#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADCY10	55811	genome.wustl.edu	37	1	167793766	167793766	+	Silent	SNP	G	G	T	rs146725782		TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr1:167793766G>T	ENST00000367851.4	-	28	4184	c.4000C>A	c.(4000-4002)Cga>Aga	p.R1334R	ADCY10_ENST00000545172.1_Silent_p.R1181R|ADCY10_ENST00000367848.1_Silent_p.R1242R	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1334					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						TGATAATGTCGGTTGGGATTC	0.478																																						dbGAP											0													157.0	173.0	168.0					1																	167793766		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.4000C>A	1.37:g.167793766G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Silent	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.R1334	ENST00000367851.4	37	c.4000	CCDS1265.1	1																																																																																			ADCY10	-	pirsf_Adenylate_cylcase_typ10	ENSG00000143199		0.478	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	45	0.00	0	G	NM_018417		167793766	167793766	-1	no_errors	ENST00000367851	ensembl	human	known	69_37n	silent	35	41.67	25	SNP	0.002	T
AK9	221264	genome.wustl.edu	37	6	109993173	109993173	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr6:109993173C>A	ENST00000424296.2	-	5	356	c.280G>T	c.(280-282)Gtc>Ttc	p.V94F	AK9_ENST00000368948.2_Missense_Mutation_p.V94F|AK9_ENST00000341338.6_5'UTR|AK9_ENST00000285397.5_Missense_Mutation_p.V94F	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	94	Adenylate kinase 1.				ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										AGCTTTATGACAAGTTCATCT	0.358																																						dbGAP											0													114.0	108.0	110.0					6																	109993173		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.280G>T	6.37:g.109993173C>A	ENSP00000410186:p.Val94Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS,smart_AAA+_ATPase	p.V94F	ENST00000424296.2	37	c.280	CCDS55048.1	6	.	.	.	.	.	.	.	.	.	.	C	15.26	2.779585	0.49891	.	.	ENSG00000155085	ENST00000424296;ENST00000368948;ENST00000285397;ENST00000448084;ENST00000532976	T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.38	5.56	2.83	0.33086	ATPase, AAA+ type, core (1);	0.224065	0.45867	D	0.000322	D	0.82426	0.5034	M	0.80183	2.485	0.80722	D	1	D;D	0.76494	0.995;0.999	D;D	0.73708	0.939;0.981	T	0.80955	-0.1151	9	.	.	.	-5.5208	5.0668	0.14585	0.0:0.5975:0.1518:0.2507	.	94;94	Q5TCS8-2;Q5TCS8	.;AKD1_HUMAN	F	94;94;94;17;94	ENSP00000410186:V94F;ENSP00000357944:V94F;ENSP00000285397:V94F;ENSP00000407510:V17F;ENSP00000436325:V94F	.	V	-	1	0	AKD1	110099866	0.073000	0.21202	0.843000	0.33291	0.549000	0.35272	-0.154000	0.10130	0.306000	0.22856	-0.150000	0.13652	GTC	AKD1	-	pfam_Adenylate_kin,smart_AAA+_ATPase	ENSG00000155085		0.358	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AKD1	HGNC	protein_coding		54	0.00	0	C	NM_001145128		109993173	109993173	-1	no_errors	ENST00000424296	ensembl	human	known	69_37n	missense	58	23.68	18	SNP	0.783	A
APAF1	317	genome.wustl.edu	37	12	99074131	99074131	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr12:99074131C>G	ENST00000551964.1	+	14	2733	c.1997C>G	c.(1996-1998)tCt>tGt	p.S666C	APAF1_ENST00000547045.1_Missense_Mutation_p.S666C|APAF1_ENST00000552268.1_Intron|APAF1_ENST00000359972.2_Missense_Mutation_p.S655C|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000339433.3_Missense_Mutation_p.S666C|APAF1_ENST00000357310.1_Missense_Mutation_p.S666C|APAF1_ENST00000550527.1_Missense_Mutation_p.S655C|APAF1_ENST00000549007.1_Missense_Mutation_p.S666C	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	666					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	TGTGCATTCTCTACAGATGAC	0.353																																						dbGAP											0													89.0	87.0	88.0					12																	99074131		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.1997C>G	12.37:g.99074131C>G	ENSP00000448165:p.Ser666Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_NB-ARC,pfam_CARD,superfamily_WD40_repeat_dom,superfamily_DEATH-like,smart_WD40_repeat,pirsf_Apoptotic_pept-activating_1,pfscan_CARD,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Disease_R,prints_G-protein_beta_WD-40_rep	p.S666C	ENST00000551964.1	37	c.1997	CCDS9069.1	12	.	.	.	.	.	.	.	.	.	.	C	25.3	4.627460	0.87560	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2	5.33	5.33	0.75918	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.84660	0.5521	M	0.92649	3.33	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.995	D	0.88403	0.3016	10	0.87932	D	0	-15.7153	19.0194	0.92906	0.0:1.0:0.0:0.0	.	666;666;655;666;655	C9JLV4;O14727-4;O14727-3;O14727;O14727-2	.;.;.;APAF_HUMAN;.	C	666;655;666;666;655;666;666	ENSP00000448165:S666C;ENSP00000353059:S655C;ENSP00000349862:S666C;ENSP00000341830:S666C;ENSP00000448449:S655C;ENSP00000449791:S666C;ENSP00000448161:S666C	ENSP00000341830:S666C	S	+	2	0	APAF1	97598262	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	7.437000	0.80417	2.496000	0.84212	0.467000	0.42956	TCT	APAF1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Apoptotic_pept-activating_1,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000120868		0.353	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APAF1	HGNC	protein_coding	OTTHUMT00000408006.1	58	0.00	0	C	NM_181861.1		99074131	99074131	+1	no_errors	ENST00000551964	ensembl	human	known	69_37n	missense	49	28.99	20	SNP	1.000	G
