#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTN3	89	genome.wustl.edu	37	11	66318583	66318583	+	RNA	SNP	T	T	A			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr11:66318583T>A	ENST00000502692.1	+	0	392				ACTN3_ENST00000513398.1_RNA	NM_001258371.1	NP_001245300.1	Q08043	ACTN3_HUMAN	actinin, alpha 3 (gene/pseudogene)						focal adhesion assembly (GO:0048041)|muscle filament sliding (GO:0030049)|regulation of apoptotic process (GO:0042981)	actin filament (GO:0005884)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)	10						agtcagtggctgagctgagct	0.562																																						dbGAP											0																																										-	-	-			0			M86407		11q13.2	2013-10-02	2012-10-05		ENSG00000248746	ENSG00000248746			165	protein-coding gene	gene with protein product		102574	"""actinin, alpha 3"""			1339456	Standard	NM_001104		Approved		uc031qbp.1	Q08043	OTTHUMG00000160815		11.37:g.66318583T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP77|Q4KKV2	Silent	SNP	NULL	p.A69	ENST00000502692.1	37	c.207		11																																																																																			ACTN3	-	NULL	ENSG00000248746		0.562	ACTN3-003	KNOWN	basic	polymorphic_pseudogene	ACTN3	HGNC	polymorphic_pseudogene	OTTHUMT00000362465.1	38	0.00	0	T	NM_001104		66318583	66318583	+1	no_errors	ENST00000511191	ensembl	human	known	69_37n	silent	18	14.29	3	SNP	0.001	A
ATP6V1C2	245973	genome.wustl.edu	37	2	10915114	10915114	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr2:10915114C>T	ENST00000272238.4	+	10	851	c.742C>T	c.(742-744)Cgt>Tgt	p.R248C	ATP6V1C2_ENST00000381661.3_Missense_Mutation_p.R248C	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	248					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)	p.R248C(2)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		GTTCACTGTTCGTGAATTTTA	0.458																																					NSCLC(188;1042 2136 10807 16813 47705)	dbGAP											2	Substitution - Missense(2)	endometrium(2)											140.0	140.0	140.0					2																	10915114		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.742C>T	2.37:g.10915114C>T	ENSP00000272238:p.Arg248Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96EL8	Missense_Mutation	SNP	pfam_ATPase_V1-cplx_csu	p.R248C	ENST00000272238.4	37	c.742	CCDS42653.1	2	.	.	.	.	.	.	.	.	.	.	C	18.96	3.733807	0.69189	.	.	ENSG00000143882	ENST00000272238;ENST00000381661	T;T	0.62232	0.04;0.04	5.7	4.82	0.62117	.	0.055981	0.64402	D	0.000001	D	0.83353	0.5236	M	0.91038	3.17	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87741	0.2585	10	0.87932	D	0	-9.0223	16.2032	0.82103	0.1339:0.8661:0.0:0.0	.	248;248	Q8NEY4-2;Q8NEY4	.;VATC2_HUMAN	C	248	ENSP00000272238:R248C;ENSP00000371077:R248C	ENSP00000272238:R248C	R	+	1	0	ATP6V1C2	10832565	0.831000	0.29352	0.870000	0.34147	0.806000	0.45545	1.454000	0.35178	1.387000	0.46486	0.491000	0.48974	CGT	ATP6V1C2	-	pfam_ATPase_V1-cplx_csu	ENSG00000143882		0.458	ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ATP6V1C2	HGNC	protein_coding	OTTHUMT00000323555.1	27	0.00	0	C	NM_144583		10915114	10915114	+1	no_errors	ENST00000272238	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	0.992	T
PHF7	51533	genome.wustl.edu	37	3	52442072	52442072	+	5'Flank	SNP	T	T	C	rs375129361		TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr3:52442072T>C	ENST00000327906.3	+	0	0				BAP1_ENST00000460680.1_Missense_Mutation_p.T93A|BAP1_ENST00000296288.5_Missense_Mutation_p.T93A	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		AAGGCATGAGTTGCACAAGAG	0.542																																						dbGAP											0													47.0	38.0	41.0					3																	52442072		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		3.37:g.52442072T>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	K4DI82	Missense_Mutation	SNP	pfam_Peptidase_C12,prints_Peptidase_C12	p.T93A	ENST00000327906.3	37	c.277	CCDS2854.1	3	.	.	.	.	.	.	.	.	.	.	T	32	5.163535	0.94727	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000470173	T;T;T	0.62364	0.03;0.03;0.03	5.49	5.49	0.81192	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (4);	0.043292	0.85682	D	0.000000	D	0.85944	0.5815	H	0.96748	3.875	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.90801	0.4694	10	0.87932	D	0	-2.3	15.5817	0.76448	0.0:0.0:0.0:1.0	.	93	Q92560	BAP1_HUMAN	A	93;93;14	ENSP00000417132:T93A;ENSP00000296288:T93A;ENSP00000417776:T14A	ENSP00000296288:T93A	T	-	1	0	BAP1	52417112	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.790000	0.85794	2.092000	0.63282	0.459000	0.35465	ACT	BAP1	-	pfam_Peptidase_C12,prints_Peptidase_C12	ENSG00000163930		0.542	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAP1	HGNC	protein_coding	OTTHUMT00000351155.1	36	0.00	0	T	NM_016483		52442072	52442072	-1	no_errors	ENST00000460680	ensembl	human	known	69_37n	missense	16	46.67	14	SNP	1.000	C
BRWD1	54014	genome.wustl.edu	37	21	40571052	40571052	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr21:40571052C>G	ENST00000333229.2	-	40	5617	c.5290G>C	c.(5290-5292)Gat>Cat	p.D1764H	BRWD1_ENST00000380800.3_Missense_Mutation_p.D1764H|BRWD1_ENST00000342449.3_Missense_Mutation_p.D1764H	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1764					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TGATCTGAATCATGACTTTTA	0.418																																					Melanoma(170;988 1986 4794 16843 39731)	dbGAP											0													86.0	86.0	86.0					21																	40571052		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.5290G>C	21.37:g.40571052C>G	ENSP00000330753:p.Asp1764His	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D1764H	ENST00000333229.2	37	c.5290	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	C	11.77	1.737608	0.30774	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.55760	0.5;0.52;0.59	5.28	1.34	0.21922	.	0.813958	0.11192	N	0.589745	T	0.36358	0.0964	L	0.40543	1.245	0.80722	D	1	P;B	0.37636	0.603;0.255	B;B	0.33521	0.165;0.081	T	0.28332	-1.0047	10	0.49607	T	0.09	-0.1776	3.1183	0.06382	0.1948:0.4656:0.0:0.3396	.	1764;1764	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	H	1764	ENSP00000330753:D1764H;ENSP00000344333:D1764H;ENSP00000370178:D1764H	ENSP00000330753:D1764H	D	-	1	0	BRWD1	39492922	0.000000	0.05858	0.975000	0.42487	0.745000	0.42441	0.223000	0.17719	0.590000	0.29694	-0.140000	0.14226	GAT	BRWD1	-	NULL	ENSG00000185658		0.418	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	42	0.00	0	C	NM_033656		40571052	40571052	-1	no_errors	ENST00000333229	ensembl	human	known	69_37n	missense	44	13.73	7	SNP	0.977	G
C8orf58	541565	genome.wustl.edu	37	8	22459837	22459837	+	Intron	SNP	G	G	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr8:22459837G>T	ENST00000289989.5	+	5	953				C8orf58_ENST00000409586.3_Intron|CCAR2_ENST00000389279.3_5'Flank|CCAR2_ENST00000521301.1_5'Flank|CCAR2_ENST00000308511.4_5'Flank			Q8NAV2	CH058_HUMAN	chromosome 8 open reading frame 58											endometrium(1)|lung(1)|ovary(1)|skin(1)	4		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00563)|Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		TAGGGGACAGGTATATGTGGG	0.637																																						dbGAP											0													15.0	15.0	15.0					8																	22459837		2186	4286	6472	-	-	-	SO:0001627	intron_variant	0			BC012750	CCDS34862.1, CCDS56527.1, CCDS75708.1	8p21.3	2010-08-17			ENSG00000241852	ENSG00000241852			32233	protein-coding gene	gene with protein product							Standard	NM_001013842		Approved	FLJ34715	uc003xce.3	Q8NAV2	OTTHUMG00000154160	ENST00000289989.5:c.879+12G>T	8.37:g.22459837G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI44	Missense_Mutation	SNP	NULL	p.G68V	ENST00000289989.5	37	c.203	CCDS34862.1	8	.	.	.	.	.	.	.	.	.	.	G	9.853	1.194206	0.22037	.	.	ENSG00000241852	ENST00000495957	.	.	.	4.6	-6.79	0.01715	.	.	.	.	.	T	0.25232	0.0613	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30937	-0.9961	4	.	.	.	.	7.2352	0.26066	0.6404:0.2484:0.1112:0.0	.	.	.	.	V	68	.	.	G	+	2	0	C8orf58	22515782	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.686000	0.05161	-1.354000	0.02188	0.462000	0.41574	GGT	C8orf58	-	NULL	ENSG00000241852		0.637	C8orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf58	HGNC	protein_coding	OTTHUMT00000334183.1	29	0.00	0	G	NM_001013842		22459837	22459837	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000495957	ensembl	human	putative	69_37n	missense	15	31.82	7	SNP	0.000	T
CASZ1	54897	genome.wustl.edu	37	1	10707860	10707862	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr1:10707860_10707862delCTC	ENST00000377022.3	-	16	3810_3812	c.3493_3495delGAG	c.(3493-3495)gagdel	p.E1165del	CASZ1_ENST00000344008.5_In_Frame_Del_p.E1165del|RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1165					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GGACTCACTTCTCCTGGAACTGG	0.635																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.3493_3495delGAG	1.37:g.10707860_10707862delCTC	ENSP00000366221:p.Glu1165del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	In_Frame_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E1165in_frame_del	ENST00000377022.3	37	c.3495_3493	CCDS41246.1	1																																																																																			CASZ1	-	NULL	ENSG00000130940		0.635	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	74	0.00	0	CTC	NM_017766		10707860	10707862	-1	no_errors	ENST00000377022	ensembl	human	known	69_37n	in_frame_del	24	14.29	4	DEL	1.000:1.000:1.000	-
CCDC60	160777	genome.wustl.edu	37	12	119772957	119772957	+	5'UTR	SNP	G	G	C			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr12:119772957G>C	ENST00000327554.2	+	0	441				CCDC60_ENST00000536742.1_5'UTR|CCDC60_ENST00000539847.1_5'UTR|CCDC60_ENST00000546345.1_3'UTR	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60											endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		TGGGGGCACAGGCTAAAACCT	0.493																																						dbGAP											0													51.0	57.0	55.0					12																	119772957		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.-25G>C	12.37:g.119772957G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000327554.2	37	NULL	CCDS9190.1	12																																																																																			CCDC60	-	-	ENSG00000183273		0.493	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	HGNC	protein_coding	OTTHUMT00000401680.1	40	0.00	0	G	NM_178499		119772957	119772957	+1	no_errors	ENST00000546345	ensembl	human	known	69_37n	rna	27	18.18	6	SNP	0.000	C
CNTNAP2	26047	genome.wustl.edu	37	7	147914614	147914614	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr7:147914614C>A	ENST00000361727.3	+	19	3761	c.3245C>A	c.(3244-3246)aCt>aAt	p.T1082N	CNTNAP2_ENST00000538075.1_Missense_Mutation_p.T141N	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	1082	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GTCAAACCCACTGGTAAGGAC	0.483										HNSCC(39;0.1)																												dbGAP											0													85.0	74.0	78.0					7																	147914614		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.3245C>A	7.37:g.147914614C>A	ENSP00000354778:p.Thr1082Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EGF-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.T1082N	ENST00000361727.3	37	c.3245	CCDS5889.1	7	.	.	.	.	.	.	.	.	.	.	C	2.108	-0.404488	0.04832	.	.	ENSG00000174469	ENST00000361727;ENST00000538075	T;T	0.77229	-1.08;-1.08	5.25	5.25	0.73442	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.523566	0.20996	N	0.081958	T	0.44871	0.1314	N	0.00462	-1.47	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09164	-1.0687	10	0.02654	T	1	.	17.4392	0.87561	0.0:1.0:0.0:0.0	.	1082	Q9UHC6	CNTP2_HUMAN	N	1082;141	ENSP00000354778:T1082N;ENSP00000440732:T141N	ENSP00000354778:T1082N	T	+	2	0	CNTNAP2	147545547	0.040000	0.19996	0.683000	0.30040	0.904000	0.53231	3.373000	0.52394	2.438000	0.82558	0.561000	0.74099	ACT	CNTNAP2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000174469		0.483	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	19	0.00	0	C			147914614	147914614	+1	no_errors	ENST00000361727	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	0.063	A
