0.0936)|Lung(427;0.201)		CGGCCTCCAAGACTACTCACC	0.632																																						dbGAP											0													25.0	28.0	27.0					1																	25558585		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF273089	CCDS258.1, CCDS259.1	1p36.11	2013-08-21	2013-08-21	2005-09-14	ENSG00000117614	ENSG00000117614			19824	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 29"""	607090	"""CCNDBP1 interactor"", ""SYF2 homolog, RNA splicing factor (S. cerevisiae)"""	CBPIN		11118353	Standard	NM_207170		Approved	p29, DKFZp564O2082, NTC31, fSAP29	uc001bjt.1	O95926	OTTHUMG00000043610	ENST00000236273.4:c.132+9C>T	1.37:g.25558585G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TH73	RNA	SNP	-	NULL	ENST00000236273.4	37	NULL	CCDS259.1	1																																																																																			SYF2	-	-	ENSG00000117614		0.632	SYF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYF2	HGNC	protein_coding	OTTHUMT00000101962.1	104	0.00	0	G	NM_015484		25558585	25558585	-1	no_errors	ENST00000476231	ensembl	human	known	69_37n	rna	48	26.15	17	SNP	0.000	A
TBC1D30	23329	genome.wustl.edu	37	12	65269392	65269392	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr12:65269392T>A	ENST00000229088.6	+	13	2599	c.2599T>A	c.(2599-2601)Tca>Aca	p.S867T	TBC1D30_ENST00000542120.1_Missense_Mutation_p.S590T|TBC1D30_ENST00000539867.1_Missense_Mutation_p.S704T			Q9Y2I9	TBC30_HUMAN	TBC1 domain family, member 30	867					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)	ciliary basal body (GO:0036064)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			NS(3)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	5						AGGCAGCAACTCAAAAACCCC	0.577																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB023201	CCDS53813.1	12q14.3	2013-07-10			ENSG00000111490	ENSG00000111490			29164	protein-coding gene	gene with protein product		615077				12618308, 17646400	Standard	NM_015279		Approved	KIAA0984	uc010sst.2	Q9Y2I9	OTTHUMG00000168824	ENST00000229088.6:c.2599T>A	12.37:g.65269392T>A	ENSP00000229088:p.Ser867Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KP01|B9A6M9|E7EMW4|F5GYJ9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.S867T	ENST00000229088.6	37	c.2599		12	.	.	.	.	.	.	.	.	.	.	T	11.60	1.685522	0.29872	.	.	ENSG00000111490	ENST00000229088;ENST00000542120;ENST00000539867	T;T;T	0.07216	3.21;3.25;3.24	5.15	-0.844	0.10741	.	0.686444	0.14638	N	0.307418	T	0.04952	0.0133	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41179	-0.9523	9	.	.	.	-0.1043	4.8306	0.13437	0.0:0.3287:0.2735:0.3978	.	704	F5GYJ9	.	T	867;590;704	ENSP00000229088:S867T;ENSP00000440640:S590T;ENSP00000440207:S704T	.	S	+	1	0	TBC1D30	63555659	.	.	0.002000	0.10522	0.102000	0.19082	.	.	-0.179000	0.10654	-0.661000	0.03856	TCA	TBC1D30	-	NULL	ENSG00000111490		0.577	TBC1D30-201	KNOWN	basic	protein_coding	TBC1D30	HGNC	protein_coding		39	0.00	0	T	XM_037557		65269392	65269392	+1	no_errors	ENST00000229088	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.001	A
TBC1D3P5	440419	genome.wustl.edu	37	17	25756953	25756953	+	RNA	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr17:25756953C>T	ENST00000586223.1	+	0	1787					NR_033892.1				TBC1 domain family, member 3 pseudogene 5																		GGCCCAGGAACATGTGGGGGC	0.692																																						dbGAP											0																																										-	-	-			0					17q11.1	2014-03-20			ENSG00000266433	ENSG00000266433			43567	pseudogene	pseudogene							Standard	NR_033892		Approved		uc002gzg.3		OTTHUMG00000179156		17.37:g.25756953C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000586223.1	37	NULL		17																																																																																			TBC1D3P5	-	-	ENSG00000266433		0.692	TBC1D3P5-003	KNOWN	non_canonical_TEC|basic	processed_transcript	TBC1D3P5	HGNC	pseudogene	OTTHUMT00000451073.1	23	0.00	0	C	NR_033892		25756953	25756953	+1	no_errors	ENST00000581469	ensembl	human	known	69_37n	rna	11	64.52	20	SNP	0.987	T
