#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AIM1L	55057	genome.wustl.edu	37	1	26669642	26669642	+	5'UTR	SNP	G	G	T			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr1:26669642G>T	ENST00000308182.5	-	0	264				AIM1L_ENST00000527815.1_Missense_Mutation_p.F116L			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like								carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		ACTCTGAGAAGAAGATCACCT	0.627																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490	ENST00000308182.5:c.-166C>A	1.37:g.26669642G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNG3|Q5T137|Q5T150	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.F116L	ENST00000308182.5	37	c.348		1	.	.	.	.	.	.	.	.	.	.	G	8.511	0.866600	0.17250	.	.	ENSG00000176092	ENST00000527815	T	0.69435	-0.4	4.53	2.46	0.29980	.	.	.	.	.	T	0.34716	0.0907	N	0.01729	-0.75	0.80722	D	1	.	.	.	.	.	.	T	0.12016	-1.0564	7	0.12103	T	0.63	.	8.0357	0.30491	0.0937:0.1604:0.7459:0.0	.	.	.	.	L	116	ENSP00000433931:F116L	ENSP00000433931:F116L	F	-	3	2	AIM1L	26542229	0.998000	0.40836	1.000000	0.80357	0.289000	0.27227	0.139000	0.16036	1.253000	0.44018	0.557000	0.71058	TTC	AIM1L	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin	ENSG00000176092		0.627	AIM1L-201	KNOWN	basic	protein_coding	AIM1L	HGNC	protein_coding		54	0.00	0	G	NM_001039775.2		26669642	26669642	-1	no_errors	ENST00000527815	ensembl	human	known	69_37n	missense	17	34.62	9	SNP	1.000	T
ANKZF1	55139	genome.wustl.edu	37	2	220099673	220099673	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr2:220099673A>G	ENST00000323348.5	+	10	1504	c.1330A>G	c.(1330-1332)Aag>Gag	p.K444E	ANKZF1_ENST00000409849.1_Missense_Mutation_p.K234E|ANKZF1_ENST00000410034.3_Missense_Mutation_p.K444E|GLB1L_ENST00000497855.1_5'Flank	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	444						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AAGGAATAAGAAGGAGAAAAG	0.522																																						dbGAP											0													56.0	64.0	61.0					2																	220099673		2093	4219	6312	-	-	-	SO:0001583	missense	0			AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.1330A>G	2.37:g.220099673A>G	ENSP00000321617:p.Lys444Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NVZ4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K444E	ENST00000323348.5	37	c.1330	CCDS42821.1	2	.	.	.	.	.	.	.	.	.	.	A	10.42	1.346007	0.24426	.	.	ENSG00000163516	ENST00000323348;ENST00000409849;ENST00000410034	T;T;T	0.34275	1.37;1.55;1.37	5.3	5.3	0.74995	.	0.429162	0.28583	N	0.014829	T	0.30947	0.0781	L	0.45581	1.43	0.31113	N	0.709766	B	0.20780	0.048	B	0.16289	0.015	T	0.22521	-1.0214	10	0.21014	T	0.42	-14.1038	13.1204	0.59323	1.0:0.0:0.0:0.0	.	444	Q9H8Y5	ANKZ1_HUMAN	E	444;234;444	ENSP00000321617:K444E;ENSP00000386815:K234E;ENSP00000386337:K444E	ENSP00000321617:K444E	K	+	1	0	ANKZF1	219807917	1.000000	0.71417	1.000000	0.80357	0.191000	0.23601	1.723000	0.38053	2.225000	0.72522	0.482000	0.46254	AAG	ANKZF1	-	NULL	ENSG00000163516		0.522	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKZF1	HGNC	protein_coding	OTTHUMT00000335790.1	83	0.00	0	A	NM_018089		220099673	220099673	+1	no_errors	ENST00000323348	ensembl	human	known	69_37n	missense	32	25.58	11	SNP	1.000	G
BCL11B	64919	genome.wustl.edu	37	14	99641544	99641546	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr14:99641544_99641546delCTC	ENST00000357195.3	-	4	1636_1638	c.1627_1629delGAG	c.(1627-1629)gagdel	p.E543del	BCL11B_ENST00000345514.2_In_Frame_Del_p.E472del|BCL11B_ENST00000443726.2_In_Frame_Del_p.E349del	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	543	Glu-rich.				alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CCAGTAGCAGctcctcctcctcc	0.7			T	TLX3	T-ALL																																	dbGAP		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	0									,	259,3515		17,225,1645					,	1.8	1.0			6	544,6744		46,452,3146	no	coding,coding	BCL11B	NM_138576.2,NM_022898.1	,	63,677,4791	A1A1,A1R,RR		7.4643,6.8627,7.2591	,	,		803,10259				-	-	-	SO:0001651	inframe_deletion	0			AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1627_1629delGAG	14.37:g.99641553_99641555delCTC	ENSP00000349723:p.Glu543del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H162	In_Frame_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E543in_frame_del	ENST00000357195.3	37	c.1629_1627	CCDS9950.1	14																																																																																			BCL11B	-	NULL	ENSG00000127152		0.700	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL11B	HGNC	protein_coding	OTTHUMT00000072332.2	10	0.00	0	CTC	NM_138576		99641544	99641546	-1	no_errors	ENST00000357195	ensembl	human	known	69_37n	in_frame_del	4	33.33	2	DEL	1.000:1.000:1.000	-
C19orf47	126526	genome.wustl.edu	37	19	40827096	40827096	+	3'UTR	SNP	C	C	T			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr19:40827096C>T	ENST00000582783.1	-	0	1974				C19orf47_ENST00000392035.2_3'UTR|C19orf47_ENST00000584868.1_5'UTR	NM_001256440.1	NP_001243369.1	Q8N9M1	CS047_HUMAN	chromosome 19 open reading frame 47							nucleus (GO:0005634)				endometrium(5)|kidney(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20			Lung(22;0.000636)			GGCAGGAAAACGGATGCGCCT	0.637																																						dbGAP											0													62.0	59.0	60.0					19																	40827096		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			AL834131	CCDS58662.1	19q13.2	2012-07-20			ENSG00000160392	ENSG00000160392			26723	protein-coding gene	gene with protein product						12477932	Standard	NM_001256440		Approved	FLJ36888	uc002oni.5	Q8N9M1	OTTHUMG00000179028	ENST00000582783.1:c.*693G>A	19.37:g.40827096C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IZ33|Q8N0V9	RNA	SNP	-	NULL	ENST00000582783.1	37	NULL	CCDS58662.1	19																																																																																			C19orf47	-	-	ENSG00000160392		0.637	C19orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf47	HGNC	protein_coding	OTTHUMT00000444488.1	38	0.00	0	C	NM_178830		40827096	40827096	-1	no_errors	ENST00000584868	ensembl	human	known	69_37n	rna	17	15.00	3	SNP	0.000	T
C2CD3	26005	genome.wustl.edu	37	11	73850818	73850818	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr11:73850818G>C	ENST00000334126.7	-	4	765	c.539C>G	c.(538-540)cCt>cGt	p.P180R	C2CD3_ENST00000313663.7_Missense_Mutation_p.P180R|C2CD3_ENST00000539061.1_Missense_Mutation_p.P180R			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	180					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					GTCAGTGGTAGGAAGTGGATG	0.443																																						dbGAP											0													137.0	140.0	139.0					11																	73850818		2200	4293	6493	-	-	-	SO:0001583	missense	0			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.539C>G	11.37:g.73850818G>C	ENSP00000334379:p.Pro180Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	p.P180R	ENST00000334126.7	37	c.539		11	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598346	0.46318	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000289350;ENST00000539061	T;T	0.11930	2.73;2.77	5.01	3.14	0.36123	.	0.059782	0.64402	D	0.000002	T	0.28599	0.0708	M	0.68952	2.095	0.34532	D	0.709286	D;D	0.64830	0.994;0.992	P;P	0.61800	0.836;0.894	T	0.40646	-0.9552	10	0.72032	D	0.01	-4.5876	9.3317	0.38025	0.1741:0.0:0.8259:0.0	.	180;180	Q4AC94;Q4AC94-1	C2CD3_HUMAN;.	R	180	ENSP00000334379:P180R;ENSP00000323339:P180R	ENSP00000289350:P180R	P	-	2	0	C2CD3	73528466	1.000000	0.71417	0.926000	0.36857	0.937000	0.57800	2.170000	0.42443	0.783000	0.33636	0.650000	0.86243	CCT	C2CD3	-	NULL	ENSG00000168014		0.443	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding		87	0.00	0	G	NM_015531		73850818	73850818	-1	no_errors	ENST00000334126	ensembl	human	known	69_37n	missense	70	33.33	35	SNP	0.997	C
CAMK2G	818	genome.wustl.edu	37	10	75608353	75608353	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr10:75608353G>T	ENST00000351293.3	-	8	589	c.532C>A	c.(532-534)Cca>Aca	p.P178T	CAMK2G_ENST00000322680.3_Missense_Mutation_p.P178T|CAMK2G_ENST00000472912.1_5'UTR|CAMK2G_ENST00000305762.7_Missense_Mutation_p.P178T|CAMK2G_ENST00000423381.1_Missense_Mutation_p.P178T|CAMK2G_ENST00000372765.1_Missense_Mutation_p.P178T|CAMK2G_ENST00000444854.2_Intron|CAMK2G_ENST00000394762.2_Missense_Mutation_p.P178T|CAMK2G_ENST00000322635.3_Missense_Mutation_p.P178T|RP11-574K11.8_ENST00000446730.2_RNA	NM_001222.3|NM_172173.2	NP_001213.2|NP_751913.1	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II gamma	178	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|dephosphorylation (GO:0016311)|G1/S transition of mitotic cell cycle (GO:0000082)|insulin secretion (GO:0030073)|interferon-gamma-mediated signaling pathway (GO:0060333)|nervous system development (GO:0007399)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of calcium ion transport (GO:0051924)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of skeletal muscle adaptation (GO:0014733)|synaptic transmission (GO:0007268)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-dependent protein serine/threonine phosphatase activity (GO:0004723)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			kidney(2)|large_intestine(2)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	15	Prostate(51;0.0112)				Bosutinib(DB06616)	AAGTAACCTGGGGTGCCAGCA	0.522											OREG0020267	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													46.0	43.0	44.0					10																	75608353		2203	4300	6503	-	-	-	SO:0001583	missense	0			U81554	CCDS7336.1, CCDS7337.1, CCDS7338.1, CCDS73153.1	10q22	2008-10-30	2008-10-30		ENSG00000148660	ENSG00000148660			1463	protein-coding gene	gene with protein product		602123	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma"""	CAMKG		8287681	Standard	NM_001204492		Approved		uc001jvm.2	Q13555	OTTHUMG00000018492	ENST00000351293.3:c.532C>A	10.37:g.75608353G>T	ENSP00000277853:p.Pro178Thr	Somatic	1161	WXS	Illumina GAIIx	Phase_IV	O00561|O15378|Q13279|Q13282|Q13556|Q5SQZ3|Q5SQZ4|Q5SWX4|Q7KYX5|Q8N4I3|Q8NIA4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ca/CaM-dep_prot_kinase-assoc,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P178T	ENST00000351293.3	37	c.532	CCDS7336.1	10	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279819	0.80692	.	.	ENSG00000148660	ENST00000351293;ENST00000322635;ENST00000423381;ENST00000394763;ENST00000322680;ENST00000394762;ENST00000433289;ENST00000305762;ENST00000372765	T;T;T;T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.58	5.62	5.62	0.85841	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61236	0.2331	M	0.82132	2.575	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.997;1.0;0.986;0.981;0.989;1.0;1.0;1.0	D;D;D;P;D;D;D;D	0.85130	0.971;0.965;0.912;0.76;0.929;0.996;0.933;0.997	T	0.64939	-0.6289	10	0.87932	D	0	.	19.6578	0.95851	0.0:0.0:1.0:0.0	.	170;178;178;178;178;178;178;178	B3KY86;Q13555-4;Q13555-6;Q13555-10;A8K6N9;Q13555;Q13555-5;Q13555-8	.;.;.;.;.;KCC2G_HUMAN;.;.	T	178;178;178;178;178;178;113;178;178	ENSP00000277853:P178T;ENSP00000315599:P178T;ENSP00000410298:P178T;ENSP00000319060:P178T;ENSP00000378243:P178T;ENSP00000393784:P113T;ENSP00000307082:P178T;ENSP00000361851:P178T	ENSP00000307082:P178T	P	-	1	0	CAMK2G	75278359	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.869000	0.99810	2.640000	0.89533	0.655000	0.94253	CCA	CAMK2G	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000148660		0.522	CAMK2G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK2G	HGNC	protein_coding	OTTHUMT00000048715.1	40	0.00	0	G	NM_172169		75608353	75608353	-1	no_errors	ENST00000423381	ensembl	human	known	69_37n	missense	16	33.33	8	SNP	1.000	T