CPEB2	132864	genome.wustl.edu	37	4	15009075	15009075	+	Silent	SNP	G	G	A			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr4:15009075G>A	ENST00000507071.1	+	2	585	c.498G>A	c.(496-498)ttG>ttA	p.L166L	CPEB2_ENST00000382395.3_Silent_p.L166L|CPEB2_ENST00000259997.5_Silent_p.L166L|CPEB2_ENST00000442003.2_Silent_p.L603L|CPEB2_ENST00000382401.3_Silent_p.L166L|CPEB2_ENST00000345451.3_Silent_p.L166L|CPEB2_ENST00000541112.1_Silent_p.L603L|RP11-665G4.1_ENST00000513384.1_RNA|CPEB2_ENST00000538197.1_Silent_p.L603L|RP11-665G4.1_ENST00000502344.1_RNA			Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding protein 2	166					cellular response to arsenic-containing substance (GO:0071243)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to oxidative stress (GO:0034599)|negative regulation of cytoplasmic translation (GO:2000766)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of GTPase activity (GO:0034260)	cytoplasm (GO:0005737)|messenger ribonucleoprotein complex (GO:1990124)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|ribosome binding (GO:0043022)|translation repressor activity, nucleic acid binding (GO:0000900)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(3)	14						TATCTCCATTGAAGAAACCGT	0.443																																						dbGAP											0													131.0	121.0	124.0					4																	15009075		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY247744	CCDS56325.1, CCDS56326.1	4p15.33	2013-02-12			ENSG00000137449	ENSG00000137449		"""RNA binding motif (RRM) containing"""	21745	protein-coding gene	gene with protein product		610605				12672660	Standard	NM_182485		Approved		uc003gnk.2	Q7Z5Q1	OTTHUMG00000090669	ENST00000507071.1:c.498G>A	4.37:g.15009075G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EPM3|F5H160|Q3B8N6|Q3MI89|Q3MI90|Q3MI92|Q7Z5Q0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L603	ENST00000507071.1	37	c.1809		4																																																																																			CPEB2	-	NULL	ENSG00000137449		0.443	CPEB2-001	KNOWN	basic|appris_candidate	protein_coding	CPEB2	HGNC	protein_coding	OTTHUMT00000207349.2	35	0.00	0	G	XM_059607		15009075	15009075	+1	no_errors	ENST00000538197	ensembl	human	known	69_37n	silent	20	28.57	8	SNP	1.000	A
CRAT	1384	genome.wustl.edu	37	9	131864751	131864751	+	Silent	SNP	C	C	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr9:131864751C>T	ENST00000318080.2	-	5	852	c.558G>A	c.(556-558)aaG>aaA	p.K186K	CRAT_ENST00000464290.1_5'UTR|RP11-247A12.1_ENST00000434250.1_RNA	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase	186					carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	CTGTGTCCTGCTTGGGGCCCG	0.602																																						dbGAP											0													228.0	211.0	217.0					9																	131864751		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.558G>A	9.37:g.131864751C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T952|Q9BW16	Silent	SNP	pfam_Carn_acyl_trans	p.K186	ENST00000318080.2	37	c.558	CCDS6919.1	9																																																																																			CRAT	-	pfam_Carn_acyl_trans	ENSG00000095321		0.602	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAT	HGNC	protein_coding	OTTHUMT00000253700.1	108	0.00	0	C			131864751	131864751	-1	no_errors	ENST00000318080	ensembl	human	known	69_37n	silent	73	22.34	21	SNP	1.000	T
CSN3	1448	genome.wustl.edu	37	4	71110590	71110590	+	Splice_Site	SNP	G	G	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr4:71110590G>T	ENST00000304954.3	+	2	140	c.54G>T	c.(52-54)ttG>ttT	p.L18F		NM_005212.2	NP_005203.2	Q9UNS2	CSN3_HUMAN	casein kappa	162					cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						TGCCTTTTTTGGTAAGTTAAT	0.274																																						dbGAP											0													78.0	78.0	78.0					4																	71110590		2202	4296	6498	-	-	-	SO:0001630	splice_region_variant	0			U51899	CCDS3538.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000171209	ENSG00000171209			2446	protein-coding gene	gene with protein product		601695	"""casein, kappa"""	CSN10		8863730, 9050925	Standard	NM_005212		Approved		uc003hfe.4	P07498	OTTHUMG00000129399	ENST00000304954.3:c.54+1G>T	4.37:g.71110590G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	pfam_Casein_kappa,pirsf_Casein_kappa	p.L18F	ENST00000304954.3	37	c.54	CCDS3538.1	4	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113888	0.56398	.	.	ENSG00000171209	ENST00000304954	T	0.39787	1.06	4.21	3.37	0.38596	.	0.810721	0.10517	N	0.665385	T	0.58264	0.2110	L	0.61218	1.895	0.34918	D	0.748117	D	0.76494	0.999	D	0.71656	0.974	T	0.64032	-0.6502	10	0.87932	D	0	-14.7526	7.8937	0.29693	0.1107:0.0:0.8893:0.0	.	18	P07498	CASK_HUMAN	F	18	ENSP00000304822:L18F	ENSP00000304822:L18F	L	+	3	2	CSN3	71145179	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	1.599000	0.36751	1.369000	0.46134	0.650000	0.86243	TTG	CSN3	-	pfam_Casein_kappa,pirsf_Casein_kappa	ENSG00000171209		0.274	CSN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSN3	HGNC	protein_coding	OTTHUMT00000251555.1	29	0.00	0	G	NM_005212	Missense_Mutation	71110590	71110590	+1	no_errors	ENST00000304954	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	1.000	T
CXorf23	256643	genome.wustl.edu	37	X	19984272	19984272	+	Silent	SNP	T	T	A			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chrX:19984272T>A	ENST00000379682.4	-	2	570	c.537A>T	c.(535-537)atA>atT	p.I179I	CXorf23_ENST00000379687.3_Silent_p.I179I|CXorf23_ENST00000356980.3_Silent_p.I179I			A2AJT9	CX023_HUMAN	chromosome X open reading frame 23	179						mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(6)|skin(1)|urinary_tract(1)	11						TTTCTTCTTGTATCCTCTGGT	0.423																																						dbGAP											0													163.0	142.0	149.0					X																	19984272		1861	4104	5965	-	-	-	SO:0001819	synonymous_variant	0			AL833278	CCDS14194.2	Xp22.13	2012-11-27			ENSG00000173681	ENSG00000173681			27413	protein-coding gene	gene with protein product						14702039	Standard	NM_198279		Approved		uc004czp.3	A2AJT9	OTTHUMG00000021226	ENST00000379682.4:c.537A>T	X.37:g.19984272T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4E8|Q5VSM7|Q5VSN1|Q6ZS60|Q8N1W7	Silent	SNP	NULL	p.I179	ENST00000379682.4	37	c.537		X																																																																																			CXorf23	-	NULL	ENSG00000173681		0.423	CXorf23-006	NOVEL	basic	protein_coding	CXorf23	HGNC	protein_coding	OTTHUMT00000055991.2	60	0.00	0	T	NM_198279		19984272	19984272	-1	no_errors	ENST00000379687	ensembl	human	known	69_37n	silent	86	14.00	14	SNP	0.854	A
DKC1	1736	genome.wustl.edu	37	X	154005112	154005112	+	Silent	SNP	A	A	G			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chrX:154005112A>G	ENST00000369550.5	+	15	1725	c.1515A>G	c.(1513-1515)aaA>aaG	p.K505K	SNORA56_ENST00000383966.1_RNA	NM_001142463.1|NM_001363.3	NP_001135935.1|NP_001354.1	O60832	DKC1_HUMAN	dyskeratosis congenita 1, dyskerin	505	Nuclear and nucleolar localization.				cell proliferation (GO:0008283)|pseudouridine synthesis (GO:0001522)|RNA processing (GO:0006396)|rRNA processing (GO:0006364)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)|telomerase activity (GO:0003720)			breast(2)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)	15	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					agaagaagaaAGCAAAAGAGG	0.393									Congenital Dyskeratosis																													dbGAP											0													111.0	91.0	98.0					X																	154005112		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	AJ224481	CCDS14761.1, CCDS76062.1	Xq28	2014-09-17			ENSG00000130826	ENSG00000130826			2890	protein-coding gene	gene with protein product		300126		DKC		9590285, 9888995	Standard	NM_001142463		Approved	XAP101, dyskerin, NAP57, NOLA4	uc004fmm.3	O60832	OTTHUMG00000024242	ENST00000369550.5:c.1515A>G	X.37:g.154005112A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	F5BSB3|O43845|Q96G67|Q9Y505	Silent	SNP	pfam_Dyskerin-like,pfam_PsdUridine_synth,pfam_PUA,superfamily_PsdUridine_synth_cat_dom,superfamily_PUA-like_domain,smart_PUA,pfscan_PUA,tigrfam_Pseudouridine_synthase-related,tigrfam_Uncharacterised_CHP00451	p.K505	ENST00000369550.5	37	c.1515	CCDS14761.1	X																																																																																			DKC1	-	NULL	ENSG00000130826		0.393	DKC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKC1	HGNC	protein_coding	OTTHUMT00000061180.5	35	0.00	0	A	NM_001363		154005112	154005112	+1	no_errors	ENST00000369550	ensembl	human	known	69_37n	silent	34	17.07	7	SNP	0.963	G
DNA2	1763	genome.wustl.edu	37	10	70190369	70190369	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr10:70190369T>C	ENST00000358410.3	-	14	2082	c.2032A>G	c.(2032-2034)Aca>Gca	p.T678A	DNA2_ENST00000399180.2_Missense_Mutation_p.T764A|DNA2_ENST00000399179.2_Intron	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	678	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						GCAGAGTGTGTATAGCTGGTC	0.368																																						dbGAP											0													58.0	54.0	55.0					10																	70190369		1822	4081	5903	-	-	-	SO:0001583	missense	0			D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.2032A>G	10.37:g.70190369T>C	ENSP00000351185:p.Thr678Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	pfam_DNA_replication_fac_Dna2	p.T764A	ENST00000358410.3	37	c.2290		10	.	.	.	.	.	.	.	.	.	.	T	24.0	4.480228	0.84747	.	.	ENSG00000138346	ENST00000399180;ENST00000358410	D;D	0.87729	-2.29;-2.29	5.34	5.34	0.76211	.	0.054750	0.64402	D	0.000001	D	0.93638	0.7968	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.94537	0.7741	10	0.87932	D	0	.	13.9417	0.64059	0.0:0.0:0.0:1.0	.	678	P51530	DNA2L_HUMAN	A	764;678	ENSP00000382133:T764A;ENSP00000351185:T678A	ENSP00000351185:T678A	T	-	1	0	DNA2	69860375	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.825000	0.86693	2.023000	0.59567	0.529000	0.55759	ACA	DNA2	-	NULL	ENSG00000138346		0.368	DNA2-001	KNOWN	basic|appris_principal	protein_coding	DNA2	HGNC	protein_coding	OTTHUMT00000048334.2	42	0.00	0	T			70190369	70190369	-1	no_errors	ENST00000399180	ensembl	human	known	69_37n	missense	34	26.09	12	SNP	1.000	C
DNAH14	127602	genome.wustl.edu	37	1	225332281	225332281	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr1:225332281C>A	ENST00000445597.2	+	18	3488	c.3488C>A	c.(3487-3489)gCc>gAc	p.A1163D	DNAH14_ENST00000430092.1_Missense_Mutation_p.A1547D|DNAH14_ENST00000439375.2_Missense_Mutation_p.A1547D			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	1163					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						GGCTGTCCTGCCGGTCCAGCT	0.443																																						dbGAP											0													66.0	67.0	67.0					1																	225332281		692	1591	2283	-	-	-	SO:0001583	missense	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.3488C>A	1.37:g.225332281C>A	ENSP00000409472:p.Ala1163Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Tautomerase,smart_AAA+_ATPase	p.A1547D	ENST00000445597.2	37	c.4640		1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.910776	0.72983	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375;ENST00000328556	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.32	4.4	0.53042	.	.	.	.	.	T	0.55257	0.1909	M	0.66560	2.04	0.80722	D	1	P	0.51351	0.944	P	0.53722	0.733	T	0.60576	-0.7236	9	0.59425	D	0.04	.	15.2535	0.73568	0.0:0.8585:0.1415:0.0	.	1547	Q0VDD8-4	.	D	1163;1547;1547;642	ENSP00000409472:A1163D;ENSP00000414402:A1547D;ENSP00000392061:A1547D;ENSP00000332424:A642D	ENSP00000332424:A642D	A	+	2	0	DNAH14	223398904	0.007000	0.16637	0.038000	0.18304	0.993000	0.82548	0.785000	0.26830	1.349000	0.45751	0.514000	0.50259	GCC	DNAH14	-	smart_AAA+_ATPase	ENSG00000185842		0.443	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	47	0.00	0	C	XM_059166		225332281	225332281	+1	no_errors	ENST00000430092	ensembl	human	known	69_37n	missense	46	14.81	8	SNP	0.969	A
DPF2	5977	genome.wustl.edu	37	11	65107855	65107855	+	Splice_Site	SNP	G	G	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr11:65107855G>T	ENST00000528416.1	+	2	165		c.e2-1		DPF2_ENST00000415073.2_Splice_Site|DPF2_ENST00000532264.1_Intron|DPF2_ENST00000252268.4_Splice_Site	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						CTTCCCTGCAGCCTTGGGGAG	0.557																																						dbGAP											0													178.0	177.0	177.0					11																	65107855		2201	4297	6498	-	-	-	SO:0001630	splice_region_variant	0			U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.33-1G>T	11.37:g.65107855G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7C9|B4DT58	Splice_Site	SNP	-	e2-1	ENST00000528416.1	37	c.33-1	CCDS8100.1	11	.	.	.	.	.	.	.	.	.	.	G	20.4	3.986986	0.74589	.	.	ENSG00000133884	ENST00000528416;ENST00000415073;ENST00000252268	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0187	0.86427	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DPF2	64864431	1.000000	0.71417	0.997000	0.53966	0.755000	0.42902	9.869000	0.99810	2.618000	0.88619	0.655000	0.94253	.	DPF2	-	-	ENSG00000133884		0.557	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPF2	HGNC	protein_coding	OTTHUMT00000387293.3	25	0.00	0	G	NM_006268	Intron	65107855	65107855	+1	no_errors	ENST00000528416	ensembl	human	known	69_37n	splice_site	18	25.00	6	SNP	1.000	T