TEX10	54881	genome.wustl.edu	37	9	103092448	103092448	+	Silent	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr9:103092448G>A	ENST00000374902.4	-	6	1430	c.1254C>T	c.(1252-1254)atC>atT	p.I418I	TEX10_ENST00000535814.1_Silent_p.I421I|TEX10_ENST00000537512.1_Silent_p.I353I	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	418						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		TGCAATGCTTGATGCTAGAAA	0.353																																						dbGAP											0													125.0	121.0	122.0					9																	103092448		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.1254C>T	9.37:g.103092448G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Silent	SNP	pfam_IPI1-like_dom,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.I418	ENST00000374902.4	37	c.1254	CCDS6748.1	9																																																																																			TEX10	-	superfamily_ARM-type_fold	ENSG00000136891		0.353	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX10	HGNC	protein_coding	OTTHUMT00000053416.1	57	0.00	0	G	NM_017746		103092448	103092448	-1	no_errors	ENST00000374902	ensembl	human	known	69_37n	silent	25	35.90	14	SNP	1.000	A
THOC2	57187	genome.wustl.edu	37	X	122734860	122734860	+	3'UTR	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chrX:122734860G>A	ENST00000245838.8	-	0	5161				THOC2_ENST00000497887.1_5'Flank	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2						mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						AAGCATTTCAGAATGGAAATA	0.289																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.*348C>T	X.37:g.122734860G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	RNA	SNP	-	NULL	ENST00000245838.8	37	NULL	CCDS43988.1	X																																																																																			THOC2	-	-	ENSG00000125676		0.289	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC2	HGNC	protein_coding	OTTHUMT00000058153.3	78	0.00	0	G			122734860	122734860	-1	no_errors	ENST00000492203	ensembl	human	known	69_37n	rna	44	16.67	9	SNP	0.000	A
THY1	7070	genome.wustl.edu	37	11	119290034	119290034	+	3'UTR	SNP	G	G	C	rs1054735	byFrequency	TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr11:119290034G>C	ENST00000284240.5	-	0	1609				USP2-AS1_ENST00000500970.1_RNA|USP2-AS1_ENST00000578923.1_RNA|USP2-AS1_ENST00000498979.2_RNA|USP2-AS1_ENST00000530002.1_RNA|THY1_ENST00000527590.1_5'UTR|RP11-334E6.12_ENST00000578216.1_RNA|THY1_ENST00000528522.1_3'UTR	NM_006288.3	NP_006279.2	P04216	THY1_HUMAN	Thy-1 cell surface antigen						angiogenesis (GO:0001525)|cytoskeleton organization (GO:0007010)|focal adhesion assembly (GO:0048041)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of GTPase activity (GO:0043547)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of T cell activation (GO:0050870)|retinal cone cell development (GO:0046549)|single organismal cell-cell adhesion (GO:0016337)|T cell receptor signaling pathway (GO:0050852)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|integrin binding (GO:0005178)|Rho GTPase activator activity (GO:0005100)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.83e-05)		TGAGGGATTGGGGGGAGGGGG	0.582													G|||	3150	0.628994	0.3548	0.5692	5008	,	,		17612	0.88		0.6133	False		,,,				2504	0.7996					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M11749	CCDS8424.1	11q23.3	2013-01-14				ENSG00000154096		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11801	protein-coding gene	gene with protein product		188230				2864690	Standard	NM_006288		Approved	CD90	uc001pwr.3	P04216		ENST00000284240.5:c.*84C>G	11.37:g.119290034G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16008|Q9NSP1	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.P161A	ENST00000284240.5	37	c.481	CCDS8424.1	11	1355	0.6204212454212454	175	0.3556910569105691	200	0.5524861878453039	502	0.8776223776223776	478	0.6306068601583114	G	0.006	-2.081448	0.00371	.	.	ENSG00000154096	ENST00000524970	.	.	.	3.88	1.97	0.26223	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.13602	-1.0503	4	0.87932	D	0	.	9.1011	0.36669	0.0:0.155:0.6833:0.1617	rs1054735;rs3174574;rs1054735	.	.	.	A	161	.	ENSP00000432808:P161A	P	-	1	0	THY1	118795244	0.014000	0.17966	0.004000	0.12327	0.003000	0.03518	0.038000	0.13862	0.211000	0.20683	-2.769000	0.00120	CCA	THY1	-	NULL	ENSG00000154096		0.582	THY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THY1	HGNC	protein_coding	OTTHUMT00000388370.2	28	0.00	0	G	NM_006288		119290034	119290034	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000524970	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	0.002	C