CELA2A	63036	genome.wustl.edu	37	1	15788123	15788123	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr1:15788123G>T	ENST00000359621.4	+	3	222	c.197G>T	c.(196-198)aGc>aTc	p.S66I		NM_033440.2	NP_254275.1	P08217	CEL2A_HUMAN	chymotrypsin-like elastase family, member 2A	66	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|keratohyalin granule (GO:0036457)	serine hydrolase activity (GO:0017171)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(2)|prostate(1)	16						ATAGCCAACAGCTGGGTCCTG	0.597																																						dbGAP											0													119.0	103.0	108.0					1																	15788123		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS157.1	1p36.21	2009-07-09			ENSG00000142615	ENSG00000142615	3.4.21.71		24609	protein-coding gene	gene with protein product	"""elastase 2A"""	609443				3646943, 2834346	Standard	NM_033440		Approved	ELA2A	uc001awk.3	P08217	OTTHUMG00000002258	ENST00000359621.4:c.197G>T	1.37:g.15788123G>T	ENSP00000352639:p.Ser66Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5I4|Q14243	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.S66I	ENST00000359621.4	37	c.197	CCDS157.1	1	.	.	.	.	.	.	.	.	.	.	G	6.052	0.377928	0.11466	.	.	ENSG00000142615	ENST00000375924;ENST00000359621	D	0.89343	-2.5	4.26	0.386	0.16254	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.092160	0.44483	U	0.000459	D	0.85199	0.5642	L	0.46819	1.47	0.09310	N	1	P	0.36587	0.559	B	0.43225	0.412	T	0.77405	-0.2600	10	0.72032	D	0.01	.	7.3643	0.26764	0.6988:0.0:0.3012:0.0	.	66	P08217	CEL2A_HUMAN	I	66	ENSP00000352639:S66I	ENSP00000352639:S66I	S	+	2	0	CELA2A	15660710	0.000000	0.05858	0.111000	0.21465	0.083000	0.17756	0.288000	0.18939	-0.196000	0.10366	-0.883000	0.02948	AGC	CELA2A	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000142615		0.597	CELA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA2A	HGNC	protein_coding	OTTHUMT00000006445.1	43	0.00	0	G	NM_033440		15788123	15788123	+1	no_errors	ENST00000359621	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.250	T
COL6A5	256076	genome.wustl.edu	37	3	130116598	130116598	+	Missense_Mutation	SNP	C	C	T	rs557597562		TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr3:130116598C>T	ENST00000432398.2	+	9	4234	c.3740C>T	c.(3739-3741)gCg>gTg	p.A1247V	COL6A5_ENST00000265379.6_Missense_Mutation_p.A1247V	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1247	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						GTGAGCTTGGCGTTTAAGGTG	0.532																																						dbGAP											0													156.0	137.0	143.0					3																	130116598		692	1591	2283	-	-	-	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.3740C>T	3.37:g.130116598C>T	ENSP00000390895:p.Ala1247Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.A1247V	ENST00000432398.2	37	c.3740		3	.	.	.	.	.	.	.	.	.	.	C	13.49	2.252597	0.39797	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.29917	1.55;1.55	5.26	5.26	0.73747	.	.	.	.	.	T	0.52240	0.1722	L	0.53249	1.67	0.31335	N	0.684393	D	0.89917	1.0	D	0.73708	0.981	T	0.55438	-0.8141	9	0.51188	T	0.08	.	17.6409	0.88136	0.0:1.0:0.0:0.0	.	1247	A8TX70-2	.	V	1247	ENSP00000390895:A1247V;ENSP00000265379:A1247V	ENSP00000265379:A1247V	A	+	2	0	COL6A5	131599288	1.000000	0.71417	1.000000	0.80357	0.123000	0.20343	3.552000	0.53705	2.452000	0.82932	0.561000	0.74099	GCG	COL6A5	-	NULL	ENSG00000172752		0.532	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		55	0.00	0	C	NM_153264		130116598	130116598	+1	no_errors	ENST00000265379	ensembl	human	known	69_37n	missense	29	43.14	22	SNP	1.000	T
CUX1	1523	genome.wustl.edu	37	7	101740745	101740745	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr7:101740745G>T	ENST00000292535.7	+	5	408	c.370G>T	c.(370-372)Gaa>Taa	p.E124*	CUX1_ENST00000292538.4_Nonsense_Mutation_p.E135*|CUX1_ENST00000547394.2_Nonsense_Mutation_p.E119*|CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000393824.3_Nonsense_Mutation_p.E98*|CUX1_ENST00000437600.4_Nonsense_Mutation_p.E135*|CUX1_ENST00000360264.3_Nonsense_Mutation_p.E135*|CUX1_ENST00000549414.2_Nonsense_Mutation_p.E124*|CUX1_ENST00000556210.1_Nonsense_Mutation_p.E124*|CUX1_ENST00000550008.2_Nonsense_Mutation_p.E124*|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000546411.2_Nonsense_Mutation_p.E124*	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	124					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						AACTCTGGAAGAATACAACAA	0.393																																						dbGAP											0													88.0	93.0	91.0					7																	101740745		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.370G>T	7.37:g.101740745G>T	ENSP00000292535:p.Glu124*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Nonsense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_LemA-like_dom,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.E135*	ENST00000292535.7	37	c.403	CCDS5721.1	7	.	.	.	.	.	.	.	.	.	.	G	42	9.722613	0.99248	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000360264;ENST00000393824;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	.	.	.	6.06	6.06	0.98353	.	0.179734	0.47455	D	0.000233	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-12.6486	18.8014	0.92018	0.0:0.0:1.0:0.0	.	.	.	.	X	135;119;135;135;135;124;124;124;124;124	.	ENSP00000292535:E124X	E	+	1	0	CUX1	101527465	1.000000	0.71417	0.982000	0.44146	0.987000	0.75469	9.103000	0.94232	2.882000	0.98803	0.655000	0.94253	GAA	CUX1	-	NULL	ENSG00000257923		0.393	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CUX1	HGNC	protein_coding	OTTHUMT00000347535.1	38	0.00	0	G	NM_001913		101740745	101740745	+1	no_errors	ENST00000360264	ensembl	human	known	69_37n	nonsense	57	33.72	29	SNP	1.000	T