DUSP4	1846	genome.wustl.edu	37	8	29195879	29195879	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr8:29195879T>A	ENST00000240100.2	-	3	1108	c.719A>T	c.(718-720)tAt>tTt	p.Y240F	DUSP4_ENST00000240101.2_Missense_Mutation_p.Y149F	NM_001394.6	NP_001385.1	Q13115	DUS4_HUMAN	dual specificity phosphatase 4	240	Tyrosine-protein phosphatase.				endoderm formation (GO:0001706)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein dephosphorylation (GO:0006470)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			endometrium(1)|large_intestine(1)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		CTTGTACTGATAGTGTCCTTC	0.557																																						dbGAP											0													189.0	150.0	163.0					8																	29195879		2203	4300	6503	-	-	-	SO:0001583	missense	0			U21108	CCDS6072.1, CCDS6073.1	8p12-p11	2011-06-09			ENSG00000120875	ENSG00000120875		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3070	protein-coding gene	gene with protein product	"""VH1 homologous phosphatase 2"", ""MAP kinase phosphatase 2"""	602747				7535768, 9205128	Standard	NM_001394		Approved	HVH2, MKP-2, TYP	uc003xhm.3	Q13115	OTTHUMG00000133395	ENST00000240100.2:c.719A>T	8.37:g.29195879T>A	ENSP00000240100:p.Tyr240Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBU5|D3DSU4|G5E930|Q13524	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.Y240F	ENST00000240100.2	37	c.719	CCDS6072.1	8	.	.	.	.	.	.	.	.	.	.	T	8.127	0.782154	0.16189	.	.	ENSG00000120875	ENST00000240100;ENST00000240101	T;T	0.58652	0.32;0.32	4.93	3.67	0.42095	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.054308	0.85682	D	0.000000	T	0.32194	0.0821	N	0.03115	-0.41	0.54753	D	0.999989	B;B	0.31485	0.325;0.058	B;B	0.38803	0.282;0.07	T	0.16424	-1.0403	10	0.09590	T	0.72	.	9.0909	0.36610	0.1644:0.0:0.0:0.8356	.	240;149	Q13115;G5E930	DUS4_HUMAN;.	F	240;149	ENSP00000240100:Y240F;ENSP00000240101:Y149F	ENSP00000240100:Y240F	Y	-	2	0	DUSP4	29251798	0.995000	0.38212	1.000000	0.80357	0.991000	0.79684	1.913000	0.39956	2.143000	0.66587	0.460000	0.39030	TAT	DUSP4	-	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pirsf_MKP,pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000120875		0.557	DUSP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP4	HGNC	protein_coding	OTTHUMT00000257249.1	55	0.00	0	T	NM_001394		29195879	29195879	-1	no_errors	ENST00000240100	ensembl	human	known	69_37n	missense	45	13.46	7	SNP	0.999	A
EEA1	8411	genome.wustl.edu	37	12	93245024	93245024	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr12:93245024C>T	ENST00000322349.8	-	9	925	c.661G>A	c.(661-663)Gaa>Aaa	p.E221K		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	221					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						GCAACATCTTCTATACCAGGT	0.333																																						dbGAP											0													87.0	77.0	80.0					12																	93245024		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.661G>A	12.37:g.93245024C>T	ENSP00000317955:p.Glu221Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14221	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Znf_C2H2	p.E221K	ENST00000322349.8	37	c.661	CCDS31874.1	12	.	.	.	.	.	.	.	.	.	.	C	27.5	4.836590	0.91117	.	.	ENSG00000102189	ENST00000322349;ENST00000540777	T	0.69926	-0.44	5.84	5.84	0.93424	.	0.000000	0.56097	D	0.000040	T	0.75243	0.3823	L	0.34521	1.04	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	T	0.72191	-0.4365	10	0.36615	T	0.2	.	20.1535	0.98095	0.0:1.0:0.0:0.0	.	221	Q15075	EEA1_HUMAN	K	221;220	ENSP00000317955:E221K	ENSP00000317955:E221K	E	-	1	0	EEA1	91769155	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.020000	0.76419	2.764000	0.94973	0.650000	0.86243	GAA	EEA1	-	NULL	ENSG00000102189		0.333	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEA1	HGNC	protein_coding	OTTHUMT00000407304.1	55	0.00	0	C	NM_003566		93245024	93245024	-1	no_errors	ENST00000322349	ensembl	human	known	69_37n	missense	43	41.89	31	SNP	1.000	T
GDE1	51573	genome.wustl.edu	37	16	19516399	19516399	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr16:19516399G>C	ENST00000353258.3	-	5	832	c.652C>G	c.(652-654)Cgg>Ggg	p.R218G	CTA-363E6.7_ENST00000569345.1_RNA	NM_016641.3	NP_057725.1	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1	218	GP-PDE.		R -> Q (in dbSNP:rs2072086).		glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol glycerophosphodiesterase activity (GO:0047395)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	13						ATTACATCCCGATCTGTTTGT	0.358																																						dbGAP											0													181.0	176.0	178.0					16																	19516399		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10578.1	16p12-p11.2	2011-01-25			ENSG00000006007	ENSG00000006007	3.1.4.46		29644	protein-coding gene	gene with protein product	"""membrane interacting protein of RGS16"""	605943				12576545, 16472945	Standard	NM_016641		Approved	MIR16	uc002dgh.3	Q9NZC3	OTTHUMG00000131454	ENST00000353258.3:c.652C>G	16.37:g.19516399G>C	ENSP00000261386:p.Arg218Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O43334|Q6PKF7|Q7KYR4	Missense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.R218G	ENST00000353258.3	37	c.652	CCDS10578.1	16	.	.	.	.	.	.	.	.	.	.	G	11.55	1.672369	0.29693	.	.	ENSG00000006007	ENST00000353258	T	0.11169	2.8	5.66	4.68	0.58851	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.504521	0.22467	N	0.059671	T	0.08626	0.0214	L	0.31065	0.9	0.31540	N	0.660006	B	0.32753	0.383	B	0.30716	0.119	T	0.06373	-1.0830	10	0.72032	D	0.01	-0.5592	9.2879	0.37769	0.0:0.1179:0.6016:0.2805	.	218	Q9NZC3	GDE1_HUMAN	G	218	ENSP00000261386:R218G	ENSP00000261386:R218G	R	-	1	2	GDE1	19423900	1.000000	0.71417	0.392000	0.26245	0.555000	0.35460	2.886000	0.48578	1.336000	0.45506	0.655000	0.94253	CGG	GDE1	-	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000006007		0.358	GDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDE1	HGNC	protein_coding	OTTHUMT00000254274.2	42	0.00	0	G	NM_016641		19516399	19516399	-1	no_errors	ENST00000353258	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	0.995	C
GLTSCR1	29998	genome.wustl.edu	37	19	48204725	48204725	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr19:48204725delC	ENST00000396720.3	+	15	3930	c.3736delC	c.(3736-3738)cttfs	p.L1246fs	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1246										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		GCCCACCAAGCTTGTGATCCG	0.721																																						dbGAP											0													6.0	10.0	9.0					19																	48204725		1922	4040	5962	-	-	-	SO:0001589	frameshift_variant	0			AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.3736delC	19.37:g.48204725delC	ENSP00000379946:p.Leu1246fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MW01	Frame_Shift_Del	DEL	NULL	p.V1247fs	ENST00000396720.3	37	c.3736	CCDS46134.1	19																																																																																			GLTSCR1	-	NULL	ENSG00000063169		0.721	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLTSCR1	HGNC	protein_coding	OTTHUMT00000465846.1	8	0.00	0	C	NM_015711		48204725	48204725	+1	no_errors	ENST00000396720	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	1.000	-
GOLGA8DP	100132979	genome.wustl.edu	37	15	22709918	22709918	+	RNA	SNP	C	C	T	rs202074930		TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr15:22709918C>T	ENST00000314246.8	-	0	1062				RN7SL545P_ENST00000495815.2_RNA			Q0D2H9	GOG8D_HUMAN	golgin A8 family, member D, pseudogene							Golgi apparatus (GO:0005794)											TCACCTCCTGCGACATTTTTC	0.502																																						dbGAP											0																																										-	-	-			0					15q11.2	2014-04-10	2011-04-15	2010-02-12	ENSG00000185182	ENSG00000185182			32376	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8D"""	GOLGA8D		12477932	Standard	NR_027407		Approved		uc010axw.2	Q0D2H9	OTTHUMG00000171882		15.37:g.22709918C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000314246.8	37	NULL		15																																																																																			GOLGA8DP	-	-	ENSG00000185182		0.502	GOLGA8DP-002	KNOWN	basic	processed_transcript	GOLGA8DP	HGNC	pseudogene	OTTHUMT00000415613.1	77	0.00	0	C	NR_027407		22709918	22709918	-1	no_errors	ENST00000314246	ensembl	human	known	69_37n	rna	82	22.64	24	SNP	0.015	T
GTF2A1	2957	genome.wustl.edu	37	14	81651922	81651922	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr14:81651922G>C	ENST00000553612.1	-	8	1379	c.976C>G	c.(976-978)Cag>Gag	p.Q326E	GTF2A1_ENST00000434192.2_Missense_Mutation_p.Q287E	NM_001278940.1|NM_015859.3	NP_001265869.1|NP_056943.1	P52655	TF2AA_HUMAN	general transcription factor IIA, 1, 19/37kDa	326					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(234;0.0287)		AAGAGTTCCTGTCCTTCCTCA	0.358																																						dbGAP											0													203.0	177.0	186.0					14																	81651922		2203	4300	6503	-	-	-	SO:0001583	missense	0			X75383	CCDS9873.1, CCDS9874.1	14q31	2010-03-23	2002-08-29					"""General transcription factors"""	4646	protein-coding gene	gene with protein product		600520	"""glucose regulated protein, 58kD pseudogene"""			8224848	Standard	NM_015859		Approved	TFIIA	uc001xvf.2	P52655		ENST00000553612.1:c.976C>G	14.37:g.81651922G>C	ENSP00000452454:p.Gln326Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KNQ9	Missense_Mutation	SNP	pfam_TFIIA_asu/bsu,superfamily_TFIIA_b-brl,superfamily_TFIIA_a-hlx	p.Q326E	ENST00000553612.1	37	c.976	CCDS9873.1	14	.	.	.	.	.	.	.	.	.	.	G	17.26	3.343430	0.61073	.	.	ENSG00000165417	ENST00000553612;ENST00000344860;ENST00000434192	T;T	0.37058	1.22;1.22	5.2	5.2	0.72013	Transcription factor IIA, beta-barrel (2);	0.000000	0.85682	D	0.000000	T	0.34542	0.0901	L	0.37897	1.145	0.53005	D	0.999967	B	0.20671	0.047	B	0.36464	0.225	T	0.10800	-1.0614	10	0.02654	T	1	-5.4996	19.1038	0.93285	0.0:0.0:1.0:0.0	.	326	P52655	TF2AA_HUMAN	E	326;287;287	ENSP00000452454:Q326E;ENSP00000409492:Q287E	ENSP00000298173:Q326E	Q	-	1	0	GTF2A1	80721675	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.717000	0.84732	2.577000	0.86979	0.655000	0.94253	CAG	GTF2A1	-	pfam_TFIIA_asu/bsu,superfamily_TFIIA_b-brl	ENSG00000165417		0.358	GTF2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2A1	HGNC	protein_coding	OTTHUMT00000413309.1	46	0.00	0	G	NM_015859		81651922	81651922	-1	no_errors	ENST00000553612	ensembl	human	known	69_37n	missense	34	27.66	13	SNP	1.000	C
H3F3A	3020	genome.wustl.edu	37	1	226252077	226252077	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr1:226252077C>G	ENST00000366813.1	+	1	400	c.25C>G	c.(25-27)Cgc>Ggc	p.R9G	H3F3A_ENST00000366814.3_Missense_Mutation_p.R9G|H3F3A_ENST00000366816.1_Missense_Mutation_p.R9G|H3F3A_ENST00000366815.3_Missense_Mutation_p.R9G|RP11-396C23.4_ENST00000609423.1_RNA			P84243	H33_HUMAN	H3 histone, family 3A	9				R -> L (in Ref. 7; AAH81561). {ECO:0000305}.	blood coagulation (GO:0007596)|brain development (GO:0007420)|DNA replication-independent nucleosome assembly (GO:0006336)|positive regulation of cell growth (GO:0030307)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nuclear nucleosome (GO:0000788)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			central_nervous_system(116)|endometrium(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	123	Breast(184;0.179)			GBM - Glioblastoma multiforme(131;0.203)		GCAGACTGCCCGCAAATCGAC	0.488			Mis		glioma						OREG0014293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP		Dom	yes		1	1q42.12	3020	"""H3 histone, family 3A"""		O	0													31.0	32.0	32.0					1																	226252077		2202	4297	6499	-	-	-	SO:0001583	missense	0			BC029405	CCDS1550.1	1q42.12	2011-01-27			ENSG00000163041	ENSG00000163041		"""Histones / Replication-independent"""	4764	protein-coding gene	gene with protein product		601128		H3F3		3031613	Standard	NM_002107		Approved	H3.3A	uc001hpw.3	P84243	OTTHUMG00000037507	ENST00000366813.1:c.25C>G	1.37:g.226252077C>G	ENSP00000355778:p.Arg9Gly	Somatic	2311	WXS	Illumina GAIIx	Phase_IV	P06351|P33155|Q5VV55|Q5VV56|Q66I33|Q9V3W4	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.R9G	ENST00000366813.1	37	c.25	CCDS1550.1	1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.004812	0.35320	.	.	ENSG00000163041	ENST00000366816;ENST00000366815;ENST00000366814;ENST00000366813	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	4.32	4.32	0.51571	Histone-fold (2);	0.000000	0.85682	D	0.000000	T	0.65688	0.2715	.	.	.	0.58432	D	0.999999	D;B	0.69078	0.997;0.001	P;B	0.59948	0.866;0.001	T	0.72623	-0.4237	9	0.87932	D	0	.	16.7598	0.85509	0.0:1.0:0.0:0.0	.	9;9	B4DEB1;P84243	.;H33_HUMAN	G	9	ENSP00000355781:R9G;ENSP00000355780:R9G;ENSP00000355779:R9G;ENSP00000355778:R9G	ENSP00000355778:R9G	R	+	1	0	H3F3A	224318700	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.563000	0.82314	2.106000	0.64143	0.655000	0.94253	CGC	H3F3A	-	superfamily_Histone-fold,prints_Histone_H3	ENSG00000163041		0.488	H3F3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	H3F3A	HGNC	protein_coding	OTTHUMT00000091324.1	78	0.00	0	C	NM_002107		226252077	226252077	+1	no_errors	ENST00000366813	ensembl	human	known	69_37n	missense	79	13.19	12	SNP	1.000	G