CHRNG	1146	genome.wustl.edu	37	2	233404776	233404776	+	Missense_Mutation	SNP	G	G	A	rs186589083	byFrequency	TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr2:233404776G>A	ENST00000389494.3	+	2	151	c.130G>A	c.(130-132)Gcg>Acg	p.A44T	CHRNG_ENST00000389492.3_Missense_Mutation_p.A44T	NM_005199.4	NP_005190.4	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma (muscle)	44					muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)			breast(2)|endometrium(3)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)	Galantamine(DB00674)	CCTGCGGCCCGCGGAACGAGA	0.632													G|||	4	0.000798722	0.0	0.0	5008	,	,		17737	0.004		0.0	False		,,,				2504	0.0					dbGAP											0													62.0	68.0	66.0					2																	233404776		2203	4300	6503	-	-	-	SO:0001583	missense	0			X01715	CCDS33400.1	2q37.1	2012-10-02	2012-02-07		ENSG00000196811	ENSG00000196811		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1967	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, gamma (muscle)"""	100730	"""cholinergic receptor, nicotinic, gamma"""	ACHRG			Standard	NM_005199		Approved		uc002vsx.1	P07510	OTTHUMG00000153327	ENST00000389494.3:c.130G>A	2.37:g.233404776G>A	ENSP00000374145:p.Ala44Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWM8|Q14DU4|Q53RG2	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.A44T	ENST00000389494.3	37	c.130	CCDS33400.1	2	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	14.24	2.475403	0.43942	.	.	ENSG00000196811	ENST00000389494;ENST00000541596;ENST00000389492	T;T	0.77489	-1.1;-1.1	4.01	4.01	0.46588	Neurotransmitter-gated ion-channel ligand-binding (3);	0.152135	0.43579	D	0.000557	T	0.71710	0.3372	L	0.49640	1.575	0.42256	D	0.991997	B;B	0.24092	0.079;0.097	B;B	0.37144	0.034;0.242	T	0.76315	-0.3004	10	0.51188	T	0.08	.	16.2992	0.82801	0.0:0.0:1.0:0.0	.	44;44	Q14DU4;P07510	.;ACHG_HUMAN	T	44	ENSP00000374145:A44T;ENSP00000374143:A44T	ENSP00000374143:A44T	A	+	1	0	CHRNG	233113020	0.984000	0.35163	0.095000	0.20976	0.171000	0.22731	4.343000	0.59348	2.063000	0.61619	0.448000	0.29417	GCG	CHRNG	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd	ENSG00000196811		0.632	CHRNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNG	HGNC	protein_coding	OTTHUMT00000330743.1	51	0.00	0	G	NM_005199		233404776	233404776	+1	no_errors	ENST00000389494	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	0.854	A
COL5A1	1289	genome.wustl.edu	37	9	137593087	137593087	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr9:137593087A>G	ENST00000371817.3	+	4	976	c.562A>G	c.(562-564)Acc>Gcc	p.T188A	COL5A1_ENST00000464187.1_3'UTR	NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	188	Laminin G-like.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		AAAGAAGACCACCAAATTCCT	0.512																																						dbGAP											0													165.0	123.0	137.0					9																	137593087		2203	4300	6503	-	-	-	SO:0001583	missense	0			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.562A>G	9.37:g.137593087A>G	ENSP00000360882:p.Thr188Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15094|Q5SUX4	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Laminin_G,smart_Fib_collagen_C	p.T188A	ENST00000371817.3	37	c.562	CCDS6982.1	9	.	.	.	.	.	.	.	.	.	.	A	17.76	3.469199	0.63625	.	.	ENSG00000130635	ENST00000371817	T	0.02369	4.32	5.07	5.07	0.68467	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.067647	0.64402	U	0.000020	T	0.14700	0.0355	M	0.93978	3.48	0.50632	D	0.999889	P	0.47762	0.9	P	0.49799	0.622	T	0.02743	-1.1116	10	0.72032	D	0.01	.	15.1174	0.72413	1.0:0.0:0.0:0.0	.	188	P20908	CO5A1_HUMAN	A	188	ENSP00000360882:T188A	ENSP00000360882:T188A	T	+	1	0	COL5A1	136732908	0.999000	0.42202	0.190000	0.23270	0.705000	0.40729	5.984000	0.70548	2.021000	0.59480	0.482000	0.46254	ACC	COL5A1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G	ENSG00000130635		0.512	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A1	HGNC	protein_coding	OTTHUMT00000054954.2	74	0.00	0	A	NM_000093		137593087	137593087	+1	no_errors	ENST00000371817	ensembl	human	known	69_37n	missense	55	11.29	7	SNP	1.000	G
DYRK3	8444	genome.wustl.edu	37	1	206821748	206821748	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr1:206821748T>G	ENST00000367109.2	+	3	1373	c.1205T>G	c.(1204-1206)cTt>cGt	p.L402R	DYRK3_ENST00000489878.1_Intron|DYRK3_ENST00000367108.3_Missense_Mutation_p.L382R|DYRK3_ENST00000367106.1_Missense_Mutation_p.L382R	NM_003582.2	NP_003573.2	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3	402	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				erythrocyte differentiation (GO:0030218)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)|skin(1)|stomach(2)	25	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CTTGCAGAACTTTTAACAGGA	0.488																																					Melanoma(164;427 2622 26826 51707)	dbGAP											0													105.0	111.0	109.0					1																	206821748		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y12735	CCDS30999.1, CCDS31000.1	1q32	2008-07-18			ENSG00000143479	ENSG00000143479	2.7.12.1		3094	protein-coding gene	gene with protein product	"""regulatory erythroid kinase"", ""dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 5"", ""protein kinase Dyrk3"""	603497				9748265	Standard	NM_003582		Approved	RED, REDK, hYAK3-2	uc001hej.3	O43781	OTTHUMG00000036339	ENST00000367109.2:c.1205T>G	1.37:g.206821748T>G	ENSP00000356076:p.Leu402Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT79|Q7Z752|Q9HBY6|Q9HBY7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L402R	ENST00000367109.2	37	c.1205	CCDS30999.1	1	.	.	.	.	.	.	.	.	.	.	T	18.56	3.649504	0.67358	.	.	ENSG00000143479	ENST00000367109;ENST00000367108;ENST00000367106	T;T;T	0.30448	1.53;1.53;1.53	5.31	5.31	0.75309	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.71350	0.3329	H	0.98487	4.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.83263	-0.0047	10	0.87932	D	0	.	14.588	0.68342	0.0:0.0:0.0:1.0	.	402;382	O43781;O43781-2	DYRK3_HUMAN;.	R	402;382;382	ENSP00000356076:L402R;ENSP00000356075:L382R;ENSP00000356073:L382R	ENSP00000356073:L382R	L	+	2	0	DYRK3	204888371	1.000000	0.71417	0.932000	0.37286	0.988000	0.76386	7.868000	0.87116	2.231000	0.72958	0.454000	0.30748	CTT	DYRK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000143479		0.488	DYRK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK3	HGNC	protein_coding	OTTHUMT00000088458.1	44	0.00	0	T	NM_003582		206821748	206821748	+1	no_errors	ENST00000367109	ensembl	human	known	69_37n	missense	22	46.34	19	SNP	0.999	G
EMC7	56851	genome.wustl.edu	37	15	34393857	34393857	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr15:34393857T>C	ENST00000256545.4	-	1	292	c.184A>G	c.(184-186)Atc>Gtc	p.I62V	PGBD4_ENST00000397766.2_5'Flank|EMC7_ENST00000532113.1_5'UTR	NM_020154.2	NP_064539.1	Q9NPA0	EMC7_HUMAN	ER membrane protein complex subunit 7	62						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										GCCGCCGAGATCCAGTCCTGA	0.617																																						dbGAP											0													115.0	113.0	113.0					15																	34393857		2201	4298	6499	-	-	-	SO:0001583	missense	0			AJ245874	CCDS10032.1	15q14	2012-05-30	2012-05-30	2012-05-30	ENSG00000134153	ENSG00000134153			24301	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 24"""	C15orf24		10873569, 22119785	Standard	NM_020154		Approved	C11orf3	uc001zhm.3	Q9NPA0	OTTHUMG00000129367	ENST00000256545.4:c.184A>G	15.37:g.34393857T>C	ENSP00000256545:p.Ile62Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC00|Q96ED5	Missense_Mutation	SNP	pfam_DUF2012,superfamily_Carb-bd-like_fold	p.I62V	ENST00000256545.4	37	c.184	CCDS10032.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.87|10.87	1.471469|1.471469	0.26423|0.26423	.|.	.|.	ENSG00000134153|ENSG00000134153	ENST00000527822|ENST00000256545	.|.	.|.	.|.	5.27|5.27	2.87|2.87	0.33458|0.33458	.|Carbohydrate-binding-like fold (1);Domain of unknown function DUF2012 (1);Carboxypeptidase, regulatory domain (1);	.|0.054916	.|0.64402	.|D	.|0.000001	T|T	0.27559|0.27559	0.0677|0.0677	N|N	0.16656|0.16656	0.425|0.425	0.43242|0.43242	D|D	0.995152|0.995152	.|B	.|0.11235	.|0.004	.|B	.|0.09377	.|0.004	T|T	0.05305|0.05305	-1.0893|-1.0893	5|9	.|0.10111	.|T	.|0.7	-16.4492|-16.4492	4.7173|4.7173	0.12901|0.12901	0.147:0.1449:0.0:0.7081|0.147:0.1449:0.0:0.7081	.|.	.|62	.|Q9NPA0	.|CO024_HUMAN	G|V	51|62	.|.	.|ENSP00000256545:I62V	D|I	-|-	2|1	0|0	C15orf24|C15orf24	32181149|32181149	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.899000|1.899000	0.39818|0.39818	0.998000|0.998000	0.38996|0.38996	0.477000|0.477000	0.44152|0.44152	GAT|ATC	EMC7	-	pfam_DUF2012,superfamily_Carb-bd-like_fold	ENSG00000134153		0.617	EMC7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EMC7	HGNC	protein_coding	OTTHUMT00000251519.1	54	0.00	0	T	NM_020154		34393857	34393857	-1	no_errors	ENST00000256545	ensembl	human	known	69_37n	missense	18	40.00	12	SNP	1.000	C
AMER1	139285	genome.wustl.edu	37	X	63412663	63412663	+	Silent	SNP	G	G	A			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chrX:63412663G>A	ENST00000330258.3	-	2	776	c.504C>T	c.(502-504)ggC>ggT	p.G168G	AMER1_ENST00000374869.3_Silent_p.G168G|AMER1_ENST00000403336.1_Silent_p.G168G	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	168					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									AGCCTTTTAGGCCTTTCTTTG	0.557																																						dbGAP											67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)											52.0	51.0	51.0					X																	63412663		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.504C>T	X.37:g.63412663G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2IB86|Q8N885	Silent	SNP	pfam_Uncharacterised_FAM123	p.G168	ENST00000330258.3	37	c.504	CCDS14377.2	X																																																																																			FAM123B	-	pfam_Uncharacterised_FAM123	ENSG00000184675		0.557	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM123B	HGNC	protein_coding	OTTHUMT00000316584.1	117	0.00	0	G	NM_152424		63412663	63412663	-1	no_errors	ENST00000330258	ensembl	human	known	69_37n	silent	35	23.91	11	SNP	0.982	A
FILIP1	27145	genome.wustl.edu	37	6	76063403	76063403	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr6:76063403T>A	ENST00000237172.7	-	4	811	c.481A>T	c.(481-483)Acc>Tcc	p.T161S	FILIP1_ENST00000393004.2_Missense_Mutation_p.T161S|FILIP1_ENST00000370020.1_Missense_Mutation_p.T62S	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	161										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						CGCCGGTAGGTTTCTTTCTGT	0.428																																						dbGAP											0													118.0	108.0	111.0					6																	76063403		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.481A>T	6.37:g.76063403T>A	ENSP00000237172:p.Thr161Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,prints_Tropomyosin	p.T161S	ENST00000237172.7	37	c.481	CCDS4984.1	6	.	.	.	.	.	.	.	.	.	.	T	17.82	3.483352	0.63962	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.41758	0.99;0.99;0.99	5.79	5.79	0.91817	Cortactin-binding protein-2, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.34861	0.0912	N	0.25890	0.77	0.54753	D	0.999988	D;P;P	0.89917	1.0;0.747;0.702	D;P;B	0.87578	0.998;0.617;0.355	T	0.17623	-1.0363	10	0.07175	T	0.84	-18.9778	16.1307	0.81436	0.0:0.0:0.0:1.0	.	161;161;161	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	S	161;161;62	ENSP00000376728:T161S;ENSP00000237172:T161S;ENSP00000359037:T62S	ENSP00000237172:T161S	T	-	1	0	FILIP1	76120123	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.817000	0.86213	2.209000	0.71365	0.459000	0.35465	ACC	FILIP1	-	pfam_Cortactin-binding_p2_N	ENSG00000118407		0.428	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FILIP1	HGNC	protein_coding	OTTHUMT00000041263.1	69	0.00	0	T	XM_029179		76063403	76063403	-1	no_errors	ENST00000237172	ensembl	human	known	69_37n	missense	15	63.41	26	SNP	1.000	A