TM4SF1	4071	genome.wustl.edu	37	3	149095218	149095218	+	Silent	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr3:149095218G>A	ENST00000305366.3	-	1	434	c.117C>T	c.(115-117)tcC>tcT	p.S39S	TM4SF1-AS1_ENST00000496491.1_RNA|TM4SF1_ENST00000472441.1_5'Flank|TM4SF1-AS1_ENST00000484046.1_RNA	NM_014220.2	NP_055035.1	P30408	T4S1_HUMAN	transmembrane 4 L six family member 1	39						integral component of plasma membrane (GO:0005887)				endometrium(3)|large_intestine(1)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			GGTGGTTTTCGGAGGCATACT	0.502																																						dbGAP											0													86.0	77.0	80.0					3																	149095218		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M90657	CCDS3143.1	3q21-q25	2005-03-21	2005-03-21		ENSG00000169908	ENSG00000169908			11853	protein-coding gene	gene with protein product		191155	"""transmembrane 4 superfamily member 1"""	M3S1		1565644	Standard	NM_014220		Approved	L6	uc003exb.1	P30408	OTTHUMG00000159597	ENST00000305366.3:c.117C>T	3.37:g.149095218G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IB51	Silent	SNP	pfam_L6_membrane	p.S39	ENST00000305366.3	37	c.117	CCDS3143.1	3																																																																																			TM4SF1	-	pfam_L6_membrane	ENSG00000169908		0.502	TM4SF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM4SF1	HGNC	protein_coding	OTTHUMT00000356368.1	54	0.00	0	G			149095218	149095218	-1	no_errors	ENST00000305366	ensembl	human	known	69_37n	silent	29	30.95	13	SNP	0.000	A
TMEM69	51249	genome.wustl.edu	37	1	46156753	46156753	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:46156753A>C	ENST00000372025.4	+	2	1170	c.13A>C	c.(13-15)Atc>Ctc	p.I5L	TMEM69_ENST00000496366.1_Intron	NM_016486.3	NP_057570.2	Q5SWH9	TMM69_HUMAN	transmembrane protein 69	5						integral component of membrane (GO:0016021)				kidney(3)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(166;0.155)					GCTTCGCTTCATCCAGAAGTT	0.433																																						dbGAP											0													110.0	100.0	103.0					1																	46156753		1904	4127	6031	-	-	-	SO:0001583	missense	0			BC040289, BC013608	CCDS41325.1	1p34.1	2008-02-05	2005-08-17	2005-08-17	ENSG00000159596	ENSG00000159596			28035	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 154"""	C1orf154			Standard	NM_016486		Approved	FLJ21029	uc001cor.1	Q5SWH9	OTTHUMG00000040993	ENST00000372025.4:c.13A>C	1.37:g.46156753A>C	ENSP00000361095:p.Ile5Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SWW5|Q7Z2G0|Q9P0P9	Missense_Mutation	SNP	pfam_DUF3429	p.I5L	ENST00000372025.4	37	c.13	CCDS41325.1	1	.	.	.	.	.	.	.	.	.	.	A	13.87	2.366713	0.41902	.	.	ENSG00000159596	ENST00000372025	.	.	.	5.42	2.87	0.33458	.	0.352776	0.28459	N	0.015263	T	0.26955	0.0660	N	0.20986	0.625	0.25009	N	0.991411	B	0.11235	0.004	B	0.12156	0.007	T	0.15665	-1.0429	9	0.33141	T	0.24	-4.2663	9.8942	0.41309	0.6758:0.3242:0.0:0.0	.	5	Q5SWH9	TMM69_HUMAN	L	5	.	ENSP00000361095:I5L	I	+	1	0	TMEM69	45929340	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	0.978000	0.29488	0.952000	0.37798	0.529000	0.55759	ATC	TMEM69	-	NULL	ENSG00000159596		0.433	TMEM69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM69	HGNC	protein_coding	OTTHUMT00000098390.1	45	0.00	0	A	NM_016486		46156753	46156753	+1	no_errors	ENST00000372025	ensembl	human	known	69_37n	missense	8	46.67	7	SNP	1.000	C
TMEM63A	9725	genome.wustl.edu	37	1	226053738	226053738	+	Intron	SNP	C	C	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:226053738C>G	ENST00000366835.3	-	10	946				TMEM63A_ENST00000537914.1_5'UTR|TMEM63A_ENST00000474478.1_5'UTR	NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A						ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)			breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					GGTTTCCTACCCAACTCCAGC	0.547																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.676-71G>C	1.37:g.226053738C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53GI7|Q5TE96|Q8N2U2	RNA	SNP	-	NULL	ENST00000366835.3	37	NULL	CCDS31042.1	1																																																																																			TMEM63A	-	-	ENSG00000196187		0.547	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63A	HGNC	protein_coding	OTTHUMT00000091154.2	46	0.00	0	C	NM_014698		226053738	226053738	-1	no_errors	ENST00000474478	ensembl	human	known	69_37n	rna	36	30.77	16	SNP	0.002	G