HEG1	57493	genome.wustl.edu	37	3	124731767	124731767	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr3:124731767G>C	ENST00000311127.4	-	6	2723	c.2656C>G	c.(2656-2658)Cct>Gct	p.P886A	HEG1_ENST00000477536.1_5'Flank	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	886					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						AGTATTTCAGGATGGGTCAGC	0.502																																						dbGAP											0													128.0	130.0	129.0					3																	124731767		2020	4183	6203	-	-	-	SO:0001583	missense	0			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.2656C>G	3.37:g.124731767G>C	ENSP00000311502:p.Pro886Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.P886A	ENST00000311127.4	37	c.2656	CCDS46898.1	3	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292963	0.60086	.	.	ENSG00000173706	ENST00000311127	D	0.89552	-2.53	4.65	4.65	0.58169	.	0.000000	0.38492	U	0.001664	D	0.92818	0.7716	M	0.66939	2.045	0.39228	D	0.963623	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.92291	0.5841	10	0.38643	T	0.18	.	13.199	0.59756	0.0:0.0:1.0:0.0	.	886;886	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	A	886	ENSP00000311502:P886A	ENSP00000311502:P886A	P	-	1	0	HEG1	126214457	0.995000	0.38212	0.976000	0.42696	0.079000	0.17450	2.682000	0.46934	2.573000	0.86826	0.561000	0.74099	CCT	HEG1	-	NULL	ENSG00000173706		0.502	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEG1	HGNC	protein_coding	OTTHUMT00000355732.2	78	0.00	0	G	XM_087386		124731767	124731767	-1	no_errors	ENST00000311127	ensembl	human	known	69_37n	missense	99	18.18	22	SNP	0.860	C
HHLA1	10086	genome.wustl.edu	37	8	133111199	133111199	+	Silent	SNP	T	T	A			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr8:133111199T>A	ENST00000414222.1	-	4	209	c.210A>T	c.(208-210)gcA>gcT	p.A70A	HHLA1_ENST00000434736.2_Silent_p.A106A	NM_001145095.1	NP_001138567.1	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1	70						extracellular region (GO:0005576)				endometrium(6)|kidney(1)|lung(2)|skin(1)|stomach(2)	12						CGATTGACCTTGCGGGCAGCT	0.433																																						dbGAP											0													105.0	102.0	103.0					8																	133111199		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AF110315		8q24	2011-03-01			ENSG00000132297	ENSG00000132297			4904	protein-coding gene	gene with protein product		604109		PLA2L		10329003	Standard	NM_001145095		Approved		uc011liy.1	C9JL84	OTTHUMG00000140390	ENST00000414222.1:c.210A>T	8.37:g.133111199T>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.A70	ENST00000414222.1	37	c.210		8																																																																																			HHLA1	-	NULL	ENSG00000132297		0.433	HHLA1-201	KNOWN	basic|appris_principal	protein_coding	HHLA1	HGNC	protein_coding		34	0.00	0	T	XR_017860		133111199	133111199	-1	no_errors	ENST00000414222	ensembl	human	known	69_37n	silent	32	20.00	8	SNP	0.023	A
IQSEC1	9922	genome.wustl.edu	37	3	12977712	12977712	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr3:12977712C>A	ENST00000273221.4	-	3	1062	c.846G>T	c.(844-846)caG>caT	p.Q282H	IQSEC1_ENST00000473088.1_5'Flank	NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	282					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GCAGGGCTGTCTGGGGTTCGG	0.662																																						dbGAP											0													65.0	67.0	66.0					3																	12977712		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.846G>T	3.37:g.12977712C>A	ENSP00000273221:p.Gln282His	Somatic		WXS	Illumina GAIIx	Phase_IV	O94863|Q96D85	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.Q282H	ENST00000273221.4	37	c.846	CCDS33703.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.556|2.556	-0.302971|-0.302971	0.05495|0.05495	.|.	.|.	ENSG00000144711|ENSG00000144711	ENST00000450726|ENST00000273221;ENST00000435445;ENST00000429247	.|T;T	.|0.43294	.|0.95;0.95	4.75|4.75	0.598|0.598	0.17512|0.17512	.|.	.|2.030570	.|0.01772	.|N	.|0.031238	T|T	0.27933|0.27933	0.0688|0.0688	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|P;P;B	.|0.42337	.|0.571;0.776;0.126	.|B;B;B	.|0.31751	.|0.126;0.135;0.039	T|T	0.28776|0.28776	-1.0033|-1.0033	4|9	.|0.59425	.|D	.|0.04	.|.	4.8654|4.8654	0.13606|0.13606	0.0:0.4651:0.158:0.377|0.0:0.4651:0.158:0.377	.|.	.|268;268;282	.|E9PG60;C9JMG9;Q6DN90	.|.;.;IQEC1_HUMAN	Y|H	283|282;268;268	.|ENSP00000273221:Q282H;ENSP00000402299:Q268H	.|ENSP00000273221:Q282H	D|Q	-|-	1|3	0|2	IQSEC1|IQSEC1	12952712|12952712	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.037000|0.037000	0.13140|0.13140	-0.357000|-0.357000	0.07651|0.07651	0.217000|0.217000	0.20800|0.20800	-0.137000|-0.137000	0.14449|0.14449	GAC|CAG	IQSEC1	-	NULL	ENSG00000144711		0.662	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQSEC1	HGNC	protein_coding	OTTHUMT00000339865.2	84	0.00	0	C	NM_014869		12977712	12977712	-1	no_errors	ENST00000273221	ensembl	human	known	69_37n	missense	59	22.37	17	SNP	0.009	A
KDM8	79831	genome.wustl.edu	37	16	27222495	27222495	+	Intron	SNP	G	G	C			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr16:27222495G>C	ENST00000286096.4	+	2	671				KDM8_ENST00000568965.1_Intron|KDM8_ENST00000380948.2_Intron|CTD-3203P2.1_ENST00000567108.1_RNA|KDM8_ENST00000441782.2_Intron	NM_024773.2	NP_079049.2	Q8N371	KDM8_HUMAN	lysine (K)-specific demethylase 8						G2/M transition of mitotic cell cycle (GO:0000086)|histone H3-K36 demethylation (GO:0070544)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (H3-K36 specific) (GO:0051864)|metal ion binding (GO:0046872)										AGAGGCAGCAGAGAAACTTCG	0.488																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK023860	CCDS10627.1, CCDS45448.1	16p12.1	2012-03-28	2012-03-28	2012-03-28	ENSG00000155666	ENSG00000155666		"""Chromatin-modifying enzymes / K-demethylases"""	25840	protein-coding gene	gene with protein product		611917	"""jumonji domain containing 5"""	JMJD5		20457893	Standard	NM_024773		Approved	FLJ13798	uc010vcn.1	Q8N371	OTTHUMG00000131677	ENST00000286096.4:c.498+553G>C	16.37:g.27222495G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLU9|Q6VAK5|Q9H8B1	RNA	SNP	-	NULL	ENST00000286096.4	37	NULL	CCDS10627.1	16																																																																																			KDM8	-	-	ENSG00000155666		0.488	KDM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM8	HGNC	protein_coding	OTTHUMT00000254580.3	25	0.00	0	G	NM_024773		27222495	27222495	+1	no_errors	ENST00000562269	ensembl	human	known	69_37n	rna	24	17.24	5	SNP	0.000	C
LCT	3938	genome.wustl.edu	37	2	136567102	136567102	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr2:136567102G>T	ENST00000264162.2	-	8	2825	c.2815C>A	c.(2815-2817)Cca>Aca	p.P939T	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	939	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TTGCTCCCTGGTGTGTGGGTA	0.532																																						dbGAP											0													84.0	82.0	83.0					2																	136567102		2203	4300	6503	-	-	-	SO:0001583	missense	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2815C>A	2.37:g.136567102G>T	ENSP00000264162:p.Pro939Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG58	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.P939T	ENST00000264162.2	37	c.2815	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606179	0.66445	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.38077	1.16	5.78	5.78	0.91487	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.194995	0.56097	D	0.000027	T	0.69646	0.3134	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74847	-0.3525	10	0.66056	D	0.02	-13.834	20.0139	0.97470	0.0:0.0:1.0:0.0	.	939	P09848	LPH_HUMAN	T	939;371	ENSP00000264162:P939T	ENSP00000264162:P939T	P	-	1	0	LCT	136283572	1.000000	0.71417	0.982000	0.44146	0.772000	0.43724	6.659000	0.74412	2.724000	0.93272	0.563000	0.77884	CCA	LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000115850		0.532	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	51	0.00	0	G	NM_002299		136567102	136567102	-1	no_errors	ENST00000264162	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	1.000	T
LPAL2	80350	genome.wustl.edu	37	6	160898283	160898283	+	RNA	SNP	G	G	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr6:160898283G>T	ENST00000335388.5	-	0	1382					NR_028092.1		Q16609	LPAL2_HUMAN	lipoprotein, Lp(a)-like 2, pseudogene							extracellular region (GO:0005576)				large_intestine(1)|lung(4)	5		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)		CATTACCATGGTAGCACTGCC	0.458																																						dbGAP											0																																										-	-	-			0			U19517		6q26-q27	2010-10-27	2010-10-27	2004-02-18	ENSG00000213071	ENSG00000213071			21210	pseudogene	pseudogene		611682	"""apolipoprotein A-like"", ""lipoprotein, Lp(a)-like 2"""	APOAL		7749817, 7679504	Standard	NR_028092		Approved	APOARGC	uc011efy.2	Q16609	OTTHUMG00000015952		6.37:g.160898283G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5B4	RNA	SNP	-	NULL	ENST00000335388.5	37	NULL		6																																																																																			LPAL2	-	-	ENSG00000213071		0.458	LPAL2-003	KNOWN	basic	processed_transcript	LPAL2	HGNC	pseudogene	OTTHUMT00000042950.1	149	0.00	0	G	NM_024492		160898283	160898283	-1	no_errors	ENST00000335388	ensembl	human	known	69_37n	rna	169	11.98	23	SNP	0.493	T
MAGEA11	4110	genome.wustl.edu	37	X	148797955	148797955	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chrX:148797955G>A	ENST00000355220.5	+	5	911	c.809G>A	c.(808-810)tGc>tAc	p.C270Y	MAGEA11_ENST00000333104.4_Missense_Mutation_p.C241Y	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	270	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GCCTCTGTATGCATGCAACTG	0.468																																						dbGAP											0													116.0	109.0	112.0					X																	148797955		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.809G>A	X.37:g.148797955G>A	ENSP00000347358:p.Cys270Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5ETU4|Q6ZRZ5	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.C270Y	ENST00000355220.5	37	c.809	CCDS48180.1	X	.	.	.	.	.	.	.	.	.	.	N	0.004	-2.373501	0.00207	.	.	ENSG00000185247	ENST00000412632;ENST00000333104;ENST00000355220	T;T;T	0.04603	3.59;3.59;3.59	0.985	-0.0431	0.13861	.	.	.	.	.	T	0.07279	0.0184	M	0.77103	2.36	0.09310	N	1	B;B	0.31581	0.309;0.329	B;B	0.41135	0.198;0.348	T	0.42932	-0.9422	9	0.02654	T	1	.	3.7653	0.08620	0.0:0.0:0.5728:0.4272	.	241;270	G5E962;P43364	.;MAGAB_HUMAN	Y	241;241;270	ENSP00000391496:C241Y;ENSP00000328177:C241Y;ENSP00000347358:C270Y	ENSP00000328177:C241Y	C	+	2	0	MAGEA11	148576450	0.000000	0.05858	0.003000	0.11579	0.020000	0.10135	-0.282000	0.08445	-0.084000	0.12595	0.436000	0.28706	TGC	MAGEA11	-	pfam_MAGE,pfscan_MAGE	ENSG00000185247		0.468	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEA11	HGNC	protein_coding	OTTHUMT00000058725.4	60	0.00	0	G	NM_005366		148797955	148797955	+1	no_errors	ENST00000355220	ensembl	human	known	69_37n	missense	68	22.73	20	SNP	0.002	A
MEGF8	1954	genome.wustl.edu	37	19	42853696	42853696	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr19:42853696C>T	ENST00000251268.6	+	14	2344	c.2344C>T	c.(2344-2346)Cgg>Tgg	p.R782W	MEGF8_ENST00000334370.4_Missense_Mutation_p.R715W	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	782					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				GGAGACGCGGCGGCTGCAGCG	0.652																																						dbGAP											0													28.0	34.0	32.0					19																	42853696		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.2344C>T	19.37:g.42853696C>T	ENSP00000251268:p.Arg782Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAY0|O75097	Missense_Mutation	SNP	pfam_CUB,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB,superfamily_Plexin-like_fold,smart_CUB,smart_EGF-like,smart_Plexin-like,smart_EGF-like_Ca-bd,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin	p.R782W	ENST00000251268.6	37	c.2344		19	.	.	.	.	.	.	.	.	.	.	C	11.50	1.656206	0.29425	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.22743	1.94;1.99	4.64	0.781	0.18561	.	1.019340	0.07875	N	0.968481	T	0.26304	0.0642	N	0.14661	0.345	0.47994	D	0.999567	P;D	0.76494	0.926;0.999	B;P	0.62089	0.085;0.898	T	0.21999	-1.0229	10	0.62326	D	0.03	.	11.0912	0.48117	0.5242:0.4757:0.0:0.0	.	782;715	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	W	715;782	ENSP00000334219:R715W;ENSP00000251268:R782W	ENSP00000251268:R782W	R	+	1	2	MEGF8	47545536	0.969000	0.33509	0.979000	0.43373	0.305000	0.27757	0.107000	0.15375	0.319000	0.23209	0.491000	0.48974	CGG	MEGF8	-	NULL	ENSG00000105429		0.652	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	74	0.00	0	C	NM_001410		42853696	42853696	+1	no_errors	ENST00000251268	ensembl	human	known	69_37n	missense	49	31.94	23	SNP	0.780	T