GABRR3	200959	genome.wustl.edu	37	3	97705686	97705686	+	RNA	DEL	G	G	-			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr3:97705686delG	ENST00000472788.1	-	0	1246					NM_001105580.2	NP_001099050.1	A8MPY1	GBRR3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 3 (gene/pseudogene)						gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			large_intestine(2)|lung(1)	3					Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	AATCGGTGCTGGGGCTGCATA	0.433																																						dbGAP											0													82.0	73.0	76.0					3																	97705686		1884	4105	5989	-	-	-			0			Y18994	CCDS54617.1	3q11.2	2014-03-25	2014-03-25		ENSG00000183185	ENSG00000183185		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	17969	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 3"""		"""gamma-aminobutyric acid (GABA) receptor, rho 3"", ""gamma-aminobutyric acid (GABA) A receptor, rho 3"""			10542332	Standard	NM_001105580		Approved		uc021xbp.1	A8MPY1	OTTHUMG00000159135		3.37:g.97705686delG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UIV9	Frame_Shift_Del	DEL	NULL	p.S416fs	ENST00000472788.1	37	c.1245		3																																																																																			GABRR3	-	NULL	ENSG00000183185		0.433	GABRR3-002	KNOWN	not_organism_supported|basic	polymorphic_pseudogene	GABRR3	HGNC	polymorphic_pseudogene	OTTHUMT00000353445.2	67	0.00	0	G			97705686	97705686	-1	pseudogene	ENST00000472788	ensembl	human	known	69_37n	frame_shift_del	20	56.25	27	DEL	0.985	-
GGT3P	2679	genome.wustl.edu	37	22	18762636	18762636	+	RNA	SNP	G	G	A	rs518944		TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr22:18762636G>A	ENST00000412448.1	-	0	1600							A6NGU5	GGT3_HUMAN	gamma-glutamyltransferase 3 pseudogene						glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)										CCCGTCATCCGGCGTGTAGAA	0.622																																						dbGAP											0																																										-	-	-			0					22q11.21	2008-08-05	2008-03-10	2008-03-10	ENSG00000197421	ENSG00000197421		"""Gamma-glutamyltransferases"""	4252	pseudogene	pseudogene			"""gamma-glutamyltransferase 3"""	GGT3		8104871, 18357469	Standard	NR_003267		Approved		uc002zob.1	A6NGU5	OTTHUMG00000150161		22.37:g.18762636G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000412448.1	37	NULL		22																																																																																			GGT3P	-	-	ENSG00000197421		0.622	GGT3P-002	KNOWN	basic	processed_transcript	GGT3P	HGNC	pseudogene	OTTHUMT00000341281.1	13	0.00	0	G	NR_003267		18762636	18762636	-1	no_errors	ENST00000412448	ensembl	human	known	69_37n	rna	0	100.00	3	SNP	0.088	A
HERC2	8924	genome.wustl.edu	37	15	28501279	28501279	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr15:28501279G>A	ENST00000261609.7	-	18	2810	c.2702C>T	c.(2701-2703)gCg>gTg	p.A901V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCGCTCCTCCGCGGTGGGCAG	0.711																																						dbGAP											0													14.0	16.0	15.0					15																	28501279		2181	4273	6454	-	-	-	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.2702C>T	15.37:g.28501279G>A	ENSP00000261609:p.Ala901Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.A901V	ENST00000261609.7	37	c.2702	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	G	35	5.457142	0.96223	.	.	ENSG00000128731	ENST00000261609	T	0.42900	0.96	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.65954	0.2741	M	0.77103	2.36	0.80722	D	1	D	0.76494	0.999	D	0.65874	0.939	T	0.68591	-0.5368	10	0.54805	T	0.06	.	19.0185	0.92903	0.0:0.0:1.0:0.0	.	901	O95714	HERC2_HUMAN	V	901	ENSP00000261609:A901V	ENSP00000261609:A901V	A	-	2	0	HERC2	26174874	1.000000	0.71417	0.655000	0.29622	0.928000	0.56348	9.792000	0.99085	2.500000	0.84329	0.539000	0.68188	GCG	HERC2	-	NULL	ENSG00000128731		0.711	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	80	0.00	0	G	NM_004667		28501279	28501279	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	missense	32	28.89	13	SNP	0.996	A
HSPA5	3309	genome.wustl.edu	37	9	128002548	128002548	+	Missense_Mutation	SNP	A	A	G	rs191087735		TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr9:128002548A>G	ENST00000324460.6	-	3	598	c.395T>C	c.(394-396)aTt>aCt	p.I132T	RP11-65N13.8_ENST00000468244.1_RNA	NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	132					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	CCCACCTCCAATATCAACTTG	0.343										Prostate(1;0.17)			A|||	1	0.000199681	0.0	0.0	5008	,	,		17578	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													95.0	87.0	90.0					9																	128002548		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.395T>C	9.37:g.128002548A>G	ENSP00000324173:p.Ile132Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.I132T	ENST00000324460.6	37	c.395	CCDS6863.1	9	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	15.26	2.779999	0.49891	.	.	ENSG00000044574	ENST00000324460;ENST00000401067	T	0.03801	3.8	4.71	4.71	0.59529	.	0.149540	0.64402	D	0.000019	T	0.04407	0.0121	N	0.17723	0.515	0.58432	D	0.999993	B	0.02656	0.0	B	0.12837	0.008	T	0.43393	-0.9394	10	0.45353	T	0.12	-8.2906	13.3886	0.60809	1.0:0.0:0.0:0.0	.	132	P11021	GRP78_HUMAN	T	132	ENSP00000324173:I132T	ENSP00000324173:I132T	I	-	2	0	HSPA5	127042369	1.000000	0.71417	0.996000	0.52242	0.970000	0.65996	9.300000	0.96151	1.762000	0.52044	0.459000	0.35465	ATT	HSPA5	-	pfam_Hsp_70_fam	ENSG00000044574		0.343	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA5	HGNC	protein_coding	OTTHUMT00000054062.1	65	0.00	0	A			128002548	128002548	-1	no_errors	ENST00000324460	ensembl	human	known	69_37n	missense	18	60.87	28	SNP	1.000	G
HSPA8	3312	genome.wustl.edu	37	11	122929479	122929479	+	Silent	SNP	G	G	A			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr11:122929479G>A	ENST00000532636.1	-	7	1502	c.1383C>T	c.(1381-1383)ctC>ctT	p.L461L	HSPA8_ENST00000534319.1_Silent_p.L225L|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000453788.2_Silent_p.L461L|HSPA8_ENST00000533540.1_Silent_p.L315L|SNORD14E_ENST00000364009.1_RNA|HSPA8_ENST00000534624.1_Silent_p.L461L|HSPA8_ENST00000526862.1_5'Flank|HSPA8_ENST00000227378.3_Silent_p.L461L|SNORD14C_ENST00000365382.1_RNA|HSPA8_ENST00000526110.1_Silent_p.L442L			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	461					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GTATGCCTGTGAGTTCAAACT	0.448																																					Colon(21;486 594 5900 6733 14272)	dbGAP											0													92.0	81.0	85.0					11																	122929479		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.1383C>T	11.37:g.122929479G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3R6	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.L461	ENST00000532636.1	37	c.1383	CCDS8440.1	11																																																																																			HSPA8	-	pfam_Hsp_70_fam	ENSG00000109971		0.448	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	HSPA8	HGNC	protein_coding	OTTHUMT00000387515.1	102	0.00	0	G			122929479	122929479	-1	no_errors	ENST00000534624	ensembl	human	known	69_37n	silent	8	75.00	24	SNP	1.000	A
IL13RA2	3598	genome.wustl.edu	37	X	114239780	114239780	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chrX:114239780G>T	ENST00000371936.1	-	10	1345	c.1096C>A	c.(1096-1098)Cca>Aca	p.P366T	IL13RA2_ENST00000243213.1_Missense_Mutation_p.P366T			Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2	366					cytokine-mediated signaling pathway (GO:0019221)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	23						TAGGTGTTTGGCTTACGCAAA	0.358																																						dbGAP											0													74.0	65.0	68.0					X																	114239780		2203	4300	6503	-	-	-	SO:0001583	missense	0			X95302	CCDS14565.1	Xq23	2014-01-21			ENSG00000123496	ENSG00000123496		"""Interleukins and interleukin receptors"", ""CD molecules"""	5975	protein-coding gene	gene with protein product	"""cancer/testis antigen 19"""	300130				8663118, 9083087	Standard	NM_000640		Approved	IL-13R, IL13BP, CD213a2, CT19	uc004epx.3	Q14627	OTTHUMG00000022229	ENST00000371936.1:c.1096C>A	X.37:g.114239780G>T	ENSP00000361004:p.Pro366Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7E2|O00667	Missense_Mutation	SNP	pfam_IL6_recept-bd,superfamily_Fibronectin_type3	p.P366T	ENST00000371936.1	37	c.1096	CCDS14565.1	X	.	.	.	.	.	.	.	.	.	.	G	3.097	-0.185704	0.06340	.	.	ENSG00000123496	ENST00000371936;ENST00000243213	D;D	0.89552	-2.53;-2.53	3.87	2.04	0.26737	.	3.278640	0.01214	N	0.007924	D	0.82346	0.5017	N	0.22421	0.69	0.09310	N	1	B	0.16166	0.016	B	0.13407	0.009	T	0.65257	-0.6212	10	0.23302	T	0.38	0.0016	7.7799	0.29058	0.0:0.1746:0.6517:0.1737	.	366	Q14627	I13R2_HUMAN	T	366	ENSP00000361004:P366T;ENSP00000243213:P366T	ENSP00000243213:P366T	P	-	1	0	IL13RA2	114146036	0.019000	0.18553	0.000000	0.03702	0.000000	0.00434	1.487000	0.35540	0.088000	0.17205	-1.471000	0.01009	CCA	IL13RA2	-	NULL	ENSG00000123496		0.358	IL13RA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL13RA2	HGNC	protein_coding	OTTHUMT00000057966.1	88	0.00	0	G	NM_000640		114239780	114239780	-1	no_errors	ENST00000243213	ensembl	human	known	69_37n	missense	34	26.09	12	SNP	0.000	T
IZUMO3	100129669	genome.wustl.edu	37	9	24543688	24543688	+	Silent	SNP	A	A	G			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr9:24543688A>G	ENST00000543880.2	-	6	786	c.555T>C	c.(553-555)gcT>gcC	p.A185A	RP11-20A20.2_ENST00000602851.1_lincRNA|IZUMO3_ENST00000604921.1_Silent_p.A179A			Q5VZ72	IZUM3_HUMAN	IZUMO family member 3	185						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)										CCAGTATTACAGCTGTTGCCA	0.418																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS65020.1	9p21.3	2014-02-17	2010-07-29	2010-07-29	ENSG00000205442	ENSG00000205442		"""-"""	31421	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 134"""	C9orf134		19658160, 22957301	Standard	NM_001271706		Approved	bA20A20.1	uc031tdg.1	Q5VZ72	OTTHUMG00000019704	ENST00000543880.2:c.555T>C	9.37:g.24543688A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.C118R	ENST00000543880.2	37	c.352		9	.	.	.	.	.	.	.	.	.	.	A	0.189	-1.054838	0.01965	.	.	ENSG00000205442	ENST00000412335	.	.	.	4.69	-2.62	0.06152	.	.	.	.	.	T	0.18087	0.0434	.	.	.	.	.	.	.	.	.	.	.	.	T	0.27297	-1.0078	3	.	.	.	1.113	0.9384	0.01350	0.354:0.3161:0.176:0.1538	.	.	.	.	R	118	.	.	C	-	1	0	IZUMO3	24533688	0.014000	0.17966	0.000000	0.03702	0.001000	0.01503	0.593000	0.23999	-0.191000	0.10448	0.528000	0.53228	TGT	IZUMO3	-	NULL	ENSG00000205442		0.418	IZUMO3-001	NOVEL	not_organism_supported|basic	protein_coding	IZUMO3	HGNC	protein_coding	OTTHUMT00000467652.1	58	0.00	0	A	NM_001271706		24543688	24543688	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000412335	ensembl	human	putative	69_37n	missense	2	84.62	11	SNP	0.000	G
KIF27	55582	genome.wustl.edu	37	9	86518580	86518580	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr9:86518580G>A	ENST00000297814.2	-	4	996	c.853C>T	c.(853-855)Cgc>Tgc	p.R285C	KIF27_ENST00000413982.1_Missense_Mutation_p.R285C|KIF27_ENST00000334204.2_Missense_Mutation_p.R285C	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	285	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						CTCTTCCTGCGTGGGTCCCCA	0.438																																						dbGAP											0													78.0	83.0	82.0					9																	86518580		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.853C>T	9.37:g.86518580G>A	ENSP00000297814:p.Arg285Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R285C	ENST00000297814.2	37	c.853	CCDS6665.1	9	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934879	0.52866	.	.	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204	T;T;T	0.73469	-0.75;-0.75;-0.75	5.66	5.66	0.87406	Kinesin, motor domain (3);	0.164918	0.28241	N	0.016066	D	0.82981	0.5155	M	0.70842	2.15	0.41098	D	0.985644	D;D;D	0.71674	0.998;0.998;0.998	P;P;P	0.61940	0.629;0.847;0.896	D	0.84204	0.0452	10	0.59425	D	0.04	.	12.792	0.57539	0.0:0.0:0.7273:0.2727	.	285;285;285	Q86VH2-3;Q86VH2-2;Q86VH2	.;.;KIF27_HUMAN	C	285	ENSP00000297814:R285C;ENSP00000401688:R285C;ENSP00000333928:R285C	ENSP00000297814:R285C	R	-	1	0	KIF27	85708400	0.847000	0.29606	1.000000	0.80357	0.467000	0.32768	3.084000	0.50143	2.657000	0.90304	0.655000	0.94253	CGC	KIF27	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom	ENSG00000165115		0.438	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF27	HGNC	protein_coding	OTTHUMT00000052861.1	61	0.00	0	G	NM_017576		86518580	86518580	-1	no_errors	ENST00000297814	ensembl	human	known	69_37n	missense	22	12.00	3	SNP	0.992	A