TNRC6B	23112	genome.wustl.edu	37	22	40676008	40676008	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr22:40676008C>A	ENST00000454349.2	+	10	3483	c.3272C>A	c.(3271-3273)tCa>tAa	p.S1091*	TNRC6B_ENST00000497559.1_3'UTR|TNRC6B_ENST00000402203.1_Nonsense_Mutation_p.S344*|TNRC6B_ENST00000301923.9_Nonsense_Mutation_p.S344*|TNRC6B_ENST00000335727.9_Nonsense_Mutation_p.S1038*	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	1091					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						GGAAGCCTTTCAGATAAAAAA	0.438																																						dbGAP											0													186.0	187.0	187.0					22																	40676008		1838	4097	5935	-	-	-	SO:0001587	stop_gained	0			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.3272C>A	22.37:g.40676008C>A	ENSP00000401946:p.Ser1091*	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Nonsense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.S1091*	ENST00000454349.2	37	c.3272	CCDS54533.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	9.994668|9.994668	0.99313|0.99313	.|.	.|.	ENSG00000100354|ENSG00000100354	ENST00000446273|ENST00000301923;ENST00000402203;ENST00000454349;ENST00000400140;ENST00000335727	.|.	.|.	.|.	5.93|5.93	4.92|4.92	0.64577|0.64577	.|.	.|0.442902	.|0.24276	.|N	.|0.039954	T|.	0.44540|.	0.1298|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.52472|.	-0.8571|.	3|.	.|0.14656	.|T	.|0.56	9.0591|9.0591	10.7043|10.7043	0.45946|0.45946	0.1318:0.8004:0.0:0.0679|0.1318:0.8004:0.0:0.0679	.|.	.|.	.|.	.|.	K|X	834|344;344;1091;1038;1038	.|.	.|ENSP00000306759:S344X	Q|S	+|+	1|2	0|0	TNRC6B|TNRC6B	39005954|39005954	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.068000|3.068000	0.50018|0.50018	1.509000|1.509000	0.48786|0.48786	0.655000|0.655000	0.94253|0.94253	CAG|TCA	TNRC6B	-	superfamily_UBA-like	ENSG00000100354		0.438	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	TNRC6B	HGNC	protein_coding		35	0.00	0	C			40676008	40676008	+1	no_errors	ENST00000454349	ensembl	human	known	69_37n	nonsense	16	55.56	20	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7574005	7574005	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr17:7574005A>G	ENST00000269305.4	-	10	1211	c.1022T>C	c.(1021-1023)tTc>tCc	p.F341S	TP53_ENST00000445888.2_Missense_Mutation_p.F341S|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	341	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		F -> C (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I332fs*5(1)|p.F341C(1)|p.?(1)|p.F341fs*4(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCTCTCGGAACATCTCGAA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	12	Whole gene deletion(8)|Deletion - Frameshift(2)|Substitution - Missense(1)|Unknown(1)	bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|stomach(1)|oesophagus(1)|prostate(1)											62.0	48.0	53.0					17																	7574005		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1022T>C	17.37:g.7574005A>G	ENSP00000269305:p.Phe341Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.F341S	ENST00000269305.4	37	c.1022	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	27.8	4.865325	0.91511	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.94000	-3.33;-3.33	5.43	5.43	0.79202	p53, tetramerisation domain (3);	0.151595	0.47455	D	0.000237	D	0.95834	0.8644	M	0.73598	2.24	0.45129	D	0.998142	P	0.37573	0.6	P	0.55055	0.767	D	0.96149	0.9106	10	0.87932	D	0	-19.1541	13.43	0.61049	1.0:0.0:0.0:0.0	.	341	P04637	P53_HUMAN	S	341;341;330	ENSP00000269305:F341S;ENSP00000391478:F341S	ENSP00000269305:F341S	F	-	2	0	TP53	7514730	1.000000	0.71417	0.987000	0.45799	0.826000	0.46750	7.690000	0.84178	2.061000	0.61500	0.459000	0.35465	TTC	TP53	-	pfam_p53_tetrameristn,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	24	0.00	0	A	NM_000546		7574005	7574005	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	3	70.00	7	SNP	0.935	G