DOCK2	1794	genome.wustl.edu	37	5	169445994	169445994	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr5:169445994T>A	ENST00000256935.8	+	33	3343	c.3263T>A	c.(3262-3264)aTg>aAg	p.M1088K	DOCK2_ENST00000520908.1_Missense_Mutation_p.M580K|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.M149K	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1088	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATCCCAGGCATGGTAGGACCT	0.473																																						dbGAP											0													209.0	201.0	204.0					5																	169445994		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3263T>A	5.37:g.169445994T>A	ENSP00000256935:p.Met1088Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c_dom,superfamily_ARM-type_fold,superfamily_Ferritin/RR-like,smart_SH3_domain,pfscan_SH3_domain	p.M1088K	ENST00000256935.8	37	c.3263	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	t	27.5	4.837561	0.91117	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.26810	1.71;1.71;1.71	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.42698	0.1214	M	0.87682	2.9	0.53005	D	0.999963	D;P	0.54601	0.967;0.936	P;B	0.47206	0.541;0.295	T	0.56774	-0.7923	10	0.87932	D	0	.	14.3495	0.66691	0.0:0.0:0.0:1.0	.	580;1088	E7ERW7;Q92608	.;DOCK2_HUMAN	K	1088;580;149	ENSP00000256935:M1088K;ENSP00000429283:M580K;ENSP00000438827:M149K	ENSP00000256935:M1088K	M	+	2	0	DOCK2	169378572	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.936000	0.87665	1.792000	0.52537	0.524000	0.50904	ATG	DOCK2	-	superfamily_ARM-type_fold	ENSG00000134516		0.473	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	33	0.00	0	T	NM_004946		169445994	169445994	+1	no_errors	ENST00000256935	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	1.000	A
EHHADH	1962	genome.wustl.edu	37	3	184911173	184911173	+	Missense_Mutation	SNP	T	T	G	rs141210101		TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr3:184911173T>G	ENST00000231887.3	-	7	1088	c.1013A>C	c.(1012-1014)aAg>aCg	p.K338T	EHHADH-AS1_ENST00000417720.1_RNA|EHHADH_ENST00000456310.1_Missense_Mutation_p.K242T	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	338	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			GGTTATCATCTTGTTTGCAGT	0.478																																						dbGAP											0													131.0	133.0	132.0					3																	184911173		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1013A>C	3.37:g.184911173T>G	ENSP00000231887:p.Lys338Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	pfam_Crotonase_core,pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like	p.K338T	ENST00000231887.3	37	c.1013	CCDS33901.1	3	.	.	.	.	.	.	.	.	.	.	T	8.435	0.849505	0.17034	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	T;T	0.77877	-1.13;-1.13	6.08	-3.81	0.04294	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.696149	0.15383	N	0.265235	T	0.52597	0.1744	N	0.17278	0.47	0.09310	N	1	B	0.27853	0.191	B	0.28709	0.093	T	0.41360	-0.9513	10	0.24483	T	0.36	0.2886	4.0462	0.09774	0.1013:0.3736:0.1047:0.4204	.	338	Q08426	ECHP_HUMAN	T	338;338;242	ENSP00000231887:K338T;ENSP00000387746:K242T	ENSP00000231887:K338T	K	-	2	0	EHHADH	186393867	0.000000	0.05858	0.000000	0.03702	0.979000	0.70002	0.242000	0.18087	-0.640000	0.05495	0.482000	0.46254	AAG	EHHADH	-	pfam_3-OHacyl-CoA_DH_NAD-bd	ENSG00000113790		0.478	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHHADH	HGNC	protein_coding	OTTHUMT00000345326.1	75	0.00	0	T			184911173	184911173	-1	no_errors	ENST00000231887	ensembl	human	known	69_37n	missense	55	25.33	19	SNP	0.000	G
EP300	2033	genome.wustl.edu	37	22	41527610	41527611	+	Frame_Shift_Ins	INS	-	-	G			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr22:41527610_41527611insG	ENST00000263253.7	+	6	2720_2721	c.1501_1502insG	c.(1501-1503)caafs	p.Q501fs		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	501					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						GCAGTCTCCCCAAGGCATGCGG	0.465			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																													dbGAP		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0																																										-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	Exception_encountered	22.37:g.41527610_41527611insG	ENSP00000263253:p.Gln501fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKC2	Frame_Shift_Ins	INS	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.Q501fs	ENST00000263253.7	37	c.1501_1502	CCDS14010.1	22																																																																																			EP300	-	NULL	ENSG00000100393		0.465	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	39	0.00	0	-	NM_001429		41527610	41527611	+1	no_errors	ENST00000263253	ensembl	human	known	69_37n	frame_shift_ins	21	22.22	6	INS	1.000:1.000	G
FREM1	158326	genome.wustl.edu	37	9	14816829	14816829	+	Missense_Mutation	SNP	G	G	T	rs7041710	byFrequency	TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr9:14816829G>T	ENST00000380880.3	-	15	3370	c.2587C>A	c.(2587-2589)Ctc>Atc	p.L863I	FREM1_ENST00000422223.2_Missense_Mutation_p.L863I|FREM1_ENST00000380881.4_Missense_Mutation_p.L864I			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	863			L -> V (in dbSNP:rs7041710). {ECO:0000269|PubMed:15878328}.		cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		acctccaagagtaggtcatcc	0.418																																						dbGAP											0													67.0	70.0	69.0					9																	14816829		1873	4095	5968	-	-	-	SO:0001583	missense	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.2587C>A	9.37:g.14816829G>T	ENSP00000370262:p.Leu863Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.L864I	ENST00000380880.3	37	c.2590	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	G	4.773	0.143648	0.09134	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.26660	1.72;1.72;1.72	5.65	-4.39	0.03611	.	1.807960	0.01944	N	0.042162	T	0.17662	0.0424	L	0.27053	0.805	0.80722	P	0.0	B	0.16166	0.016	B	0.17098	0.017	T	0.20739	-1.0266	9	0.37606	T	0.19	4.8189	7.0784	0.25217	0.3052:0.4779:0.217:0.0	.	863	Q5H8C1	FREM1_HUMAN	I	864;863;863	ENSP00000370263:L864I;ENSP00000412940:L863I;ENSP00000370262:L863I	ENSP00000370257:L866I	L	-	1	0	FREM1	14806829	0.000000	0.05858	0.001000	0.08648	0.370000	0.29829	-0.610000	0.05629	-1.049000	0.03234	-0.175000	0.13238	CTC	FREM1	-	NULL	ENSG00000164946		0.418	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	26	0.00	0	G	NM_144966		14816829	14816829	-1	no_errors	ENST00000380881	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	0.001	T