KLF15	28999	genome.wustl.edu	37	3	126071710	126071710	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr3:126071710A>G	ENST00000296233.3	-	2	286	c.56T>C	c.(55-57)gTt>gCt	p.V19A	KLF15_ENST00000509675.1_5'UTR	NM_014079.3	NP_054798.1	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	19					cardiac muscle hypertrophy in response to stress (GO:0014898)|cellular response to peptide (GO:1901653)|glial cell differentiation (GO:0010001)|glomerular visceral epithelial cell differentiation (GO:0072112)|glucose transport (GO:0015758)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(7)|ovary(2)|skin(2)	12				GBM - Glioblastoma multiforme(114;0.147)		CAGATACCCAACTGGGCATTT	0.607																																						dbGAP											0													45.0	35.0	38.0					3																	126071710		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029254	CCDS3036.1	3q21.3	2013-01-08			ENSG00000163884	ENSG00000163884		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	14536	protein-coding gene	gene with protein product	"""kidney-enriched Kruppel-like factor"""	606465				10982849	Standard	NM_014079		Approved	KKLF	uc011bkk.1	Q9UIH9	OTTHUMG00000162689	ENST00000296233.3:c.56T>C	3.37:g.126071710A>G	ENSP00000296233:p.Val19Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V19A	ENST00000296233.3	37	c.56	CCDS3036.1	3	.	.	.	.	.	.	.	.	.	.	A	1.123	-0.654720	0.03480	.	.	ENSG00000163884	ENST00000296233	T	0.07567	3.18	4.33	1.9	0.25705	.	0.908585	0.09530	N	0.789708	T	0.06690	0.0171	L	0.34521	1.04	0.09310	N	1	B	0.14012	0.009	B	0.14578	0.011	T	0.44620	-0.9316	10	0.23302	T	0.38	.	6.6734	0.23080	0.759:0.0:0.241:0.0	.	19	Q9UIH9	KLF15_HUMAN	A	19	ENSP00000296233:V19A	ENSP00000296233:V19A	V	-	2	0	KLF15	127554400	0.012000	0.17670	0.001000	0.08648	0.354000	0.29330	2.419000	0.44671	0.261000	0.21753	-0.353000	0.07706	GTT	KLF15	-	NULL	ENSG00000163884		0.607	KLF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF15	HGNC	protein_coding	OTTHUMT00000370096.1	42	0.00	0	A	NM_014079		126071710	126071710	-1	no_errors	ENST00000296233	ensembl	human	known	69_37n	missense	8	42.86	6	SNP	0.002	G
LRRC4C	57689	genome.wustl.edu	37	11	40136396	40136396	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr11:40136396C>T	ENST00000278198.2	-	2	3410	c.1447G>A	c.(1447-1449)Gac>Aac	p.D483N	LRRC4C_ENST00000528697.1_Missense_Mutation_p.D483N|LRRC4C_ENST00000530763.1_Missense_Mutation_p.D483N|LRRC4C_ENST00000527150.1_Missense_Mutation_p.D483N			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	483					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GTCTCCCAGTCGACCACTGGA	0.502																																						dbGAP											0													127.0	108.0	114.0					11																	40136396		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1447G>A	11.37:g.40136396C>T	ENSP00000278198:p.Asp483Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0T1|Q7L0N3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.D483N	ENST00000278198.2	37	c.1447	CCDS31464.1	11	.	.	.	.	.	.	.	.	.	.	C	4.070	0.010745	0.07912	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.55052	0.54;0.54;0.54;0.54	5.84	4.93	0.64822	.	0.333762	0.33591	N	0.004755	T	0.35364	0.0929	N	0.22421	0.69	0.31405	N	0.67621	B	0.17465	0.022	B	0.13407	0.009	T	0.34179	-0.9839	10	0.17832	T	0.49	.	10.2604	0.43423	0.0:0.8346:0.0:0.1654	.	483	Q9HCJ2	LRC4C_HUMAN	N	483	ENSP00000278198:D483N;ENSP00000436976:D483N;ENSP00000437132:D483N;ENSP00000434761:D483N	ENSP00000278198:D483N	D	-	1	0	LRRC4C	40092972	0.971000	0.33674	0.968000	0.41197	0.956000	0.61745	1.876000	0.39588	1.461000	0.47929	0.655000	0.94253	GAC	LRRC4C	-	NULL	ENSG00000148948		0.502	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRRC4C	HGNC	protein_coding	OTTHUMT00000389499.1	188	0.00	0	C	NM_020929		40136396	40136396	-1	no_errors	ENST00000527150	ensembl	human	known	69_37n	missense	84	16.83	17	SNP	0.935	T
MYO1H	283446	genome.wustl.edu	37	12	109879456	109879456	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr12:109879456G>A	ENST00000431443.2	+	25	2557	c.2557G>A	c.(2557-2559)Gga>Aga	p.G853R	MYO1H_ENST00000310903.5_Missense_Mutation_p.G843R	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	853	Myosin tail. {ECO:0000255}.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						AATCTTCAGGGGAAGGAAAGA	0.398																																						dbGAP											0													95.0	85.0	88.0					12																	109879456		1858	4102	5960	-	-	-	SO:0001583	missense	0				CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.2557G>A	12.37:g.109879456G>A	ENSP00000444076:p.Gly853Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H3C6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.G853R	ENST00000431443.2	37	c.2557		12	.	.	.	.	.	.	.	.	.	.	G	24.7	4.559192	0.86335	.	.	ENSG00000174527	ENST00000310903;ENST00000431443;ENST00000542268	T;T	0.55234	0.53;0.53	5.09	5.09	0.68999	Myosin tail 2 (1);	0.000000	0.46145	D	0.000318	T	0.76392	0.3981	M	0.86953	2.85	0.51767	D	0.99993	D;D	0.76494	0.999;0.999	D;D	0.72338	0.977;0.962	T	0.81013	-0.1125	10	0.72032	D	0.01	.	17.4368	0.87554	0.0:0.0:1.0:0.0	.	853;843	Q8N1T3;F5H3C6	MYO1H_HUMAN;.	R	843;853;34	ENSP00000439182:G843R;ENSP00000444076:G853R	ENSP00000439182:G843R	G	+	1	0	MYO1H	108363839	1.000000	0.71417	0.994000	0.49952	0.756000	0.42949	8.896000	0.92521	2.524000	0.85096	0.655000	0.94253	GGA	MYO1H	-	pfam_Myosin_tail_2	ENSG00000174527		0.398	MYO1H-201	KNOWN	basic	protein_coding	MYO1H	HGNC	protein_coding		37	0.00	0	G	NM_173597		109879456	109879456	+1	no_errors	ENST00000431443	ensembl	human	known	69_37n	missense	29	27.50	11	SNP	1.000	A
NAALAD2	10003	genome.wustl.edu	37	11	89885543	89885543	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr11:89885543delA	ENST00000534061.1	+	6	917	c.687delA	c.(685-687)gtafs	p.V229fs	NAALAD2_ENST00000321955.4_Frame_Shift_Del_p.V229fs|NAALAD2_ENST00000525171.1_Frame_Shift_Del_p.V229fs|NAALAD2_ENST00000375944.3_Frame_Shift_Del_p.V229fs	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	229					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				CTCCTGAGGTACAGCCATATC	0.473																																						dbGAP											0													118.0	100.0	106.0					11																	89885543		2201	4299	6500	-	-	-	SO:0001589	frameshift_variant	0			AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.687delA	11.37:g.89885543delA	ENSP00000432481:p.Val229fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQR4|Q4KKV4|Q4VAM9	Frame_Shift_Del	DEL	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.Q230fs	ENST00000534061.1	37	c.687	CCDS8288.1	11																																																																																			NAALAD2	-	pfam_Protease-assoc_domain	ENSG00000077616		0.473	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALAD2	HGNC	protein_coding	OTTHUMT00000389424.2	56	0.00	0	A	NM_005467		89885543	89885543	+1	no_errors	ENST00000534061	ensembl	human	known	69_37n	frame_shift_del	14	12.50	2	DEL	0.997	-
NCAPD3	23310	genome.wustl.edu	37	11	134055270	134055270	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr11:134055270delC	ENST00000534548.2	-	17	2261	c.2197delG	c.(2197-2199)gacfs	p.D733fs	RP11-700F16.3_ENST00000531710.1_RNA	NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	733					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CTGCTGTAGTCCAGCCTGGGT	0.438																																						dbGAP											0													64.0	61.0	62.0					11																	134055270		2201	4296	6497	-	-	-	SO:0001589	frameshift_variant	0			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.2197delG	11.37:g.134055270delC	ENSP00000433681:p.Asp733fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS2|Q4KMQ9	Frame_Shift_Del	DEL	superfamily_ARM-type_fold,pirsf_Condns_HCP-6	p.D733fs	ENST00000534548.2	37	c.2197	CCDS31723.1	11																																																																																			NCAPD3	-	superfamily_ARM-type_fold,pirsf_Condns_HCP-6	ENSG00000151503		0.438	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD3	HGNC	protein_coding	OTTHUMT00000393575.2	74	0.00	0	C	NM_015261		134055270	134055270	-1	no_errors	ENST00000534548	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	1.000	-
TENM2	57451	genome.wustl.edu	37	5	167589717	167589717	+	Missense_Mutation	SNP	G	G	A	rs577591482		TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr5:167589717G>A	ENST00000518659.1	+	13	2563	c.2524G>A	c.(2524-2526)Gtt>Att	p.V842I	TENM2_ENST00000545108.1_Missense_Mutation_p.V842I|TENM2_ENST00000519204.1_Missense_Mutation_p.V721I|CTB-178M22.1_ENST00000517408.1_RNA|TENM2_ENST00000520394.1_Missense_Mutation_p.V610I|TENM2_ENST00000403607.2_Missense_Mutation_p.V666I	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	842					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CGGATGCAACGTTGCCATGGA	0.567													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18524	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													75.0	78.0	77.0					5																	167589717		2084	4218	6302	-	-	-	SO:0001583	missense	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.2524G>A	5.37:g.167589717G>A	ENSP00000429430:p.Val842Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl,superfamily_Cytokine_IL1-like,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.V842I	ENST00000518659.1	37	c.2524		5	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698942	0.68501	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19	5.42	5.42	0.78866	.	0.053894	0.64402	N	0.000001	T	0.65260	0.2674	N	0.20445	0.575	0.43698	D	0.996156	D;D;D	0.71674	0.994;0.998;0.992	P;P;D	0.67548	0.696;0.797;0.952	T	0.59380	-0.7465	10	0.13470	T	0.59	.	19.2383	0.93871	0.0:0.0:1.0:0.0	.	842;842;610	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	I	842;842;721;610;666	ENSP00000429430:V842I;ENSP00000438635:V842I;ENSP00000428964:V721I;ENSP00000427874:V610I;ENSP00000384905:V666I	ENSP00000384905:V666I	V	+	1	0	ODZ2	167522295	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.058000	0.89460	2.525000	0.85131	0.655000	0.94253	GTT	ODZ2	-	superfamily_ConA-like_lec_gl	ENSG00000145934		0.567	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ODZ2	HGNC	protein_coding	OTTHUMT00000376096.1	48	0.00	0	G	NM_001122679		167589717	167589717	+1	no_errors	ENST00000518659	ensembl	human	known	69_37n	missense	37	21.28	10	SNP	1.000	A
OR4K5	79317	genome.wustl.edu	37	14	20389502	20389502	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr14:20389502T>C	ENST00000315915.4	+	1	762	c.737T>C	c.(736-738)gTa>gCa	p.V246A		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CATATTGCAGTAGTAATATTA	0.403																																						dbGAP											0													241.0	254.0	250.0					14																	20389502		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		ENST00000315915.4:c.737T>C	14.37:g.20389502T>C	ENSP00000319511:p.Val246Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFA7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V246A	ENST00000315915.4	37	c.737	CCDS32024.1	14	.	.	.	.	.	.	.	.	.	.	.	17.51	3.407540	0.62399	.	.	ENSG00000176281	ENST00000315915	T	0.00237	8.47	4.52	4.52	0.55395	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45361	D	0.000377	T	0.00384	0.0012	M	0.74881	2.28	0.35199	D	0.774076	P	0.49635	0.926	P	0.51999	0.687	T	0.73325	-0.4018	10	0.87932	D	0	.	11.8114	0.52185	0.0:0.0:0.0:1.0	.	246	Q8NGD3	OR4K5_HUMAN	A	246	ENSP00000319511:V246A	ENSP00000319511:V246A	V	+	2	0	OR4K5	19459342	0.984000	0.35163	0.143000	0.22291	0.679000	0.39708	2.738000	0.47401	1.886000	0.54624	0.533000	0.62120	GTA	OR4K5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176281		0.403	OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K5	HGNC	protein_coding	OTTHUMT00000409867.1	131	0.00	0	T	NM_001005483		20389502	20389502	+1	no_errors	ENST00000315915	ensembl	human	known	69_37n	missense	90	15.89	17	SNP	0.702	C