TRAF4	9618	genome.wustl.edu	37	17	27075097	27075097	+	Silent	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr17:27075097G>A	ENST00000262395.5	+	4	492	c.363G>A	c.(361-363)ctG>ctA	p.L121L	TRAF4_ENST00000262396.6_Silent_p.L121L|AC010761.10_ENST00000579468.1_RNA|TRAF4_ENST00000444415.3_Silent_p.L121L|AC010761.9_ENST00000577325.1_RNA	NM_004295.3	NP_004286.2	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4	121					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein kinase activity (GO:0045860)|regulation of apoptotic process (GO:0042981)|respiratory gaseous exchange (GO:0007585)|respiratory tube development (GO:0030323)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	DNA binding (GO:0003677)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|WW domain binding (GO:0050699)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			CCATGAAGCTGAGCCGCCGTG	0.582																																						dbGAP											0													65.0	71.0	69.0					17																	27075097		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X80200	CCDS11243.1	17q11-q21.3	2013-01-09			ENSG00000076604	ENSG00000076604		"""RING-type (C3HC4) zinc fingers"""	12034	protein-coding gene	gene with protein product		602464				7592751, 7490069	Standard	NM_004295		Approved	CART1, MLN62, RNF83	uc002hcs.3	Q9BUZ4	OTTHUMG00000132677	ENST00000262395.5:c.363G>A	17.37:g.27075097G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75615|Q14848|Q2KJU4|Q2PJN8	Silent	SNP	pfam_MATH,pfam_Znf_C3HC4_RING-type,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.L121	ENST00000262395.5	37	c.363	CCDS11243.1	17																																																																																			TRAF4	-	superfamily_TRAF-like,pirsf_TNF_rcpt--assoc_TRAF,pfscan_Znf_TRAF	ENSG00000076604		0.582	TRAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF4	HGNC	protein_coding	OTTHUMT00000255944.2	33	0.00	0	G	NM_145751		27075097	27075097	+1	no_errors	ENST00000262395	ensembl	human	known	69_37n	silent	5	68.75	11	SNP	1.000	A
TRAF4	9618	genome.wustl.edu	37	17	27075180	27075180	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr17:27075180G>A	ENST00000262395.5	+	4	575	c.446G>A	c.(445-447)aGt>aAt	p.S149N	TRAF4_ENST00000262396.6_Missense_Mutation_p.S149N|AC010761.10_ENST00000579468.1_RNA|TRAF4_ENST00000444415.3_Missense_Mutation_p.S149N|AC010761.9_ENST00000577325.1_RNA	NM_004295.3	NP_004286.2	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4	149					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein kinase activity (GO:0045860)|regulation of apoptotic process (GO:0042981)|respiratory gaseous exchange (GO:0007585)|respiratory tube development (GO:0030323)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	DNA binding (GO:0003677)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|WW domain binding (GO:0050699)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			TGTGACTTCAGTGGGGAGGCC	0.587																																						dbGAP											0													65.0	69.0	67.0					17																	27075180		2203	4300	6503	-	-	-	SO:0001583	missense	0			X80200	CCDS11243.1	17q11-q21.3	2013-01-09			ENSG00000076604	ENSG00000076604		"""RING-type (C3HC4) zinc fingers"""	12034	protein-coding gene	gene with protein product		602464				7592751, 7490069	Standard	NM_004295		Approved	CART1, MLN62, RNF83	uc002hcs.3	Q9BUZ4	OTTHUMG00000132677	ENST00000262395.5:c.446G>A	17.37:g.27075180G>A	ENSP00000262395:p.Ser149Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O75615|Q14848|Q2KJU4|Q2PJN8	Missense_Mutation	SNP	pfam_MATH,pfam_Znf_C3HC4_RING-type,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.S149N	ENST00000262395.5	37	c.446	CCDS11243.1	17	.	.	.	.	.	.	.	.	.	.	G	13.36	2.214568	0.39102	.	.	ENSG00000076604	ENST00000262395;ENST00000454852;ENST00000422344;ENST00000444415;ENST00000262396	T;T;T;T	0.30714	1.52;1.78;1.52;1.68	5.82	4.79	0.61399	Zinc finger, TRAF-type (1);	0.044283	0.85682	D	0.000000	T	0.24160	0.0585	L	0.31926	0.97	0.43230	D	0.995126	B;B	0.31413	0.322;0.134	B;B	0.31614	0.133;0.074	T	0.03157	-1.1066	10	0.26408	T	0.33	.	14.1585	0.65432	0.0:0.2282:0.7718:0.0	.	149;149	Q9BUZ4;Q9BUZ4-2	TRAF4_HUMAN;.	N	149;149;156;149;149	ENSP00000262395:S149N;ENSP00000415789:S156N;ENSP00000438154:S149N;ENSP00000262396:S149N	ENSP00000262395:S149N	S	+	2	0	TRAF4	24099307	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.958000	0.63660	2.745000	0.94114	0.561000	0.74099	AGT	TRAF4	-	superfamily_TRAF-like,pirsf_TNF_rcpt--assoc_TRAF,pfscan_Znf_TRAF	ENSG00000076604		0.587	TRAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF4	HGNC	protein_coding	OTTHUMT00000255944.2	28	0.00	0	G	NM_145751		27075180	27075180	+1	no_errors	ENST00000262395	ensembl	human	known	69_37n	missense	4	60.00	6	SNP	1.000	A