TMEM132C	92293	genome.wustl.edu	37	12	128778703	128778703	+	Intron	SNP	G	G	A	rs1683709	byFrequency	TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr12:128778703G>A	ENST00000435159.2	+	1	85				MIR3612_ENST00000579753.1_RNA	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C							integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						TTCACTAGAGGCGTCCTGACA	0.517													G|||	1667	0.332867	0.3011	0.2594	5008	,	,		17392	0.4812		0.174	False		,,,				2504	0.4387					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.85+26671G>A	12.37:g.128778703G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YX8	RNA	SNP	-	NULL	ENST00000435159.2	37	NULL		12																																																																																			MIR3612	-	-	ENSG00000265635		0.517	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	MIR3612	HGNC	protein_coding		14	0.00	0	G	XM_044062		128778703	128778703	+1	no_errors	ENST00000579753	ensembl	human	known	69_37n	rna	8	38.46	5	SNP	0.000	A
MYSM1	114803	genome.wustl.edu	37	1	59127079	59127079	+	Splice_Site	SNP	T	T	C			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr1:59127079T>C	ENST00000472487.1	-	18	2308	c.2269A>G	c.(2269-2271)Agc>Ggc	p.S757G	MYSM1_ENST00000493821.1_5'UTR	NM_001085487.2	NP_001078956.1	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	757					chromatin remodeling (GO:0006338)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(7;9.36e-06)					AGTACATACCTATGGGAGAGC	0.353																																						dbGAP											0													166.0	152.0	157.0					1																	59127079		1836	4080	5916	-	-	-	SO:0001630	splice_region_variant	0			AB067502	CCDS41343.1	1p32.1	2009-02-11	2009-02-11		ENSG00000162601	ENSG00000162601			29401	protein-coding gene	gene with protein product		612176				11572484, 17428495, 17707232	Standard	NM_001085487		Approved	KIAA1915	uc009wab.2	Q5VVJ2	OTTHUMG00000009533	ENST00000472487.1:c.2270+1A>G	1.37:g.59127079T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA54|B3KX65|Q68DD3|Q6AI53|Q7Z3G8|Q96PX3	Missense_Mutation	SNP	pfam_SWIRM,pfam_JAB1_Mov34_MPN_PAD1,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,smart_JAB1_Mov34_MPN_PAD1,pfscan_SWIRM,pfscan_Myb-like_dom	p.S757G	ENST00000472487.1	37	c.2269	CCDS41343.1	1	.	.	.	.	.	.	.	.	.	.	T	10.87	1.473409	0.26423	.	.	ENSG00000162601	ENST00000472487	T	0.25085	1.82	5.13	5.13	0.70059	.	0.088461	0.85682	D	0.000000	T	0.23572	0.0570	L	0.45581	1.43	0.37489	D	0.916303	B	0.22276	0.067	B	0.18871	0.023	T	0.08764	-1.0706	10	0.33940	T	0.23	-9.465	12.8107	0.57637	0.0:0.0:0.0:1.0	.	757	Q5VVJ2	MYSM1_HUMAN	G	757	ENSP00000418734:S757G	ENSP00000418734:S757G	S	-	1	0	MYSM1	58899667	1.000000	0.71417	0.990000	0.47175	0.869000	0.49853	3.224000	0.51238	2.158000	0.67659	0.377000	0.23210	AGC	MYSM1	-	NULL	ENSG00000162601		0.353	MYSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYSM1	HGNC	protein_coding	OTTHUMT00000026343.2	23	0.00	0	T	XM_055481	Missense_Mutation	59127079	59127079	-1	no_errors	ENST00000472487	ensembl	human	known	69_37n	missense	31	22.50	9	SNP	0.988	C
NFE2L3	9603	genome.wustl.edu	37	7	26224313	26224313	+	Missense_Mutation	SNP	C	C	T	rs147199325		TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr7:26224313C>T	ENST00000056233.3	+	4	1254	c.995C>T	c.(994-996)aCa>aTa	p.T332I		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	332					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						AGAGATCCAACAGCAAGGACT	0.408																																						dbGAP											0													108.0	96.0	100.0					7																	26224313		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.995C>T	7.37:g.26224313C>T	ENSP00000056233:p.Thr332Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_Maf,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.T332I	ENST00000056233.3	37	c.995	CCDS5396.1	7	.	.	.	.	.	.	.	.	.	.	c	0.830	-0.745584	0.03065	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.31247	1.5	4.63	-5.14	0.02875	.	1.593220	0.03300	N	0.188821	T	0.13927	0.0337	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20107	-1.0285	10	0.38643	T	0.18	1.2662	4.7543	0.13075	0.1048:0.4831:0.2352:0.177	.	332	Q9Y4A8	NF2L3_HUMAN	I	332;38	ENSP00000056233:T332I	ENSP00000056233:T332I	T	+	2	0	NFE2L3	26190838	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.396000	0.07278	-0.575000	0.05982	-1.912000	0.00520	ACA	NFE2L3	-	NULL	ENSG00000050344		0.408	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	HGNC	protein_coding	OTTHUMT00000214088.1	30	0.00	0	C			26224313	26224313	+1	no_errors	ENST00000056233	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	0.000	T
NFE2L3	9603	genome.wustl.edu	37	7	26224323	26224323	+	Silent	SNP	T	T	C	rs113074870		TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr7:26224323T>C	ENST00000056233.3	+	4	1264	c.1005T>C	c.(1003-1005)acT>acC	p.T335T		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	335					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						CAGCAAGGACTTCACAGTCAC	0.418																																						dbGAP											0													108.0	96.0	100.0					7																	26224323		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1005T>C	7.37:g.26224323T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Silent	SNP	pfam_bZIP_1,pfam_bZIP_Maf,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.T335	ENST00000056233.3	37	c.1005	CCDS5396.1	7																																																																																			NFE2L3	-	NULL	ENSG00000050344		0.418	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	HGNC	protein_coding	OTTHUMT00000214088.1	30	0.00	0	T			26224323	26224323	+1	no_errors	ENST00000056233	ensembl	human	known	69_37n	silent	35	16.67	7	SNP	0.002	C
NUP188	23511	genome.wustl.edu	37	9	131733098	131733098	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr9:131733098C>T	ENST00000372577.2	+	11	995	c.974C>T	c.(973-975)gCc>gTc	p.A325V		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	325					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						GTGCTTTTGGCCTGGGCTCTC	0.493																																						dbGAP											0													185.0	167.0	173.0					9																	131733098		2203	4300	6503	-	-	-	SO:0001583	missense	0			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.974C>T	9.37:g.131733098C>T	ENSP00000361658:p.Ala325Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	pfam_Nucleoporin_Nup188,superfamily_ARM-type_fold	p.A325V	ENST00000372577.2	37	c.974	CCDS35156.1	9	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691583	0.88735	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.38077	1.16	5.92	5.92	0.95590	.	0.048421	0.85682	D	0.000000	T	0.46464	0.1394	L	0.29908	0.895	0.80722	D	1	D	0.56746	0.977	P	0.59703	0.862	T	0.14699	-1.0463	10	0.34782	T	0.22	-12.8426	19.3088	0.94175	0.0:1.0:0.0:0.0	.	325	Q5SRE5	NU188_HUMAN	V	214;325	ENSP00000361658:A325V	ENSP00000349125:A214V	A	+	2	0	NUP188	130772919	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.461000	0.80834	2.813000	0.96785	0.561000	0.74099	GCC	NUP188	-	pfam_Nucleoporin_Nup188	ENSG00000095319		0.493	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	HGNC	protein_coding	OTTHUMT00000054529.2	75	0.00	0	C			131733098	131733098	+1	no_errors	ENST00000372577	ensembl	human	known	69_37n	missense	48	44.83	39	SNP	1.000	T
NUP210L	91181	genome.wustl.edu	37	1	154062034	154062034	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr1:154062034G>C	ENST00000368559.3	-	16	2295	c.2224C>G	c.(2224-2226)Ctg>Gtg	p.L742V	NUP210L_ENST00000271854.3_Missense_Mutation_p.L742V	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	742					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CTAGGGTTCAGGACACCTGGA	0.468																																						dbGAP											0													99.0	99.0	99.0					1																	154062034		1916	4127	6043	-	-	-	SO:0001583	missense	0			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2224C>G	1.37:g.154062034G>C	ENSP00000357547:p.Leu742Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.L742V	ENST00000368559.3	37	c.2224	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.832401	0.50845	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.23754	1.89;1.89	4.57	1.62	0.23740	.	0.000000	0.40728	N	0.001039	T	0.20495	0.0493	L	0.44542	1.39	0.28594	N	0.909519	D;D	0.69078	0.997;0.997	D;D	0.78314	0.991;0.991	T	0.04900	-1.0919	10	0.30078	T	0.28	-11.4927	8.0904	0.30797	0.2629:0.0:0.7371:0.0	.	742;742	E7EP56;Q5VU65	.;P210L_HUMAN	V	742	ENSP00000357547:L742V;ENSP00000271854:L742V	ENSP00000271854:L742V	L	-	1	2	NUP210L	152328658	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.308000	0.43690	0.548000	0.28955	0.467000	0.42956	CTG	NUP210L	-	NULL	ENSG00000143552		0.468	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3	23	0.00	0	G	NM_207308		154062034	154062034	-1	no_errors	ENST00000368559	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	C
NUPL1	9818	genome.wustl.edu	37	13	25875893	25875893	+	5'UTR	SNP	C	C	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr13:25875893C>T	ENST00000381736.3	+	0	232				NUPL1_ENST00000381718.3_5'UTR|NUPL1_ENST00000463407.1_5'UTR|NUPL1_ENST00000466694.1_3'UTR|RP11-271M24.2_ENST00000568856.2_lincRNA	NM_001008564.1|NM_014089.3	NP_001008564.1|NP_054808.1	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	nucleocytoplasmic transporter activity (GO:0005487)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|stomach(1)|urinary_tract(1)	16		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		TTGCTGACGGCGTCGAGCCCT	0.687																																					Pancreas(166;1040 2004 4560 4728 37041)|GBM(109;1045 1520 7614 9308 19618)	dbGAP											0													26.0	25.0	26.0					13																	25875893		2199	4299	6498	-	-	-	SO:0001623	5_prime_UTR_variant	0			AB007870	CCDS9314.1, CCDS31949.1	13q12.12	2011-04-12			ENSG00000139496	ENSG00000139496			20261	protein-coding gene	gene with protein product		607615				9455477	Standard	NM_014089		Approved	KIAA0410	uc001uqi.3	Q9BVL2	OTTHUMG00000016608	ENST00000381736.3:c.-19C>T	13.37:g.25875893C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI12|B4DZJ1|O43160|Q5JRG2|Q5JRG5	RNA	SNP	-	NULL	ENST00000381736.3	37	NULL	CCDS9314.1	13																																																																																			NUPL1	-	-	ENSG00000139496		0.687	NUPL1-001	KNOWN	basic|CCDS	protein_coding	NUPL1	HGNC	protein_coding	OTTHUMT00000044228.2	65	0.00	0	C			25875893	25875893	+1	no_errors	ENST00000495460	ensembl	human	known	69_37n	rna	43	31.75	20	SNP	0.002	T
PGS1	9489	genome.wustl.edu	37	17	76392449	76392449	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr17:76392449C>G	ENST00000262764.6	+	3	420	c.394C>G	c.(394-396)Cct>Gct	p.P132A	PGS1_ENST00000329897.7_Intron	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	132					cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			GGGGACAGGTCCTTTGGAACA	0.493																																					Esophageal Squamous(45;182 1126 10685 43198)	dbGAP											0													82.0	96.0	91.0					17																	76392449		1968	4141	6109	-	-	-	SO:0001583	missense	0				CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.394C>G	17.37:g.76392449C>G	ENSP00000262764:p.Pro132Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	pirsf_PLipase-D_PtdSer-synthase-type,pfscan_PLipase_D/transphosphatidylase	p.P132A	ENST00000262764.6	37	c.394	CCDS42391.1	17	.	.	.	.	.	.	.	.	.	.	C	13.64	2.297121	0.40694	.	.	ENSG00000087157	ENST00000262764	T	0.20463	2.07	5.31	5.31	0.75309	.	0.245141	0.34223	U	0.004141	T	0.20373	0.0490	L	0.32530	0.975	0.80722	D	1	P	0.34837	0.472	B	0.37780	0.258	T	0.03587	-1.1022	10	0.15499	T	0.54	-11.7974	18.9708	0.92713	0.0:1.0:0.0:0.0	.	132	Q32NB8	PGPS1_HUMAN	A	132	ENSP00000262764:P132A	ENSP00000262764:P132A	P	+	1	0	PGS1	73904044	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	4.310000	0.59141	2.469000	0.83416	0.655000	0.94253	CCT	PGS1	-	pirsf_PLipase-D_PtdSer-synthase-type	ENSG00000087157		0.493	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGS1	HGNC	protein_coding	OTTHUMT00000437301.1	16	0.00	0	C	NM_024419		76392449	76392449	+1	no_errors	ENST00000262764	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	1.000	G
POM121L2	94026	genome.wustl.edu	37	6	27277899	27277899	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr6:27277899A>T	ENST00000444565.1	-	1	2050	c.2051T>A	c.(2050-2052)aTt>aAt	p.I684N	POM121L2_ENST00000377451.2_Missense_Mutation_p.I620N	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	684										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						TGGTGGGAAAATGAATCCTGT	0.522																																						dbGAP											0													115.0	107.0	109.0					6																	27277899		692	1591	2283	-	-	-	SO:0001583	missense	0			AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.2051T>A	6.37:g.27277899A>T	ENSP00000392726:p.Ile684Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1I7	Missense_Mutation	SNP	NULL	p.I684N	ENST00000444565.1	37	c.2051	CCDS59497.1	6	.	.	.	.	.	.	.	.	.	.	A	15.45	2.836382	0.50951	.	.	ENSG00000158553	ENST00000377451;ENST00000444565	T;T	0.18338	2.22;2.22	3.85	-0.0865	0.13681	.	0.857997	0.09465	U	0.798411	T	0.08447	0.0210	L	0.58810	1.83	0.09310	N	1	D	0.54047	0.964	P	0.52481	0.7	T	0.16188	-1.0411	10	0.15952	T	0.53	.	3.4531	0.07506	0.5761:0.2018:0.222:0.0	.	684	C9J1I7	.	N	620;684	ENSP00000366671:I620N;ENSP00000392726:I684N	ENSP00000366671:I620N	I	-	2	0	POM121L2	27385878	0.001000	0.12720	0.000000	0.03702	0.224000	0.24922	1.157000	0.31724	-0.002000	0.14469	0.254000	0.18369	ATT	POM121L2	-	NULL	ENSG00000158553		0.522	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	HGNC	protein_coding	OTTHUMT00000040143.2	40	0.00	0	A	NM_033482		27277899	27277899	-1	no_errors	ENST00000444565	ensembl	human	known	69_37n	missense	62	16.22	12	SNP	0.000	T