PAWR	5074	genome.wustl.edu	37	12	80083615	80083615	+	Missense_Mutation	SNP	C	C	G	rs8176806		TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr12:80083615C>G	ENST00000328827.4	-	2	782	c.410G>C	c.(409-411)gGc>gCc	p.G137A	RP11-530C5.1_ENST00000551995.1_lincRNA|PAWR_ENST00000547571.1_5'UTR	NM_002583.2	NP_002574.2	Q96IZ0	PAWR_HUMAN	PRKC, apoptosis, WT1, regulator	137			G -> A. {ECO:0000269|Ref.3}.		actin filament bundle assembly (GO:0051017)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|interleukin-2 biosynthetic process (GO:0042094)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|positive regulation of apoptotic process (GO:0043065)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|enzyme binding (GO:0019899)|leucine zipper domain binding (GO:0043522)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						CGAGCTCTTGCCCTTCTCTGG	0.721																																						dbGAP											0													10.0	10.0	10.0					12																	80083615		2196	4293	6489	-	-	-	SO:0001583	missense	0			U63809	CCDS31863.1	12q21.2	2013-03-07			ENSG00000177425	ENSG00000177425			8614	protein-coding gene	gene with protein product	"""prostate apoptosis response-4"""	601936				8943350, 9790775	Standard	NM_002583		Approved	par-4, PAR4	uc001syx.3	Q96IZ0	OTTHUMG00000170080	ENST00000328827.4:c.410G>C	12.37:g.80083615C>G	ENSP00000328088:p.Gly137Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O75796|Q6FHY9|Q8N700	Missense_Mutation	SNP	NULL	p.G137A	ENST00000328827.4	37	c.410	CCDS31863.1	12	.	.	.	.	.	.	.	.	.	.	C	13.24	2.176916	0.38413	.	.	ENSG00000177425	ENST00000328827	T	0.06608	3.28	3.48	3.48	0.39840	.	0.227351	0.39687	N	0.001296	T	0.07279	0.0184	L	0.40543	1.245	0.31868	N	0.620076	P	0.45957	0.869	P	0.45276	0.475	T	0.08432	-1.0722	9	.	.	.	-4.84	9.1021	0.36676	0.0:0.8972:0.0:0.1028	rs8176806	137	Q96IZ0	PAWR_HUMAN	A	137	ENSP00000328088:G137A	.	G	-	2	0	PAWR	78607746	1.000000	0.71417	0.997000	0.53966	0.547000	0.35210	2.225000	0.42954	1.752000	0.51891	0.563000	0.77884	GGC	PAWR	-	NULL	ENSG00000177425		0.721	PAWR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAWR	HGNC	protein_coding	OTTHUMT00000407175.1	31	0.00	0	C	NM_002583		80083615	80083615	-1	no_errors	ENST00000328827	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	1.000	G
PCBP4	57060	genome.wustl.edu	37	3	51993955	51993956	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr3:51993955_51993956delCA	ENST00000461554.1	-	8	802_803	c.471_472delTG	c.(469-474)gatgccfs	p.A158fs	PCBP4_ENST00000355852.2_Frame_Shift_Del_p.A158fs|PCBP4_ENST00000428823.2_Intron|RP11-155D18.12_ENST00000488257.1_RNA|PCBP4_ENST00000395013.3_Intron|PCBP4_ENST00000471622.1_Frame_Shift_Del_p.A158fs|PCBP4_ENST00000484633.1_Intron|PCBP4_ENST00000322099.7_Frame_Shift_Del_p.A158fs|PCBP4_ENST00000395014.2_Frame_Shift_Del_p.A179fs	NM_001174100.1	NP_001167571.1	P57723	PCBP4_HUMAN	poly(rC) binding protein 4	158						cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|large_intestine(2)|lung(2)|prostate(1)|stomach(1)	8				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGGATGATGGCATCAGGCACCC	0.624																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF176330	CCDS2839.1, CCDS2840.1, CCDS2840.2	3p21	2013-07-16	2001-11-28		ENSG00000090097	ENSG00000090097			8652	protein-coding gene	gene with protein product	"""RNA binding protein MCG10"", ""LYST-interacting protein"", ""alphaCP-4 protein"""	608503	"""poly(rC)-binding protein 4"""			10936052	Standard	NM_033008		Approved	MCG10, LIP4	uc003dch.2	P57723	OTTHUMG00000157366	ENST00000461554.1:c.471_472delTG	3.37:g.51993955_51993956delCA	ENSP00000417196:p.Ala158fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AH7	Frame_Shift_Del	DEL	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.A179fs	ENST00000461554.1	37	c.535_534	CCDS2839.1	3																																																																																			PCBP4	-	smart_KH_dom	ENSG00000090097		0.624	PCBP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCBP4	HGNC	protein_coding	OTTHUMT00000348597.1	57	0.00	0	CA	NM_020418		51993955	51993956	-1	no_errors	ENST00000395014	ensembl	human	known	69_37n	frame_shift_del	17	10.53	2	DEL	0.952:0.452	-
PCDHA2	56146	genome.wustl.edu	37	5	140176412	140176412	+	Silent	SNP	G	G	A			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr5:140176412G>A	ENST00000526136.1	+	1	1863	c.1863G>A	c.(1861-1863)ccG>ccA	p.P621P	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Silent_p.P621P|PCDHA2_ENST00000520672.2_Silent_p.P621P|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	621	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCGCATCCCGTTCCGCGTGG	0.642																																						dbGAP											0													112.0	107.0	109.0					5																	140176412		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1863G>A	5.37:g.140176412G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75287|Q9BTV3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P621	ENST00000526136.1	37	c.1863	CCDS54914.1	5																																																																																			PCDHA2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204969		0.642	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	HGNC	protein_coding	OTTHUMT00000372877.3	184	0.00	0	G	NM_018905		140176412	140176412	+1	no_errors	ENST00000526136	ensembl	human	known	69_37n	silent	115	10.85	14	SNP	0.404	A
PDZD2	23037	genome.wustl.edu	37	5	32074112	32074112	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr5:32074112C>T	ENST00000438447.1	+	18	3288	c.2900C>T	c.(2899-2901)gCc>gTc	p.A967V	PDZD2_ENST00000282493.3_Missense_Mutation_p.A967V			O15018	PDZD2_HUMAN	PDZ domain containing 2	967					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.A967V(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TGCTACGATGCCAACGATGCC	0.602																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											66.0	70.0	68.0					5																	32074112		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.2900C>T	5.37:g.32074112C>T	ENSP00000402033:p.Ala967Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A967V	ENST00000438447.1	37	c.2900	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	C	14.21	2.467185	0.43839	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.07444	3.19;3.19	5.16	3.28	0.37604	.	0.909484	0.09133	N	0.844048	T	0.06462	0.0166	N	0.19112	0.55	0.09310	N	1	B;B	0.34103	0.08;0.437	B;B	0.32864	0.027;0.154	T	0.40942	-0.9536	10	0.48119	T	0.1	.	8.4159	0.32670	0.1612:0.5034:0.3354:0.0	.	793;967	B4E3P2;O15018	.;PDZD2_HUMAN	V	967;769;967	ENSP00000402033:A967V;ENSP00000282493:A967V	ENSP00000282493:A967V	A	+	2	0	PDZD2	32109869	0.001000	0.12720	0.000000	0.03702	0.987000	0.75469	0.083000	0.14871	0.506000	0.28125	0.551000	0.68910	GCC	PDZD2	-	NULL	ENSG00000133401		0.602	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	41	0.00	0	C			32074112	32074112	+1	no_errors	ENST00000282493	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	0.001	T
PCDHB5	26167	genome.wustl.edu	37	5	140516842	140516842	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr5:140516842C>T	ENST00000231134.5	+	1	2043	c.1826C>T	c.(1825-1827)aCg>aTg	p.T609M		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	609	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCAAGGCCACGGAGCCCGGG	0.716																																						dbGAP											0													45.0	48.0	47.0					5																	140516842		2148	4216	6364	-	-	-	SO:0001583	missense	0			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1826C>T	5.37:g.140516842C>T	ENSP00000231134:p.Thr609Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q549F4|Q9UFU9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T609M	ENST00000231134.5	37	c.1826	CCDS4247.1	5	.	.	.	.	.	.	.	.	.	.	C	12.91	2.078697	0.36662	.	.	ENSG00000113209	ENST00000231134	T	0.52526	0.66	4.65	2.8	0.32819	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.68833	0.3044	M	0.85373	2.75	0.29261	N	0.871315	D	0.89917	1.0	D	0.79108	0.992	T	0.64041	-0.6500	9	0.87932	D	0	.	9.8666	0.41148	0.0:0.7819:0.1403:0.0778	.	609	Q9Y5E4	PCDB5_HUMAN	M	609	ENSP00000231134:T609M	ENSP00000231134:T609M	T	+	2	0	PCDHB5	140497026	0.001000	0.12720	1.000000	0.80357	0.444000	0.32077	0.108000	0.15396	0.475000	0.27415	-0.451000	0.05528	ACG	PCDHB5	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113209		0.716	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB5	HGNC	protein_coding	OTTHUMT00000251811.1	218	0.00	0	C	NM_015669		140516842	140516842	+1	no_errors	ENST00000231134	ensembl	human	known	69_37n	missense	99	30.28	43	SNP	0.991	T
PHIP	55023	genome.wustl.edu	37	6	79698009	79698009	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr6:79698009delG	ENST00000275034.4	-	21	2544	c.2377delC	c.(2377-2379)caafs	p.Q793fs		NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	793					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TAATTGTGTTGATTTGTCTGT	0.343																																						dbGAP											0													165.0	156.0	159.0					6																	79698009		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.2377delC	6.37:g.79698009delG	ENSP00000275034:p.Gln793fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Frame_Shift_Del	DEL	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quinonprotein_ADH-like,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.Q793fs	ENST00000275034.4	37	c.2377	CCDS4987.1	6																																																																																			PHIP	-	NULL	ENSG00000146247		0.343	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHIP	HGNC	protein_coding	OTTHUMT00000041297.2	87	0.00	0	G			79698009	79698009	-1	no_errors	ENST00000275034	ensembl	human	known	69_37n	frame_shift_del	43	16.98	9	DEL	1.000	-
PHIP	55023	genome.wustl.edu	37	6	79698011	79698011	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr6:79698011T>A	ENST00000275034.4	-	21	2542	c.2375A>T	c.(2374-2376)aAt>aTt	p.N792I		NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	792					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		ATTGTGTTGATTTGTCTGTTG	0.353																																						dbGAP											0													165.0	155.0	158.0					6																	79698011		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.2375A>T	6.37:g.79698011T>A	ENSP00000275034:p.Asn792Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quinonprotein_ADH-like,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.N792I	ENST00000275034.4	37	c.2375	CCDS4987.1	6	.	.	.	.	.	.	.	.	.	.	T	17.94	3.511859	0.64522	.	.	ENSG00000146247	ENST00000275034	T	0.29655	1.56	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.39860	0.1094	M	0.61703	1.905	0.54753	D	0.999982	D;D	0.65815	0.995;0.995	D;D	0.72982	0.979;0.979	T	0.23404	-1.0189	9	.	.	.	-23.2244	12.1435	0.54010	0.0:0.0:0.0:1.0	.	792;792	A7J992;Q8WWQ0	.;PHIP_HUMAN	I	792	ENSP00000275034:N792I	.	N	-	2	0	PHIP	79754730	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	5.807000	0.69157	1.860000	0.53959	0.477000	0.44152	AAT	PHIP	-	NULL	ENSG00000146247		0.353	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHIP	HGNC	protein_coding	OTTHUMT00000041297.2	87	0.00	0	T			79698011	79698011	-1	no_errors	ENST00000275034	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	1.000	A
PEX7	5191	genome.wustl.edu	37	6	137191068	137191068	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr6:137191068G>T	ENST00000318471.4	+	7	755	c.674G>T	c.(673-675)gGc>gTc	p.G225V	PEX7_ENST00000541292.1_Missense_Mutation_p.G225V	NM_000288.3	NP_000279.1	O00628	PEX7_HUMAN	peroxisomal biogenesis factor 7	225					endochondral ossification (GO:0001958)|ether lipid biosynthetic process (GO:0008611)|fatty acid beta-oxidation (GO:0006635)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-2 binding (GO:0005053)|protein homodimerization activity (GO:0042803)			lung(7)|prostate(1)	8	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000257)|OV - Ovarian serous cystadenocarcinoma(155;0.00492)		AGTTTGAGAGGCTGGGACTTA	0.393																																						dbGAP											0													243.0	247.0	246.0					6																	137191068		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF180814	CCDS5180.1	6q21-q22.2	2013-01-10			ENSG00000112357	ENSG00000112357		"""WD repeat domain containing"""	8860	protein-coding gene	gene with protein product	"""Refsum disease"""	601757				9090381, 10673331	Standard	NM_000288		Approved	PTS2R, RD	uc003qhd.3	O00628	OTTHUMG00000015650	ENST00000318471.4:c.674G>T	6.37:g.137191068G>T	ENSP00000315680:p.Gly225Val	Somatic		WXS	Illumina GAIIx	Phase_IV	C0H5X6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G225V	ENST00000318471.4	37	c.674	CCDS5180.1	6	.	.	.	.	.	.	.	.	.	.	G	6.398	0.441490	0.12164	.	.	ENSG00000112357	ENST00000541292;ENST00000318471	T;T	0.52057	0.68;0.68	5.84	5.84	0.93424	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.272140	0.40818	N	0.001020	T	0.07683	0.0193	N	0.00389	-1.56	0.80722	D	1	B	0.28324	0.207	B	0.28638	0.092	T	0.39542	-0.9609	10	0.07175	T	0.84	-25.8713	18.9107	0.92483	0.0:0.0:1.0:0.0	.	225	O00628	PEX7_HUMAN	V	225	ENSP00000441004:G225V;ENSP00000315680:G225V	ENSP00000315680:G225V	G	+	2	0	PEX7	137232761	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.025000	0.64097	2.751000	0.94390	0.591000	0.81541	GGC	PEX7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000112357		0.393	PEX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX7	HGNC	protein_coding	OTTHUMT00000042387.2	111	0.00	0	G	NM_000288		137191068	137191068	+1	no_errors	ENST00000318471	ensembl	human	known	69_37n	missense	39	25.00	13	SNP	1.000	T