GATA3	2625	genome.wustl.edu	37	10	8115955	8115956	+	Frame_Shift_Ins	INS	-	-	C			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr10:8115955_8115956insC	ENST00000346208.3	+	6	1756_1757	c.1301_1302insC	c.(1300-1305)caccccfs	p.HP434fs	GATA3_ENST00000379328.3_Frame_Shift_Ins_p.HP435fs|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	434					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						GGACCACACCACCCCTCCAGCA	0.629			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	0																																										-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1305dupC	10.37:g.8115959_8115959dupC	ENSP00000341619:p.His434fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.S437fs	ENST00000346208.3	37	c.1304_1305	CCDS7083.1	10																																																																																			GATA3	-	pirsf_TF_GATA-1/2/3	ENSG00000107485		0.629	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	27	0.00	0	-	NM_001002295		8115955	8115956	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	40	21.57	11	INS	1.000:0.921	C
INTS4L2	644619	genome.wustl.edu	37	7	65157820	65157820	+	RNA	SNP	G	G	C			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr7:65157820G>C	ENST00000430126.2	+	0	1147							Q2T9F4	IN4L2_HUMAN	integrator complex subunit 4-like 2																		TTCCTGCCTTGAGGGTATGTT	0.443																																						dbGAP											0																																										-	-	-			0			BC111554		7q11.21	2013-03-26			ENSG00000232270	ENSG00000273024			22351	other	unknown							Standard	NR_027392		Approved	MGC133166	uc003tue.2	Q2T9F4	OTTHUMG00000156558		7.37:g.65157820G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000430126.2	37	NULL		7																																																																																			INTS4L2	-	-	ENSG00000232270		0.443	INTS4L2-002	KNOWN	basic	processed_transcript	INTS4L2	HGNC	pseudogene	OTTHUMT00000345545.2	33	0.00	0	G	NR_027392		65157820	65157820	+1	no_errors	ENST00000430126	ensembl	human	known	69_37n	rna	49	39.02	32	SNP	0.988	C
LILRB4	11006	genome.wustl.edu	37	19	55176608	55176608	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr19:55176608C>T	ENST00000391736.1	+	8	1049	c.734C>T	c.(733-735)cCt>cTt	p.P245L	LILRB4_ENST00000391733.3_Missense_Mutation_p.P245L|LILRB4_ENST00000430952.2_Missense_Mutation_p.P245L|LILRB4_ENST00000391734.3_Missense_Mutation_p.P245L|LILRB4_ENST00000270452.2_Missense_Mutation_p.P245L	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	245					immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		CCCCTCATGCCTACAGGGTCA	0.642																																						dbGAP											0													45.0	39.0	41.0					19																	55176608		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.734C>T	19.37:g.55176608C>T	ENSP00000375616:p.Pro245Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Missense_Mutation	SNP	pfam_Immunoglobulin,pfscan_Ig-like	p.P245L	ENST00000391736.1	37	c.734	CCDS12902.1	19	.	.	.	.	.	.	.	.	.	.	C	4.783	0.145666	0.09134	.	.	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	T;T;T;T;T;T	0.00493	7.03;7.03;7.04;7.02;7.06;7.0	1.17	-0.0788	0.13713	.	.	.	.	.	T	0.00552	0.0018	M	0.78456	2.415	0.09310	N	1	B;B;B;B;B	0.27882	0.192;0.001;0.001;0.001;0.002	B;B;B;B;B	0.19391	0.025;0.0;0.004;0.006;0.002	T	0.40440	-0.9563	9	0.66056	D	0.02	.	4.1625	0.10291	0.4005:0.5995:0.0:0.0	.	245;244;245;245;245	A8MUE1;C9JST2;Q8NHJ6-3;Q8NHJ6-2;Q8NHJ6	.;.;.;.;LIRB4_HUMAN	L	245;245;245;245;245;244	ENSP00000375616:P245L;ENSP00000270452:P245L;ENSP00000408995:P245L;ENSP00000375614:P245L;ENSP00000375613:P245L;ENSP00000401962:P244L	ENSP00000270452:P245L	P	+	2	0	LILRB4	59868420	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.054000	0.14205	0.008000	0.14787	0.407000	0.27541	CCT	LILRB4	-	NULL	ENSG00000186818		0.642	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB4	HGNC	protein_coding	OTTHUMT00000141127.3	32	0.00	0	C			55176608	55176608	+1	no_errors	ENST00000270452	ensembl	human	known	69_37n	missense	20	52.38	22	SNP	0.000	T
MATN1	4146	genome.wustl.edu	37	1	31191659	31191659	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr1:31191659T>A	ENST00000373765.4	-	3	622	c.587A>T	c.(586-588)cAg>cTg	p.Q196L	MATN1-AS1_ENST00000414532.2_RNA|MATN1-AS1_ENST00000454613.1_RNA|MATN1-AS1_ENST00000414763.1_RNA|MATN1_ENST00000477320.1_5'UTR	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein	196	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		GTGTTCGTCCTGCGGCTCGCT	0.687																																						dbGAP											0													35.0	33.0	34.0					1																	31191659		2203	4300	6503	-	-	-	SO:0001583	missense	0			M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.587A>T	1.37:g.31191659T>A	ENSP00000362870:p.Gln196Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7E3|Q5TBB9	Missense_Mutation	SNP	pfam_VWF_A,pfam_Matrilin_coiled-coil_trimer,pfam_EGF-like_Ca-bd,smart_VWF_A,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_VWF_A	p.Q196L	ENST00000373765.4	37	c.587	CCDS336.1	1	.	.	.	.	.	.	.	.	.	.	T	18.54	3.646409	0.67358	.	.	ENSG00000162510	ENST00000373765	T	0.77358	-1.09	4.68	3.49	0.39957	von Willebrand factor, type A (3);	.	.	.	.	T	0.39009	0.1062	N	0.00227	-1.8	0.32827	D	0.503481	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.48747	-0.9008	9	0.13853	T	0.58	-17.5106	7.4716	0.27353	0.484:0.0:0.0:0.516	.	180;196	A3KMG0;P21941	.;MATN1_HUMAN	L	196	ENSP00000362870:Q196L	ENSP00000362870:Q196L	Q	-	2	0	MATN1	30964246	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.799000	0.55529	1.734000	0.51633	0.402000	0.26972	CAG	MATN1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000162510		0.687	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MATN1	HGNC	protein_coding	OTTHUMT00000010458.1	13	0.00	0	T	NM_002379		31191659	31191659	-1	no_errors	ENST00000373765	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	1.000	A