PPT2	9374	genome.wustl.edu	37	6	32123479	32123479	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr6:32123479C>T	ENST00000324816.6	+	4	920	c.352C>T	c.(352-354)Cgg>Tgg	p.R118W	PPT2_ENST00000361568.2_Missense_Mutation_p.R124W|PPT2-EGFL8_ENST00000453656.2_3'UTR|PRRT1_ENST00000375150.2_5'Flank|PPT2_ENST00000375137.2_Missense_Mutation_p.R118W|PPT2-EGFL8_ENST00000422437.1_Missense_Mutation_p.R118W|PPT2_ENST00000375143.2_Missense_Mutation_p.R118W|PPT2_ENST00000445576.2_Missense_Mutation_p.R118W|PPT2_ENST00000493548.1_Intron|PPT2_ENST00000437001.2_5'UTR|PPT2_ENST00000395523.1_Missense_Mutation_p.R118W			Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2	118					cellular protein modification process (GO:0006464)|macromolecule depalmitoylation (GO:0098734)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	palmitoyl hydrolase activity (GO:0098599)|palmitoyl-(protein) hydrolase activity (GO:0008474)|thiolester hydrolase activity (GO:0016790)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	17						CCTTGTGTGCCGGGCTCTGCT	0.562																																						dbGAP											0													166.0	142.0	150.0					6																	32123479		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF020543	CCDS4740.1, CCDS4742.1	6p21.3	2012-07-02			ENSG00000221988	ENSG00000221988	3.1.2.22		9326	protein-coding gene	gene with protein product		603298				9341199, 10051407	Standard	NM_138717		Approved		uc003nzw.3	Q9UMR5	OTTHUMG00000031257	ENST00000324816.6:c.352C>T	6.37:g.32123479C>T	ENSP00000320528:p.Arg118Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A2ABC9|A2ABD1|A2ARM7|A2BFH7|A2BFH9|A2BFI2|A8K9L4|B0S868|G8JLE1|O14799|Q0P6K0|Q5JP13|Q5JP14|Q5JQF0|Q5SSX4|Q5SSX5|Q5SSX6|Q5STJ4|Q5STJ5|Q5STJ6|Q6FI80|Q99945	Missense_Mutation	SNP	pfam_Palm_thioest,prints_Palm_thioest	p.R124W	ENST00000324816.6	37	c.370	CCDS4742.1	6	.	.	.	.	.	.	.	.	.	.	C	24.1	4.492555	0.84962	.	.	ENSG00000221988	ENST00000414204;ENST00000361568;ENST00000395523;ENST00000445576;ENST00000324816;ENST00000375137;ENST00000375143;ENST00000436118	T;D;D;D;D;D;D	0.97642	-0.19;-4.47;-4.47;-4.47;-4.47;-4.47;-4.47	5.47	5.47	0.80525	.	0.118284	0.64402	D	0.000019	D	0.98770	0.9586	M	0.92784	3.345	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.93;0.958;0.99	D	0.99755	1.1019	10	0.87932	D	0	-4.8685	16.8737	0.86046	0.0:1.0:0.0:0.0	.	118;118;124	Q9UMR5-2;Q9UMR5;B0S872	.;PPT2_HUMAN;.	W	118;124;118;118;118;118;118;118	ENSP00000398847:R118W;ENSP00000354608:R124W;ENSP00000378894:R118W;ENSP00000412381:R118W;ENSP00000320528:R118W;ENSP00000364279:R118W;ENSP00000364285:R118W	ENSP00000320528:R118W	R	+	1	2	PPT2	32231457	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.251000	0.43187	2.579000	0.87056	0.549000	0.68633	CGG	PPT2	-	pfam_Palm_thioest,prints_Palm_thioest	ENSG00000221988		0.562	PPT2-207	KNOWN	basic|appris_principal|CCDS	protein_coding	PPT2	HGNC	protein_coding	OTTHUMT00000076552.4	63	0.00	0	C	NM_138717		32123479	32123479	+1	no_errors	ENST00000361568	ensembl	human	known	69_37n	missense	45	27.42	17	SNP	1.000	T
PSG8	440533	genome.wustl.edu	37	19	43262237	43262237	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr19:43262237delT	ENST00000306511.4	-	3	723	c.626delA	c.(625-627)aagfs	p.K209fs	PSG8_ENST00000404209.4_Frame_Shift_Del_p.K209fs|PSG8_ENST00000600709.1_5'UTR|PSG8_ENST00000406636.3_Frame_Shift_Del_p.K87fs|PSG8_ENST00000401467.2_Intron	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	209	Ig-like C2-type 1.					extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				TGCAGTGTACTTTGTGACACC	0.502																																						dbGAP											0													252.0	262.0	259.0					19																	43262237		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.626delA	19.37:g.43262237delT	ENSP00000305005:p.Lys209fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Frame_Shift_Del	DEL	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.K209fs	ENST00000306511.4	37	c.626	CCDS33037.1	19																																																																																			PSG8	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000124467		0.502	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG8	HGNC	protein_coding	OTTHUMT00000464526.1	173	0.00	0	T			43262237	43262237	-1	no_errors	ENST00000306511	ensembl	human	known	69_37n	frame_shift_del	130	17.72	28	DEL	0.040	-
PSMA5	5686	genome.wustl.edu	37	1	109952635	109952635	+	Splice_Site	SNP	G	G	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr1:109952635G>T	ENST00000271308.4	-	8	583	c.563C>A	c.(562-564)tCt>tAt	p.S188Y	PSMA5_ENST00000490870.1_5'UTR|PSMA5_ENST00000538610.1_Splice_Site_p.S130Y	NM_002790.3	NP_002781.2	P28066	PSA5_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 5	188					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)	5		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.045)|Colorectal(144;0.116)|Epithelial(280;0.187)|all cancers(265;0.196)|LUSC - Lung squamous cell carcinoma(189;0.235)		CAAAGTCATAGACTTGAAACA	0.358																																						dbGAP											0													185.0	184.0	184.0					1																	109952635		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X61970	CCDS799.1, CCDS55619.1	1p13	2008-02-05			ENSG00000143106	ENSG00000143106		"""Proteasome (prosome, macropain) subunits"""	9534	protein-coding gene	gene with protein product		176844				1888762	Standard	NM_002790		Approved	ZETA	uc001dxn.3	P28066	OTTHUMG00000012001	ENST00000271308.4:c.562-1C>A	1.37:g.109952635G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8F6|B4E2V4|Q3T1C1|Q6IBF7	Missense_Mutation	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.S188Y	ENST00000271308.4	37	c.563	CCDS799.1	1	.	.	.	.	.	.	.	.	.	.	g	20.8	4.043325	0.75732	.	.	ENSG00000143106	ENST00000538610;ENST00000271308	T;T	0.22743	1.94;1.94	5.45	5.45	0.79879	.	0.061078	0.64402	D	0.000003	T	0.30262	0.0759	M	0.83852	2.665	0.80722	D	1	B	0.23249	0.082	B	0.38755	0.281	T	0.14420	-1.0473	10	0.87932	D	0	-10.0889	18.4319	0.90628	0.0:0.0:1.0:0.0	.	188	P28066	PSA5_HUMAN	Y	130;188	ENSP00000440618:S130Y;ENSP00000271308:S188Y	ENSP00000271308:S188Y	S	-	2	0	PSMA5	109754158	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.813000	0.99286	2.711000	0.92665	0.558000	0.71614	TCT	PSMA5	-	pfam_Proteasome_sua/b	ENSG00000143106		0.358	PSMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA5	HGNC	protein_coding	OTTHUMT00000033192.2	37	0.00	0	G	NM_002790	Missense_Mutation	109952635	109952635	-1	no_errors	ENST00000271308	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	T
SCN7A	6332	genome.wustl.edu	37	2	167301344	167301344	+	Silent	SNP	G	G	A	rs561659004		TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr2:167301344G>A	ENST00000409855.1	-	12	1680	c.1554C>T	c.(1552-1554)aaC>aaT	p.N518N		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	518					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	GAAAACATACGTTTAAAATTA	0.333													g|||	1	0.000199681	0.0008	0.0	5008	,	,		16972	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													51.0	50.0	50.0					2																	167301344		1822	4082	5904	-	-	-	SO:0001819	synonymous_variant	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1554C>T	2.37:g.167301344G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.N518	ENST00000409855.1	37	c.1554	CCDS46442.1	2																																																																																			SCN7A	-	NULL	ENSG00000136546		0.333	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	21	0.00	0	G			167301344	167301344	-1	no_errors	ENST00000409855	ensembl	human	known	69_37n	silent	21	21.43	6	SNP	0.660	A
SEC14L6	730005	genome.wustl.edu	37	22	30930019	30930019	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr22:30930019G>T	ENST00000402034.2	-	3	137	c.138C>A	c.(136-138)agC>agA	p.S46R		NM_001193336.2	NP_001180265.2	B5MCN3	S14L6_HUMAN	SEC14-like 6 (S. cerevisiae)	46						integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			lung(3)	3						GCAGGTCAAAGCTCCGAGCTG	0.562																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS54518.1	22q12.2	2011-05-06			ENSG00000214491	ENSG00000214491			40047	protein-coding gene	gene with protein product							Standard	NM_001193336		Approved		uc021wnu.1	B5MCN3	OTTHUMG00000151267	ENST00000402034.2:c.138C>A	22.37:g.30930019G>T	ENSP00000385695:p.Ser46Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.S46R	ENST00000402034.2	37	c.138	CCDS54518.1	22	.	.	.	.	.	.	.	.	.	.	g	5.920	0.353879	0.11182	.	.	ENSG00000214491	ENST00000402034	D	0.85484	-1.99	3.95	-1.0	0.10196	.	.	.	.	.	T	0.79782	0.4505	L	0.52759	1.655	0.52501	D	0.999956	.	.	.	.	.	.	T	0.71045	-0.4706	7	0.42905	T	0.14	9.1454	0.5098	0.00593	0.2927:0.1815:0.3407:0.185	.	.	.	.	R	46	ENSP00000385695:S46R	ENSP00000385695:S46R	S	-	3	2	SEC14L6	29260019	0.021000	0.18746	0.028000	0.17463	0.380000	0.30137	0.051000	0.14141	-0.059000	0.13154	0.543000	0.68304	AGC	SEC14L6	-	pfam_CRAL/TRIO_N_dom,superfamily_CRAL/TRIO_N_dom,prints_CRAL-bd_toc_tran	ENSG00000214491		0.562	SEC14L6-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf|CCDS	protein_coding	SEC14L6	HGNC	protein_coding	OTTHUMT00000322022.2	33	0.00	0	G			30930019	30930019	-1	no_errors	ENST00000402034	ensembl	human	novel	69_37n	missense	30	11.76	4	SNP	0.157	T
SERPINI1	5274	genome.wustl.edu	37	3	167525056	167525056	+	Silent	SNP	T	T	C			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr3:167525056T>C	ENST00000295777.5	+	6	1337	c.906T>C	c.(904-906)gaT>gaC	p.D302D	SERPINI1_ENST00000446050.2_Silent_p.D302D|SERPINI1_ENST00000488374.1_3'UTR	NM_005025.4	NP_005016.1	Q99574	NEUS_HUMAN	serpin peptidase inhibitor, clade I (neuroserpin), member 1	302					cell death (GO:0008219)|central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|peripheral nervous system development (GO:0007422)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(7)|skin(2)	20						AGGAAATTGATTTAAAAGATG	0.328																																						dbGAP											0													64.0	71.0	69.0					3																	167525056		2203	4295	6498	-	-	-	SO:0001819	synonymous_variant	0			Z81326	CCDS3203.1	3q26.1	2014-02-18	2005-08-18		ENSG00000163536	ENSG00000163536		"""Serine (or cysteine) peptidase inhibitors"""	8943	protein-coding gene	gene with protein product		602445	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 1"""	PI12		24172014	Standard	NM_005025		Approved	neuroserpin	uc003ffa.4	Q99574	OTTHUMG00000158450	ENST00000295777.5:c.906T>C	3.37:g.167525056T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K217|D3DNP1|Q6AHZ4	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom	p.F11L	ENST00000295777.5	37	c.31	CCDS3203.1	3	.	.	.	.	.	.	.	.	.	.	T	9.394	1.076281	0.20227	.	.	ENSG00000163536	ENST00000466865	.	.	.	5.36	1.69	0.24217	.	.	.	.	.	T	0.55705	0.1937	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47407	-0.9120	4	.	.	.	.	8.0239	0.30425	0.0:0.3163:0.0:0.6837	.	.	.	.	L	11	.	.	F	+	1	0	SERPINI1	169007750	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	0.439000	0.21575	0.357000	0.24183	0.533000	0.62120	TTT	SERPINI1	-	pfam_Sepin_dom,superfamily_Sepin_dom	ENSG00000163536		0.328	SERPINI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINI1	HGNC	protein_coding	OTTHUMT00000351056.1	35	0.00	0	T			167525056	167525056	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000466865	ensembl	human	novel	69_37n	missense	26	21.21	7	SNP	0.999	C
SGCZ	137868	genome.wustl.edu	37	8	13965707	13965707	+	Silent	SNP	C	C	T	rs550319628		TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr8:13965707C>T	ENST00000382080.1	-	6	1300	c.585G>A	c.(583-585)acG>acA	p.T195T	SGCZ_ENST00000421524.2_Silent_p.T148T	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	182					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)		p.T195T(1)		NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		TGATGTGCGGCGTCTCCACAG	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		15352	0.0		0.0	False		,,,				2504	0.001					dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											95.0	85.0	89.0					8																	13965707		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.585G>A	8.37:g.13965707C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6REU0	Silent	SNP	pfam_Sarcoglycan	p.T195	ENST00000382080.1	37	c.585	CCDS5992.2	8																																																																																			SGCZ	-	pfam_Sarcoglycan	ENSG00000185053		0.458	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SGCZ	HGNC	protein_coding	OTTHUMT00000207636.2	90	0.00	0	C	NM_139167		13965707	13965707	-1	no_errors	ENST00000382080	ensembl	human	known	69_37n	silent	87	11.22	11	SNP	0.993	T