PI4KAP2	375133	genome.wustl.edu	37	22	21841928	21841928	+	RNA	SNP	G	G	A			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr22:21841928G>A	ENST00000450651.1	-	0	653							A4QPH2	PI4P2_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 2						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(3)|urinary_tract(1)	4						GAACCACATCGGCATGCAGGA	0.592																																						dbGAP											0													9.0	8.0	8.0					22																	21841928		689	1562	2251	-	-	-			0					22q11.21	2014-03-20	2007-08-14		ENSG00000183506	ENSG00000183506			33577	pseudogene	pseudogene							Standard	NR_003700		Approved		uc011aie.1	A4QPH2	OTTHUMG00000150827		22.37:g.21841928G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ICJ0|Q6ZT68|Q8WUK7	RNA	SNP	-	NULL	ENST00000450651.1	37	NULL		22																																																																																			PI4KAP2	-	-	ENSG00000183506		0.592	PI4KAP2-005	KNOWN	basic	processed_transcript	PI4KAP2	HGNC	pseudogene	OTTHUMT00000334908.1	30	0.00	0	G			21841928	21841928	-1	no_errors	ENST00000450651	ensembl	human	known	69_37n	rna	4	66.67	8	SNP	0.912	A
PLEKHB1	58473	genome.wustl.edu	37	11	73364048	73364048	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr11:73364048A>C	ENST00000354190.5	+	5	810	c.379A>C	c.(379-381)Aac>Cac	p.N127H	PLEKHB1_ENST00000543085.1_Missense_Mutation_p.N57H|PLEKHB1_ENST00000535129.1_Missense_Mutation_p.N108H|PLEKHB1_ENST00000398494.4_Missense_Mutation_p.N108H|PLEKHB1_ENST00000227214.6_Missense_Mutation_p.N108H|PLEKHB1_ENST00000398492.4_Missense_Mutation_p.N127H	NM_021200.2	NP_067023.1	Q9UF11	PKHB1_HUMAN	pleckstrin homology domain containing, family B (evectins) member 1	127	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				multicellular organismal development (GO:0007275)|phototransduction (GO:0007602)|regulation of cell differentiation (GO:0045595)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	7						GCTGGAGGCAAACTCCACCCC	0.567																																						dbGAP											0													79.0	92.0	88.0					11																	73364048		1945	4139	6084	-	-	-	SO:0001583	missense	0			AF081583	CCDS44672.1, CCDS44673.1, CCDS44674.1, CCDS44675.1	11q13.5-q14.1	2013-01-10	2002-11-04	2002-11-08	ENSG00000021300	ENSG00000021300		"""Pleckstrin homology (PH) domain containing"""	19079	protein-coding gene	gene with protein product		607651	"""PH domain containing, retinal 1"""	PHRET1		10585447	Standard	NM_021200		Approved	PHR1, KPL1	uc001ouc.3	Q9UF11	OTTHUMG00000168030	ENST00000354190.5:c.379A>C	11.37:g.73364048A>C	ENSP00000346127:p.Asn127His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0Q5|B2RBP1|B7Z716|Q9UBF5|Q9UI37|Q9UI44	Missense_Mutation	SNP	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.N127H	ENST00000354190.5	37	c.379	CCDS44672.1	11	.	.	.	.	.	.	.	.	.	.	A	11.80	1.747286	0.30955	.	.	ENSG00000021300	ENST00000354190;ENST00000398492;ENST00000227214;ENST00000398494;ENST00000543085;ENST00000539157;ENST00000546251;ENST00000535582;ENST00000538227;ENST00000539549;ENST00000542185;ENST00000543524;ENST00000541597;ENST00000535129;ENST00000542389;ENST00000540431	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6	4.53	4.53	0.55603	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.163209	0.53938	D	0.000047	T	0.30070	0.0753	N	0.08118	0	0.23798	N	0.996818	P;P;P;D	0.67145	0.863;0.79;0.79;0.996	P;P;P;D	0.66497	0.595;0.464;0.464;0.944	T	0.10132	-1.0643	10	0.40728	T	0.16	-6.9635	10.5443	0.45052	1.0:0.0:0.0:0.0	.	108;131;127;127	F5GXN2;Q59EU5;Q9UF11-2;Q9UF11	.;.;.;PKHB1_HUMAN	H	127;127;108;108;57;115;108;108;108;108;108;108;108;108;108;115	ENSP00000346127:N127H;ENSP00000381505:N127H;ENSP00000227214:N108H;ENSP00000381507:N108H;ENSP00000441224:N57H;ENSP00000445990:N115H;ENSP00000439714:N108H;ENSP00000438809:N108H;ENSP00000445807:N108H;ENSP00000444453:N108H;ENSP00000442136:N108H;ENSP00000442616:N108H;ENSP00000440102:N108H;ENSP00000441558:N115H	ENSP00000227214:N108H	N	+	1	0	PLEKHB1	73041696	0.981000	0.34729	0.554000	0.28268	0.083000	0.17756	4.882000	0.63121	2.259000	0.74868	0.528000	0.53228	AAC	PLEKHB1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000021300		0.567	PLEKHB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLEKHB1	HGNC	protein_coding	OTTHUMT00000397593.1	35	0.00	0	A			73364048	73364048	+1	no_errors	ENST00000354190	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	0.644	C
PNMA1	9240	genome.wustl.edu	37	14	74179692	74179692	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr14:74179692delA	ENST00000316836.3	-	1	1436	c.651delT	c.(649-651)cttfs	p.L217fs		NM_006029.4	NP_006020.4	Q8ND90	PNMA1_HUMAN	paraneoplastic Ma antigen 1	217					inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleolus (GO:0005730)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|prostate(1)|urinary_tract(2)	13				BRCA - Breast invasive adenocarcinoma(234;0.00331)|KIRC - Kidney renal clear cell carcinoma(182;0.0797)		tgttggacttaaggatgcgaa	0.542																																						dbGAP											0													66.0	73.0	71.0					14																	74179692		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF037364	CCDS9818.1	14q24.3	2012-02-09	2012-02-09		ENSG00000176903	ENSG00000176903		"""Paraneoplastic Ma antigens"""	9158	protein-coding gene	gene with protein product		604010	"""paraneoplastic antigen MA1"""			10050892	Standard	NM_006029		Approved	MA1	uc001xor.1	Q8ND90	OTTHUMG00000169183	ENST00000316836.3:c.651delT	14.37:g.74179692delA	ENSP00000318914:p.Leu217fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4L5|O95144|Q8NG07	Frame_Shift_Del	DEL	superfamily_Globin-like	p.K218fs	ENST00000316836.3	37	c.651	CCDS9818.1	14																																																																																			PNMA1	-	NULL	ENSG00000176903		0.542	PNMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMA1	HGNC	protein_coding	OTTHUMT00000402774.1	97	0.00	0	A	NM_006029		74179692	74179692	-1	no_errors	ENST00000316836	ensembl	human	known	69_37n	frame_shift_del	12	14.29	2	DEL	1.000	-
POLQ	10721	genome.wustl.edu	37	3	121202430	121202430	+	Splice_Site	DEL	C	C	-			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr3:121202430delC	ENST00000264233.5	-	18	5902		c.e18-1			NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta						ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		GCACTAATTTCTTTaaaaaaa	0.328								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)	dbGAP											0													31.0	32.0	32.0					3																	121202430		2200	4297	6497	-	-	-	SO:0001630	splice_region_variant	0			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.5774-1G>-	3.37:g.121202430delC		Somatic		WXS	Illumina GAIIx	Phase_IV	O95160|Q6VMB5	Splice_Site	DEL	-	e18-1	ENST00000264233.5	37	c.5774-1	CCDS33833.1	3																																																																																			POLQ	-	-	ENSG00000051341		0.328	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	HGNC	protein_coding	OTTHUMT00000355097.1	10	0.00	0	C	NM_199420	Intron	121202430	121202430	-1	no_errors	ENST00000264233	ensembl	human	known	69_37n	splice_site_del	6	33.33	3	DEL	1.000	-
PPIL2	23759	genome.wustl.edu	37	22	22036753	22036753	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr22:22036753delA	ENST00000335025.8	+	8	506	c.415delA	c.(415-417)aagfs	p.K139fs	PPIL2_ENST00000406385.1_Frame_Shift_Del_p.K139fs|PPIL2_ENST00000398831.3_Frame_Shift_Del_p.K139fs|PPIL2_ENST00000412327.1_Frame_Shift_Del_p.K139fs|PPIL2_ENST00000492445.2_Frame_Shift_Del_p.K139fs|PPIL2_ENST00000456792.2_Frame_Shift_Del_p.K118fs					peptidylprolyl isomerase (cyclophilin)-like 2											endometrium(4)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	17	Colorectal(54;0.105)					TATCAAGGCCAAGAACTTCCG	0.607																																						dbGAP											0													126.0	100.0	109.0					22																	22036753		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS13793.1	22q11.21	2013-01-29			ENSG00000100023	ENSG00000100023		"""U-box domain containing"""	9261	protein-coding gene	gene with protein product	"""U-box domain containing 7"""	607588				10591208	Standard	NM_014337		Approved	UBOX7, CYC4, Cyp-60	uc002zvh.4	Q13356	OTTHUMG00000030174	ENST00000335025.8:c.415delA	22.37:g.22036753delA	ENSP00000334553:p.Lys139fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,smart_Ubox_domain,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.K139fs	ENST00000335025.8	37	c.415	CCDS13793.1	22																																																																																			PPIL2	-	NULL	ENSG00000100023		0.607	PPIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL2	HGNC	protein_coding	OTTHUMT00000075028.4	44	0.00	0	A			22036753	22036753	+1	no_errors	ENST00000412327	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	1.000	-
PRELID2	153768	genome.wustl.edu	37	5	145214806	145214806	+	Silent	SNP	G	G	A			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr5:145214806G>A	ENST00000334744.4	-	1	61	c.9C>T	c.(7-9)gtC>gtT	p.V3V	PRELID2_ENST00000358004.2_Silent_p.V3V|PRELID2_ENST00000511435.1_Silent_p.V3V|PRELID2_ENST00000505416.1_Silent_p.V3V|PRELID2_ENST00000394450.2_5'UTR	NM_182960.2	NP_892005.1	Q8N945	PRLD2_HUMAN	PRELI domain containing 2	3	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CATCCACCGAGACCCCCATcc	0.716																																						dbGAP											0													50.0	46.0	48.0					5																	145214806		1920	3656	5576	-	-	-	SO:0001819	synonymous_variant	0			AK095695	CCDS34261.1, CCDS34262.1, CCDS43377.1	5q32	2012-04-23			ENSG00000186314	ENSG00000186314			28306	protein-coding gene	gene with protein product						12477932	Standard	NM_182960		Approved	MGC21644, FLJ38376	uc003lnq.1	Q8N945	OTTHUMG00000163384	ENST00000334744.4:c.9C>T	5.37:g.145214806G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	G5EA01|Q96EQ3	Silent	SNP	pfam_PRELI/MSF1,pfscan_PRELI/MSF1	p.V3	ENST00000334744.4	37	c.9	CCDS34262.1	5																																																																																			PRELID2	-	pfscan_PRELI/MSF1	ENSG00000186314		0.716	PRELID2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRELID2	HGNC	protein_coding	OTTHUMT00000372970.1	57	0.00	0	G	NM_182960		145214806	145214806	-1	no_errors	ENST00000334744	ensembl	human	known	69_37n	silent	28	17.65	6	SNP	1.000	A