MCM7	4176	genome.wustl.edu	37	7	99696737	99696737	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr7:99696737C>T	ENST00000303887.5	-	5	1136	c.491G>A	c.(490-492)cGt>cAt	p.R164H	MCM7_ENST00000354230.3_De_novo_Start_OutOfFrame|AP4M1_ENST00000422582.1_5'Flank|AP4M1_ENST00000421755.1_5'Flank|MCM7_ENST00000343023.6_Missense_Mutation_p.R164H|AP4M1_ENST00000359593.4_5'Flank|AP4M1_ENST00000429084.1_5'Flank	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	164					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GACGATTCCACGCACAGTTAC	0.552																																						dbGAP											0													128.0	106.0	114.0					7																	99696737		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.491G>A	7.37:g.99696737C>T	ENSP00000307288:p.Arg164His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_MCM_7,prints_MCM_4	p.R164H	ENST00000303887.5	37	c.491	CCDS5683.1	7	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785547	0.90282	.	.	ENSG00000166508	ENST00000343023;ENST00000303887;ENST00000542483;ENST00000362082;ENST00000425308	T;T;T	0.13538	2.58;2.58;2.58	4.82	4.82	0.62117	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.41073	0.1143	M	0.85299	2.745	0.80722	D	1	D	0.89917	1.0	D	0.69479	0.964	T	0.43798	-0.9369	10	0.72032	D	0.01	0.0317	15.4455	0.75225	0.0:1.0:0.0:0.0	.	164	P33993	MCM7_HUMAN	H	164;164;101;57;57	ENSP00000344006:R164H;ENSP00000307288:R164H;ENSP00000411295:R57H	ENSP00000307288:R164H	R	-	2	0	MCM7	99534673	1.000000	0.71417	0.993000	0.49108	0.682000	0.39822	6.801000	0.75170	2.491000	0.84063	0.462000	0.41574	CGT	MCM7	-	superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,prints_MCM_7	ENSG00000166508		0.552	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM7	HGNC	protein_coding	OTTHUMT00000336534.3	52	0.00	0	C			99696737	99696737	-1	no_errors	ENST00000303887	ensembl	human	known	69_37n	missense	44	46.34	38	SNP	1.000	T
MTTP	4547	genome.wustl.edu	37	4	100510904	100510904	+	Silent	SNP	T	T	C			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr4:100510904T>C	ENST00000265517.5	+	4	701	c.498T>C	c.(496-498)aaT>aaC	p.N166N	MTTP_ENST00000511045.1_Silent_p.N193N|MTTP_ENST00000457717.1_Silent_p.N166N			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	166	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.		N -> S (in dbSNP:rs3792683).		cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	GAACCACCAATGAGGTACTTA	0.353																																						dbGAP											0													75.0	77.0	76.0					4																	100510904		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.498T>C	4.37:g.100510904T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K428|Q08AM4|Q6P5T3	Silent	SNP	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.N166	ENST00000265517.5	37	c.498	CCDS3651.1	4																																																																																			MTTP	-	pfam_Lipid_transpt_N,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	ENSG00000138823		0.353	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	HGNC	protein_coding	OTTHUMT00000253662.3	50	0.00	0	T			100510904	100510904	+1	no_errors	ENST00000265517	ensembl	human	known	69_37n	silent	35	37.50	21	SNP	0.792	C
NAV3	89795	genome.wustl.edu	37	12	78569113	78569113	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr12:78569113C>A	ENST00000397909.2	+	25	5182	c.5009C>A	c.(5008-5010)tCt>tAt	p.S1670Y	NAV3_ENST00000228327.6_Missense_Mutation_p.S1670Y|NAV3_ENST00000536525.2_Missense_Mutation_p.S1670Y|NAV3_ENST00000266692.7_Missense_Mutation_p.S1493Y			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1670						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CAGCATTCCTCTGAAAGTGTT	0.418										HNSCC(70;0.22)																												dbGAP											0													104.0	99.0	101.0					12																	78569113		1886	4110	5996	-	-	-	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.5009C>A	12.37:g.78569113C>A	ENSP00000381007:p.Ser1670Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.S1670Y	ENST00000397909.2	37	c.5009		12	.	.	.	.	.	.	.	.	.	.	C	29.3	4.998050	0.93227	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788	D;D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37;-3.37	5.61	5.61	0.85477	.	0.000000	0.33980	U	0.004368	D	0.96703	0.8924	M	0.74647	2.275	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;1.0	D;D;D;D	0.87578	0.99;0.994;0.998;0.998	D	0.96627	0.9464	10	0.72032	D	0.01	-13.0268	20.0018	0.97417	0.0:1.0:0.0:0.0	.	1670;1493;1670;1670	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.;.;NAV3_HUMAN;.	Y	1670;1670;1670;1493;291;299	ENSP00000446132:S1670Y;ENSP00000381007:S1670Y;ENSP00000228327:S1670Y;ENSP00000266692:S1493Y;ENSP00000448303:S299Y	ENSP00000228327:S1670Y	S	+	2	0	NAV3	77093244	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	7.740000	0.84986	2.793000	0.96121	0.655000	0.94253	TCT	NAV3	-	NULL	ENSG00000067798		0.418	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	59	0.00	0	C	NM_001024383		78569113	78569113	+1	no_errors	ENST00000397909	ensembl	human	known	69_37n	missense	27	43.75	21	SNP	1.000	A
OR5K2	402135	genome.wustl.edu	37	3	98216606	98216606	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr3:98216606T>G	ENST00000427338.1	+	1	159	c.82T>G	c.(82-84)Ttt>Gtt	p.F28V		NM_001004737.1	NP_001004737.1	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K, member 2	28						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GACTCTGCTGTTTGTGGTGTT	0.418																																						dbGAP											0													105.0	105.0	105.0					3																	98216606		2202	4295	6497	-	-	-	SO:0001583	missense	0			AC021660	CCDS33804.1	3q11.2	2013-09-23			ENSG00000231861	ENSG00000231861		"""GPCR / Class A : Olfactory receptors"""	14774	protein-coding gene	gene with protein product							Standard	NM_001004737		Approved		uc011bgx.2	Q8NHB8	OTTHUMG00000160049	ENST00000427338.1:c.82T>G	3.37:g.98216606T>G	ENSP00000393889:p.Phe28Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN70|Q6IF47	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F28V	ENST00000427338.1	37	c.82	CCDS33804.1	3	.	.	.	.	.	.	.	.	.	.	T	9.507	1.104821	0.20632	.	.	ENSG00000231861	ENST00000427338	T	0.04551	3.6	2.91	-1.19	0.09585	.	0.000000	0.42821	D	0.000656	T	0.10637	0.0260	M	0.88640	2.97	0.09310	N	1	P	0.41265	0.744	P	0.47864	0.559	T	0.13255	-1.0516	10	0.87932	D	0	-21.1977	1.3288	0.02130	0.1756:0.1117:0.1809:0.5318	.	28	Q8NHB8	OR5K2_HUMAN	V	28	ENSP00000393889:F28V	ENSP00000393889:F28V	F	+	1	0	OR5K2	99699296	0.077000	0.21312	0.001000	0.08648	0.197000	0.23852	1.337000	0.33862	-0.220000	0.09988	-1.078000	0.02229	TTT	OR5K2	-	prints_7TM_GPCR_Rhodpsn	ENSG00000231861		0.418	OR5K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K2	HGNC	protein_coding	OTTHUMT00000359020.2	94	0.00	0	T			98216606	98216606	+1	no_errors	ENST00000427338	ensembl	human	known	69_37n	missense	77	37.90	47	SNP	0.142	G