SLC25A41	284427	genome.wustl.edu	37	19	6432160	6432160	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr19:6432160T>A	ENST00000321510.6	-	2	331	c.263A>T	c.(262-264)aAc>aTc	p.N88I		NM_173637.3	NP_775908.2			solute carrier family 25, member 41											large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	6						GGCCTCCTTGTTATCCACTTC	0.617																																						dbGAP											0													67.0	77.0	74.0					19																	6432160		2000	4153	6153	-	-	-	SO:0001583	missense	0			AK097761	CCDS45937.1	19p13.3	2013-05-22			ENSG00000181240	ENSG00000181240		"""Solute carriers"""	28533	protein-coding gene	gene with protein product		610822				16949250	Standard	NM_173637		Approved	FLJ40442, MGC34725, APC4	uc010dus.3	Q8N5S1		ENST00000321510.6:c.263A>T	19.37:g.6432160T>A	ENSP00000322649:p.Asn88Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.N88I	ENST00000321510.6	37	c.263	CCDS45937.1	19	.	.	.	.	.	.	.	.	.	.	T	2.190	-0.385514	0.04966	.	.	ENSG00000181240	ENST00000321510;ENST00000458275	T;T	0.80566	-1.39;1.4	4.46	2.3	0.28687	Mitochondrial carrier domain (2);	0.620187	0.15471	N	0.260595	T	0.71459	0.3342	L	0.51422	1.61	0.09310	N	1	B	0.15141	0.012	B	0.22152	0.038	T	0.58493	-0.7627	10	0.35671	T	0.21	-19.8304	4.379	0.11284	0.0:0.1819:0.1711:0.6471	.	88	Q8N5S1	S2541_HUMAN	I	88	ENSP00000322649:N88I;ENSP00000405411:N88I	ENSP00000322649:N88I	N	-	2	0	SLC25A41	6383160	0.122000	0.22280	0.001000	0.08648	0.040000	0.13550	0.508000	0.22692	0.226000	0.20979	0.397000	0.26171	AAC	SLC25A41	-	superfamily_Mt_carrier_dom	ENSG00000181240		0.617	SLC25A41-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A41	HGNC	protein_coding	OTTHUMT00000462222.1	52	0.00	0	T	NM_173637		6432160	6432160	-1	no_errors	ENST00000321510	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.083	A
SP140	11262	genome.wustl.edu	37	2	231102991	231102991	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr2:231102991G>T	ENST00000392045.3	+	3	415	c.301G>T	c.(301-303)Gaa>Taa	p.E101*	SP140_ENST00000343805.6_Nonsense_Mutation_p.E101*|SP140_ENST00000417495.3_Nonsense_Mutation_p.E101*|SP140_ENST00000544128.1_3'UTR|SP140_ENST00000350136.5_Nonsense_Mutation_p.E81*|SP140_ENST00000486687.2_Nonsense_Mutation_p.E101*|SP140_ENST00000373645.3_Nonsense_Mutation_p.E101*|SP140_ENST00000420434.3_Nonsense_Mutation_p.E101*	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	101	HSR. {ECO:0000255|PROSITE- ProRule:PRU00747}.				defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TGTACTCAGTGAACTGGAGAA	0.388																																						dbGAP											0													127.0	117.0	120.0					2																	231102991		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.301G>T	2.37:g.231102991G>T	ENSP00000375899:p.Glu101*	Somatic		WXS	Illumina GAIIx	Phase_IV	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Nonsense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom,pfscan_Bromodomain	p.E101*	ENST00000392045.3	37	c.301	CCDS42831.1	2	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395741	0.62177	.	.	ENSG00000079263	ENST00000537563;ENST00000486687;ENST00000392044;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434;ENST00000373645	.	.	.	3.7	1.8	0.24995	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-10.9363	5.4367	0.16486	0.1146:0.2036:0.6818:0.0	.	.	.	.	X	101;101;101;81;101;101;101;101;101	.	ENSP00000342096:E101X	E	+	1	0	SP140	230811235	0.001000	0.12720	0.019000	0.16419	0.804000	0.45430	0.334000	0.19787	0.482000	0.27582	0.655000	0.94253	GAA	SP140	-	pfam_Sp100	ENSG00000079263		0.388	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SP140	HGNC	protein_coding	OTTHUMT00000332015.1	58	0.00	0	G	NM_007237		231102991	231102991	+1	no_errors	ENST00000392045	ensembl	human	known	69_37n	nonsense	46	17.86	10	SNP	0.025	T
SPTB	6710	genome.wustl.edu	37	14	65249163	65249163	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr14:65249163T>C	ENST00000389721.5	-	19	4143	c.4111A>G	c.(4111-4113)Aag>Gag	p.K1371E	SPTB_ENST00000556626.1_Missense_Mutation_p.K1371E|SPTB_ENST00000389720.3_Missense_Mutation_p.K1371E|SPTB_ENST00000542895.1_Missense_Mutation_p.K1371E|SPTB_ENST00000389722.3_Missense_Mutation_p.K1371E	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1371					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TGCTGGGTCTTCTCCTTTGTG	0.622																																						dbGAP											0													104.0	103.0	103.0					14																	65249163		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.4111A>G	14.37:g.65249163T>C	ENSP00000374371:p.Lys1371Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15510|Q15519	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.K1371E	ENST00000389721.5	37	c.4111	CCDS32100.1	14	.	.	.	.	.	.	.	.	.	.	T	24.5	4.540427	0.85917	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.52295	0.67;1.28;0.67;0.67;0.67;0.67	5.36	4.22	0.49857	.	0.099831	0.64402	D	0.000002	T	0.73931	0.3650	H	0.95645	3.7	0.45995	D	0.998801	D;P;D	0.59767	0.965;0.871;0.986	P;P;D	0.64776	0.843;0.788;0.929	T	0.79412	-0.1814	10	0.87932	D	0	.	10.3073	0.43689	0.0:0.0792:0.0:0.9208	.	155;1371;1375	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	E	1375;1371;155;36;1371;1371;1371;1371	ENSP00000374372:K1371E;ENSP00000451324:K36E;ENSP00000451752:K1371E;ENSP00000374371:K1371E;ENSP00000443882:K1371E;ENSP00000374370:K1371E	ENSP00000334218:K155E	K	-	1	0	SPTB	64318916	1.000000	0.71417	0.788000	0.31933	0.812000	0.45895	6.215000	0.72206	0.996000	0.38943	0.379000	0.24179	AAG	SPTB	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000070182		0.622	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	HGNC	protein_coding	OTTHUMT00000414080.1	29	0.00	0	T			65249163	65249163	-1	no_errors	ENST00000389722	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	C
STARD5	80765	genome.wustl.edu	37	15	81616333	81616333	+	Intron	SNP	C	C	G	rs533190874		TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr15:81616333C>G	ENST00000302824.6	-	1	125				STARD5_ENST00000559913.1_5'UTR|RP11-761I4.3_ENST00000559781.1_RNA|RP11-761I4.3_ENST00000560973.1_RNA	NM_181900.2	NP_871629.1	Q9NSY2	STAR5_HUMAN	StAR-related lipid transfer (START) domain containing 5						C21-steroid hormone biosynthetic process (GO:0006700)|lipid transport (GO:0006869)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)	lipid binding (GO:0008289)			large_intestine(3)|ovary(1)|skin(1)|stomach(1)	6						CGCCCAGCTCCTCACTCACGC	0.672													C|||	1	0.000199681	0.0008	0.0	5008	,	,		12913	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													19.0	15.0	16.0					15																	81616333		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			AF480304	CCDS10318.1	15q26	2011-09-12	2007-08-16		ENSG00000172345	ENSG00000172345		"""StAR-related lipid transfer (START) domain containing"""	18065	protein-coding gene	gene with protein product		607050	"""START domain containing 5"""			12011452	Standard	NM_181900		Approved	MGC10327	uc002bgm.3	Q9NSY2	OTTHUMG00000147342	ENST00000302824.6:c.99+8G>C	15.37:g.81616333C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	P59094	Missense_Mutation	SNP	NULL	p.E36D	ENST00000302824.6	37	c.108	CCDS10318.1	15																																																																																			STARD5	-	NULL	ENSG00000172345		0.672	STARD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD5	HGNC	protein_coding	OTTHUMT00000303950.2	49	0.00	0	C			81616333	81616333	-1	no_errors	ENST00000560156	ensembl	human	known	69_37n	missense	29	25.64	10	SNP	0.002	G
SYNJ1	8867	genome.wustl.edu	37	21	34072327	34072327	+	Silent	SNP	G	G	C	rs192548936		TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr21:34072327G>C	ENST00000322229.7	-	3	299	c.300C>G	c.(298-300)tcC>tcG	p.S100S	SYNJ1_ENST00000357345.3_Silent_p.S100S|SYNJ1_ENST00000433931.2_Silent_p.S139S|SYNJ1_ENST00000382499.2_Silent_p.S139S|SYNJ1_ENST00000382491.3_Silent_p.S100S			O43426	SYNJ1_HUMAN	synaptojanin 1	100					cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						TAAACTCAGTGGAAGTAACTC	0.383													G|||	1	0.000199681	0.0	0.0	5008	,	,		16881	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													66.0	67.0	66.0					21																	34072327		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.300C>G	21.37:g.34072327G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O43425|O94984|Q4KMR1	Silent	SNP	pfam_Syja_N,pfam_Endo/exonuclease/phosphatase,pfam_DUF1866,superfamily_Endo/exonuclease/phosphatase,smart_IPPc,pfscan_RRM_dom,pfscan_Syja_N	p.S139	ENST00000322229.7	37	c.417	CCDS54484.1	21																																																																																			SYNJ1	-	pfam_Syja_N	ENSG00000159082		0.383	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	SYNJ1	HGNC	protein_coding		23	0.00	0	G			34072327	34072327	-1	no_errors	ENST00000433931	ensembl	human	known	69_37n	silent	29	21.62	8	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	C	rs121912666		TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr17:7578190T>C	ENST00000269305.4	-	6	848	c.659A>G	c.(658-660)tAt>tGt	p.Y220C	TP53_ENST00000413465.2_Missense_Mutation_p.Y220C|TP53_ENST00000455263.2_Missense_Mutation_p.Y220C|TP53_ENST00000445888.2_Missense_Mutation_p.Y220C|TP53_ENST00000359597.4_Missense_Mutation_p.Y220C|TP53_ENST00000420246.2_Missense_Mutation_p.Y220C|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	GRCh37	CM015378|CM951227	TP53	M	rs121912666						102.0	94.0	97.0					17																	7578190		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>G	17.37:g.7578190T>C	ENSP00000269305:p.Tyr220Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y220C	ENST00000269305.4	37	c.659	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248510	0.80024	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99840	-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.996;1.0;0.999;0.998;1.0	D	0.96735	0.9542	10	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220C;ENSP00000352610:Y220C;ENSP00000269305:Y220C;ENSP00000398846:Y220C;ENSP00000391127:Y220C;ENSP00000391478:Y220C;ENSP00000425104:Y88C;ENSP00000423862:Y127C	ENSP00000269305:Y220C	Y	-	2	0	TP53	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	41	0.00	0	T	NM_000546		7578190	7578190	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	35	25.53	12	SNP	0.998	C
TRPC6	7225	genome.wustl.edu	37	11	101325833	101325833	+	Splice_Site	SNP	C	C	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr11:101325833C>T	ENST00000344327.3	-	11	2909		c.e11-1		TRPC6_ENST00000360497.4_Splice_Site|TRPC6_ENST00000532133.1_Splice_Site|TRPC6_ENST00000348423.4_Splice_Site	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6						aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TGTGCCCAACCTGTAATTTGA	0.299																																					Colon(166;1315 1927 11094 12848 34731)	dbGAP											0													94.0	95.0	95.0					11																	101325833		2202	4289	6491	-	-	-	SO:0001630	splice_region_variant	0			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.2485-1G>A	11.37:g.101325833C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Splice_Site	SNP	-	e11-1	ENST00000344327.3	37	c.2485-1	CCDS8311.1	11	.	.	.	.	.	.	.	.	.	.	C	9.829	1.187773	0.21954	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1789	0.98193	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRPC6	100831043	1.000000	0.71417	0.444000	0.26895	0.167000	0.22549	3.708000	0.54845	2.776000	0.95493	0.644000	0.83932	.	TRPC6	-	-	ENSG00000137672		0.299	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC6	HGNC	protein_coding	OTTHUMT00000394770.1	38	0.00	0	C	NM_004621	Intron	101325833	101325833	-1	no_errors	ENST00000344327	ensembl	human	known	69_37n	splice_site	27	38.64	17	SNP	1.000	T
UBL4A	8266	genome.wustl.edu	37	X	153713698	153713698	+	3'UTR	SNP	C	C	A			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chrX:153713698C>A	ENST00000369660.4	-	0	739				UBL4A_ENST00000477777.1_5'UTR|UBL4A_ENST00000369653.4_Nonsense_Mutation_p.E172*	NM_014235.3	NP_055050.1	P11441	UBL4A_HUMAN	ubiquitin-like 4A						cellular protein modification process (GO:0006464)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)	small conjugating protein ligase activity (GO:0019787)			endometrium(5)|lung(1)|urinary_tract(1)	7	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGTGCCGGCTCTCCTCTTCTG	0.607																																					Esophageal Squamous(74;88 1215 11149 34177 46777)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			J03589	CCDS14754.1	Xq28	2010-08-05	2005-09-27	2005-09-27	ENSG00000102178	ENSG00000102178			12505	protein-coding gene	gene with protein product		312070	"""ubiquitin-like 4"""	UBL4		2829204, 16872915	Standard	NM_014235		Approved	GDX, DXS254E, GET5, MDY2, TMA24	uc004flo.3	P11441	OTTHUMG00000013370	ENST00000369660.4:c.*180G>T	X.37:g.153713698C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5HY80	Nonsense_Mutation	SNP	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,prints_Ubiquitin_subgr,pfscan_Ubiquitin_supergroup	p.E172*	ENST00000369660.4	37	c.514	CCDS14754.1	X	.	.	.	.	.	.	.	.	.	.	C	9.861	1.196180	0.22037	.	.	ENSG00000102178	ENST00000369653	.	.	.	3.32	-1.91	0.07641	.	.	.	.	.	.	.	.	.	.	.	0.22531	N	0.999013	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.4568	0.9727	0.01419	0.1707:0.2689:0.3316:0.2287	.	.	.	.	X	172	.	ENSP00000358667:E172X	E	-	1	0	UBL4A	153366892	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.215000	0.17562	-0.659000	0.05359	-0.297000	0.09499	GAG	UBL4A	-	NULL	ENSG00000102178		0.607	UBL4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBL4A	HGNC	protein_coding	OTTHUMT00000037238.2	55	0.00	0	C	NM_014235		153713698	153713698	-1	no_errors	ENST00000369653	ensembl	human	putative	69_37n	nonsense	49	10.91	6	SNP	0.000	A