TSPAN9	10867	genome.wustl.edu	37	12	3392217	3392217	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr12:3392217G>A	ENST00000011898.5	+	9	816	c.655G>A	c.(655-657)Ggc>Agc	p.G219S	TSPAN9_ENST00000537971.1_Missense_Mutation_p.G219S	NM_006675.4	NP_006666.1	O75954	TSN9_HUMAN	tetraspanin 9	219						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)				endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			TCAGATCCTGGGCATGGCCTT	0.647																																						dbGAP											0													74.0	59.0	64.0					12																	3392217		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF089749	CCDS8520.1	12p13.33-p13.32	2013-02-14			ENSG00000011105	ENSG00000011105		"""Tetraspanins"""	21640	protein-coding gene	gene with protein product		613137				10719184, 11739647	Standard	NM_006675		Approved	NET-5	uc021qtd.1	O75954	OTTHUMG00000150333	ENST00000011898.5:c.655G>A	12.37:g.3392217G>A	ENSP00000011898:p.Gly219Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUQ7|Q53FV2|Q6FGJ8	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.G219S	ENST00000011898.5	37	c.655	CCDS8520.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.559150	0.96514	.	.	ENSG00000011105	ENST00000537971;ENST00000011898	T;T	0.81415	-1.49;-1.49	5.23	5.23	0.72850	.	0.092230	0.85682	D	0.000000	D	0.87649	0.6230	M	0.84948	2.725	0.80722	D	1	P	0.44195	0.828	P	0.50934	0.654	D	0.89761	0.3947	10	0.87932	D	0	.	16.3568	0.83237	0.0:0.0:1.0:0.0	.	219	O75954	TSN9_HUMAN	S	219	ENSP00000444799:G219S;ENSP00000011898:G219S	ENSP00000011898:G219S	G	+	1	0	TSPAN9	3262478	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.739000	0.84976	2.443000	0.82685	0.644000	0.83932	GGC	TSPAN9	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000011105		0.647	TSPAN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN9	HGNC	protein_coding	OTTHUMT00000317606.2	34	0.00	0	G	NM_006675		3392217	3392217	+1	no_errors	ENST00000011898	ensembl	human	known	69_37n	missense	12	42.86	9	SNP	1.000	A
TTC37	9652	genome.wustl.edu	37	5	94863727	94863727	+	Missense_Mutation	SNP	G	G	C	rs201518366		TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr5:94863727G>C	ENST00000358746.2	-	13	1422	c.1124C>G	c.(1123-1125)aCg>aGg	p.T375R		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	375						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						CTGATCAAGCGTACGAATTGC	0.373																																						dbGAP											0													87.0	87.0	87.0					5																	94863727		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.1124C>G	5.37:g.94863727G>C	ENSP00000351596:p.Thr375Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O15077|Q6PJI3	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T375R	ENST00000358746.2	37	c.1124	CCDS4072.1	5	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476220	0.44044	.	.	ENSG00000198677	ENST00000358746;ENST00000514952	T;T	0.76060	-0.63;-0.99	5.22	3.42	0.39159	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.281365	0.40222	N	0.001157	T	0.59998	0.2235	L	0.27053	0.805	0.24725	N	0.993126	P;P	0.44946	0.528;0.846	B;B	0.42882	0.302;0.401	T	0.51647	-0.8679	10	0.10902	T	0.67	.	11.6526	0.51297	0.1462:0.0:0.8538:0.0	.	327;375	D6RCE2;Q6PGP7	.;TTC37_HUMAN	R	375;327	ENSP00000351596:T375R;ENSP00000423742:T327R	ENSP00000351596:T375R	T	-	2	0	TTC37	94889483	0.702000	0.27816	0.578000	0.28575	0.922000	0.55478	1.720000	0.38022	0.564000	0.29238	0.484000	0.47621	ACG	TTC37	-	pfscan_TPR-contain_dom	ENSG00000198677		0.373	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC37	HGNC	protein_coding	OTTHUMT00000241651.1	26	0.00	0	G	NM_014639		94863727	94863727	-1	no_errors	ENST00000358746	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	0.713	C
VPS13D	55187	genome.wustl.edu	37	1	12405430	12405430	+	Splice_Site	SNP	G	G	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr1:12405430G>T	ENST00000358136.3	+	43	9015		c.e43-1		VPS13D_ENST00000356315.4_Splice_Site	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CTGCCTGACAGACACACCCAT	0.428																																						dbGAP											0													141.0	141.0	141.0					1																	12405430		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.8886-1G>T	1.37:g.12405430G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e42-1	ENST00000358136.3	37	c.8886-1	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.216423	0.79352	.	.	ENSG00000048707	ENST00000356315;ENST00000358136;ENST00000011700	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5386	0.87841	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	VPS13D	12328017	1.000000	0.71417	0.996000	0.52242	0.941000	0.58515	9.295000	0.96095	2.585000	0.87301	0.655000	0.94253	.	VPS13D	-	-	ENSG00000048707		0.428	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	46	0.00	0	G	NM_015378	Intron	12405430	12405430	+1	no_errors	ENST00000358136	ensembl	human	known	69_37n	splice_site	29	12.12	4	SNP	1.000	T