OR5T1	390155	genome.wustl.edu	37	11	56043116	56043116	+	Start_Codon_SNP	SNP	T	T	C			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr11:56043116T>C	ENST00000313033.2	+	1	88	c.2T>C	c.(1-3)aTg>aCg	p.M1T		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	1						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					ATAGCTAAAATGTCAGGGTTG	0.303																																						dbGAP											0													139.0	154.0	149.0					11																	56043116		2199	4295	6494	-	-	-	SO:0001582	initiator_codon_variant	0			AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.2T>C	11.37:g.56043116T>C	ENSP00000323612:p.Met1Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNM9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M1T	ENST00000313033.2	37	c.2	CCDS31525.1	11	.	.	.	.	.	.	.	.	.	.	T	6.378	0.437825	0.12104	.	.	ENSG00000181698	ENST00000313033	T	0.00611	6.23	2.97	0.549	0.17213	.	.	.	.	.	T	0.00496	0.0016	.	.	.	0.09310	N	0.999999	B	0.24963	0.115	B	0.28139	0.086	T	0.49725	-0.8909	8	0.87932	D	0	.	0.6698	0.00857	0.2058:0.1223:0.2119:0.4599	.	1	Q8NG75	OR5T1_HUMAN	T	1	ENSP00000323612:M1T	ENSP00000323612:M1T	M	+	2	0	OR5T1	55799692	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-0.012000	0.12699	0.116000	0.18110	0.375000	0.23000	ATG	OR5T1	-	NULL	ENSG00000181698		0.303	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T1	HGNC	protein_coding	OTTHUMT00000391600.1	42	0.00	0	T	NM_001004745	Missense_Mutation	56043116	56043116	+1	no_errors	ENST00000313033	ensembl	human	known	69_37n	missense	24	41.46	17	SNP	0.000	C
PITPNC1	26207	genome.wustl.edu	37	17	65688873	65688873	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr17:65688873G>A	ENST00000581322.1	+	9	868	c.868G>A	c.(868-870)Gtt>Att	p.V290I	PITPNC1_ENST00000299954.9_3'UTR|PITPNC1_ENST00000335257.6_Missense_Mutation_p.V290I|PITPNC1_ENST00000580974.1_3'UTR			Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein, cytoplasmic 1	290					phospholipid transport (GO:0015914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)			breast(1)|kidney(2)|large_intestine(3)|liver(2)|lung(4)|prostate(2)|skin(3)	17	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			ATTTCTGTCCGTTCCCAAAGA	0.557																																						dbGAP											0													94.0	97.0	96.0					17																	65688873		1902	4104	6006	-	-	-	SO:0001583	missense	0			AF171102	CCDS58587.1, CCDS58588.1	17q24.3	2008-02-05							21045	protein-coding gene	gene with protein product		605134				10531358	Standard	NM_012417		Approved	RDGBB1, RDGBB, RDGB-BETA	uc002jgc.4	Q9UKF7		ENST00000581322.1:c.868G>A	17.37:g.65688873G>A	ENSP00000464006:p.Val290Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K473|J3QR20|Q96I07	Missense_Mutation	SNP	pfam_PI_transfer,prints_PI_transfer	p.V290I	ENST00000581322.1	37	c.868	CCDS58588.1	17	.	.	.	.	.	.	.	.	.	.	G	10.92	1.486161	0.26686	.	.	ENSG00000154217	ENST00000335257	T	0.46451	0.87	5.63	3.62	0.41486	.	0.162323	0.53938	N	0.000050	T	0.26048	0.0635	L	0.32530	0.975	0.80722	D	1	B	0.16396	0.017	B	0.08055	0.003	T	0.05484	-1.0882	10	0.08837	T	0.75	-0.6139	8.1901	0.31363	0.1433:0.1312:0.7255:0.0	.	290	Q9UKF7	PITC1_HUMAN	I	290	ENSP00000335618:V290I	ENSP00000335618:V290I	V	+	1	0	PITPNC1	63119335	1.000000	0.71417	0.429000	0.26710	0.747000	0.42532	4.633000	0.61318	0.819000	0.34492	0.655000	0.94253	GTT	PITPNC1	-	NULL	ENSG00000154217		0.557	PITPNC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNC1	HGNC	protein_coding	OTTHUMT00000447194.1	52	0.00	0	G	NM_012417		65688873	65688873	+1	no_errors	ENST00000335257	ensembl	human	known	69_37n	missense	55	16.67	11	SNP	0.983	A
WDR74	54663	genome.wustl.edu	37	11	62609220	62609220	+	5'UTR	SNP	A	A	G	rs559598154		TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr11:62609220A>G	ENST00000525239.1	-	0	61				WDR74_ENST00000311713.7_5'Flank|WDR74_ENST00000529106.1_5'Flank|WDR74_ENST00000525752.1_5'Flank|WDR74_ENST00000540620.1_5'Flank|WDR74_ENST00000278856.4_5'Flank|RNU2-2P_ENST00000410396.1_RNA			Q6RFH5	WDR74_HUMAN	WD repeat domain 74						blastocyst formation (GO:0001825)|RNA metabolic process (GO:0016070)	nucleolus (GO:0005730)|nucleus (GO:0005634)				kidney(2)|large_intestine(1)|liver(1)|lung(3)|ovary(1)	8						aggacgtatcagatattaaac	0.448																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS44630.1	11q12.3	2013-01-09				ENSG00000133316		"""WD repeat domain containing"""	25529	protein-coding gene	gene with protein product							Standard	NM_018093		Approved	FLJ10439	uc001nvm.2	Q6RFH5		ENST00000525239.1:c.-477T>C	11.37:g.62609220A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8G5|Q9BRC9|Q9H6X8|Q9NVY2	RNA	SNP	-	NULL	ENST00000525239.1	37	NULL	CCDS44630.1	11																																																																																			RNU2-2	-	-	ENSG00000222328		0.448	WDR74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNU2-2	HGNC	protein_coding	OTTHUMT00000395678.1	13	0.00	0	A	NM_018093		62609220	62609220	-1	no_errors	ENST00000410396	ensembl	human	known	69_37n	rna	15	28.57	6	SNP	1.000	G