RAB6A	5870	genome.wustl.edu	37	11	73390734	73390735	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr11:73390734_73390735CC>TT	ENST00000336083.3	-	7	981_982	c.526_527GG>AA	c.(526-528)GGa>AAa	p.G176K	RAB6A_ENST00000541588.1_Missense_Mutation_p.G72K|RAB6A_ENST00000310653.6_Missense_Mutation_p.G176K|RAB6A_ENST00000536566.1_Missense_Mutation_p.G143K	NM_198896.1	NP_942599.1	P20340	RAB6A_HUMAN	RAB6A, member RAS oncogene family	176					antigen processing and presentation (GO:0019882)|early endosome to Golgi transport (GO:0034498)|GTP catabolic process (GO:0006184)|minus-end-directed organelle transport along microtubule (GO:0072385)|peptidyl-cysteine methylation (GO:0018125)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|protein domain specific binding (GO:0019904)			large_intestine(2)|lung(2)	4						GCTTTCCATTCCCGGCAAAGCT	0.411																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF130986	CCDS8223.1, CCDS8224.1, CCDS58155.1, CCDS58156.1	11q13.3	2008-08-08			ENSG00000175582	ENSG00000175582		"""RAB, member RAS oncogene"""	9786	protein-coding gene	gene with protein product		179513		RAB6			Standard	NM_001243718		Approved		uc001ouf.3	P20340	OTTHUMG00000134308	ENST00000336083.3:c.526_527delinsTT	11.37:g.73390734_73390735delinsTT	ENSP00000336850:p.Gly176Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K133|B7Z772|F5H668|Q1W5D8|Q5U0A8|Q9UBE4	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_SRP_receptor_beta_su,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.G176E|p.G176R	ENST00000336083.3	37	c.527|c.526	CCDS8224.1	11																																																																																			RAB6A	-	smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase	ENSG00000175582		0.411	RAB6A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAB6A	HGNC	protein_coding	OTTHUMT00000259241.2	115|116	0.00	0	C			73390734|73390735	73390734|73390735	-1	no_errors	ENST00000310653	ensembl	human	known	69_37n	missense	84|83	25.00|25.89	28|29	SNP	1.000	T
RAB6A	5870	genome.wustl.edu	37	11	73390744	73390744	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr11:73390744C>T	ENST00000336083.3	-	7	972	c.517G>A	c.(517-519)Gct>Act	p.A173T	RAB6A_ENST00000541588.1_Missense_Mutation_p.A69T|RAB6A_ENST00000310653.6_Missense_Mutation_p.A173T|RAB6A_ENST00000536566.1_Missense_Mutation_p.A140T	NM_198896.1	NP_942599.1	P20340	RAB6A_HUMAN	RAB6A, member RAS oncogene family	173					antigen processing and presentation (GO:0019882)|early endosome to Golgi transport (GO:0034498)|GTP catabolic process (GO:0006184)|minus-end-directed organelle transport along microtubule (GO:0072385)|peptidyl-cysteine methylation (GO:0018125)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|protein domain specific binding (GO:0019904)			large_intestine(2)|lung(2)	4						CCCGGCAAAGCTGCTGCTACA	0.408																																						dbGAP											0													141.0	143.0	143.0					11																	73390744		2200	4293	6493	-	-	-	SO:0001583	missense	0			AF130986	CCDS8223.1, CCDS8224.1, CCDS58155.1, CCDS58156.1	11q13.3	2008-08-08			ENSG00000175582	ENSG00000175582		"""RAB, member RAS oncogene"""	9786	protein-coding gene	gene with protein product		179513		RAB6			Standard	NM_001243718		Approved		uc001ouf.3	P20340	OTTHUMG00000134308	ENST00000336083.3:c.517G>A	11.37:g.73390744C>T	ENSP00000336850:p.Ala173Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K133|B7Z772|F5H668|Q1W5D8|Q5U0A8|Q9UBE4	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_SRP_receptor_beta_su,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.A173T	ENST00000336083.3	37	c.517	CCDS8224.1	11	.	.	.	.	.	.	.	.	.	.	C	33	5.199928	0.94997	.	.	ENSG00000175582	ENST00000310653;ENST00000336083;ENST00000393571;ENST00000536566;ENST00000541588;ENST00000540771	T;T;T;T	0.76709	-1.04;-1.04;-1.04;-0.53	5.29	5.29	0.74685	.	0.049436	0.85682	D	0.000000	T	0.77798	0.4184	N	0.12746	0.255	0.58432	D	0.999991	D;B;B	0.57571	0.98;0.0;0.0	D;B;B	0.68192	0.956;0.002;0.002	T	0.80661	-0.1283	10	0.49607	T	0.09	-4.3424	15.6746	0.77307	0.0:1.0:0.0:0.0	.	69;173;173	Q1W5D8;P20340;P20340-2	.;RAB6A_HUMAN;.	T	173;173;173;140;69;51	ENSP00000311449:A173T;ENSP00000336850:A173T;ENSP00000437863:A140T;ENSP00000445350:A69T	ENSP00000311449:A173T	A	-	1	0	RAB6A	73068392	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.546000	0.73887	2.477000	0.83638	0.557000	0.71058	GCT	RAB6A	-	pfam_Small_GTPase,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase	ENSG00000175582		0.408	RAB6A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAB6A	HGNC	protein_coding	OTTHUMT00000259241.2	115	0.00	0	C			73390744	73390744	-1	no_errors	ENST00000310653	ensembl	human	known	69_37n	missense	82	24.77	27	SNP	1.000	T
SEMA3G	56920	genome.wustl.edu	37	3	52473711	52473711	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr3:52473711C>G	ENST00000231721.2	-	12	1451	c.1452G>C	c.(1450-1452)gaG>gaC	p.E484D		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	484	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		ACACCTGGAGCTCCTCCAGAA	0.607																																						dbGAP											0													80.0	76.0	77.0					3																	52473711		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.1452G>C	3.37:g.52473711C>G	ENSP00000231721:p.Glu484Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7L9D9|Q9H7Q3	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.E484D	ENST00000231721.2	37	c.1452	CCDS2856.1	3	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996567	0.74818	.	.	ENSG00000010319	ENST00000231721	T	0.29917	1.55	5.68	2.94	0.34122	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.54447	0.1859	M	0.80028	2.48	0.44694	D	0.997683	D	0.71674	0.998	D	0.85130	0.997	T	0.54892	-0.8225	10	0.62326	D	0.03	.	10.9551	0.47354	0.0:0.7968:0.0:0.2032	.	484	Q9NS98	SEM3G_HUMAN	D	484	ENSP00000231721:E484D	ENSP00000231721:E484D	E	-	3	2	SEMA3G	52448751	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	1.960000	0.40422	0.345000	0.23873	-0.136000	0.14681	GAG	SEMA3G	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000010319		0.607	SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3G	HGNC	protein_coding	OTTHUMT00000351354.1	47	0.00	0	C	NM_020163		52473711	52473711	-1	no_errors	ENST00000231721	ensembl	human	known	69_37n	missense	9	40.00	6	SNP	1.000	G
SF3B1	23451	genome.wustl.edu	37	2	198266834	198266834	+	Missense_Mutation	SNP	T	T	C	rs559063155		TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr2:198266834T>C	ENST00000335508.6	-	15	2189	c.2098A>G	c.(2098-2100)Aaa>Gaa	p.K700E	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'UTR	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	700					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.K700E(179)|p.Q699_K700del(2)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GTCCGAACTTTCTGCTGCTCA	0.408			Mis		myelodysplastic syndrome								T|||	1	0.000199681	0.0	0.0	5008	,	,		17946	0.0		0.0	False		,,,				2504	0.001					dbGAP		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	181	Substitution - Missense(179)|Deletion - In frame(2)	haematopoietic_and_lymphoid_tissue(153)|NS(20)|breast(5)|pancreas(2)|central_nervous_system(1)																																								-	-	-	SO:0001583	missense	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2098A>G	2.37:g.198266834T>C	ENSP00000335321:p.Lys700Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PCH3	Missense_Mutation	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.K700E	ENST00000335508.6	37	c.2098	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	T	33	5.243295	0.95272	.	.	ENSG00000115524	ENST00000335508	T	0.63580	-0.05	6.02	6.02	0.97574	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85609	0.5736	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89820	0.3988	10	0.87932	D	0	.	16.542	0.84395	0.0:0.0:0.0:1.0	.	700	O75533	SF3B1_HUMAN	E	700	ENSP00000335321:K700E	ENSP00000335321:K700E	K	-	1	0	SF3B1	197975079	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.555000	0.82223	2.304000	0.77564	0.528000	0.53228	AAA	SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.408	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	43	0.00	0	T			198266834	198266834	-1	no_errors	ENST00000335508	ensembl	human	known	69_37n	missense	19	13.64	3	SNP	1.000	C
SOGA1	140710	genome.wustl.edu	37	20	35431404	35431404	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr20:35431404T>C	ENST00000357779.3	-	11	2806	c.2480A>G	c.(2479-2481)tAc>tGc	p.Y827C	SOGA1_ENST00000237536.4_Missense_Mutation_p.Y1065C|SOGA1_ENST00000456801.2_Missense_Mutation_p.Y668C|SOGA1_ENST00000279034.6_Missense_Mutation_p.Y827C			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	827					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						GACAGCGCTGTAGGACTCAGC	0.652																																						dbGAP											0													23.0	26.0	25.0					20																	35431404		2184	4286	6470	-	-	-	SO:0001583	missense	0			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.2480A>G	20.37:g.35431404T>C	ENSP00000350424:p.Tyr827Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	pfam_DUF3166	p.Y827C	ENST00000357779.3	37	c.2480		20	.	.	.	.	.	.	.	.	.	.	T	23.5	4.426402	0.83667	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.24350	1.86;1.9;1.9;1.91	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.44329	0.1288	L	0.53249	1.67	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.23976	-1.0173	10	0.39692	T	0.17	-24.3881	13.7321	0.62794	0.0:0.0:0.0:1.0	.	827	O94964-4	.	C	1065;827;668;827	ENSP00000237536:Y1065C;ENSP00000279034:Y827C;ENSP00000413886:Y668C;ENSP00000350424:Y827C	ENSP00000237536:Y1065C	Y	-	2	0	KIAA0889	34864818	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.906000	0.69900	2.072000	0.62099	0.460000	0.39030	TAC	SOGA1	-	NULL	ENSG00000149639		0.652	SOGA1-201	KNOWN	basic	protein_coding	SOGA1	HGNC	protein_coding		41	0.00	0	T	NM_199181		35431404	35431404	-1	no_errors	ENST00000357779	ensembl	human	known	69_37n	missense	18	35.71	10	SNP	1.000	C
SUSD1	64420	genome.wustl.edu	37	9	114874096	114874096	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr9:114874096C>T	ENST00000374270.3	-	8	1181	c.1009G>A	c.(1009-1011)Gac>Aac	p.D337N	SUSD1_ENST00000374263.3_Missense_Mutation_p.D337N|SUSD1_ENST00000374264.2_Missense_Mutation_p.D337N	NM_022486.3	NP_071931.2	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1	337						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)		SUSD1/ROD1(2)	central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						TCCATAGGGTCCAACCGTTGT	0.502																																						dbGAP											0													205.0	176.0	186.0					9																	114874096		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137432	CCDS6783.1, CCDS65105.1, CCDS65106.1	9q31.3-q33.1	2008-02-05			ENSG00000106868	ENSG00000106868			25413	protein-coding gene	gene with protein product						12975309	Standard	NM_022486		Approved	DKFZP761E1824	uc004bfu.3	Q6UWL2	OTTHUMG00000020499	ENST00000374270.3:c.1009G>A	9.37:g.114874096C>T	ENSP00000363388:p.Asp337Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4C5|A8KA03|Q5T8V6|Q5T8V7|Q6P9G7|Q8WU83|Q96DM9|Q9H6V2|Q9NTA7	Nonsense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.W150*	ENST00000374270.3	37	c.450	CCDS6783.1	9	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	26.2|26.2|26.2	4.710408|4.710408|4.710408	0.89018|0.89018|0.89018	.|.|.	.|.|.	ENSG00000106868|ENSG00000106868|ENSG00000106868	ENST00000374270;ENST00000374263;ENST00000374264|ENST00000355396|ENST00000415074	T;T;T|.|.	0.74526|.|.	-0.76;-0.78;-0.85|.|.	5.61|5.61|5.61	3.76|3.76|3.76	0.43208|0.43208|0.43208	.|.|.	0.263985|.|.	0.26844|.|.	N|.|.	0.022217|.|.	T|T|.	0.47488|0.47488|.	0.1448|0.1448|.	M|M|M	0.66939|0.66939|0.66939	2.045|2.045|2.045	0.09310|0.09310|0.09310	N|N|N	1|1|1	P;P;P|.|.	0.52061|.|.	0.95;0.95;0.856|.|.	P;P;B|.|.	0.49887|.|.	0.625;0.57;0.33|.|.	T|T|.	0.35871|0.35871|.	-0.9771|-0.9771|.	10|5|.	0.29301|.|.	T|.|.	0.29|.|.	-16.6949|-16.6949|-16.6949	7.917|7.917|7.917	0.29825|0.29825|0.29825	0.0:0.7403:0.173:0.0867|0.0:0.7403:0.173:0.0867|0.0:0.7403:0.173:0.0867	.|.|.	337;337;337|.|.	F8WAQ1;Q6UWL2-2;Q6UWL2|.|.	.;.;SUSD1_HUMAN|.|.	N|E|X	337|320|150	ENSP00000363388:D337N;ENSP00000363381:D337N;ENSP00000363382:D337N|.|.	ENSP00000363381:D337N|.|.	D|G|W	-|-|-	1|2|3	0|0|0	SUSD1|SUSD1|SUSD1	113913917|113913917|113913917	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.023000|0.023000|0.023000	0.16930|0.16930|0.16930	0.888000|0.888000|0.888000	0.51559|0.51559|0.51559	-0.202000|-0.202000|-0.202000	0.09451|0.09451|0.09451	0.825000|0.825000|0.825000	0.34637|0.34637|0.34637	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAC|GGA|TGG	SUSD1	-	NULL	ENSG00000106868		0.502	SUSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD1	HGNC	protein_coding	OTTHUMT00000053668.3	57	0.00	0	C	NM_022486		114874096	114874096	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000415074	ensembl	human	novel	69_37n	nonsense	40	27.27	15	SNP	0.009	T