WHSC1L1	54904	genome.wustl.edu	37	8	38187391	38187391	+	Silent	SNP	C	C	T			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr8:38187391C>T	ENST00000317025.8	-	6	1603	c.1086G>A	c.(1084-1086)caG>caA	p.Q362Q	WHSC1L1_ENST00000433384.2_Silent_p.Q362Q|WHSC1L1_ENST00000527502.1_Silent_p.Q362Q|WHSC1L1_ENST00000316985.3_Silent_p.Q362Q	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	362					histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			CACGTTCTCTCTGAGGTCGGG	0.363			T	NUP98	AML																																	dbGAP		Dom	yes		8	8p12	54904	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)		L	0													65.0	66.0	66.0					8																	38187391		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.1086G>A	8.37:g.38187391C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Silent	SNP	pfam_PWWP,pfam_SET_dom,superfamily_Znf_FYVE_PHD,smart_PWWP,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.Q362	ENST00000317025.8	37	c.1086	CCDS43729.1	8																																																																																			WHSC1L1	-	NULL	ENSG00000147548		0.363	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1L1	HGNC	protein_coding	OTTHUMT00000381924.3	23	0.00	0	C	NM_023034		38187391	38187391	-1	no_errors	ENST00000317025	ensembl	human	known	69_37n	silent	17	46.88	15	SNP	1.000	T
WISP2	8839	genome.wustl.edu	37	20	43356514	43356514	+	IGR	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr20:43356514G>A	ENST00000372868.2	+	0	1600				WISP2_ENST00000471629.1_3'UTR|RP11-445H22.4_ENST00000445420.1_RNA|RP11-445H22.4_ENST00000427598.1_RNA|RP11-445H22.4_ENST00000427303.1_RNA			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2						cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				CAGAATTCAGGGGCAGAGTTC	0.438																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071		20.37:g.43356514G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9N4|E1P612|Q6PEG3	RNA	SNP	-	NULL	ENST00000372868.2	37	NULL	CCDS13336.1	20																																																																																			WISP2	-	-	ENSG00000064205		0.438	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WISP2	HGNC	protein_coding	OTTHUMT00000127824.1	39	0.00	0	G	NM_003881		43356514	43356514	+1	no_errors	ENST00000471629	ensembl	human	known	69_37n	rna	23	14.81	4	SNP	0.000	A
XIST	7503	genome.wustl.edu	37	X	73071663	73071663	+	lincRNA	SNP	A	A	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chrX:73071663A>G	ENST00000429829.1	-	0	925					NR_001564.2				X inactive specific transcript (non-protein coding)																		AATGGCGGCCACTTTTCCTCC	0.493																																						dbGAP											0													117.0	111.0	113.0					X																	73071663		876	1991	2867	-	-	-			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73071663A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.493	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	30	0.00	0	A	NR_001564		73071663	73071663	-1	no_errors	ENST00000429829	ensembl	human	known	69_37n	rna	21	41.67	15	SNP	0.074	G
ZBTB26	57684	genome.wustl.edu	37	9	125681646	125681646	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr9:125681646C>A	ENST00000373656.3	-	2	641	c.568G>T	c.(568-570)Gat>Tat	p.D190Y	ZBTB26_ENST00000373654.1_Missense_Mutation_p.D190Y	NM_020924.2	NP_065975.1	Q9HCK0	ZBT26_HUMAN	zinc finger and BTB domain containing 26	190					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)	11						TCTGATACATCCCCAATAGAT	0.413																																						dbGAP											0													111.0	105.0	107.0					9																	125681646		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046792	CCDS6847.1	9q34.11	2013-01-08	2004-04-15	2004-04-16	ENSG00000171448	ENSG00000171448		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23383	protein-coding gene	gene with protein product			"""zinc finger protein 481"""	ZNF481			Standard	NM_020924		Approved		uc004bnk.3	Q9HCK0	OTTHUMG00000020627	ENST00000373656.3:c.568G>T	9.37:g.125681646C>A	ENSP00000362760:p.Asp190Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ53|Q8WTR1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.D190Y	ENST00000373656.3	37	c.568	CCDS6847.1	9	.	