SLC22A10	387775	genome.wustl.edu	37	11	63072159	63072159	+	Splice_Site	SNP	G	G	A			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr11:63072159G>A	ENST00000332793.6	+	9	1398	c.1396G>A	c.(1396-1398)Gca>Aca	p.A466T	SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000544661.1_Splice_Site_p.G264G|SLC22A10_ENST00000526800.1_Intron	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	466						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	TATCTGTAGGGCAAGAGCTTC	0.363																																						dbGAP											0													126.0	116.0	119.0					11																	63072159		1841	4085	5926	-	-	-	SO:0001630	splice_region_variant	0			AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.1395-1G>A	11.37:g.63072159G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68CJ0	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A466T	ENST00000332793.6	37	c.1396	CCDS41661.1	11	.	.	.	.	.	.	.	.	.	.	g	11.76	1.733562	0.30684	.	.	ENSG00000184999	ENST00000332793	T	0.61627	0.09	2.16	1.23	0.21249	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.355574	0.24891	U	0.034780	T	0.60573	0.2279	M	0.64170	1.965	0.09310	N	0.999997	D	0.63046	0.992	D	0.66351	0.943	T	0.55412	-0.8145	10	0.02654	T	1	.	7.1562	0.25639	0.1503:0.0:0.8497:0.0	.	466	Q63ZE4	S22AA_HUMAN	T	466	ENSP00000327569:A466T	ENSP00000327569:A466T	A	+	1	0	SLC22A10	62828735	0.982000	0.34865	0.004000	0.12327	0.008000	0.06430	1.617000	0.36943	0.498000	0.27948	0.574000	0.79327	GCA	SLC22A10	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000184999		0.363	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A10	HGNC	protein_coding	OTTHUMT00000382622.3	60	0.00	0	G	NM_001039752	Missense_Mutation	63072159	63072159	+1	no_errors	ENST00000332793	ensembl	human	known	69_37n	missense	63	13.70	10	SNP	0.024	A
SLC2A4RG	56731	genome.wustl.edu	37	20	62373244	62373244	+	Silent	SNP	G	G	A			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr20:62373244G>A	ENST00000266077.2	+	4	466	c.414G>A	c.(412-414)aaG>aaA	p.K138K	RP4-583P15.10_ENST00000447343.2_RNA|SLC2A4RG_ENST00000493772.1_Intron	NM_020062.3	NP_064446.2	Q9NR83	S2A4R_HUMAN	SLC2A4 regulator	138					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|lung(2)|prostate(2)|skin(1)	7	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					AGCCCTGGAAGGAGGCCCTGG	0.672																																						dbGAP											0													12.0	14.0	13.0					20																	62373244		2183	4289	6472	-	-	-	SO:0001819	synonymous_variant	0			AF249267	CCDS13537.1	20q13.33	2010-03-11			ENSG00000125520	ENSG00000125520			15930	protein-coding gene	gene with protein product	"""GLUT4 enhancer factor"", ""Huntington's disease gene regulatory region-binding protein 1"""	609493				10825161	Standard	NM_020062		Approved	GEF, HDBP1, Si-1-2, Si-1-2-19	uc002ygq.3	Q9NR83	OTTHUMG00000032997	ENST00000266077.2:c.414G>A	20.37:g.62373244G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PHL5|Q6F6I6|Q6F6I7|Q6GTK5|Q8TAH5|Q8WVW7|Q96QD3|Q9BV85	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K138	ENST00000266077.2	37	c.414	CCDS13537.1	20																																																																																			SLC2A4RG	-	NULL	ENSG00000125520		0.672	SLC2A4RG-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A4RG	HGNC	protein_coding	OTTHUMT00000080202.1	10	0.00	0	G	NM_020062		62373244	62373244	+1	no_errors	ENST00000266077	ensembl	human	known	69_37n	silent	5	61.54	8	SNP	0.932	A
SUPT5H	6829	genome.wustl.edu	37	19	39964082	39964082	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr19:39964082C>T	ENST00000599117.1	+	26	2780	c.2413C>T	c.(2413-2415)Cag>Tag	p.Q805*	SUPT5H_ENST00000402194.2_Nonsense_Mutation_p.Q801*|SUPT5H_ENST00000598725.1_Nonsense_Mutation_p.Q805*|SUPT5H_ENST00000359191.6_Nonsense_Mutation_p.Q801*|SUPT5H_ENST00000432763.2_Nonsense_Mutation_p.Q805*			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	805	9 X 7 AA approximate tandem repeats of G- S-[QR]-T-P-X-[YQ], motif CTR1.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CTACGGCTCACAGACGCCCCT	0.647																																						dbGAP											0													89.0	87.0	88.0					19																	39964082		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.2413C>T	19.37:g.39964082C>T	ENSP00000470252:p.Gln805*	Somatic		WXS	Illumina GAIIx	Phase_IV	O43279|Q59G52|Q99639	Nonsense_Mutation	SNP	pfam_TF_Spt5_NGN-domain,pfam_KOW,pfam_Spt5_N,superfamily_Translation_prot_SH3-like,smart_Transcrpt_antiterm_NusG_N,smart_KOW,pirsf_TF_Spt5	p.Q805*	ENST00000599117.1	37	c.2413	CCDS12536.1	19	.	.	.	.	.	.	.	.	.	.	C	41	8.905134	0.98998	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	4.64	4.64	0.57946	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.9302	16.2818	0.82694	0.0:1.0:0.0:0.0	.	.	.	.	X	805;801;783;805	.	.	Q	+	1	0	SUPT5H	44655922	1.000000	0.71417	0.942000	0.38095	0.967000	0.64934	4.575000	0.60908	2.136000	0.66102	0.462000	0.41574	CAG	SUPT5H	-	pirsf_TF_Spt5	ENSG00000196235		0.647	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT5H	HGNC	protein_coding	OTTHUMT00000464918.1	17	0.00	0	C	NM_003169		39964082	39964082	+1	no_errors	ENST00000359191	ensembl	human	known	69_37n	nonsense	10	64.29	18	SNP	0.999	T
TTC29	83894	genome.wustl.edu	37	4	147858746	147858746	+	Splice_Site	SNP	G	G	C	rs144526409		TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr4:147858746G>C	ENST00000325106.4	-	4	402	c.176C>G	c.(175-177)gCt>gGt	p.A59G	RP11-292D4.2_ENST00000515530.1_RNA|TTC29_ENST00000398886.4_Splice_Site_p.A85G|TTC29_ENST00000513335.1_Splice_Site_p.A85G	NM_031956.2	NP_114162.2	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	59										breast(2)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					TTGTACTTACGCAGCAACTTC	0.269																																						dbGAP											0													67.0	59.0	61.0					4																	147858746		1792	4034	5826	-	-	-	SO:0001630	splice_region_variant	0			AF345910	CCDS47141.1, CCDS75200.1	4q31.23	2013-01-11				ENSG00000137473		"""Tetratricopeptide (TTC) repeat domain containing"""	29936	protein-coding gene	gene with protein product						12477932	Standard	NM_031956		Approved	NYD-SP14	uc003ikw.4	Q8NA56		ENST00000325106.4:c.176+1C>G	4.37:g.147858746G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4GU95|Q9BXB6	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.A85G	ENST00000325106.4	37	c.254	CCDS47141.1	4	.	