UBE4A	9354	genome.wustl.edu	37	11	118239438	118239438	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr11:118239438T>A	ENST00000431736.2	+	3	286	c.214T>A	c.(214-216)Ttc>Atc	p.F72I	UBE4A_ENST00000252108.3_Missense_Mutation_p.F72I					ubiquitination factor E4A											autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		TAGCCGCTCATTCCGATCACA	0.448																																						dbGAP											0													213.0	203.0	207.0					11																	118239438		2200	4296	6496	-	-	-	SO:0001583	missense	0			D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.214T>A	11.37:g.118239438T>A	ENSP00000387362:p.Phe72Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ub_conjug_fac_E4_core,pfam_Ubox_domain,smart_Ubox_domain	p.F72I	ENST00000431736.2	37	c.214	CCDS8396.1	11	.	.	.	.	.	.	.	.	.	.	T	19.73	3.881238	0.72294	.	.	ENSG00000110344	ENST00000252108;ENST00000431736	T;T	0.42513	0.97;0.97	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.35770	0.0943	L	0.40543	1.245	0.80722	D	1	P;B	0.34522	0.455;0.403	B;B	0.34346	0.18;0.172	T	0.11155	-1.0599	10	0.25106	T	0.35	-13.0064	15.5613	0.76249	0.0:0.0:0.0:1.0	.	72;72	Q14139;Q14139-2	UBE4A_HUMAN;.	I	72	ENSP00000252108:F72I;ENSP00000387362:F72I	ENSP00000252108:F72I	F	+	1	0	UBE4A	117744648	1.000000	0.71417	0.967000	0.41034	0.982000	0.71751	7.446000	0.80609	2.269000	0.75478	0.533000	0.62120	TTC	UBE4A	-	NULL	ENSG00000110344		0.448	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBE4A	HGNC	protein_coding	OTTHUMT00000398143.1	53	0.00	0	T	NM_004788		118239438	118239438	+1	no_errors	ENST00000431736	ensembl	human	known	69_37n	missense	5	61.54	8	SNP	0.998	A
UGGT2	55757	genome.wustl.edu	37	13	96684189	96684189	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr13:96684189C>T	ENST00000376747.3	-	2	265	c.195G>A	c.(193-195)tgG>tgA	p.W65*	UGGT2_ENST00000397618.3_Nonsense_Mutation_p.W65*|UGGT2_ENST00000376712.4_Nonsense_Mutation_p.W65*|UGGT2_ENST00000376714.3_Nonsense_Mutation_p.W65*	NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	65					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						CCAAAAACTGCCAAAATTTTT	0.269																																						dbGAP											0													57.0	60.0	59.0					13																	96684189		2199	4278	6477	-	-	-	SO:0001587	stop_gained	0			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.195G>A	13.37:g.96684189C>T	ENSP00000365938:p.Trp65*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Nonsense_Mutation	SNP	pfam_UDP-g_GGtrans,pfam_Glyco_trans_8	p.W65*	ENST00000376747.3	37	c.195	CCDS9480.1	13	.	.	.	.	.	.	.	.	.	.	C	36	5.970508	0.97156	.	.	ENSG00000102595	ENST00000376747;ENST00000376722;ENST00000376714;ENST00000397618;ENST00000376712	.	.	.	5.79	5.79	0.91817	.	0.060744	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-6.5415	20.0411	0.97590	0.0:1.0:0.0:0.0	.	.	.	.	X	65	.	ENSP00000365902:W65X	W	-	3	0	UGGT2	95482190	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.440000	0.73435	2.739000	0.93911	0.655000	0.94253	TGG	UGGT2	-	NULL	ENSG00000102595		0.269	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT2	HGNC	protein_coding	OTTHUMT00000045507.1	22	0.00	0	C	NM_020121		96684189	96684189	-1	no_errors	ENST00000376747	ensembl	human	known	69_37n	nonsense	7	30.00	3	SNP	1.000	T
USH1C	10083	genome.wustl.edu	37	11	17547981	17547981	+	Missense_Mutation	SNP	C	C	T	rs397517883		TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr11:17547981C>T	ENST00000318024.4	-	8	695	c.587G>A	c.(586-588)cGa>cAa	p.R196Q	USH1C_ENST00000527020.1_Missense_Mutation_p.R196Q|USH1C_ENST00000527720.1_Missense_Mutation_p.R165Q|USH1C_ENST00000005226.7_Missense_Mutation_p.R196Q	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	196					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						CAGGCTGCCTCGCACGCCCTG	0.597																																						dbGAP											0													72.0	55.0	60.0					11																	17547981		2200	4293	6493	-	-	-	SO:0001583	missense	0			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.587G>A	11.37:g.17547981C>T	ENSP00000317018:p.Arg196Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R196Q	ENST00000318024.4	37	c.587	CCDS31438.1	11	.	.	.	.	.	.	.	.	.	.	C	18.15	3.560478	0.65538	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226;ENST00000526181	T;T;T;T;T	0.26957	1.72;1.7;1.99;1.78;2.08	5.79	2.84	0.33178	PDZ/DHR/GLGF (1);	0.500026	0.19874	N	0.104140	T	0.13628	0.0330	L	0.27053	0.805	0.22034	N	0.999408	P;D;D	0.56746	0.89;0.974;0.977	B;B;B	0.40134	0.088;0.234;0.32	T	0.15954	-1.0419	10	0.13108	T	0.6	.	7.7364	0.28817	0.0:0.6623:0.0:0.3377	.	196;196;196	Q9Y6N9-4;Q9Y6N9;Q7RTU8	.;USH1C_HUMAN;.	Q	196;165;196;196;207	ENSP00000317018:R196Q;ENSP00000432944:R165Q;ENSP00000436934:R196Q;ENSP00000005226:R196Q;ENSP00000437128:R207Q	ENSP00000005226:R196Q	R	-	2	0	USH1C	17504557	0.100000	0.21855	0.017000	0.16124	0.017000	0.09413	0.322000	0.19576	0.330000	0.23485	0.650000	0.86243	CGA	USH1C	-	superfamily_PDZ	ENSG00000006611		0.597	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USH1C	HGNC	protein_coding	OTTHUMT00000389146.1	50	0.00	0	C	NM_005709		17547981	17547981	-1	no_errors	ENST00000005226	ensembl	human	known	69_37n	missense	7	68.18	15	SNP	0.515	T
VN1R4	317703	genome.wustl.edu	37	19	53770436	53770436	+	Silent	SNP	G	G	A			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr19:53770436G>A	ENST00000311170.4	-	1	536	c.483C>T	c.(481-483)aaC>aaT	p.N161N	CTD-2245F17.9_ENST00000599803.1_lincRNA	NM_173857.2	NP_776256.2	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	161					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	22				GBM - Glioblastoma multiforme(134;0.00294)		CCAAATCCTCGTTCACTGTGA	0.463										HNSCC(26;0.072)																												dbGAP											0													37.0	34.0	35.0					19																	53770436		2202	4280	6482	-	-	-	SO:0001819	synonymous_variant	0			AY114733	CCDS33099.1	19q13.42	2012-08-22			ENSG00000228567	ENSG00000228567		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19871	protein-coding gene	gene with protein product						12123587	Standard	NM_173857		Approved	V1RL4	uc010ydu.2	Q7Z5H5		ENST00000311170.4:c.483C>T	19.37:g.53770436G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3E2|Q7Z5H6|Q7Z5H7|Q8TDU2	Silent	SNP	pfam_Vmron_rcpt_1,pfam_TAS2_rcpt,pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Vmron_rcpt_1	p.N161	ENST00000311170.4	37	c.483	CCDS33099.1	19																																																																																			VN1R4	-	pfam_Vmron_rcpt_1,pfam_TAS2_rcpt,pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000228567		0.463	VN1R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VN1R4	HGNC	protein_coding	OTTHUMT00000464287.1	217	0.00	0	G	NM_173857		53770436	53770436	-1	no_errors	ENST00000311170	ensembl	human	known	69_37n	silent	65	36.89	38	SNP	0.000	A
VPS41	27072	genome.wustl.edu	37	7	38908841	38908841	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr7:38908841C>T	ENST00000310301.4	-	3	127	c.73G>A	c.(73-75)Gaa>Aaa	p.E25K	VPS41_ENST00000395969.2_Missense_Mutation_p.E25K	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	25	Poly-Glu.				Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						GGTTCCTCTTCGCTCTCTTCT	0.433																																						dbGAP											0													140.0	134.0	136.0					7																	38908841		2203	4300	6503	-	-	-	SO:0001583	missense	0			U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.73G>A	7.37:g.38908841C>T	ENSP00000309457:p.Glu25Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_VPS41,pfscan_Znf_RING	p.E25K	ENST00000310301.4	37	c.73	CCDS5457.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.521698	0.96416	.	.	ENSG00000006715	ENST00000310301;ENST00000395969;ENST00000414632	T;T;T	0.46063	0.88;0.88;0.88	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.70263	0.3204	M	0.88105	2.93	0.80722	D	1	D;D;D	0.63046	0.992;0.992;0.992	D;D;D	0.65443	0.935;0.935;0.935	T	0.69953	-0.5005	10	0.35671	T	0.21	-25.9364	20.1772	0.98182	0.0:1.0:0.0:0.0	.	25;25;25	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	K	25;25;12	ENSP00000309457:E25K;ENSP00000379297:E25K;ENSP00000411919:E12K	ENSP00000265745:E25K	E	-	1	0	VPS41	38875366	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.433000	0.80362	2.778000	0.95560	0.655000	0.94253	GAA	VPS41	-	pirsf_VPS41	ENSG00000006715		0.433	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS41	HGNC	protein_coding	OTTHUMT00000226986.3	53	0.00	0	C			38908841	38908841	-1	no_errors	ENST00000310301	ensembl	human	known	69_37n	missense	24	35.14	13	SNP	1.000	T
VSIG8	391123	genome.wustl.edu	37	1	159826348	159826348	+	Silent	SNP	G	G	C			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr1:159826348G>C	ENST00000368100.1	-	5	873	c.738C>G	c.(736-738)ggC>ggG	p.G246G	C1orf204_ENST00000491974.1_5'Flank|C1orf204_ENST00000368102.1_5'Flank	NM_001013661.1	NP_001013683.1	Q5VU13	VSIG8_HUMAN	V-set and immunoglobulin domain containing 8	246	Ig-like V-type 2.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	8	all_hematologic(112;0.0597)					AAACACTGTAGCCCACGTTGT	0.557																																						dbGAP											0													335.0	260.0	286.0					1																	159826348		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS30913.1	1q23.2	2013-01-11			ENSG00000243284	ENSG00000243284		"""Immunoglobulin superfamily / V-set domain containing"""	32063	protein-coding gene	gene with protein product							Standard	NM_001013661		Approved		uc001fuh.3	Q5VU13	OTTHUMG00000168834	ENST00000368100.1:c.738C>G	1.37:g.159826348G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VU14	Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_sub2,pfscan_Ig-like	p.G246	ENST00000368100.1	37	c.738	CCDS30913.1	1																																																																																			VSIG8	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000243284		0.557	VSIG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSIG8	HGNC	protein_coding	OTTHUMT00000085978.8	116	0.00	0	G	NM_001013661		159826348	159826348	-1	no_errors	ENST00000368100	ensembl	human	known	69_37n	silent	55	14.06	9	SNP	1.000	C
ZNF397	84307	genome.wustl.edu	37	18	32822883	32822883	+	Intron	DEL	T	T	-			TCGA-E2-A56Z-01A-12D-A29N-09	TCGA-E2-A56Z-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	da5821cd-8653-41e5-b2ee-d60e2e541f2f	fd447987-24d9-46ec-8f43-5525d8f42fde	g.chr18:32822883delT	ENST00000330501.7	+	2	567				ZNF397_ENST00000589420.1_Intron|ZNF397_ENST00000585800.1_Intron|ZNF397_ENST00000355632.4_Intron|ZNF397_ENST00000591206.1_Intron|ZNF397_ENST00000261333.6_Intron|ZNF397_ENST00000592264.1_Intron	NM_001135178.2	NP_001128650.1	Q8NF99	ZN397_HUMAN	zinc finger protein 397						transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	12						GGAAAAGGAATTTACAGCCTG	0.453																																						dbGAP											0													35.0	38.0	37.0					18																	32822883		2188	4296	6484	-	-	-	SO:0001627	intron_variant	0			BC006172	CCDS32814.1, CCDS45852.1	18p12	2013-01-09	2003-07-22			ENSG00000186812		"""-"", ""Zinc fingers, C2H2-type"""	18818	protein-coding gene	gene with protein product		609601	"""zinc finger protein 47"""	ZNF47			Standard	NM_032347		Approved	ZSCAN15, MGC13250	uc010dmp.3	Q8NF99		ENST00000330501.7:c.414+35T>-	18.37:g.32822883delT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BRM2	Frame_Shift_Del	DEL	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	p.L150fs	ENST00000330501.7	37	c.447	CCDS45852.1	18																																																																																			ZNF397	-	smart_Tscrpt_reg_SCAN	ENSG00000186812		0.453	ZNF397-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF397	HGNC	protein_coding	OTTHUMT00000442398.1	11	0.00	0	T	NM_032347		32822883	32822883	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000588119	ensembl	human	putative	69_37n	frame_shift_del	4	33.33	2	DEL	0.002	-