.	.	.	.	.	.	.	.	.	C	9.956	1.221388	0.22457	.	.	ENSG00000171448	ENST00000373656;ENST00000373654	T;T	0.12774	2.65;2.65	5.52	4.63	0.57726	.	0.180372	0.47093	D	0.000259	T	0.12008	0.0292	N	0.19112	0.55	0.44627	D	0.997601	P	0.35844	0.524	B	0.38803	0.282	T	0.09271	-1.0682	10	0.66056	D	0.02	.	14.3209	0.66487	0.0:0.9291:0.0:0.0709	.	190	Q9HCK0	ZBT26_HUMAN	Y	190	ENSP00000362760:D190Y;ENSP00000362758:D190Y	ENSP00000362758:D190Y	D	-	1	0	ZBTB26	124721467	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.304000	0.59104	1.341000	0.45600	-0.136000	0.14681	GAT	ZBTB26	-	NULL	ENSG00000171448		0.413	ZBTB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB26	HGNC	protein_coding	OTTHUMT00000053960.1	56	0.00	0	C	NM_020924		125681646	125681646	-1	no_errors	ENST00000373654	ensembl	human	known	69_37n	missense	38	35.59	21	SNP	1.000	A
ZMAT1	84460	genome.wustl.edu	37	X	101139060	101139060	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chrX:101139060C>G	ENST00000372782.3	-	7	1386	c.1339G>C	c.(1339-1341)Gag>Cag	p.E447Q	ZMAT1_ENST00000540921.1_Missense_Mutation_p.E447Q|ZMAT1_ENST00000494068.1_5'UTR|ZMAT1_ENST00000458570.1_Missense_Mutation_p.E276Q	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	447						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						TGGAAAGTCTCACATGGGAGC	0.413																																						dbGAP											0													171.0	160.0	163.0					X																	101139060		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.1339G>C	X.37:g.101139060C>G	ENSP00000361868:p.Glu447Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDS3|Q96JN6	Missense_Mutation	SNP	superfamily_Asn/Gln_tRNA_amidoTrfrase-rel,smart_Znf_U1,smart_Znf_C2H2-like	p.E447Q	ENST00000372782.3	37	c.1339	CCDS35348.1	X	.	.	.	.	.	.	.	.	.	.	C	12.25	1.880359	0.33162	.	.	ENSG00000166432	ENST00000372782;ENST00000540921;ENST00000458570	T;T;T	0.24538	2.42;2.42;1.85	4.59	3.73	0.42828	.	0.382704	0.26507	N	0.023994	T	0.36524	0.0970	M	0.70595	2.14	0.23851	N	0.996667	D	0.63880	0.993	P	0.53266	0.722	T	0.18618	-1.0331	10	0.54805	T	0.06	-1.8222	7.557	0.27829	0.0:0.8842:0.0:0.1158	.	447	Q5H9K5	ZMAT1_HUMAN	Q	447;447;276	ENSP00000361868:E447Q;ENSP00000437529:E447Q;ENSP00000413044:E276Q	ENSP00000361868:E447Q	E	-	1	0	ZMAT1	101025716	0.963000	0.33076	0.572000	0.28498	0.309000	0.27889	2.300000	0.43620	1.264000	0.44198	0.600000	0.82982	GAG	ZMAT1	-	NULL	ENSG00000166432		0.413	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT1	HGNC	protein_coding	OTTHUMT00000057598.1	67	0.00	0	C			101139060	101139060	-1	no_errors	ENST00000372782	ensembl	human	known	69_37n	missense	27	49.06	26	SNP	0.673	G
ZNF585A	199704	genome.wustl.edu	37	19	37643190	37643190	+	Silent	SNP	G	G	A			TCGA-E2-A2P5-01A-11D-A19Y-09	TCGA-E2-A2P5-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	34e624a6-5da3-4150-bfb8-d86ee8732d08	4bce079d-bbf4-481c-8aab-a007e90d4e97	g.chr19:37643190G>A	ENST00000356958.4	-	5	1869	c.1611C>T	c.(1609-1611)ctC>ctT	p.L537L	ZNF585A_ENST00000355533.2_Intron|ZNF585A_ENST00000292841.5_Silent_p.L482L|ZNF585A_ENST00000392157.2_Silent_p.L482L|ZNF585A_ENST00000588723.1_Intron			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	537					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GATGTATATTGAGGTGTGACT	0.413																																						dbGAP											0													114.0	112.0	112.0					19																	37643190		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.1611C>T	19.37:g.37643190G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TE95|Q96MV3	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L537	ENST00000356958.4	37	c.1611		19																																																																																			ZNF585A	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196967		0.413	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	ZNF585A	HGNC	protein_coding	OTTHUMT00000457980.2	73	0.00	0	G	NM_152655		37643190	37643190	-1	no_errors	ENST00000356958	ensembl	human	known	69_37n	silent	39	15.22	7	SNP	0.009	A