.	.	.	.	.	.	.	.	.	g	10.69	1.420224	0.25552	.	.	ENSG00000137473	ENST00000513335;ENST00000398886;ENST00000325106;ENST00000398883;ENST00000504425;ENST00000515315	T;T;T;T	0.24723	1.84;1.84;1.87;1.86	5.65	1.79	0.24919	.	0.697888	0.14097	N	0.341667	T	0.17577	0.0422	L	0.33485	1.01	0.26390	N	0.97658	B;B;B	0.14805	0.008;0.011;0.008	B;B;B	0.14578	0.007;0.011;0.007	T	0.22208	-1.0223	9	.	.	.	-1.3255	9.3635	0.38210	0.1254:0.3711:0.5036:0.0	.	59;85;59	E7EQ14;G5E9Z5;Q8NA56	.;.;TTC29_HUMAN	G	85;85;59;59;59;85	ENSP00000423505:A85G;ENSP00000381861:A85G;ENSP00000316740:A59G;ENSP00000425778:A59G	.	A	-	2	0	TTC29	148078196	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.754000	0.38369	0.742000	0.32697	-0.121000	0.15023	GCT	TTC29	-	NULL	ENSG00000137473		0.269	TTC29-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC29	HGNC	protein_coding		61	0.00	0	G	NM_031956	Missense_Mutation	147858746	147858746	-1	no_errors	ENST00000398886	ensembl	human	known	69_37n	missense	55	21.43	15	SNP	0.999	C
UMODL1	89766	genome.wustl.edu	37	21	43510515	43510515	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr21:43510515A>T	ENST00000408910.2	+	6	898	c.898A>T	c.(898-900)Acg>Tcg	p.T300S	UMODL1_ENST00000400427.1_Missense_Mutation_p.T228S|UMODL1_ENST00000400424.2_Missense_Mutation_p.T228S|UMODL1_ENST00000408989.2_Missense_Mutation_p.T300S	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	300	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						AGCTCCAGCCACGTCTCCACG	0.552																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	dbGAP											0													93.0	97.0	96.0					21																	43510515		2091	4208	6299	-	-	-	SO:0001583	missense	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.898A>T	21.37:g.43510515A>T	ENSP00000386147:p.Thr300Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_SEA,pfam_EGF-like_Ca-bd,pfam_EMI_domain,pfam_Whey_acidic_protein_4-diS_core,superfamily_Fibronectin_type3,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_EGF-like_Ca-bd,smart_Fibronectin_type3,smart_Zona_pellucida_Endoglin/CD105,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.T300S	ENST00000408910.2	37	c.898	CCDS42936.1	21	.	.	.	.	.	.	.	.	.	.	A	2.738	-0.262914	0.05754	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910;ENST00000380462;ENST00000400417	T;T;T;T	0.70749	-0.51;-0.5;-0.51;-0.5	3.8	0.0206	0.14125	.	8.767160	0.00695	N	0.000742	T	0.40094	0.1103	N	0.02539	-0.55	0.09310	N	1	B;B	0.19073	0.033;0.005	B;B	0.19946	0.027;0.007	T	0.45614	-0.9249	10	0.06891	T	0.86	0.2583	2.2387	0.04014	0.249:0.3049:0.0:0.446	.	300;300	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	S	228;228;300;300;146;146	ENSP00000383279:T228S;ENSP00000383276:T228S;ENSP00000386126:T300S;ENSP00000386147:T300S	ENSP00000369829:T146S	T	+	1	0	UMODL1	42383584	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	0.182000	0.16900	0.115000	0.18071	0.260000	0.18958	ACG	UMODL1	-	smart_EGF-like_Ca-bd	ENSG00000177398		0.552	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	32	0.00	0	A			43510515	43510515	+1	no_errors	ENST00000408989	ensembl	human	known	69_37n	missense	57	19.44	14	SNP	0.000	T
ZNF14	7561	genome.wustl.edu	37	19	19823822	19823822	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr19:19823822C>A	ENST00000344099.3	-	4	406	c.268G>T	c.(268-270)Gtt>Ttt	p.V90F		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	90					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				TTGATATTAACATTTGGCATC	0.383																																						dbGAP											0													134.0	124.0	127.0					19																	19823822		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.268G>T	19.37:g.19823822C>A	ENSP00000340514:p.Val90Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGA4|Q9ULZ5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V90F	ENST00000344099.3	37	c.268	CCDS12409.1	19	.	.	.	.	.	.	.	.	.	.	C	3.803	-0.041359	0.07452	.	.	ENSG00000105708	ENST00000344099	T	0.14893	2.47	1.4	0.156	0.14910	.	.	.	.	.	T	0.05593	0.0147	N	0.02539	-0.55	0.09310	N	1	B	0.33919	0.432	B	0.29440	0.102	T	0.31752	-0.9932	9	0.48119	T	0.1	.	5.395	0.16265	0.0:0.396:0.604:0.0	.	90	P17017	ZNF14_HUMAN	F	90	ENSP00000340514:V90F	ENSP00000340514:V90F	V	-	1	0	ZNF14	19684822	0.036000	0.19791	0.000000	0.03702	0.048000	0.14542	0.112000	0.15479	-0.103000	0.12175	-0.515000	0.04445	GTT	ZNF14	-	NULL	ENSG00000105708		0.383	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF14	HGNC	protein_coding	OTTHUMT00000460775.1	34	0.00	0	C	NM_021030		19823822	19823822	-1	no_errors	ENST00000344099	ensembl	human	known	69_37n	missense	57	10.94	7	SNP	0.001	A
ZNF37BP	100129482	genome.wustl.edu	37	10	43018703	43018703	+	RNA	SNP	C	C	A			TCGA-E9-A1N3-01A-12D-A159-09	TCGA-E9-A1N3-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6c3891a9-baa9-4309-9974-d82fd5f97417	dbbc85cd-811a-4d6a-b515-3ea1f6f01ea5	g.chr10:43018703C>A	ENST00000452075.3	-	0	945					NR_026777.1				zinc finger protein 37B, pseudogene																		ATCCATGGCTCCTTGCCTGTC	0.408																																						dbGAP											0																																										-	-	-			0			AK026980		10q11.21	2012-10-05	2010-08-03	2010-08-03	ENSG00000234420	ENSG00000234420			13103	pseudogene	pseudogene			"""zinc finger protein 37b (KOX 21)"", ""zinc finger protein 37B"", ""zinc finger protein 37B (pseudogene)"""	ZNF37B		2014798, 8464732	Standard	NR_026777		Approved	KOX21, FLJ23327	uc001jab.4		OTTHUMG00000018011		10.37:g.43018703C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000452075.3	37	NULL		10																																																																																			ZNF37BP	-	-	ENSG00000234420		0.408	ZNF37BP-002	KNOWN	basic	processed_transcript	ZNF37BP	HGNC	pseudogene	OTTHUMT00000047675.2	23	0.00	0	C	NR_026777		43018703	43018703	-1	no_errors	ENST00000435805	ensembl	human	known	69_37n	rna	14	41.67	10	SNP	0.400	A