WDFY3	23001	genome.wustl.edu	37	4	85603603	85603603	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr4:85603603C>A	ENST00000295888.4	-	64	10154	c.9747G>T	c.(9745-9747)ttG>ttT	p.L3249F	WDFY3_ENST00000322366.6_Missense_Mutation_p.L3232F	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	3249	Interaction with ATG5.|Interaction with SQSTM1.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CAGGAACTTGCAAAAATTCCA	0.328																																						dbGAP											0													49.0	51.0	50.0					4																	85603603		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.9747G>T	4.37:g.85603603C>A	ENSP00000295888:p.Leu3249Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L3249F	ENST00000295888.4	37	c.9747	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	C	16.41	3.115489	0.56505	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.66460	-0.21;-0.21	5.98	2.6	0.31112	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.63686	0.2532	L	0.29908	0.895	0.58432	D	0.999998	D	0.65815	0.995	P	0.56434	0.798	T	0.57505	-0.7800	10	0.31617	T	0.26	.	10.4804	0.44689	0.0:0.7427:0.0:0.2573	.	3249	Q8IZQ1	WDFY3_HUMAN	F	3232;3249	ENSP00000318466:L3232F;ENSP00000295888:L3249F	ENSP00000295888:L3249F	L	-	3	2	WDFY3	85822627	0.990000	0.36364	0.979000	0.43373	0.990000	0.78478	0.248000	0.18198	0.275000	0.22094	0.591000	0.81541	TTG	WDFY3	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000163625		0.328	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	31	0.00	0	C	NM_014991		85603603	85603603	-1	no_errors	ENST00000295888	ensembl	human	known	69_37n	missense	19	13.64	3	SNP	1.000	A
WFDC2	10406	genome.wustl.edu	37	20	44108623	44108623	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr20:44108623C>G	ENST00000372676.3	+	3	341	c.265C>G	c.(265-267)Cag>Gag	p.Q89E	WFDC2_ENST00000342873.3_Missense_Mutation_p.Q38E|WFDC2_ENST00000339946.3_Missense_Mutation_p.Q41E|WFDC2_ENST00000488143.1_3'UTR|AL031663.1_ENST00000599747.1_5'Flank	NM_006103.3	NP_006094.3	Q14508	WFDC2_HUMAN	WAP four-disulfide core domain 2	89	WAP 2. {ECO:0000255|PROSITE- ProRule:PRU00722}.				negative regulation of endopeptidase activity (GO:0010951)|proteolysis (GO:0006508)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase inhibitor activity (GO:0019828)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			lung(1)	1		Myeloproliferative disorder(115;0.0122)				TAACTTTCCCCAGCTCGGCCT	0.557																																						dbGAP											0													152.0	154.0	153.0					20																	44108623		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63187	CCDS35501.1	20q13.12	2013-01-21			ENSG00000101443	ENSG00000101443		"""WAP four-disulfide core domain containing"""	15939	protein-coding gene	gene with protein product	"""epididymal protein 4"""					1686187, 10570965	Standard	NM_006103		Approved	HE4, WAP5, dJ461P17.6, EDDM4	uc002xoo.3	Q14508	OTTHUMG00000032594	ENST00000372676.3:c.265C>G	20.37:g.44108623C>G	ENSP00000361761:p.Gln89Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2A5|A2A2A6|A6PVD5|Q6IB27|Q8WXV9|Q8WXW0|Q8WXW1|Q8WXW2|Q96KJ1	Missense_Mutation	SNP	pfam_Whey_acidic_protein_4-diS_core,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,prints_4-disulphide_core	p.Q89E	ENST00000372676.3	37	c.265	CCDS35501.1	20	.	.	.	.	.	.	.	.	.	.	C	11.00	1.511655	0.27036	.	.	ENSG00000101443	ENST00000372676;ENST00000339946;ENST00000342873	T;T;T	0.71461	-0.57;-0.57;-0.57	5.26	2.02	0.26589	Whey acidic protein, 4-disulphide core (5);	0.786081	0.11286	N	0.579784	T	0.62221	0.2410	L	0.49350	1.555	0.09310	N	1	B;B;B	0.32160	0.358;0.218;0.166	B;B;B	0.28011	0.085;0.085;0.04	T	0.44467	-0.9326	10	0.32370	T	0.25	-7.5919	11.2098	0.48790	0.5335:0.4665:0.0:0.0	.	38;41;89	Q14508-2;Q14508-3;Q14508	.;.;WFDC2_HUMAN	E	89;41;38	ENSP00000361761:Q89E;ENSP00000340215:Q41E;ENSP00000342890:Q38E	ENSP00000340215:Q41E	Q	+	1	0	WFDC2	43542037	0.161000	0.22892	0.001000	0.08648	0.045000	0.14185	0.492000	0.22435	0.205000	0.20568	0.655000	0.94253	CAG	WFDC2	-	pfam_Whey_acidic_protein_4-diS_core,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core	ENSG00000101443		0.557	WFDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WFDC2	HGNC	protein_coding	OTTHUMT00000079476.3	34	0.00	0	C			44108623	44108623	+1	no_errors	ENST00000372676	ensembl	human	known	69_37n	missense	54	10.00	6	SNP	0.001	G
ZNF358	140467	genome.wustl.edu	37	19	7584511	7584511	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr19:7584511C>T	ENST00000597229.1	+	2	553	c.383C>T	c.(382-384)aCt>aTt	p.T128I	ZNF358_ENST00000394341.2_Missense_Mutation_p.T128I|CTD-2207O23.11_ENST00000602083.1_RNA	NM_018083.4	NP_060553.4	Q9NW07	ZN358_HUMAN	zinc finger protein 358	128					embryonic forelimb morphogenesis (GO:0035115)|neural tube development (GO:0021915)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T128I(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|lung(1)|skin(2)	8						TCTGGCCTCACTGCCACCCCC	0.692																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											50.0	42.0	45.0					19																	7584511		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001252	CCDS32890.2	19p13.2	2013-01-08			ENSG00000198816	ENSG00000198816		"""Zinc fingers, C2H2-type"""	16838	protein-coding gene	gene with protein product							Standard	NM_018083		Approved	FLJ10390, ZFEND	uc002mgn.2	Q9NW07		ENST00000597229.1:c.383C>T	19.37:g.7584511C>T	ENSP00000472305:p.Thr128Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BTM7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T128I	ENST00000597229.1	37	c.383	CCDS32890.2	19	.	.	.	.	.	.	.	.	.	.	C	7.673	0.687296	0.14973	.	.	ENSG00000198816	ENST00000361576;ENST00000394341	T	0.07800	3.16	3.53	2.46	0.29980	.	.	.	.	.	T	0.05960	0.0155	N	0.24115	0.695	0.09310	N	1	B	0.23650	0.089	B	0.23574	0.047	T	0.35051	-0.9804	9	0.44086	T	0.13	-0.0993	6.2759	0.20981	0.214:0.5781:0.2078:0.0	.	128	Q9NW07	ZN358_HUMAN	I	128	ENSP00000377873:T128I	ENSP00000354703:T128I	T	+	2	0	ZNF358	7490511	0.006000	0.16342	0.099000	0.21106	0.470000	0.32858	2.004000	0.40854	1.021000	0.39600	0.462000	0.41574	ACT	ZNF358	-	NULL	ENSG00000198816		0.692	ZNF358-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF358	HGNC	protein_coding	OTTHUMT00000316747.1	15	0.00	0	C			7584511	7584511	+1	no_errors	ENST00000394341	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	0.069	T
ZNF383	163087	genome.wustl.edu	37	19	37734543	37734543	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr19:37734543C>G	ENST00000589413.1	+	8	1988	c.1405C>G	c.(1405-1407)Cag>Gag	p.Q469E	ZNF383_ENST00000352998.3_Missense_Mutation_p.Q469E|ZNF383_ENST00000590503.1_Missense_Mutation_p.Q469E			Q8NA42	ZN383_HUMAN	zinc finger protein 383	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)	15			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CATTCGTCATCAGGGAATTCA	0.373																																						dbGAP											0													54.0	57.0	56.0					19																	37734543		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY438646	CCDS12501.1	19q13.13	2013-01-08				ENSG00000188283		"""Zinc fingers, C2H2-type"", ""-"""	18609	protein-coding gene	gene with protein product							Standard	NM_152604		Approved	FLJ35863	uc002ofu.1	Q8NA42		ENST00000589413.1:c.1405C>G	19.37:g.37734543C>G	ENSP00000464871:p.Gln469Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6X2C7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q469E	ENST00000589413.1	37	c.1405	CCDS12501.1	19	.	.	.	.	.	.	.	.	.	.	C	11.38	1.621668	0.28889	.	.	ENSG00000188283	ENST00000352998	T	0.06371	3.31	4.03	2.95	0.34219	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08223	0.0205	L	0.49640	1.575	0.23221	N	0.998091	B	0.12013	0.005	B	0.13407	0.009	T	0.19289	-1.0310	9	0.49607	T	0.09	.	11.4648	0.50232	0.0:0.8159:0.1841:0.0	.	469	Q8NA42	ZN383_HUMAN	E	469	ENSP00000340132:Q469E	ENSP00000340132:Q469E	Q	+	1	0	ZNF383	42426383	0.001000	0.12720	1.000000	0.80357	0.973000	0.67179	1.037000	0.30241	0.991000	0.38814	0.563000	0.77884	CAG	ZNF383	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000188283		0.373	ZNF383-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF383	HGNC	protein_coding	OTTHUMT00000458141.1	27	0.00	0	C	NM_152604		37734543	37734543	+1	no_errors	ENST00000352998	ensembl	human	known	69_37n	missense	13	43.48	10	SNP	1.000	G
ZNF132	7691	genome.wustl.edu	37	19	58946286	58946286	+	Silent	SNP	G	G	A			TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr19:58946286G>A	ENST00000254166.3	-	3	925	c.525C>T	c.(523-525)gaC>gaT	p.D175D		NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	175					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		GTGCGTCCCTGTCCTTGTACC	0.532																																						dbGAP											0													162.0	128.0	139.0					19																	58946286		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.525C>T	19.37:g.58946286G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MI9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D175	ENST00000254166.3	37	c.525	CCDS12980.1	19																																																																																			ZNF132	-	NULL	ENSG00000131849		0.532	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF132	HGNC	protein_coding	OTTHUMT00000467035.1	85	0.00	0	G	NM_003433		58946286	58946286	-1	no_errors	ENST00000254166	ensembl	human	known	69_37n	silent	49	40.24	33	SNP	0.561	A
ZW10	9183	genome.wustl.edu	37	11	113619011	113619011	+	Missense_Mutation	SNP	T	T	C	rs200582784		TCGA-E2-A573-01A-11D-A29N-09	TCGA-E2-A573-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5cf9c046-c6bb-4872-827b-9d1dfe6d28f9	45873e30-7f35-4727-ba6e-3301004bef48	g.chr11:113619011T>C	ENST00000200135.3	-	8	1201	c.1057A>G	c.(1057-1059)Aca>Gca	p.T353A		NM_004724.3	NP_004715.1	O43264	ZW10_HUMAN	zw10 kinetochore protein	353					ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic metaphase plate congression (GO:0007080)|mitotic sister chromatid segregation (GO:0000070)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|protein transport (GO:0015031)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|nucleus (GO:0005634)|spindle pole (GO:0000922)	centromeric DNA binding (GO:0019237)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	18		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		CTGCTATTTGTTGGAATCGAA	0.398													T|||	1	0.000199681	0.0	0.0	5008	,	,		15630	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													171.0	157.0	162.0					11																	113619011		2201	4296	6497	-	-	-	SO:0001583	missense	0			U54996	CCDS8363.1	11q23	2013-01-17	2012-12-13		ENSG00000086827	ENSG00000086827			13194	protein-coding gene	gene with protein product		603954	"""ZW10 (Drosophila) homolog, centromere/kinetochore protein"", ""ZW10, kinetochore associated, homolog (Drosophila)"""			9298984	Standard	NM_004724		Approved	KNTC1AP	uc001poe.3	O43264	OTTHUMG00000168190	ENST00000200135.3:c.1057A>G	11.37:g.113619011T>C	ENSP00000200135:p.Thr353Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A528	Missense_Mutation	SNP	pfam_RZZ-complex_Zw10	p.T353A	ENST00000200135.3	37	c.1057	CCDS8363.1	11	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	T	12.69	2.012874	0.35511	.	.	ENSG00000086827	ENST00000200135	T	0.41758	0.99	5.93	2.3	0.28687	.	0.230915	0.51477	N	0.000086	T	0.24509	0.0594	L	0.40543	1.245	0.21740	N	0.999561	B	0.02656	0.0	B	0.10450	0.005	T	0.28933	-1.0028	10	0.06625	T	0.88	-6.9721	4.0872	0.09953	0.1179:0.064:0.2461:0.572	.	353	O43264	ZW10_HUMAN	A	353	ENSP00000200135:T353A	ENSP00000200135:T353A	T	-	1	0	ZW10	113124221	1.000000	0.71417	0.165000	0.22776	0.989000	0.77384	1.753000	0.38359	0.140000	0.18849	-0.313000	0.08912	ACA	ZW10	-	pfam_RZZ-complex_Zw10	ENSG00000086827		0.398	ZW10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZW10	HGNC	protein_coding	OTTHUMT00000398700.1	52	0.00	0	T	NM_004724		113619011	113619011	-1	no_errors	ENST00000200135	ensembl	human	known	69_37n	missense	49	31.94	23	SNP	0.374	C
